WO2003048366A1 - Plasmides immunogenes sivmac239 et vaccin a base d'adn contre le sida, les contenant - Google Patents

Plasmides immunogenes sivmac239 et vaccin a base d'adn contre le sida, les contenant Download PDF

Info

Publication number
WO2003048366A1
WO2003048366A1 PCT/KR2002/000855 KR0200855W WO03048366A1 WO 2003048366 A1 WO2003048366 A1 WO 2003048366A1 KR 0200855 W KR0200855 W KR 0200855W WO 03048366 A1 WO03048366 A1 WO 03048366A1
Authority
WO
WIPO (PCT)
Prior art keywords
plasmid
gene
hiv
sivmac239
signal peptide
Prior art date
Application number
PCT/KR2002/000855
Other languages
English (en)
Inventor
Young-Chul Sung
You-Suk Suh
Original Assignee
Postech Foundation
Genexine Co., Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020020023839A external-priority patent/KR100900249B1/ko
Application filed by Postech Foundation, Genexine Co., Ltd. filed Critical Postech Foundation
Priority to AU2002258268A priority Critical patent/AU2002258268A1/en
Publication of WO2003048366A1 publication Critical patent/WO2003048366A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/575—Hormones
    • C07K14/61—Growth hormones [GH] (Somatotropin)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/53—DNA (RNA) vaccination
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
    • C12N2740/15022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/16011—Human Immunodeficiency Virus, HIV
    • C12N2740/16111—Human Immunodeficiency Virus, HIV concerning HIV env
    • C12N2740/16122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/16011—Human Immunodeficiency Virus, HIV
    • C12N2740/16211—Human Immunodeficiency Virus, HIV concerning HIV gagpol
    • C12N2740/16222—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/16011—Human Immunodeficiency Virus, HIV
    • C12N2740/16311—Human Immunodeficiency Virus, HIV concerning HIV regulatory proteins
    • C12N2740/16322—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/108—Plasmid DNA episomal vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2840/00—Vectors comprising a special translation-regulating system
    • C12N2840/20—Vectors comprising a special translation-regulating system translation of more than one cistron
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2840/00—Vectors comprising a special translation-regulating system
    • C12N2840/20—Vectors comprising a special translation-regulating system translation of more than one cistron
    • C12N2840/203—Vectors comprising a special translation-regulating system translation of more than one cistron having an IRES

Definitions

  • the present invention relates to an AIDS DNA vaccine. More particularly, the present invention relates to SINmac239 and HIV immunogenic plasmids and AIDS D ⁇ A vaccines containing the plasmids.
  • D ⁇ A vaccination is the most recently developed vaccination method.
  • Ertl et al. disclosed a method for administering a live or dead vaccine in a strategy for common immunization (Ertl et al., J. Immunol. 156, 3579-3582 (1996)).
  • Hassett et al. warned that a live vaccine may be dangerous in case of a human or animal patient with lowered immunity and or pregnant patient, since the antigen in the vaccine can revert to or mutate into a pathogenic form, though it can generally elicit an effective immune response in a vaccinated body (Hassett et al., Trends in Microbiol. 8, 307-312 (1996)).
  • Tang et al. found that an expression plasmid encoding an antigenic protein that is directly injected into mouse can induce an antibody response (Tang, D.C., et al.,
  • immunization with plasmid DNA may activate both humoral immunity and cellular immunity, including production of antigen-specific CD8+ cytotoxic T cells as well as CD4+ T helper cell (Donnellym, J.J., et al., Ann Rev.
  • Feigner et al. disclosed a method for delivering an isolated polynucleotide such as DNA or RNA, in which the polynucleotide is intramuscularly administered to mammals so that muscle cells absorb the polynucleotide, the method having therapeutic effects in the mammals (US PAT. No.5,589,466).
  • a DNA vaccine comprising naked plasmid DNA has some merits, as compared to immunization methods depending upon injection of purified or recombinant protein, or attenuated live or recombinant virus, as follows. (1) Genes encoding a particular tumor antigen and/or immunomodulatory cytokine can be introduced at the same time, since one or more genes can be easily introduced at the same time.
  • the methods using these vaccines have problems, for example, evasion of immune response in vivo, such as HIV escaping immune recognition through its mutation, and risk of infection due to recovery of pathogenicity of a virus vector which has been administered as an attenuated vaccine. Furthermore, the methods failed to show desired prophylactic or therapeutic effects versus AIDS.
  • plasmid DNA when administered to primates, induced humoral immune response and cell-mediated immune respone, and effectively induced Thl (T helper- 1) bias immune response and CTL response, which are known to be important for protection against viruses such as HIV-1, especially in small animals, monkeys, chimpanzees and humans.
  • Thl T helper- 1 bias immune response and CTL response
  • EP 0276591 disclosed a vaccine consisting of a viral vector and recombinant DNA coding for the p25 protein of the AIDS virus.
  • the viral vector is characterized by comprising a part of the genome of a vector virus; the complete gag gene or one of its fragments, especially a gene coding for the p25 protein or a gene coding for the pi 8 protein of the HIV virus responsible for AIDS; and elements ensuring the expression of these proteins in cells during culturing.
  • EP 0572737 disclosed a substantially pure HIV antigen comprising a Gag-Env fusion protein consisting of a Gag polypeptide fused at its C-end to an Env peptide.
  • FR 2596771 disclosed a viral vector characterized by comprising: a portion of the genome of a virus, a gene encoding one of the glycoproteins (gp) of the envelope of the virus responsible for AIDS; and elements ensuring the expression of this glycoprotein in cells.
  • gp glycoproteins
  • WO 99277958 disclosed an AIDS vaccine based on HIV-1 Tat as immunogen, in which HIV-1 Tat is inoculated either as DNA and/or recombinant protein or as peptides; alone or in combination with other genes or viral gene products (Nef, Rev, Gag) or parts thereof; or in combination with various immunomodulant cytokines (IL-1)
  • Tat, Nef, Rev, Gag and the immunomodulant cytokines are administered both as a mixture of recombinant proteins, peptides or fusion proteins (Tat/Nef, Tat/Rev, Tat/Gag, Tat/IL-12, Tat/IL-15), or as plasmid DNA.
  • Amara et al. reported a study in which primates were immunized with a DNA vaccine containing many HIV and SIV genes (HIV-1 envelope, tat and rev genes and SIV gag, pol, vif, vpx and vpr genes) and a MVA (modified Vaccinia Ankara) booster vaccine containing HIV- and SIV-derived genes (Amara R.R., et al., Science 292, 69-
  • the first immunogenic plasmid comprises the vector pTV2 which was developed as a basic vector for a DNA vaccine, and the gag, dpol (corresponding to protease) and env genes derived from the virus SIVmac239 and the regulatory gene rev derived from the virus SIVmac239, but does not comprise the regulatory genes tat and nef; and the second immunogenic plasmid comprises the vector pTV2 which was developed as a basic vector for a DNA vaccine, and the SIVmac239 pol gene encoding reverse transcriptase (RT) and integrase and a DNA sequence encoding a signal peptide of glycoprotein D (gD) of
  • HSV Herpes Simplex Nirus fused to the pol gene.
  • HSV Herpes Simplex Nirus fused to the pol gene.
  • These first and second immunogenic plasmids were developed to make up for defects of conventionally developed AIDS D ⁇ A vaccines in which the regulatory genes nef and tat, known to inhibit or disturb immune response ex vivo, were used, and the pol gene including many
  • One feature of the present invention is the vector pGXIO developed as a basic vector for a D ⁇ A vaccine.
  • the pGXIO is confirmed to have a higher level of expression upon cell infection ex vivo, and to induce more excellent immune response in vivo (upon immunization of mouse), as compared to the vector pTV2.
  • nef and tat which are excluded in the previous invention and increase the expression efficiency of a gene to be introduced
  • portions of the nef and tat genes are used, not their full-length sequence, and the vector is designed so that the nef and tat genes are expressed through fusion with another regulatory gene, thereby achieving codon optimization.
  • the present invention provides the vector pGXIO as a basic vector for producing immunogenic plasmids which are used in the
  • the present invention provides the immunogenic plasmid pGXIO-SIV/GE, which is used in the AIDS DNA vaccine composition according to the present invention, characterized by comprising the
  • the present invention provides an immunogenic plasmid, which is used in the AIDS DNA vaccine composition according to the present invention and characterized by comprising the vector pGXIO and the SIVmac239 pol gene encoding reverse transcriptase (RT) and integrase (INT) and a
  • SIVmac239 pol gene which are operably linked to the vector.
  • the present invention provides an immunogenic plasmid, which is used in the AIDS DNA vaccine according to the present invention and characterized by comprising the SIVmac239 vif gene and the
  • the present invention provides an immunogenic plasmid, which is used in the AIDS DNA vaccine according to the present invention and characterized by comprising any one of genes having from exon
  • the present invention provides an immunogenic plasmid, which is used in the AIDS DNA vaccine according to the present invention and characterized by comprising (i) the SIVmac239 vif gene and the
  • the present invention provides the immunogenic plasmid pGXIO-HIV/GE, which is used in the ADDS DNA vaccine (composition) according to the present invention, characterized by comprising the HIV-
  • the present invention provides an immunogenic plasmid, which is used in the AIDS DNA vaccine (composition) according to the present invention and characterized by comprising the vector pGXIO and the HIV-1 pol gene encoding reverse transcriptase (RT) and integrase (INT) and the DNA sequence encoding a signal peptide of secretory protein fused to the 3' end of the HIN-1 pol gene which are operably linked to the vector.
  • composition comprising the vector pGXIO and the HIV-1 pol gene encoding reverse transcriptase (RT) and integrase (INT) and the DNA sequence encoding a signal peptide of secretory protein fused to the 3' end of the HIN-1 pol gene which are operably linked to the vector.
  • the present invention provides an immunogenic plasmid, which is used in the AIDS D ⁇ A vaccine according to the present invention and characterized by comprising the HIV-1 vif gene and the D ⁇ A sequence encoding a signal peptide of secretory protein and the HIV-1 nef gene fused to the 3' and 5' ends of the HIV-1 vif gene, respectively.
  • the present invention provides an immunogenic plasmid, which is used in the AIDS D ⁇ A vaccine according to the present invention and characterized by comprising any one of genes having from exon
  • the present invention provides an immunogenic plasmid, which is used in the AIDS DNA vaccine according to the present invention and characterized by comprising (i) the HIV-1 vif gene and the DNA sequence encoding a signal peptide of secretory protein and the HIV-1 nef gene fused to the 3' and 5' ends of the HIV-1 vif gene, respectively, and (ii) any one of genes having from exon 1 to a full length of the HIV-1 tat gene and the DNA sequence encoding a signal peptide of secretory protein and the HIV-1 vpx gene fused to the 3' and 5' ends of the HIV-1 tat gene, respectively.
  • the present invention provides the adjuvant plasmid pGX10-hIL-12m, which can be used in the AIDS DNA vaccine according to the present invention.
  • the present invention provides a DNA vaccine composition for prophylaxis or treatment of AIDS, characterized by comprising (i) plasmid pGXIO-SIV/GE and (ii) plasmid comprising the vector pGXIO and the SIVmac239 pol gene encoding reverse transcriptase and integrase and the DNA sequence encoding a signal peptide of secretory protein fused to the 3' end of the
  • SIVmac239 pol gene which are operably linked to the vector pGXIO.
  • the present invention provides a DNA vaccine composition for prophylaxis or treatment of AIDS, characterized by comprising (i) plasmid comprising the SIVmac239 gag, dpol, env and rev genes, (ii) plasmid comprising the SIVmac239 pol gene encoding reverse transcriptase and integrase and the DNA sequence encoding a signal peptide of secretory protein fused to the 3' end of the SIVmac239 pol gene, (iii) plasmid comprising the SIVmac239 vif gene and the DNA sequence encoding a signal peptide of secretory protein and the SIVmac239 nef gene fused to the 3' and 5' ends of the vif gene, respectively, and/or
  • plasmid comprising any one of genes having from exon 1 to a full length of the SIVmac239 tat gene and the DNA sequence encoding a signal peptide of secretory protein and the SIVmac239 vpx gene fused to the 3' and 5' ends of the SIVmac239 tat gene, respectively.
  • the present invention provides a DNA vaccine composition for prophylaxis or treatment of AIDS, characterized by comprising (i) plasmid comprising the SIVmac239 gag, dpol, env and rev genes, (ii) plasmid comprising the SIVmac239 pol gene encoding reverse transcriptase and integrase and the DNA sequence encoding a signal peptide of secretory protein fused to the 3' end of the SIVmac239 pol gene, and (iii) plasmid comprising (a) SIVmac239 vif gene and the DNA sequence encoding a signal peptide of secretory protein and the SIVmac239 nef gene fused to the 3' and 5' ends of the SIVmac239 vif gene, respectively, and (b) any one of genes having from exon 1 to a full length of the SIVmac239 tat gene and the DNA sequence encoding a signal peptide of secretory protein
  • the present invention provides a DNA vaccine composition for prophylaxis or treatment of AIDS, characterized by comprising (i) plasmid pGXIO-HIV/GE and (ii) plasmid comprising the vector pGXIO and the HIV-1 pol gene encoding reverse transcriptase and integrase and the DNA sequence encoding a signal peptide of secretory protein fused to the 3' end of the HIV-
  • the present invention provides a DNA vaccine composition for prophylaxis or treatment of AIDS, characterized by comprising (i) plasmid comprising the HIV-1 gag, dpol, env and rev genes, (ii) plasmid comprising the HIV-1 pol gene encoding reverse transcriptase and integrase and the
  • HJV-1 pol gene (iii) plasmid comprising the HTV-1 vif gene and the DNA sequence encoding a signal peptide of secretory protein and the HIV-1 nef gene fused to the 3' and 5' ends of the vif gene, respectively, and/or (iv) plasmid comprising any one of genes having from exon 1 to a full length of the HIV-1 tat gene and the DNA sequence encoding a signal peptide of secretory protein and the HIV-1 vpx gene fused to the 3' and 5' ends of the HIV-1 tat gene, respectively.
  • the present invention provides a DNA vaccine composition for prophylaxis or treatment of AIDS, characterized by comprising (i) plasmid comprising the HIV-1 gag, dpol, env and rev genes, (ii) plasmid comprising the HIV-1 pol gene encoding reverse transcriptase and integrase and the DNA sequence encoding a signal peptide of secretory protein fused to the 3' end of the HIV-1 pol gene, and (iii) plasmid comprising (a) HIV-1 vif gene and the DNA sequence encoding a signal peptide of secretory protein and the HIV-1 nef gene fused to the 3' and 5' ends of the HIV-1 vif gene, respectively, and (b) any one of genes having from exon 1 to a full length of the HIV-1 tat gene and the DNA sequence encoding a signal peptide of secretory protein and the HIV-1 vpx gene fused to the 5' end of the HIV-1
  • Fig. 1 is a gene map of the vector pGXIO used to express the SIVmac239 immunogenic gene according to the present invention, wherein SV40 pA refers to SV40 polyA;
  • Fig. 2 is a gene map of the vector pGXIO (3.6 kb) used to express the SIVmac239 immunogenic gene according to the present invention
  • Fig. 3 is a restriction map of the vector pGXIO (3.6kb) comprising 3641 nucleotides, which is used to express the SIVmac239 immunogenic gene according to the present invention, wherein the CMV promoter corresponds to nucleotides 3619-
  • the TPL corresponds to nucleotides 666 to 1101
  • the SV40 late polyA sequence corresponds to nucleotides 1236 to 1457
  • the SV40 enhancer corresponds to nucleotides 1469 to 1713
  • the kanamycin resistance ORF corresponds to nucleotides 1727 to 2521
  • the ColEl origin corresponds to nucleotides 2907 to 3580, and the specific restriction sites are underlined;
  • Fig. 4 is a restriction map of the SIVmac239 clone
  • Fig. 5 is a construction map of pGXIO-SIV/GE according to the present invention, which is used as the SIVmac239 immunogenic plasmid;
  • Fig. 6 is a construction map of pGXIO-SIV/dpol according to the present invention, which is used as the SIVmac239 immunogenic plasmid;
  • Fig. 7 is a construction map of pGXIO-SIV/VN according to the present invention, which is used as the SIVmac239 immunogenic plasmid;
  • Fig. 8 is a construction map of pGXIO-SIV/TV according to the present invention, which is used as the SINmac239 immunogenic plasmid;
  • Fig. 9 is a construction map of pGXIO-SIV/VNTV according to the present invention, which is used as the SIVmac239 immunogenic plasmid;
  • Fig. 10 is a construction map of pGXIO-SIV/TVVN according to the present invention, which is used as the SINmac239 immunogenic plasmid
  • Fig. 11 is a construction map of pGXlO-HJV/GE according to the present invention, which is used as the HIV-1 immunogenic plasmid;
  • Fig. 12 is a construction map of pGXIO-HIV/dpol according to the present invention, which is used as the HIV-1 immunogenic plasmid;
  • Fig. 13 is a construction map of pGXlO-HJV/VN according to the present invention, which is used as the HIV-1 immunogenic plasmid;
  • Fig. 14 is a construction map of pGXlO-HJV/TV according to the present invention, which is used as the HIV-1 immunogenic plasmid;
  • Fig. 15 is a construction map of pGXIO-HIV/VNTV according to the present invention, which is used as the HIN-1 immunogenic plasmid
  • Fig. 16 is a construction map of pGXIO-HIV/TVV ⁇ according to the present invention, which is used as the HIV-1 immunogenic plasmid;
  • Fig. 17 is a construction map of the adjuvant plasmid pGX10-hp35/IRES/hp40 (pGX10-hIL-12m) according to the present invention, which is used as an adjuvant for the AIDS D ⁇ A vaccine of the present invention
  • Fig. 18 is a graph showing expression levels of the human growth hormone expressed by the vector pGXIO, which is used to express the SIVmac239 immunogenic gene according to the present invention, and by the conventional vectors pTV2 and pGXl which are used as controls;
  • Fig. 17 is a construction map of the adjuvant plasmid pGX10-hp35/IRES/hp40 (pGX10-hIL-12m) according to the present invention, which is used as an adjuvant for the AIDS D ⁇ A vaccine of the present invention
  • Fig. 18 is a graph showing expression levels of the human growth hormone expressed by the vector pGXIO, which is used to express the SIVmac239 immuno
  • 19 is a construction map of the plasmid pTV2/hGH, which is used as a control for comparison of levels of the human growth hormone expressed by the vector pGXIO, which is used to express the SIVmac239 immunogenic gene according to the present invention;
  • Fig. 20 is a construction map of the plasmid pGXl/hGH, which is used as a control for comparison of levels of the human growth hormone expressed by the vector pGXIO, which is used to express the SIVmac239 immunogenic gene according to the present invention;
  • Fig. 21 is a restriction map of the adjuvant plasmid pAGGSIL-4, which is used as an adjuvant for the AIDS DNA vaccine according to the present invention
  • Fig. 22 is a restriction map of the adjuvant plasmid pCAGGSIL-12, which is used as an adjuvant for the AIDS DNA vaccine according to the present invention
  • Fig. 23 is a construction map of the plasmid pGXO/hGH, which is used as a control for comparison of abilities to induce immune response, as evaluated by expression of the human growth hormone, with the vector pGXIO, which is used to express the SIVmac239 immunogenic gene according to the present invention;
  • Fig. 24 is a construction map of the plasmid pGXIO/hGH, which is used as a control for comparison of abilities to induce immune response, through expression of the human growth hormone, with the vector pGXIO, which is used to express the SIVmac239 immunogenic gene according to the present invention
  • Fig. 25 is a graph showing the abilities to induce immune response, through expression of human growth hormone, of the vector pGXIO, which is used to express the SIVmac239 immunogenic gene according to the present invention, and the plasmid pTV2/hGH and pGXO/hGH, which are used as controls
  • Fig. 26 is a experimental protocol for evaluating the vaccine efficiencies of the immunogenic plasmids according to the present invention.
  • Fig. 27 is a graph showing the vacine efficiencies of the immunogenic plasmids according to the present invention, evaluated by counting the number of peripheral blood mononuclear cells (PBMC) in blood of Rhesus monkeys infected with SIVmac239. The results are expressed as the number of infectious PBMC per one million PBMC in blood of the treated monkey at various points of time after infection of the monkeys with SIVmac239.
  • the X axis represents time (weeks) elapsing after infection with SIVmac239
  • the Y axis represents the number of infectious PBMC
  • the 4 to 5 digit numbers represent the assigned numbers of respective monkeys; Fig.
  • FIG. 28 is a graph showing the vaccine efficiencies of the immunogenic plasmids according to the present invention, evaluated by counting copies of SIV RNA in blood plasma of Rhesus monkeys infected with SIVmac239. The results are expressed as the titers of SIV RNA detected in 1ml of the blood plasma of the treated monkeys at various points of time after infection of the monkeys with SIVmac239.
  • the X axis represents time (weeks) elapsing after infection with SIVmac239
  • the Y axis represents the number of SIVmac239 RNA molecules per 1ml of the blood plasma
  • the 4 to 5 digit numbers represent the assigned numbers of respective monkeys;
  • Fig. 29 is a graph showing the vaccine efficiencies of the immunogenic plasmids according to the present invention, evaluated by measuring the number of absolute CD4+ cells in blood of Rhesus monkeys infected with SIVmac239. The results are expressed as percentages of the absolute number of CD4+ cells per unit volume of blood, relative to the absolute number of CD4+ cells per unit volume of blood before infection in the treated monkeys at various points of time after infection of the monkeys with SIVmac239.
  • the X axis represents time (week) elapsing after infection with SIVmac239
  • the Y axis represents the percentages of the number of
  • Fig. 30 is a graph showing the vaccine efficiencies of the immunogenic plasmids according to the present invention, evaluated by measuring gag-specific T-cell response induced by SIV DNA immunization. The results are obtained by measuring the T-cell immune response induced by immunization in monkeys undergoing respective treatments just before infection with SIVmac239.
  • the X axis represents the assigned numbers of respective monkeys, and the Y axis represents the number of cells secreting IFN- ⁇ in response to stimulation by the gag peptide per one million PBMC;
  • Fig. 31 is a view showing the results of a Western blot analysis in which the plasmids pGXIO-SIV/GE and pGXIO-SIV/dpol according to the present invention, and the immunogenic plasmid pTV2-SIV/GE as a control, were transfected into HeLa cells and examined for the expression of antigen proteins by immunoblotting;
  • Fig. 32 is a view showing the results of a Western blot analysis in which the plasmids pGXIO-SIV/GE and pGXIO-SIV/dpol according to the present invention, and the immunogenic plasmid pTV2-SIV/GE and pTV2-SIV/dpol as controls, were transfected into HeLa cells and examined for the expression of antigen proteins by immunoblotting;
  • Fig. 33 is a view showing the results of a Western blot analysis in which the plasmids pGXIO-SIV/VN and pGXIO-SIV/VNTV according to the present invention were transfected into HeLa cells and examined for the expression of adjuvant antigen proteins (Vif-Nef) by immunoblotting; and
  • Fig. 34 is a view showing the results of a Western blot analysis in which the plasmid pGXIO-SIV/TV according to the present invention was transfected into HeLa cells and examined for the expression of adjuvant antigen protein (Tat- Vpx) by immunoblotting.
  • a representative model known to induce AIDS in monkey is a model in which a monkey is infected with SHIV89.6P.
  • this model (1) uses virus which is produced by artificial recombination; (2) induces abnormally rapid decline in CD4 levels, thereby leading to death; (3) shows conditions by infection itself as well as symptoms of an immune deficiency disease condition; and (4) readily induces protection, as compared to the SIVmac239/monkey, as observed from many cases achieving successful protection using attenuated virus, DNA and recombinant virus vector, though it has been very recently developed, unlike SIVmac239.
  • an attenuated virus as a vaccine, there are safety problems, since the attenuated virus can transform into a pathogenic virus.
  • it has been attempted to induce protection through immunization with DNA and infection of blood with the virus SIVmac251.
  • this attempt failed to induce protection, which caused reduction of CD4 levels in monkey, leading to death.
  • the present invention uses a model in which a DNA vaccine is administered to Rhesus macaques, which is then blood-infected with SIVmac239 to determine whether the vaccine can protect the monkey against the virus.
  • the virus SIVmac239 is obtained by subjecting the virus SIVmac251 twice to in vivo passage, and hence has very similar base sequence, virulence and pathology to SIVmac251.
  • This model is characterized in that it can induce AIDS and also has an infection route, immunological indices after infection (CD4 number, CD29+CD4+T cell), and time to reach the maximum virus titer, which are all similar to the HIV-1 infection process in human beings.
  • the model used in the present invention is used in studies to determine the natures of protective immunization against HIV-1 in human beings, i.e. to determine which immune response should be induced to protect against the infection by HIV-1. Defects of this model are rapid development of AIDS and inevitable death. However, the rapid development can be an advantage of the model in that results can be obtained in a short time. Another feature of this model is that it does not readily induce protection, as seen from the fact that only an immunization method using a vaccine of attenuated virus has succeeded in protection.
  • a DNA vaccine has been developed, which can successfully protect against the blood infection with the virus SIVmac239.
  • "successful protection” means that, upon infection with virus after administration of a vaccine, one of the following conditions is observed: (1) no proliferation of the virus is observed and the virus is removed (sterilizing immunity has been induced); (2) proliferation of the virus is observed in the early infection stage but removed later (without development of any disease); (3) proliferation of the virus is suppressed for a long period of time and no disease is developed (no infection); and (4) the patient slowly develops a disease condition while maintaining the virus titer at a low level, thereby preventing infection.
  • the vector pGXIO which is developed as one aspect of the present invention is formed by augmenting the vector pTV2, which has been previously developed and filed by the present inventors, and the vector pTX, which has been disclosed by Lee A.H. et al. (Vaccine 1999, 17: 473-9).
  • This vector has been proven to have a high level of expression in vitro (10 times higher than the vector pTV2) and also to show excellent immune response in vivo (inducing 10 times more antibody response than the vector pTX).
  • the gene pol and adjuvant which is used in the DNA vaccine according to the present invention.
  • the secretory protein for example, a signal sequence of gD (glycoprotein D) of Herpes Simplex virus has been shown to increase an expression level of a gene which has been fused thereto and immune response, particularly cell immune response, in vivo (Lee et al., J. Virol 72(10),
  • the genes nef and tat are fused to other adjuvant genes vif and vpx, respectively to produce expression vectors, so that their immune disturbance activities can be reduced. Also, where appropriate, not the full-length nef and tat genes, but a portion of them is used.
  • vector refers to a DNA molecule which acts as a carrier which can safely deliver a foreign gene into a host cell
  • vector refers to a DNA molecule which acts as a carrier which can safely deliver a foreign gene into a host cell
  • vector in order to be a useful vector, it should be replicable and should have a device by which it can be introduced into the host cell, and there should be provided means of detecting its presence
  • foreign gene include structural and adjuvant genes of
  • plasmid generally refers to a circular DNA molecule in which a foreign gene is operably linked to a vector so as to be expressed in a host cell
  • a plasmid can be a vector in that it is used to carry a foreign gene by treatment of certain restriction enzymes Therefore, in this application, the terms plasmid and vector are interchangeably used, but may be distinguished in their meanings by those having ordinary knowledge in the genetic engineering field without clarification of their meanings
  • immunogenic plasmid refers to a circular DNA molecule which includs a gene encoding an antigen and induces antigen-specific humoral and cell-mediated immune responses
  • adjuvant plasmid refers to a circular DNA molecule which expresses an immunoregulatory molecule to promote antigen-specific humoral and cell-mediated immune responses induced by an immunogenic plasmid
  • structural gene refers to gag, env and pol genes coding for structural proteins of SIVmac239 and HIV-1
  • the gag gene produces proteins having molecular weights of 55,000 (p55) daltons, 24,000 (p24) daltons, 17,000 (pl7) daltons and 15,000 (pl5) daltons
  • the p55 antigen is a precursor which is formed in the early stage of infection and then divided into different core proteins
  • the gag protein exists in an inner nucleocapsid of virus.
  • the pi 7 protein forms the matrix between the core and envelope and is buried in an inner part of the envelope.
  • the p24 and pi 5 proteins form the core coats enclosing the nucleic acids.
  • the env gene produces glycoproteins having molecular weights of 160,000 (gpl60) daltons, 120,000 (gp!20) daltons and 41,000 (gp41) daltons.
  • the gpl60 is a precursor of the glycoproteins gpl20 and gp41 and is not a constitutional component of mature virus.
  • the gp41 protein exists between the inner membrane and outer membrane and therefore, is also called a transmembrane protein.
  • the gpl20 protein forms 72 nobs over the envelope.
  • the gp41 protein is involved in binding to CD4 molecule of a host cell, together with the gpl20.
  • the pol gene produces p66, p51 (reverse transcriptase), and p31 (integrase or endonuclease) proteins.
  • the polymerase component plays a role in reverse-transcription of RNA to DNA and integration of DNA into cellular DNA, and functions to cleave a precursor into smaller active materials.
  • the polymerase antigen exists within the core, in connection with nucleic acids.
  • the gpl60 and p55 proteins are precursors, which are secreted to blood during replication of the virus to produce antibodies, whereby they can be used to detect antibodies against these precursors by a serological method.
  • the first immunogenic plasmid construct includes the nucleotide sequence corresponding to the protease coding part (not the full-length sequence) of the structural gene pol, which is expressed herein as "dpol”.
  • the second immunogenic plasmid construct includes only the nucleotide sequence encoding reverse-transcriptase and integrase (not the full-length sequence) of the structural gene pol, which is expressed herein as "RT-INT".
  • the RT- INT coding part can be optionally mutated.
  • regulatory gene refers to the nef, vpr, vpu, tat, rev and vif genes, which encode regulatory proteins of SIVmac239 and HIV-1. Products of these regulatory genes function to modify expression of viral proteins and replication of virus, and regulate infectivity of the virus.
  • tat has transcription activity
  • rev has various functions such as inhibition of CD4 receptor and regulation of T cell activity
  • vif increses infectivity of the virus
  • vpr supports replication of virus
  • vpu pl6 is involved in release of virus
  • vpx pi 5 affects infectivity of the virus.
  • vpr among the foregoing regulatory genes is not used.
  • the term "operably linked" as used herein means that the respective components of a plasmid or vector are arranged so as to exert their own functions.
  • a control sequence operably linked to a coding sequence can affect expression of the coding sequence.
  • the control sequence does not need to lie adjacent to the coding sequence as long as the control sequence can act to regulate the expression of the coding sequence.
  • the promoter sequence can be said to be "operably linked" to the coding sequence.
  • Vector pGXIO The present inventors developed a basic vector for an immunogenic plasmid to be contained in an AIDS DNA vaccine, and designated the pGXIO.
  • the vector pGXIO of the invention is a novel vector of 3.6 kb, characterized by comprising SV40 ori, simian virus 40 replication origin, cytomegalovirus (CMV) early promoter/enhancer sequence, adenovirus tripartite leader sequence (TPL), multi-cloning site (MCS), simian virus 40 polyadenylation sequence
  • CMV cytomegalovirus
  • TPL adenovirus tripartite leader sequence
  • MCS multi-cloning site
  • the vector pGXIO was prepared from a known vector, that is pTX, which had been previously disclosed by the present inventors (Lee A.H., et al., Vaccine 17:473-9
  • Example 1 and Fig. 1 can be prepared using pTV2 vector, which has been used as a DNA vaccine vector in studies on small animals
  • KCTC Korean Collection of Type Cultures
  • KCTC 10212BP Accession No. KCTC 10212BP
  • KCTC 10212BP Accession No. 10212BP
  • EF1 viral promoter
  • MCK muscle specific promoter
  • LCK T cell specific promoter
  • VZV varianta zoster virus
  • HCMV human cytomegalovirus
  • VSV vesicular stomatitis virus
  • VP7 rotavirus outer capsid glycoprotein
  • the vector pGXIO is an improvement of the vector pTX and pTV2, which are already known, as described above, and shows a high level of expression in vitro (10 times higher than pTV2, Fig. 18) and moreover, generates a superior immune response, even in vivo. It was observed that the vector pGXIO induces immune responses at a level 10 times stronger than pTX, and pGXIO-HIV/RT (reverse transcriptase) produces anti-RT antibodies in an amount 10 times greater than pTXIO-HIV/RT (data not shown).
  • the known vector pTV2 is disclosed in Korean Patent Application Laid- open No. 2001-0054338(July 2, 2001) and its corresponding US Patent Publication No.
  • the following four types of basic immunogenic plasmids were constructed for use as AIDS DNA vaccines to be examined for their efficacy in rhesus macaques monkeys:
  • first SIV immunogenic plasmid comprising: the vector pGXIO, and (i) the SIVmac239 gag gene encoding matrix protein (MA), capsid protein (CA) and nucleocapsid protein (NC); (ii) the SIVmac239 dpol sequence in the pol gene, encoding protease; (iii) the SIVmac239 env gene encoding envelope protein; and (iv) the SIVmac239 regulatory gene rev, encoding the protein Rev, operably linked thereto;
  • MA matrix protein
  • CA capsid protein
  • NC nucleocapsid protein
  • second SIV immunogenic plasmid comprising: the vector pGXIO, and the SIVmac239 pol gene encoding reverse transcriptase (RT) and integrase (INT) and a DNA sequence encoding a signal peptide of secretory protein fused to the 3' end of the SIVmac239 pol gene, operably linked thereto;
  • third SIV immunogenic plasmid comprising: the SIVmac239 vif gene, and a DNA sequence encoding signal peptide of secretory protein and the SIVmac239 nef gene, fused to the
  • An immunogenic plasmid (hereinafter referred to as "fourth SIV immunogenic plasmid) comprising: a DNA sequence comprising any one of genes having from exon 1 to a full-length sequence of the SIVmac239 tat gene, and a DNA sequence encoding signal peptide of secretory protein and the SIVmac239 vpx gene fused to the 3' and 5' ends of the SIVmac239 tat gene, respectively.
  • This novel immunogenic plasmid of 8.7 kb is formed by introducing the gag, dpol (protease) and env genes, and the SIVmac239 rev regulatory gene to be operably linked to the MCS (multi-cloning site) of the vector pGXIO according to the present invention, which is used in the DNA vaccine against the SIVmac239/rhesus macaques monkey according to the present invention.
  • the detailed procedure for constructing this plasmid is described in Example 2 and illustrated Fig. 5.
  • This plasmid is designated pGXIO-SIV/GE and was deposited with Korean Collection of Type Cultures (KCTC), one of international depository authorities, on March, 2002, as Accession No. KCTC 10215BP, under the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure.
  • KCTC Korean Collection of Type Cultures
  • the plasmid pGXIO-SIV/GE shows a superior expression efficiency, as compared to the immunogenic plasmid pTV-SIV/GE of 10.0 kb disclosed in pending Korean Patent Application Laid-open No. 2001-0054338 and its corresponding US Patent Publication No. 2001004531, which were filed by the present inventors. This can be confirmed by Fig. 31 showing a photograph of Western blotting analyses of pGXIO-SIV/GE and pTV-SIV/GE.
  • This novel immunogenic plasmid is formed by introducing the SIVmac239 pol gene encoding reverse transcriptase and integrase and the DNA sequence encoding signal peptide of secretory protein fused to the 3' end of the SIVmac239 pol gene into the MCS (multi-cloning site) to be operably linked to the vector pGXIO according to the present invention, which is used in the DNA vaccine against the SIVmac239/rhesus macaques monkey according to the present invention, together with the first SIV immunogenic plasmid.
  • the pol gene may be mutated so that its integrase activity is suppressed.
  • a mutated gene in a DNA vaccine, possibility of production of a virus which can proliferate in the subject inoculated with the DNA vaccine is further lowered, thereby leading to improvement in safety.
  • nucleotides 5130-5135 site in the integrase region is known to be very important for the enzyme activity of integrase (codon for Asp 116, Fields Nirology, Third edition pi 893, Lippincott-Raven Co., 1996).
  • nucleotides 5130-5135 site so as to prevent proliferation of the virus in host cells.
  • nucleotides 5130-5132 site of integrase is deleted and/or nucleotides 5133-5135 site is substituted with codon for serine. Consequently, the gene was mutated to express Ser 117, instead of Asn 117. In our own experiments, it was confirmed that such mutated SIVmac239 virus did not proliferate in host cells.
  • the above-described position numbers of the base sequence followed the SIVmac239 clone of GeneBank Accession Number M33262 (Fig. 4).
  • a DNA sequence encoding signal peptide of secretory protein is fused.
  • transcription of transcriptase and integrase is directly controlled by CMV promoter, thereby increasing expression levels of the enzymes.
  • a signal peptide of glycoprotein is used as a signal sequence of secretory protein.
  • glycoprotein examples include herpes simplex virus glycoprotein gD, varicella zoster virus (VZV) gB, human cytomegalovirus (HCMV) gH, gL, gO, vesicular stomatitis virus (VSV) G protein, rotavirus outer capsid glycoprotein, VP7 and the like.
  • VZV varicella zoster virus
  • HCMV human cytomegalovirus
  • VSV vesicular stomatitis virus
  • VP7 rotavirus outer capsid glycoprotein
  • a second immunogenic plasmid of 6.3 kb is formed by inserting the SIVmac239 pol gene encoding reverse transcriptase and integrase in which the nucleotides 5130-5132 site is deleted and the nucleotides 5133-5135 site is substituted with serine codon, and a DNA sequence encoding a signal peptide of glycoprotein D (gD) derived from herpes simplex virus (HSV) which is fused to the 3' end of the SIVmac239 pol gene, into the MCS (multi-cloning site) to be operably linked to the vector pGXIO according to the present invention.
  • gD glycoprotein D
  • HSV herpes simplex virus
  • the pol gene comes under direct transcriptional control of CMV promoter due to the DNA signal sequence encoding 33 N-terminal amino acids of HSV gD, which is fused to the 3' end of the pol gene, thereby increasing expression strength of reverse transcriptase and integrase.
  • This plasmid is used as a second SIV immunogenic plasmid of 8.7 kb in the DNA vaccine against the SIVmac239/rhesus macaques monkey according to the present invention.
  • the detailed procedure for constructing this plasmid is described in
  • This plasmid is designated pGX-SIV/dpol and was also deposited with Korean Collection of Type Cultures (KCTC), one of international depository authorities, on March, 2002, as Accession No. KCTC 10214BP, under the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure.
  • KCTC Korean Collection of Type Cultures
  • the plasmid pGXIO-SIV/dpol shows a superior expression efficiency (data not shown), as compared to the immunogenic plasmid pTV-SIV/dpol of 10.0 kb disclosed in Korean Patent Application Laid-open No. 2001-0054338 and its corresponding US
  • This novel plasmid is constructed by inserting the SIVmac239 vif gene, and a
  • the vector which can be used includes any mammalian cell expression vectors, preferably, a DNA vaccine vector optimized to induce immune response upon expression in muscle cells,
  • the vector is a vector including
  • CMV promoter and optionally TPL sequence SV40 pA examples include, but are not limited to, pGXIO and pTV2; pVXl, pRC/CMV, pREP4 and pREPIO (though including RSV promoter), pcDNAl, pcDNAl . l, pcDNA3, pcDNA3/CAT, pRC/CMV and pRC/CMV2 supplied by Invitrogen Corp.; pCMV-script supplied by Stratagene; and pSI, pCI and pCI-neo supplied by Promega. The most preferred is pGXIO.
  • the third immunogenic plasmid thus constructed is delivered along with the first SIV immunogenic plasmid pGXIO-SIV/GE and the second SIV immunogenic plasmid (for example, pGXIO-SIV/dpol) to enhance the protection induced by the first and second immunogenic plasmids.
  • the third immunogenic plasmid is delivered along with the first SIV immunogenic plasmid pGXIO-SIV/GE and the second SIV immunogenic plasmid
  • the fourth SIV immunogenic plasmid for example, pGXIO-SIV/TV
  • the fourth SIV immunogenic plasmid for example, pGXIO-SIV/TV
  • the SIVmac239 vif regulatory gene and the SIVmac239 nef regulatory gene, which is fused to the 5' end of the SIVmac239 vif regulatory gene may be modified to remove immunosuppressive effects.
  • the modification can be effected by various methods. For example, Serl l4- Leul50 in the vif gene can be modified (Fields Nirology Third edition, pl901, Lippincott-Raven Col, 1996) and Arg 137, Arg 138 and Gly2 (involved in myristylation) in the nef gene can be modified.
  • a DNA sequence encoding a signal peptide of secretory protein is fused to the 3' end of the SIVmac239 vif gene.
  • the transcription of the vif gene is directly controlled by CMV promoter, thereby increasing expression levels of the Vif and Nef proteins.
  • the DNA sequence encoding a signal peptide of glycoprotein is used as the DNA sequence encoding a signal peptide of secretory protein.
  • glycoprotein examples include herpes simplex virus glycoprotein gD, varicella zoster virus (VZV) gB, human cytomegalovirus (HCMV) gH, gL, gO, vesicular stomatitis virus (VSV) G protein, rotavirus outer capsid glycoprotein, VP7 and the like.
  • VZV varicella zoster virus
  • HCMV human cytomegalovirus
  • VSV vesicular stomatitis virus
  • VP7 rotavirus outer capsid glycoprotein
  • another immunogenic plasmid of 5.1 kb is constructed by inserting the SIVmac239 vif gene, and a DNA sequence encoding a signal peptide of HSV gD and the modified SIVmac239 nef gene fused to the 3' and 5' ends of the SIVmac239 vif gene, respectively, to the MCS (multi-cloning site) of the vector pGXIO according to the present invention, in which the genes and the signal sequence are operably linked to the vector.
  • This plasmid is used as a third or fourth SIV immunogenic plasmid in the DNA vaccine against the SIVmac239/rhesus macaques monkey according to the present invention. The detailed procedure for constructing this plasmid is described in Example 4 and illustrated Fig. 7. This plasmid is designated pGX-SIV/VN and was also deposited with Korean Collection of Type
  • KCTC Cultures
  • the third SIV immunogenic plasmid pGXIO-SIV/VN comprises a gene (VN) formed by binding the SIVmac239 vif and nef.
  • the nef gene is modified by the deletion of codons for Argl37 and Argl38 which are known to play an important role in the downregulation activity of CD4 (J Biol Chem. 270; 15307,
  • this plasmid was devised to increase expression of fused Nif-Nef by fusing the signal sequence encoding 33 N-terminal amino acids of HSV gD to the 3' end of the VN gene so that the VN gene comes under direct transcription control of CMV promoter
  • This novel plasmid is constructed by inserting a DNA sequence comprising any one of genes having from exon 1 to a full-length sequence of the SIVmac239 tat gene, and a DNA sequence encoding signal peptide of secretory protein and the SIVmac239 vpx gene fused to the 3' and 5' ends of the SIVmac239 tat gene, respectively, into a vector, in which the genes and signal sequence are operably linked to the vector.
  • the vector which can be used includes any mammalian cell expression vectors, preferably, a DNA vaccine vector optimized to induce immune response upon expression in muscle cells, DC, and T cells.
  • the vector is a vector including CMV promoter and optionally TPL sequence SV40 pA.
  • vectors which can be used in the present invention include, but are not limited to, pGXIO and pTV2; pVXl, pRC/CMV, pREP4 and pREPlO (though including RSV promoter), pcDNAl, pcDNAl . l, pcDNA3, pcDNA3/CAT, pRC/CMV and pRC/CMV2 supplied by Invitrogen Corp.; pCMV-script supplied by Stratagene; and pSI, pCI and pCI-neo supplied by Promega. The most preferred is pGXIO.
  • the fourth plasmid thus constructed is delivered along with the first SIV immunogenic plasmid pGXIO-SIV/GE and the second SIV immunogenic plasmid (for example, PGXIO-SIV/dpol) to enhance the protection induced by the first and second immunogenic plasmids.
  • the fourth SIV immunogeinc plasmid is delivered along with the first SIV immunogenic plasmid pGXIO-SIV/GE, the second SIV immunogenic plasmid
  • the third SIV immunogenic plasmid for example, pGXIO-SIV/VN
  • the third SIV immunogenic plasmid for example, pGXIO-SIV/VN
  • the tat gene is preferably used in a modified form since it can be bring about suppression of immune responses in a immunized host.
  • a region in the tat gene which can be modified comprises the entire gene except exon 1.
  • the exon 1 of the tat gene expresses the enzyme activity (immune disturbance) of the Tat but the effect is less than that of exon 1+exon 2.
  • the immune epitope included in exon 2 of the tat gene cannot be used. Therefore, it is the most preferable to use only the exon 1 site of the tat gene.
  • a DNA sequence encoding a signal peptide of secretory protein is fused to the 3' end of the SIVmac239 tat regulatory gene.
  • the transcription of the tat gene is directly controlled by the CMV promoter, thereby increasing expression levels of the Tat and Vpx proteins.
  • the DNA sequence encoding a signal peptide of glycoprotein is used as the DNA sequence encoding a signal peptide of secretory protein.
  • glycoprotein examples include herpes simplex virus glycoprotein gD, varicella zoster virus (VZV) gB, human cytomegalovirus (HCMV) gH, gL, gO, vesicular stomatitis virus (VSV) G protein, rotavirus outer capsid glycoprotein, VP7 and the like.
  • VZV varicella zoster virus
  • HCMV human cytomegalovirus
  • VSV vesicular stomatitis virus
  • VP7 rotavirus outer capsid glycoprotein
  • another immunogenic plasmid of 4.3 kb is constructed by inserting exon 1 of the SINmac239 tat gene, and a DNA sequence encoding a signal peptide of HSV gD and the SIVmac239 vpx gene fused to the 3' and 5' ends of the SIVmac239 tat gene, respectively, into the MCS (multi-cloning site) of the vector pGXIO according to the present invention, in which the genes and the signal sequences are operably linked to the vector.
  • This plasmid is used as a third or fourth SIV immunogenic plasmid in the DNA vaccine against the SIVmac239/rhesus macaques monkey according to the present invention. The detailed procedure for constructing this plasmid is described in Example 5 and illustrated Fig. 8. This plasmid is designated pGX-SIV/TV and was also deposited with Korean Collection of
  • KCTC Type Cultures
  • the fourth SIV immunogenic plasmid pGXIO-SIV/TV comprises a gene (TV) formed by fusing exon 1 of the SIVmac239 tat gene and vpx gene.
  • this plasmid was formed by fusing the signal sequence encoding 33 N- terminal amino acids of HSV gD to the 5' end of the TV gene so that the gene TV comes under direct transcriptional control of CMV promoter.
  • Immunogenic plasmid comprising the SIVmac239 regulatory genes vif, nef, tat and vpx
  • a plasmid is constructed by inserting (i) the SIVmac239 vif gene, and a DNA sequence encoding a signal peptide of secretory protein and the SIVmac239 nef gene fused to the 3' and 5' ends of the
  • SIVmac239 vif gene respectively, and (ii) a DNA sequence comprising any one of genes having from exon 1 to a full-length sequence of the SIVmac239 tat gene, and a DNA sequence encoding a signal peptide of secretory protein and the SIVmac239 vpx gene fused to the 3' and 5' ends of the SIVmac239 tat gene, respectively, into a vector, in which the genes and signal sequences are operably linked to the vector.
  • vectors which can be used in the present invention include, but are not limited to, pGXIO and pTV2; pVXl, pRC/CMV, pREP4 and pREPlO (though including RSV promoter), pcDNAl, pcDNAl . l, pcDNA3, pcDNA3/CAT, pRC/CMV and pRC/CMV2 supplied by Invitrogen Corp.; pCMV-script supplied by Stratagene; and pSI, pCI and pCI-neo supplied by Promega.
  • the most preferred is pGXIO.
  • the plasmid thus constructed is delivered along with the first SIV immunogenic plasmid pGXIO-SIV/GE and the second SIV immunogenic plasmid (for example, pGXIO-SIV/dpol) to enhance the protection induced by the first and second immunogenic plasmids. Also, this plasmid can reduce the number of immunogenic plasmid which should be prepared for a DNA vaccine, thereby lowering the production cost.
  • the SIVmac239 vif regulatory gene and the SIVmac239 nef regulatory gene, which is fused at the 5' end of the SIVmac239 vif regulatory gene may be modified to remove its immunosuppressive effects.
  • the modification can be effected by various methods. For example, Serl l4- Leul50 in the gene vif can be modified (Fields Virology Third edition, pl901, Lippincott-Raven Col, 1996) and Argl37, Argl38 and Gly2 (involved in myristylation) in the gene nef can be modified.
  • the tat gene is preferably used in a modified form since it may bring about immune disturbance, though it can be used in its full-length form.
  • a region in the tat gene which can be modified comprises the entire gene except exon 1.
  • the exon 1 of the tat gene expresses the enzyme activity (immune disturbance) of the Tat but the effect is less than that of exon 1+exon 2.
  • the immune epitope included in exon 2 of the tat gene cannot be used. Therefore, it is the. most preferable to use only exon 1 site of the tat gene.
  • the nef and tat genes can be independently modified.
  • nef gene is modified while the tat gene is not modified, and where the tat gene is modified while the nef gene is not modified, or where both the nef and tat genes are modified.
  • a DNA sequence encoding a signal peptide of secretory protein is fused to each 3' end of the SIVmac239 vif and tat genes.
  • the transcription of the vif and tat genes is directly controlled by each CMV promoter, thereby increasing expression levels of the Vif and Nef proteins.
  • the DNA sequence encoding a signal peptide of glycoprotein is used as a signal sequence of secretory protein.
  • glycoprotein examples include herpes simplex virus glycoprotein gD, varicella zoster virus (VZV) gB, human cytomegalovirus (HCMV) gH, gL, gO, vesicular stomatitis virus (VSV) G protein, rotavirus outer capsid glycoprotein, VP7 and the like.
  • VZV varicella zoster virus
  • HCMV human cytomegalovirus
  • VSV vesicular stomatitis virus
  • VP7 rotavirus outer capsid glycoprotein
  • an immunogenic plasmid of 7.5 kb is constructed by inserting exon 1 of the SIVmac239 tat gene, and a DNA sequence encoding signal peptide of HSV gD and the SIVmac239 vpx gene fused to the 3' and 5' ends of the
  • SIVmac239 tat gene respectively, into a third SIV immunogenic plasmid comprising the SIVmac239 vif gene, and a DNA sequence encoding a signal peptide of HSV gD and the modified SIVmac239 nef gene (having codons for Argl37 and Argl38 deleted) fused to the 3' and 5' ends of the SIVmac239 vif gene, respectively, to be operably linked to MCS (multi-cloning site) of the vector pGXIO according to the invention, in which the genes and the signal sequences are operably linked to the third SIV immunogenic plasmid.
  • MCS multi-cloning site
  • This plasmid is used as an additional SIV immunogenic plasmid in the DNA vaccine against the SIVmac239/rhesus macaques monkey according to the present invention.
  • the detailed procedure for constructing this plasmid is described in Example 6 and illustrated Fig. 9.
  • an immunogenic plasmid of 7.5 kb is constructed by inserting the SIVmac239 vif gene, and a DNA sequence encoding signal peptide of HSV gD and the modified SIVmac239 nef gene fused to the 3' and 5' ends of the SIVmac239 vif gene, respectively, into a fourth SIV immunogenic plasmid comprising exon 1 of the SIVmac239 tat gene, and a DNA sequence encoding signal peptide of HSV gD and the SIVmac239 vpx gene fused to the 3' and 5' ends of the SIVmac239 tat gene, respectively, to be operably linked to MCS (multi-cloning site) of the vector pGXIO according to the present invention, in which the genes and the signal sequences are operably linked to the fourth SIV immunogenic plasmid.
  • This plasmid is used as an additional
  • SIVmac239/rhesus macaques monkey according to the present invention.
  • the detailed procedure for constructing this plasmid is described in Example 7 and illustrated Fig. 10.
  • This plasmid is designated pGX-SIV/TVVN.
  • HIV-1 and SIV both belong to lentivirus species, and structures and functions of their structural genes are not exactly the same, but are very similar. Also, within some genes commonly found in HIV-1 and SIN such as the gag gene, the D ⁇ A sequences have a high homology and their polyclonal antibodies are cross-reactive. Above all, the conditions appearing in humans infected with HIV are similar to the conditions appearing in monkeys infected with SIV. For these reasons, when substituting SIV genes with HIV genes while using a human model, it may be expected to achieve efficacy similar to that in a SIV/monkey model.
  • first HJV immunogenic plasmid comprising: the vector pGXIO, and (i) the HIV-1 gag gene encoding matrix protein (MA), capsid protein (CA) and nucleocapsid protein (NC); (ii) the HIV-1 dpol sequence in the pol gene, encoding protease; (iii) the HIV-1 env gene encoding envelope protein; and (iv) the HIV-1 regulatory gene rev, encoding the protein Rev, operably linked thereto;
  • first HJV immunogenic plasmid comprising: the vector pGXIO, and (i) the HIV-1 gag gene encoding matrix protein (MA), capsid protein (CA) and nucleocapsid protein (NC); (ii) the HIV-1 dpol sequence in the pol gene, encoding protease; (iii) the HIV-1 env gene encoding envelope protein; and (iv) the HIV-1 regulatory gene rev, encoding the protein Rev, operably linked thereto;
  • second HIV immunogenic plasmid comprising: the vector pGXIO, and the HIV-1 pol gene encoding reverse transcriptase (RT) and integrase (INT) and a DNA sequence encoding a signal peptide of secretory protein fused to the 3' end of the HJV-1 pol gene, operably linked thereto;
  • An immunogenic plasmid (hereinafter referred to as "third HJV immunogenic plasmid) comprising: the HIV vif gene, and a DNA sequence encoding signal peptide of secretory protein and the HIV-1 nef gene, fused to the 3' and 5' ends of the HIV-1 vif gene, respectively; and
  • An immunogenic plasmid (hereinafter referred to as "fourth HIV immunogenic plasmid) comprising: a DNA sequence comprising any one of genes having from exon 1 to a full-length sequence of the HIV-1 tat gene, and a DNA sequence encoding signal peptide of secretory protein and the HIV-1 vpx gene fused to the 3' and 5' ends of the HIV-1 tat gene, respectively.
  • This novel immunogenic plasmid of 8.7 kb is formed by introducing the gag, dpol (protease) and env genes, and the HIV rev regulatory gene to be operably linked to the MCS (multi-cloning site) of the vector pGXIO according to the present invention, which is used in the DNA vaccine against AIDS human patients.
  • the detailed procedure for constructing this plasmid is described in Example 8 and illustrated Fig. 11. This plasmid is designated pGXIO-HIV/GE.
  • the plasmid pGXIO-SIV/GE shows a superior expression efficiency, as compared to the immunogenic plasmid pTV-HIV/GE of 11.0 kb disclosed in Korean Patent Application Laid-open No. 2001-0054338 and its corresponding US Patent Publication No. 2001004531, which were filed by the present inventors.
  • This novel immunogenic plasmid is formed by introducing the HIV pol gene encoding reverse transcriptase and integrase and the D ⁇ A sequence encoding signal peptide of secretory protein fused to the 3' end of the HIV pol gene into the MCS
  • multi-cloning site to be operably linked to the vector pGXIO according to the present invention, which is used in the D ⁇ A vaccine against AIDS human patients, together with the first HIV immunogenic plasmid.
  • the pol gene may be mutated so that its integrase activity is suppressed.
  • mutated gene When using such mutated gene in
  • nucleotides 5130-5135 site in the integrase region is known to be very important for the enzyme activity of integrase (codon for Asp 116, Fields Nirology, Third edition pl893, Lippincott-Raven Co., 1996). Therefore, it is possible to inhibit the activity of integrase by modifying nucleotides 5130-5135 site so as to prevent proliferation of the virus in host cells.
  • nucleotides 5130-5132 site of integrase is deleted and/or nucleotides 5133-5135 site is substituted with codon for serine. Consequently, the gene was mutated to express Serl l7, instead of Asnl l7. In our own experiments, it was confirmed that such mutated HIN-1 virus did not proliferate in host cells.
  • the above-described position numbers of the nucleotide sequence followed the HIV-1 JR-CSF clone of GeneBank Accession Number M38429.
  • a D ⁇ A sequence encoding signal peptide of secretory protein is fused to the 3' end of the HIV-1 pol gene encoding reverse transcriptase and integrase (expressed as RT-I ⁇ T in the drawings).
  • a signal peptide of glycoprotein is used as a signal sequence of secretory protein.
  • glycoprotein examples include herpes simplex virus glycoprotein gD, varicella zoster virus (VZV) gB, human cytomegalovirus (HCMV) gH, gL, gO, vesicular stomatitis virus (VSV) G protein, rotavirus outer capsid glycoprotein, VP7 and the like.
  • VZV varicella zoster virus
  • HCMV human cytomegalovirus
  • VSV vesicular stomatitis virus
  • VP7 rotavirus outer capsid glycoprotein
  • a second HIV immunogenic plasmid of 6.2 kb is formed by inserting the HJV pol gene encoding reverse transcriptase and integrase in which the nucleotides 5130-5132 site is deleted and the nucleotides 5133-5135 site is substituted with serine codon, and a D ⁇ A sequence encoding a signal peptide of glycoprotein D (gD) derived from herpes simplex virus (HSV) which is fused to the 3' end of the HIV- 1 pol gene, into the MCS (multi-cloning site) to be operably linked to the vector pGXIO according to the present invention.
  • HJV pol gene encoding reverse transcriptase and integrase in which the nucleotides 5130-5132 site is deleted and the nucleotides 5133-5135 site is substituted with serine codon
  • gD glycoprotein D
  • HSV herpes simplex virus
  • the pol gene comes under direct transcriptional control of CMN promoter due to the D ⁇ A signal sequence encoding 33 ⁇ -terminal amino acids of HSV gD, which is fused to the 3' end of the pol gene, thereby increasing expression strength of reverse transcriptase and integrase.
  • This plasmid is used as a second HIV immunogenic plasmid in the D ⁇ A vaccine against AIDS human patients. The detailed procedure for constructing this plasmid is described in Example 9 and illustrated Fig. 12. This plasmid is designated pGX- HlV/dpol.
  • the plasmid pGXIO-HJN/dpol shows a superior expression efficiency (data not shown), as compared to the immunogenic plasmid pTV-HIV/dpol of 7.5 kb disclosed in Korean Patent Application Laid-open No. 2001-0054338 and its corresponding US
  • Patent Publication No. 2001004531 which were filed by the present inventors.
  • This novel plasmid is constructed by inserting the HJV-1 vif gene, and a DNA sequence encoding a signal peptide of secretory protein and the HIV-1 nef gene fused to the 3' and 5' ends of the HIV-1 vif gene, respectively, to a vector, in which the genes and signal sequence are operably linked to the vector.
  • the vector which can be used includes any mammalian cell expression vectors, preferably, a DNA vaccine vector optimized to induce immune response upon expression in muscle cells, DC, and T cells.
  • the vector is a vector including CMV promoter and optionally TPL sequence SV40 pA.
  • vectors which can be used in the present invention include, but are not limited to, pGXIO and pTV2; pVXl, pRC/CMN pREP4 and pREPlO (though including RSV promoter), pcD ⁇ Al, pcD ⁇ Al. l, pcD ⁇ A3, pcDNA3/CAT, pRC/CMV and pRC/CMV2 supplied by Invitrogen Corp.; pCMV-script supplied by Stratagene; and pSI, pCI and pCI-neo supplied by Promega. The most preferred is pGXIO.
  • the third immunogenic plasmid thus constructed is delivered along with the first SIV immunogenic plasmid pGXIO-HIV/GE and the second HIV immunogenic plasmid (for example, pGXIO-HJV/dpol) to enhance the protection induced by the first and second immunogenic plasmids.
  • the third immunogenic plasmid is delivered along with the first HIV immunogenic plasmid pGXIO-HIV/GE and the second SIV immunogenic plasmid (for example, pGXIO-HJV/pol) and the fourth HIV immunogenic plasmid (for example, pGXlO-HIV/TV) to enhance the protection induced by the first and second immunogenic plasmids.
  • the HIV-1 vif regulatory gene and the HIV-1 nef regulatory gene which is fused to the 5' end of the HIV-1 vif regulatory gene, may be modified to remove immunosuppressive effects.
  • the modification can be effected by various methods. For example, Serl l4-Leul50 in the vif gene can be modified (Fields Nirology Third edition, pi 901, Lippincott-Raven Col, 1996) and Arg 137, Argl38 and Gly2 (involved in myristylation) in the nef gene can be modified.
  • a D ⁇ A sequence encoding a signal peptide of secretory protein is fused.
  • the transcription of the vif gene is directly controlled by CMV promoter, thereby increasing expression levels of the Vif and ⁇ ef proteins.
  • the D ⁇ A sequence encoding a signal peptide of glycoprotein is used as the D ⁇ A sequence encoding a signal peptide of secretory protein.
  • the glycoprotein include herpes simplex virus glycoprotein gD, varicella zoster virus (VZV) gB, human cytomegalovirus (HCMV) gH, gL, gO, vesicular stomatitis virus (VSV) G protein, rotavirus outer capsid glycoprotein, VP7 and the like.
  • another immunogenic plasmid of 5.1 kb is constructed by inserting the HIV-1 vif gene, and a DNA sequence encoding a signal peptide of HSV gD and the modified HIV-1 nef gene fused to the 3' and 5' ends of the SIVmac239 vif gene, respectively, to the MCS (multi-cloning site) of the vector pGXIO according to the present invention, in which the genes and the signal sequence are operably linked to the vector.
  • This plasmid is used as a third or fourth HIV immunogenic plasmid in the
  • This plasmid is designated pGX-HIV/VN.
  • the third SIV immunogenic plasmid pGXlO-HJV/VN comprises a gene (VN) formed by binding the HJV-1 vif and nef.
  • the nef gene is modified by the deletion of codons for Argl37 and Argl38 which are known to play an important role in the downregulation activity of CD4 (J. Biol. Chem. 270; 15307, 1995) so as to prevent the immunosuppressive effects of the Nef protein.
  • this plasmid was devised to increase expression of fused Vif-Nef by fusing the signal sequence encoding 33 N-terminal amino acids of HSV gD to the 3' end of the VN gene so that the VN gene comes under direct transcription control of CMV promoter.
  • This novel plasmid is constructed by inserting a DNA sequence comprising any one of genes having from exon 1 to a full-length sequence of the HIV-1 tat gene, and a DNA sequence encoding signal peptide of secretory protein and the HJV-1 vpx gene fused to the 3' and 5' ends of the HIV-1 tat gene, respectively, into a vector, in which the genes and signal sequence are operably linked to the vector.
  • the vector which can be used includes any mammalian cell expression vectors, preferably, a DNA vaccine vector optimized to induce immune response upon expression in muscle cells, DC, and T cells.
  • the vector is a vector including CMV promoter and optionally TPL sequence SV40 pA.
  • vectors which can be used in the present invention include, but are not limited to, pGXIO and pTV2; pVXl, pRC/CMN pREP4 and pREPlO (though including RSV promoter), pcD ⁇ Al, pcD ⁇ Al.l, pcD ⁇ A3, pcDNA3/CAT, pRC/CMV and pRC/CMV2 supplied by Invitrogen Corp.; pCMV-script supplied by Stratagene; and pSI, pCI and pCI-neo supplied by Promega. The most preferred is pGXIO.
  • the fourth plasmid thus constructed is delivered along with the first HIV immunogenic plasmid pGXIO-HIV/GE and the second HIV immunogenic plasmid (for example, pGXIO-HIV/dpol) to enhance the protection induced by the first and second immunogenic plasmids.
  • the fourth HIV immunogeinc plasmid is delivered along with the first HIV immunogenic plasmid pGXIO-HIV/GE, the second HIV immunogenic plasmid (for example, pGXIO-HJV/dpol) and the third HIV immunogenic plasmid (for example, pGXlO-HJV/VN) to enhance the protection induced by the first and second HIV immunogenic plasmid
  • the tat gene is preferably used in a modified form since it may bring about immune disturbance, though it can be used in its full-length form.
  • a region in the tat gene which can be modified comprises the entire gene except exon 1.
  • the exon 1 of the tat gene expresses the enzyme activity (immune disturbance) of the Tat but the effect is less than that of exon 1+exon 2.
  • the immune epitope included in exon 2 of the tat gene cannot be used. Therefore, it is the most preferable to use only the exon 1 site of the tat gene.
  • a DNA sequence encoding a signal peptide of secretory protein is fused to the 3' end of the HJV-1 tat regulatory gene.
  • the transcription of the tat gene is directly controlled by the CMV promoter, thereby increasing expression levels of the Tat and Vpx proteins.
  • the DNA sequence encoding a signal peptide of glycoprotein is used as the DNA sequence encoding a signal peptide of secretory protein.
  • glycoprotein examples include herpes simplex virus glycoprotein gD, varicella zoster virus (VZV) gB, human cytomegalovirus (HCMV) gH, gL, gO, vesicular stomatitis virus (VSV) G protein, rotavirus outer capsid glycoprotein, VP7 and the like.
  • VZV varicella zoster virus
  • HCMV human cytomegalovirus
  • VSV vesicular stomatitis virus
  • VP7 rotavirus outer capsid glycoprotein
  • another immunogenic plasmid of 4.2 kb is constructed by inserting exon 1 of the HIV- 1 tat gene, and a DNA sequence encoding a signal peptide of HSV gD and the HIV-1 vpx gene fused to the 3' and 5' ends of the HJV-1 tat gene, respectively, into the MCS (multi-cloning site) of the vector pGXIO according to the present invention, in which the genes and the signal sequences are operably linked to the vector.
  • This plasmid is used as a third or fourth HJV immunogenic plasmid in the
  • the fourth HIV immunogenic plasmid pGXIO-HIV/TV comprises a gene (TV) formed by fusing exon 1 of the SIVmac239 tat gene and vpx gene.
  • this plasmid was formed by fusing the signal sequence encoding 33 N- terminal amino acids of HSV gD to the 5' end of the TV gene so that the gene TV comes under direct transcriptional control of CMV promoter.
  • Immunogenic plasmid comprising the HJV-1 regulatory genes vif, nef, tat and vpx
  • a plasmid is constructed by inserting (i) the HIV-1 vif gene, and a DNA sequence encoding a signal peptide of secretory protein and the HIV-1 nef gene fused to the 3' and 5' ends of the HJV-1 vif gene, respectively, and (ii) a DNA sequence comprising any one of genes having from exon 1 to a full-length sequence of the HIV-1 tat gene, and a DNA sequence encoding a signal peptide of secretory protein and the HIV-1 vpx gene fused to the 3' and 5' ends of the HIV-1 tat gene, respectively, into a vector, in which the genes and signal sequences are operably linked to the vector.
  • vectors which can be used in the present invention include, but are not limited to, pGXIO and pTV2; pVXl, pRC/CMN pREP4 and pREPlO (though including RSV promoter), pcD ⁇ Al, pcD ⁇ Al . l, pcD ⁇ A3, pcDNA3/CAT, pRC/CMV and pRC/CMV2 supplied by Invitrogen Corp.; pCMV-script supplied by Stratagene; and pSI, pCI and pCI-neo supplied by Promega.
  • the most preferred is pGXIO.
  • the plasmid thus constructed is delivered along with the first HIV immunogenic plasmid pGXIO-FQN/GE and the second HIV immunogenic plasmid (for example, pGXIO-HIV/dpol) to enhance the protection induced by the first and second immunogenic plasmids. Also, this plasmid can reduce the number of immunogenic plasmid which should be prepared for a D ⁇ A vaccine, thereby lowering the production cost.
  • the HJN-1 vif regulatory gene and the HIV-1 nef regulatory gene which is fused at the 5' end of the HIV-1 vif regulatory gene, may be modified to remove its immunosuppressive effects.
  • the modification can be effected by various methods. For example, Serl 14-Leul50 in the gene vif can be modified (Fields Nirology Third edition, pl901, Lippincott-Raven Col, 1996) and Argl37, Argl38 and Gly2 (involved in myristylation) in the gene nef can be modified.
  • the tat gene is preferably used in a modified form since it may bring about immune disturbance, though it can be used in its full-length form.
  • a region in the tat gene which can be modified comprises the entire gene except exon 1.
  • the exon 1 of the tat gene expresses the enzyme activity (immune disturbance) of the Tat but the effect is less than that of exon 1+exon 2.
  • the immune epitope included in exon 2 of the tat gene cannot be used. Therefore, it is the most preferable to use only exon 1 site of the tat gene.
  • the nef and tat genes can be independently modified.
  • nef gene is modified while the tat gene is not modified, and where the tat gene is modified while the nef gene is not modified, or where both the nef and tat genes are modified.
  • a DNA sequence encoding a signal peptide of secretory protein is fused to each 3 ' end of the HJV- 1 vif and tat genes.
  • the transcription of the vif and tat genes is directly controlled by each CMV promoter, thereby increasing expression levels of the Nif and ⁇ ef proteins.
  • the D ⁇ A sequence encoding a signal peptide of glycoprotein is used as a signal sequence of secretory protein.
  • glycoprotein examples include herpes simplex virus glycoprotein gD, varicella zoster virus (NZV) gB, human cytomegalovirus (HCMV) gH, gL, gO, vesicular stomatitis virus (VSV) G protein, rotavirus outer capsid glycoprotein, VP7 and the like.
  • ZV varicella zoster virus
  • HCMV human cytomegalovirus
  • VSV vesicular stomatitis virus
  • VP7 rotavirus outer capsid glycoprotein
  • an immunogenic plasmid of 7.5 kb is constructed by inserting exon 1 of the HJV-1 tat gene, and a D ⁇ A sequence encoding signal peptide of HSV gD and the HIV-1 vpx gene fused to the 3' and 5' ends of the HIV-1 tat gene, respectively, into a third HIV immunogenic plasmid comprising the HIV-1 vif gene, and a D ⁇ A sequence encoding a signal peptide of HSV gD and the modified HIV-1 nef gene (having codons for Argl37 and Argl38 deleted) fused to the 3' and 5' ends of the HJV-1 vif gene, respectively, to be operably linked to MCS (multi-cloning site) of the vector pGXIO according to the invention, in which the genes and the signal sequences are operably linked to the third HIV immunogenic plasmid.
  • MCS multi-cloning site
  • This plasmid is used as an additional HIV immunogenic plasmid in the DNA vaccine against AIDS human patients.
  • the detailed procedure for constructing this plasmid is described in Example 12 and illustrated Fig. 15.
  • This plasmid is designated pGX-SIV/VNTV
  • an immunogenic plasmid of 7.5 kb is constructed by inserting the HJV-1 vif gene, and a DNA sequence encoding signal peptide of HSV gD and the modified HIV-1 nef gene fused to the 3' and 5' ends of the HJV-1 vif gene, respectively, into a fourth HIV immunogenic plasmid comprising exon 1 of the HIV-1 tat gene, and a DNA sequence encoding signal peptide of HSV gD and the HIV-1 vpx gene fused to the 3' and 5' ends of the HIV-1 tat gene, respectively, to be operably linked to MCS (multi-cloning site) of the vector pGXIO according to the present invention, in which the genes and the signal sequences are operably linked to the fourth HIV immunogenic plasmid.
  • MCS multi-cloning site
  • This plasmid is used as an additional HIV immunogenic plasmid in the DNA vaccine against AIDS human patients.
  • the detailed procedure for constructing this plasmid is described in Example 13 and illustrated Fig. 16.
  • This plasmid is designated pGX-SIV/TWN.
  • compositions containing immunogenic plasmids of the invention are useful as vaccines for prophylaxis of AIDS.
  • Immunotherapy is a method for inhibiting virus proliferation by enhancing immune response to virus, rather than a method for introducing chemical substances which can inhibit enzymes necessary for proliferation of virus such as reverse transcriptase and protease.
  • DNA immunotherapy has been applied to HJV infected chimpanzees (Boyer J D., et al., AIDS 14:1515-22, 2000; and Boyer J D., et al., J.
  • compositions containing immunogenic plasmids of the invention can be used as vaccines for treatment of AIDS.
  • DNA vaccines of the invention for AIDS protection are in accordance with practices used for common vaccines, especially DNA vaccines for protection.
  • DNA vaccines for AIDS therapy can be administered and formulated the same as DNA vaccines for AIDS protection in that they are used to increase immune response to AIDS virus.
  • DNA vaccine of the invention will preferably be administered by direct (in vivo) gene transfer.
  • Naked DNA can be given by intramuscular, subcutaneous, intravenous, intraarterial or buccal injection.
  • Plasmid DNA may be coated onto gold particles and introduced biolistically with a "gene-gun" into the epidermis of the skin or the oral or vaginal mucosae (Fynan et al., Proc. Natl. Acad. Sci. USA 90: 11478, 1993;
  • DNA vaccine vectors may also be used in conjunction with various delivery systems. Liposomes have been used to deliver DNA vaccines by intramuscular injection (Gregoriadis et al, FEBS Lett.402: 107, 1997) or into the respiratory system by non-invasive means such as intranasal inhalation (Fynan et al., supra).
  • DNA vaccines can also be injected directly into tumors or directly into lymphoid tissues (e.g., Peyer's patches in the gut wall). It is also possible to formulate the vector to target delivery to certain cell types, for example, to APC. Targeting to APC such as dendritic cells is possible through attachment of a mannose moiety (dendritic cells have a high density of mannose receptors) or a ligand for one of the other receptors found preferentially on APC. There is no limitation as to the route by which the DNA vaccine is delivered, nor the manner in which it is formulated, as long as the cells that are transfected can express antigen in such a way that an immune response is induced.
  • DNA vaccine of the present invention is administered to mucosa
  • it may be placed into a pharmaceutically acceptable suspension, solution or emulsion for administration to mucosa.
  • Suitable mediums include saline and liposomal preparations.
  • pharmaceutically acceptable carriers preferred for use with the gene expression plasmids of the invention may include sterile aqueous or non-aqueous solutions, suspensions, and emulsions suitable for ingestion, inhalation, or administration as a suppository to the rectum or vagina.
  • non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and certain organic esters such as ethyl oleate.
  • Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media.
  • Preservatives and other additives may also be present such as, for example, antimicrobials, antioxidants, chelating agents, and inert gases and the like.
  • antimicrobials for example, antimicrobials, antioxidants, chelating agents, and inert gases and the like.
  • Isotonic buffered solution is the preferred medium for maximal uptake of the gene plasmids contained in DNA vaccines of the invention. Further, use of absorption promoters, detergents, and mild chemical irritants is also preferred to enhance transmission of antigen-encoding polynucleotide preparation compositions through the point of entry and into contact with tissue adjacent to or containing a mucosal inductor site.
  • promoters and detergents which have been used with success in mucosal delivery of organic and peptide-based drugs, see Chien, Novel Drug Delivery Systems, Ch. 4 (Marcel Dekker, 1992).
  • Mucosa refers to mucosal tissues of a host wherever they may be located in the body including, but not limited to, respiratory passages (including bronchial passages, lung epithelia and nasal epithelia), genital passages (including vaginal, penile and anal mucosa), urinary passages (e.g , urethra, bladder), the mouth, eyes and vocal cords
  • “Point of Entry” refers to the site of introduction of the polynucleotide into a host, including immediately adjacent tissue
  • “Mucosal Inductor Site” refers to a site on the mucosa where uptake of the antigen- encoding polynucleotide preparation is sought, including, but not limited to, Waldeyer's ring, Peyer's patches, gut-associated lympohoid tissues, bronchial-associated lymphoid tissues, nasal-associated lymphoid tissues, genital-associated lymphoid tissues, and tonsils
  • the dosage of DNA vaccine according to the present invention can be varied depending on administration manner, tissues to which DNA vaccine is administered, such as skeletal muscle and skin, desired antibody titer, particular treatment requirement for immunization subject, etc
  • the effective amount of each plasmid contained in DNA vaccine of the present invention is from 0 01 to 0 2 mg/kg of weight, preferably 0 01 to 0 1 mg/kg of weight
  • coated projectiles enables a smaller amount of the vaccine to be administered
  • the DNA vaccine composition can be lyophilized to increase its stability at room temperature, to reduce the requirement for costly cold storage, and to extend product shelf-life
  • the lyophilization process consists of three successive steps of freezing, primary drying and secondary drying After freezing the product, the primary drying step involves lowering pressure and supplying heat for water vapor sublimation. During the secondary drying step, the residual absorbed moisture evaporates from the dried material.
  • DNA vaccine of the present invention can be lyophilized as follows (1) Determine the collapse temperature of the formulation by using freeze- drying microscopic analysis, (2) Place the vials on the freeze-drier shelves at room temperature and subsequently equilibrate at -1C for about 30 minutes, (3) Cool the shelves to -55C and hold that temperature for 2 hours; (4) Carry out primary drying at a product temperature of about -32C or 5C below the collapse temperature, (5) Carry out secondary drying at 35C (Complete the drying after adjusting the chamber pressure to between 55-120 mmHg), (6) Insert the stoppers into the vials under vacuum in the freeze-dryer (Crimp-seal the freeze-dried vials and store them at 2-8C)
  • a variety of excipients and lyoprotectants can be used in lyophilized DNA vaccine formulations.
  • the excipients include but are not limited to buffer of 0.9% NaCl + 10 mM sodium phosphate, pH 7.0 or 10 mM sodium citrate, pH 7.0.
  • the lyoprotectants serve to protect biological molecules from freezing and drying processes and give mechanical support to the finished product.
  • Examples of the lyoprotectant are PBS(phosphate-buffered saline, pH 7 0), PBS/4%, 12% or 15% trehalose, PBS/12% or 20% mannitol, PBS/15% or 20% lactose, PBS/4% sucrose, PBS/2% sorbitol, PBS/2% PEG(polyethylene glycol), PBS/4% trehalose/ 1% PEG/1% PVP(polyvinyl pyrolidone), PBS/4% mannitol/1% PEG/1% PVP, PBS/4% lactose/2% PEG and PBS/12% lactose/0.9% benzoyl alcohol.
  • PBS phosphate-buffered saline, pH 7 0
  • PBS/4%, 12% or 15% trehalose PBS/12% or 20% mannitol, PBS/15% or 20% lactose
  • PBS/4% sucrose PBS/2% sorbitol
  • DNA vaccine of the invention can further contain adjuvant plasmids expressing immunoregulatory molecules such as cytokine proteins.
  • adjuvant plasmids include but are not limited to plasmids expressing IL-1, IL-2, IL-4, IL-7, IL-12, IFN- ⁇ , and GM-CSF.
  • IL-4 expressing plasmid are plasmid pCAGGSEL-12(Fig.
  • the preferred adjuvant plasmid used in DNA vaccine of the invention is plasmid pGX10-hIL-12m.
  • Restriction enzyme treatment was performed as follows. 2 ⁇ g (1 ⁇ gl ⁇ t) of plasmid DNA or purified PCR product was mixed with 20 unit (2 ⁇ t) of a restriction enzyme (the restriction enzymes used in the following examples were products of Takara Shuzo Co., Ltd and New England Biolab, Inc ) along with buffer solution (10-times concentrated solution) supplied by manufacturer Distilled water was added to 50 ⁇ i The reaction was performed at 37 ° C for 2hr
  • DNA segment ligation and transformation of E. coli DNA solution treated with restriction enzyme was subjected to electrophoresis over 0 8% agarose gel (GIBCO-BRL) An agarose gel was cut to separate gel slice containing DNA segments of a desired size The DNA segments were extracted and purified by means of a gel extraction kit (QIAEN) The DNA segments were added to a buffer solution with T4 DNA ligase (Takara) and were ligated at 16 ° C for lOhr E coli was transformed by the ligated DNA segments according to the method described in Sambrook, et al , Molecular Cloning (2nd ed ), Chapter 1 74
  • PCR amplification was performed as follows. 200 pmol of two types of oligonucleotides (primers) were mixed with 20 ng of a template DNA, 10 unit of Takara exTaq (polymerase), 5 ⁇ i of Takara exTaq lOx buffer solution, 5 ⁇ i of 2.5mM dNTP mixture and distilled water to make a final volume of 50 ⁇ i.
  • the mixture was subjected to predenaturation for 4 min at 94 ° C, denaturation for 1 min at 94 °C, annealing for 1 min at 52 °C and polymerization at 72 ° C for 1 min per 1 kb of amplification product (for example, 0.5 min for 0.5 kb amplification; 3 min for 3 kb amplification) in order. This procedure was repeated for 30 cycles. For the final extension, the reaction was kept at 72 °C for 5 min.
  • the used PCR apparatus was Perkin Elmer's Gene Amp PCR System 2400.
  • the resulting PCR product was analyzed by electrophoresis over agarose gel and purified with a gel extraction kit of QIAGEN. The product was then cut with restriction enzymes and used in cloning for ligation with other DNA segments or other PCR products.
  • segment of 0.7 kb (including entire VAI and a part of SV40 polyA) was inserted into a unique Hpa I site of SV40 polyA part of vector pTV-2 (Lee, et al., J. Virol, 72,8430-36, (1998)) to form vector P TV-3 of 5.3 kb.
  • CMV5 TCG CGA CCC GGG CGA CGG CCA GTG AAT TGT ACC G: SEQ.
  • VA3 TCG CGA GGC GCG CCA CGA GCC GCC GCG CCT GGA AGG: SEQ. ID. NO: 2 (antisense)
  • the PCR product (2.0 kb) was cut with Nrul according to the above-described restriction enzyme treatment.
  • PCR was conducted using vector pZero-2 (Invitrogen) as a template and the following primers.
  • Vector pGX-1 was cut with restriction enzymes Xbal and Sail. The larger
  • DNA segment (3.1 kb) was separated according to the above-described procedure.
  • Vector pGL3-Enhancer (Promega) was cut with restriction enzymes Xbal and Sail. The smaller DNA segment (0.5 kb) was separated by the same method as above. The separated segments were joined together to form vector pGXIO
  • Fig. 2 and Fig. 3 show the gene map of the prepared vector pGXIO (3 5 kb) and sequential position of all 3641 nucleotides, respectively.
  • 3464Xba (ATCTAGAGGTATGGAGAAATAT): SEQ. ID. NO.: 6 (antisense).
  • PCR primers GeneBank Accession No. M33262; Regier, et al., AIDS Res. Hum. Retroviruses, 6,1221-1231, (1990)
  • SIVmac239 DNA clone GeneBank Accession No. M33262; Regier, et al., AIDS Res. Hum. Retroviruses, 6,1221-1231, (1990)
  • Nucleotide sequences 1193-3464 of SIVmac239 DNA which numbers were designated based on Gene Bank numbering, starting from the primer end cut by the restriction enzyme, were inserted into pBluescript SK+ (Stratagene) which had been cut with Sail and Xbal, and subjected to Klenow fragment treatment as in A of Example 1, to form vector pSK-SIVgag (5.3 kb)
  • the amplification product was inserted at Smal site of pBluescript SK+ (Stratagene) to form vector pSK-SIVenv3 (4.2 kb).
  • Vector pSK-SIV/ge-1 was cut with restriction enzymes Clal and Notl.
  • the resulting segment including the vector (6.7 kb) was joined with the segment not including the vector (1.2 kb), prepared by cutting pSK-SIVenv3 with restriction enzymes Clal and Notl, to form vector pSK-SIV/ge (7.9 kb).
  • the prepared pSK- SIV/ge DNA was cut with Kpnl and Notl and inserted at Kpnl/Notl site of vector pTV2
  • E. coli DH5a transformed by the prepared plasmid pTV-SIV/GE according to the present invention was deposited at KCTC (Korean Collection for Type Cultures) of KRIBB (Korea Research Institute of Bioscience and Biotechnology) on November 27,
  • Plasmid pTV-SIV/GE was cut with restriction enzymes Mlul and Xhol to prepare a segment (6.1 kb) including CMV promoter, TLP sequence and SIV gene.
  • pGXIO vector was cut with restriction enzymes Mlul and Xhol to prepare a DNA segment (2.6 kb) not including CMV promoter or TLP sequence. Two DNA segments were joined together to form plasmid pGXIO-SIV/GE (8.7 kb).
  • BamHI (AATGGATCCA TAGCTAAGT AGAG): SEQ. ID. NO.: 11 (sense)
  • Xhol (ATTTCTCGAG GCTATGCCAC CTCTC): SEQ. ID. NO.: 12 (antisense).
  • nucleotide sequences 3105-5668 of SIVmac239 DNA clone (GeneBank Accession: M33262) were amplified and cut with restriction enzymes BamHI and Xhol.
  • TGTGTGTAGA TGTGTAATAG GCC SEQ. ID. NO.: 14 (antisense).
  • the amplification product was mixed with ATP to a final concentration of 100 uM and 10 units of T4 polynucleotide kinase (New England BioLabs) and incubated at 37 ° C for lhr, and then self-ligated. Trnsformation of E. coli was performed by using the ligated DNA, and pSK-gDsSIV/polm (5.7 kb) was generated.
  • E. coli DH5a transformed with the prepared plasmid pTV-SIV/dpol according to the present invention was deposited at KCTC of KRIBB on November 27, 1999
  • Plasmid pTV-SIV/dpol was cut with restriction enzymes Notl and Xhol.
  • the resulting segment (2.7 kb) including SIV gene was inserted into vector pGXIO (3.6 kb), which had been cut with the same restriction enzymes, to form plasmid pGXlO-
  • PstlgDs CAA CTGCAG ATG GGG GGG GCT GCC G
  • gDsAscINotl ATT GCG GCC GCA GGC GCG CCG ATC TGA GAG AGG CAT CC: SEQ. ID. NO.: 16 (antisense).
  • PCR was conducted using these c oligonucleotides as primers and the vector pGXIO-SIV/pol as a template.
  • the amplification product was cut with restriction enzymes Pstl and Notl.
  • the resulting segment (0.1 kb) was inserted into vector pBluescriptSK (Stratagene) (3.0 kb), which had been cut with the same restriction enzymes, to form a plasmid pSK-gDs (3.1 kb).
  • PCR was conducted using these synthetic oligonucleotides as primers and SIVmac239 clone (Gene Bank Accession No M33262) as a template
  • the amplification product was cut with restriction enzymes Ascl and Notl, and the resulting segment (0 6 kb) was inserted into pSK-gDs (3 1 kb), which had been cut with the same restriction enzymes, to form a plasmid pSK-gDs/Vif (3 7 kb)
  • oligonucleotides were prepared BH5'nef (TAC GGA TCC ATG GGT GGA GCT ATTT T) SEQ ID NO 19
  • PCR was conducted using these synthetic oligonucleotides as primers and SIVmac239 clone (Gene Bank Accession No M33262) as a template
  • the PCR product was cut with restriction enzymes BamHI and Spel, and the resulting segment was inserted between BamHI and Spel sites of pBluscript SK+ (Stratagen) to form a plasmid pSK-5nef (3 0 kb)
  • PCR was conducted using these oligonucleotides as primers and SIVmac239 clone (Gene Bank Accession No. M33262) as a template.
  • the PCR product was cut with restriction enzymes Spel and Notl.
  • the resulting segment (0.4 kb) was inserted into plasmid pSK-5nef (3.4 kb), which had been cut with restriction enzymes Spel and
  • PCR was carried out using vector pSK-nefM as a template and the following oligonucleotides as primers:
  • Xba5'nef (ACC TCT AGA ATG GGT GGA GCT ATT T): SEQ. ID. NO: 23 (sense)
  • 3'nefNotI (AAA GCGGCCGC TGT TTC AGC GAG TTT): SEQ. ID. NO.: 22 (antisense).
  • the product was cut with restriction enzymes Notl and Xbal, and the resulting segment (0.8 kb) was inserted into pSK-gDs/Nif (3.7 kb), which had been cut with restriction enzymes ⁇ otI and Xbal, to form a plasmid pSK-V ⁇ (4.5 kb).
  • D ⁇ A segment (1.4 kb) was ligated with D ⁇ A segment (3.7 kb) prepared by cutting pGXIO-SIV/TV (This could be prepared by using pSK-gDs/Nif and pGXIO intermediates previously) with restriction enzymes Ascl and Not I, to form a plasmid pGX10-SIN/VN (5.1 kb).
  • pGXIO-SIV/TV This could be prepared by using pSK-gDs/Nif and pGXIO intermediates previously
  • restriction enzymes Ascl and Not I to form a plasmid pGX10-SIN/VN (5.1 kb).
  • AscKtat (TAT GGCG CGCC TGG AGA CAC CCT TGA GG) SEQ ID NO 24 (sense) tat3*NheNotI (AAA GCGG CCG CAA TCT AGA GTT TGA TGC AGA AGA
  • the product was cut with restriction enzymes Notl and Xbal, and the resulting DNA segment of 0 3 kb was inserted into pSK-gDs/tat, which had been cut with restriction enzymes Notl and Nhel, to form pSK-SIV/TV (3.7 kb).
  • Plasmid pSK-SIV/TV was cut with restriction enzymes Pstl and Notl.
  • the smaller DNA segment (0.7 kb) was inserted into pGXIO, which had been cut with the same restriction enzymes, to form pGXIO-SIV/TV (4.3 kb).
  • Sal5CMV (CCCG GTCGAC GGCCAG TGA ATT G): SEQ. ID. NO: 28 (sense)
  • Sal3enh (CTT CTG AA GTCGAC GGA TCC GC): SEQ. ID. NO.: 29 (antisense).
  • PCR was conducted using these oligonucleotides as primers and plasmid pGXIO-SIV/TV as a template.
  • the product was cut with restriction enzyme Sail, and the resulting segment 2.4 kb was inserted into pGXIO-SIV/VN, which had been cut with the same restriction enzyme, to form a plasmid pGXIO-SIV/VNTV.
  • PCR was conducted using plasmid pGXIO-SIV/VN as a template and the same oligonucleotides used in Example 6, i.e., Sal5CMV (sense) and Sal3enh (antisense), as primers.
  • the product was cut with restriction enzyme Sail, and the resulting segment of 3.2 kb was inserted into pGXIO-SIV/TV, which had been cut with the same restriction enzyme, to form a plasmid pGXIO-SIV/TVVN.
  • the following Examples illustrate the preparation of HIV vaccine immunogenic plasmids by substituting SIVmac239 genes with corresponding HIV-1 genes. HXB2 and JRCSF were used as HJV-1 gene.
  • Plasmid pTX GE (Lee A H et al., Vaccine 17:473-9, 1999) includes gag, env and rev genes of HXB2 (Gene Bank Accession No. K03455) as HIV gene and does not express and tat genes.
  • Plasmid pGXIO-HIV/GE (9.7kb) was constructed by ligating DNA fragment of 7.5kb (including CMV promoter, TPL sequence, HJV genes and portion of SV40 polyA), which had been obtained by digesting plasmid pTX GE with restriction enzymes Hpal and Mlul, with DNA fragment of 2.2kb (including replication orgin and kanamycine resistance gene), which had been obtained by digesting vector pGXIO with restriction enzymes Hpal and Mlul.
  • PCR amplification was carried out using these synthetic oligonucleotides as PCR primers, and proviral genes (pYK- JRCSF, NIH, AIDS Research and Reference Reagent Program) of HJV-1 JR-CSF (Gene Bank Accession No M38429) as templates for PCR
  • Pst3pol (ACA CTG CAG GGC AGC AAT TTC ACC) SEQ ID NO 32 (sense) polClal (CTT ATC GAT GTT CTA ATC CTC ATC) SEQ ID NO 33 (antisense)
  • PCT amplification was carried out using these synthetic oligonucleotides as PCR primers, and HIV-1 JR-CSF clones as templates for PCR
  • the product obtained thereby was digested with restriction enzymes Pstl and Clal
  • the resulting DNA fragment was inserted into plasmid pSK-5pol, which had been cut with the same restriction enzymes Pstl and Clal, to form plasmid pSK-poIMjr (5.5kb).
  • Plasmid pSK-poIMjr was digested with restriction enzymes BamHI and Nael to obtain DNA fragment of 2.8kb including HIV-1 pol gene.
  • Plasmid pSK- gDs/E2t (Lee et al., J. Virol., 72:8430, 1998) was digested with the same restriction enzymes BamHI and Nael to obtain DNA fragment of 2.8kb. The two DNA fragments were ligated to form plasmid pSK-gDs/polMjr of 5.6kb.
  • Plasmid pSK-gDs/polMjr was digested with restriction enzymes Notl and Xhol to obtain DNA fragment of 2.6kb. The resulting DNA fragment was inserted into Notl and Xhol sites of vector pGXIO to form pGXIO-HJV/dpol (6.2kb).
  • VifXbal (CAT TCT AGA GTG TCC ATT CAT TGT ATG GC): SEQ. ID. NO. 35 (antisense).
  • PCT amplification was carried out using these synthetic oligonucleotides as PCR primers, and HIN-1 JR-CSF clones as templates for PCR.
  • the product obtained thereby was digested with restriction enzymes Pstl and Clal.
  • the resulting D ⁇ A fragment was inserted into plasmid pSK-5pol, which had been cut with the same restriction enzymes Pstl and Clal, to form plasmid pSK-poIMjr (5.5kb).
  • BH5'nef-HIV TAA GGA TCC ATG GGT GGC AAG TGG TCA: SEQ. ID.
  • 5'SpeI (ATC ACT AGT TGA GTA AAT TAG CCC TTC): SEQ. ID. NO. 36 (antisense).
  • PCT amplification was carried out using these synthetic oligonucleotides as PCR primers, and HIV-1 JR-CSF clones (GeneBank Accession No. M38429) as templates for PCR.
  • the product obtained thereby was digested with restriction enzymes BamHJ and Spel.
  • the resulting DNA fragment was inserted into plasmid pBluscriptSK ⁇
  • PCT amplification was carried out using these synthetic oligonucleotides as PCR primers, and HIV-1 JR-CSF clones (GeneBank Accession No M38429) as templates for PCR
  • the product obtained thereby was digested with restriction enzymes Spel and Notl
  • the resulting DNA fragment of 0 3 kb was inserted into plasmid pSK-5nefjr, which had been cut with the same restriction enzymes Spel and Notl, to form plasmid pSK-5nefMjr (3 6kb)
  • Vector pSK-VNjr was digested with restriction enzymes Ascl and Notl. The resulting small DNA fragment of 1.2kb was inserted into pGXIO-HIV/TV, which had been cut with restriction enzymes Pstl and Notl, to form pGXlO-
  • AscI5'tat-HIV (ATC GGCG CGCC TGG AGC CAG TAG ATC CT): SEQ. ID. NO. 40 (sense) tat3'XbaI-HIV (CCC TCT AGA CTT TGG TAG AGA AAC TTG): SEQ. ID.
  • PCT amplification was carried out using these synthetic oligonucleotides as PCR primers, and HJV-1 JR-CSF clones (GeneBank Accession No. M38429) as templates for PCR.
  • the product obtained thereby was digested with restriction enzymes Ascl and
  • PCT amplification was carried out using these synthetic oligonucleotides as PCR primers, and HIV-1 JR-CSF clones (GeneBank Accession No M38429) as templates for PCR
  • the product obtained thereby was digested with restriction enzymes Notl and Xbal
  • the resulting DNA fragment of 0 2kb was inserted into plasmid pSK-gDs/tatjr, which had been cut with the same restriction enzymes Notl and Xbal, to form plasmid pSK-TVjr (3 5kb)
  • Vector pSK-TVjr was digested with restriction enzymes Ascl and Notl The resulting small DNA fragment of 0 5kb was inserted into pGXl 0-HJV/TV of 3 7kb, which had been cut with restriction enzymes Ascl and Notl, to form pGXIO-HIV/TV of 4 2kb
  • PCT amplification was carried out using these synthetic oligonucleotides as PCR primers, and pGXIO-HIV/TV as templates for PCR
  • the product obtained thereby was digested with restriction enzyme Sail
  • the resulting DNA fragment of 2 3kb was inserted into plasmid pGXlO-HJV/VN, which had been cut with the same restriction enzyme Sail, to form plasmid pGXIO-HIV/VNTV
  • PCT amplification was carried out using the following synthetic oligonucleotides as PCR primers, and pGXIO-HJV/VN as template for PCR
  • RT-PCR PCR System 2400, Perkin Elmer
  • complementary primers from NC37 cell human B cell activated with PMA (phorbol myrystic acetate)
  • cDNAs encoding human p35 subunit of 820 bp and human p40 subunit of 1,050 bp were cloned and amplified.
  • complementary primers for amplification of human p35 subunit the following oligonucleotides were used:
  • hp35 (5'-CCCGGGAAAGTCCTGCCGCGCCTCG-3'): SEQ. ID. NO. 44
  • hp35 (5'-ACAACGGTTTGGAGGGA-3 * ): SEQ. ID. NO. 45 (antisense).
  • hp40 5'-AGAGCACCATGGGTCACCAGCAGTTGG-3' SEQ. ID. NO. 46 (sense)
  • hp40 5'-CGATGCGGCCGCACCTAACTGCAGGG-3' SEQ. ID. NO. 47 (antisense).
  • Each amplified cDNA was subcloned into starting vector pBluescriptSK+ (Stratagene). Genes encoding P35 and p40 subunits was inserted into Smal site of vector pBluescriptSK+ to pSK-hp35 of 3.8kb and pSK-hp40 of 4. Okb, respectively.
  • a bicistronic vector co-expressing genes encoding p35 and p40 subunits was constructed.
  • the IRES gene of EMC V was produced by RT-PCR and digested with restriction enzyme EcoRV. The resulting DNA fragment was inserted into EcoRV site of vector pBluescriptSK+ (Stratagene) to form vector pSK- IRES of 3.5kb. Then, the following oligonucleotides were used as complementary primers:
  • IRES (5'-AAGATATCGAATTCCCCCTC-3'): SEQ. ID. NO. 48 (sense)
  • IRES (5'-TTGCCATGGCCATATTTATCA-3'): SEQ. ID. NO. 49 (antisense).
  • Plasmid pSK-hp35 was digested with restriction enzymes Smal and Notl and filled with T4 DNA polymerase to obtain hp35 fragment of 0.8kb. This DNA fragment was inserted into DNA fragment of 3.5kb formed by digesting vector pSK-IRES with restriction enzyme EcoRV to construct pSK-hp35/TRES of 4.3kb.
  • the hp40 DNA fragment of l.Okb obtained by digesting pSK-hp40 with restriction enzymes Ncol and Notl was inserted into pSK-hp35/IRES, which had been cut with the same restriction enzymes, to construct the plasmid co-expressing genes encoding p35 and p40 subunits.
  • the construct was digested with restriction enzymes Smal and Clal and ligated with ligase so that portion of restriction enzyme site upstream of hp35 was removed.
  • the plasmid obtained thereby is designated pSK-hp35/IRES/hp40.
  • PCR was carried out using T7 primer and hp40-N222L antisense primer and pSK-hp40 as template to substitute amino acid 222, asparagine, of hp40 with leucine.
  • second PCR was conducted using T3 primer and hp40-
  • N222L sense primer As results, two PCR fragments sharing common site including mutational point were formed. The second PCR was carried out using a mixture of those fragments as template and flanking primer to produce fusion product thereof. The resulting fusion DNA fragment was digested with restriction enzymes Ncol and Notl and inserted into vector pBluescriptSK+ of
  • T7 (5'-GTAATACGACTCACTATAGGGC-3'): SEQ. ID. NO. 50 (sense)
  • hp40-N222L (5'-TATGAGCTCTACACCAGCAGC-3 * ): SEQ. ID. NO. 51 (antisense).
  • hp40-N222L fragment of plasmid pSK-hp40-N222L was substituted with hp40 fragment of plasmid pSK- hp35/IRES/hp40 to construct plasmid pSK-hp35/IRES/hp40-N222L of 5 3kb
  • hIL-12 (5'-AACTCGAGGTCGACGGTATC-3'): SEQ. ID. NO. 54 (sense)
  • hIL-12 (5'-TTCTCGAGCGGCCGCACCT-3'): SEQ. ID. 55 (antisense).
  • PCR amplification was carried out using these synthetic oligonucleoties as primers and vector pSK-hp35/ERES/hp40-N222L as template to obtain fragment hp35/IRES/hp40-N222L.
  • This fragment was digested with restriction enzyme Xhol and inserted into vector pGXIO, which had been cut with restriction enzyme Xhol, to construct plasmid pGX10-hp35/IRES/hp40-N222L (or pGX10-hp35/IRES/hp40) of 5.9kb.
  • human growth hormone (hGH) gene was inserted into the multi-cloning site of pGXIO vector according to the present invention, and its expression level was compared to that of control vector. The test result was shown in
  • hGHF (AAGAA TTC GAT ATG TTCCCAA CTAT TC): SEQ. ID. NO.: 56 (sense) hGHR (TTT TCT AGA ATTA GAAGCC ACAC GACC): SEQ. ID. NO.: 57 (antisense).
  • the amplification product was cut with restriction enzymes EcoRI and Xbal, and the resulting segment was inserted into pTV2, which had been digested with the same restriction enzymes, to form a plasmid pTV2/hGH.
  • pGXl/hGH pTV2/hGH was cut with restriction enzymes EcoRI and Xbal. The resulting DNA segment of 0.6 kb was inserted into vector pGXl, which had been digested with the same restriction enzymes, to form a plasmid pGXl/hGH.
  • pGXIO/hGH Fig. 24
  • P TV2/hGH was cut with restriction enzymes EcoRI and Xbal.
  • the resulting DNA segment of 0.6 kb was inserted into vector pGXIO, which had been cut with restriction enzymes EcoRI and Xbal, to form a plasmid pGX hGH.
  • PCR amplification was carried out using pZero-2 (Invitrogen) as a template and the following oligonucleotides as primers
  • KanXmF (TTG GAA AAC GTT CTT CGG GCG GCC TAT TGG TTA AAA
  • KanXmR CCT GAA CGT TTT CCT TTT CAC GTA GAA AGC
  • pGXO/hGH was prepared by digesting pTV2/hGH with restriction enzymes EcoRI and Xbal and inserting the resulting DNA segment of 0 6 kb into vector pGXO, which had been cut with the same restriction enzymes EcoRI and Xbal (Fig 23b)
  • Fig. 18 represent relative expression levels (hGH concentration in culture medium) of each vector, when the hGH expression of pTV2/hGH was defined as 100. That is, the larger the value, the higher the hGH levels in the culture medium expressed after transfection of vector DNA. Therefore, it can be seen from
  • vector pGXIO of the present invention expresses three times more hGH than control group vector pTV2.
  • hGH-expressing plasmid DNAs (pTV2/hGH, pGXO/hGH and pGXIO/hGH) prepared and purified in Experimental Example 1 were separately dissolved in a physiological saline to the concentration of 1 ⁇ gl ⁇ i. 100 ⁇ i of this solution was injected in leg muscle (tibialis anterior muscle) of 8 weeks old female BALB/c mouse, and its immune response was observed. Three weeks after injection, blood was drawn from subocular vein of the mouse and analyzed by antibody ELISA. The antibody ELISA was carried out according to the method of Song, et al. in J. Virol, 74, 2920, 2000. After 9 weeks, 100 ⁇ g of DNA solution was injected by the same method.
  • Fig. 25 amounts of anti-hGH antibody before immunization were spotted on a left side as O.D (abso ⁇ tion) at 405 nm.
  • the central spots indicate the O.D values of anti-hGH in blood serum collected at 3 weeks after vaccination.
  • Spots on the right side are the O.D values of anti-hGH in blood serum collected at 9 weeks after vaccination. Higher O.D values mean stronger anti-hGH responses as induced.
  • Experimental Examples 1 and 2 demonstrate that vector pGXIO is superior to the control group vector pTV in terms of their in vitro expression levels and antibody production after immunization.
  • Plasmids pTV-SIV/GE and pTV-SIV/dpol were dissolved in saline (0.85%
  • Plasmids pGXIO-SIV/GE, pGXIO-SIV/dpol, pGXIO-SIV/VN and pGXlO- SIV/TV according to the present invention were separately dissolved in saline (0.85% NaCl) to form four solutions of 2 iiig/md concentration.
  • saline 0.85% NaCl
  • 400 ⁇ g (2 mgt t) of each solution was injected in the monkey's leg muscle at four sites.
  • SIN/TV and adjuvant plasmid pGX10-hIL-12m according to the present invention were separately dissolved in saline (0.85% ⁇ aCl) to form five solutions of 2.5 mglml concentration.
  • saline 0.85% ⁇ aCl
  • 400 ⁇ g (2.5 mg/m ) of each solution (total 2 mg) was injected in the monkey's leg muscle at four sites.
  • the same D ⁇ A as one used at the first immunization was injected by the same method.
  • This method was as follows: 6 ml of blood obtained from monkey (treated with citric acid) was put in a tube (lympho-prep, Greiner) containing 3 m of Ficoll- hypaque (Pharmacia). The blood was centrifuged for 20 min at 20 ° C and 1200xg to separate red blood cells, PBMCs and plasma. Separated PBMCs were subjected to continuous dilution to reduce the number of cells by half from 1 10 . Then, 10 C8166 target cells were added to the final dilution and cultured together (culture medium: RPMI1640 + 10% fetal bovine serum). After 3-4 days, half the culture medium including cells was removed and fresh culture medium was added.
  • culture medium RPMI1640 + 10% fetal bovine serum
  • the cultivation was carried out for 2 weeks. Upon completion of cultivation, the supernatant was taken (after centrifuging for lOmin at 800xg).
  • p27 antigen detection ELISA was carried out using a Coulter kit following the manufacturer's instruction. The final PBMC dilution that exhibits positive reaction was identified, and number of infectious cells per one million PBMCs was determined. If a dilution exhibits p27 positive reaction for 2.5X 10 5 PBMCs and p27 negative reaction for the next dilution (1.25X10 5 PBMCs), the infectious cell ratio is 4/1,000,000.
  • Fig. 27 Reduction of infectious PBMCs means that cells wherein SIVmac239 was capable of replicating are reduced, which in turn means that SIVmac239 replication in the monkey body was controlled.
  • Fig. 27 shows number of infectious cells per one million PBMCs 0, 2, 4, 8, 12 and 16 weeks after SIVmac239 infection for each monkey group.
  • the number of infectious cells dropped to 0.13% (128/1000000) after 8 weeks, and 24 weeks after, for two of the five monkeys, number of infectious cells was less than 1 (per 1,000,000), for one monkey, it dropped to 16; which was about 100-1000 times more efficient in inhibiting viral replication, compared to monkeys immunized with vector (Group 1;
  • RNA copies in plasma was determined by Quantitative Competitive RT-PCR (Reverse Transcription PCR) method of BPRC (Biomedical Primate Research Centre, the Netherlands) In this method, RT-PCR was carried out using RNA mixture of known reference SIVmac239 RNA and RNA separated from sample plasma as a template. If the number of RNA copies in plasma was larger than that of reference RNA, the plasma RNA was amplified; and otherwise, the reference RNA was amplified PCR. Size of the amplification product was measured by electrophoresis in agarose gel. The used reference RNA was the one which had been modified so that
  • PCR product has a size larger or smaller than that of SIVmac239 RNA even when using the same primer. Accordingly, the discrepancy resulting from the size of the product should be compensated. More detailed description of this method was provided in a paper by Watson, et al. (J. Virol 71,284-290, (1997)).
  • the number of RNA copies in plasma was another indication of viral infection degree. If SIV replicates actively, RNA was secreted to the plasma. Therefore, if the number of RNA copies in plasma was low, it means that RNA replication was inhibited properly (Fig. 28).
  • monkeys of Groups 1, 3 and 4 showed more than 500,000 copies of SIV RNA in 1 ml of plasma 4-24 weeks after infection.
  • three of the five monkeys (Group 2+5) showed a reduction to 100,000 after 12 weeks and further reduction afterwards (16 weeks and 24 weeks).
  • the other two monkeys showed smaller number of viral copies after 12 weeks compared to infected monkeys (Group 1), they showed more than 100,000 copies after 16 weeks, which was not much different from that of infected monkeys (Groups 1, 3 and 4).
  • Absolute number of CD4+ cells in unit volume of blood was determined, which was the most general method for evaluating AIDS progress in monkey and human. If monkey was infected with SIVmac239, number of CD4+ cells, which are the mainly infected cells, decreases gradually due to apoptosis. Reduction of CD4+ cell number causes dysfunction of monkey's immune system. This causes AIDS-associated disease, and consequently, the monkey dies. That was, reduction of absolute number of
  • CD4+ cells means that immune functions of the host deteriorated, and that replication of SIVmac239 was not controlled effectively. 1 week, 2 weeks, 4 weeks, 6 weeks, 8 weeks, 12 weeks, 16 weeks, 20 weeks,
  • Fig. 29 In Fig. 29, absolute number of CD4+ T cells in 1 ⁇ i of blood was presented as a percentage of the number before infection (100%). The initial number of CD4+ T cells was determined before SIV infection at more than two time points. Fig. 29 shows that one monkey in Group 1 showed a gradual decrease in the number of CD4+ cells, and reach 50% of initial value % after 28 weeks.
  • DNA vaccine wherein PBMCs are stimulated by a Gag peptide pool and the number of PBMCs that secrete INF- ⁇ was determined.
  • a 96-well plate U-cytech
  • 5 ⁇ g (100 ⁇ i in PBS) of anti-IFN- ⁇ mAb per well was let stand for 15hr at 4°C . It was then washed 6 times with PBST (PBS + 0.05% Tween-20). After adding 200 ⁇ i of 2% BSA/PBS per well for lhr at 37°C to block sites not bound to mAb, 100 ⁇ i of
  • ELISPOT test medium 45% RPMI1640, 45% XVIVO, 10% fetal bovin serum, 1% antibiotics
  • 2X 10 5 PBMCs purification method of PBMC was described in
  • Fig. 30 The results are shown in Fig. 30.
  • Fig. 30 the number of T cells per million PBMCs that secrete IFN- ⁇ due to stimulation by gag peptide was shown. This represents the number of SIVmac239 gag-specific T cells. A larger number means that a stronger gag-specific T cell immune responses were induced.
  • a gag-specific immune response was induced by the group immunized with immunogenic plasmids pTV-SIV/GE and pTV-SIV/pol (Group 5) and the group immunized with immunogenic plasmids pGXIO-SIV/GE, pGXIO-SIV/pol, pGXIO-SIV/VN and pGXIO-SIV/TV according to the present invention (Grroup 3), and there was no difference in strength of the response.
  • the superior viral replication inhibition effect generated by immunization with immunogenic plasmids pGXIO-SIV/GE, pGXIO-SIV/pol, pGXIO-SIV/VN and pGXIO-SIV/TV according to the present invention seems to be caused by the presence of regulatory gene, rather than by the difference in vector pGXIO.
  • the culture medium was removed. After washing with PBS, the cells are harvested for SDS-PAGE (SDS-polyacrylamide gel electrophorsis). After performing the SDS- page the proteins on the gel was transferred to nitrocellulose membrane (Schleicher &
  • Blocking buffer containing 1/3000 (v/v) of HRP-conjugated anti-human IgG (Sigma) was reacted with the membrane for 2hr at room temperature, and washed 4 times with washing buffer. After washing the membrane with distilled water 5 times, 10 mi of 1 : 1 Luminol/Enhancer solution (Pierce) and Stable Peroxide Solution (Pierce) was added to initiate a peroxidase reaction. After exposing the product for lOmin on X-ray film (AGFA), the film was developed to obtain the expression profile.
  • pGXIO-SIV/GE expressed SIV env and gag proteins well, and pGXIO-SIV/pol expressed RT-INT polyprotein well.
  • gag and env protein expression was significantly lower than pGXIO-SIV/GE. This means that pGXIO vector was superior in in-vitro expression efficiency, compared with pTV2.
  • Plasmids pGXIO, pGXIO-SIV/VN and pGXIO-SIV/VNTV are transfected into HeLa cells.
  • SIV nef polyclonal Ab (NIBSC APR444) was used to detect vif-nef protein, and HRP-conjugated anti-rabbit IgG was used as secondary antibody.
  • HRP-conjugated anti-rabbit IgG was used as secondary antibody.
  • Other details are the same as those of Experimental Example 7.
  • pGXIO-SIV/VN and pGXIO-SIV/VNTV expressed vif- nef protein well in HeLa cell.
  • Plasmids pGXIO and pGXIO-SIV/TV are transfected into HeLa cells.
  • SIV tat polyclonal Ab (NIBSC APR4006) was used to detect tat-vpx protein, and HRP- conjugated anti-rabbit IgG was used as secondary antibody.
  • HRP- conjugated anti-rabbit IgG was used as secondary antibody.
  • Other details are the same as those of Experimental Example 7.
  • pGXIO-SIV/TV expressed tat-vpx protein well in HeLa cell.
  • HIV DNA vaccine containing immunogenic plasmids pGXIO-HIV/pol, pGXIO-HIV/GE and pGXIO-HIV/VNTV and adjuvant plasmid pGX10-hIL-12m (2 mg each) according to the present invention was administered to chimpanzees chronically infected with HIV-1 (HIV IIIB), through gluteus maximus (or deltoid muscle) injection.
  • One chimpanzee was injected 4 times at one month intervals, and the other chimpanzee was injected 4 times at one month interval and after 4 months period, injected again 5 times at one month interval.
  • HJV DNA vaccine containing immunogenic plasmids pGXIO-HIV/pol, pGXIO-HIV/GE and pGXIO-HIV/VNTV and adjuvant plasmid pGX10-hIL-12m (1 mg each) according to the present invention was administered 8 Ukrainian patients infected with HJV-1.
  • Four persons are injected 6 times at 2 months intervals; two persons were injected 5 times at 2 month intervals; and the remaining two persons were injected 4 times at 2 month intervals, through intramuscular injection. Injection were alternately administered to gluteus maximus and deltoid muscles.

Abstract

L'invention concerne des plasmides immunogènes possédant une excellente efficacité d'expression des immunogènes et une efficacité immunitaire dans le modèle de singe rhésus/SIVmac239 et chez les patients humains atteints du SIDA. L'invention porte également sur des vaccins à base d'ADN pour la prophylaxie ou le traitement du SIDA, contenant lesdits plasmides immunogènes.
PCT/KR2002/000855 2001-12-07 2002-05-08 Plasmides immunogenes sivmac239 et vaccin a base d'adn contre le sida, les contenant WO2003048366A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2002258268A AU2002258268A1 (en) 2001-12-07 2002-05-08 Sivmac239 immunogenic plasmids and aids dna vaccine containing the same

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20010079870 2001-12-07
KR2001-0079870 2001-12-07
KR1020020023839A KR100900249B1 (ko) 2001-12-07 2002-04-30 ＳＩＶｍａｃ239의 면역원성 플라스미드 및 이들을 함유한ＡＩＤＳ ＤＮＡ 백신
KR2002-0023839 2002-04-30

Publications (1)

Publication Number Publication Date
WO2003048366A1 true WO2003048366A1 (fr) 2003-06-12

Family

ID=26639521

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2002/000855 WO2003048366A1 (fr) 2001-12-07 2002-05-08 Plasmides immunogenes sivmac239 et vaccin a base d'adn contre le sida, les contenant

Country Status (2)

Country Link
AU (1) AU2002258268A1 (fr)
WO (1) WO2003048366A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2010265313A (ja) * 2004-06-17 2010-11-25 Wyeth Llc ３つの完全な転写単位を有するプラスミドおよびｈｉｖに対する免疫応答を誘発するための免疫原組成物

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5698432A (en) * 1991-05-17 1997-12-16 Retroscreen Ltd. Vaccines and methods for their production
US6004799A (en) * 1996-03-05 1999-12-21 The Regents Of The University Of California Recombinant live feline immunodeficiency virus and proviral DNA vaccines
KR20010054338A (ko) * 1999-12-06 2001-07-02 서유석 원숭이에서 ＳＩＶｍａｃ２３９의 감염에 대한 방어를유도하는 ＡＩＤＳ ＤＮＡ 백신

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5698432A (en) * 1991-05-17 1997-12-16 Retroscreen Ltd. Vaccines and methods for their production
US6004799A (en) * 1996-03-05 1999-12-21 The Regents Of The University Of California Recombinant live feline immunodeficiency virus and proviral DNA vaccines
KR20010054338A (ko) * 1999-12-06 2001-07-02 서유석 원숭이에서 ＳＩＶｍａｃ２３９의 감염에 대한 방어를유도하는 ＡＩＤＳ ＤＮＡ 백신

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
HARMS J.S. ET AL., BRAZ. J. MED. BIOL. RES., vol. 32, no. 2, 1999, pages 155 - 162 *
LEE A.H. ET AL., VACCINE, vol. 17, 1999, pages 473 - 479 *
LEE S.W. ET AL., J. VIROL., vol. 72, 1998, pages 8430 - 8436 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2010265313A (ja) * 2004-06-17 2010-11-25 Wyeth Llc ３つの完全な転写単位を有するプラスミドおよびｈｉｖに対する免疫応答を誘発するための免疫原組成物
US8623382B2 (en) 2004-06-17 2014-01-07 Wyeth Llc Immunogenic compositions for inducing an immune response to HIV

Also Published As

Publication number Publication date
AU2002258268A1 (en) 2003-06-17

Similar Documents

Publication Publication Date Title
JP5123343B2 (ja) Ｈｉｖｃｏｎ：ｈｉｖ免疫原及びその使用
JP4749481B2 (ja) 弱毒化された非機能性ｖｉｆタンパク質による免疫応答性誘導
Dale et al. Chimeric human papilloma virus–simian/human immunodeficiency virus virus-like-particle vaccines: immunogenicity and protective efficacy in macaques
KR100971268B1 (ko) ＳＩＶｍａｃ239의 면역원성 플라스미드 및 이들을 함유한 ＡＩＤＳ ＤＮＡ 백신
EP0882134B1 (fr) Procedes et compositions pour l'immunisation genetique protectrice et therapeutique
US20080280354A1 (en) Recombinant poxvirus for chimeric proteins of the human immunodeficiency virus
EP2536838A2 (fr) Vecteurs exprimant des antigènes du vih et le gm-csf et procédés associés destinés à générer une réponse immunitaire
US20110123485A1 (en) Viral vectors for delivering vaccines for hiv and other infectious diseases
US20110110892A1 (en) Vectors for delivering disease neutralizing agents
Malkevitch et al. A call for replicating vector prime-protein boost strategies in HIV vaccine design
US20090142373A1 (en) Immunizing Against HIV Infection
WO1994017825A1 (fr) Mutants de genes multiples du virus d'immunodeficience humaine utilises dans un vaccin
KR100354562B1 (ko) 원숭이에서 ＳＩＶｍａｃ２３９의 감염에 대한 방어를유도하는 ＡＩＤＳ ＤＮＡ 백신
WO2003048366A1 (fr) Plasmides immunogenes sivmac239 et vaccin a base d'adn contre le sida, les contenant
US20030232060A1 (en) Attenuated, doxycycline-inducible human immunodeficiency virus proviral molecular clones
Part Nonhuman Primates HIV/SIV Vaccine Trials Database
EP1776961A1 (fr) Vaccination contre infections de VIH
Simian-Human Antigen Expression Kinetics and Immune
AU1971201A (en) Methods and compositions for protective and therapeutic genetic immunization

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SD SE SG SI SK SL TJ TM TN TR TT TZ UA UG US UZ VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP