WO2003050302A2 - Tgnp activity or expression as marker for apoptosis - Google Patents

Tgnp activity or expression as marker for apoptosis Download PDF

Info

Publication number
WO2003050302A2
WO2003050302A2 PCT/GB2002/005670 GB0205670W WO03050302A2 WO 2003050302 A2 WO2003050302 A2 WO 2003050302A2 GB 0205670 W GB0205670 W GB 0205670W WO 03050302 A2 WO03050302 A2 WO 03050302A2
Authority
WO
WIPO (PCT)
Prior art keywords
tgnp
expression
cells
apoptosis
cell
Prior art date
Application number
PCT/GB2002/005670
Other languages
French (fr)
Other versions
WO2003050302A3 (en
Inventor
Ian Hayes
Thomas Cotter
Finbarr Murphy
Liam Seery
Original Assignee
Eirx Therapeutics Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Eirx Therapeutics Ltd filed Critical Eirx Therapeutics Ltd
Priority to AU2002356293A priority Critical patent/AU2002356293A1/en
Publication of WO2003050302A2 publication Critical patent/WO2003050302A2/en
Publication of WO2003050302A3 publication Critical patent/WO2003050302A3/en

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5011—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing antineoplastic activity
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4747—Apoptosis related proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/136—Screening for pharmacological compounds
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Definitions

  • the present invention relates to the use of the gene TGNP in the detection and modulation of apoptosis in cells.
  • it relates to a method for identifying genes associated with TGNP gene expression and thus their association with apoptosis.
  • Programmed cell death or apoptosis is a genetically programmed process by which cells die under both physiological and a variety of pathological conditions (Kerr et al, Br. J. Cancer, 26, 239-257, 1972). It serves as the counter-balancing force to mitosis during adult life and is a major contributor to the sculpting of physiological structures during the many processes of development (Wyllie et al, Int. Rev. Cytol, 68, 251-305, 1980). It is characterised by a number of well-defined biochemical hallmarks.
  • DNA fragmentation caused by the activation of an endogenous endonuclease enzyme (Wyllie, Nature, 284, 555-556,1980; Enari et al., Nature, 391, 43-50, 1998).
  • endogenous endonuclease enzyme Wang, Nature, 284, 555-556,1980; Enari et al., Nature, 391, 43-50, 1998.
  • the result is a DNA ladder pattern that can be readily visualised in agarose cells. Coupled with DNA fragmentation is cell shrinkage (Wesselbory et al., Cell Immunol. 148, 234-41, 1993) where water is actively extruded from the cell.
  • the apoptotic cell then undergoes fragmentation into apoptotic bodies that are engulfed by neighbouring cells or cells of the reticuloendothelial system.
  • a second well-defined characteristic is the exposure of the phospholipid phosphatidylserine to the outside surface of the plasma membrane of the cell as it undergoes apoptosis (Fadok et al., J Immunol. 148, 2207-16, 1992). Normally this lipid is located on the inner side of the membrane lipid bilayer. The underlying mechanism responsible for this lipid flipping is poorly understood at present. Its expression serves as a signal for the recognition and phagocytosis of the apoptotic cell (Fadok et al., J Immunol. 148, 2207-16, 1992) Under normal physiological conditions apoptosis is tightly regulated.
  • apoptosis is retarded or inhibited
  • ARDS acute respiratory distress syndrome
  • Inappropriate or excessive apoptosis occurs under conditions of ischaemia (stroke, myocardial infarction, etc) Linnik et al., Blood. 80, 1750-7, 1992, Gorman et al., J Neurol Sci. 139, 45-52, 1996) a series of neurodegenerative conditions, myelosuppression (Mori et al, Blood. 92, 101-7, 1998) following chemotherapy or irradiation (Lotem et al., Blood. 80, 1750-7, 1992) and a significant number of other diseases where cell death is a key feature of the pathology.
  • ROS reactive oxygen species
  • ROS molecules cause oxidative damage not only to cellular structures, but may also act to initiate the expression of apoptosis regulating genes.
  • the physiological role for such ROS molecules is far less well characterised than that of other related molecules such as nitric oxide (NO).
  • NO nitric oxide
  • the published literature is unclear, with examples of NO both driving and inhibiting apoptosis (Brune et al., Cell Death Differ. 1999 10,969-975, 1999).
  • NO nitric oxide
  • ROS may act as second messengers in signal transduction pathways in the context of cytokine/growth factor stimulation of cells.
  • Other more recent studies have indicated that they may also activate unique pathways.
  • the specific targets of ROS generated intracellularly are largely unknown at present, but it is known that the addition of hydrogen peroxide or other ROS generators to cells in culture leads to the activation of the transcription factor Nf/kB (Schreck et al., EMBO J 10, 2247-2258, 1991). This in turn controls the expression of a series of genes involved in a variety of cellular functions.
  • ROS mitogen activated protein kinase
  • a cell has the ability to produce ROS at a number of different sites. In relation to signal transduction events it is still unclear where the source of ROS is within the cell. There are a number of potential enzyme systems capable of ROS generation. Perhaps the best documented one, particularly in neutrophils and other phagocytic cells, is NADPH oxidase. Studies using inhibitors of this enzyme such as DPI suggest that this enzyme is also involved in the generation of ROS in non phagocytic cells (Griendling et al., Circulation, 74, 1141-1148, 1994). Mitochondria play a key role in apoptosis and are also a major site of ROS generation.
  • the loss of mitochondrial membrane potential is coupled to the release of cytochrome C and this in turn has two effects.
  • the first is the generation of ROS, since the respiratory chain is disrupted by the removal of cytochrome C.
  • the second is the cleavage of cellular DNA through a series of cytochrome C mediated caspase activation steps, which is an end point of the apoptosis process.
  • ROS ROS are involved in p53 mediated apoptosis (Johnson et al., Proc. Natl. Acad. Sci. USA, 93, 11848-11852, 1997). Cells generated to over-express p53 undergo apoptosis, accompanied by ROS production and this can be blocked by anti-oxidants (Polyak et al., Nature, 389, 300-305, 1997).
  • ROS production is closely associated with the initiation and propagation of apoptosis.
  • the mechanism of ROS activity in apoptosis has until recently been unclear.
  • a series of enzymes involved in maintaining the redox balance within a cell contribute to the ability of that cell to survive in the presence of elevated ROS levels.
  • Such enzymes include catalase and superoxide dismutase which work to reduce the oxidative stress in cells.
  • catalase and superoxide dismutase which work to reduce the oxidative stress in cells.
  • superoxide dismutase which work to reduce the oxidative stress in cells.
  • Bcl-2 proteins most notably Bcl-2 are thought to mediate their anti-apoptotic effects via an anti-oxidant process (Hockenberry et al., Cell. 1993 75 :241-51). The precise mechanism by which Bcl-2 mediates its effects are still not quite defined.
  • NF-kB redox sensitive transcription factor
  • the first of these is tyrosine phosphorylation at the plasma membrane due either to intrinsic receptor tyrosine kinase activity (e.g. the insulin growth factor 1 receptor), or indirectly coupled to tyrosine kinases or alternatively directly coupled to several transmembrane G protein-coupled receptors.
  • intrinsic receptor tyrosine kinase activity e.g. the insulin growth factor 1 receptor
  • indirectly coupled to tyrosine kinases or alternatively directly coupled to several transmembrane G protein-coupled receptors.
  • Blood neutrophils have relatively short lives with greater than 80% of them apoptosing within the first 24 hours.
  • Apoptotic neutrophils are phagocytosed by macrophages via thrombospondin and macrophage CD36/ vitronectin receptor (Savil 1992, Clinical Science 83, 649-55, Savil et al. 1993, Immunology Today 14,131-136) and thus prevent release of potentially lethal cocktail of enzymes in the host, should the neutrophil undergo necrosis.
  • certain inflammatory environments favour the survival of neutrophils.
  • cytokines including GM-CSF, IL-1, IL-2, IL- 8 and IFN ⁇ can delay neutrophil apoptosis (Brach et al, 1992, Blood 80, 2920 -2924; Calotta et al 1992, Blood 80, 2012-2020, Lee et al 1993, J Leuk Biol 54, 283 - 388, Pericle et al 1994, Eur. J. Immunol24, 440 - 444, Get ref for IL8).
  • inflammatory proteins e.g. C5A
  • bacterial products e.g. LPS
  • Granulocyte macrophage colony-stimulating factor (GM-CSF) is known to inhibit PMN apoptosis both in vitro and in vivo (Cox et al. 1992, Am. J. Respiratory Cell Mol
  • GM-CSF selectively induced tyrosine phosphorylation of Extracellular Signal-Related kinase (ERK), a member of microtubule associated protein kinase (MAPK) family
  • ERK Extracellular Signal-Related kinase
  • MAPK microtubule associated protein kinase
  • Al-Shami et al. (Blood 1997, 89(3) 1035-1044) has shown that GM-CSF induces both a time and concentration- dependent increase in the level of tyrosine phosphorylation of the PI-3- kinase regulatory subunit p85, possibly via lyn kinase.
  • Klein et al. J. Immunol.
  • MCL1 myeloid cell leukaemia 1
  • MCL1 myeloid cell leukaemia 1
  • Neutrophils also express mRNA for Al, another Bcl-2 homologue with anti-apoptotic properties (Chuang PI, Yee E, Karsan A, Winn RK, Harlan JM, Biochem Biophys Res Commun 1998; 249(2): 361-5).
  • GM-CSF inhibits death through apoptosis by the regulation of 'effector genes' that control the process of apoptosis.
  • a signal acts through a signal transduction cascade and is associated with significant changes, or patterns of changes, in gene expression in the cell.
  • the identities of such 'effector genes' and their role in the signalling pathways that lead to the biochemical events of cell death have been incompletely determined.
  • apoptosis represents a significant therapeutic target, since many diseases are due to defects in this process. Many physiological factors induce and prevent cell apoptosis. For example, cytokines or growth factors such as GM-CSF inhibit death through apoptosis. There is an acute need to identify the genes that regulate this process. In other words, if one identifies a gene that prevents apoptosis, then this gene/gene product or its function can be blocked by a drug and apoptosis allowed to occur. To-date many of the genes found have certain fundamental flaws e.g. they act late in the process, after the cell has committed to a death programme, or they are ubiquitous, that is they are not restricted to a particular cell type. The ideal target to control apoptosis act early in the process and are restricted to a particular cell type.
  • the present invention identifies that the expression of the gene TGNP is correlated with an early stage in apoptosis.
  • TGNP gene expression is decreased in neutrophil apoptosis and increased in neutrophil survival when apoptosis is inhibited by the presence of GM-CSF.
  • GM-CSF inhibition of apoptosis is blocked by gliotoxin, TGNP expression is down regulated.
  • expression of recombinant TGNP in HeLa cells resulted in significant inhibition of proliferation/viability thus identifying TGNP as a modulator of cell growth/survival.
  • TGNP Trans-Golgi network integral membrane protein
  • GenBank Accession number U62390; gi2772589.
  • the human TGNP gene contains 4 exons and additional TGNP cDNAs, that are produced by alternative usage of 3 -prime splice sites in intron 3, have been identified.
  • TGNP is expresssed as multiple splice variants including a 46kDa isoform (TGN46).
  • TGN46 46kDa isoform
  • This protein isoform is identified under accession number AAC39539; gi 2226273.
  • the alternatively spliced cDNAs encode the 48kDa (TGN48) and 51kDa (TGN51) isoforms, which have longer C-terminal tails.
  • the 51kDa isoform is identified in Swiss Prot, Accession number: 043493; gi 12643559.
  • amino acid sequence for the 46kDa isoform is set out in SEQ ID NO: 1.
  • Isoform TGN51 is more abundant in fetal lung and kidney. Isoform TGN48 is barely expressed in embryonic kidney and promyelocytic cells. Expression has also been identified in adipose, adrenal gland, bladder, brain, breast, colon, epid_tumor, eye, genitourinary tract, germ cell, head neck, kidney, liver, lung, lung_tumor, marrow, nervous_normal, normal head/neck tissue, pancreas, placenta normal, pool, pooled brain, lung, testis, pooled colon, kidney, stomach, prostate, skin, synovial membrane, tonsil and uterus.
  • the TGNP gene maps to chromosomal position 2pl 1.2.
  • model discovery assays are configured to target the 'early' regulatory events occurring in apoptosis induced by ROS and, in particular, in the inhibition of apoptosis by GM-CSF.
  • apoptosis by GM-CSF is itself inhibited by a drug, such as gliotoxin, then changes, or patterns of changes can be targeted by clustering those changes that are common and both increase and/or decrease depending on the treatment.
  • a change that is a 'decrease' following induction of apoptosis is a candidate target gene, however, a change that is additionally an 'increase' following inhibition of apoptosis by GM-CSF has a higher probability of being a target gene because its regulation shows increased correlation with the process. Likewise, a change that is further a 'decrease' following inhibition of GM-CSF inhibitory effect has a yet higher probability of being a target gene because its regulation shows increased correlation with the process.
  • Genes regulated in these models following modulation of apoptosis include genes that 1) are 'effector' genes involved in the cells defence mechanisms aimed at preventing apoptosis (anti-apoptotic genes) and thus represent therapeutic targets, 2) make up aspects of the apoptosis and/or GM-CSF signal cascade and thus represent therapeutic targets, 3) initiate the process of apoptosis (pro-apoptotic genes) and thus represent therapeutic targets, and 4) are associated with the processes of apoptosis and defence that will aid in the understanding of key pathways, processes and mechanisms that may subsequently lead to the identification of therapeutic targets.
  • a method for detecting apoptosis in a cell comprising detecting a decrease in any one of: i) a TGNP polypeptide having an amino acid sequence as set out in SEQ ID NO: i; ii) a polypeptide having at least 80 % homology with i); iii) a nucleic acid encoding a polypeptide having the sequence set out in i) or ii); iv) a nucleic acid which hybridises under stringent conditions to the sequence set out in iii); or v) the complement of iv).
  • Levels of gene expression may be determined in any appropriate manner. Detecting a decrease in gene expression may be achieved by measuring TGNP gene expression in treated versus non-treated cells. Preferably, gene expression may be measured by detecting nucleic acid encoding a TGNP polypeptide such as TGNP mRNA transcripts, or a fragment thereof. In one embodiment, the method of measuring mRNA transcripts may use an amplification technique as described herein. In another embodiment, TGNP expression may be measured by detecting the TGNP polypeptide gene product, or fragment thereof, using, for example, agents that bind TGNP. Suitable agents include anti-TGNP antibodies. In another aspect, there is provided a method of detecting GM-CSF-induced cell survival by detecting an increase in TGNP gene expression.
  • a method of modulating apoptosis in a cell comprising the step of increasing, decreasing or otherwise altering the functional activity of TGNP or the nucleic acid encoding it.
  • said modulation of apoptosis is inhibition.
  • said modulation of apoptosis confers survival in a cell.
  • a method of modulating cell growth in a cell comprising the step of increasing, decreasing or otherwise altering the functional activity of TGNP or the nucleic acid encoding it.
  • the modulation of cell growth is the inhibition of proliferation.
  • the cell may be a therapeutic target for the treatment of disease.
  • a cell may be a cancer cell, a cell involved in an inflammatory disorder, a cell involved in an autoimmune disorder or in a neurodegenerative disorder.
  • the term 'altered functional activity of TGNP or the nucleic acid encoding it' includes within its scope increased, decreased or an otherwise altered activity of TGNP as compared with the native protein functioning in its normal environment, that is within a single cell under native conditions. In addition, it also includes within its scope an increased or decreased level of expression and/or altered intracellular distribution of the nucleic acid encoding TGNP, and/or an altered the intracellular distribution of TGNP itself.
  • the method of modulating apoptosis or cell growth involves decreasing TGNP gene expression.
  • the expression of TGNP is reduced by greater than 50%, 60%, 70%, 80%, 90% or more of its normal level in untreated cells.
  • a decrease in TGNP gene expression may be effected by antisense expression.
  • Other means of decreasing TGNP gene expression will be recognised by those skilled in the art and include introducing dominant negatives, peptides or small molecules including RNA molecules such as siRNA molecules which cause a decrease in gene expression through RNA interference. Suitable siRNA molecules are described in the Examples section herein.
  • said method involves increasing TGNP gene expression and therefore increasing cell survival.
  • the expression of TGNP is increased by greater than 50%, 60%, 70%, 80%, 90%, 100%, 200%, 500% or more of its normal level in untreated cells.
  • said method comprises providing an expression vector comprising a nucleic acid sequence encoding a TGNP polypeptide; introducing the expression vector into the cell and maintaining the cell under conditions permitting expression of the encoded polypeptide in the cell.
  • a nucleic acid encoding TGNP or a TGNP polypeptide encompasses fragments thereof.
  • TGNP or an agent that alters TGNP expression in a cell, in the modulation of apoptosis.
  • apoptosis is assessed by expression of TGNP in a test system and measuring the impact on cell growth and viability.
  • TGNP may itself be used to identify other candidate genes or proteins which are involved in apoptosis.
  • molecules which 'interact' with TGNP include molecules which bind to TGNP either directly or indirectly.
  • Methods for detecting those molecules include physical methods and molecular biology techniques as herein described. Suitable standard laboratory techniques will be familiar to those skilled in the art and include immunoprecipitation, immunoblotting and fluorescence techniques. One skilled in the art, will appreciate that this list is not intended to be exhaustive. Suitable molecular biology techniques include phage display and the yeast two-hybrid system described herein.
  • a method for identifying a gene product whose expression is modulated by the expression of TGNP comprising the steps of:
  • said method further comprises the step of exposing said cell to conditions which promote apoptosis or cell survival prior to measuring global gene expression.
  • Such a method may be modulated to identify compounds that modulate TGNP protein function. Accordingly, in another aspect, there is provided a method for identifying a compound that modulates TGNP protein function comprising: - taking a cell expressing TGNP;
  • expression levels are assessed by measuring gene transcription. This is preferably carried out by measuring the rate and/or amount of specific mRNA production in the cell.
  • a preferred embodiment of this aspect of the invention involves the use of arrayed oligonucleotide probes capable of hybridising to mRNA populations. Differences in hybridisation patterns of different mRNA populations may be used to identify genes which are differentially expressed in the two populations. Differential expression may include different expression patterns observed across a time course.
  • the arrayed oligonucleotide probes are advantageously derived from cDNA or EST libraries, and represent genes which are expressed by the cells under investigation.
  • Levels of gene expression may be determined in any appropriate manner. Preferably, levels of gene expression may be determined by the measurement of protein production by mRNA translation to detect increases or decreases in the rate or amount of mRNA translation.
  • global gene expression is measured by assaying gene transcription using a microarray.
  • global gene expression is measured by protein array.
  • Another aspect of the invention is directed to the identification of agents capable of modulating TGNP gene expression or protein function.
  • the invention provides assays for determimng compounds that modulate the function and/or expression of TGNP.
  • the identification of agents capable of modulating TGNP protein function can be detected by measuring the expression of a gene whose expression is regulated by TGNP.
  • a method for identifying a compound that modulates TGNP protein function comprising:
  • a method for identifying a compound that modulates TGNP protein function comprising: - taking a cell expressing TGNP;
  • nucleic acid construct comprising the promoter sequence of an TGNP-regulated gene operably linked to a reporter gene
  • a 'cell expressing TGNP' is a cell which has been transfected with a nucleic acid construct encoding TGNP preferably by providing a vector encoding TGNP and introducing said vector into a cell under conditions to promote expression of TGNP, as described above. Transfection may result in transient, stable or inducible expression of TGNP using methods familiar to those skilled in the art or as described herein.
  • the TGNP-regulated gene is selected from the group consisting of Tax interacting Protein, tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide, protein regulator of cytokinesis 1, acyl-Coenzyme A oxidase 2, branched chain, Cbp/p300-interacting transactivator, with Glu/ Asp-rich carboxy-terminal domain, 2, Interleukin 3 receptor, alpha (low affinity), eukaryotic translation initiation factor 3, subunit 6 (48kD):, B-cell CLL/lymphoma 9:, Rho- associated, coiled-coil containing protein kinase 2:, Neuropilin 1, Phosphodiesterase 3 A, cGMP-inhibited, B-cell CLL/lymphoma 2: :, Human secretory protein (TREFOIL FACTOR 3; TFF3 ), Vanin 1:, Calpain, large polypeptide L
  • a system for screening for compounds that modulate TGNP protein function comprising a cell expressing TGNP which is co-transfected with a nucleic acid construct encoding an TGNP-regulated gene or the promoter sequence of such a gene operably linked to a reporter gene.
  • Suitably said method can be used to identify compounds that enhance cell survival.
  • TGNP in an assay for identifying an agent which modulates apoptosis.
  • Cells useful in the methods of the invention may be from any source, for example from primary cultures, from established cell lines, in organ culture or in vivo.
  • Cell lines useful in the invention include cells and cell lines of haematopoietic origin. Suitable cells include HeLa, U937 (monocyte), TF-1, HEK293 (T), primary cultures of neutrophils or cells having neutrophil characteristics, for example HL60 cells, murine FDCP-1, FDCPmix, 3T3, primary or human stem cells.
  • Other suitable cells include cancer cell lines such as U251, SKOV3, OVCAR3, MCF7 PC3, HCT15, 786-0, HT29, M-14, H460 and LnCap.
  • cells may be disease-associated cells such as cancer, inflammatory, autoimmune or neurodegeration-associated cells.
  • the modulation of apoptosis can be for therapeutic purposes. Accordingly in another aspect of the invention there is provided a method of treatment of disease comprising administering a modulator of TGNP gene expression or functional activity to an individual.
  • a modulator of TGNP expression or activity in the manufacture of a medicament for use in the treatment of disease.
  • said modulator is an antisense molecule or an RNA molecule which mediates RNA interference and thus causes a decrease in TGNP expression.
  • Suitable diseases include cancer, inflammation, autoimmune disease and neurodegenerative disorders.
  • a number of inflammatory diseases such as asthma, chronic obstructive pulmonary disease (COPD), Cystic Fibrosis (CF), Rheumatoid Arthritis (RA) and Inflammatory bowel disease (IBD) are characterised by a) elevated levels and expression of cytokines and growth factors that act predominantly on myeloid cells, b) prolonged survival of myeloid cells, and c) prolonged activation of myeloid cells.
  • COPD chronic obstructive pulmonary disease
  • CF Cystic Fibrosis
  • RA Rheumatoid Arthritis
  • IBD Inflammatory bowel disease
  • TGNP or an agent that alters TGNP expression in a cell, in the treatment of inflammatory diseases through the modulation of myeloid cell apoptosis.
  • myeloid cell refers to terminally differentiated, non-dividing cells of the myeloid lineage. These cells include neutrophils, eosinophils and monocytes/macrophages. In one embodiment of any aspect of the present invention, the myeloid cell is a neutrophil, eosinophil or monocyte/macrophage.
  • Inflammatory diseases include, but are not limited to, diseases such as sepsis, Acute Respiratory Distress Syndrome, Pre enclampsia, Myocardial ischemia, reperfusion injury, Psoriasis, Asthma, COPD, bronchiolitis, Cystic Fibrosis, Rheumatoid Arthritis, Inflammatory Bowel Disease, Crohns Disease and Ulcerative colitis.
  • diseases such as sepsis, Acute Respiratory Distress Syndrome, Pre enclampsia, Myocardial ischemia, reperfusion injury, Psoriasis, Asthma, COPD, bronchiolitis, Cystic Fibrosis, Rheumatoid Arthritis, Inflammatory Bowel Disease, Crohns Disease and Ulcerative colitis.
  • an isolated nucleic acid molecule comprising a promoter, said nucleic acid sequence being selected from the group consisting of: i) a nucleic acid molecule having the sequence set out in SEQ ID NO:2; ii) a nucleic acid molecule having at least 60% homology with i); iii) a nucleic acid molecule hybridising under stringent conditions to i) or ii); and iv) the complement of the sequences set out in i) to iii).
  • the TGNP promoter region has been identified to comprise a number of sites which bind specific transcription factors or enhancers. Accordingly, in one embodiment there is provided a nucleic acid sequence as set out in i), ii) or iii) above which comprises one or more of the enhancer or transcription factor binding elements selected from the group consisting of C/EBP, Mef-2, CATT, GATA-1, NFKB, PrRE, Pit- 1 , AP2, CRE and Spl and including others known to the art but not specified herein. In another embodiment, said nucleic acid sequence comprises all of these enhancer or transcription factor binding elements.
  • GM-CSF GM-CSF
  • the promoter sequence comprises the sequence set out SEQ ID NO:2.
  • the promoter sequence comprises the region of the genomic sequence from -2032 to +4 of the transcription start site for TGNP.
  • a vector comprising a nucleic acid as defined above.
  • said vector comprises a nucleic acid in accordance with the invention operably linked to a reporter gene.
  • the vector may further comprise other sequences such as sequences encoding selectable markers.
  • Suitably modulation of expression may be an increase (activation) or a decrease (inhibition) of expression from the TGNP promoter.
  • Figure 1 shows the dose responsiveness of the anti-apoptotic effect of GM-CSF. Optical densities are read at 570nm using a plate reader. The results indicate a direct correlation between survival and concentrations of GM-CSF added to the culture medium.
  • Figure 2 shows that the fungal metabolite gliotoxin blocks the GM-CSF in the inhibition of neutrophil apoptosis.
  • the method is as described in Example 1.
  • Optical densities are read at 570nm using a plate reader.
  • Gliotoxin effectively blocks the GM- CSF mediated inhibition of neutrophil apoptosis.
  • the blocking effect is not seen when the inactive analogue of gliotoxin, methylgliotoxin is added with GM-CSF.
  • No increased neutrophil apoptosis is seen with the addition of gliotoxin alone to isolated neutrophils, demonstrating that the effect is specific to, and limited to, a reversal of the protective effects of GM-CSF.
  • Figure 3 shows a phosphoimage scan of a microarray.
  • Figure 4 shows the analysis of a captured image film by Array VisionTM software.
  • FIG. 5 shows the results of combined code cluster analysis.
  • FIG. 6 shows cluster analysis of LifeGrid filters.
  • TGNP is identified by association, as a modulator of apoptosis and cell survival.
  • Human purified peripheral blood neutrophils are either allowed to undergo spontaneous apoptosis (Apop), or else are treated with 5U/ml GM-CSF to inhibit apoptosis (GM-CSF).
  • Samples are isolated for RNA extraction and microarray gene analysis, 2 h (Apop2 and GMCSF2), 3 h (Apop3), 4 h (Apop4 and GMCSF4), 5 h (Apop5) and 6 h (Apop6 and GMCSF6) post- isolation.
  • Gliotoxin (0.1 ⁇ g/ml; Glio) or its inactive analogue Methyl Gliotoxin (0.1 ⁇ g/ml; Methyl) are added in the presence of GM-CSF.
  • Average fold change values (from two spots on the filters) for selected candidate apoptosis/survival-associated genes are compared to time zero controls (except GM4 which compares fold change of 4 h treatment of GM-CSF plus Gliotoxin with 4 h treatment of GM-CSF with Methyl Gliotoxin control), are analysed by GeneMaths using a Pearson correlation and Ward cluster algorithms. Increased expression (light) and decreased expression (dark) are represented and referenced by a color scale bar. TGNP gene is highlighted in bold.
  • FIG. 7 shows TGNP mRNA is increased in GM-CSF-induced neutrophil survival, and this increased expression is blocked by Gliotoxin. Human purified peripheral blood neutrophils are treated as described in Figure 6. The relative amounts of TGNP transcripts are shown.
  • Figure 8 shows a dendrogram representation of cluster analysis for Figure 6. Marker genes, with known function in apoptosis and survival are indicated. TGNP gene is marked.
  • FIG. 9 shows TGNP is adjacently correlated with signal transduction associated to apoptosis.
  • Human purified peripheral blood neutrophils are either allowed to undergo spontaneous apoptosis (Apop), or else are treated with 5U/ml GM-CSF to inhibit apoptosis (GM-CSF).
  • Samples are isolated for RNA extraction and microarray gene analysis, 2 h (Apop2 and GMCSF2), 3 h (Apop3), 4 h (Apop4 and GMCSF4), 5 h (Apop5) and 6 h (Apop ⁇ and GMCSF6) post-isolation.
  • Gliotoxin 0.1 ⁇ g/ml; Glio
  • Methyl Gliotoxin 0.1 ⁇ g/ml; Methyl
  • Average fold change values from two spots on the filters
  • GM4 which compares fold change of 4 h treatment of GM-CSF plus Gliotoxin with 4 h treatment of GM-CSF with Methyl Gliotoxin control
  • GeneMaths using a Pearson correlation and Ward cluster algorithms.
  • Increased expression (light) and decreased expression (dark) are represented and referenced by a color scale bar. TGNP gene is indicated.
  • FIG. 10 shows TGNP gene expression is decreased by cisplatin-induced apoptosis in HeLa cells.
  • HeLa cells are plated into 75cm 2 flasks (6xl0 6 cells/ flask) and allowed to adhere for four hours. After this period, cells are treated with Cisplatin (lug/ml) and incubated at 37°C.
  • RNA samples are isolated and analysed by microarray, using Incyte LifeGrid filters at 0 h, 2 h and 4 h following the addition of cisplatin. Average fold change of the TGNP gene at 2 h and 4h, compared with 0 h is indicated.
  • Figure 11 shows a graphical representation of the effect of known survival and pro- apoptotic genes on the proliferation/ viability of HeLa cells, as determined by a plaque assay.
  • Figure 12 shows a graphical representation of the effect of TGNP on the proliferation/ viability of HeLa cells, as determined by a plaque assay.
  • Cells were quantified by crystal violet staining and measurement of Abs 570nm are the mean ⁇ standard error of three wells.
  • Figure 13 shows the nucleotide sequence for the TGNP promoter.
  • the underlined sequence represents the beginning of the mRNA transcript.
  • Figure 14 shows enhancer and transcription factor binding elements in the TGNP promoter. Numbers in brackets indicate positions derived from the sequence presented in Figure 13 (SEQ ID NO:2).
  • Figure 15 shows Forward and Side Scatter analysis of TF-1 population by Flow Cytometry. TF-1 cells are cultured for 48h in the presence or absence of GM-CSF (2ng/ml) prior to acquisition and analysis using a FacsCalibre flow cytometer. The area enclosed in the gate represents the live gate region. From this figure, it is observed that there is a decrease of approx. 50% in the number of cells with side scatter parameters of healthy cells in the factor deprived cells.
  • Figure 16 shows cell cycle analysis by flow cytometry. Apoptotic cells have less DNA, resulting in an increase in low intensity staining, measured as a sub GI peak in fluorescent histograms.
  • Figure 17 shows a composite of dot plots showing a typical result for TF-1 cells treated under the various conditions.
  • Cells are transduced with either an empty expression vector containing no insert or BCL2 and subjected to the indicated conditions.
  • BCL2 in TF-1 cells allows more cells to survive GMCSF withdrawal, as determined by the percentage of cells in the live gate.
  • debris bottom left
  • Figure 18 shows % apoptosis in TFl cells transduced with either TGNP or an empty expression cassette (Control) cultured for 48h in the presence or absence of GMCSF. Following this period, % apoptosis is determined by FSC/SSC characteristics. Percentage apoptosis is calculated by measuring the amount of death in GMCSF free cultures relative to corresponding cultures where GMCSF is present.
  • Apoptosis or programmed cell death is a controlled intracellular process characterised by the condensation and subsequent fragmentation of the cell nucleus during which the plasma membrane remains intact. It is an active, highly regulated process distinguished by cell shrinkage and packaging of the cell contents into apoptotic bodies that are subsequently engulfed by macrophages, thus avoiding activation of the inflammatory response (for review see Wyllie, Br. Med. Bull. 53:451- 465, 1997). Apoptotic death is distinct from other cell processes including necrotic cell death and replicative senescence.
  • modulating apoptosis is meant that for a given cell, under certain environmental conditions, its normal tendency to undergo apoptosis is changed compared to an untreated cell.
  • blood neutrophils have a defined apoptotic tendency - within a population of cells, greater than 80% will apoptose within the first 24 hours. Modulating the apoptosis of blood neutrophils means changing this normal apoptotic tendency such that apoptosis is increased or decreased relative to the normal rate.
  • blood neutrophils in the presence of GM-CSF have a decreased tendency to apoptose.
  • modulating apoptosis of blood neutrophils in the presence of GM-CSF means increasing or decreasing apoptosis relative to their normal decreased tendency under these conditions.
  • a decreased tendency to apoptose may also be a measurable increase in cell survival and may be the result of an inhibition of apoptosis by inhibiting one or more components of the apoptotic pathway.
  • expression refers to the transcription of a genes DNA template to produce the corresponding mRNA and translation of this mRNA to produce the corresponding gene product (i.e., a peptide, polypeptide, or protein).
  • activates gene expression refers to inducing or increasing the transcription of a gene in response to a treatment where such induction or increase is compared to the amount of gene expression in the absence of said treatment.
  • decreased gene expression or “down-regulates gene expression” refers to inhibiting or blocking the transcription of a gene in response to a treatment and where such decrease or down- regulation is compared to the amount of gene expresssion in the absence of said treatment.
  • Antibodies can be whole antibodies, or antigen-binding fragments thereof.
  • the invention includes fragments such as Fv and Fab, as well as Fab' and F(ab') 2 , and antibody variants such as scFv, single domain antibodies, Dab antibodies and other antigen-binding antibody-based molecules.
  • the "functional activity" of a protein in the context of the present invention describes the function the protein performs in its native environment. Altering the functional activity of a protein includes within its scope increasing, decreasing or otherwise altering the native activity of the protein itself. In addition, it also includes within its scope increasing or decreasing the level of expression and/or altering the intracellular distribution of the nucleic acid encoding the protein, and/or altering the intracellular distribution of the protein itself.
  • variants or derivatives in relation to TGNP polypeptide includes any substitution of, variation of, modification of, replacement of, deletion of or addition of one (or more) amino acids from or to the polypeptide sequence of TGNP.
  • nucleic acids encoding TGNP are understood to comprise variants or derivatives thereof.
  • nucleic acid refers to single stranded or double stranded DNA and RNA molecules including natural nucleic acids found in nature and/or modified, artificial nucleic acids having modified backbones or bases, as are known in the art.
  • an "isolated" nucleic acid refers to material removed from its original environment (for example, the natural environment in which it occurs in nature), and thus is altered by the hand of man from its natural state.
  • an isolated polynucleotide could be part of a vector or a composition of matter, or could be contained within a cell, and still be “isolated” because that vector, composition of matter, or particular cell is not the original environment of the polynucleotide.
  • the term "isolated” does not refer to genomic or cDNA libraries, whole cell total or mRNA preparations, genomic DNA preparations (including those separated by electrophoresis and transferred onto blots), sheared whole cell genomic DNA preparations or other compositions where the art demonstrates no distinguishing features of the nucleic acids of the present invention.
  • Vector refers to any agent such as a plasmid, cosmid, virus, autonomously replicating sequence, phage, or linear single-stranded, circular single-stranded, linear double-stranded, or circular double-stranded DNA or RNA nucleotide sequence that carries exogenous DNA into a host cell or organism.
  • the recombinant vector may be derived from any source and is capable of genomic integration or autonomous replication.
  • promoter refers to a nucleic acid sequence, usually found upstream (5') to a coding sequence, that is capable of directing transcription of a nucleic acid sequence into mRNA.
  • the promoter or promoter region typically provide a recognition site for RNA polymerase and the other factors necessary for proper initiation of transcription.
  • a promoter or promoter region includes variations of promoters derived by inserting or deleting regulatory regions, subjecting the promoter to random or site-directed mutagenesis, etc.
  • the activity or strength of a promoter may be measured in terms of the amounts of RNA it produces, or the amount of protein accumulation in a cell or tissue, relative to a promoter whose transcriptional activity has been previously assessed.
  • a "nucleic acid encoding the promoter sequence of TGNP” means a nucleic acid which is capable of directing transcription of TGNP gene expression.
  • the term moreover includes those polynucleotides capable of hybridising, under stringent hybridisation conditions, to the naturally occurring nucleic acids identified above, or the complement thereof.
  • “Stringent hybridisation conditions” refers to an overnight incubation at 42°C in a solution comprising 50% formamide, 5x SSC (750 mM NaCI, 75 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5x Denhardt's solution, 10% dextran sulphate, and 20 pg/ml denatured, sheared salmon sperm DNA, followed by washing the filters in O.lx SSC at about 65°C.
  • operably linked refers to the functional spatial arrangement of two or more nucleic acid regions or nucleic acid sequences.
  • a promoter region may be positioned relative to a nucleic acid sequence such that transcription of a nucleic acid sequence is directed by the promoter region.
  • a promoter region is "operably linked" to the nucleic acid sequence.
  • RNA polymerase a promoter or promoter region for a gene typically provides a recognition site for RNA polymerase and for the other factors, such as transcription factors or enhancers, which are necessary for proper initiation of transcription.
  • the TGNP promoter region has been identified to comprise a number of sites which bind specific transcription factors or enhancers.
  • reporter gene is a gene which is inco ⁇ orated into an expression vector and placed under the same controls as a gene of interest to express an easily measurable phenotype.
  • myeloid cell encompasses terminally differentiated, non-dividing (i.e. non- proliferative) cells derived from the myeloid cell lineage and includes neutrophils or polymo ⁇ honuclear neutrophils (PMNs), eosinophils and mononuclear phagocytes.
  • the latter cells are known as monocytes when in the blood and macrophages when they have migrated into the tissues.
  • Terminal differentiation is the normal endpoint in cellular differentiation and is usually not reversible.
  • “Inflammatory disorders” or “inflammatory diseases” are disorders characterised by chronic or acute inflammation. This, in turn, is characterised by elevated levels of cytokines and/or survival factors for myeloid cells. These disorders are characterised by the prolongued survival of myeloid cells including neutrophils, eosinophils and monocytes/macrophages which can be present as a mixture of one or more of these cell types. Accordingly, reference to treatment of inflammatory disorders or diseases includes treatment of the individual cell types or treatment of a mixture of different cell types. The resultant increased numbers of these inflammatory cells is associated with the disease pathology. In chronic inflammation a persistent inflammatory response causes damaging effects such as tissue damage.
  • Chronic Inflammatory Diseases include cystic fibrosis, acute respiratory distress syndrome, chronic obstructive pulmonary disease, inflammatory bowel disease and rheumatoid arthritis.
  • Other inflammatory diseases are known to those skilled in the art and include sepsis, Pre enclampsia, Myocardial ischemia, reperfusion injury, Psoriasis, Asthma, bronchiolitis, Crohns Disease and Ulcerative colitis.
  • TGNP Trans Golgi Network integral membrane protein
  • TGNP may be involved in regulating membrane traffic to and from trans-golgi network
  • TGN38A R. norvegicus pir: S22415 membrane protein TGN38 40% 480aa long form precursor A. thaliana ⁇ ir:T06029 hypothetical protein T28I19.100 21% 345aa
  • Endocytosis signal Domain (isoform TGN51) Amino acids 437-440 Endocytosis signal Domain (isoform TGN51) Amino acids 461-464 14X14 AA Tandem Repeats Domain: Amino acids 54-249 Repeat: Amino acids 54-67 Amino acids 68-81 Amino acids 82-95 Amino acids 96-109 Amino acids 110-123 Amino acids 124-137 Amino acids 138-151 Amino acids 152-165 Amino acids 166-179 Amino acids 180-193 Amino acids 194-207 Amino acids 208-221 Amino acids 222-234 Amino acids 235-249
  • N-Linked Glycosylation motif Amino acid 39 N-Linked Glycosylation motif: Amino acid 82 N-Linked Glycosylation motif: Amino acid 96 N-Linked Glycosylation motif: Amino acid 152 N-Linked Glycosylation motif: Amino acid 180 N-Linked Glycosylation motif: Amino acid 208 N-Linked Glycosylation motif: Amino acid 222 N-Linked Glycosylation motif: Amino acid 373 N-Linked Glycosylation motif: Amino acid 377
  • TGN38 a transmembrane glycoprotein predominantly localized to the trans-Golgi network, has been used to study both the structure and the function of the trans-Golgi network (TGN).
  • the TGN is a key sorting station for proteins. It has been demonstated that TGN38 returns from the plasma membrane via the endocytic pathway. It has therefore been concluded that TGN was structurally and functionally distinct from the Golgi cisternae, indicating that different molecules control membrane traffic from the Golgi cisternae and from the TGN. Sequence analysis confirms that TGN38 has 100% identity to TGN46.
  • TGN46 human TGN46 (TGNP) gene contains 4 exons and additional TGN46 cDNAs that are produced by alternative usage of 3 -prime splice sites in intron 3 have been identified.
  • the alternatively spliced cDNAs encode the TGN48 and TGN51 isoforms, which have longer C-terminal tails. When expressed in mammalian cells, all 3 forms localized mostly to the TGN. The longer splice variants are identical apart from the longer C-terminal tails. Accordingly, TGN48 has 437/453 amino acid identity and TGN 51 has 437/480 amino acid identity.
  • TGNP also includes within its scope, variants, derivitives and fragments thereof, in as far as they possess the requisite ability to modulate apoptosis.
  • Natural variants of TGNP are likely to comprise conservative amino acid substitutions.
  • Conservative substitutions may be defined, for example according to the Table below. Amino acids in the same block in the second column and preferably in the same line in the third column may be substituted for each other:
  • Natural variants of TGNP further include splice variants such as TGN 46, 48 and 51 isoforms as described herein.
  • Suitable fragments of TGNP will be at least about 5, e.g. 10, 12, 15 or 20 amino acids in length. They may also be less than 100, 75 or 50 amino acids in length. They may contain one or more (e.g. 5, 10, 15, or 20) substitutions, deletions or insertions, including conserved substitutions.
  • a fragment of TGNP used in the methods of the present invention must possess the requisite activity of being capable of modulating apoptosis.
  • Levels of gene expression may be determined using a number of different techniques.
  • RNA may be extracted from cells using RNA extraction techniques including, for example, using acid phenol/guanidine isothiocyanate extraction (RNAzol B; Biogenesis), or RNeasy RNA preparation kits (Qiagen).
  • RNAzol B acid phenol/guanidine isothiocyanate extraction
  • RNeasy RNA preparation kits Qiagen.
  • Typical assay formats utilising ribonucleic acid hybridisation include nuclear run-on assays, RT-PCR and RNase protection assays (Melton et al, Nuc. Acids Res. 12:7035. Methods for detection which can be employed include radioactive labels, enzyme labels, chemiluminescent labels, fluorescent labels and other suitable labels.
  • RT-PCR is used to amplify RNA targets.
  • the reverse transcriptase enzyme is used to convert RNA to complementary DNA (cDNA) which can then be amplified to facilitate detection.
  • DNA amplification methods are known, most of which rely on an enzymatic chain reaction (such as a polymerase chain reaction, a ligase chain reaction, or a self- sustained sequence replication) or from the replication of all or part of the vector into which it has been cloned.
  • an enzymatic chain reaction such as a polymerase chain reaction, a ligase chain reaction, or a self- sustained sequence replication
  • PCR is a nucleic acid amplification method described inter alia in U.S. Pat. Nos. 4,683,195 and 4,683,202. PCR can be used to amplify any known nucleic acid in a diagnostic context (Mok et al., (1994), Gynaecologic Oncology, 52: 247-252).
  • Self- sustained sequence replication (3SR) is a variation of TAS, which involves the isothermal amplification of a nucleic acid template via sequential rounds of reverse transcriptase (RT), polymerase and nuclease activities that are mediated by an enzyme cocktail and appropriate oligonucleotide primers (Guatelli et al. (1990) Proc. Natl. Acad. Sci. USA 87:1874).
  • Ligation amplification reaction or ligation amplification system uses DNA ligase and four oligonucleotides, two per target strand. This technique is described by Wu, D. Y. and Wallace, R. B. (1989) Genomics 4:560. In the Q ⁇ Replicase technique, RNA replicase for the bacteriophage Q ⁇ , which replicates single-stranded RNA, is used to amplify the target DNA, as described by Lizardi et al. (1988) Bio/Technology 6:1197.
  • rolling circle amplification (Lizardi et al., (1998) Nat Genet 19:225) is an amplification technology available commercially (RCATTM) which is driven by DNA polymerase and can replicate circular oligonucleotide probes with either linear or geometric kinetics under isothermal conditions.
  • RCATTM rolling circle amplification
  • SDA strand displacement amplification
  • Primers suitable for use in various amplification techniques can be prepared according to methods known in the art.
  • RNA transcripts RNA transcripts present.
  • Methods for detection which can be employed include radioactive labels, enzyme labels, chemiluminescent labels, fluorescent labels and other suitable labels.
  • the detection of nucleic acids encoding TGNP can be used, in the context of the present invention, to identify early stage apoptosis in cells - a decrease in TGNP transcripts is associated with the onset of apoptosis. An increase is associated with cell survival and, in particular, is an early response in GM-CSF-mediated inhibition of apoptosis in neutrophils.
  • Gene expression may also be detected by measuring the TGNP_polypeptide. This may be achieved by using molecules which bind to the TGNP polypeptide. Suitable molecules/agents which bind either directly or indirectly to TGNP in order to detect the presence of the protein include naturally occurring molecules such as peptides and proteins, for example antibodies, or they may be synthetic molecules.
  • Standard laboratory techniques such as immunoblotting can be used to detect altered levels of TGNP, as compared with untreated cells in the same cell population.
  • An example of a suitable protocol is detailed below:
  • Gene expression may also be determined by detecting changes in post-translational processing of polypeptides or post-transcriptional modification of nucleic acids. For example, differential phosphorylation of polypeptides, the cleavage of polypeptides or alternative splicing of RNA, and the like may be measured. Levels of expression of gene products such as polypeptides, as well as their post-translational modification, may be detected using proprietary protein assays or techniques such as 2D polyacrylamide gel electrophoresis.
  • a number of methods are known in the art for monitoring the onset of apoptosis. These include mo ⁇ hological analysis, DNA ladder formation, cell cycle analysis, externalisation of membrane phospholipid phosphatidyl serine and caspase activation analysis.
  • Cell survival may be monitored by a number of techniques including cell cycle analysis and measuring cell viability. Measurements of cell proliferation may be made using a number of techniques including a plaque assay in which adherent cells are plated out in tissue culture plates and left to grow prior to fixing and staining. The number of colonies formed reflects the amount of cell proliferation.
  • TGNP The functional activity of TGNP may be modified by suitable molecules/agents which bind either directly or indirectly to TGNP, or to the nucleic acid encoding it.
  • Agents may be naturally occurring molecules such as peptides and proteins, for example antibodies, or they may be synthetic molecules.
  • Methods of modulating the level of expression of TGNP include, for example, using antisense techniques.
  • Antisense constructs i.e. nucleic acid, preferably RNA, constructs complementary to the sense nucleic acid or mRNA, are described in detail in US 6,100,090 (Monia et al), and Neckers et al., 1992, CritRev Oncog 3(1-2):175-231, the teachings of which document are specifically inco ⁇ orated by reference.
  • Suitable antisense molecules may be variants, based on these molecules, which have been chemically modified.
  • the antisense nucleic acids can usefully include altered, often nuclease-resistant, intemucleoside bonds. See Hartmann et al. (eds.), Manual of Antisense Methodology (Perspectives in Antisense Science), Kluwer Law International (1999) (ISBN:079238539X); Stein et al. (eds.), Applied Antisense Oligonucleotide Technology. Wiley-Liss (cover (1998) (ISBN: 0471172790); Chadwick et al. (eds.), Oligonucleotides as Therapeutic Agents - Symposium No. 209. John Wiley & Son Ltd (1997) (ISBN: 0471972797).
  • modified oligonucleotide backbones are, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3 '-5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2"-5* to 5'-2 ⁇
  • modified oligonucleotide backbones for antisense use that do not include a phosphorus atom have backbones that are formed by short chain alkyl or cycloalkyl intemucleoside linkages, mixed heteroatom and alkyl or cycloalkyl intemucleoside linkages, or one or more short chain heteroatomic or heterocyclic intemucleoside linkages.
  • RNA-mediated interference is another method for modulating gene expression based on a biological response to double-stranded RNA (dsRNA) resulting in the degradation of homologous mRNA (Dernberg and Ka ⁇ en, Cell 111 :159-162, 2002). Since its description in 1998 (Fire and Mello, Nature 391:806-811, 1998) RNAi has rapidly become a standard experimental tool for targeted destruction of mRNAs in worms, flies, plants and mammals (for review see McManus and Sha ⁇ , Nature Genetics 3:737-747, 2002).
  • dsRNA double-stranded RNA
  • RNAi is believed to function primarily as a cellular defence mechanism against viruses and transposable elements (Ketting et al, Cell 99:133-141, 1999; Tabara et al, Cell 99:132-132, 1999; see also Elbashir et al, Genes Dev. 15:188-200, 2001).
  • RNAi-like processes also appear to be involved in the post-transcriptional regulation of a variety of metazoan developmental processes (reviewed in Ruvkun, Science 294:797-799, 2001).
  • RNA interference is initiated when the dsRNA is processed to short 21- 23nt fragments (Zamore et al, Cell 101:25-33, 2000; Bernstein et al, Nature 409:363- 366, 2001).
  • siRNAs small interfering RNAs
  • siRNAs are now used routinely in mammalian cells to study the functional consequences of reducing the expression of specific genes (McManus and Sha ⁇ , Nature Genetics 3:737-747, 2002). Methods for designing effective siRNAs are described, for example, in http://www.ambion.com/hottopics/mai.
  • Compounds having inhibitory, activating, or modulating activity can be identified using in vitro and in vivo assays for TGNP activity and or expression, e.g., ligands, agonists, antagonists, and their homologs and mimetics.
  • Modulator screening may be performed by adding a putative modulator test compound to a tissue or cell sample, and monitoring the effect of the test compound on the function and/or expression of TGNP. A parallel sample which does not receive the test compound is also monitored as a control. The treated and untreated cells are then compared by any suitable phenotypic criteria, including but not limited to microscopic analysis, viability testing, ability to replicate, histologjcal examination, the level of a particular RNA or polypeptide associated with the cells, the level of enzymatic activity expressed by the cells or cell lysates, and the ability of the cells to interact with other cells or compounds.
  • phenotypic criteria including but not limited to microscopic analysis, viability testing, ability to replicate, histologjcal examination, the level of a particular RNA or polypeptide associated with the cells, the level of enzymatic activity expressed by the cells or cell lysates, and the ability of the cells to interact with other cells or compounds.
  • Methods for inducing apoptosis include, without limitation, exposure to chemotherapy or radiotherapy agents and withdrawal of obligate survival factors (e.g. GM-CSF, NGF) if applicable. Differences between treated and untreated cells indicates effects attributable to the test compound.
  • obligate survival factors e.g. GM-CSF, NGF
  • Myeloid cells die spontaneously in culture although with differing time courses depending on the cell type. Neutrophils in culture apoptose within 24 hours although this can be delayed to over 48 hours in the presence of survival factors. Eosinophil apoptosis is observed over 48 hours with a delay to several days in the presence of survival factors. Macrophages are generally much longer lived. Thus, the ability of a compound to modulate myeloid cell apoptosis can be assessed by monitoring the rate of apoptosis in the presence or absence of the test compound and after the withdrawal of obligate survival factors (e.g. GM-CSF, IL-8, IL-5, G-CSF or BAL) if applicable. Differences between treated and untreated cells indicates effects attributable to the test compound. Expressing TGNP in cells
  • TGNP may be expressed in cells by introducing vectors encoding the TGNP polypeptide.
  • vectors that will drive expression of polypeptides from the inserted heterologous nucleic acid
  • expression vectors will often include a variety of other genetic elements operatively linked to the protein-encoding heterologous nucleic acid insert, typically genetic elements that drive transcription, such as promoters and enhancer elements, those that facilitate RNA processing, such as transcription termination and/or polyadenylation signals, and those that facilitate translation, such as ribosomal consensus sequences.
  • expression vectors will often include a variety of other genetic elements operatively linked to the protein-encoding heterologous nucleic acid insert, typically genetic elements that drive transcription, such as promoters and enhancer elements, those that facilitate RNA processing, such as transcription termination and/or polyadenylation signals, and those that facilitate translation, such as ribosomal consensus sequences.
  • conditions that permit expression of the polypeptide from these vectors will depend on the type of vector and cell expression system chosen.
  • Vectors for expressing proteins are known for expression in prokaryotic cells, in yeast cells, typically S. cerevisiae and in mammalian cells and each include the specifc genetic elements for expression in the particular cell type.
  • Vector-drive protein expression can be constitutive or inducible.
  • Inducible vectors include either naturally inducible promoters, such as the trc promoter, which is regulated by the lac operon, and the pL promoter, which is regulated by tryptophan, the MMTV-LTR promoter, which is inducible by dexamethasone, or can contain synthetic promoters and/or additional elements that confer inducible control on adjacent promoters.
  • Plasmid vectors will typically be introduced into chemically competent or electrocompetent bacterial cells.
  • Vectors can be introduced into yeast cells by spheroplasting, treatment with lithium salts, electroporation, or protoplast fusion.
  • Mammalian and insect cells can be directly infected by packaged viral vectors, or transfected by lipid, chemical or electrical means.
  • Expression vectors can be designed to fuse the expressed polypeptide to small protein tags that facilitate purification and/or visualization.
  • proteins can be expressed with a tag that facilitates purification of the fusion protein.
  • Suitable tags and their purification means are known and include poly- his/immobilized metal affinity chromatography, glutathione-S-transferase/glutathione affinity resins, Xpress epitope/detectable by anti-Xpress antibody (Invitrogen, Carlsbad, CA, USA), myc tag/anti-myc tag antibody, V5 epitope/anti-V5 antibody (Invitrogen, Carlsbad, CA, USA) and FLAG® epitope/anti-FLAG antibody (Stratagene, La Jolla, CA, USA).
  • vectors can include appropriate sequences that encode secretion signals, such as leader peptides.
  • Expression vectors can also be designed to fuse proteins encoded by the heterologous nucleic acid insert to polypeptides larger than purification and/or identification tags.
  • Useful protein fusions include those that permit display of the encoded protein on the surface of a phage or cell, fusions to intrinsically fluorescent proteins, such as those that have a green fluorescent protein (GFP)-like chromophore, fusions to the IgG Fc region, and fusions for use in two hybrid systems.
  • GFP green fluorescent protein
  • TGNP protein can be expressed and purified from systems such as these for use in methods for detecting molecules which interact with TGNP.
  • TGNP as an affinity ligand to identify agents which bind to it; labeling TGNP with a detectable label and using it as a probe to detect apoptotic products in electrophoresis gels; labeling the TGNP target and using it to probe libraries of genes and/or cDNAs; labeling the TGNP target and using it to probe cDNA expression libraries to find clones synthesizing proteins which can bind to the target; performing UV-crosslinking studies to identify agents which can bind to the target; using the TGNP in gel retardation assays which would detect its ability to bind to nucleic acid encoding identified agents; performing footprinting analyses to identify the regions within a nucleic acid to which the target binds.
  • immunoprecipitation Another technique that allows the identification of protein-protein interactions is immunoprecipitation.
  • An example of a protocol for immunoprecipitation is detailed below:
  • lysates from sonicated, Triton X-100-solublized cells (60 ⁇ g protein in lOO ⁇ l PBS with protease inhibitors) are incubated for 90 min at 37°C with 500 ng affinity-purified rabbit polyclonal antibodies specific for TGNP, followed by an addition of lO ⁇ l packed protein A/G-agarose beads (30 min, 37°C: Santa Cruz Biotechnology), vigorous washing of the pellet (10 min at lOOOOg, 3 x) in PBS, 5% SDS PAGE, and immunodetection with an TGNP-specific mAb.
  • yeast-two hybrid system Another useful technique for identifying interacting protein is the yeast-two hybrid system described, for example in Bartel et al. (eds.), The Yeast Two-Hvbrid System. Oxford University Press (1997) (ISBN: 0195109384) the disclosure of which is inco ⁇ orated herein by reference.
  • Protein interactions can also be analysed using protein arrays. These may be generated by a range of different techniques which allow proteins to be deposited on a flat surface at different densities. High density protein arrays can be generated using automated approaches similar to those described for DNA arrays (see below). Proteins interacting with TGNP may be identified by, for example, using TGNP protein to probe an expression array. Positive interactions could then be detected by the presence of, for example, a labelled antibody or by placing a tag on TGNP. The identity of the interacting protein can be determined by techniques such as mass spectrometry.
  • Cells useful in the method of the invention may be from any source, for example from primary cultures, from established cell lines, in organ culture or in vivo.
  • Cell lines useful in the invention include cells and cell lines of haematopoietic origin. Suitable cells include HeLa, U937 (monocyte), TF-1, HEK293 (T), primary cultures of neutrophils or cells having neutrophil characteristics, for example HL60 cells, murine FDCP-1, FDCPmix, 3T3, primary or human stem cells.
  • Regulation of gene activity can be accomplished at a number of levels. Most commonly, regulation is at the transcriptional level - specific transcription factors modulate the expression of subsets of target genes. Post-transcriptional regulation (translational regulation), is determined by the rate and mechanism of RNA processing in the cell, i.e. accumulation, translation and degradation. Subsequent protein-level regulation of genetic activity is accomplished through post-translational modification.
  • a number of individual gene product types whose expression or function is associated with TGNP gene expression may be screened for in the present invention. These products include polypeptides and nucleic acids.
  • the expression levels assessed may be absolute levels of production of a particular polypeptide or nucleic acid, or the levels of production of a derivative of any polypeptide or nucleic acid.
  • the invention may be configured to measure the level of expression of a particular mRNA splice variant, or the amount present of a phosphorylated derivative of a particular polypeptide.
  • the gene product to be monitored is unknown, however, methods are employed which facilitate the identification of the gene product whose expression is to be measured.
  • the gene product is a nucleic acid
  • arrays of oligonucleotide probes may be used as a basis for screening populations of mRNA derived from cells.
  • Gene Arrays can additionally be constructed specifically, by spotting nucleotide sequences derived from cDNA clones generated from novel libraries or from cDNA clones purchased commercially. Such arrays allow the expression profiling of proprietary and/or novel nucleotide sequences.
  • Gene Arrays are additionally constructed by commercial sources (e.g. Genescreen), by spotting nucleotide sequences derived from cDNA clones generated from novel libraries or from cDNA clones purchased commercially. Such arrays allow the expression profiling of proprietary and/or novel nucleotide sequences. Many of the cDNA sequences or EST (expressed sequence tag) sequences deposited in the public domain databases are derived from a restricted set of tissue types, such as liver, brain and foetal tissue. The cloning of in-house cDNA libraries which are focused to specific cellular events, such as ROS-mediated apoptosis offers the possibility to identify, clone and characterise novel genes which are associated with this process.
  • Arrays of nucleic acids may be prepared by direct chemical synthesis of nucleic acid molecules. Chemical synthesis involves the synthesis of arrays of nucleic acids on a surface in a manner that places each distinct nucleic acid (e.g., unique nucleic acid sequence) at a discrete, predefined location in the array. The identity of each nucleic acid is determined by its spatial location in the array. These methods may be adapted from those described in U.S. Patent No. 5,143,854; WO90/15070 and WO92/10092; Fodor etal. (1991) Science, 251: 767; Dower and Fodor (1991) Ann. Rep. Med. Chem., 26: 271.
  • arrays of nucleic acids may be prepared by gridding of nucleic acid molecules.
  • Oligonucleotides may be advantageously arrayed by robotic picking, since robotic techniques allow the most precise and condensed gridding of nucleic acid molecules; however, any technique, including manual techniques, which is suitable for locating molecules at discrete locations on a support, may be used.
  • the gridding may be regular, such that each colony is at a given distance from the next, or random. If molecules are spaced randomly, their density can be adjusted to statistically reduce or eliminate the probability of overlapping on the chosen support.
  • Apparatus for producing nucleic acid microarrays is available commercially, for example from Genetix and Genetic Microsystems. Moreover, pre-prepared arrays of nucleic acid molecules are available commercially, for example from Incyte Genomics Inc. (Human LifeGrid (TM) ). Such arrays will comprise expressed sequence tags (ESTs) representative of most or all the genes expressed in a cell or organism, thus providing a platform for the screening of mRNA populations from multiple ROS-treated cells.
  • ESTs expressed sequence tags
  • Samples for mRNA population analysis may be isolated and purified by any suitable mRNA production method; for example an RNA isolation kit is available from Stratagene.
  • arrays of antibodies may be used as a basis for screening populations of polypeptides derived from cells. Examples of protein and antibody arrays are given in Proteomics: A Trends Guide, Elsevier Science Ltd., July 2000 which is inco ⁇ orated by reference.
  • 2D PAGE typically involves sample preparation, electrophoresis in a first dimension on an immobilised pH gradient, SDS-PAGE electrophoresis in a second dimension, and sample detection. Protocols for 2D PAGE are widely available in the art, for example at http://www.expasv.ch /ch2d/protocols/. the contents of which as of 30.11.2001 are inco ⁇ orated herein by reference. Samples for 2D PAGE may be prepared by conventional techniques.
  • HeLa cells transfected with TGNP are grown in a suitable medium, such as RPMI 1640 containing 10% foetal calf serum (FCS).
  • a suitable medium such as RPMI 1640 containing 10% foetal calf serum (FCS).
  • FCS foetal calf serum
  • the suspension is transferred into a tube and the cells are centrifuged at 1000 g for 5 minutes. Supernatant is discarded and the cells are washed with RPMI 1640 without FCS.
  • 0.8 x 10 6 cells are mixed and solubilised with 60 ⁇ l of a solution containing urea (8 M), CHAPS (4% w/v), Tris (40 mM), DTE (65 mM) and a trace of bromophenol blue.
  • the whole final diluted HeLa sample is loaded on the first dimensional separation.
  • the method of the present invention advantageously employs a step of establishing a reference expression level for the gene products being investigated. This can be carried out by using un-transfected HeLa cells to serve as a standard for one or more subsequent assays; or it may be an integral part of every assay. For example mRNA or polypeptide populations from HeLa transfected and untransfected cells may be assessed simultaneously on a nucleic acid array or by 2D PAGE, and changes in expression patterns identified by direct comparison.
  • primers may be selected using the Primer Design facility of the GeneTool Lite software (Biotools Inc.), which have minimal internal stability and annealing temperatures of 60°C.
  • PCR templates are prepared using genomic DNA purified from HL60 cells, isolated using the Qiagen 'Blood and cell culture DNA mini Kit', (Cat. 13323), as per manufacturers instructions. PCR amplifications are performed using lOOng of genomic DNA as template. Amplimers are gel purified using the Qiaquick gel isolation kit (Qiagen, cat. 28706) and ligated to pCDNA3.1 using the Topo-TA cloning kit (Invitrogen, cat. 45-0005) according to the manufacturers instructions. Ligated DNA is transformed to E.coli (ToplO). Transformants are selected for plasmid DNA preparation and sequence analysis.
  • Plasmid DNA is prepared using either the Qiagen miniprep (cat. 27106) or midiprep (cat. 12643) kits as described by the manufacturer. Insert orientation is determined by PCR with TGNP-specific reverse primer and vector-specific forward primer (T7 primer). Plasmid miniprep DNA (100 ng to 5 ⁇ g) is sent to MWG Biotech or Lark Technologies for contract sequencing.
  • TGNP promoter The function and context of several of the transcription factors and enhancers for which binding sites have been identified in the TGNP promoter are associated with growth factor signalling, haematopoietic cell differentiation (especially granulocyte lineages), cell survival and also redox regulation, as described:
  • the C/EBP SV40 enhancer binding site represents the recognition sequence for a liver-specfic transcription factor implicated in the coordinated and tissue-specific transcriptional regulation.
  • This DNA-binding protein also binds to TTR, alpha 1-AT, and albumin regulatory sites (Costa et al (1988) Proc Natl Acad Sci U S A 85: 3840- 3844).
  • the MEF2 genes are members of the MADS gene family (named for the yeast mating type-specific transcription factor MCM1, the plant homeotic genes 'agamous' and 'deficiens') and the human serum response factor a family that also includes several homeotic genes and other transcription factors, all of which share a conserved DNA- binding domain. They have been associated with cellular differentiation (muscle; Yu et al. Genes Dev. 6: 1783-1798, 1992), growth factor-induction (Pollock and Treisman Genes Dev. 5: 2327-2341, 1991.). MEF2 are also induced via the p38 MAP kinase cascade, in neurons where they are critical for survival (Mao et al.
  • GATA-1 is a haematopoetic transcription factor.
  • GATA1 and friend of GATA1 are each essential for erythroid and megakaryocyte development.
  • FOG a zinc finger protein, interacts with the amino (N) finger of GAT A 1 and cooperates with GATA1 to promote differentiation.
  • C/EBPs and specific Ets family members are important for eosinophil lineage determination (McNagny KM et al. EMBO J 1998 Jul l;17(13):3669-80).
  • GATA-1 and C/EBPbeta synergistically transactivate the promoter of an eosinophil-specific granule protein gene and FOG may act as a negative cofactor for the eosinophil lineage (Yamaguchi Y et al. Blood 1999 Aug 15;94(4):1429-39).
  • FOG is a repressor of the eosinophil lineage
  • C/EBP-mediated down-regulation of FOG is a critical step in eosinophil lineage commitment.
  • Maintenance of a multipotent state in hematopoiesis is achieved through cooperation between FOG and GATA-1 (Querfurth E et al. Genes Dev 2000 Oct l;14(19):2515-25).
  • the well-known Rel/NF-kappaB family of vertebrate transcription factors comprises a number of structurally related, interacting proteins that bind DNA as dimers and whose activity is regulated by subcellular location. This family includes many members (p50, p52, RelA, RelB and c-Rel), most of which can form DNA-binding homo- or hetero- dimers. All Rel proteins contain a highly conserved domain of approximately 300 amino-acids, called the Rel homology domain (RH), which contains sequences necessary for the formation of dimers, nuclear localization, DNA binding and IkappaB binding.
  • RH Rel homology domain
  • NF-kappa B nuclear factor-kappa B
  • AP-1 activator protein- 1
  • GSH ubiquitous tripeptide thiol
  • the promoter regions of the human gamma-GCS subunits contain AP-1, NF -kappa B, and antioxidant response elements and are regulated by oxidants, growth factors, inflammatory cytokine tumor necrosis factor-alpha (TNF-alpha), and anti-inflammatory agent (dexamethasone). Fine tuning between the redox GSH levels and the activation of transcription factors may determine the balance of transcription for proinflammatory and antioxidant gamma- GCS genes in inflammation (Rahman IBiochem Pharmacol 2000 Oct 15;60(8):1041- 9).
  • AP-2 transcription factors represent a family of three closely related and evolutionarily conserved sequence-specific DNA-binding proteins, AP-2alpha, -beta and -gamma.
  • AP-2 proteins play a critical role in cell growth, differentiation and programmed death, where mutations or changes in precisely programmed expression patterns are likely to contribute to congenital malformations or neoplastic diseases (Hilger-Eversheim et al (2000) Gene 260(1-2):1-12).
  • thioredoxin is a potent stimulator of AP-2 DNA binding, probably through the oxidation state of conserved cysteine residues in the AP-2 DNA binding domain (Huang et al (1998) Biochem Biophys Res Commun 249(2):307-12).
  • the Sp/KLF family is comprised of at least twenty members which include Spl -4 and numerous kruppel-like factors. Members of this family bind with varying affinities to sequences designated as 'Spl sites' (e.g., GC-boxes, CACCC-boxes, and basic transcription elements). Family members have different transcriptional properties and can modulate each other's activity by a variety of mechanisms. Since cells can express multiple family members, Sp/KLF factors are likely to make up a transcriptional network through which gene expression can be fine-tuned. 'Spl site'-dependent transcription can be growth-regulated, and the activity, expression, and/or post- translational modification of multiple family members is altered with cell growth.
  • 'Spl site'-dependent transcription can be growth-regulated, and the activity, expression, and/or post- translational modification of multiple family members is altered with cell growth.
  • Sp/KLF factors are involved in many growth-related signal transduction pathways and their overexpression can have positive or negative effects on proliferation.
  • Sp/KLF factors have been implicated in apoptosis and angiogenesis; thus, the family is involved in several aspects of tumorigenesis (Black et al, (2001) J. Cell Physiol. 188(2): 143-60; Philipsen et al (1999) Nucleic Acids Res. 27(15):2991 -3000).
  • TGNP promoter sequence or a promoter sequence from a gene whose transcription is controlled by TGNP can be detected using a nucleic acid construct comprising the TGNP promoter sequence operably linked to a reporter gene.
  • a reporter gene is a gene which is inco ⁇ orated into an expression vector and placed under the same controls as a gene of interest to express an easily measurable phenotype.
  • suitable reporter genes are known whose expression may be detectable by histochemical staining, liquid scintillation, spectrophotometry or luminometry.
  • reporter systems have been adapted for a broad range of assays, including colorimetric, fluorescent, bioluminescent, chemiluminescent, ELISA, and/or in situ staining. Suitable reporter systems are based on the expression of enzymes such as chloramphenicol acetyltransferase (CAT), b-galatosidase (b-gal), b-glucuronidase, alkaline phosphatase and luciferase. More recently, a number of reporter systems have been developed which are based on using Green fluorescent proteins (GFP) or various derivatives or mutant forms including EGFP. Reporter genes and detection systems are reviewed by Sussman in The Principle 15[15]:25, Jul. 23, 2001 which is inco ⁇ orated by reference.
  • GFP Green fluorescent proteins
  • GM-CSF is used to activate transcription from the TGNP promoter but other known or test compounds could be used.
  • Primers to amplify the promoter region are selected, using the Primer Designer facility of the GeneTool Lite software (Biotools Inc), which have minimal internal stability and annealing temperatures of 60°C.
  • a PCR reaction is carried out to amplify the promoter sequence from genomic DNA.
  • Amplimers are gel purified using the Qiaquick gel isolation kit (Qiagen, cat. 28706) and ligated to pCDNA3.1 using the Topo-TA cloning kit (Invitrogen, cat. 45-0005) according to the manufacturers instructions.
  • Ligated DNA is transformed to E.coli (ToplO). Transformants are selected for plasmid DNA preparation and sequence analysis.
  • Plasmid DNA is prepared using either the Qiagen miniprep (cat. 27106) or midiprep (cat. 12643) kits as described by the manufacturer. Insert orientation is determined by PCR with TGNP-specific reverse primer and vector-specific forward primer (T7 primer). Plasmid miniprep DNA (100 ng to 5 ⁇ g) is sent to MWG Biotech or Lark Technologies for contract sequencing.
  • U937 cells are transfected with lO ⁇ g of an EGFP reporter construct (pEGFP, Clontech), containing a genomic fragment driving the expression of the EGFP gene (TGNP -EGFP).
  • the fragment includes the putative TGNP promoter region.
  • Cells are transfected by the calcium phosphate method. Transfection of the pEGFP vector without the TGNP genomic fragment is used as a negative control whereas a construct containing the CMV promoter serves as a positive control.
  • U937 cells containing either pEGFP or TGNP-EGFP are treated with GM-CSF (50 Units) either in the presence or absence of gliotoxin (0.1 ⁇ g/ml).
  • GM-CSF 50 Units
  • gliotoxin 0.1 ⁇ g/ml
  • flow cytometric analysis using a FacsCalibre (Becton Dickinson).
  • Cells are considered positive for EGFP expression when the FL1 signal is greater than the background signal generated by either pEGFP or untreated TGNP-EGFP. All values are corrected for transfection efficiency by standardization against ⁇ -gal activity, derived from the cofransfected plasmid pSV ⁇ -gal (Promega).
  • DoubleTwist (www.doubletwist.com) tools were used to analyse the target sequences retrieved from Genbank.
  • the DoubleTwist suite inco ⁇ orates a number of research agents to generate computational analysis outputs using algorithms that search multiple gene, protein, and patent databases for information about query sequences. These tools access the DoubleTwist annotated databases and all published information about the query sequences. For the pmpose of this study the following agents were used: Perform Comprehensive Sequence Analysis; Retrieve Assembled ESTs; Retrieve and Analyse Human Genome.
  • the Comprehensive Sequence Analysis agent uses the BLAST2N, BLAST2X, TBLAST2N, and BLAST2P algorithms to search the following databases: SwissProt; NR-Nuc; NR-Pro; dbEST; PDB; PAT; PATaa; HTG; Genbank's cumulative nightly nucleotide and protein database updates; and Myriad Genetics ProNet database. Additionally the Blimps and Blkprob algorithms are used to search the Blocks+ database. This agent provides information about functional protein identities and similarities, DNA identities and similarities, patented sequences, protein domains, structural identities and similarities, and genomic DNA identities and similarities.
  • the Assembled ESTs agent (Human) identifies matching EST clusters derived from the DoubleTwist Gene Indices.
  • the Gene Indices are collections of assembled EST and mRNA sequences derived by, screening out non-informative sequences (such as vector and ribosomal sequences), clustering the remaimng sequences, first by matching pairs for overlapping bases, then by sub-dividing into gene variants (subclusters); aligning the sequences in each cluster, and deriving a consensus sequence for each cluster and subcluster.
  • the sequence collection is therefore checked and statistically corrected for many sequencing and cloning errors such as orientation, chimerism, and contamination.
  • DoubleTwist' s interactive data-mining tool Cluster Viewer was used to visualise the alignments.
  • the "Analyse Human Genome” agent also uses a proprietary DoubleTwist genome database derived from public data. Genomic sequences that are at least 15 kilobases in length are obtained from Genbank's Genomic Sequences Primate (GB PRI) division. Unfinished human genomic sequences are obtained from Genbank's High Throughput Genomic (HTG) Sequences division. The data is annotated by splitting the HTG sequences phase 0, 1, and 2 into component fragments while maintaining the GB PRI sequences intact.
  • Sequence contamination, from vector, bacterial, yeast or mitochrondrial sequences are masked and the Repeat Masker program (http://repeatmasker.genome.washington.edii/cgi-bin/RM2_req.pl) is used to mask repetitive elements and regions of low complexity.
  • the GrailEXP, FGENESH and Genscan algorithms are then employed to predict coding regions, introns and exons.
  • the Halfwise algorithm is used to match predicted coding regions with models from the Pfa database.
  • the Unigene database and the DoubleTwist Human Gene Index are further searched for DNA similarities using the BLASTN algorithm and the NR Pro database is searched, using BLASTX, for similar proteins.
  • Double Twist Genomic Viewer an interactive data mining and visualization tool was used to examine the output from the Genome Analysis agent.
  • Example 1 Gene expression and cluster analysis of neutrophil apoptosis and survival; TGNP is identified by associa ⁇ on, as a modulator of apoptosis and cell survival
  • the pellet is resuspended in 1 ml cell culture tested water (Sigma) for 40 sec, followed by the addition of 14ml Hanks buffer (Sigma) and centrifuged (300g, 10 min.). This lysis step is repeated to ensure removal of all erythrocytes.
  • the remaining pellet is resuspended in RPMI 1640 supplemented with 10% foetal calf serum (Sigma), L-glutamine (2mM), penicillin (100 U/ml; Sigma), streptomycin (100 ⁇ g/ml; Sigma) and amphotericin B (2.5 ⁇ g/ml; Sigma). Cell number and viability is checked using trypan blue exclusion (Boyum, (1968) ScandJClin Lab Invest Suppl; 97:77-89).
  • Isolated neutrophils are maintained at a density of 2 xlO 6 / ml in RPMI 1640 supplemented with 10% foetal calf serum (Sigma). Further additions to the medium included L-glutamine (2mM), penicillin (100 U/ml), streptomycin (100 ⁇ g/ml) and amphotericin B (2.5 ⁇ g/ml) (Sigma). Cells are incubated at 37°C in a humidified CO 2 (5%) incubator. As described in by Haslett (Clinical Science 83, pp 639-648, 1992), WO 01/46469 and WO 02/04657, upon culture in a serum-containing cell culture medium these neutrophils undergo spontaneous apoptosis. Dose responsiveness of the anti-apoptotic effect of GM-CSF.
  • neutrophils are resuspended in serum containing culture medium containing 5 U/ml of GM-CSF.
  • This inhibitor allows us to focus in on the specific biochemical events mediating the GM-CSF survival events. In turn one is able to remove some of the noise associated GM-CSF treatment.
  • Neutrophils are isolated and purified from peripheral blood of normal healthy individuals. Neutrophils are resuspended in serum containing culture medium containing 5 U/ml of GM-CSF at a concentration of 2xl0 6 /ml. Also added to the culture mix is either 0.1 ⁇ g/ml of the fungal metabolite Gliotoxin or its inactive analogue bis -Dethio -bis (Methylthio) Methyl Gliotoxin, with lOO ⁇ l/well plated into a 96 well plate and culture at 37°C commenced.
  • FIG. 2 demonstrates that gliotoxin effectively blocks the GM-CSF inhibition of neutrophil apoptosis. This blocking effect is not seen when the inactive analogue of gliotoxin, methylgliotoxin is added with GM-CSF. No increased neutrophil apoptosis is seen with the addition of gliotoxin alone to isolated neutrophils demonstrating that the effect is specific to and limited to a reversal of the protective effects of GM-CSF.
  • microarrays are used to measure global gene expression associated with neutrophil apoptosis, GM-CSF inhibition of neutrophil apoptosis, and the inhibition of this effect using the fungal metabolite Gliotoxin.
  • an inactive analogue of Gliotoxin Methyl Gliotoxin is used. Analysis of such microarray results identifies genes whose expression pattern changes (either up-regulation or down- regulation) in an association with a measurable apoptotic phenotype.
  • RNAzol B acid phenol/guanidine isothiocyanate extraction
  • RNeasy RNA preparation kits Qiagen. Any contaminating genomic DNA is removed by DNase treatment (DNase I, Gibco-BRL).
  • RNA is also prepared from neutrophil cells following treatment (for the time indicated in hours) with GM-CSF (50units/ml), Gliotoxin (lO ⁇ M) or MethylGliotoxin (lO ⁇ M). RNA is also prepared from neutrophils that have not been exposed to d g (i.e. as an untreated control). RNA is prepared from these cells using two sequential extractions with RNAzol B.
  • microarraying can be used to profile gene expression of thousands of genes simultaneously.
  • the microarray process is described both for the use of Human LifeGridTMmicroarray filters and can be separated into three parts: the filter, the hybridisation of radiolabelled cDNA probe, and the detection and quantitation of the microarray results.
  • the microarray filter is the microarray filter
  • This example describes the use of the Human LifeGridTMmicroarray filters obtained from Incyte Genomics (USA). These filters contain cDNA probes representing approximately 8,400 human mRNAs.
  • This example describes the synthesis of a radiolabelled cDNA from total cellular mRNA.
  • the labeled cDNA is used to 'probe' DNA fragments, which have been immobilised on to a filter membrane, by complementary hybridisation.
  • RNA is reverse transcribed to first strand cDNA in a reaction containing M-MLV reverse transcriptase (RT; alternatively Superscript II is used (Life Sciences)), RT buffer, dNTPs and [ ⁇ - 33 P] dCTP (2000- 4000 Ci/mmol) at 42°C for 1 to 5hours. Uninco ⁇ orated nucleotides are removed using spin-columns and the labeled probe stored at -80°C until required.
  • RT M-MLV reverse transcriptase
  • Labeled probes may also be generated from cDNA, genomic DNA or PCR products.
  • a random primed labeling procedure can be used, for example the Ready- Prime Labeling kit (APBiotech), applied as per manufacturers instructions.
  • Radiolabelled cDNA probe is hybridised to DNA fragments immobilised onto a membrane (typically a nylon or nitrocellulase filter).
  • membrane filters are pre-hybridised in hybridisation buffer (5 to 20 ml) at 42°C for 2 to 16 h using a hybridisation oven (Hybaid). Following pre-hybridisation, the labeled cDNA probe is added to fresh hybridisation buffer (5 to 20 ml) and hybridised at 42°C for 14 to 16 h. Following hybridisation, the hybridisation mix is removed and the filters washed with 2 x SSC buffer at RT for 5 min., twice with 2 x SSC, 1% SDS buffer at 68°C for 30 min. and twice with 0.6 x SSC, 1% SDS buffer at 68°C for 30 min.
  • Hybridised filters are wrapped in plastic wrap (Saran) and exposed to a Low-Energy Phosphoimaging screen (Molecular Dynamics). The screen is then placed on the phosphoimager and the gel image captured by scanning at a resolution of 50 microns (See Figure 3).
  • the captured image file is then analysed using software such as Array Vision (Imaging Research Inc.; See Figure 4).
  • ArrayVision Imaging Research Inc.; See Figure 4
  • This program contains facilities for spot detection and quantification, and background detection and quantification.
  • This data is then exported to a text file for further analysis.
  • a variety of data fields are exported from the ArrayVision analysis, including; Spot Label, Position, Density, Background, and particularly, Background subtracted density (sDens) and signal/noise ratio (S/N).
  • the exported text file is up-loaded to an SQL-7.0 database, to populate a table containing array data from all experiments. As the data is imported to the database, a Normalisation factor is calculated and the sDENs values modified accordingly.
  • This Normalised data is stored in a newly created column within the table.
  • the Normalisation factor facilitates accurate comparison between datasets.
  • a number of different calculations may be used.
  • a normalization factor may be derived from Linear Regression calculated by reference to housekeeping genes.
  • the Global Mean is calculated as the average of the sDens values across all of the arrays to be compared and a normalisation factor is then derived by division of the overall spot density with the Global Mean value. Spot density values (individual sDens) are then corrected by multiplying across all values with the normalisation factor.
  • a Global Geometric Mean normalization factor may be calculated and used to adjust the dataset.
  • the data from multiple hybridisation experiments can then be stored in a suitable format, for example in an Access or SQL 7.0 database.
  • Comparison between arrays generates an output file containing the gene identifier and the fold-change in expression relative to the reference dataset.
  • Fold change, (Tx vs Ty) is calculated by dividing the normalised spot density values of Tx with Ty.
  • multiple time-course experiments are prepared and fold-change values calculated with reference to the TO time point.
  • the fold change data derived from comparison of multiple hybridisation experiments can be analysed using a variety of approaches, including hierarchical clustering, (supervised or unsupervised), k-means clustering or self-organising maps.
  • Software enabling these analyses includes the Cluster and Treeview software (M.Eisen, Stanford Uni, USA), J-Express (European Bioinformatics Institute), GeneMaths (Applied Maths, Belgium) or GeneSpring (Silicon Genetics, USA).
  • Hierarchical clustering is implemented using the GeneMaths software. Trees are generated using the WARD algorithm with distance calculated using the Pearson similarity metric. Alternatively Euclidean distance metrics are used.
  • fold-change data can be difficult to inte ⁇ ret owing to either a very large dataset and/or a wide range in fold change values.
  • the visualization and inte ⁇ retation of these datasets may be simplified using codes or combined codes.
  • each unique gene is represented by at least two identical cDNAs on the array.
  • the fold change value is calculated as described, then for each spot, a value above 5-fold change is accorded a code of 2, a fold-change value of less then 5 but greater then 2 is accorded a code of 1 and a fold-change value of less then 2 is accorded a code value of 0.
  • a combined code is then derived by adding the code values for each identical cDNA on the array.
  • the use of combined codes can greatly simplify the Cluster analysis and the subsequent visualisation (See Figure 5). Comparison of coordinate patterns of gene expression, by bioinformatic data analysis, using this model system, allows the identification of cell pathways and processes associated with apoptosis and survival.
  • 'differentially regulated' genes are identified and clustered by either normalised sDens (level of expression) or by fold chance values.
  • Candidate genes, associated with apoptosis and survival are those that are reproducibly differentially regulated in multiple experiments or time courses and are additionally 'reciprocally regulated' in conditions that permit apoptosis versus survival, respectively.
  • Figure 6 shows the visual representation of a clustered selection of candidate neutrophil apoptosis/survival-associated genes identified of LifeGrid filters. Each row represents the differential regulation of an individual gene. The Fold Change colour scale is shown.
  • Apop neutrophil apoptosis time course experiments are represented (Apop), with RNA samples isolated at 2 h (Apop2), 3 h (Apop3), 4 h (Apop4), 5 h (Apop5) and 6 h (Apop6) post-isolation of neutrophils. Fold change values are expressed relative to zero hour control samples.
  • GM-CSF Three representative GM-CSF time course experiments are represented (GM-CSF), with RNA samples isolated at 2 h (GMCSF2), 4 h (GMCSF4) and 6 h (GMCSF6) post-treatment with GM-CSF. Fold change values are expressed relative to zero hour control samples. Blockage of GM-CSF-mediated inhibition of neutrophil apoptosis by treatment with Gliotoxin
  • GMCSF is added in the presence of Gliotoxin (Glio) or an inactive analogue Methyl Gliotoxin (Methyl), with RNA samples isolated at 2 h (Glio2 and Methyl2), 4 h (Glio4 and MethyW) and 6 h (Glio6 and Methyl ⁇ ) post-treatment with GM-CSF. Fold change values are expressed relative to zero hour control samples. In the remaining two experiments (GM 4) RNA samples are isolated at 4 h post-treatment with GM-CSF, and fold change values are expressed relative to Methyl Gliotoxin control samples.
  • RNA sample profiled by microarray, represents the pool of multiple experiments carried out on neutrophils isolated from individual human donors.
  • the number of donor samples used for each experiment/time course is summarised in Table 1.
  • Average fold change values are clustered with GeneMaths, using a Pearson correlation and Ward clustering algorithm.
  • Candidate genes represented in this selection share similar overall expression characteristics, that of an 'apoptosis/survival cluster'.
  • Candidate genes tend to be down-regulated (dark) in multiple experiments and time courses for apoptosis (Apop, GM and Glio; see legend) and up-regulated (light) in experiments and time courses for survival (Methyl and GMCSF; see legend).
  • TGNP One of the differentially expressed genes associated with apoptosis and survival is identified as TGNP.
  • Example 2 TGNP mRNA is increased in GM-CSF-induced neutrophil survival, and this increased expression is blocked by Gliotoxin
  • Figure 7 shows the relative amounts of TGNP transcripts isolated from neutrophils treated according to Example 1. Experimental conditions and cluster analysis of average fold change comparisons are as described in Example 1.
  • TGNP is up-regulated in multiple experiments between 2 and 6 h following addition of GM-CSF. Up-regulated genes may represent potential survival factor genes, which block or delay the apoptosis in neutrophils. Increased expression of TGNP, following GM-CSF treatment, is blocked by the fungal inhibitor gliotoxin (Glio and GM; see legend).
  • Figure 8 shows a dendrogram representation of the association of candidate genes from the cluster analysis illustrated in Figure 1 (performed using the method detailed in Example 1) of TGNP expression compared to other known genes that have a similar pattern of gene expression across multiple experiments.
  • these are cytochrome c oxidase subunit Vllb (2060789), BH3 interacting domain death agonist (2782033), BCL2-related protein Al (2555673), CD53 antigen (3003048), interleukin 1 receptor antagonist (519653), ATP-binding cassette, sub-family B (MDR/TAP), member (2887130), GRO3 oncogene (617159) and nerve growth factor, beta polypeptide (2887215). All of these genes are known to be involved in apoptosis and survival.
  • cytochrome c oxidase, CD53 and interleukin 1 receptor antagonist are also associated with Redox regulation.
  • Cytochrome c oxidase (COX), the terminal component of the respiratory chain complex of most aerobic organisms, is composed of 13 subunits in mammals. Mitochondrial release of cytochrome c is one of the principle stepps initiating the execution of apoptosis. Mitochondrial antisense RNA for cytochrome C oxidase can induce mo ⁇ hologic changes and cell death in human hematopoietic cell lines (Blood 1997 Dec l;90(l l):4567-77). Apoptosis and ROS detoxification enzymes correlate with cytochrome c oxidase deficiency in mitochondrial encephalomyopathies (Mol Cell Neurosci 2001 Apr; 17(4):696-705).
  • BID BH3 interacting domain death agonist
  • BCL2 -related protein Al otherwise known as Bfl-1 was first isolated by Lin et al. (1993) as a novel mouse cDNA sequence, designated BCL2 -related protein Al (Bcl2al) and was identified as a member of the Bcl-2 family of apoptosis regulators by the predicted protein sequence.
  • Bcl2al BCL2 -related protein Al
  • An anti-apoptotic role of Bfl-1 is described in staurosporine-treated B-lymphoblastic cells (Int J Hematol 2000 Dec;72(4):484-90).
  • CD53 is an N-glycosylated pan-leukocyte antigen of 35,000 to 42,000 MW.
  • CD53 Increased expression of CD53 has been described on apoptotic human neutrophils (J Leukoc Biol 2000 Mar;67(3):369-73). Voehringer DW et al, described CD53 associated with resistance to ionising radiation, using microarray experiments. Expression of CD53 can lead to the increase of total cellular glutathione, which is the principle intracellular antioxidant and has been shown to inhibit many forms of apoptosis (Proc Natl Acad Sci U S A 2000 Mar 14;97(6):2680-5).
  • the Inter Leukin 1 receptor antagonist (IL1RN) is a protein that binds to IL1 receptors and inhibits the binding of IL1 -alpha and ILl-beta.
  • IL1RN Inter Leukin 1 receptor antagonist
  • Overexpression of interleukin- 1 receptor antagonist provides cardioprotection against ischemia-reperfusion injury associated with reduction in apoptosis (Circulation 2001 Sep 18;104(12 Suppl 1):I308- 13). Hypoxia induces the expression and release of interleukin 1 receptor antagonist in mitogen-activated mononuclear cells (Cytokine 2001 Mar 21;13(6):334-41).
  • IL-lra gene up-regulates interleukin- 1 beta converting enzyme (ICE) gene expression: possible mechanism underlying IL-1 beta-resistance of cancer cells (Br J Cancer 1999 Sep;81(2):277-86).
  • ICE interleukin- 1 beta converting enzyme
  • MDR/TAP ATP-binding cassette, sub-family B
  • MDRl multiple dmg resistance
  • Increased expression and amplification of MDRl sequences were also found in multidrug-resistant sublines of human leukemia and ovarian carcinoma cells.
  • Overexpression of MDRl appears to be a consistent feature of mammalian cells displaying resistance to multiple anticancer drugs and has been postulated to mediate resistance.
  • GRO3 oncogene The GRO gene, a CXC chemokine otherwise known as macrophage inflammatory protein 1 beta (MIP-1B), was initially identified by Anisowicz et al. (1987) by its constitutive overexpression in spontaneously transformed Chinese hamster fibroblasts. Neutrophils have been shown regulate their own apoptosis via preservation of CXC receptors. Gro-alpha and IL-8 (CXC chemokines) suppress neutrophil apoptosis (Neu J Surg Res 2000 May l;90(l):32-8). Nerve growth factor, beta polypeptide: Nerve growth factor is a well-characterised cytokine survival factor.
  • MIP-1B macrophage inflammatory protein 1 beta
  • NGF withdrawal induces apoptosis in a range of cells in-vitro and in-vivo.
  • Nerve growth factor suppresses apoptosis of murine neutrophils (Biochem Biophys Res Commun 1992 Jul 31;186(2): 1050-6).
  • TGNP gene expression across multiple reciprocal experiments, with a significant number of known apoptosis and survival genes identifies a function for TGNP in neutrophil and cellular apoptosis and survival.
  • Example 4 TGNP network protein is adjacently correlated with known regulators of protein trafficking.
  • Figure 9 represents a small sub cluster (graphical representation and dendrogram) of very closely related gene expression patterns across a range of reciprocal neutrophil apoptosis and survival experiments, that TGNP network protein is closely associated with proteins that are known regulators of protein trafficking.
  • the cluster analysis was performed, for averaged normalized sDens (expression level) measurements, across >8,000 genes present on the Incyte LifeGrid filter, using Pearson correlation and Ward cluster algorithms. All details are as for Example 1.
  • Cofilin 2 Ubiquitous among eukaryotes, the cofilins are essential proteins responsible for the high turnover rates of actin filaments in vivo.. Both bind to F-actin cooperatively and induce a twist in the actin filament that results in the loss of the phalloidin-binding site. This conformational change may be responsible for the enhancement of the off rate of subunits at the minus end of cofilin-decorated filaments and for the weak filament-severing activity. They are usually concentrated in regions containing dynamic actin pools. Actin filament integrity has been shown to be required for the normal positioning and mo ⁇ hology of the golgi complex (Eur. J. Cell Biol(1998) 76 9-17).
  • Cofilin has an nuclear localization signal sequence and translocates into the nucleus together with actin in response to various stresses (Cell Struct Funct. 1996; 21(5):421-4.). Cofilins are essential for cytokinesis, phagocytosis, fluid phase endocytosis, and other cellular processes dependent upon actin dynamics (Annu Rev Cell Dev Biol 1999;15:185-230).
  • Phospholiase A2 group IVA (cytosolic): Lipids have been implicated in the regulation of membrane-protein trafficking, vesicular fusion, and targeting. Cytosolic Phospholipase A2 is known to be a key regulator if arachidonic acid release in cells. It has also been shown that cPLA(2) plays an important role in determining Golgi architecture and selective control of constitutive membrane-protein trafficking in renal epithelial cells (J Clin Invest 2000 Oct;106(8):983-93).
  • Example 5 TGNP network protein is adjacently correlated with Transcriptional Regulation
  • TGNP is expressed as multiple slice varient mRNAs.
  • Kain et al. (1998) identified two TGN46 cDNAs that are produced by alternative usage of 3 -prime splice sites in intron 3.
  • the alternatively spliced cDNAs encode the TGN48 and TGN51 isoforms, which have longer C-terminal tails (J. Biol. Chem. (1998) 273: 981-988, 1998). It has been suggested that alternative splice forms of TGNP play a role in the selection of the cargo molecules for vesicles arising from the Trans Golgi Network (Ewr. J Cell Biol (2000) 79 790-794).
  • snRNA small nuclear RNA
  • Figure 9 represents a small sub cluster (graphical representation and dendrogram) of very closely related gene expression patterns across a range of reciprocal neutrophil apoptosis and survival experiments, that TGNP network protein is closely associated with several proteins which are known regulators of RNA splicing. TGNP is also associated with the expression of transcription factor genes.
  • the cluster analysis was performed, for averaged normalized sDens (expression level) measurements, across >8,000 genes present on the Incyte LifeGrid filter, using Pearson correlation and Ward cluster algorithms. All details are as for example 1.
  • Glioma amplified sequence 41 Sequence comparison indicated high similarity between the GAS41 protein, the yeast and human AF9 and human ⁇ NL Fischer et al. (1997) noted that both AF9 and ⁇ NL belong to a new class of transcription factors, indicating that GAS41 may also represent a transcription factor (Hum. Molec. Genet. 1997 6: 1817-1822;.
  • SNAPc is composed of at least four polypeptides of 43, 45, 50 and 190 kDa, as well as variable amounts of the TATA box binding protein, TBP (EMBO J 1996 Dec 16;15(24):7129- 36).
  • Dual specificity phosphatases 11 (RNA RNP complex- 1 interacting): Protein tyrosine phosphatases, in conjunction with protein tyrosine kinases, regulate the levels of protein tyrosine phosphorylation important for cell growth, differentiation, or transformation. Dual-specificity phosphatases, a subfamily of protein tyrosine phosphatases, play important roles in signal transduction, cell cycle regulation, and tumor suppression. A unique feature of this phosphatase is that it binds directly to RNA in vitro with high affinity. In addition, it was found that Dual specificity phosphatases 11 interacted with splicing factors 9G8 and SRp30C, possibly through an RNA intermediate during a yeast two-hybrid screen.
  • Dual specificity phosphatases 11 exhibited a nuclear-staining pattern that was sensitive to RNase A, but not to DNase I, suggesting that Dual specificity phosphatases 11 in the cells are associated with RNA and/or ribonucleoprotein particles. Taken together, this data suggest that Dual specificity phosphatases 11 is a novel phosphatase that may participate in nuclear mRNA metabolism including RNA splicing (J Biol Chem 1998 Aug 7;273(32):20347-53).
  • rap6 GTPase activating protein (GAP and centrosome associated) associates with three protein CDC like kinase 3 and more distantly with splicing factor arginine/ serine -rich 11 and general transcripton factor IIF, polypeptide 2 (30kD subunit), all three of which are associated with RNA splicing, thus reinforcing a relationship between Trans Golgi Network Proteins and RNA splicing.
  • GAP and centrosome associated associates with three protein CDC like kinase 3 and more distantly with splicing factor arginine/ serine -rich 11 and general transcripton factor IIF, polypeptide 2 (30kD subunit), all three of which are associated with RNA splicing, thus reinforcing a relationship between Trans Golgi Network Proteins and RNA splicing.
  • GTPase activating protein (GAP and centrosome associated): This protein displays a GTPase activating protein (GAP) activity for Rab6 (Rap proteins play an important role in vesicular transport and membrane traffic - see Curr Opin Cell Biol (1997) 496- 504 for review). Most of this protein is found in the cytosolic compartment , but a minor pool was associated with the centrosome. In addition, GTPase activating protein (GAP and centrosome associated) was found in complexes with cytosolic ⁇ - tubulin. Therefore, GTPase activating protein (GAP and centrosome associated) could play a pivotal role in events that coordinate Golgi dynamics and organization of microtubule cytoskeleton (EMBO J (1999) 18(7) 1772-1782).
  • CDC-like kinase 3 The CDC-like kinase 3 (clk3) is part of the Clk family of kinases
  • the three members of the Clk family of kinases (Clkl, 2, and 3) have been shown to undergo conserved alternative splicing to generate catalytically active (Clk) and inactive (ClkT) isoforms. It has been shown that catalytically active hClk2 and hClk3 cause the redistribution of SR proteins and can regulate the alternative splicing of a model precursor mRNA substrate in vivo (Exp Cell Res 1998 Jun 15;241(2):300-8).
  • Splicing factor arginine/ serine -rich 11 Contained within this 54kD nuclear protein is an arginine/ serine -rich region similar to segments of several proteins that participate in pre-mRNA splicing includingthe Ul small nuclear and "suppressor-of- white-apricot proteins. Similarly, immunolocalization data suggest that this protein may have a role in pre-RNA processing (PNAS 1991 15; 88(18) 8189-93).
  • TFIIF RNA polymerase II transcription factor
  • TGNP is associated with the expression of genes involved in Transcriptional regulation, such as RNA splicing.
  • Example 6 Effect of cisplatin treatment on TGNP expression.
  • HeLa cells are obtained from the ATCC (Manassas, Virginia, USA), maintained in DMEM medium with 10% FCS at 37°C in a 5% CO2 atmosphere and treated with cisplatin (1 ⁇ g ml). At the time points indicated RNA samples are isolated and analysed for gene expression changes by microarray using Incyte LifeGrid filters as described previously.
  • TGNP is decreased by cisplatin-induced apoptosis in HeLa cells.
  • Figure 10 shows TGNP gene expression fold change in Cisplatin treated HeLa cells.
  • Example 7 Recombinant expression of TGNP is associated with changes in gene expression, associated with apoptosis and survival
  • This example describes the analysis of oligonucleotide/polynucleotide sequences whose expression changes are associated with expression of TGNP.
  • microarrays are used to measure global gene expression associated with TGNP expression in HeLa cells. Analysis of such microarray results identifies genes whose expression pattern changes (either up-regulation or down-regulation) in a functional association with ectopic expression of TGNP. We demonstrate that the genes identified using this approach include many genes whose products have been associated with apoptosis and survival. This identification further establishes a functional cellular role of TGNP in the modulation of growth and survival.
  • HeLa cells are transiently transfected with pcDNA3.1 containing full-length cDNA for TGNP (46kDa isoform) using the CalPhos Mammalian Transfection Kit (Clontech) according to the manufacturers instructions. HeLa cells are plated in 75cm 2 flasks at a concentration of 1.5xl0 6 cells / flask. The following day, when cells are 70% to 80% confluent cells are transfected and the Cal/Phos soln left on the cells for a further 18 hours at 37°C in a 5% CO 2 humidified incubator. Typically, this transfection procedure yield 60 - 70 % transfection efficiency, as judged by FacsCalibre analysis of control EGFP transfected cells.
  • RNAzol RNAzol
  • lOO ⁇ l of chloroform lOO ⁇ l of chloroform
  • the aqueous layer is removed and the RNA is precipitated following addition of an equal volume of ice-cold isopropanol and centrifugation for 20 mins at 12000g at 4°C.
  • the RNA is further cleaned by addition to an RNeasy minispin column (Qiagen) according to the manufacturers instructions. Any contaminating DNA remaining in the elutant is removed by DNAase treatment of samples.
  • cDNA is hybridised to Human Life GridTM arrays and subjected to quantitative imaging and analysis using a STORM phosphoimager.
  • Example 8 Recombinant expression of TGNP is associated with the modulation of genes with apoptosis.
  • Interleukin 3receptor alpha (low affinity) 6
  • TIP-1 is a 14kD protein that interacts with the human homologue of rhotekin, and that this interaction markedly increase transactivation of the c-Fos Serum Response Element by RhoAN14.
  • T ⁇ Falpha the susceptibility of Tax(+) and Tax(-) murine fibroblasts to apoptosis under conditions of growth factor withdrawal or treatment with T ⁇ Falpha, which trigger apoptosis through different pathways, i.e., mitochondrial and receptor-mediated pathways, respectively.
  • Tax-expressing cells are protected from apoptotic death induced by serum deprivation but are sensitive to TNFalpha-mediated apoptosis, suggesting that Tax expression has different effects on cell death, depending on the apoptotic stimulus used.
  • the 14-3-3 proteins are a part of an emerging family of proteins and protein domains that bind to serine/threonine-phosphorylated residues in a context specific manner, analogous to the Src homology 2 (SH2) and phospho-tyrosine binding (PTB) domains.
  • 14-3-3 proteins bind and regulate key proteins involved in various physiological processes such as intracellular signaling (e.g. Raf, MLK, MEKK, PI-3 kinase, IRS-1), cell cycling (e.g.
  • Cdc25, Weel, CDK2, centrosome Cdc25, Weel, CDK2, centrosome
  • apoptosis e.g. BAD, ASK-1
  • transcription regulation e.g. FKHRL1, DAF-16, p53, TAZ, TLX-2, histone deacetylase
  • SH2 and PTB domains which serve mainly to mediate protein-protein interactions
  • 14-3-3 proteins in many cases alter the function of the target protein, thus allowing them to serve as direct regulators of their targets.
  • Protein regulator of cytokinesis 1 PRCl Jiang et al. (1998) identified a human protein, which they designated 'protein regulating cytokinesis- 1' (PRCl), that is involved in cytokinesis.
  • PRCl is a good substrate for several cyclin-dependent kinases (CDK) in vitro and is phosphorylated in vivo at sites that are phosphorylated by CDK in vitro, strongly suggesting that PRCl is an in vivo CDK substrate.
  • CDK cyclin-dependent kinases
  • PRCl has sequence homology to the budding yeast anaphase spindle elongation factor Asel.
  • Asel PRCl protein levels are high during S and G2/M and drop dramatically after cells exit mitosis and enter GI.
  • PRCl is a nuclear protein in inte ⁇ hase, becomes associated with mitotic spindles in a highly dynamic manner during mitosis, and localizes to the cell midbody during cytokinesis. Microinjection of anti-PRCl antibodies into HeLa cells blocked cellular cleavage, but not nuclear division, indicating a functional role for PRCl in the process of cytokinesis (Mol Cell 1998;2(6):877-85).
  • the gene EP300 is essential for normal cardiac and neural development, whereas CREBBP is essential for neurulation, hematopoietic differentiation, angiogenesis and skeletal and cardiac development.
  • the CBP/p300-interacting transactivator with ED- rich tail 2 (CITED2) binds EP300 and CREBBP with high affinity and regulates gene transcription. It has been shown that CITED2 interacts with and co-activates all isoforms of transcription factor AP-2 (TFAP2)( Nat Genet 2001 Dec;29(4):469-74). Substantial evidence points to a critical role for the p300/CREB binding protein (CBP) coactivators in p53 responses to DNA damage.
  • CBP p300/CREB binding protein
  • p300/CBP and the associated protein P/CAF bind to and acetylate p53 during the DNA damage response, and are needed for full p53 transactivation as well as downstream p53 effects of growth arrest and/or apoptosis.
  • p300/CBP appear to be complex integrators of signals that regulate p53, and biochemically, the multipartite p53/p300/CBP interaction is equally complex.
  • p300/CBP can both positively and negatively regulate p53 transactivation, as well as p53 protein turnover depending on cellular context and environmental stimuli, such as DNA damage (Eur J Biochem 2001 May;268(10):2773-8).
  • Interleukin 3receptor, alpha (low affinity) Interleukin 3 (IL-3) promotes development of hematopoietic cells through activation of the IL-3 receptor (IL-3R) complex consisting of alpha and beta subunits.
  • the alpha subunit binds IL-3 with low affinity and forms a high-affinity receptor with the common beta subunit (beta c).
  • the beta c subunit does not bind any cytokine by itself but is involved in the formation of high-affinity functional receptors for IL-5 and GM-CSF.
  • IL-3 As the alpha subunits provide the specificity to cytokines and beta c plays a major role in signal transduction, IL-3, GM-CSF and IL-5 exhibit similar functions when they act on the same cells.
  • IL3 is a known suppressor of apoptosis haematopoietic cells (EMBO J 1995 Jan 16;14(2):266- 75).
  • Inhibition occurs at the level of polypeptide chain initiation and is accompanied by the phosphorylation of the alpha subunit of initiation factor eIF2 and the caspase-dependent cleavage of initiation factors eIF4G, eIF4B, eIF2alpha and the p35 subunit of eIF3. Proteolytic cleavage of these proteins yields characteristic products which may exert regulatory effects on the translational machinery. Inhibition of caspase activity protects protein synthesis from long-term inhibition in cells treated with some, but not all, inducers of apoptosis (Cell Death Differ 2000 Jul;7(7):603-15).
  • BCL9 is associated with B-cell acute lymphoblastic leukemia. It may be a target of translocation in B-cell malignancies with abnormalities of lq21. Its function is unknown. The overexpression of BCL9 may be of pathogenic significance in B-cell malignancies (Blood. 1998 Mar 15;91(6): 1873-81).
  • ROCK2 is a serine/threonine kinase that regulates cytokinesis, smooth muscle contraction, the formation of actin stress fibers and focal adhesions, and the activation of the c-fos, serum response element.
  • ROCK2 is an isozyme of ROCK1.
  • Increased phosphorylation of myosin light chain (MLC) is necessary for the dynamic membrane blebbing that is observed at the onset of apoptosis.
  • ROCK I an effector of the small GTPase Rho, has recently been identified as a new substrate for caspases.
  • ROCK I is cleaved by caspase-3 at a conserved DETD1113/G sequence and its carboxy-terminal inhibitory domain is removed, resulting in deregulated and constitutive kinase activity.
  • ROCK proteins are known to regulate MLC-phosphorylation, and apoptotic cells exhibit a gradual increase in levels of phosphorylated MLC concomitant with ROCK I cleavage. This phosphorylation, as well as membrane blebbing, is abrogated by inhibition of caspases or ROCK proteins, but both processes are independent of Rho activity.
  • caspase-3 seems to be responsible for bleb formation in apoptotic cells (Nat Cell Biol 2001 3(4): 346-52).
  • Neuropilin 1 Lung cancers are reported to always express the neuropilin- 1 receptor for secreted semaphorins. Semaphorins SEMA3B and its homologue SEMA3F are 3p21.3 candidate tumor suppressor genes (TSGs), the expression of which is frequently lost in lung cancers. HI 299 cells transfected with wild-type but not mutant SEMA3B underwent apoptosis. Similarly, it has been reported that supernatant from SEMA3B tranfected COS-7 cells reduced the growth of several lung cancer lines 30- 90% (Proc Natl Acad Sci U S A 2001 Nov 20;98(24): 13954-9).
  • Phosphodiesterase 3A cGMP-inhibited. It has been shown that this particular phosphodiesterase can loose its cAMP hydrolytic activity in the presence of cGMP (Proc. Nat. Acad. Sci. 89: 3721-3725, 1992.). The loss of this hydrolytic activity it thought to regulate the decision to undergo apoptosis in selective cells (Cell Signal 2000;12(8):541-8).
  • Bcl-2 expression is classically seen as anti-apoptotic.
  • High expression of Bcl-2 and Bcl-XL are commonly found in human cancers and contributes to neoplastic cell expansion and interferes with the therapeutic action of many chemotherapeutic drugs.
  • the functional blockade of Bcl-2 or Bcl-XL could either restore the apoptotic process in tumor cells or sensitize these tumors for chemo- and radiotherapies (Oncogene 2000 Dec 27;19(56):6627-31).
  • TFF3 Human secretory protein
  • TFF3 INTESTINAL TREFOIL FACTOR
  • ITF Trefoil factor 3
  • TFF3- treated IEC-18 cells are resistant to anoikis, an anchorage-related apoptosis in epithelium.
  • the stable expression of a mutant form of the endogenous NF- kappaB inhibitor (IkappaBalpha(mut)) in IEC-18 cells results in a significant attenuation of anti-anoikic effect of TFF3.
  • TFF3 is an endogenous gastrointestinal peptide with anti-anoikic property
  • TFF3 activates NF-kappaB in enterocytes
  • TFF3 -induced resistance to anoikis in intestinal epithelial cells is mediated by a distinct signaling cascade linked to NF- kappaB (Biochem Biophys Res Commun 2000 Aug 11 ;274(3):576-82).
  • Vanin 1 This gene encodes for pantetheinase enzyme which is a ubiquitiously expressed enzyme which in vitro has been shown to recycle pantothenic acid to produce cysteamine, a potent antioxidant. In this context it has been suggested that this gene might be involved in the regulation of immune function in the context of oxidative stress (FEBS Lett 2000483(2-3): 149-54).
  • Calpain, large polypeptide L3 Much of the proteolysis that occurs during apoptosis is directed by caspases, a family of related cysteinyl proteases. A relatively small number of cellular proteins are targeted by caspases, yet their function is dramatically affected and apoptosis is triggered. Other proteases, such as granzymes and calpain, are also involved in the apoptotic signaling process, but in a much more cell type- and or stimulus type-specific manner (Semin Cell Dev Biol 2000 Jun;l 1(3):191-201).
  • gene function associated with proliferation, survival and death can be ascertained by the expression of the recombinant gene (mRNA) in a test (model) system by measurement of impact on cell growth and viability.
  • mRNA recombinant gene
  • HeLa cells are plated into a 24 well tissue culture plate at a concentration of 1.5 xlO 4 /ml. Cells are left to adhere overnight, before transfecting the cells with a pcDNA3.1 plasmid containing the gene of interest (full-length coding mRNA sequence) using a Calcium Phosphate transfection kit (Clontech). Cells are left in the transfection medium for 24h, prior to replacing it with fresh culture medium.
  • transfected cells are treated with G418 (an antibiotic to select for cells containing an integrated copy of the plasmid and gene of interest, by virtue of the plasmid containing and expressing a gene for neomycin resistance) at a concentration of 500 ⁇ g/ ml and culture maintained for a further 7 days or until cells in test or control wells become confluent. Cells are then fixed and stained with Crystal Violet (1% in ethanol) for five minutes. To quantify, cells are solubilized by adding 33% Acetic Acid and the absorbance measured by reading the plate at 570nm using a colorimetric plate reader.
  • G418 an antibiotic to select for cells containing an integrated copy of the plasmid and gene of interest, by virtue of the plasmid containing and expressing a gene for neomycin resistance
  • This assay is validated by a number of control genes, which are known to affect cell growth/survival, including superoxide dismutase (SOD), glutathione peroxidase, p53 and p73.
  • SOD superoxide dismutase
  • glutathione peroxidase glutathione peroxidase
  • p53 p73
  • p73 and p53 are known tumor suppressor genes, which induce cell apoptosis.
  • Figure 11 shows graphical representation of the effect of these known survival and pro-apoptotic genes on the proliferation/viability of HeLa cells, as determined by a plaque assay.
  • Figure 12 shows graphical representation of the effect of TGNP on the proliferation/viability of HeLa cells, as determined by a plaque assay.
  • Expression of recombinant TGNP (46kDa isoform) in HeLa cells resulted in significant inhibition of proliferation/viability, at an equivalent level to that elicited by the tumor suppressor gene p53. These results identify TGNP as a 'modulator of cell growth/survival'.
  • Example 10 Amplification and cloning of coding sequence for TGNP.
  • Primers are selected using the Primer Designer facility of the GeneTool Lite software (Biotools Inc). Primers are selected to have minimal internal stability and annealing temperatures of approximately 60°C.
  • An Nhel restriction site (underlined) is inco ⁇ orated to the 5 'end of the forward primer, to allow for orientation of the insert.
  • a Notl restriction site (underlined) is inco ⁇ orated to the 5 'end of the Reverse primer, to allow for orientation of the insert.
  • Templates for PCRs are prepared by reverse transcription of total RNA isolated from Hela or HL60 cell lines, or Brain and kidney tissue samples (Stratagene). Briefly, total cellular RNA (1 ⁇ g to 20 ⁇ g) or polyA + mRNA (100 ng to 5 mg) is incubated with an oligo (dT) primer. Primed RNA is reverse transcribed to first stand cDNA in a reaction containing M-MLV reverse transcriptase (RT; alternatively Superscript II is used (Life Sciences)), RT buffer, and dNTPs at 42°C for 1 to 2 hours.
  • RT M-MLV reverse transcriptase
  • PCRs are prepared with primers (500nMol), appropriate templates (1/100 dilution of the reverse transcription reaction), buffer and Taq polymerase (1 unit/reaction) (Qiagen) as directed by supplier. Reactions are subjected to 35 cycles of amplification with denaturation (94°C Imin), annealing (58°C 1 min) and extension (72°C Imin). Products are analysed by gel electrophoresis. Full-length amplimers are gel purified using the Qiaquick gel isolation kit (Qiagen, cat. 28706) and ligated to pCDNA3.1 using the Topo-TA cloning kit (Invitrogen, cat. 45-0005) according to the manufacturers instructions. Ligated DNA is transformed to E.coli (ToplO). Transformants are selected for plasmid DNA preparation and sequence analysis.
  • Plasmid DNA is prepared using either the Qiagen miniprep (cat. 27106) or midiprep (cat. 12643) kits as described by the manufacturer.
  • Plasmid miniprep DNA (100 ng to 5 ⁇ g) is sent to MWG Biotech or Lark Technologies for contract sequencing. Sequencing reactions are primed using one of the following universal primer sequences:
  • Primers are selected using the Primer Designer facility of the GeneTool Lite software (Biotools Inc). Primers are selected to have minimal internal stability and annealing temperatures of 60°C.
  • Templates for PCR are prepared using genomic DNA purified from HL60 cells using the Qiagen 'Blood and cell culture DNA mini Kit', (Cat. 13323), as per manufacturers instmctions. PCR amplifications are performed as described previously using lOOng of genomic DNA as template.
  • Amplimers are gel purified using the Qiaquick gel isolation kit (Qiagen, cat. 28706) and ligated to pCDNA3.1 using the Topo-TA cloning kit (Invitrogen, cat. 45-0005) according to the manufacturers instmctions. Ligated DNA is transformed to E.coli (ToplO). Transformants are selected for plasmid DNA preparation and sequence analysis.
  • Plasmid DNA is prepared using either the Qiagen miniprep (cat. 27106) or midiprep
  • Insert orientation is determined by PCR with TGNP-specific reverse primer and vector-specific forward primer (T7 primer). Plasmid miniprep DNA (100 ng to 5 ⁇ g) is sent to MWG Biotech or Lark Technologies for contract sequencing.
  • the promoter sequence of TGNP is given in Figure 13 as SEQ ID NO:2.
  • C/EBP SV40 C enhancer binding protein recognition site (TC*TACTC) Costa, R.H. et al., Proc Natl Acad Sci U S A 85: 3840-3844 (1988)
  • Mef-2 Mammalian MEF-2 recognition site ([CT]TA[AT]AAATA[AG]) Faisst, S. & Meyer, S. Nucleic Acids Res 20: 3-26 (1992)
  • CATT Mammalian CATT-BP recognition site (GTCACCATT)
  • GATA-1 Vertebrate GATA-1 recognition site ([AT]GATA[AC][CG][AGC]) Tu ⁇ aev, K.T. & Vasetskii, E.S. Genetika 26: 804-816 (1990)
  • NFkB Mammalian NF-kB recognition site (GGG[AG][ACT]T[CT][CT][ACT]C) Lenardo, M.J. & Baltimore, D. Cell 58: 227-229 (1989)
  • PrRE Mammalian prolactin response element (CCTGA[AT][AT]A) Gutierrez-Hartmann A. et al., Proc Natl Acad Sci U S A 84: 5211-5215 (1987)
  • AP2 Mammalian AP-2 recognition site (G[CG] [CG] [AT]G[CG]CC) Mitchell, P.J. et al., Cell 50: 847-861 (1987)
  • Example 12 Transient transfection in U937 cells and analysis of GM-CSF responsiveness.
  • GM-CSF enhances TGNP promoter activity in U937 cells.
  • U937 cells are transfected with lO ⁇ g of an EGFP reporter constmct (pEGFP, Clontech), containing a 2,036bp human genomic fragment driving the expression of the EGFP gene (TGNP-EGFP).
  • the fragment represents the region from -2032 to +4 of the transcription start site, including the putative TGNP promoter region.
  • the 2036bp fragment is cloned to the Topo-TA vector (described above) and subcloned to pEGFP using BamH and Xbal restriction sites.
  • U937 macrophage cell line was cultured at 37°C under 5% CO2 in RPMI supplemented with 10% foetal calf serum. Cells were transfected by the calcium phosphate method. Transfection of the pEGFP vector without the TGNP genomic fragment is used as a negative control whereas a constmct containing the CMV promoter serves as a positive control.
  • U937 cells containing either pEGFP or TGNP-EGFP are treated with GM-CSF (50 Units) either in the presence or absence of gliotoxin (0.1 ⁇ g/ml).
  • GM-CSF 50 Units
  • gliotoxin 0.1 ⁇ g/ml
  • flow cytometric analysis using a FacsCalibre (Becton Dickinson).
  • FacsCalibre Becton Dickinson
  • Cells are considered positive for EGFP expression when the FLl signal is greater than the background signal generated by either pEGFP or untreated TGNP-EGFP. All values were corrected for transfection efficiency by standardization against ⁇ -gal activity, derived from the cofransfected plasmid pSV ⁇ -gal (Promega).
  • the erythroleukaemic TFl cell line is growth factor dependent, requiring GM-CSF for survival in culture. Withdrawal of GM-CSF causes TFl cells to undergo spontaneous apoptosis.
  • candidate regulators of the apoptotic process such as TGNP, can be determined in these cells by measuring the extent of apoptosis following introduction of the candidate gene to the cells.
  • Light Scatter Analysis takes advantage of the fact that by using the laser beam of a flow cytometer one can determine the size (Forward Scatter) and granularity (Side Scatter) of a cell.
  • the mo ⁇ hological changes associated with apoptosis, such as decreased size (shrinkage) and granularity affect these parameters.
  • cells undergoing apoptosis will move to the left and slightly down, from the parameters of a healthy population.
  • TF-1 cells are plated into 24 well plates (2xl0 5 /ml) and are cultured for 48h in the presence or absence of GM-CSF (2ng/ml). Cells are then harvested by centrifugation (lOOO ⁇ m, for 10 min) and washed in PBS. The pellet is resuspended in PBS (2xl0 5 cells/ml) and acquired by a FacsCalibre. Forward and Side scatter parameters are assessed using Cell Quest software.
  • the analysis may be enhanced by co-expression of marker genes such as Green
  • TF-1 cells are cultured for 48h in the presence or absence of GM-CSF (2ng/ml). Cells are then harvested by centrifugation (lOOO ⁇ m, for 10 min) and washed in PBS. The pellet is resuspended in PBS (2xl0 5 cells/ml) and 1ml is then added in a dropwise fashion to ice cold 70% EtoH whilst continuously vortexing. Cells are then permeabilized by incubating at -20°C for 24 h. To stain DNA, cells are centrifuged and washed in PBS.
  • RNAse A 50 ⁇ g/ml
  • GM-CSF withdrawal decreases the percentage of cells in live gate
  • Culturing TF-1 cells in the absence of GM-CSF induces cell death. This death induces mo ⁇ hological changes in the Forward and Side Scatter parameters that can be detected by FacsCalibre analysis. Consequently, by observing the percentage of cells in the live gate (which is an arbitrary region pre-set on a healthy population of TF-1 cells grown in the presence of GM-CSF (2ng/ml)), one observes that there is a decrease in the percentage of cells with these light scatter parameters, when cytokine is withdrawn.
  • Figure 15 shows the percentage of cells in the live gate decreases from 77% to 35% upon factor withdrawal for 48h, representing a decrease of approx. 50% over the time period.
  • DNA degradation due to endonucleases activated during the apoptotic process, and subsequent release during the fixation and washing process results in a population of cells with reduced fluorescence upon propidium iodide staining as analysed by a fluorescence histogram (sub GI).
  • Figure 16 shows TF-1 cells grown in the absence of GMCSF for 48 h have an increase of cells with sub-Gl profiles from 5% to approximately 55%, indicative of the cells undergoing apoptosis.
  • BCL2 inhibits the apoptosis of Tf-1 cells
  • a number of gene products have been previously shown to regulate the effect of apoptotic stimuli on cells.
  • the archetypical example of this is BCL2 protein expression where over-expression of this gene, has previously been shown to inhibit apoptosis in a number of cellular systems. (Hockenbery D, Nunez G, Milliman C, Schreiber RD, Korsmeyer SJ, Nature 348(6299):334-6, 1990).
  • the BCL2 coding sequence is cloned into the retroviral expression vector pMSCV (Clontech). Plasmids are transfected into the retroviral packaging cell line Phoenix 293 (Nolan Laboratory, Standford University) using the CalPhos Mammalian Transfection Kit (Clontech) according to the manufacturer's instmctions. Retrovims is harvested 72 hours later. Retrovims is transduced to TFl cells by incubation for 18 hours. Media is changed and cells are incubated for an additional 96 hours. Cells are transduced with either BCL2 plasmid or control plasmid.
  • the cells are then induced to undergo apoptosis by withdrawal of GMCSF for 48h.
  • the percentage of transduced cells remaimng in the live gate (an arbitrary region pre-set on a healthy population of TF-1 cells grown in the presence of GM-CSF (2ng ml)) is recorded.
  • An index of antiapoptotic activity is calculated by computing the difference in samples +/- GMCSF.
  • TFl cells are transduced with either a retroviral expression vector expressing the TGNP coding sequence (TGNP plasmid) or a control retrovims.
  • the TGNP coding sequence encoding the amino acid sequence set out in SEQ ID NO: 1 is cloned into the retroviral expression vector pMSCV (Clontech). Plasmids are transfected into the retroviral packaging cell line Phoenix 293 (Standford) using the CalPhos Mammalian Transfection Kit (Clontech) according to the manufacturer's instmctions. Retrovims is harvested 72 hours later. Retrovims is transduced to TFl cells by incubation for 18 hours. Media is changed and cells are incubated for an additional 48 hours in the presence or absence of GMCSF.
  • Figure 18 shows he percentage apoptosis of control and TGNP cells in the absence of GMCSF.
  • the control cells have undergone extensive apoptosis (32%) while the TGNP cells remain viable, demonstrating 11% apoptosis.
  • RNAi interfering RNA
  • the TGNP CDS is screened for AAN19TT siRNA target sequences with a GC content of 40-55% (http://www.ambion.com/techlib/misc/siRNA_finder.html).
  • Candidate targets are subject to a BLAST search against the Genbank database to ensure that the selected sequences share no significant homology with any other human genes.
  • oligonucleotides selected are:
  • the TGNP siRNA is initially tested for efficacy in Hela, U251 or PC3 cells.
  • Cells were plated at a density of 7.2 x 10 4 in each well of a 6 well plate and incubated at 37°C overnight in DMEM culture medium (IX Dulbeccos modified Eagles medium (Sigma D2554), 0.004% folic acid, 4 mM L-glutamine, 0.37% sodium bicarbonate, 0.1 mM sodium pyruvate) containing 10% foetal calf serum (FCS).
  • DMEM culture medium IX Dulbeccos modified Eagles medium (Sigma D2554), 0.004% folic acid, 4 mM L-glutamine, 0.37% sodium bicarbonate, 0.1 mM sodium pyruvate
  • FCS foetal calf serum
  • 2 ⁇ g of duplex siRNA is transfected into Hela cells using DMRIE-C reagent (Invitrogen 10459-014) according to the manufacturer
  • RNAi RNAi + TGNP siRNA
  • RNA is isolated using Qiagen' s RNeasy Miniprep columns (Qiagen 74104) after lysis on QIAshredder columns (Qiagen 79654). The RNA is quantified by spectrophotometric analysis and 1 ⁇ g was reverse transcribed into cDNA using SuperScriptll RNAseH-Reverse Transcriptase (Invitrogen 18064-014).
  • Q-PCR primers are designed to amplify a PCR product of 149 nucleotides in length from the CDS of TGNP, following the guidelines outlined in the Quantitect SYBR Green PCR handbook from Qiagen.
  • Forward primer 5' caaggtggttccagagcagcc 3'
  • Reverse primer 5' gctgccatttccagaaccgtt 3'
  • a control RPS13 (NM_001017) amplified PCR product diluted to [1000,100,10,1 and 0.1 fg] respectively, used to quantify the level of transcript; 2. RPS13 amplified from sample templates as separate PCR reactions for normalisation pu ⁇ oses.
  • the cDNA templates from appropriate cells transfected with either TGNP or missense siRNA, and a mock-transfected control, are amplified with TGNP Q-PCR primers using QuantiTectSYBR Green PCR kit (Qiagen 204143) on a DNA Engine Opticon System (MJ Research).
  • the amplification conditions include a 95°C step for 15 min for initial activation of HotStarTaq DNA polymerase, followed by 35 cycles of (15s at 94°C, 30s at 60°C, 30s at 72°).
  • the fluorescence of the samples at 521 nm is read between the annealing and extension steps of the protocol.
  • the melting curves are calculated at the end of the 35 cycles and confirm product homogeneity.
  • a standard curve is plotted using the log [template quantity] of the RPS13 control template dilutions (as above) versus cycle number at which the fluorescence intensity measured in the well exceeds the level specified in the cycle threshold parameters (the C(T) value).
  • An estimate of the quantity of initial template in treatment samples is determined from this plot and the amount of TGNP present in each sample is normalized across samples by calculating the ratio of TGNP to RPS13 for each sample.
  • Model cell lines preferebaly include, but are not limited to, TFl, U251, SKOV3, OVCAR3, MCF7, PC3, HCT15, 786-0, HT29, M-14, H460, LnCap and PC3.
  • Model cells 4 x 10 5 cells/ well, are transfected with 2 ⁇ g of siRNA in each of 7 wells of a 24 well plate using 8 ⁇ l DMRIE-C reagent (InVitrogen). Cells are simultaneously transfected in parallel with a control missense siRNA. The transfection media is replaced after four hours with fresh media containing 10% FCS and incubated at 37°C. These cells are harvested 48 and 72 hours post transfection for Q-PCR and phenotypic assays. RNA is isolated, cDNA is reverse transcribed and Q-PCR was performed as described above.
  • TFl cells 4 x 10 5 cells/ well, are transfected with 2 ⁇ g of siRNA in each of 7 wells of a 24 well plate using 8 ⁇ l DMRIE-C reagent (InVitrogen). Cells are simultaneously transfected in parallel with a control missense siRNA. Recombinant
  • GMCSF is added to the OPTI-MEM media during transfection.
  • the transfection media is replaced after four hours with fresh RPMI 1640 containing GMSCF and 10% FCS and incubated at 37°C. Twenty-four hours post-transfection, the media are changed; RPMI 1640 +10% FCS containing GMSCF is added to 3 wells and RPMI 1640 +
  • T72+G, T72-G according to the time of harvesting post-transfection and the presence (+G) or absence (-G) of GM-CSF in the media.
  • RNA is isolated, cDNA is reverse transcribed and Q-PCR is performed as described above.
  • FSC/SSC Forward Scatter/Side Scatter
  • TF-1 cells are plated into 24 well plates (2xl0 5 /ml) and are cultured for 48h in the presence or absence of GM-CSF (2ng/ml). Cells are then harvested by centrifugation (lOOO ⁇ m, for 10 min) and washed in PBS. The pellet is resuspended in PBS (2xl0 5 cells/ml) and acquired by a FacsCalibre (HP Biosciences). Forward and Side scatter parameters are assessed using Cell Quest software.
  • SubGl parameters are obtained by resuspending cells in a buffer, (0.1% Sodium Citrate, 0.1% TritonX-100, 200 ⁇ l of Propidium Iodide at 5mg/ml made up to 20mls in PBS) and staining for 7hours at 4°C in the dark. The PI stained cells are then acquired by the flow cytometer. Analysis of FL2 fluorescence is performed on Cell Quest software to allow quantification of the Sub-Gl phase of the cell.
  • Example 18 Differential expression of TGNP is associated with inflammatory diseases
  • Blood samples (20ml) are obtained with informed consent from a group of patients suffering from Cystic Fibrosis (CF), Chronic Obstructive Pulmonary Disease (COPD) and Sepsis.
  • Neutrophils are prepared from these samples as described (Example 1).
  • the isolated neutrophils are lysed in RNAZol (Biogenesis) and RNA is prepared as described (Example 1).
  • RNAZol Biogenesis
  • cDNA from these samples is used for array hybridization and quantitative PCR. Differential gene expression is determined by reference to a pooled set of samples from normal controls. Up regulation of TGNP in disease samples is confirmed by quantitative PCR.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Analytical Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Biophysics (AREA)
  • Hematology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Toxicology (AREA)
  • Wood Science & Technology (AREA)
  • Urology & Nephrology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Cell Biology (AREA)
  • Food Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Physics & Mathematics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The invention provides a method for detecting apoptosis in a cell comprising detecting an alteration in any one of - i) a TGNP polypeptide having an amino acid sequence as set out in SEQ ID NO: 1; ii) a polypeptide having at least 80 % homology with i); iii) a nucleic acid encoding a polypeptide having the sequence set out in i) or ii); iv) a nucleic acid which hybridises under stringent conditions to the sequence set out in iii); or v) the complement of iii) or iv). The invention accordingly provides a method of modulating apoptosis by modulating TGNP gene expression and a method for identifying genes associated with TGNP gene expression and thus identifying other genes associated with apoptosis. The invention also provides a novel nucleic acid sequence encoding the promoter region for TGNP.

Description

TGNP
FIELD OF THE INVENTION
The present invention relates to the use of the gene TGNP in the detection and modulation of apoptosis in cells. In particular, it relates to a method for identifying genes associated with TGNP gene expression and thus their association with apoptosis.
BACKGROUND TO THE INVENTION
Programmed cell death or apoptosis is a genetically programmed process by which cells die under both physiological and a variety of pathological conditions (Kerr et al, Br. J. Cancer, 26, 239-257, 1972). It serves as the counter-balancing force to mitosis during adult life and is a major contributor to the sculpting of physiological structures during the many processes of development (Wyllie et al, Int. Rev. Cytol, 68, 251-305, 1980). It is characterised by a number of well-defined biochemical hallmarks. These include DNA fragmentation, caused by the activation of an endogenous endonuclease enzyme (Wyllie, Nature, 284, 555-556,1980; Enari et al., Nature, 391, 43-50, 1998). The result is a DNA ladder pattern that can be readily visualised in agarose cells. Coupled with DNA fragmentation is cell shrinkage (Wesselbory et al., Cell Immunol. 148, 234-41, 1993) where water is actively extruded from the cell. The apoptotic cell then undergoes fragmentation into apoptotic bodies that are engulfed by neighbouring cells or cells of the reticuloendothelial system.
A second well-defined characteristic is the exposure of the phospholipid phosphatidylserine to the outside surface of the plasma membrane of the cell as it undergoes apoptosis (Fadok et al., J Immunol. 148, 2207-16, 1992). Normally this lipid is located on the inner side of the membrane lipid bilayer. The underlying mechanism responsible for this lipid flipping is poorly understood at present. Its expression serves as a signal for the recognition and phagocytosis of the apoptotic cell (Fadok et al., J Immunol. 148, 2207-16, 1992) Under normal physiological conditions apoptosis is tightly regulated. However, there are a number of diseases where the process becomes deregulated, leading to a particular pathology. Examples of where apoptosis is retarded or inhibited include some types of tumour development, a number of inflammatory conditions such as acute respiratory distress syndrome (ARDS) and other related conditions (Matute- Bello et al, Am J Respir Crit Care Med. 56, 1969-77, 1997). Inappropriate or excessive apoptosis occurs under conditions of ischaemia (stroke, myocardial infarction, etc) Linnik et al., Blood. 80, 1750-7, 1992, Gorman et al., J Neurol Sci. 139, 45-52, 1996) a series of neurodegenerative conditions, myelosuppression (Mori et al, Blood. 92, 101-7, 1998) following chemotherapy or irradiation (Lotem et al., Blood. 80, 1750-7, 1992) and a significant number of other diseases where cell death is a key feature of the pathology.
A key event in the initiation and propagation of apoptosis is the generation of reactive oxygen species (ROS) (McGowan et al., Exp Cell Res, 238, 248-56, 1998). These species include hydrogen peroxide, superoxide and the hydroxyl radicals. They can be generated either at the level of the mitochondrion, where any disruption of the respiratory chain can lead to their production or via a number of enzyme reactions such as NADPH oxidase (Nauseef et al., Proc Assoc Am Physicians, 111, 373-82, 1999). This enzyme is particularly active in the neutrophil. Such molecules cause oxidative damage not only to cellular structures, but may also act to initiate the expression of apoptosis regulating genes. In mammalian cells the physiological role for such ROS molecules is far less well characterised than that of other related molecules such as nitric oxide (NO). In relation to the involvement of NO in apoptosis the published literature is unclear, with examples of NO both driving and inhibiting apoptosis (Brune et al., Cell Death Differ. 1999 10,969-975, 1999). There is an increasing volume of evidence for a ROS role in driving apoptosis, but, until recently, mechanisms of this has not been understood (Hildeman et al., Immunity. 10,735-44, 1999,Gorman et al., J Neurol Sci. 139, 45-52, 1996).
Studies over the past 5 years have demonstrated that a variety of cytokines, growth factors and agents that induce apoptosis can lead to the generation of ROS. These studies have suggested that ROS may act as second messengers in signal transduction pathways in the context of cytokine/growth factor stimulation of cells. Other more recent studies have indicated that they may also activate unique pathways. The specific targets of ROS generated intracellularly are largely unknown at present, but it is known that the addition of hydrogen peroxide or other ROS generators to cells in culture leads to the activation of the transcription factor Nf/kB (Schreck et al., EMBO J 10, 2247-2258, 1991). This in turn controls the expression of a series of genes involved in a variety of cellular functions. Other targets of ROS include the activation of the mitogen activated protein kinase (MAPK) which is known to be involved in the regulation of cell proliferation ( Kamata et al., J. Biol. Chem, 271, 33018-33025).
A cell has the ability to produce ROS at a number of different sites. In relation to signal transduction events it is still unclear where the source of ROS is within the cell. There are a number of potential enzyme systems capable of ROS generation. Perhaps the best documented one, particularly in neutrophils and other phagocytic cells, is NADPH oxidase. Studies using inhibitors of this enzyme such as DPI suggest that this enzyme is also involved in the generation of ROS in non phagocytic cells (Griendling et al., Circulation, 74, 1141-1148, 1994). Mitochondria play a key role in apoptosis and are also a major site of ROS generation. The loss of mitochondrial membrane potential is coupled to the release of cytochrome C and this in turn has two effects. The first is the generation of ROS, since the respiratory chain is disrupted by the removal of cytochrome C. The second is the cleavage of cellular DNA through a series of cytochrome C mediated caspase activation steps, which is an end point of the apoptosis process.
It has been suggested that ROS are involved in p53 mediated apoptosis (Johnson et al., Proc. Natl. Acad. Sci. USA, 93, 11848-11852, 1997). Cells generated to over-express p53 undergo apoptosis, accompanied by ROS production and this can be blocked by anti-oxidants (Polyak et al., Nature, 389, 300-305, 1997). There are a number of other examples where ROS production is closely associated with the initiation and propagation of apoptosis. However, the mechanism of ROS activity in apoptosis has until recently been unclear. A series of enzymes involved in maintaining the redox balance within a cell contribute to the ability of that cell to survive in the presence of elevated ROS levels. Such enzymes include catalase and superoxide dismutase which work to reduce the oxidative stress in cells. In addition to redox modulating enzymes several other proteins most notably Bcl-2 are thought to mediate their anti-apoptotic effects via an anti-oxidant process (Hockenberry et al., Cell. 1993 75 :241-51). The precise mechanism by which Bcl-2 mediates its effects are still not quite defined. Other proteins such as members of the heat-shock family have also been demonstrated to protect cells from undergoing apoptosis in a pro-oxidant environment (Creagh et al., Leukemia. 2000 (7):1161-73. The redox sensitive transcription factor NF-kB is also known to induce the expression of a series of genes (some known and others yet to be discovered) which modulate the cells ability to undergo apoptosis.
We have previously shown that production of intracellular ROS is causally or consequentially connected with the modulation of early transcription and/or translation, and or post-translational modification in cells of genes which control the progression of the cell towards apoptosis (WO 01/46469). Unlike caspases and other genes known to be involved in apoptosis, which generally act at the execution stage of apoptosis and are only activated once the cell is committed to the apoptotic fate, the genes whose expression is modulated during or after ROS exposure are required for induction of apoptosis, before the cell has made a commitment to die. Accordingly, regulation of the expression of ROS-associated genes provides a mechanism by which the entry of the cell into the apoptotic process may be induced or prevented.
The number of factors which are know to induce survival in particular cell types is ever increasing (e.g. IL2, IL3, IL4, IL5, IL8, GM-CSF, insulin like growth factor 1, NGF, VEGF, PDGF, SCF, LIF, EGF etc.). Many of these survival factors appear to share a commonality in the survival pathway (Datta SR et al. Genes and Development 13: 2905-2927, 1999). For an extracellular stimuli, to confer survival on a cell, it must inhibit the endogenous apoptotic machinery. The model predicts that there is a series of temporal events that occur upon survival factor/ receptor interaction. The first of these is tyrosine phosphorylation at the plasma membrane due either to intrinsic receptor tyrosine kinase activity (e.g. the insulin growth factor 1 receptor), or indirectly coupled to tyrosine kinases or alternatively directly coupled to several transmembrane G protein-coupled receptors.
Blood neutrophils have relatively short lives with greater than 80% of them apoptosing within the first 24 hours. Apoptotic neutrophils are phagocytosed by macrophages via thrombospondin and macrophage CD36/ vitronectin receptor (Savil 1992, Clinical Science 83, 649-55, Savil et al. 1993, Immunology Today 14,131-136) and thus prevent release of potentially lethal cocktail of enzymes in the host, should the neutrophil undergo necrosis. However, certain inflammatory environments favour the survival of neutrophils. In vitro, several cytokines including GM-CSF, IL-1, IL-2, IL- 8 and IFNγ can delay neutrophil apoptosis (Brach et al, 1992, Blood 80, 2920 -2924; Calotta et al 1992, Blood 80, 2012-2020, Lee et al 1993, J Leuk Biol 54, 283 - 388, Pericle et al 1994, Eur. J. Immunol24, 440 - 444, Get ref for IL8). Furthermore, inflammatory proteins (e.g. C5A) and bacterial products (e.g. LPS) have also been shown to inhibit apoptosis. These findings together with other results demonstrating that the presence of either actinomycin D or cycloheximide can promote apoptosis in PMN (Whyte et al, 1991, Clin Sci. 80: 5p) suggests a role for active gene expression and translation in control of PMN apoptosis. Moreover, other investigators have shown that NFKB regulated genes seem to play a critical role in preventing apoptosis induced by TNFα, since inhibition of this transcription factor using the fungal metabolite Gliotoxin, induces rapid apoptosis (Ward et al. 1999, J. Biol. Chem. 274. 4309-4318). The same investigators also demonstrated that blocking NFKB with Gliotoxin removes the anti-apoptotic effect of LPS. Yoshida et al have identified an alternative mode of action of gliotoxin. These investigators demonstrated that gliotoxin inhibited NADPH oxidase and consequently prevented the onset of superoxide generation by human neutrophils in response to phorbol myristate. (Yoshida et al Biochem Biophys Res Commun 2000, 268(3) 716-23).
Granulocyte macrophage colony-stimulating factor (GM-CSF) is known to inhibit PMN apoptosis both in vitro and in vivo (Cox et al. 1992, Am. J. Respiratory Cell Mol
Biol. 7, 507; Chintinis et al 1996, J. Leuk Biol 59:835). One consequence of GM-CSF treatment of PMN is a time and dose dependent tyrosine phosphorylation event within the cell (McCall et al., 1991, Blood 78(7) 1842-52). That tyrosine phosphorylation is implicated in the regulation of apoptosis has been demonstrated (Simon et al 1995, Int. Arch Allergy Immunol. 107, 338-339). These workers demonstrated that the effect of GM-CSF on granulocyte cell death could be attenuated by the tyrosine kinase inhibitor genestein, suggesting that increases in tyrosine phosphorylation are essential to inhibit cell death. To further analyse a role for tyrosine phosphorylation, the authors increased levels of tyrosine phosphorylation using the protein- phosphatase inhibitor phenylansine oxide (PAO). Similar to GM-CSF, treatment of the cells with PAO is followed by a large increase in tyrosine phosphorylation and matched inhibition of apoptosis. Inhibitors of tyrosine phosphorylation (Genestein and Herbimycin A) reversed the effects of PAO on tyrosine phosphorylation and neutrophil apoptosis.
Furthermore, Wei et al (J. Immunology 1996,157, 5155-5162) suggested specificity in the anti-apoptotic signalling pathway by showing that GM-CSF inhibition of programmed cell death did not appear to be related to known proteins associated with cell survival i.e. p53, cdc2, Rb, and Bcl-2. However GM-CSF did induce a rapid activation of Lyn, a src family tyrosine kinase, and Lyn antisense treatment of neutrophils reversed the survival promoting effect of GM-CSF. Other investigators have demonstrated that GM-CSF selectively induced tyrosine phosphorylation of Extracellular Signal-Related kinase (ERK), a member of microtubule associated protein kinase (MAPK) family (Yuo et al. 1997, BBRC 235, 42- 46). Al-Shami et al. (Blood 1997, 89(3) 1035-1044) has shown that GM-CSF induces both a time and concentration- dependent increase in the level of tyrosine phosphorylation of the PI-3- kinase regulatory subunit p85, possibly via lyn kinase. In corroboration of these results, Klein et al. (J. Immunol. 2000, 164, 4286-4291), using pharmacological inhibitors of signal transduction, further demonstrated a role for PI 3 -kinase and ERK. These investigators showed that GM-CSF caused a rapid phosphorylation of the protein Akt, a substrate for PI 3-kinase. Akt phosphorylation is in turn associated with phosphorylation of BAD, a pro-apoptotic member of the Bcl-2 family. The authors hypothesised that this phosphorylation resulted in disengagement of Bad with anti- apoptotic family members of Bcl-2 family, allowing them to prevent neutrophil apoptosis. The link between GM-CSF and tyrosine phosphorylation and# inhibition of programmed cell death has until recently been unknown. Previously, prolonged survival of PMN caused by inhibition of apoptosis is observed in bcl-2 transgenic mice (Lagasse and Weissman, 1994, J. Exp. Med. 179 1047). This result is surprising since normal peripheral blood neutrophils are negative for bcl-2 (Wei et al. J. Immunology 1996,157, 5155-5162), however it does show that targets for the Bcl-2 family of apoptosis associated proteins can control PMN apoptosis. Weinnman et al. (1999, Blood, 93, 3106-3115) investigated the role of other members of the Bcl-2 family in regulating PMN apoptosis. The authors cultured PMN for 0, 2,6 or 22h in the presence of TNFα (pro-apoptotic) or GM-CSF or are left untreated. Fresh, unstimulated PMN showed a high level of expression of Bcl-XL that gradually decreased as the culture proceeded, suggesting that loss of this protective protein may play a role in spontaneous apoptosis. The reduction of Bcl-XL in the presence of TNFα is much stronger when compared to control cells. GM-CSF did not alter the effect of Bcl-XL. Next the investigators examined expression of Bax-α, a proapoptotic member of the Bcl-2 family. Results showed that GM-CSF induced a down regulation of Bax-α when compared to control cells, suggesting that the down- regulation of this death promoting is involved in PMN survival mediated by GM-CSF. The authors concluded that GM-CSF seems to promote survival by modulating the Bax-α/ Bcl-XL ratio via down regulation of Bax-α. Furthermore, the authors suggested that inhibition of apoptosis by GM-CSF might be due to a caspase 3 regulation since no further reduction of apoptosis is observed, above that already seen, when PMN are stimulated GM-CSF after inhibition of caspase-3 with its inhibitor Z- DEVD-FMK.
Other members of the Bcl-2 family have also been implicated in neutrophil apoptosis. Expression of myeloid cell leukaemia 1 (MCL1), another viability-promoting family member, has been shown to decrease during neutrophil apoptosis but increases in response to GM-CSF and LPS, suggesting a link with PMN survival, (Moulding DA, Quayle JA, Hart CA, Edwards SW, Blood 1998; 92(7): 2495-502). Neutrophils also express mRNA for Al, another Bcl-2 homologue with anti-apoptotic properties (Chuang PI, Yee E, Karsan A, Winn RK, Harlan JM, Biochem Biophys Res Commun 1998; 249(2): 361-5). The authors demonstrated that agonists that promote cell survival (e.g. LPS and G-CSF) up-regulated the message for this protein. Moreover, neutrophil apoptosis is enhanced in mice that lack Al-a, a subtype of the Al gene, and LPS- induced inhibition of apoptosis is abolished. However in these mice TNFα induced apoptosis is unchanged, which suggest that Al is involved in regulating some but not all neutrophil apoptotic pathways (Hamasaki A, Sendo F, Nakayama K, Ishida N, Negishi I, Nakayama Ki, Hatakeyama S, J Exp Med 1998; 188(11):1985-92).
In our copending international patent application, WO 02/04657, we have shown that GM-CSF inhibits death through apoptosis by the regulation of 'effector genes' that control the process of apoptosis. A signal acts through a signal transduction cascade and is associated with significant changes, or patterns of changes, in gene expression in the cell. To date, however, the identities of such 'effector genes' and their role in the signalling pathways that lead to the biochemical events of cell death have been incompletely determined.
Our previous work, as described in WO 01/46469 and WO 02/04657, therefore establishes two assays for the identification of genes involved in the regulation of apoptosis, by screening for genes whose expression is modulated by changes in intracellular ROS concentrations and/or the action of GM-CSF. Using these assays, we have verified changes in expression in a number of known genes whose role in apotosis has been previously established - such as various Bcl-2 related proteins and caspases. The assays therefore provide a method for validating the involvement of candidate genes in apoptosis.
The control of apoptosis represents a significant therapeutic target, since many diseases are due to defects in this process. Many physiological factors induce and prevent cell apoptosis. For example, cytokines or growth factors such as GM-CSF inhibit death through apoptosis. There is an acute need to identify the genes that regulate this process. In other words, if one identifies a gene that prevents apoptosis, then this gene/gene product or its function can be blocked by a drug and apoptosis allowed to occur. To-date many of the genes found have certain fundamental flaws e.g. they act late in the process, after the cell has committed to a death programme, or they are ubiquitous, that is they are not restricted to a particular cell type. The ideal target to control apoptosis act early in the process and are restricted to a particular cell type.
SUMMARY OF THE INVENTION
The present invention identifies that the expression of the gene TGNP is correlated with an early stage in apoptosis. In particular, TGNP gene expression is decreased in neutrophil apoptosis and increased in neutrophil survival when apoptosis is inhibited by the presence of GM-CSF. Furthermore, when GM-CSF inhibition of apoptosis is blocked by gliotoxin, TGNP expression is down regulated. In addition, expression of recombinant TGNP in HeLa cells resulted in significant inhibition of proliferation/viability thus identifying TGNP as a modulator of cell growth/survival.
Trans-Golgi network integral membrane protein (referred to herein as TGNP) (Synonyms: TGOLN2, TGNP2, TGN46 (TGNP B2), TGN48, TGN38 homolog, TTGN2, Trans-Golgi network protein, 38KD, RAT, Homolog of TGN38; Gene name: TGNP, TGN51 or TGN46) TGNP gene is identified in GenBank, Accession number U62390; gi2772589. The human TGNP gene contains 4 exons and additional TGNP cDNAs, that are produced by alternative usage of 3 -prime splice sites in intron 3, have been identified. TGNP is expresssed as multiple splice variants including a 46kDa isoform (TGN46). This protein isoform is identified under accession number AAC39539; gi 2226273. The alternatively spliced cDNAs encode the 48kDa (TGN48) and 51kDa (TGN51) isoforms, which have longer C-terminal tails. The 51kDa isoform is identified in Swiss Prot, Accession number: 043493; gi 12643559.
The amino acid sequence for the 46kDa isoform is set out in SEQ ID NO: 1.
SEQ ID NO: 1
1 MRFWALVLL NVAAAGAVP LATESVKQEE AGVRPSAGNV STHPSLSQRP GGSTKSHPEP 61 QTPKDSPSKS SAEAQTPEDT PNKSGGEAKT KDSSNKSGA EAQTPKGSTS KSGSEAQTTK 121 DSTSKSHPE QTPKDSTGKS GAEAQTPEDS PNRSGAEPKT QKDSPSKSGS EAQTTKDVPN 181 KSGADGQTPK DGSSKSGAED QTPKDVPNKS GAEKQTPKDG SNKSGAEEQG PIDGPSKSGA 241 EEQTSKDSPN KWPEQPSRK DHSKPISNPS DNKELPKADT NQLADKGKLS PHAFKTESGE 301 ETDLISPPQE EVKSSEPTED VGPKEAEDDD TGPEEGSPPK EEKEKMSGSA SSENREGTLS 361 DSTGSEKDDL YPNGSGNGSA ESSHFFAY V TAAILVAVLY IAHHNKRKII AFVLEGKRSK 421 VTRRPKASDY QRLDQKS Isoform TGN46 is widely expressed. Isoform TGN51 is more abundant in fetal lung and kidney. Isoform TGN48 is barely expressed in embryonic kidney and promyelocytic cells. Expression has also been identified in adipose, adrenal gland, bladder, brain, breast, colon, epid_tumor, eye, genitourinary tract, germ cell, head neck, kidney, liver, lung, lung_tumor, marrow, nervous_normal, normal head/neck tissue, pancreas, placenta normal, pool, pooled brain, lung, testis, pooled colon, kidney, stomach, prostate, skin, synovial membrane, tonsil and uterus.
The TGNP gene maps to chromosomal position 2pl 1.2.
The identification and role of this gene in apoptosis has been validated using model assays described in our copending applications WO 01/46469 and WO 02/04657 as described herein.
These model discovery assays are configured to target the 'early' regulatory events occurring in apoptosis induced by ROS and, in particular, in the inhibition of apoptosis by GM-CSF. When apoptosis by GM-CSF is itself inhibited by a drug, such as gliotoxin, then changes, or patterns of changes can be targeted by clustering those changes that are common and both increase and/or decrease depending on the treatment. For example, a change that is a 'decrease' following induction of apoptosis is a candidate target gene, however, a change that is additionally an 'increase' following inhibition of apoptosis by GM-CSF has a higher probability of being a target gene because its regulation shows increased correlation with the process. Likewise, a change that is further a 'decrease' following inhibition of GM-CSF inhibitory effect has a yet higher probability of being a target gene because its regulation shows increased correlation with the process.
Genes regulated in these models following modulation of apoptosis include genes that 1) are 'effector' genes involved in the cells defence mechanisms aimed at preventing apoptosis (anti-apoptotic genes) and thus represent therapeutic targets, 2) make up aspects of the apoptosis and/or GM-CSF signal cascade and thus represent therapeutic targets, 3) initiate the process of apoptosis (pro-apoptotic genes) and thus represent therapeutic targets, and 4) are associated with the processes of apoptosis and defence that will aid in the understanding of key pathways, processes and mechanisms that may subsequently lead to the identification of therapeutic targets.
We have previously demonstrated that these cell-based apoptosis models, which are combined with a genomics approach, identify genes known to be involved in apoptosis and defence. In these models, the expression of TGNP correlates with that of known apoptosis genes, redox modulation and survival genes thus confirming its role in apoptosis or in modulating apoptosis. We therefore provide a method for detecting apoptosis in a cell comprising detecting a decrease in TGNP gene expression.
Accordingly in a first aspect of the invention, there is provided a method for detecting apoptosis in a cell comprising detecting a decrease in any one of: i) a TGNP polypeptide having an amino acid sequence as set out in SEQ ID NO: i; ii) a polypeptide having at least 80 % homology with i); iii) a nucleic acid encoding a polypeptide having the sequence set out in i) or ii); iv) a nucleic acid which hybridises under stringent conditions to the sequence set out in iii); or v) the complement of iv).
Levels of gene expression may be determined in any appropriate manner. Detecting a decrease in gene expression may be achieved by measuring TGNP gene expression in treated versus non-treated cells. Preferably, gene expression may be measured by detecting nucleic acid encoding a TGNP polypeptide such as TGNP mRNA transcripts, or a fragment thereof. In one embodiment, the method of measuring mRNA transcripts may use an amplification technique as described herein. In another embodiment, TGNP expression may be measured by detecting the TGNP polypeptide gene product, or fragment thereof, using, for example, agents that bind TGNP. Suitable agents include anti-TGNP antibodies. In another aspect, there is provided a method of detecting GM-CSF-induced cell survival by detecting an increase in TGNP gene expression.
In another aspect, there is provided a method of modulating apoptosis in a cell comprising the step of increasing, decreasing or otherwise altering the functional activity of TGNP or the nucleic acid encoding it. In one embodiment, said modulation of apoptosis is inhibition. In another embodiment, said modulation of apoptosis confers survival in a cell.
In another aspect there is provided a method of modulating cell growth in a cell comprising the step of increasing, decreasing or otherwise altering the functional activity of TGNP or the nucleic acid encoding it.
In one embodiment, the modulation of cell growth is the inhibition of proliferation.
Suitably the cell may be a therapeutic target for the treatment of disease. For example, such a cell may be a cancer cell, a cell involved in an inflammatory disorder, a cell involved in an autoimmune disorder or in a neurodegenerative disorder.
In the context of the present invention the term 'altered functional activity of TGNP or the nucleic acid encoding it' includes within its scope increased, decreased or an otherwise altered activity of TGNP as compared with the native protein functioning in its normal environment, that is within a single cell under native conditions. In addition, it also includes within its scope an increased or decreased level of expression and/or altered intracellular distribution of the nucleic acid encoding TGNP, and/or an altered the intracellular distribution of TGNP itself.
In one embodiment, the method of modulating apoptosis or cell growth involves decreasing TGNP gene expression. In a preferred aspect, the expression of TGNP is reduced by greater than 50%, 60%, 70%, 80%, 90% or more of its normal level in untreated cells. Preferably, a decrease in TGNP gene expression may be effected by antisense expression. Other means of decreasing TGNP gene expression will be recognised by those skilled in the art and include introducing dominant negatives, peptides or small molecules including RNA molecules such as siRNA molecules which cause a decrease in gene expression through RNA interference. Suitable siRNA molecules are described in the Examples section herein.
In another embodiment, said method involves increasing TGNP gene expression and therefore increasing cell survival. In a preferred aspect, the expression of TGNP is increased by greater than 50%, 60%, 70%, 80%, 90%, 100%, 200%, 500% or more of its normal level in untreated cells.
Preferably, said method comprises providing an expression vector comprising a nucleic acid sequence encoding a TGNP polypeptide; introducing the expression vector into the cell and maintaining the cell under conditions permitting expression of the encoded polypeptide in the cell. As defined herein, a nucleic acid encoding TGNP or a TGNP polypeptide encompasses fragments thereof.
In a further aspect, there is provided the use of TGNP, or an agent that alters TGNP expression in a cell, in the modulation of apoptosis.
Suitably, apoptosis is assessed by expression of TGNP in a test system and measuring the impact on cell growth and viability.
TGNP may itself be used to identify other candidate genes or proteins which are involved in apoptosis.
Accordingly, in a further aspect, there is provided a method for identifying a molecule which interacts with TGNP.
In the context of the present invention, molecules which 'interact' with TGNP include molecules which bind to TGNP either directly or indirectly. Methods for detecting those molecules include physical methods and molecular biology techniques as herein described. Suitable standard laboratory techniques will be familiar to those skilled in the art and include immunoprecipitation, immunoblotting and fluorescence techniques. One skilled in the art, will appreciate that this list is not intended to be exhaustive. Suitable molecular biology techniques include phage display and the yeast two-hybrid system described herein.
In another aspect, there is provided a method for identifying a gene product whose expression is modulated by the expression of TGNP comprising the steps of:
- providing a vector encoding TGNP - introducing said vector in a cell under conditions to promote expression of TGNP
- measuring global gene expression associated with TGNP expression
In one embodiment, said method further comprises the step of exposing said cell to conditions which promote apoptosis or cell survival prior to measuring global gene expression.
Such a method may be modulated to identify compounds that modulate TGNP protein function. Accordingly, in another aspect, there is provided a method for identifying a compound that modulates TGNP protein function comprising: - taking a cell expressing TGNP;
- introducing a test compound; and
- measuring global gene expression compared to expression in the absence of the test compound as an indication of modulation of TGNP protein function.
Advantageously, expression levels are assessed by measuring gene transcription. This is preferably carried out by measuring the rate and/or amount of specific mRNA production in the cell. A preferred embodiment of this aspect of the invention involves the use of arrayed oligonucleotide probes capable of hybridising to mRNA populations. Differences in hybridisation patterns of different mRNA populations may be used to identify genes which are differentially expressed in the two populations. Differential expression may include different expression patterns observed across a time course. The arrayed oligonucleotide probes are advantageously derived from cDNA or EST libraries, and represent genes which are expressed by the cells under investigation.
Levels of gene expression may be determined in any appropriate manner. Preferably, levels of gene expression may be determined by the measurement of protein production by mRNA translation to detect increases or decreases in the rate or amount of mRNA translation.
Preferably, global gene expression is measured by assaying gene transcription using a microarray. In another embodiment, global gene expression is measured by protein array.
Another aspect of the invention is directed to the identification of agents capable of modulating TGNP gene expression or protein function. In this regard, the invention provides assays for determimng compounds that modulate the function and/or expression of TGNP.
Suitably, the identification of agents capable of modulating TGNP protein function can be detected by measuring the expression of a gene whose expression is regulated by TGNP.
Accordingly, in one aspect there is provided a method for identifying a compound that modulates TGNP protein function comprising:
- taking a cell expressing TGNP; - transfecting said cell with a nucleic acid construct encoding an TGNP-regulated gene;
- introducing a test compound; and
- detecting expression of the TGNP-regulated gene compared to expression in the absence of the test compound as an indication of modulation of TGNP protein function.
In another aspect there is provided a method for identifying a compound that modulates TGNP protein function comprising: - taking a cell expressing TGNP;
- transfecting said cell with a nucleic acid construct comprising the promoter sequence of an TGNP-regulated gene operably linked to a reporter gene;
- introducing a test compound; and - detecting altered reporter gene expression compared to expression in the absence of the test compound as an indication of modulation of TGNP protein function.
Suitably, a 'cell expressing TGNP' is a cell which has been transfected with a nucleic acid construct encoding TGNP preferably by providing a vector encoding TGNP and introducing said vector into a cell under conditions to promote expression of TGNP, as described above. Transfection may result in transient, stable or inducible expression of TGNP using methods familiar to those skilled in the art or as described herein.
Suitably, the TGNP-regulated gene is selected from the group consisting of Tax interacting Protein, tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide, protein regulator of cytokinesis 1, acyl-Coenzyme A oxidase 2, branched chain, Cbp/p300-interacting transactivator, with Glu/ Asp-rich carboxy-terminal domain, 2, Interleukin 3 receptor, alpha (low affinity), eukaryotic translation initiation factor 3, subunit 6 (48kD):, B-cell CLL/lymphoma 9:, Rho- associated, coiled-coil containing protein kinase 2:, Neuropilin 1, Phosphodiesterase 3 A, cGMP-inhibited, B-cell CLL/lymphoma 2: :, Human secretory protein (TREFOIL FACTOR 3; TFF3 ), Vanin 1:, Calpain, large polypeptide L3 and Monoamine oxidase A.
In yet another aspect, there is provided a system for screening for compounds that modulate TGNP protein function, said system comprising a cell expressing TGNP which is co-transfected with a nucleic acid construct encoding an TGNP-regulated gene or the promoter sequence of such a gene operably linked to a reporter gene.
Suitably said method can be used to identify compounds that enhance cell survival.
In another aspect, there is provided a use of TGNP in an assay for identifying an agent which modulates apoptosis. Cells useful in the methods of the invention may be from any source, for example from primary cultures, from established cell lines, in organ culture or in vivo. Cell lines useful in the invention include cells and cell lines of haematopoietic origin. Suitable cells include HeLa, U937 (monocyte), TF-1, HEK293 (T), primary cultures of neutrophils or cells having neutrophil characteristics, for example HL60 cells, murine FDCP-1, FDCPmix, 3T3, primary or human stem cells. Other suitable cells include cancer cell lines such as U251, SKOV3, OVCAR3, MCF7 PC3, HCT15, 786-0, HT29, M-14, H460 and LnCap.
Where methods are therapeutic, cells may be disease-associated cells such as cancer, inflammatory, autoimmune or neurodegeration-associated cells.
The modulation of apoptosis can be for therapeutic purposes. Accordingly in another aspect of the invention there is provided a method of treatment of disease comprising administering a modulator of TGNP gene expression or functional activity to an individual.
In another aspect, there is provided the use of a modulator of TGNP expression or activity in the manufacture of a medicament for use in the treatment of disease.
Suitably, said modulator is an antisense molecule or an RNA molecule which mediates RNA interference and thus causes a decrease in TGNP expression.
Suitable diseases include cancer, inflammation, autoimmune disease and neurodegenerative disorders.
A number of inflammatory diseases such as asthma, chronic obstructive pulmonary disease (COPD), Cystic Fibrosis (CF), Rheumatoid Arthritis (RA) and Inflammatory bowel disease (IBD) are characterised by a) elevated levels and expression of cytokines and growth factors that act predominantly on myeloid cells, b) prolonged survival of myeloid cells, and c) prolonged activation of myeloid cells. Thus, increased numbers of activated myeloid cells such as neutrophils are associated with, and strongly implicated in, the pathology of a number of these chronic and acute inflammatory diseases (Williams TJ and Jose PJ: Novartis Found Symp 2001 ;234: 136- 41; discussion 141-8; Barnes PJ: Chest 2000 Feb;117(2 Suppl): 10S-4S; Nadel JA: Chest 2000 Feb;117(2 Suppl): 10S-4S; Ward I et al: Trends Pharmacol Sci 1999 Dec;20(12):503-9; Bradbury J and Lakatos L: Drug Discov Today 2001 May l;6(9):441-442).
Accordingly, in one embodiment, there is provided the use of TGNP, or an agent that alters TGNP expression in a cell, in the treatment of inflammatory diseases through the modulation of myeloid cell apoptosis.
In the context of the present invention, the term "myeloid cell" refers to terminally differentiated, non-dividing cells of the myeloid lineage. These cells include neutrophils, eosinophils and monocytes/macrophages. In one embodiment of any aspect of the present invention, the myeloid cell is a neutrophil, eosinophil or monocyte/macrophage.
Inflammatory diseases include, but are not limited to, diseases such as sepsis, Acute Respiratory Distress Syndrome, Pre enclampsia, Myocardial ischemia, reperfusion injury, Psoriasis, Asthma, COPD, bronchiolitis, Cystic Fibrosis, Rheumatoid Arthritis, Inflammatory Bowel Disease, Crohns Disease and Ulcerative colitis.
In another aspect of the invention, there is provided an isolated nucleic acid molecule comprising a promoter, said nucleic acid sequence being selected from the group consisting of: i) a nucleic acid molecule having the sequence set out in SEQ ID NO:2; ii) a nucleic acid molecule having at least 60% homology with i); iii) a nucleic acid molecule hybridising under stringent conditions to i) or ii); and iv) the complement of the sequences set out in i) to iii).
The TGNP promoter region has been identified to comprise a number of sites which bind specific transcription factors or enhancers. Accordingly, in one embodiment there is provided a nucleic acid sequence as set out in i), ii) or iii) above which comprises one or more of the enhancer or transcription factor binding elements selected from the group consisting of C/EBP, Mef-2, CATT, GATA-1, NFKB, PrRE, Pit- 1 , AP2, CRE and Spl and including others known to the art but not specified herein. In another embodiment, said nucleic acid sequence comprises all of these enhancer or transcription factor binding elements.
Suitably activation of transcription from said nucleic acid sequence is regulated by GM-CSF.
In a particularly preferred embodiment, the promoter sequence comprises the sequence set out SEQ ID NO:2.
Suitably the promoter sequence comprises the region of the genomic sequence from -2032 to +4 of the transcription start site for TGNP.
In another aspect of the invention, there is provided a vector comprising a nucleic acid as defined above.
Preferably, said vector comprises a nucleic acid in accordance with the invention operably linked to a reporter gene.
In another embodiment, the vector may further comprise other sequences such as sequences encoding selectable markers.
In a further aspect of the invention, there is provided a method of identifying a compound that modulates expression from the TGNP promoter comprising
- transfecting a cell with a nucleic acid in accordance with the invention operably linked to a reporter gene; - introducing a compound of interest;
- detecting TGNP gene expression by detecting the reporter gene product; and comparing with TGNP gene expression in the absence of the compound of interest.
Suitably modulation of expression may be an increase (activation) or a decrease (inhibition) of expression from the TGNP promoter.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 shows the dose responsiveness of the anti-apoptotic effect of GM-CSF. Optical densities are read at 570nm using a plate reader. The results indicate a direct correlation between survival and concentrations of GM-CSF added to the culture medium.
Figure 2 shows that the fungal metabolite gliotoxin blocks the GM-CSF in the inhibition of neutrophil apoptosis. The method is as described in Example 1. Optical densities are read at 570nm using a plate reader. Gliotoxin effectively blocks the GM- CSF mediated inhibition of neutrophil apoptosis. The blocking effect is not seen when the inactive analogue of gliotoxin, methylgliotoxin is added with GM-CSF. No increased neutrophil apoptosis is seen with the addition of gliotoxin alone to isolated neutrophils, demonstrating that the effect is specific to, and limited to, a reversal of the protective effects of GM-CSF.
Figure 3 shows a phosphoimage scan of a microarray.
Figure 4 shows the analysis of a captured image film by Array Vision™ software.
Figure 5 shows the results of combined code cluster analysis.
Figure 6 shows cluster analysis of LifeGrid filters. TGNP is identified by association, as a modulator of apoptosis and cell survival. Human purified peripheral blood neutrophils are either allowed to undergo spontaneous apoptosis (Apop), or else are treated with 5U/ml GM-CSF to inhibit apoptosis (GM-CSF). Samples are isolated for RNA extraction and microarray gene analysis, 2 h (Apop2 and GMCSF2), 3 h (Apop3), 4 h (Apop4 and GMCSF4), 5 h (Apop5) and 6 h (Apop6 and GMCSF6) post- isolation. In some experiments Gliotoxin (0.1 μg/ml; Glio) or its inactive analogue Methyl Gliotoxin (0.1 μg/ml; Methyl) are added in the presence of GM-CSF. Average fold change values (from two spots on the filters) for selected candidate apoptosis/survival-associated genes are compared to time zero controls (except GM4 which compares fold change of 4 h treatment of GM-CSF plus Gliotoxin with 4 h treatment of GM-CSF with Methyl Gliotoxin control), are analysed by GeneMaths using a Pearson correlation and Ward cluster algorithms. Increased expression (light) and decreased expression (dark) are represented and referenced by a color scale bar. TGNP gene is highlighted in bold.
Figure 7 shows TGNP mRNA is increased in GM-CSF-induced neutrophil survival, and this increased expression is blocked by Gliotoxin. Human purified peripheral blood neutrophils are treated as described in Figure 6. The relative amounts of TGNP transcripts are shown.
Figure 8 shows a dendrogram representation of cluster analysis for Figure 6. Marker genes, with known function in apoptosis and survival are indicated. TGNP gene is marked.
Figure 9 shows TGNP is adjacently correlated with signal transduction associated to apoptosis. Human purified peripheral blood neutrophils are either allowed to undergo spontaneous apoptosis (Apop), or else are treated with 5U/ml GM-CSF to inhibit apoptosis (GM-CSF). Samples are isolated for RNA extraction and microarray gene analysis, 2 h (Apop2 and GMCSF2), 3 h (Apop3), 4 h (Apop4 and GMCSF4), 5 h (Apop5) and 6 h (Apopό and GMCSF6) post-isolation. In some experiments Gliotoxin (0.1 μg/ml; Glio) or its inactive analogue Methyl Gliotoxin (0.1 μg/ml; Methyl) are added in the presence of GM-CSF. Average fold change values (from two spots on the filters) for all (>8,000) genes on the Incyte LifeGrid filters are compared to time zero controls (except GM4 which compares fold change of 4 h treatment of GM-CSF plus Gliotoxin with 4 h treatment of GM-CSF with Methyl Gliotoxin control), and are analysed by GeneMaths using a Pearson correlation and Ward cluster algorithms. Increased expression (light) and decreased expression (dark) are represented and referenced by a color scale bar. TGNP gene is indicated.
Figure 10 shows TGNP gene expression is decreased by cisplatin-induced apoptosis in HeLa cells. HeLa cells are plated into 75cm2 flasks (6xl06 cells/ flask) and allowed to adhere for four hours. After this period, cells are treated with Cisplatin (lug/ml) and incubated at 37°C. RNA samples are isolated and analysed by microarray, using Incyte LifeGrid filters at 0 h, 2 h and 4 h following the addition of cisplatin. Average fold change of the TGNP gene at 2 h and 4h, compared with 0 h is indicated.
Figure 11 shows a graphical representation of the effect of known survival and pro- apoptotic genes on the proliferation/ viability of HeLa cells, as determined by a plaque assay. HeLa cells are either untransfected (Mock), or transfected with control plasmids (Null=empty pcDNA vector, EGFP, the tumor suppressors p53 and p73, and the survival genes SOD and glutathione peroxidase). Cells were quantified by crystal violet staining and measurement of Abs 570nm are the mean +_standard error of three wells.
Figure 12 shows a graphical representation of the effect of TGNP on the proliferation/ viability of HeLa cells, as determined by a plaque assay. HeLa cells are either untransfected (Mock), or transfected with control plasmids (Null=empty pcDNA vector, EGFP, and the tumor suppressor p53), or TGNP. Cells were quantified by crystal violet staining and measurement of Abs 570nm are the mean ^standard error of three wells.
Figure 13 shows the nucleotide sequence for the TGNP promoter. The underlined sequence represents the beginning of the mRNA transcript.
Figure 14 shows enhancer and transcription factor binding elements in the TGNP promoter. Numbers in brackets indicate positions derived from the sequence presented in Figure 13 (SEQ ID NO:2). Figure 15 shows Forward and Side Scatter analysis of TF-1 population by Flow Cytometry. TF-1 cells are cultured for 48h in the presence or absence of GM-CSF (2ng/ml) prior to acquisition and analysis using a FacsCalibre flow cytometer. The area enclosed in the gate represents the live gate region. From this figure, it is observed that there is a decrease of approx. 50% in the number of cells with side scatter parameters of healthy cells in the factor deprived cells.
Figure 16 shows cell cycle analysis by flow cytometry. Apoptotic cells have less DNA, resulting in an increase in low intensity staining, measured as a sub GI peak in fluorescent histograms.
Figure 17 shows a composite of dot plots showing a typical result for TF-1 cells treated under the various conditions. Cells are transduced with either an empty expression vector containing no insert or BCL2 and subjected to the indicated conditions. The presence of BCL2 in TF-1 cells allows more cells to survive GMCSF withdrawal, as determined by the percentage of cells in the live gate. Of particular note, is the lack of debris (bottom left) in BCL2 cells compared to control cells post factor withdrawal, again indicating reduced death.
Figure 18 shows % apoptosis in TFl cells transduced with either TGNP or an empty expression cassette (Control) cultured for 48h in the presence or absence of GMCSF. Following this period, % apoptosis is determined by FSC/SSC characteristics. Percentage apoptosis is calculated by measuring the amount of death in GMCSF free cultures relative to corresponding cultures where GMCSF is present.
DETAILED DESCRIPTION OF THE INVENTION
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art (e.g., in cell culture, molecular genetics, nucleic acid chemistry, hybridisation techniques and biochemistry). Standard techniques are used for molecular, genetic and biochemical methods. See, generally, Sambrook et al, Molecular Cloning: A Laboratory Manual, 2d ed. (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. and Ausubel et al, Short Protocols in Molecular Biology (1999) 4th Ed, John Wiley & Sons, Inc.; as well as Guthrie et al., Guide to Yeast Genetics and Molecular Biology, Methods in Enzymology, Vol. 194, Academic Press, Inc., (1991), PCR Protocols: A Guide to Methods and Applications (Innis, et al. 1990. Academic Press, San Diego, Calif.), McPherson et al., PCR Volume 1, Oxford University Press, (1991), Culture of Animal Cells: A Manual of Basic Technique, 2nd Ed. (R. I. Freshney. 1987. Liss, Inc. New York, N.Y.), and Gene Transfer and Expression Protocols, pp. 109-128, ed. E. J. Murray, The Humana Press Inc., Clifton, N.J.). These documents are incoφorated herein by reference.
Definitions
"Apoptosis" or programmed cell death is a controlled intracellular process characterised by the condensation and subsequent fragmentation of the cell nucleus during which the plasma membrane remains intact. It is an active, highly regulated process distinguished by cell shrinkage and packaging of the cell contents into apoptotic bodies that are subsequently engulfed by macrophages, thus avoiding activation of the inflammatory response (for review see Wyllie, Br. Med. Bull. 53:451- 465, 1997). Apoptotic death is distinct from other cell processes including necrotic cell death and replicative senescence.
By "modulating apoptosis" is meant that for a given cell, under certain environmental conditions, its normal tendency to undergo apoptosis is changed compared to an untreated cell. For example, blood neutrophils have a defined apoptotic tendency - within a population of cells, greater than 80% will apoptose within the first 24 hours. Modulating the apoptosis of blood neutrophils means changing this normal apoptotic tendency such that apoptosis is increased or decreased relative to the normal rate. Similarly, blood neutrophils in the presence of GM-CSF have a decreased tendency to apoptose. Thus, modulating apoptosis of blood neutrophils in the presence of GM-CSF means increasing or decreasing apoptosis relative to their normal decreased tendency under these conditions. A decreased tendency to apoptose may also be a measurable increase in cell survival and may be the result of an inhibition of apoptosis by inhibiting one or more components of the apoptotic pathway. The term "expression" refers to the transcription of a genes DNA template to produce the corresponding mRNA and translation of this mRNA to produce the corresponding gene product (i.e., a peptide, polypeptide, or protein). The term " activates gene expression" refers to inducing or increasing the transcription of a gene in response to a treatment where such induction or increase is compared to the amount of gene expression in the absence of said treatment. Similarly, the terms "decreases gene expression" or "down-regulates gene expression" refers to inhibiting or blocking the transcription of a gene in response to a treatment and where such decrease or down- regulation is compared to the amount of gene expresssion in the absence of said treatment.
"Antibodies" can be whole antibodies, or antigen-binding fragments thereof. For example, the invention includes fragments such as Fv and Fab, as well as Fab' and F(ab')2, and antibody variants such as scFv, single domain antibodies, Dab antibodies and other antigen-binding antibody-based molecules.
The "functional activity" of a protein in the context of the present invention describes the function the protein performs in its native environment. Altering the functional activity of a protein includes within its scope increasing, decreasing or otherwise altering the native activity of the protein itself. In addition, it also includes within its scope increasing or decreasing the level of expression and/or altering the intracellular distribution of the nucleic acid encoding the protein, and/or altering the intracellular distribution of the protein itself.
The terms "variant" or "derivative" in relation to TGNP polypeptide includes any substitution of, variation of, modification of, replacement of, deletion of or addition of one (or more) amino acids from or to the polypeptide sequence of TGNP. Preferably, nucleic acids encoding TGNP are understood to comprise variants or derivatives thereof.
The term "nucleic acid", as used herein, refers to single stranded or double stranded DNA and RNA molecules including natural nucleic acids found in nature and/or modified, artificial nucleic acids having modified backbones or bases, as are known in the art.
An "isolated" nucleic acid, as referred to herein, refers to material removed from its original environment (for example, the natural environment in which it occurs in nature), and thus is altered by the hand of man from its natural state. For example, an isolated polynucleotide could be part of a vector or a composition of matter, or could be contained within a cell, and still be "isolated" because that vector, composition of matter, or particular cell is not the original environment of the polynucleotide. Preferably, the term "isolated" does not refer to genomic or cDNA libraries, whole cell total or mRNA preparations, genomic DNA preparations (including those separated by electrophoresis and transferred onto blots), sheared whole cell genomic DNA preparations or other compositions where the art demonstrates no distinguishing features of the nucleic acids of the present invention.
"Vector" refers to any agent such as a plasmid, cosmid, virus, autonomously replicating sequence, phage, or linear single-stranded, circular single-stranded, linear double-stranded, or circular double-stranded DNA or RNA nucleotide sequence that carries exogenous DNA into a host cell or organism. The recombinant vector may be derived from any source and is capable of genomic integration or autonomous replication.
The term "promoter" or "promoter region" refers to a nucleic acid sequence, usually found upstream (5') to a coding sequence, that is capable of directing transcription of a nucleic acid sequence into mRNA. The promoter or promoter region typically provide a recognition site for RNA polymerase and the other factors necessary for proper initiation of transcription. As contemplated herein, a promoter or promoter region includes variations of promoters derived by inserting or deleting regulatory regions, subjecting the promoter to random or site-directed mutagenesis, etc. The activity or strength of a promoter may be measured in terms of the amounts of RNA it produces, or the amount of protein accumulation in a cell or tissue, relative to a promoter whose transcriptional activity has been previously assessed. A "nucleic acid encoding the promoter sequence of TGNP" means a nucleic acid which is capable of directing transcription of TGNP gene expression. The term moreover includes those polynucleotides capable of hybridising, under stringent hybridisation conditions, to the naturally occurring nucleic acids identified above, or the complement thereof.
"Stringent hybridisation conditions" refers to an overnight incubation at 42°C in a solution comprising 50% formamide, 5x SSC (750 mM NaCI, 75 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5x Denhardt's solution, 10% dextran sulphate, and 20 pg/ml denatured, sheared salmon sperm DNA, followed by washing the filters in O.lx SSC at about 65°C.
The phrase "operably linked" refers to the functional spatial arrangement of two or more nucleic acid regions or nucleic acid sequences. For example, a promoter region may be positioned relative to a nucleic acid sequence such that transcription of a nucleic acid sequence is directed by the promoter region. Thus, a promoter region is "operably linked" to the nucleic acid sequence.
"Transcription" refers to the process of producing an RNA copy from a DNA template. As discussed above, a promoter or promoter region for a gene typically provides a recognition site for RNA polymerase and for the other factors, such as transcription factors or enhancers, which are necessary for proper initiation of transcription. The TGNP promoter region has been identified to comprise a number of sites which bind specific transcription factors or enhancers.
A "reporter gene" is a gene which is incoφorated into an expression vector and placed under the same controls as a gene of interest to express an easily measurable phenotype.
The term "myeloid cell" encompasses terminally differentiated, non-dividing (i.e. non- proliferative) cells derived from the myeloid cell lineage and includes neutrophils or polymoφhonuclear neutrophils (PMNs), eosinophils and mononuclear phagocytes. The latter cells are known as monocytes when in the blood and macrophages when they have migrated into the tissues. Terminal differentiation is the normal endpoint in cellular differentiation and is usually not reversible.
"Inflammatory disorders" or "inflammatory diseases" are disorders characterised by chronic or acute inflammation. This, in turn, is characterised by elevated levels of cytokines and/or survival factors for myeloid cells. These disorders are characterised by the prolongued survival of myeloid cells including neutrophils, eosinophils and monocytes/macrophages which can be present as a mixture of one or more of these cell types. Accordingly, reference to treatment of inflammatory disorders or diseases includes treatment of the individual cell types or treatment of a mixture of different cell types. The resultant increased numbers of these inflammatory cells is associated with the disease pathology. In chronic inflammation a persistent inflammatory response causes damaging effects such as tissue damage. Chronic Inflammatory Diseases include cystic fibrosis, acute respiratory distress syndrome, chronic obstructive pulmonary disease, inflammatory bowel disease and rheumatoid arthritis. Other inflammatory diseases are known to those skilled in the art and include sepsis, Pre enclampsia, Myocardial ischemia, reperfusion injury, Psoriasis, Asthma, bronchiolitis, Crohns Disease and Ulcerative colitis.
Trans Golgi Network integral membrane protein (TGNP)
TGNP may be involved in regulating membrane traffic to and from trans-golgi network
Although there are no curated orthologs, a number of model organisms have proteins showing similarities to TGNP including:
Selected model organism protein similarities
M. musculus pir: B56940 integral membrane protein 40% 435aa
TGN38A R. norvegicus pir: S22415 membrane protein TGN38 40% 480aa long form precursor A. thaliana ρir:T06029 hypothetical protein T28I19.100 21% 345aa
C. elegans pir:T19431 hpothetical protein C25A1.10 24% 352aa
D. melanogaster sp:P19334 TRP drome transient-receptor 24% 333aa
potential protein S.cerevisiae sp:P32583 SR40_Yeast suppressor protein 22% 297aa
SRP40
In addition, a number of calculated orthologs are identified as follows: TGNP
l. Rat X35565 %ID 82.3 mRNA
2. Thale Cress AB026646 %ID 66.0 genomic DNA
3. Mouse D50032 %ID 82.0 complete eds
4. Zebrafish AW778676 %ID 63.1 EST
5. Clawed Frog Y11587 %ID 65.0 mRNA
6. Fly LocusID 43415|DOA %ID 64.2
A number of sequence domains are found within the amino acid sequence for TGNP (as given in SEQ ID NO: 1). These are as follows:
Signal Peptide: Amino acids 1-21 Extracellular Domain: Amino acids 22-381 Transmembrane: Amino acids 382-402 Cytoplasmic Domain: Amino acids 403-480
Endocytosis signal Domain (isoform TGN46 & TGN48) Amino acids 430-433
Endocytosis signal Domain (isoform TGN51) Amino acids 437-440 Endocytosis signal Domain (isoform TGN51) Amino acids 461-464 14X14 AA Tandem Repeats Domain: Amino acids 54-249 Repeat: Amino acids 54-67 Amino acids 68-81 Amino acids 82-95 Amino acids 96-109 Amino acids 110-123 Amino acids 124-137 Amino acids 138-151 Amino acids 152-165 Amino acids 166-179 Amino acids 180-193 Amino acids 194-207 Amino acids 208-221 Amino acids 222-234 Amino acids 235-249
N-Linked Glycosylation motif: Amino acid 39 N-Linked Glycosylation motif: Amino acid 82 N-Linked Glycosylation motif: Amino acid 96 N-Linked Glycosylation motif: Amino acid 152 N-Linked Glycosylation motif: Amino acid 180 N-Linked Glycosylation motif: Amino acid 208 N-Linked Glycosylation motif: Amino acid 222 N-Linked Glycosylation motif: Amino acid 373 N-Linked Glycosylation motif: Amino acid 377
Mutagen (Y->A) Loss of relocalization to the trans-golgi: Amino acid 430
Conflict (G->A): Amino acid 86
Conflict (L->Q): Amino acid 91
Conflict (Q->K): Amino acid 103
Conflict (P->Q): Amino acid 105
Conflict (P->A): Amino acid 158
Conflict (R->W): Amino acid 259
Conflict (G->E): Amino acid 322
Splice Variant (isoform TGN48) Amino acid 437-453
(IFSPPSPNRM VYSSGKR)
Splice Variant (isoform TGN51 ) Amino acids 437-480
(YVLILNVFPA PPKRSFLPQV LTEWYIPLEK DERHQWIVLL SFQL) TGN38, a transmembrane glycoprotein predominantly localized to the trans-Golgi network, has been used to study both the structure and the function of the trans-Golgi network (TGN). The TGN is a key sorting station for proteins. It has been demonstated that TGN38 returns from the plasma membrane via the endocytic pathway. It has therefore been concluded that TGN was structurally and functionally distinct from the Golgi cisternae, indicating that different molecules control membrane traffic from the Golgi cisternae and from the TGN. Sequence analysis confirms that TGN38 has 100% identity to TGN46. It was determined that the human TGN46 (TGNP) gene contains 4 exons and additional TGN46 cDNAs that are produced by alternative usage of 3 -prime splice sites in intron 3 have been identified. The alternatively spliced cDNAs encode the TGN48 and TGN51 isoforms, which have longer C-terminal tails. When expressed in mammalian cells, all 3 forms localized mostly to the TGN. The longer splice variants are identical apart from the longer C-terminal tails. Accordingly, TGN48 has 437/453 amino acid identity and TGN 51 has 437/480 amino acid identity.
Variants and fragments of TGNP
In the context of the present invention the term TGNP also includes within its scope, variants, derivitives and fragments thereof, in as far as they possess the requisite ability to modulate apoptosis.
Natural variants of TGNP are likely to comprise conservative amino acid substitutions. Conservative substitutions may be defined, for example according to the Table below. Amino acids in the same block in the second column and preferably in the same line in the third column may be substituted for each other:
Figure imgf000033_0001
Natural variants of TGNP further include splice variants such as TGN 46, 48 and 51 isoforms as described herein.
Suitable fragments of TGNP will be at least about 5, e.g. 10, 12, 15 or 20 amino acids in length. They may also be less than 100, 75 or 50 amino acids in length. They may contain one or more (e.g. 5, 10, 15, or 20) substitutions, deletions or insertions, including conserved substitutions. A fragment of TGNP used in the methods of the present invention must possess the requisite activity of being capable of modulating apoptosis.
Measuring gene expression
Levels of gene expression may be determined using a number of different techniques.
a) at the RNA level
Gene expression can be detected at the RNA level. RNA may be extracted from cells using RNA extraction techniques including, for example, using acid phenol/guanidine isothiocyanate extraction (RNAzol B; Biogenesis), or RNeasy RNA preparation kits (Qiagen).Typical assay formats utilising ribonucleic acid hybridisation include nuclear run-on assays, RT-PCR and RNase protection assays (Melton et al, Nuc. Acids Res. 12:7035. Methods for detection which can be employed include radioactive labels, enzyme labels, chemiluminescent labels, fluorescent labels and other suitable labels.
Typically, RT-PCR is used to amplify RNA targets. In this process, the reverse transcriptase enzyme is used to convert RNA to complementary DNA (cDNA) which can then be amplified to facilitate detection.
Many DNA amplification methods are known, most of which rely on an enzymatic chain reaction (such as a polymerase chain reaction, a ligase chain reaction, or a self- sustained sequence replication) or from the replication of all or part of the vector into which it has been cloned.
Many target and signal amplification methods have been described in the literature, for example, general reviews of these methods in Landegren, U., et al., Science 242:229- 237 (1988) and Lewis, R., Genetic Engineering News 10:1, 54-55 (1990).
PCR is a nucleic acid amplification method described inter alia in U.S. Pat. Nos. 4,683,195 and 4,683,202. PCR can be used to amplify any known nucleic acid in a diagnostic context (Mok et al., (1994), Gynaecologic Oncology, 52: 247-252). Self- sustained sequence replication (3SR) is a variation of TAS, which involves the isothermal amplification of a nucleic acid template via sequential rounds of reverse transcriptase (RT), polymerase and nuclease activities that are mediated by an enzyme cocktail and appropriate oligonucleotide primers (Guatelli et al. (1990) Proc. Natl. Acad. Sci. USA 87:1874). Ligation amplification reaction or ligation amplification system uses DNA ligase and four oligonucleotides, two per target strand. This technique is described by Wu, D. Y. and Wallace, R. B. (1989) Genomics 4:560. In the Qβ Replicase technique, RNA replicase for the bacteriophage Qβ, which replicates single-stranded RNA, is used to amplify the target DNA, as described by Lizardi et al. (1988) Bio/Technology 6:1197.
Alternative amplification technology can be exploited in the present invention. For example, rolling circle amplification (Lizardi et al., (1998) Nat Genet 19:225) is an amplification technology available commercially (RCAT™) which is driven by DNA polymerase and can replicate circular oligonucleotide probes with either linear or geometric kinetics under isothermal conditions. A further technique, strand displacement amplification (SDA; Walker et al, (1992) PNAS (USA) 80:392) begins with a specifically defined sequence unique to a specific target.
Primers suitable for use in various amplification techniques can be prepared according to methods known in the art.
Once the nucleic acid has been amplified, a number of techniques are available for the quantification of DNA and thus quantification of the RNA transcripts present. Methods for detection which can be employed include radioactive labels, enzyme labels, chemiluminescent labels, fluorescent labels and other suitable labels.
The detection of nucleic acids encoding TGNP can be used, in the context of the present invention, to identify early stage apoptosis in cells - a decrease in TGNP transcripts is associated with the onset of apoptosis. An increase is associated with cell survival and, in particular, is an early response in GM-CSF-mediated inhibition of apoptosis in neutrophils.
b) at the polypeptide level
Gene expression may also be detected by measuring the TGNP_polypeptide. This may be achieved by using molecules which bind to the TGNP polypeptide. Suitable molecules/agents which bind either directly or indirectly to TGNP in order to detect the presence of the protein include naturally occurring molecules such as peptides and proteins, for example antibodies, or they may be synthetic molecules.
Standard laboratory techniques such as immunoblotting can be used to detect altered levels of TGNP, as compared with untreated cells in the same cell population. An example of a suitable protocol is detailed below:
Aliquots of total protein extracts (40μg), are run on SDS-PAGE and electroblotted overnight at 4°C onto nitrocellulose membrane. Immunodetection involved antibodies specific for TGNP, appropriate secondary antibodies (goat, anti-rabbit or goat-anti- mouse: Bio-Rad, CA, USA) conjugated to horseradish peroxidase, and the enhanced ECL chemiluminescence detection system (Amersham, UK).
Gene expression may also be determined by detecting changes in post-translational processing of polypeptides or post-transcriptional modification of nucleic acids. For example, differential phosphorylation of polypeptides, the cleavage of polypeptides or alternative splicing of RNA, and the like may be measured. Levels of expression of gene products such as polypeptides, as well as their post-translational modification, may be detected using proprietary protein assays or techniques such as 2D polyacrylamide gel electrophoresis.
Monitoring the onset of apoptosis
A number of methods are known in the art for monitoring the onset of apoptosis. These include moφhological analysis, DNA ladder formation, cell cycle analysis, externalisation of membrane phospholipid phosphatidyl serine and caspase activation analysis. Cell survival may be monitored by a number of techniques including cell cycle analysis and measuring cell viability. Measurements of cell proliferation may be made using a number of techniques including a plaque assay in which adherent cells are plated out in tissue culture plates and left to grow prior to fixing and staining. The number of colonies formed reflects the amount of cell proliferation.
Modifying the functional activity of TGNP
The functional activity of TGNP may be modified by suitable molecules/agents which bind either directly or indirectly to TGNP, or to the nucleic acid encoding it. Agents may be naturally occurring molecules such as peptides and proteins, for example antibodies, or they may be synthetic molecules. Methods of modulating the level of expression of TGNP include, for example, using antisense techniques. Antisense constructs, i.e. nucleic acid, preferably RNA, constructs complementary to the sense nucleic acid or mRNA, are described in detail in US 6,100,090 (Monia et al), and Neckers et al., 1992, CritRev Oncog 3(1-2):175-231, the teachings of which document are specifically incoφorated by reference.
Suitable antisense molecules may be variants, based on these molecules, which have been chemically modified. For example, the antisense nucleic acids can usefully include altered, often nuclease-resistant, intemucleoside bonds. See Hartmann et al. (eds.), Manual of Antisense Methodology (Perspectives in Antisense Science), Kluwer Law International (1999) (ISBN:079238539X); Stein et al. (eds.), Applied Antisense Oligonucleotide Technology. Wiley-Liss (cover (1998) (ISBN: 0471172790); Chadwick et al. (eds.), Oligonucleotides as Therapeutic Agents - Symposium No. 209. John Wiley & Son Ltd (1997) (ISBN: 0471972797).
Other modified oligonucleotide backbones are, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3 '-5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2"-5* to 5'-2\
Other modified oligonucleotide backbones for antisense use that do not include a phosphorus atom have backbones that are formed by short chain alkyl or cycloalkyl intemucleoside linkages, mixed heteroatom and alkyl or cycloalkyl intemucleoside linkages, or one or more short chain heteroatomic or heterocyclic intemucleoside linkages. These include those having moφholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts. Other methods of modulating gene expression are known to those skilled in the art and include dominant negative approaches as well as introducing peptides or small molecules which inhibit gene expression or functional activity.
RNA-mediated interference (RNAi) is another method for modulating gene expression based on a biological response to double-stranded RNA (dsRNA) resulting in the degradation of homologous mRNA (Dernberg and Kaφen, Cell 111 :159-162, 2002). Since its description in 1998 (Fire and Mello, Nature 391:806-811, 1998) RNAi has rapidly become a standard experimental tool for targeted destruction of mRNAs in worms, flies, plants and mammals (for review see McManus and Shaφ, Nature Genetics 3:737-747, 2002). At present, RNAi is believed to function primarily as a cellular defence mechanism against viruses and transposable elements (Ketting et al, Cell 99:133-141, 1999; Tabara et al, Cell 99:132-132, 1999; see also Elbashir et al, Genes Dev. 15:188-200, 2001). However, RNAi-like processes also appear to be involved in the post-transcriptional regulation of a variety of metazoan developmental processes (reviewed in Ruvkun, Science 294:797-799, 2001).
The introduction of dsRNA to cells triggers the specific degradation of homologous RNAs only within the region of identity with the dsRNA (Zamore et al, 2000). Significantly, RNA interference is initiated when the dsRNA is processed to short 21- 23nt fragments (Zamore et al, Cell 101:25-33, 2000; Bernstein et al, Nature 409:363- 366, 2001). In vitro synthesised 21-23 nucleotide dsRNA molecules, called small interfering RNAs (siRNAs), also induce the RNA interference effect (Elbashir et al, Genes Dev. 15:188-200, 2001). These siRNAs are now used routinely in mammalian cells to study the functional consequences of reducing the expression of specific genes (McManus and Shaφ, Nature Genetics 3:737-747, 2002). Methods for designing effective siRNAs are described, for example, in http://www.ambion.com/hottopics/mai.
In addition, changes in events immediately down-stream of TGNP, such as expression of genes whose transcription is regulated by TGNP expression, can be used as an indication that a molecule in question affects the functional activity of TGNP. Modulator Screening Assays
Compounds having inhibitory, activating, or modulating activity can be identified using in vitro and in vivo assays for TGNP activity and or expression, e.g., ligands, agonists, antagonists, and their homologs and mimetics.
Modulator screening may be performed by adding a putative modulator test compound to a tissue or cell sample, and monitoring the effect of the test compound on the function and/or expression of TGNP. A parallel sample which does not receive the test compound is also monitored as a control. The treated and untreated cells are then compared by any suitable phenotypic criteria, including but not limited to microscopic analysis, viability testing, ability to replicate, histologjcal examination, the level of a particular RNA or polypeptide associated with the cells, the level of enzymatic activity expressed by the cells or cell lysates, and the ability of the cells to interact with other cells or compounds.
Methods for inducing apoptosis are well known in the art and include, without limitation, exposure to chemotherapy or radiotherapy agents and withdrawal of obligate survival factors (e.g. GM-CSF, NGF) if applicable. Differences between treated and untreated cells indicates effects attributable to the test compound.
Myeloid cells die spontaneously in culture although with differing time courses depending on the cell type. Neutrophils in culture apoptose within 24 hours although this can be delayed to over 48 hours in the presence of survival factors. Eosinophil apoptosis is observed over 48 hours with a delay to several days in the presence of survival factors. Macrophages are generally much longer lived. Thus, the ability of a compound to modulate myeloid cell apoptosis can be assessed by monitoring the rate of apoptosis in the presence or absence of the test compound and after the withdrawal of obligate survival factors (e.g. GM-CSF, IL-8, IL-5, G-CSF or BAL) if applicable. Differences between treated and untreated cells indicates effects attributable to the test compound. Expressing TGNP in cells
TGNP may be expressed in cells by introducing vectors encoding the TGNP polypeptide.
Particularly useful in the present invention are those vectors that will drive expression of polypeptides from the inserted heterologous nucleic acid ("expression vectors"). These will often include a variety of other genetic elements operatively linked to the protein-encoding heterologous nucleic acid insert, typically genetic elements that drive transcription, such as promoters and enhancer elements, those that facilitate RNA processing, such as transcription termination and/or polyadenylation signals, and those that facilitate translation, such as ribosomal consensus sequences. As will be recognised by those skilled in the art, conditions that permit expression of the polypeptide from these vectors will depend on the type of vector and cell expression system chosen.
Vectors for expressing proteins are known for expression in prokaryotic cells, in yeast cells, typically S. cerevisiae and in mammalian cells and each include the specifc genetic elements for expression in the particular cell type.
Vector-drive protein expression can be constitutive or inducible. Inducible vectors include either naturally inducible promoters, such as the trc promoter, which is regulated by the lac operon, and the pL promoter, which is regulated by tryptophan, the MMTV-LTR promoter, which is inducible by dexamethasone, or can contain synthetic promoters and/or additional elements that confer inducible control on adjacent promoters.
Methods for introducing the vectors and nucleic acids into host cells are well known in the art; the choice of technique will depend primarily upon the specific vector to be introduced and the host cell chosen. Plasmid vectors will typically be introduced into chemically competent or electrocompetent bacterial cells. Vectors can be introduced into yeast cells by spheroplasting, treatment with lithium salts, electroporation, or protoplast fusion. Mammalian and insect cells can be directly infected by packaged viral vectors, or transfected by lipid, chemical or electrical means.
Expression vectors can be designed to fuse the expressed polypeptide to small protein tags that facilitate purification and/or visualization.
For example, proteins can be expressed with a tag that facilitates purification of the fusion protein. Suitable tags and their purification means are known and include poly- his/immobilized metal affinity chromatography, glutathione-S-transferase/glutathione affinity resins, Xpress epitope/detectable by anti-Xpress antibody (Invitrogen, Carlsbad, CA, USA), myc tag/anti-myc tag antibody, V5 epitope/anti-V5 antibody (Invitrogen, Carlsbad, CA, USA) and FLAG® epitope/anti-FLAG antibody (Stratagene, La Jolla, CA, USA).
For secretion of expressed proteins, vectors can include appropriate sequences that encode secretion signals, such as leader peptides. Expression vectors can also be designed to fuse proteins encoded by the heterologous nucleic acid insert to polypeptides larger than purification and/or identification tags. Useful protein fusions include those that permit display of the encoded protein on the surface of a phage or cell, fusions to intrinsically fluorescent proteins, such as those that have a green fluorescent protein (GFP)-like chromophore, fusions to the IgG Fc region, and fusions for use in two hybrid systems.
TGNP protein can be expressed and purified from systems such as these for use in methods for detecting molecules which interact with TGNP.
Detecting molecules which interact with TGNP
Techniques such as analytical centrifugation, affinity binding studies involving chromatography or electrophoresis can be used to detect molecules which interact directly with TGNP. Those skilled in the art will appreciate that this list is by no means exhaustive. More specifically, it is possible to use TGNP as an affinity ligand to identify agents which bind to it; labeling TGNP with a detectable label and using it as a probe to detect apoptotic products in electrophoresis gels; labeling the TGNP target and using it to probe libraries of genes and/or cDNAs; labeling the TGNP target and using it to probe cDNA expression libraries to find clones synthesizing proteins which can bind to the target; performing UV-crosslinking studies to identify agents which can bind to the target; using the TGNP in gel retardation assays which would detect its ability to bind to nucleic acid encoding identified agents; performing footprinting analyses to identify the regions within a nucleic acid to which the target binds. Those skilled in the art will be aware of other suitable techniques and will appreciate that this list is not intended to be exhaustive.
Another technique that allows the identification of protein-protein interactions is immunoprecipitation. An example of a protocol for immunoprecipitation is detailed below:
For immunoprecipitation, lysates from sonicated, Triton X-100-solublized cells (60μg protein in lOOμl PBS with protease inhibitors) are incubated for 90 min at 37°C with 500 ng affinity-purified rabbit polyclonal antibodies specific for TGNP, followed by an addition of lOμl packed protein A/G-agarose beads (30 min, 37°C: Santa Cruz Biotechnology), vigorous washing of the pellet (10 min at lOOOOg, 3 x) in PBS, 5% SDS PAGE, and immunodetection with an TGNP-specific mAb.
Another useful technique for identifying interacting protein is the yeast-two hybrid system described, for example in Bartel et al. (eds.), The Yeast Two-Hvbrid System. Oxford University Press (1997) (ISBN: 0195109384) the disclosure of which is incoφorated herein by reference.
Protein interactions can also be analysed using protein arrays. These may be generated by a range of different techniques which allow proteins to be deposited on a flat surface at different densities. High density protein arrays can be generated using automated approaches similar to those described for DNA arrays (see below). Proteins interacting with TGNP may be identified by, for example, using TGNP protein to probe an expression array. Positive interactions could then be detected by the presence of, for example, a labelled antibody or by placing a tag on TGNP. The identity of the interacting protein can be determined by techniques such as mass spectrometry.
Cells
Cells useful in the method of the invention may be from any source, for example from primary cultures, from established cell lines, in organ culture or in vivo. Cell lines useful in the invention include cells and cell lines of haematopoietic origin. Suitable cells include HeLa, U937 (monocyte), TF-1, HEK293 (T), primary cultures of neutrophils or cells having neutrophil characteristics, for example HL60 cells, murine FDCP-1, FDCPmix, 3T3, primary or human stem cells.
Measuring global gene expression
Expression of recombinant TGNP in cells can be induced using an expression system including any of those described herein.
Determination of expression levels of genes associated with TGNP will enable the identification of other known or novel genes that play a role in apoptosis.
Regulation of gene activity can be accomplished at a number of levels. Most commonly, regulation is at the transcriptional level - specific transcription factors modulate the expression of subsets of target genes. Post-transcriptional regulation (translational regulation), is determined by the rate and mechanism of RNA processing in the cell, i.e. accumulation, translation and degradation. Subsequent protein-level regulation of genetic activity is accomplished through post-translational modification.
A number of individual gene product types whose expression or function is associated with TGNP gene expression may be screened for in the present invention. These products include polypeptides and nucleic acids. The expression levels assessed may be absolute levels of production of a particular polypeptide or nucleic acid, or the levels of production of a derivative of any polypeptide or nucleic acid. For example, the invention may be configured to measure the level of expression of a particular mRNA splice variant, or the amount present of a phosphorylated derivative of a particular polypeptide.
Where it is desired to monitor the levels of expression of a known gene product, conventional assay techniques may be employed, including nucleic acid hybridisation studies and activity-based protein assays. Kits for the quantitation of nucleic acids and polypeptides are available commercially.
Where the gene product to be monitored is unknown, however, methods are employed which facilitate the identification of the gene product whose expression is to be measured. For example, where the gene product is a nucleic acid, arrays of oligonucleotide probes may be used as a basis for screening populations of mRNA derived from cells.
a) Arrays
Gene Arrays of oligonucleotides specific to gene sequences archived in public domain databases, such as GenBank, are available commercially from a number of suppliers (such as Incyte Genomics, USA). Examples of such commercial arrays are in the form of either nucleotides spotted onto a membrane filter (such as nitrocellulose), or a solid support (such as glass). Commercial Gene Arrays are used to profile the patterns of gene expression which are associated with the process of apoptosis in neutrophils, and other cell types.
Gene Arrays can additionally be constructed specifically, by spotting nucleotide sequences derived from cDNA clones generated from novel libraries or from cDNA clones purchased commercially. Such arrays allow the expression profiling of proprietary and/or novel nucleotide sequences.
Gene Arrays are additionally constructed by commercial sources (e.g. Genescreen), by spotting nucleotide sequences derived from cDNA clones generated from novel libraries or from cDNA clones purchased commercially. Such arrays allow the expression profiling of proprietary and/or novel nucleotide sequences. Many of the cDNA sequences or EST (expressed sequence tag) sequences deposited in the public domain databases are derived from a restricted set of tissue types, such as liver, brain and foetal tissue. The cloning of in-house cDNA libraries which are focused to specific cellular events, such as ROS-mediated apoptosis offers the possibility to identify, clone and characterise novel genes which are associated with this process. Similarly, the cloning of in-house cDNA libraries which are focused to specific tissue types, such as the neutrophil, offers the possibility to identify, clone and characterise novel genes whose expression is restricted to this cell type. Libraries (cDNA) constructed using a physical subtraction, such as the ClonTech 'Select' SSH method (suppression hybridisation) and novel modifications of such, as described, allow the selective cloning of genes whose expression is differentially regulated in the process or cell type being studied. Gene Array technology is combined with SSH cDNA libraries to identify false-positives and further focus on truly differentially expressed genes. Clones from each SSH library constructed are picked, cultured and archived as glycerol stocks. The cDNA inserts contained within individual plasmid clone are PCR amplified and spotted onto in-house arrays. Differential expression is confirmed using hybridisation with a radiolabelled probe generated from the mRNA used for each reciprocal subtractions.
Arrays of nucleic acids may be prepared by direct chemical synthesis of nucleic acid molecules. Chemical synthesis involves the synthesis of arrays of nucleic acids on a surface in a manner that places each distinct nucleic acid (e.g., unique nucleic acid sequence) at a discrete, predefined location in the array. The identity of each nucleic acid is determined by its spatial location in the array. These methods may be adapted from those described in U.S. Patent No. 5,143,854; WO90/15070 and WO92/10092; Fodor etal. (1991) Science, 251: 767; Dower and Fodor (1991) Ann. Rep. Med. Chem., 26: 271.
In a preferred aspect of the invention, arrays of nucleic acids may be prepared by gridding of nucleic acid molecules. Oligonucleotides may be advantageously arrayed by robotic picking, since robotic techniques allow the most precise and condensed gridding of nucleic acid molecules; however, any technique, including manual techniques, which is suitable for locating molecules at discrete locations on a support, may be used.
The gridding may be regular, such that each colony is at a given distance from the next, or random. If molecules are spaced randomly, their density can be adjusted to statistically reduce or eliminate the probability of overlapping on the chosen support.
Apparatus for producing nucleic acid microarrays is available commercially, for example from Genetix and Genetic Microsystems. Moreover, pre-prepared arrays of nucleic acid molecules are available commercially, for example from Incyte Genomics Inc. (Human LifeGrid(TM)). Such arrays will comprise expressed sequence tags (ESTs) representative of most or all the genes expressed in a cell or organism, thus providing a platform for the screening of mRNA populations from multiple ROS-treated cells.
Samples for mRNA population analysis may be isolated and purified by any suitable mRNA production method; for example an RNA isolation kit is available from Stratagene.
In addition, where the gene product is a polypeptide, arrays of antibodies may be used as a basis for screening populations of polypeptides derived from cells. Examples of protein and antibody arrays are given in Proteomics: A Trends Guide, Elsevier Science Ltd., July 2000 which is incoφorated by reference.
b) 2D PAGE
For the monitoring of unknown polypeptide gene products, separation techniques such as 2 dimensional gel electrophoresis are employed. 2D PAGE typically involves sample preparation, electrophoresis in a first dimension on an immobilised pH gradient, SDS-PAGE electrophoresis in a second dimension, and sample detection. Protocols for 2D PAGE are widely available in the art, for example at http://www.expasv.ch /ch2d/protocols/. the contents of which as of 30.11.2001 are incoφorated herein by reference. Samples for 2D PAGE may be prepared by conventional techniques. In the case of the present invention, HeLa cells transfected with TGNP are grown in a suitable medium, such as RPMI 1640 containing 10% foetal calf serum (FCS). The suspension is transferred into a tube and the cells are centrifuged at 1000 g for 5 minutes. Supernatant is discarded and the cells are washed with RPMI 1640 without FCS. After centrifugation and removal of RPMI 1640, 0.8 x 106 cells are mixed and solubilised with 60 μl of a solution containing urea (8 M), CHAPS (4% w/v), Tris (40 mM), DTE (65 mM) and a trace of bromophenol blue. The whole final diluted HeLa sample is loaded on the first dimensional separation.
The method of the present invention advantageously employs a step of establishing a reference expression level for the gene products being investigated. This can be carried out by using un-transfected HeLa cells to serve as a standard for one or more subsequent assays; or it may be an integral part of every assay. For example mRNA or polypeptide populations from HeLa transfected and untransfected cells may be assessed simultaneously on a nucleic acid array or by 2D PAGE, and changes in expression patterns identified by direct comparison.
Analysis of 2D PAGE results, using appropriate software where necessary, reveals polypeptides of interest which may be isolated, sequenced and used to identify genes encoding them.
Method for identifying a promoter sequence.
Suitable methods for identifying a promoter sequence upstream of a gene are known to those skilled in the art. For example, primers may be selected using the Primer Design facility of the GeneTool Lite software (Biotools Inc.), which have minimal internal stability and annealing temperatures of 60°C.
PCR templates are prepared using genomic DNA purified from HL60 cells, isolated using the Qiagen 'Blood and cell culture DNA mini Kit', (Cat. 13323), as per manufacturers instructions. PCR amplifications are performed using lOOng of genomic DNA as template. Amplimers are gel purified using the Qiaquick gel isolation kit (Qiagen, cat. 28706) and ligated to pCDNA3.1 using the Topo-TA cloning kit (Invitrogen, cat. 45-0005) according to the manufacturers instructions. Ligated DNA is transformed to E.coli (ToplO). Transformants are selected for plasmid DNA preparation and sequence analysis.
Plasmid DNA is prepared using either the Qiagen miniprep (cat. 27106) or midiprep (cat. 12643) kits as described by the manufacturer. Insert orientation is determined by PCR with TGNP-specific reverse primer and vector-specific forward primer (T7 primer). Plasmid miniprep DNA (100 ng to 5 μg) is sent to MWG Biotech or Lark Technologies for contract sequencing.
Transcription Factors
The function and context of several of the transcription factors and enhancers for which binding sites have been identified in the TGNP promoter are associated with growth factor signalling, haematopoietic cell differentiation (especially granulocyte lineages), cell survival and also redox regulation, as described:
The C/EBP SV40 enhancer binding site represents the recognition sequence for a liver-specfic transcription factor implicated in the coordinated and tissue-specific transcriptional regulation. This DNA-binding protein also binds to TTR, alpha 1-AT, and albumin regulatory sites (Costa et al (1988) Proc Natl Acad Sci U S A 85: 3840- 3844).
The MEF2 genes are members of the MADS gene family (named for the yeast mating type-specific transcription factor MCM1, the plant homeotic genes 'agamous' and 'deficiens') and the human serum response factor a family that also includes several homeotic genes and other transcription factors, all of which share a conserved DNA- binding domain. They have been associated with cellular differentiation (muscle; Yu et al. Genes Dev. 6: 1783-1798, 1992), growth factor-induction (Pollock and Treisman Genes Dev. 5: 2327-2341, 1991.). MEF2 are also induced via the p38 MAP kinase cascade, in neurons where they are critical for survival (Mao et al. Science 286: 785- 790, 1999). GATA-1 is a haematopoetic transcription factor. GATA1 and friend of GATA1 (FOG) are each essential for erythroid and megakaryocyte development. FOG, a zinc finger protein, interacts with the amino (N) finger of GAT A 1 and cooperates with GATA1 to promote differentiation.
The commitment of multipotent cells to particular developmental pathways requires specific changes in their transcription factor complement to generate the patterns of gene expression characteristic of specialized cell types. C/EBPs and specific Ets family members, together with GATA-1, are important for eosinophil lineage determination (McNagny KM et al. EMBO J 1998 Jul l;17(13):3669-80). GATA-1 and C/EBPbeta synergistically transactivate the promoter of an eosinophil-specific granule protein gene and FOG may act as a negative cofactor for the eosinophil lineage (Yamaguchi Y et al. Blood 1999 Aug 15;94(4):1429-39). FOG is a repressor of the eosinophil lineage, and C/EBP-mediated down-regulation of FOG is a critical step in eosinophil lineage commitment. Maintenance of a multipotent state in hematopoiesis is achieved through cooperation between FOG and GATA-1 (Querfurth E et al. Genes Dev 2000 Oct l;14(19):2515-25).
The well-known Rel/NF-kappaB family of vertebrate transcription factors comprises a number of structurally related, interacting proteins that bind DNA as dimers and whose activity is regulated by subcellular location. This family includes many members (p50, p52, RelA, RelB and c-Rel), most of which can form DNA-binding homo- or hetero- dimers. All Rel proteins contain a highly conserved domain of approximately 300 amino-acids, called the Rel homology domain (RH), which contains sequences necessary for the formation of dimers, nuclear localization, DNA binding and IkappaB binding. Nuclear expression and consequent biological action of the eukaryotic NF- kappaB transcription factor complex are tightly regulated through its cytoplasmic retention by ankyrin-rich inhibitory proteins known as IkappaB (Piette et al (1997) Biol Chem 378(11): 1237-45)
The development of an oxidant/antioxidant imbalance in lung inflammation may activate redox-sensitive transcription factors such as nuclear factor-kappa B (NF-kappa B) and activator protein- 1 (AP-1), which regulate the genes for proinflammatory mediators and protective antioxidant genes. GSH, a ubiquitous tripeptide thiol, is a vital intra- and extracellular protective antioxidant against oxidative stress, which plays a key role in the control of proinflammatory processes. The promoter regions of the human gamma-GCS subunits contain AP-1, NF -kappa B, and antioxidant response elements and are regulated by oxidants, growth factors, inflammatory cytokine tumor necrosis factor-alpha (TNF-alpha), and anti-inflammatory agent (dexamethasone). Fine tuning between the redox GSH levels and the activation of transcription factors may determine the balance of transcription for proinflammatory and antioxidant gamma- GCS genes in inflammation (Rahman IBiochem Pharmacol 2000 Oct 15;60(8):1041- 9).
AP-2 transcription factors represent a family of three closely related and evolutionarily conserved sequence-specific DNA-binding proteins, AP-2alpha, -beta and -gamma. AP-2 proteins play a critical role in cell growth, differentiation and programmed death, where mutations or changes in precisely programmed expression patterns are likely to contribute to congenital malformations or neoplastic diseases (Hilger-Eversheim et al (2000) Gene 260(1-2):1-12). The DNA binding activity of AP-2 in vitro can be reversibly modulated by redox conditions, indeed thioredoxin is a potent stimulator of AP-2 DNA binding, probably through the oxidation state of conserved cysteine residues in the AP-2 DNA binding domain (Huang et al (1998) Biochem Biophys Res Commun 249(2):307-12).
The Sp/KLF family is comprised of at least twenty members which include Spl -4 and numerous kruppel-like factors. Members of this family bind with varying affinities to sequences designated as 'Spl sites' (e.g., GC-boxes, CACCC-boxes, and basic transcription elements). Family members have different transcriptional properties and can modulate each other's activity by a variety of mechanisms. Since cells can express multiple family members, Sp/KLF factors are likely to make up a transcriptional network through which gene expression can be fine-tuned. 'Spl site'-dependent transcription can be growth-regulated, and the activity, expression, and/or post- translational modification of multiple family members is altered with cell growth. Furthermore, Sp/KLF factors are involved in many growth-related signal transduction pathways and their overexpression can have positive or negative effects on proliferation. In addition to growth control, Sp/KLF factors have been implicated in apoptosis and angiogenesis; thus, the family is involved in several aspects of tumorigenesis (Black et al, (2001) J. Cell Physiol. 188(2): 143-60; Philipsen et al (1999) Nucleic Acids Res. 27(15):2991 -3000).
Methods for detecting transcription from a promoter sequence
Transcription from the TGNP promoter sequence or a promoter sequence from a gene whose transcription is controlled by TGNP can be detected using a nucleic acid construct comprising the TGNP promoter sequence operably linked to a reporter gene. A "reporter gene" is a gene which is incoφorated into an expression vector and placed under the same controls as a gene of interest to express an easily measurable phenotype. A number of suitable reporter genes are known whose expression may be detectable by histochemical staining, liquid scintillation, spectrophotometry or luminometry. Many reporters have been adapted for a broad range of assays, including colorimetric, fluorescent, bioluminescent, chemiluminescent, ELISA, and/or in situ staining. Suitable reporter systems are based on the expression of enzymes such as chloramphenicol acetyltransferase (CAT), b-galatosidase (b-gal), b-glucuronidase, alkaline phosphatase and luciferase. More recently, a number of reporter systems have been developed which are based on using Green fluorescent proteins (GFP) or various derivatives or mutant forms including EGFP. Reporter genes and detection systems are reviewed by Sussman in The Scientist 15[15]:25, Jul. 23, 2001 which is incoφorated by reference.
One method for identifying a compound that modulates expression from the TGNP promoter is outlined below. In this method GM-CSF is used to activate transcription from the TGNP promoter but other known or test compounds could be used.
Primers to amplify the promoter region are selected, using the Primer Designer facility of the GeneTool Lite software (Biotools Inc), which have minimal internal stability and annealing temperatures of 60°C. A PCR reaction is carried out to amplify the promoter sequence from genomic DNA. Amplimers are gel purified using the Qiaquick gel isolation kit (Qiagen, cat. 28706) and ligated to pCDNA3.1 using the Topo-TA cloning kit (Invitrogen, cat. 45-0005) according to the manufacturers instructions. Ligated DNA is transformed to E.coli (ToplO). Transformants are selected for plasmid DNA preparation and sequence analysis.
Plasmid DNA is prepared using either the Qiagen miniprep (cat. 27106) or midiprep (cat. 12643) kits as described by the manufacturer. Insert orientation is determined by PCR with TGNP-specific reverse primer and vector-specific forward primer (T7 primer). Plasmid miniprep DNA (100 ng to 5 μg) is sent to MWG Biotech or Lark Technologies for contract sequencing.
U937 cells are transfected with lOμg of an EGFP reporter construct (pEGFP, Clontech), containing a genomic fragment driving the expression of the EGFP gene (TGNP -EGFP). The fragment includes the putative TGNP promoter region. Cells are transfected by the calcium phosphate method. Transfection of the pEGFP vector without the TGNP genomic fragment is used as a negative control whereas a construct containing the CMV promoter serves as a positive control.
U937 cells containing either pEGFP or TGNP-EGFP are treated with GM-CSF (50 Units) either in the presence or absence of gliotoxin (0.1 μg/ml). At the indicated periods of time, cells are examined for EGFP expression by flow cytometric analysis using a FacsCalibre (Becton Dickinson). Cells are considered positive for EGFP expression when the FL1 signal is greater than the background signal generated by either pEGFP or untreated TGNP-EGFP. All values are corrected for transfection efficiency by standardization against β-gal activity, derived from the cofransfected plasmid pSV β -gal (Promega).
An increase in fluorescence is observed in U937 cells transfected with TGNP-EGFP when cultured in the presence of GM-CSF indicating that promoter activity is induced when cells are incubated in the presence of GM-CSF. Treating the cells with GM-CSF in the presence of gliotoxin attenuates this induction. Similarly, there is no increase in fluorescence when U937 cells transfected with pEGFP are treated with GM-CSF. The invention is further described, for the pmposes of illustration only, in the following examples.
EXAMPLES
Bioinformatic Sequence analysis tools
DoubleTwist (www.doubletwist.com) tools were used to analyse the target sequences retrieved from Genbank. The DoubleTwist suite incoφorates a number of research agents to generate computational analysis outputs using algorithms that search multiple gene, protein, and patent databases for information about query sequences. These tools access the DoubleTwist annotated databases and all published information about the query sequences. For the pmpose of this study the following agents were used: Perform Comprehensive Sequence Analysis; Retrieve Assembled ESTs; Retrieve and Analyse Human Genome.
The Comprehensive Sequence Analysis agent uses the BLAST2N, BLAST2X, TBLAST2N, and BLAST2P algorithms to search the following databases: SwissProt; NR-Nuc; NR-Pro; dbEST; PDB; PAT; PATaa; HTG; Genbank's cumulative nightly nucleotide and protein database updates; and Myriad Genetics ProNet database. Additionally the Blimps and Blkprob algorithms are used to search the Blocks+ database. This agent provides information about functional protein identities and similarities, DNA identities and similarities, patented sequences, protein domains, structural identities and similarities, and genomic DNA identities and similarities.
The Assembled ESTs agent (Human) identifies matching EST clusters derived from the DoubleTwist Gene Indices. The Gene Indices are collections of assembled EST and mRNA sequences derived by, screening out non-informative sequences (such as vector and ribosomal sequences), clustering the remaimng sequences, first by matching pairs for overlapping bases, then by sub-dividing into gene variants (subclusters); aligning the sequences in each cluster, and deriving a consensus sequence for each cluster and subcluster. The sequence collection is therefore checked and statistically corrected for many sequencing and cloning errors such as orientation, chimerism, and contamination. DoubleTwist' s interactive data-mining tool Cluster Viewer was used to visualise the alignments.
The "Analyse Human Genome" agent also uses a proprietary DoubleTwist genome database derived from public data. Genomic sequences that are at least 15 kilobases in length are obtained from Genbank's Genomic Sequences Primate (GB PRI) division. Unfinished human genomic sequences are obtained from Genbank's High Throughput Genomic (HTG) Sequences division. The data is annotated by splitting the HTG sequences phase 0, 1, and 2 into component fragments while maintaining the GB PRI sequences intact. Sequence contamination, from vector, bacterial, yeast or mitochrondrial sequences are masked and the Repeat Masker program (http://repeatmasker.genome.washington.edii/cgi-bin/RM2_req.pl) is used to mask repetitive elements and regions of low complexity. The GrailEXP, FGENESH and Genscan algorithms are then employed to predict coding regions, introns and exons. The Halfwise algorithm is used to match predicted coding regions with models from the Pfa database. The Unigene database and the DoubleTwist Human Gene Index are further searched for DNA similarities using the BLASTN algorithm and the NR Pro database is searched, using BLASTX, for similar proteins.
The Double Twist Genomic Viewer, an interactive data mining and visualization tool was used to examine the output from the Genome Analysis agent.
The GeneTool suite from BTI (BioTools Inc) was used for sequence analysis, ClustalW (http://www.ebi.ac.uk/clustalw/) was used for creating multiple alignments. "Translate Tool" at Expasy (http://www.expasy.ch/tools/dna.html) was used to translate nucleotide sequences to protein sequences. ORF finder at the NCBI (http://www.ncbi.nlm.nih.gov/gorfygorf.html) was used to find all open reading frames of a selectable minimum size. Example 1: Gene expression and cluster analysis of neutrophil apoptosis and survival; TGNP is identified by associaήon, as a modulator of apoptosis and cell survival
A model system for the identification of early-regulated genes in apoptosis of human primary neutrophils is described in our co-pending applications WO 01/46469 and WO 02/04657.
Isolation and culture of primary human neutrophils
Whole blood (20-50 ml) is taken from normal healthy volunteers by venepuncture. Coagulation is prevented by the use of sodium citrate. A 6% dextran (mol wt 509,000; Sigma) saline solution is added in 1:4 ratio to whole blood and the erythrocytes allowed to sediment for 45 minutes at 22°C. The buffy coat is then under-layered with 5 ml Ficoll-Paque (Pharmacia LKB Biotechnology) and centrifuged (300g, 30 min) to pellet granulocytes and erythrocytes (Boyum, 1968). The pellet is resuspended in 1 ml cell culture tested water (Sigma) for 40 sec, followed by the addition of 14ml Hanks buffer (Sigma) and centrifuged (300g, 10 min.). This lysis step is repeated to ensure removal of all erythrocytes. The remaining pellet is resuspended in RPMI 1640 supplemented with 10% foetal calf serum (Sigma), L-glutamine (2mM), penicillin (100 U/ml; Sigma), streptomycin (100 μg/ml; Sigma) and amphotericin B (2.5 μg/ml; Sigma). Cell number and viability is checked using trypan blue exclusion (Boyum, (1968) ScandJClin Lab Invest Suppl; 97:77-89).
Isolated neutrophils are maintained at a density of 2 xlO6/ ml in RPMI 1640 supplemented with 10% foetal calf serum (Sigma). Further additions to the medium included L-glutamine (2mM), penicillin (100 U/ml), streptomycin (100 μg/ml) and amphotericin B (2.5 μg/ml) (Sigma). Cells are incubated at 37°C in a humidified CO2 (5%) incubator. As described in by Haslett (Clinical Science 83, pp 639-648, 1992), WO 01/46469 and WO 02/04657, upon culture in a serum-containing cell culture medium these neutrophils undergo spontaneous apoptosis. Dose responsiveness of the anti-apoptotic effect of GM-CSF.
Primary human neutrophils are isolated and purified from peripheral blood of normal healthy individuals. Neutrophils are resuspended in serum containing culture medium together with various amounts of GM-CSF at a density of 2x106/ml, with 1 OOμl plated into a 96 well plate and cultured for 18h at 37°C. After this time lOμl of MTT (5mg/ml) is added to the cultures and incubated for a further 4h at 37°C before solubilisation of the purple coloured formazan with acidic isopropanol. Optical densities are read at 570nm using a plate reader. Figure 1 shows there is a direct correlation between survival and concentrations of GM-CSF added to the culture medium.
For subsequent experiments neutrophils are resuspended in serum containing culture medium containing 5 U/ml of GM-CSF.
Fungal metabolite Gliotoxin blocks GM-CSF inhibition of neutrophil apoptosis.
This describes the identification of an inhibitor for the GM-CSF mediated inhibition of neutrophil apoptosis. The use of this inhibitor allows us to focus in on the specific biochemical events mediating the GM-CSF survival events. In turn one is able to remove some of the noise associated GM-CSF treatment.
Primary human neutrophils are isolated and purified from peripheral blood of normal healthy individuals. Neutrophils are resuspended in serum containing culture medium containing 5 U/ml of GM-CSF at a concentration of 2xl06/ml. Also added to the culture mix is either 0.1 μg/ml of the fungal metabolite Gliotoxin or its inactive analogue bis -Dethio -bis (Methylthio) Methyl Gliotoxin, with lOOμl/well plated into a 96 well plate and culture at 37°C commenced. After the indicated time, lOμl of MTT (5mg/ml) are added to the cultures and incubated for a further 4h at 37°C before solubilisation of the puφle coloured formazan with acidic isopropanol. Optical densities are read at 570nm using a plate reader. Figure 2 demonstrates that gliotoxin effectively blocks the GM-CSF inhibition of neutrophil apoptosis. This blocking effect is not seen when the inactive analogue of gliotoxin, methylgliotoxin is added with GM-CSF. No increased neutrophil apoptosis is seen with the addition of gliotoxin alone to isolated neutrophils demonstrating that the effect is specific to and limited to a reversal of the protective effects of GM-CSF.
Commercial microarrays are used to measure global gene expression associated with neutrophil apoptosis, GM-CSF inhibition of neutrophil apoptosis, and the inhibition of this effect using the fungal metabolite Gliotoxin. In control experiments, an inactive analogue of Gliotoxin, Methyl Gliotoxin is used. Analysis of such microarray results identifies genes whose expression pattern changes (either up-regulation or down- regulation) in an association with a measurable apoptotic phenotype.
Total RNA isolation
Primary human neutrophils are isolated and purified from peripheral blood of normal healthy individuals using standard techniques. Neutrophils are resuspended in serum containing culture medium together with GM-CSF (50 U) at a concentration of 2xl06/ml, and cultured for Oh (control), 2h, 4h and 6h at 37°C. Total RNA is then prepared from both groups using acid phenol/guanidine isothiocyanate extraction (RNAzol B; Biogenesis), or RNeasy RNA preparation kits (Qiagen). Any contaminating genomic DNA is removed by DNase treatment (DNase I, Gibco-BRL). RNA is also prepared from neutrophil cells following treatment (for the time indicated in hours) with GM-CSF (50units/ml), Gliotoxin (lOμM) or MethylGliotoxin (lOμM). RNA is also prepared from neutrophils that have not been exposed to d g (i.e. as an untreated control). RNA is prepared from these cells using two sequential extractions with RNAzol B.
Measurement of global gene expression by Microarray '
The process of microarraying can be used to profile gene expression of thousands of genes simultaneously. The microarray process is described both for the use of Human LifeGrid™microarray filters and can be separated into three parts: the filter, the hybridisation of radiolabelled cDNA probe, and the detection and quantitation of the microarray results.
The microarray filter
This example describes the use of the Human LifeGrid™microarray filters obtained from Incyte Genomics (USA). These filters contain cDNA probes representing approximately 8,400 human mRNAs.
Hybridisation of radiolabelled cDNA probes.
This example describes the synthesis of a radiolabelled cDNA from total cellular mRNA. The labeled cDNA is used to 'probe' DNA fragments, which have been immobilised on to a filter membrane, by complementary hybridisation.
Methodology is as described by manufacturer, for Human LifeGrid™ arrays. Essentially, total cellular RNA (1 μg to 20 μg) or polyA+ mRNA (100 ng to 5 μg) is incubated with an oligo (dT) primer. Primed RNA is reverse transcribed to first strand cDNA in a reaction containing M-MLV reverse transcriptase (RT; alternatively Superscript II is used (Life Sciences)), RT buffer, dNTPs and [α-33P] dCTP (2000- 4000 Ci/mmol) at 42°C for 1 to 5hours. Unincoφorated nucleotides are removed using spin-columns and the labeled probe stored at -80°C until required.
Labeled probes may also be generated from cDNA, genomic DNA or PCR products. In each case a random primed labeling procedure can be used, for example the Ready- Prime Labeling kit (APBiotech), applied as per manufacturers instructions.
Radiolabelled cDNA probe is hybridised to DNA fragments immobilised onto a membrane (typically a nylon or nitrocellulase filter).
Methodology is as described by manufacturer, for Human LifeGrid™ arrays. Essentially, membrane filters are pre-hybridised in hybridisation buffer (5 to 20 ml) at 42°C for 2 to 16 h using a hybridisation oven (Hybaid). Following pre-hybridisation, the labeled cDNA probe is added to fresh hybridisation buffer (5 to 20 ml) and hybridised at 42°C for 14 to 16 h. Following hybridisation, the hybridisation mix is removed and the filters washed with 2 x SSC buffer at RT for 5 min., twice with 2 x SSC, 1% SDS buffer at 68°C for 30 min. and twice with 0.6 x SSC, 1% SDS buffer at 68°C for 30 min.
Detection and quantitation of the microarray results.
This example describes the use of a STORM Phosphoimager to quantitatively image positive signals across the filter arrays. Hybridised filters are wrapped in plastic wrap (Saran) and exposed to a Low-Energy Phosphoimaging screen (Molecular Dynamics). The screen is then placed on the phosphoimager and the gel image captured by scanning at a resolution of 50 microns (See Figure 3).
The captured image file is then analysed using software such as Array Vision (Imaging Research Inc.; See Figure 4). In this example we implement analysis with ArrayVision v5.1. This program contains facilities for spot detection and quantification, and background detection and quantification. This data is then exported to a text file for further analysis. A variety of data fields are exported from the ArrayVision analysis, including; Spot Label, Position, Density, Background, and particularly, Background subtracted density (sDens) and signal/noise ratio (S/N). In this example, the exported text file is up-loaded to an SQL-7.0 database, to populate a table containing array data from all experiments. As the data is imported to the database, a Normalisation factor is calculated and the sDENs values modified accordingly. This Normalised data is stored in a newly created column within the table. The Normalisation factor facilitates accurate comparison between datasets. A number of different calculations may be used. A normalization factor may be derived from Linear Regression calculated by reference to housekeeping genes. Alternatively, the Global Mean is calculated as the average of the sDens values across all of the arrays to be compared and a normalisation factor is then derived by division of the overall spot density with the Global Mean value. Spot density values (individual sDens) are then corrected by multiplying across all values with the normalisation factor. In a similar approach a Global Geometric Mean normalization factor may be calculated and used to adjust the dataset. The data from multiple hybridisation experiments can then be stored in a suitable format, for example in an Access or SQL 7.0 database.
Comparison between arrays generates an output file containing the gene identifier and the fold-change in expression relative to the reference dataset. Fold change, (Tx vs Ty), is calculated by dividing the normalised spot density values of Tx with Ty. In this example, multiple time-course experiments are prepared and fold-change values calculated with reference to the TO time point.
The fold change data derived from comparison of multiple hybridisation experiments can be analysed using a variety of approaches, including hierarchical clustering, (supervised or unsupervised), k-means clustering or self-organising maps. Software enabling these analyses includes the Cluster and Treeview software (M.Eisen, Stanford Uni, USA), J-Express (European Bioinformatics Institute), GeneMaths (Applied Maths, Belgium) or GeneSpring (Silicon Genetics, USA). In this example hierarchical clustering is implemented using the GeneMaths software. Trees are generated using the WARD algorithm with distance calculated using the Pearson similarity metric. Alternatively Euclidean distance metrics are used.
Simplification of Fold-change data
Following cluster analysis, fold-change data can be difficult to inteφret owing to either a very large dataset and/or a wide range in fold change values. The visualization and inteφretation of these datasets may be simplified using codes or combined codes. In this example, each unique gene is represented by at least two identical cDNAs on the array. The fold change value is calculated as described, then for each spot, a value above 5-fold change is accorded a code of 2, a fold-change value of less then 5 but greater then 2 is accorded a code of 1 and a fold-change value of less then 2 is accorded a code value of 0. A combined code is then derived by adding the code values for each identical cDNA on the array. The use of combined codes can greatly simplify the Cluster analysis and the subsequent visualisation (See Figure 5). Comparison of coordinate patterns of gene expression, by bioinformatic data analysis, using this model system, allows the identification of cell pathways and processes associated with apoptosis and survival.
In any given experiment or time course, 'differentially regulated' genes (combined code greater than or equal to 2) are identified and clustered by either normalised sDens (level of expression) or by fold chance values. Candidate genes, associated with apoptosis and survival, are those that are reproducibly differentially regulated in multiple experiments or time courses and are additionally 'reciprocally regulated' in conditions that permit apoptosis versus survival, respectively.
Figure 6 shows the visual representation of a clustered selection of candidate neutrophil apoptosis/survival-associated genes identified of LifeGrid filters. Each row represents the differential regulation of an individual gene. The Fold Change colour scale is shown.
Experiments measuring neutrophil apoptosis, GM-CSF inhibition of apoptosis and Gliotoxin blockage of GM-CSF inhibition of apoptosis were as follows:
Neutrophil apoptosis
Four representative neutrophil apoptosis time course experiments are represented (Apop), with RNA samples isolated at 2 h (Apop2), 3 h (Apop3), 4 h (Apop4), 5 h (Apop5) and 6 h (Apop6) post-isolation of neutrophils. Fold change values are expressed relative to zero hour control samples.
Inhibition of neutrophil apoptosis by treatment with GM-CSF
Three representative GM-CSF time course experiments are represented (GM-CSF), with RNA samples isolated at 2 h (GMCSF2), 4 h (GMCSF4) and 6 h (GMCSF6) post-treatment with GM-CSF. Fold change values are expressed relative to zero hour control samples. Blockage of GM-CSF-mediated inhibition of neutrophil apoptosis by treatment with Gliotoxin
Three representative Gliotoxin time course/experiments are represented. In one, GMCSF is added in the presence of Gliotoxin (Glio) or an inactive analogue Methyl Gliotoxin (Methyl), with RNA samples isolated at 2 h (Glio2 and Methyl2), 4 h (Glio4 and MethyW) and 6 h (Glio6 and Methylό) post-treatment with GM-CSF. Fold change values are expressed relative to zero hour control samples. In the remaining two experiments (GM 4) RNA samples are isolated at 4 h post-treatment with GM-CSF, and fold change values are expressed relative to Methyl Gliotoxin control samples.
Each experimental RNA sample, profiled by microarray, represents the pool of multiple experiments carried out on neutrophils isolated from individual human donors. The number of donor samples used for each experiment/time course is summarised in Table 1.
Figure imgf000062_0001
Average fold change values (from two spots on the array filters) are clustered with GeneMaths, using a Pearson correlation and Ward clustering algorithm. Candidate genes represented in this selection share similar overall expression characteristics, that of an 'apoptosis/survival cluster'. Candidate genes tend to be down-regulated (dark) in multiple experiments and time courses for apoptosis (Apop, GM and Glio; see legend) and up-regulated (light) in experiments and time courses for survival (Methyl and GMCSF; see legend).
One of the differentially expressed genes associated with apoptosis and survival is identified as TGNP.
Example 2; TGNP mRNA is increased in GM-CSF-induced neutrophil survival, and this increased expression is blocked by Gliotoxin
Figure 7 shows the relative amounts of TGNP transcripts isolated from neutrophils treated according to Example 1. Experimental conditions and cluster analysis of average fold change comparisons are as described in Example 1.
Expression of TGNP is up-regulated in multiple experiments between 2 and 6 h following addition of GM-CSF. Up-regulated genes may represent potential survival factor genes, which block or delay the apoptosis in neutrophils. Increased expression of TGNP, following GM-CSF treatment, is blocked by the fungal inhibitor gliotoxin (Glio and GM; see legend).
Example 3: Cluster analysis and gene function
In our co-pending applications WO 01/46469 and WO 02/04657, we have established that gene function can be predicted by correlation to known genes that have a similar pattern of gene expression across multiple experiments. The use of bioinformatics cluster analysis to identify novel pathways and gene function is also described, for example, by Zhao et al. PNAS 98(10): 5631-5636, (2001); Heyer LJ et al. Genome Res. 9(11):1106-15, (1999); Iyer VR et al. Science 283(5398):83-7, (1999); and in Gene Expr 7(4-6):387-400 (1999). Figure 8 shows a dendrogram representation of the association of candidate genes from the cluster analysis illustrated in Figure 1 (performed using the method detailed in Example 1) of TGNP expression compared to other known genes that have a similar pattern of gene expression across multiple experiments. Amongst these are cytochrome c oxidase subunit Vllb (2060789), BH3 interacting domain death agonist (2782033), BCL2-related protein Al (2555673), CD53 antigen (3003048), interleukin 1 receptor antagonist (519653), ATP-binding cassette, sub-family B (MDR/TAP), member (2887130), GRO3 oncogene (617159) and nerve growth factor, beta polypeptide (2887215). All of these genes are known to be involved in apoptosis and survival. Several, including cytochrome c oxidase, CD53 and interleukin 1 receptor antagonist are also associated with Redox regulation.
Cytochrome c oxidase (COX), the terminal component of the respiratory chain complex of most aerobic organisms, is composed of 13 subunits in mammals. Mitochondrial release of cytochrome c is one of the principle stepps initiating the execution of apoptosis. Mitochondrial antisense RNA for cytochrome C oxidase can induce moφhologic changes and cell death in human hematopoietic cell lines (Blood 1997 Dec l;90(l l):4567-77). Apoptosis and ROS detoxification enzymes correlate with cytochrome c oxidase deficiency in mitochondrial encephalomyopathies (Mol Cell Neurosci 2001 Apr; 17(4):696-705).
BH3 interacting domain death agonist, otherwise known as BID, is activated by the pro-apoptotic cascade. This causes BID to oligomerize BAK or BAX into pores that result in the release of cytochrome c. (for review see Cell Death Differ 2000 Dec;7(l 2): 1166-73).
BCL2 -related protein Al, otherwise known as Bfl-1 was first isolated by Lin et al. (1993) as a novel mouse cDNA sequence, designated BCL2 -related protein Al (Bcl2al) and was identified as a member of the Bcl-2 family of apoptosis regulators by the predicted protein sequence. An anti-apoptotic role of Bfl-1 is described in staurosporine-treated B-lymphoblastic cells (Int J Hematol 2000 Dec;72(4):484-90). CD53 is an N-glycosylated pan-leukocyte antigen of 35,000 to 42,000 MW. Increased expression of CD53 has been described on apoptotic human neutrophils (J Leukoc Biol 2000 Mar;67(3):369-73). Voehringer DW et al, described CD53 associated with resistance to ionising radiation, using microarray experiments. Expression of CD53 can lead to the increase of total cellular glutathione, which is the principle intracellular antioxidant and has been shown to inhibit many forms of apoptosis (Proc Natl Acad Sci U S A 2000 Mar 14;97(6):2680-5).
The Inter Leukin 1 receptor antagonist (IL1RN) is a protein that binds to IL1 receptors and inhibits the binding of IL1 -alpha and ILl-beta. Overexpression of interleukin- 1 receptor antagonist provides cardioprotection against ischemia-reperfusion injury associated with reduction in apoptosis (Circulation 2001 Sep 18;104(12 Suppl 1):I308- 13). Hypoxia induces the expression and release of interleukin 1 receptor antagonist in mitogen-activated mononuclear cells (Cytokine 2001 Mar 21;13(6):334-41). Overexpression of IL-lra gene up-regulates interleukin- 1 beta converting enzyme (ICE) gene expression: possible mechanism underlying IL-1 beta-resistance of cancer cells (Br J Cancer 1999 Sep;81(2):277-86).
ATP-binding cassette, sub-family B (MDR/TAP) is homologous to MDRl (multiple dmg resistance). Increased expression and amplification of MDRl sequences were also found in multidrug-resistant sublines of human leukemia and ovarian carcinoma cells. Overexpression of MDRl appears to be a consistent feature of mammalian cells displaying resistance to multiple anticancer drugs and has been postulated to mediate resistance.
GRO3 oncogene: The GRO gene, a CXC chemokine otherwise known as macrophage inflammatory protein 1 beta (MIP-1B), was initially identified by Anisowicz et al. (1987) by its constitutive overexpression in spontaneously transformed Chinese hamster fibroblasts. Neutrophils have been shown regulate their own apoptosis via preservation of CXC receptors. Gro-alpha and IL-8 (CXC chemokines) suppress neutrophil apoptosis (Neu J Surg Res 2000 May l;90(l):32-8). Nerve growth factor, beta polypeptide: Nerve growth factor is a well-characterised cytokine survival factor. NGF withdrawal induces apoptosis in a range of cells in-vitro and in-vivo. Nerve growth factor suppresses apoptosis of murine neutrophils (Biochem Biophys Res Commun 1992 Jul 31;186(2): 1050-6).
The close association of TGNP gene expression, across multiple reciprocal experiments, with a significant number of known apoptosis and survival genes identifies a function for TGNP in neutrophil and cellular apoptosis and survival.
Example 4: TGNP network protein is adjacently correlated with known regulators of protein trafficking.
Many proteins undergo complex trafficking itineraries within eukaryotic cells, cycling between intracellular compartments and the plasma membrane during such processes as nutrient uptake, biosynthetic protein sorting, intracellular signaling and cell movement. However, there appears to be little known about the molecular machinery involved in post -Trans Golgi Network protein trafficking.
We show here in Figure 9, which represents a small sub cluster (graphical representation and dendrogram) of very closely related gene expression patterns across a range of reciprocal neutrophil apoptosis and survival experiments, that TGNP network protein is closely associated with proteins that are known regulators of protein trafficking. The cluster analysis was performed, for averaged normalized sDens (expression level) measurements, across >8,000 genes present on the Incyte LifeGrid filter, using Pearson correlation and Ward cluster algorithms. All details are as for Example 1.
Cofilin 2: Ubiquitous among eukaryotes, the cofilins are essential proteins responsible for the high turnover rates of actin filaments in vivo.. Both bind to F-actin cooperatively and induce a twist in the actin filament that results in the loss of the phalloidin-binding site. This conformational change may be responsible for the enhancement of the off rate of subunits at the minus end of cofilin-decorated filaments and for the weak filament-severing activity. They are usually concentrated in regions containing dynamic actin pools. Actin filament integrity has been shown to be required for the normal positioning and moφhology of the golgi complex (Eur. J. Cell Biol(1998) 76 9-17). Stephens and Banting have identified the F-actin binding protein neurabin as a direct link between the integral membrane protein TGN38 and actin filaments (J. Biol Chem. (1999) 274(42) 30080-30086). In the present example we show that expression of cofilin and TGNP are intimately tied, suggesting that cofilin may regulate trafficking of TGNP-containing membranes.
Stresses and various cell stimuli activate cofilin by inducing dephosphorylation of cofilin in resting vertebrate cells. Cofilin has an nuclear localization signal sequence and translocates into the nucleus together with actin in response to various stresses (Cell Struct Funct. 1996; 21(5):421-4.). Cofilins are essential for cytokinesis, phagocytosis, fluid phase endocytosis, and other cellular processes dependent upon actin dynamics (Annu Rev Cell Dev Biol 1999;15:185-230).
Phospholiase A2, group IVA (cytosolic): Lipids have been implicated in the regulation of membrane-protein trafficking, vesicular fusion, and targeting. Cytosolic Phospholipase A2 is known to be a key regulator if arachidonic acid release in cells. It has also been shown that cPLA(2) plays an important role in determining Golgi architecture and selective control of constitutive membrane-protein trafficking in renal epithelial cells (J Clin Invest 2000 Oct;106(8):983-93).
These results demonstrate a functional association of TGNP expression with genes involved in protein sorting.
Example 5: TGNP network protein is adjacently correlated with Transcriptional Regulation
TGNP is expressed as multiple slice varient mRNAs. Kain et al. (1998) identified two TGN46 cDNAs that are produced by alternative usage of 3 -prime splice sites in intron 3. The alternatively spliced cDNAs encode the TGN48 and TGN51 isoforms, which have longer C-terminal tails (J. Biol. Chem. (1998) 273: 981-988, 1998). It has been suggested that alternative splice forms of TGNP play a role in the selection of the cargo molecules for vesicles arising from the Trans Golgi Network (Ewr. J Cell Biol (2000) 79 790-794).
Recent genetic experiments have revealed an intimate and dynamic role for small nuclear RNA (snRNA) in multiple steps of RNA splicing reactions. These interactions concern not only splice site and branch point definition, but also the catalytic reactions of the first and second steps of splicing. (Current Opin Cell Biol 1993 5(3) 448-54). The mammalian genes encoding snRNA have compact and simple promoter stmctures that can be divided into two groups since some are recognized by RNA polymerase II (class II) and some by polymerase III (class III).
We show here in Figure 9, which represents a small sub cluster (graphical representation and dendrogram) of very closely related gene expression patterns across a range of reciprocal neutrophil apoptosis and survival experiments, that TGNP network protein is closely associated with several proteins which are known regulators of RNA splicing. TGNP is also associated with the expression of transcription factor genes. The cluster analysis was performed, for averaged normalized sDens (expression level) measurements, across >8,000 genes present on the Incyte LifeGrid filter, using Pearson correlation and Ward cluster algorithms. All details are as for example 1.
Glioma amplified sequence 41 : Sequence comparison indicated high similarity between the GAS41 protein, the yeast and human AF9 and human ΕNL Fischer et al. (1997) noted that both AF9 and ΕNL belong to a new class of transcription factors, indicating that GAS41 may also represent a transcription factor (Hum. Molec. Genet. 1997 6: 1817-1822;.
Basic leucine zipper nuclear factor 1 (JΕM-1): After transfection into COS cells, the Jem protein shows a punctuated nuclear localization. It is hypothesized that this novel nuclear factor may act as a transcription factor, or a coregulator, involved in either cell growth control and/or maturation (J Biol Chem, 1998 273, Issue 32, 20347-20353). Small Nuclear RNA activating complex, polypeptide 3, 50kD: The human RNA polymerase II and III snRNA promoters share a common basal element, the proximal sequence element (PSE), which is recognized by a complex referred to as the snRNA- activating protein complex (SNAPc). Biochemical purifications suggest that SNAPc is composed of at least four polypeptides of 43, 45, 50 and 190 kDa, as well as variable amounts of the TATA box binding protein, TBP (EMBO J 1996 Dec 16;15(24):7129- 36).
Dual specificity phosphatases 11(RNA RNP complex- 1 interacting): Protein tyrosine phosphatases, in conjunction with protein tyrosine kinases, regulate the levels of protein tyrosine phosphorylation important for cell growth, differentiation, or transformation. Dual-specificity phosphatases, a subfamily of protein tyrosine phosphatases, play important roles in signal transduction, cell cycle regulation, and tumor suppression. A unique feature of this phosphatase is that it binds directly to RNA in vitro with high affinity. In addition, it was found that Dual specificity phosphatases 11 interacted with splicing factors 9G8 and SRp30C, possibly through an RNA intermediate during a yeast two-hybrid screen. Dual specificity phosphatases 11 exhibited a nuclear-staining pattern that was sensitive to RNase A, but not to DNase I, suggesting that Dual specificity phosphatases 11 in the cells are associated with RNA and/or ribonucleoprotein particles. Taken together, this data suggest that Dual specificity phosphatases 11 is a novel phosphatase that may participate in nuclear mRNA metabolism including RNA splicing (J Biol Chem 1998 Aug 7;273(32):20347-53).
Of further note is our demonstration that in a second, but closely related, subcluster, another protein termed rap6 GTPase activating protein (GAP and centrosome associated) associates with three protein CDC like kinase 3 and more distantly with splicing factor arginine/ serine -rich 11 and general transcripton factor IIF, polypeptide 2 (30kD subunit), all three of which are associated with RNA splicing, thus reinforcing a relationship between Trans Golgi Network Proteins and RNA splicing.
GTPase activating protein (GAP and centrosome associated): This protein displays a GTPase activating protein (GAP) activity for Rab6 (Rap proteins play an important role in vesicular transport and membrane traffic - see Curr Opin Cell Biol (1997) 496- 504 for review). Most of this protein is found in the cytosolic compartment , but a minor pool was associated with the centrosome. In addition, GTPase activating protein (GAP and centrosome associated) was found in complexes with cytosolic γ- tubulin. Therefore, GTPase activating protein (GAP and centrosome associated) could play a pivotal role in events that coordinate Golgi dynamics and organization of microtubule cytoskeleton (EMBO J (1999) 18(7) 1772-1782).
CDC-like kinase 3: The CDC-like kinase 3 (clk3) is part of the Clk family of kinases The three members of the Clk family of kinases (Clkl, 2, and 3) have been shown to undergo conserved alternative splicing to generate catalytically active (Clk) and inactive (ClkT) isoforms. It has been shown that catalytically active hClk2 and hClk3 cause the redistribution of SR proteins and can regulate the alternative splicing of a model precursor mRNA substrate in vivo (Exp Cell Res 1998 Jun 15;241(2):300-8). Splicing factor arginine/ serine -rich 11 : Contained within this 54kD nuclear protein is an arginine/ serine -rich region similar to segments of several proteins that participate in pre-mRNA splicing includingthe Ul small nuclear and "suppressor-of- white-apricot proteins. Similarly, immunolocalization data suggest that this protein may have a role in pre-RNA processing (PNAS 1991 15; 88(18) 8189-93).
General transcripton factor IIF, polypeptide 2 (30kD subunit): This 30 kDa protein is part of the 2 subunit RNA polymerase II transcription factor TFIIF. TFIIF affects RNA polymerase II activity both during the initiation and elongation stages of RNA transcription (PNAS 1995 92: 6042-6046).
These results demonstrate that TGNP is associated with the expression of genes involved in Transcriptional regulation, such as RNA splicing.
Example 6: Effect of cisplatin treatment on TGNP expression.
HeLa cells are obtained from the ATCC (Manassas, Virginia, USA), maintained in DMEM medium with 10% FCS at 37°C in a 5% CO2 atmosphere and treated with cisplatin (1 μg ml). At the time points indicated RNA samples are isolated and analysed for gene expression changes by microarray using Incyte LifeGrid filters as described previously.
TGNP is decreased by cisplatin-induced apoptosis in HeLa cells.
Figure 10 shows TGNP gene expression fold change in Cisplatin treated HeLa cells.
Example 7: Recombinant expression of TGNP is associated with changes in gene expression, associated with apoptosis and survival
This example describes the analysis of oligonucleotide/polynucleotide sequences whose expression changes are associated with expression of TGNP.
Commercial microarrays are used to measure global gene expression associated with TGNP expression in HeLa cells. Analysis of such microarray results identifies genes whose expression pattern changes (either up-regulation or down-regulation) in a functional association with ectopic expression of TGNP. We demonstrate that the genes identified using this approach include many genes whose products have been associated with apoptosis and survival. This identification further establishes a functional cellular role of TGNP in the modulation of growth and survival.
HeLa cells are transiently transfected with pcDNA3.1 containing full-length cDNA for TGNP (46kDa isoform) using the CalPhos Mammalian Transfection Kit (Clontech) according to the manufacturers instructions. HeLa cells are plated in 75cm2 flasks at a concentration of 1.5xl06 cells / flask. The following day, when cells are 70% to 80% confluent cells are transfected and the Cal/Phos soln left on the cells for a further 18 hours at 37°C in a 5% CO2 humidified incubator. Typically, this transfection procedure yield 60 - 70 % transfection efficiency, as judged by FacsCalibre analysis of control EGFP transfected cells. Subsequently, the medium is replaced and cells are cultured for a further 24 hours before each sample is washed twice with PBS and lysed by addition of 1ml of RNAzol. To the 1ml of RNAzol is added lOOμl of chloroform and the solution is centrifuged. The aqueous layer is removed and the RNA is precipitated following addition of an equal volume of ice-cold isopropanol and centrifugation for 20 mins at 12000g at 4°C. The RNA is further cleaned by addition to an RNeasy minispin column (Qiagen) according to the manufacturers instructions. Any contaminating DNA remaining in the elutant is removed by DNAase treatment of samples.
Measurement of global gene expression by 'Microarray' is carried out according to the method outlined in Example 1. cDNA is hybridised to Human Life Grid™ arrays and subjected to quantitative imaging and analysis using a STORM phosphoimager.
Example 8: Recombinant expression of TGNP is associated with the modulation of genes with apoptosis.
In the present example we demonstrate that the there are at least 16 genes which are modulated by overexpression TGNP are implicated in signal transduction mechanisms which result in apoptosis.
Fold increase
GENE
Tax interacting Protein -22 tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation 4 protein, beta polypeptide protein regulator of cytokinesis 1 5 acyl-Coenzyme A oxidase 2, branched chain 5
Cbp/p300-interacting transactivator, with Glu/ Asp-rich carboxy- terminal 4 domain, 2
Interleukin 3receptor, alpha (low affinity) 6
eukaryotic translation initiation factor 3, subunit 6 (48kD): 7
B-cell CLL/lymphoma 9: -6
Rho-associated, coiled-coil containing protein kinase 2: -6
Neuropilin 1 -5 Phosphodiesterase 3 A, cGMP-inhibited -7
B-cell CLL/lymphoma 2: : -6
Human secretory protein (TREFOIL FACTOR 3 ; TFF3 ) -6
Vanin 1 : -4
Calpain, large polypeptide L3 -5
Monoamine oxidase A: -7
TAX interacting proteins : TIP-1 is a 14kD protein that interacts with the human homologue of rhotekin, and that this interaction markedly increase transactivation of the c-Fos Serum Response Element by RhoAN14. As the apoptotic potential of Tax is still debated, the question was answered by testing the susceptibility of Tax(+) and Tax(-) murine fibroblasts to apoptosis under conditions of growth factor withdrawal or treatment with TΝFalpha, which trigger apoptosis through different pathways, i.e., mitochondrial and receptor-mediated pathways, respectively. Results showed that Tax- expressing cells are protected from apoptotic death induced by serum deprivation but are sensitive to TNFalpha-mediated apoptosis, suggesting that Tax expression has different effects on cell death, depending on the apoptotic stimulus used. Analysis of the mechanism(s) involved in the resistance to serum depletion-induced apoptosis indicated that Tax(+) cells do not undergo release of cytochrome c from the mitochondrial intermembrane space or redistribution of Bax from the cytosol to mitochondria, two phenomena critical to the mitochondrial apoptotic pathway (Exp Cell Res 2001 Oct l;269(2):245-55).
Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide: BRAIN PROTEIN 14-3-3, BETA ISOFORM 14-3-3-BETA. The 14-3-3 proteins are a part of an emerging family of proteins and protein domains that bind to serine/threonine-phosphorylated residues in a context specific manner, analogous to the Src homology 2 (SH2) and phospho-tyrosine binding (PTB) domains. 14-3-3 proteins bind and regulate key proteins involved in various physiological processes such as intracellular signaling (e.g. Raf, MLK, MEKK, PI-3 kinase, IRS-1), cell cycling (e.g. Cdc25, Weel, CDK2, centrosome), apoptosis (e.g. BAD, ASK-1) and transcription regulation (e.g. FKHRL1, DAF-16, p53, TAZ, TLX-2, histone deacetylase). In contrast to SH2 and PTB domains, which serve mainly to mediate protein-protein interactions, 14-3-3 proteins in many cases alter the function of the target protein, thus allowing them to serve as direct regulators of their targets. This review focuses on the various mechanisms employed by the 14-3-3 proteins in the regulation of their diverse targets, the structural basis for 14-3-3-target protein interaction with emphasis on the role of 14-3-3 dimerization in target protein binding and regulation and provides an insight on 14-3-3 regulation itself (Oncogene 2001 Oct l;20(44):6331-8).
Protein regulator of cytokinesis 1: PRCl Jiang et al. (1998) identified a human protein, which they designated 'protein regulating cytokinesis- 1' (PRCl), that is involved in cytokinesis. PRCl is a good substrate for several cyclin-dependent kinases (CDK) in vitro and is phosphorylated in vivo at sites that are phosphorylated by CDK in vitro, strongly suggesting that PRCl is an in vivo CDK substrate. PRCl has sequence homology to the budding yeast anaphase spindle elongation factor Asel. Like Asel, PRCl protein levels are high during S and G2/M and drop dramatically after cells exit mitosis and enter GI. PRCl is a nuclear protein in inteφhase, becomes associated with mitotic spindles in a highly dynamic manner during mitosis, and localizes to the cell midbody during cytokinesis. Microinjection of anti-PRCl antibodies into HeLa cells blocked cellular cleavage, but not nuclear division, indicating a functional role for PRCl in the process of cytokinesis (Mol Cell 1998;2(6):877-85).
Acyl-Coenz me A oxidase 2, branched chain: Overexpression of this enzyme in a non-tumorigenic mouse fibroblast cell line (LM tk-) demonstrated > 10-fold increase of intracellular H2O2 when exposed to a fatty acid substrate (100 μM linoleic acid) for 6 to 96 h,. This increase in H2O2 concentration was associated with increased apoptosis as evidenced by DNA fragmentation, in situ terminal deoxynucleotide transferase dUTP nick end-labeling (TUNEL). These results suggest that H2O2 generated by AOX overexpression in immortalized fibroblasts leads to apoptosis, and the extent and duration of H2O2 and possibly other DNA damaging reactive oxygen species generated by the overexpression of peroxisomal AOX can influence apoptosis and neoplastic transformation (Int J Oncol 1998 Jan;12(l):37-44). Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2: The protein EP300 and its paralog CREBBP (CREB-binding protein) are ubiquitously expressed transcriptional co-activators and histone acetyl transferases. The gene EP300 is essential for normal cardiac and neural development, whereas CREBBP is essential for neurulation, hematopoietic differentiation, angiogenesis and skeletal and cardiac development. The CBP/p300-interacting transactivator with ED- rich tail 2 (CITED2) binds EP300 and CREBBP with high affinity and regulates gene transcription. It has been shown that CITED2 interacts with and co-activates all isoforms of transcription factor AP-2 (TFAP2)( Nat Genet 2001 Dec;29(4):469-74). Substantial evidence points to a critical role for the p300/CREB binding protein (CBP) coactivators in p53 responses to DNA damage. p300/CBP and the associated protein P/CAF bind to and acetylate p53 during the DNA damage response, and are needed for full p53 transactivation as well as downstream p53 effects of growth arrest and/or apoptosis. Beyond this simplistic model, p300/CBP appear to be complex integrators of signals that regulate p53, and biochemically, the multipartite p53/p300/CBP interaction is equally complex. Through physical interaction with p53, p300/CBP can both positively and negatively regulate p53 transactivation, as well as p53 protein turnover depending on cellular context and environmental stimuli, such as DNA damage (Eur J Biochem 2001 May;268(10):2773-8).
Interleukin 3receptor, alpha (low affinity): Interleukin 3 (IL-3) promotes development of hematopoietic cells through activation of the IL-3 receptor (IL-3R) complex consisting of alpha and beta subunits. The alpha subunit binds IL-3 with low affinity and forms a high-affinity receptor with the common beta subunit (beta c). The beta c subunit does not bind any cytokine by itself but is involved in the formation of high-affinity functional receptors for IL-5 and GM-CSF. As the alpha subunits provide the specificity to cytokines and beta c plays a major role in signal transduction, IL-3, GM-CSF and IL-5 exhibit similar functions when they act on the same cells. IL3 is a known suppressor of apoptosis haematopoietic cells (EMBO J 1995 Jan 16;14(2):266- 75). Eukaryotic translation initiation factor 3, subunit 6 (48kD): The rate of protein synthesis is rapidly down-regulated in mammalian cells following the induction of apoptosis. Inhibition occurs at the level of polypeptide chain initiation and is accompanied by the phosphorylation of the alpha subunit of initiation factor eIF2 and the caspase-dependent cleavage of initiation factors eIF4G, eIF4B, eIF2alpha and the p35 subunit of eIF3. Proteolytic cleavage of these proteins yields characteristic products which may exert regulatory effects on the translational machinery. Inhibition of caspase activity protects protein synthesis from long-term inhibition in cells treated with some, but not all, inducers of apoptosis (Cell Death Differ 2000 Jul;7(7):603-15).
B-cell CLL/lymphoma 9: BCL9 is associated with B-cell acute lymphoblastic leukemia. It may be a target of translocation in B-cell malignancies with abnormalities of lq21. Its function is unknown. The overexpression of BCL9 may be of pathogenic significance in B-cell malignancies (Blood. 1998 Mar 15;91(6): 1873-81).
Rho-associated, coiled-coil containing protein kinase 2: ROCK2 is a serine/threonine kinase that regulates cytokinesis, smooth muscle contraction, the formation of actin stress fibers and focal adhesions, and the activation of the c-fos, serum response element. ROCK2, is an isozyme of ROCK1. Increased phosphorylation of myosin light chain (MLC) is necessary for the dynamic membrane blebbing that is observed at the onset of apoptosis. ROCK I, an effector of the small GTPase Rho, has recently been identified as a new substrate for caspases. ROCK I is cleaved by caspase-3 at a conserved DETD1113/G sequence and its carboxy-terminal inhibitory domain is removed, resulting in deregulated and constitutive kinase activity. ROCK proteins are known to regulate MLC-phosphorylation, and apoptotic cells exhibit a gradual increase in levels of phosphorylated MLC concomitant with ROCK I cleavage. This phosphorylation, as well as membrane blebbing, is abrogated by inhibition of caspases or ROCK proteins, but both processes are independent of Rho activity. Thus, activation of ROCK I by caspase-3 seems to be responsible for bleb formation in apoptotic cells (Nat Cell Biol 2001 3(4): 346-52).
Neuropilin 1: Lung cancers are reported to always express the neuropilin- 1 receptor for secreted semaphorins. Semaphorins SEMA3B and its homologue SEMA3F are 3p21.3 candidate tumor suppressor genes (TSGs), the expression of which is frequently lost in lung cancers. HI 299 cells transfected with wild-type but not mutant SEMA3B underwent apoptosis. Similarly, it has been reported that supernatant from SEMA3B tranfected COS-7 cells reduced the growth of several lung cancer lines 30- 90% (Proc Natl Acad Sci U S A 2001 Nov 20;98(24): 13954-9).
Phosphodiesterase 3A, cGMP-inhibited. It has been shown that this particular phosphodiesterase can loose its cAMP hydrolytic activity in the presence of cGMP (Proc. Nat. Acad. Sci. 89: 3721-3725, 1992.). The loss of this hydrolytic activity it thought to regulate the decision to undergo apoptosis in selective cells (Cell Signal 2000;12(8):541-8).
B-cell CLL/lymphoma 2: Bcl-2 expression is classically seen as anti-apoptotic. High expression of Bcl-2 and Bcl-XL are commonly found in human cancers and contributes to neoplastic cell expansion and interferes with the therapeutic action of many chemotherapeutic drugs. The functional blockade of Bcl-2 or Bcl-XL could either restore the apoptotic process in tumor cells or sensitize these tumors for chemo- and radiotherapies (Oncogene 2000 Dec 27;19(56):6627-31).
Human secretory protein (Pl.B) mRNA, complete cdsTREFOIL FACTOR 3; TFF3 INTESTINAL TREFOIL FACTOR; ITF: Trefoil factor 3 (TFF3) is an anti- apoptotic peptide secreted by intestinal goblet cells. Moreover, it was found that TFF3- treated IEC-18 cells are resistant to anoikis, an anchorage-related apoptosis in epithelium. In addition, the stable expression of a mutant form of the endogenous NF- kappaB inhibitor (IkappaBalpha(mut)) in IEC-18 cells results in a significant attenuation of anti-anoikic effect of TFF3. Taken together, these data indicate that (1) TFF3 is an endogenous gastrointestinal peptide with anti-anoikic property; (2) TFF3 activates NF-kappaB in enterocytes; and (3) TFF3 -induced resistance to anoikis in intestinal epithelial cells is mediated by a distinct signaling cascade linked to NF- kappaB (Biochem Biophys Res Commun 2000 Aug 11 ;274(3):576-82).
Vanin 1: This gene encodes for pantetheinase enzyme which is a ubiquitiously expressed enzyme which in vitro has been shown to recycle pantothenic acid to produce cysteamine, a potent antioxidant. In this context it has been suggested that this gene might be involved in the regulation of immune function in the context of oxidative stress (FEBS Lett 2000483(2-3): 149-54).
Calpain, large polypeptide L3: Much of the proteolysis that occurs during apoptosis is directed by caspases, a family of related cysteinyl proteases. A relatively small number of cellular proteins are targeted by caspases, yet their function is dramatically affected and apoptosis is triggered. Other proteases, such as granzymes and calpain, are also involved in the apoptotic signaling process, but in a much more cell type- and or stimulus type-specific manner (Semin Cell Dev Biol 2000 Jun;l 1(3):191-201).
Monoamine oxidase A: Several lines of evidence have been accumulating indicating that an important role may be played by mitochondrial homeostasis in the initiation phase, the first stage of apoptosis. Recent data represent the first demonstration that MAO-A inhibitors may protect cells from apoptosis through a mechanism involving the maintenance of mitochondrial homeostasis (FEBS Lett 1998 Apr 10;426(1):155- 9).
These results demonstrate that TGNP function is associated with the expression of genes involved in signal transduction and apoptosis.
Example 9 Functional analysis of TGNP expression in HeLa proliferation 'plaque' assay
Typically, gene function associated with proliferation, survival and death (apoptosis) can be ascertained by the expression of the recombinant gene (mRNA) in a test (model) system by measurement of impact on cell growth and viability. We have established a model 'plaque assay' using HeLa cells to measure this effect (see also Cancer Research 2000 60(16) 4654-60). The 'readout' in this assay identifies a gene function as a ' modulator of cell growth survival ' .
HeLa cells are plated into a 24 well tissue culture plate at a concentration of 1.5 xlO4 /ml. Cells are left to adhere overnight, before transfecting the cells with a pcDNA3.1 plasmid containing the gene of interest (full-length coding mRNA sequence) using a Calcium Phosphate transfection kit (Clontech). Cells are left in the transfection medium for 24h, prior to replacing it with fresh culture medium. Following 24 h, transfected cells are treated with G418 (an antibiotic to select for cells containing an integrated copy of the plasmid and gene of interest, by virtue of the plasmid containing and expressing a gene for neomycin resistance) at a concentration of 500μg/ ml and culture maintained for a further 7 days or until cells in test or control wells become confluent. Cells are then fixed and stained with Crystal Violet (1% in ethanol) for five minutes. To quantify, cells are solubilized by adding 33% Acetic Acid and the absorbance measured by reading the plate at 570nm using a colorimetric plate reader.
This assay is validated by a number of control genes, which are known to affect cell growth/survival, including superoxide dismutase (SOD), glutathione peroxidase, p53 and p73. Superoxide dismutase and glutathione peroxidase are known redox modulators and cell survival factors; SOD was also identified from our neutrophil model by cluster analysis, as in our copending applications WO 01/46469 and PCT/GB01/03101. p73 and p53 are known tumor suppressor genes, which induce cell apoptosis. Figure 11 shows graphical representation of the effect of these known survival and pro-apoptotic genes on the proliferation/viability of HeLa cells, as determined by a plaque assay. It should be stressed that in this assay, a significant increase or decrease in cell proliferation/viability is a functional identification of a 'modulator of cell growth/survival'. For, instance both SOD and glutathione peroxidase are known redox modulators and survival factors but in this assay SOD decreases proliferation/viability in this assay while glutathione peroxidase increases proliferation/viability. Both p73 and p53 decrease proliferation/viability. These results, and those for p73 and p53, in HeLa cells are consistent with the reported data (Cell Growth Differ 1996 Sep;7(9): 1175-86; J Cell Physiol 1998 Jun;175(3):359-69). This is a well-established 'model' system to validate gene function and so is not expected to replicate precisely the cellular context of these genes in the human primary neutrophil.
Figure 12 shows graphical representation of the effect of TGNP on the proliferation/viability of HeLa cells, as determined by a plaque assay. Expression of recombinant TGNP (46kDa isoform) in HeLa cells resulted in significant inhibition of proliferation/viability, at an equivalent level to that elicited by the tumor suppressor gene p53. These results identify TGNP as a 'modulator of cell growth/survival'.
Example 10 Amplification and cloning of coding sequence for TGNP.
Primers are selected using the Primer Designer facility of the GeneTool Lite software (Biotools Inc). Primers are selected to have minimal internal stability and annealing temperatures of approximately 60°C. An Nhel restriction site (underlined) is incoφorated to the 5 'end of the forward primer, to allow for orientation of the insert. Similarly a Notl restriction site (underlined) is incoφorated to the 5 'end of the Reverse primer, to allow for orientation of the insert.
Forward Primer 5'-ciagctagcaccATGCGGTTCGTGGTTGCCTTGG -3'
Reverse Primer 5'-aaaaggaaaagcggccgcTTAGGACTTCTGGTCCAAACGTTGGT-3'
Templates for PCRs are prepared by reverse transcription of total RNA isolated from Hela or HL60 cell lines, or Brain and kidney tissue samples (Stratagene). Briefly, total cellular RNA (1 μg to 20 μg) or polyA+ mRNA (100 ng to 5 mg) is incubated with an oligo (dT) primer. Primed RNA is reverse transcribed to first stand cDNA in a reaction containing M-MLV reverse transcriptase (RT; alternatively Superscript II is used (Life Sciences)), RT buffer, and dNTPs at 42°C for 1 to 2 hours.
PCRs are prepared with primers (500nMol), appropriate templates (1/100 dilution of the reverse transcription reaction), buffer and Taq polymerase (1 unit/reaction) (Qiagen) as directed by supplier. Reactions are subjected to 35 cycles of amplification with denaturation (94°C Imin), annealing (58°C 1 min) and extension (72°C Imin). Products are analysed by gel electrophoresis. Full-length amplimers are gel purified using the Qiaquick gel isolation kit (Qiagen, cat. 28706) and ligated to pCDNA3.1 using the Topo-TA cloning kit (Invitrogen, cat. 45-0005) according to the manufacturers instructions. Ligated DNA is transformed to E.coli (ToplO). Transformants are selected for plasmid DNA preparation and sequence analysis.
Plasmid DNA is prepared using either the Qiagen miniprep (cat. 27106) or midiprep (cat. 12643) kits as described by the manufacturer.
Insert orientation is determined by restriction digestion with Hindlll and Notl. Plasmid miniprep DNA (100 ng to 5 μg) is sent to MWG Biotech or Lark Technologies for contract sequencing. Sequencing reactions are primed using one of the following universal primer sequences:
Ml 3 (-24) Reverse Primer: 5' aac age tat gac cat g 3'
Ml 3 (-48) Reverse Primer: 5' age gga taa caa ttt cac aca gga 3' Ml 3 (-20) Forward Primer: 5' gta aaa cga egg cca gt 3 '
Ml 3 (-40) Forward Primer: 5' gtt ttc cca gtc acg ac 3'
T3 Primer: 5' aat taa ccc tea eta aag gg 3'
T7 Primer: 5' gta ata cga etc act ata ggg c 3'
BGH Primer: 5 'tag aag gca cag teg agg 3'
Example 11 Amplification and cloning of TGNP promoter.
Primers are selected using the Primer Designer facility of the GeneTool Lite software (Biotools Inc). Primers are selected to have minimal internal stability and annealing temperatures of 60°C.
Forward Primer: 5'-tgcactcaagcctgggtgacagag-3' (position 1-24, calculated Tm 60 degrees)
Reverse Primer: 5'-cctctccagtcccgcccctg-3' (position 2017-2036, calculated Tm 60 degrees) Amplimer size 2036bp.
Templates for PCR are prepared using genomic DNA purified from HL60 cells using the Qiagen 'Blood and cell culture DNA mini Kit', (Cat. 13323), as per manufacturers instmctions. PCR amplifications are performed as described previously using lOOng of genomic DNA as template.
Amplimers are gel purified using the Qiaquick gel isolation kit (Qiagen, cat. 28706) and ligated to pCDNA3.1 using the Topo-TA cloning kit (Invitrogen, cat. 45-0005) according to the manufacturers instmctions. Ligated DNA is transformed to E.coli (ToplO). Transformants are selected for plasmid DNA preparation and sequence analysis.
Plasmid DNA is prepared using either the Qiagen miniprep (cat. 27106) or midiprep
(cat. 12643) kits as described by the manufacturer.
Insert orientation is determined by PCR with TGNP-specific reverse primer and vector-specific forward primer (T7 primer). Plasmid miniprep DNA (100 ng to 5 μg) is sent to MWG Biotech or Lark Technologies for contract sequencing.
The promoter sequence of TGNP is given in Figure 13 as SEQ ID NO:2.
The following promoter sites are identified and shown in Figure 14:
C/EBP: SV40 C enhancer binding protein recognition site (TC*TACTC) Costa, R.H. et al., Proc Natl Acad Sci U S A 85: 3840-3844 (1988)
Mef-2: Mammalian MEF-2 recognition site ([CT]TA[AT]AAATA[AG]) Faisst, S. & Meyer, S. Nucleic Acids Res 20: 3-26 (1992)
CATT: Mammalian CATT-BP recognition site (GTCACCATT)
Tuφaev, K.T. & Vasetskii, E.S. Genetika 26: 804-816 (1990)
GATA-1: Vertebrate GATA-1 recognition site ([AT]GATA[AC][CG][AGC]) Tuφaev, K.T. & Vasetskii, E.S. Genetika 26: 804-816 (1990) NFkB: Mammalian NF-kB recognition site (GGG[AG][ACT]T[CT][CT][ACT]C) Lenardo, M.J. & Baltimore, D. Cell 58: 227-229 (1989)
PrRE: Mammalian prolactin response element (CCTGA[AT][AT]A) Gutierrez-Hartmann A. et al., Proc Natl Acad Sci U S A 84: 5211-5215 (1987)
Pit-1: Pit-l/GHF-1 (homeo domain) binding sequence ([TA][TA]TAT*CAT) Lewin, B., Genes IV, Oxford University Press, Oxford (1990) p. 565
AP2 : Mammalian AP-2 recognition site (G[CG] [CG] [AT]G[CG]CC) Mitchell, P.J. et al., Cell 50: 847-861 (1987)
CRE: Human PI promoter CRE element, cAMP responsive (TGA[TC][GC]TCA) Lichtenheld, M.G., Podack, E.R., J Immunology 143: 4267-4274 (1989)
Spl: Vertebrate Spl recognition site ([GT][AG]GGC[GT][AG][AG][GT]) Faisst, S. & Meyer, S. Nucleic Acids Res 20: 3-26 (1992)
Example 12 Transient transfection in U937 cells and analysis of GM-CSF responsiveness.
GM-CSF enhances TGNP promoter activity in U937 cells.
U937 cells are transfected with lOμg of an EGFP reporter constmct (pEGFP, Clontech), containing a 2,036bp human genomic fragment driving the expression of the EGFP gene (TGNP-EGFP). The fragment represents the region from -2032 to +4 of the transcription start site, including the putative TGNP promoter region. The 2036bp fragment is cloned to the Topo-TA vector (described above) and subcloned to pEGFP using BamH and Xbal restriction sites.
U937 macrophage cell line was cultured at 37°C under 5% CO2 in RPMI supplemented with 10% foetal calf serum. Cells were transfected by the calcium phosphate method. Transfection of the pEGFP vector without the TGNP genomic fragment is used as a negative control whereas a constmct containing the CMV promoter serves as a positive control.
EGFP Assay
U937 cells containing either pEGFP or TGNP-EGFP are treated with GM-CSF (50 Units) either in the presence or absence of gliotoxin (0.1 μg/ml). At the indicated periods of time, cells are examined for EGFP expression by flow cytometric analysis using a FacsCalibre (Becton Dickinson). Cells are considered positive for EGFP expression when the FLl signal is greater than the background signal generated by either pEGFP or untreated TGNP-EGFP. All values were corrected for transfection efficiency by standardization against β-gal activity, derived from the cofransfected plasmid pSV β-gal (Promega).
An increase in fluorescence is observed in U937 cells transfected with TGNP-EGFP when cultured in the presence of GM-CSF indicating that promoter activity is induced when cells are incubated in the presence of GM-CSF. Treating the cells with GM-CSF in the presence of gliotoxin attenuates this induction. Similarly, there is no increase in fluorescence when U937 cells transfected with pEGFP are treated with GM-CSF.
Example 13 Ectopic expression of TGNP enhances apoptosis of Growth factor dependent cell line TFl
The erythroleukaemic TFl cell line is growth factor dependent, requiring GM-CSF for survival in culture. Withdrawal of GM-CSF causes TFl cells to undergo spontaneous apoptosis. The impact of candidate regulators of the apoptotic process, such as TGNP, can be determined in these cells by measuring the extent of apoptosis following introduction of the candidate gene to the cells. Material and Methods
Analysis of TF-1 Apoptosis by Light Scatter Analysis
Light Scatter Analysis takes advantage of the fact that by using the laser beam of a flow cytometer one can determine the size (Forward Scatter) and granularity (Side Scatter) of a cell. The moφhological changes associated with apoptosis, such as decreased size (shrinkage) and granularity affect these parameters. As a consequence, cells undergoing apoptosis will move to the left and slightly down, from the parameters of a healthy population.
TF-1 cells are plated into 24 well plates (2xl05/ml) and are cultured for 48h in the presence or absence of GM-CSF (2ng/ml). Cells are then harvested by centrifugation (lOOOφm, for 10 min) and washed in PBS. The pellet is resuspended in PBS (2xl05 cells/ml) and acquired by a FacsCalibre. Forward and Side scatter parameters are assessed using Cell Quest software.
The analysis may be enhanced by co-expression of marker genes such as Green
Fluorescent Protein, and subsequently measuring apoptosis or survival of the 'tagged' cells.
Analysis of TF-1 Apoptosis by sub GI analysis
As cells undergo apoptosis, endonucleases break down DNA in the nucleus.
Subsequent fixation and washing allows the degraded low molecular weight DNA to be extracted from the cell. As a result, cells that have undergone apoptosis contain less DNA and stain less intensely when treated with propidium iodide. Consequently, cells with fractional DNA content are located to the left of the GI peaks (sub GI) on DNA frequency histograms.
TF-1 cells are cultured for 48h in the presence or absence of GM-CSF (2ng/ml). Cells are then harvested by centrifugation (lOOOφm, for 10 min) and washed in PBS. The pellet is resuspended in PBS (2xl05 cells/ml) and 1ml is then added in a dropwise fashion to ice cold 70% EtoH whilst continuously vortexing. Cells are then permeabilized by incubating at -20°C for 24 h. To stain DNA, cells are centrifuged and washed in PBS. Cells are resuspended in 500μl Propidium Iodide Buffer (Propidium iodide (50μg/ml); RNAse A (50μg/ml) for 15 min in the dark before flow cytometric analysis using a FacsCalibre (Becton Dickinson). Analysis is performed using Cell Quest software.
RESULTS
GM-CSF withdrawal decreases the percentage of cells in live gate
Culturing TF-1 cells in the absence of GM-CSF induces cell death. This death induces moφhological changes in the Forward and Side Scatter parameters that can be detected by FacsCalibre analysis. Consequently, by observing the percentage of cells in the live gate (which is an arbitrary region pre-set on a healthy population of TF-1 cells grown in the presence of GM-CSF (2ng/ml)), one observes that there is a decrease in the percentage of cells with these light scatter parameters, when cytokine is withdrawn.
Figure 15 shows the percentage of cells in the live gate decreases from 77% to 35% upon factor withdrawal for 48h, representing a decrease of approx. 50% over the time period.
DNA degradation, due to endonucleases activated during the apoptotic process, and subsequent release during the fixation and washing process results in a population of cells with reduced fluorescence upon propidium iodide staining as analysed by a fluorescence histogram (sub GI).
Figure 16 shows TF-1 cells grown in the absence of GMCSF for 48 h have an increase of cells with sub-Gl profiles from 5% to approximately 55%, indicative of the cells undergoing apoptosis.
Expression of BCL2 inhibits the apoptosis of Tf-1 cells A number of gene products have been previously shown to regulate the effect of apoptotic stimuli on cells. The archetypical example of this is BCL2 protein expression where over-expression of this gene, has previously been shown to inhibit apoptosis in a number of cellular systems. (Hockenbery D, Nunez G, Milliman C, Schreiber RD, Korsmeyer SJ, Nature 348(6299):334-6, 1990). We have transduced the human BCL2 gene into TF-1 cells to examine its effect on survival following GMCSF withdrawal.
To assess the antiapoptotic effect of BCL2 over-expression in TF-1 cells, the BCL2 coding sequence is cloned into the retroviral expression vector pMSCV (Clontech). Plasmids are transfected into the retroviral packaging cell line Phoenix 293 (Nolan Laboratory, Standford University) using the CalPhos Mammalian Transfection Kit (Clontech) according to the manufacturer's instmctions. Retrovims is harvested 72 hours later. Retrovims is transduced to TFl cells by incubation for 18 hours. Media is changed and cells are incubated for an additional 96 hours. Cells are transduced with either BCL2 plasmid or control plasmid. The cells are then induced to undergo apoptosis by withdrawal of GMCSF for 48h. The percentage of transduced cells remaimng in the live gate (an arbitrary region pre-set on a healthy population of TF-1 cells grown in the presence of GM-CSF (2ng ml)) is recorded. An index of antiapoptotic activity is calculated by computing the difference in samples +/- GMCSF.
As can be seen in Figure 17, removal of GMCSF from the culture medium induces apoptosis of control cells, as determined by the number of cells moving out of the live gate (indicated by the gate). In contrast, expression of BCL2 reduces the number of cells moving from the live gate. The ability of BCL2 to prevent GMCSF withdrawal induced apoptosis has been peviously reported (Ito, Overexpression of bcl-2 suppresses apoptosis in the human leukemia cell line TF-1, Rinsho Byori 1997, 45(7) 628 -37).
These data illustrate the appropriate nature of this assay for determination of apoptotic or survival activity. TGNP over-expression inhibits apoptosis in TFl cells.
To assess the apoptotic activity of TGNP, TFl cells are transduced with either a retroviral expression vector expressing the TGNP coding sequence (TGNP plasmid) or a control retrovims. The TGNP coding sequence encoding the amino acid sequence set out in SEQ ID NO: 1 is cloned into the retroviral expression vector pMSCV (Clontech). Plasmids are transfected into the retroviral packaging cell line Phoenix 293 (Standford) using the CalPhos Mammalian Transfection Kit (Clontech) according to the manufacturer's instmctions. Retrovims is harvested 72 hours later. Retrovims is transduced to TFl cells by incubation for 18 hours. Media is changed and cells are incubated for an additional 48 hours in the presence or absence of GMCSF.
The cells are examined for viability after 48 hours using forward scatter/side scatter parameters. Figure 18 shows he percentage apoptosis of control and TGNP cells in the absence of GMCSF. The control cells have undergone extensive apoptosis (32%) while the TGNP cells remain viable, demonstrating 11% apoptosis. These data demonstrate that TGNP mediates a strong anti-apoptotic effect in TFl cells.
Example 17 Knock-down of TGNP gene expression using interfering RNA (RNAi)
siRNA oligos
The TGNP CDS is screened for AAN19TT siRNA target sequences with a GC content of 40-55% (http://www.ambion.com/techlib/misc/siRNA_finder.html). Candidate targets are subject to a BLAST search against the Genbank database to ensure that the selected sequences share no significant homology with any other human genes.
The oligonucleotides selected are:
5' AGACCCAAAAAGACAGCCCtt 3' (sense)
5' GGGCUGUCUUUUUGGGUCUtt 3' (antisense) These are chemically synthesised as N19(RNA) +TT(DNA) by Eurogentec. The oligos are annealed at a concentration of 20μM in annealing buffer (lOOmM potassium acetate, 30 mM HEPES-KOH, pH 7.4, 2 mM magnesium acetate) for 1 min at 90°C followed by 1 hour at 37°C. Duplex siRNAs are stored at -20°C until required.
Testing siRNA efficacy
The TGNP siRNA is initially tested for efficacy in Hela, U251 or PC3 cells. Cells were plated at a density of 7.2 x 104 in each well of a 6 well plate and incubated at 37°C overnight in DMEM culture medium (IX Dulbeccos modified Eagles medium (Sigma D2554), 0.004% folic acid, 4 mM L-glutamine, 0.37% sodium bicarbonate, 0.1 mM sodium pyruvate) containing 10% foetal calf serum (FCS). 2μg of duplex siRNA is transfected into Hela cells using DMRIE-C reagent (Invitrogen 10459-014) according to the manufacturer's recommendations. Additional wells of cells are transfected with 2 μg of a scrambled control. The latter sample serves as a positive control for RNAi and also demonstrates the specificity of the TGNP knock down by TGNP siRNA. The sequence of the scrambled control siRNA is
Sense : UGAGAAUGUGAUGCGCGUCTT Antisense: GACGCGCAUCACAUUCUCATT
The cells are harvested 24 hours post transfection by trypsinization and the levels of TGNP transcript are compared by Q-PCR (quantitative polymerase chain reaction). RNA is isolated using Qiagen' s RNeasy Miniprep columns (Qiagen 74104) after lysis on QIAshredder columns (Qiagen 79654). The RNA is quantified by spectrophotometric analysis and 1 μg was reverse transcribed into cDNA using SuperScriptll RNAseH-Reverse Transcriptase (Invitrogen 18064-014).
Q-PCR primers are designed to amplify a PCR product of 149 nucleotides in length from the CDS of TGNP, following the guidelines outlined in the Quantitect SYBR Green PCR handbook from Qiagen. Forward primer: 5' caaggtggttccagagcagcc 3' Reverse primer: 5' gctgccatttccagaaccgtt 3'
Primers are synthesised by MWG Biotech.
Two template standards are used for quantitative PCR assessment of mRNA levels:
1. A control RPS13 (NM_001017) amplified PCR product diluted to [1000,100,10,1 and 0.1 fg] respectively, used to quantify the level of transcript; 2. RPS13 amplified from sample templates as separate PCR reactions for normalisation puφoses.
The cDNA templates from appropriate cells transfected with either TGNP or missense siRNA, and a mock-transfected control, are amplified with TGNP Q-PCR primers using QuantiTectSYBR Green PCR kit (Qiagen 204143) on a DNA Engine Opticon System (MJ Research). The amplification conditions include a 95°C step for 15 min for initial activation of HotStarTaq DNA polymerase, followed by 35 cycles of (15s at 94°C, 30s at 60°C, 30s at 72°). The fluorescence of the samples at 521 nm is read between the annealing and extension steps of the protocol. The melting curves are calculated at the end of the 35 cycles and confirm product homogeneity.
A standard curve is plotted using the log [template quantity] of the RPS13 control template dilutions (as above) versus cycle number at which the fluorescence intensity measured in the well exceeds the level specified in the cycle threshold parameters (the C(T) value). An estimate of the quantity of initial template in treatment samples is determined from this plot and the amount of TGNP present in each sample is normalized across samples by calculating the ratio of TGNP to RPS13 for each sample.
The normalised expression values are used to estimate percentage knockdown of TGNP with reference to the control transfected cells, (in this case cells transfected with missense RNAi). Following confirmation of siRNA activity in test cells, the siRNA duplex is introduced to the model cell line. Model cell lines preferebaly include, but are not limited to, TFl, U251, SKOV3, OVCAR3, MCF7, PC3, HCT15, 786-0, HT29, M-14, H460, LnCap and PC3.
Model cells, 4 x 105 cells/ well, are transfected with 2 μg of siRNA in each of 7 wells of a 24 well plate using 8 μl DMRIE-C reagent (InVitrogen). Cells are simultaneously transfected in parallel with a control missense siRNA. The transfection media is replaced after four hours with fresh media containing 10% FCS and incubated at 37°C. These cells are harvested 48 and 72 hours post transfection for Q-PCR and phenotypic assays. RNA is isolated, cDNA is reverse transcribed and Q-PCR was performed as described above.
Alternatively TFl cells, 4 x 105 cells/ well, are transfected with 2 μg of siRNA in each of 7 wells of a 24 well plate using 8 μl DMRIE-C reagent (InVitrogen). Cells are simultaneously transfected in parallel with a control missense siRNA. Recombinant
GMCSF is added to the OPTI-MEM media during transfection. The transfection media is replaced after four hours with fresh RPMI 1640 containing GMSCF and 10% FCS and incubated at 37°C. Twenty-four hours post-transfection, the media are changed; RPMI 1640 +10% FCS containing GMSCF is added to 3 wells and RPMI 1640 +
10% FCS without GMSCF is added to the other 3 wells. These cells are harvested 48 and 72 hours post transfection for Q-PCR and phenotypic assays. Control TFl cells, which are not transfected, are similarly treated. Samples are labelled T48+G, T48-G,
T72+G, T72-G, according to the time of harvesting post-transfection and the presence (+G) or absence (-G) of GM-CSF in the media. RNA is isolated, cDNA is reverse transcribed and Q-PCR is performed as described above.
Survival assays used are: 1. Cell count, Cell counts are determined using a haemocytometer. Cell viability is determined using the MTT assay. Briefly, 5mg/ml MTT in PBS was added to lOOμl aliquots of cells, mixed thoroughly and incubated for 4 hours at 37°C. Mitochondrial succinate dehydrogenase of viable cells can convert the soluble MTT salt to an insoluble blue formazan crystal. Addition of lOOμl of 0.1 N HCl/Isopropanol allows the samples to be read at 570nm on a Molecular Devices Emax precision micro plate reader.
2. Percentage of cells with Forward Scatter/Side Scatter (FSC/SSC) profiles of healthy cells (as described above).
TF-1 cells are plated into 24 well plates (2xl05/ml) and are cultured for 48h in the presence or absence of GM-CSF (2ng/ml). Cells are then harvested by centrifugation (lOOOφm, for 10 min) and washed in PBS. The pellet is resuspended in PBS (2xl05 cells/ml) and acquired by a FacsCalibre (HP Biosciences). Forward and Side scatter parameters are assessed using Cell Quest software.
3. Percentage of cells with in the Sub GI phase of growth as a measure of the apoptosis in the cells (as described above)
SubGl parameters are obtained by resuspending cells in a buffer, (0.1% Sodium Citrate, 0.1% TritonX-100, 200μl of Propidium Iodide at 5mg/ml made up to 20mls in PBS) and staining for 7hours at 4°C in the dark. The PI stained cells are then acquired by the flow cytometer. Analysis of FL2 fluorescence is performed on Cell Quest software to allow quantification of the Sub-Gl phase of the cell.
Example 18 Differential expression of TGNP is associated with inflammatory diseases
Blood samples (20ml) are obtained with informed consent from a group of patients suffering from Cystic Fibrosis (CF), Chronic Obstructive Pulmonary Disease (COPD) and Sepsis. Neutrophils are prepared from these samples as described (Example 1). The isolated neutrophils are lysed in RNAZol (Biogenesis) and RNA is prepared as described (Example 1). Following reverse transcription, cDNA from these samples is used for array hybridization and quantitative PCR. Differential gene expression is determined by reference to a pooled set of samples from normal controls. Up regulation of TGNP in disease samples is confirmed by quantitative PCR.
All publications mentioned in the above specification, and references cited in said publications, are herein incoφorated by reference. Various modifications and variations of the described methods and system of the present invention will be apparent to those skilled in the art without departing from the scope and spirit of the present invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention which are obvious to those skilled in molecular biology or related fields are intended to be within the scope of the following claims.

Claims

1. A method for detecting apoptosis in a cell comprising detecting a decrease in TGNP activity or expression by detecting a decrease in any one of: i) a TGNP polypeptide having an amino acid sequence as set out in SEQ ID NO: l; ii) a polypeptide having at least 80 % homology with i); iii) a nucleic acid encoding a polypeptide having the sequence set out in i) or ii); iv) a nucleic acid which hybridises under stringent conditions to the sequence set out in iii); or v) the complement of iii) or iv).
2. A method of modulating apoptosis in a cell comprising the step of increasing, decreasing or otherwise altering the functional activity of i) a TGNP polypeptide having an amino acid sequence as set out in SEQ ID NO: i; ii) a polypeptide having at least 80% homology with i); iii) a nucleic acid encoding a TGNP polypeptide having the sequence set out in i) or ii); iv) a nucleic acid which hybridises under stringent conditions to the sequence set out in iii); or v) the complement of iii) or iv).
3. A method as claimed in claim 2 comprising decreasing TGNP gene expression.
4. A method as claimed in claim 3 wherein TGNP gene expression is decreased by RNAi or antisense treatment.
5. A method as claimed in claim 2 comprising increasing TGNP gene expression.
6. A method as claimed in claim 2 or claim 5 comprising: a) providing an expression vector comprising a nucleic acid sequence encoding a
TGNP polypeptide, said nucleic acid sequence being selected from the group consisting of: i) a nucleic acid encoding a TGNP polypeptide having an amino acid sequence as set out in SEQ ID NO: 1; ii) a nucleic acid which hybridises under stringent conditions to the sequence set out in i); or iii) the complement of ii); b) introducing the expression vector into the cell and maintaining the cell under conditions permitting expression of the encoded polypeptide in the cell.
7. A method for identifying a gene product whose expression is modulated by the expression of TGNP comprising the steps of: - providing a vector encoding TGNP as defined in claim 6;
- introducing said vector in a cell under conditions to promote expression of TGNP; and
- measuring global gene expression associated with TGNP expression.
8. A method as claimed in claim 7 wherein global gene expression is measured by assaying gene transcription using a microarray.
9. A composition comprising a modulator of TGNP gene expression for use as a medicament.
10. A composition as claimed in claim 9 wherein said modulator of TGNP gene expression is selected from an antisense TGNP molecule and an RNAi TGNP molecule.
11. A method of treatment of a disease comprising administering a modulator of TGNP gene expression or functional activity to an individual.
12. A method as claimed in claim 11 wherein the modulator of TGNP gene expression is selected from an antisense TGNP molecule and an RNAi TGNP molecule.
13. A method as claimed in claim 11 or claim 12 wherein the disease is selected from cancer, an inflammatory disease, an autoimmune disease and a neurodegenerative disease.
14. Use of a modulator of TGNP gene expression or functional activity in the manufacture of a medicament for use in the treatment of disease.
15. An isolated nucleic acid molecule comprising a promoter, said nucleic acid sequence being selected from the group consisting of: i) a nucleic acid molecule having the sequence set out in SEQ ID NO:2; ii) a nucleic acid molecule having at least 60% homology with i); iii) a nucleic acid molecule hybridising under stringent conditions to i) or ii); and iv) the complement of the sequences set out in i) to iii).
16. An isolated nucleic acid molecule as claimed in claim 15 which comprises at least one enhancer or transcription factor binding element selected from the group consisting of C/EBP, Mef-2, CATT, GATA-1, NFKB, PrRE, Pit-1, AP2, CRE and Spl.
17. An isolated nucleic acid molecule as claimed in claim 15 or claim 16 which comprises a promoter sequence which is activated by GM-CSF.
18. A vector comprising a nucleic acid molecule as claimed in any of claims 15 to 17.
19. A vector as claimed in claim 18 wherein said nucleic acid molecule is operably linked to a reporter gene.
20. A method of identifying a compound that activates expression from the TGNP promoter comprising - transfecting a cell with a nucleic acid constmct as claimed in claim 18 or claim 19 operably linked to a reporter gene;
- introducing a compound of interest;
- detecting TGNP gene expression by detecting the reporter gene product; and
- comparing with TGNP gene expression in the absence of the compound of interest.
PCT/GB2002/005670 2001-12-13 2002-12-13 Tgnp activity or expression as marker for apoptosis WO2003050302A2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2002356293A AU2002356293A1 (en) 2001-12-13 2002-12-13 Tgnp activity or expression as marker for apoptosis

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB0129846.2 2001-12-13
GBGB0129846.2A GB0129846D0 (en) 2001-12-13 2001-12-13 Tgnp

Publications (2)

Publication Number Publication Date
WO2003050302A2 true WO2003050302A2 (en) 2003-06-19
WO2003050302A3 WO2003050302A3 (en) 2004-01-08

Family

ID=9927562

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2002/005670 WO2003050302A2 (en) 2001-12-13 2002-12-13 Tgnp activity or expression as marker for apoptosis

Country Status (3)

Country Link
AU (1) AU2002356293A1 (en)
GB (1) GB0129846D0 (en)
WO (1) WO2003050302A2 (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999014356A2 (en) * 1997-09-17 1999-03-25 The Johns Hopkins University P53-induced apoptosis
WO2001046468A2 (en) * 1999-12-21 2001-06-28 Eirx Therapeutics Ltd Screening method for ros-induced apoptosis in a cell
WO2001079556A2 (en) * 2000-04-14 2001-10-25 Millennium Pharmaceuticals, Inc. Novel genes, compositions and methods for the identification, assessment, prevention, and therapy of human cancers

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999014356A2 (en) * 1997-09-17 1999-03-25 The Johns Hopkins University P53-induced apoptosis
WO2001046468A2 (en) * 1999-12-21 2001-06-28 Eirx Therapeutics Ltd Screening method for ros-induced apoptosis in a cell
WO2001079556A2 (en) * 2000-04-14 2001-10-25 Millennium Pharmaceuticals, Inc. Novel genes, compositions and methods for the identification, assessment, prevention, and therapy of human cancers

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
RENATE KAIN, ET AL: "MOLECULAR CLONING AND EXPRESSION OF A NOVEL HUMAN TRANS-GOLGI NETWORK GLYCOPROTEIN, TGN51, THAT CONTAINS MULTIPLE TYROSINE-CONTAINING MOTIFS" THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 273, no. 2, 9 January 1998 (1998-01-09), pages 981-988, XP002259110 *
WANG Y ET AL: "Identification of the genes responsive to etoposide-induced apoptosis: application of DNA chip technology" FEBS LETTERS, ELSEVIER SCIENCE PUBLISHERS, AMSTERDAM, NL, vol. 445, no. 2-3, 26 February 1999 (1999-02-26), pages 269-273, XP004259270 ISSN: 0014-5793 *

Also Published As

Publication number Publication date
AU2002356293A1 (en) 2003-06-23
AU2002356293A8 (en) 2003-06-23
WO2003050302A3 (en) 2004-01-08
GB0129846D0 (en) 2002-01-30

Similar Documents

Publication Publication Date Title
Zimmerman et al. Mitosis-specific anchoring of γ tubulin complexes by pericentrin controls spindle organization and mitotic entry
Cho et al. The dual-specificity phosphatase CDC14B bundles and stabilizes microtubules
Ballas et al. Regulation of neuronal traits by a novel transcriptional complex
Arai et al. Targeted disruption of p185/Cul7 gene results in abnormal vascular morphogenesis
Suzuki et al. Involvement of the Polycomb-group gene Ring1B in the specification of the anterior-posterior axis in mice
Hamard et al. The C terminus of p53 regulates gene expression by multiple mechanisms in a target-and tissue-specific manner in vivo
EP2274324B1 (en) Substances and compositions for enhancing dna repair and methods of use
Ramakrishna et al. Lys-63-specific deubiquitination of SDS3 by USP17 regulates HDAC activity
Fishler et al. Genetic instability and mammary tumor formation in mice carrying mammary-specific disruption of Chk1 and p53
Lawson et al. Isolation and characterization of the cDNA for mouse neutrophil collagenase: demonstration of shared negative regulatory pathways for neutrophil secondary granule protein gene expression
Ng et al. Characterization of tissue‐specific LIM domain protein (FHL1C) which is an alternatively spliced isoform of a human LIM‐only protein (FHL1)
Liberati et al. An essential role for Mad homology domain 1 in the association of Smad3 with histone deacetylase activity
Li et al. A targeted mutation of Nkd1 impairs mouse spermatogenesis
Xue et al. CDK8 regulates insulin secretion and mediates postnatal and stress-induced expression of neuropeptides in pancreatic β cells
Thevenon et al. A nucleolar isoform of the drosophila ubiquitin specific protease dUSP36 regulates MYC-dependent cell growth
Lee et al. Identification and characterization of putative tumor suppressor NGB, a GTP-binding protein that interacts with the neurofibromatosis 2 protein
US20050042643A1 (en) Elavl-1
WO2003050302A2 (en) Tgnp activity or expression as marker for apoptosis
US20060160095A1 (en) Survivin
WO2003091384A2 (en) A role for survivin in apoptosis of myeloid cells
EP1682573B1 (en) The use of eukaryotic genes affecting cell cycle control or cell cycle progression for diagnosis and treatment of proliferattive diseases
WO2003048361A2 (en) P55pik
WO2003054010A2 (en) Early stage redox-related apoptosis modulator-2 (esram-2)
US20140234321A1 (en) Hunk, a snf1-related kinase essential for mammary tumor metastasis
Garg et al. Molecular cloning and characterization of the catalytic domain of zebrafish homologue of the ataxia-telangiectasia mutated gene

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SC SD SE SG SK SL TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR IE IT LU MC NL PT SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase in:

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP