WO2003046006A1 - Polynucleotides encoding nexin-related serine protease inhibitor - Google Patents

Polynucleotides encoding nexin-related serine protease inhibitor Download PDF

Info

Publication number
WO2003046006A1
WO2003046006A1 PCT/EP2002/013203 EP0213203W WO03046006A1 WO 2003046006 A1 WO2003046006 A1 WO 2003046006A1 EP 0213203 W EP0213203 W EP 0213203W WO 03046006 A1 WO03046006 A1 WO 03046006A1
Authority
WO
WIPO (PCT)
Prior art keywords
nexin
serine protease
protease inhibitor
related serine
polynucleotide
Prior art date
Application number
PCT/EP2002/013203
Other languages
French (fr)
Inventor
Alex Smolyar
Original Assignee
Bayer Healthcare Ag
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Bayer Healthcare Ag filed Critical Bayer Healthcare Ag
Priority to AU2002352115A priority Critical patent/AU2002352115A1/en
Publication of WO2003046006A1 publication Critical patent/WO2003046006A1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/81Protease inhibitors
    • C07K14/8107Endopeptidase (E.C. 3.4.21-99) inhibitors
    • C07K14/811Serine protease (E.C. 3.4.21) inhibitors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide

Definitions

  • the invention relates to the regulation of human nexin-related serine protease inhibitor.
  • Serine proteases are enzymes that break down proteins and have a serine and a histidine involved at the active site of the catalysis. This group includes enzymes active in digestion, blood clotting, immune reactions, and fertilization of the ovum. Serine proteases can be regulated to provide therapeutic uses. For. example, metastasizing cancer cells invade the extracellular matrix using plasma membrane protrusions that contact and dissolve the matrix with proteases.
  • One embodiment of the invention is a nexin-related serine protease inhibitor polypeptide comprising an amino acid sequence selected from the group consisting of:
  • amino acid sequences which are at least about 32% identical to the amino acid sequence shown in SEQ ID NO: 2;
  • Yet another embodiment of the invention is a method of screening for agents which decrease extracellular matrix degradation.
  • a test compound is contacted with a nexin-related serine protease inhibitor polypeptide comprising an amino acid sequence selected from the group consisting of:
  • amino acid sequences which are at least about 32% identical to the amino acid sequence shown in SEQ ID NO: 2;
  • Binding between the test compound and the nexin-related serine protease inhibitor polypeptide is detected.
  • a test compound which binds to the nexin-related serine protease inhibitor polypeptide is thereby identified as a potential agent for decreasing extracellular matrix degradation.
  • the agent can work by decreasing the activity of the nexin-related serine protease inhibitor.
  • Another embodiment of the invention is a method of screening for agents which decrease extracellular matrix degradation.
  • a test compound is contacted with a polynucleotide encoding a nexin-related serine protease inhibitor polypeptide, wherein the polynucleotide comprises a nucleotide sequence selected from the group consisting of: nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO: 1; and
  • a test compound which binds to the polynucleotide is identified as a potential agent for decreasing extracellular matrix degradation.
  • the agent can work by decreasing the amount of the nexin-related serine protease inhibitor through interacting with the nexin-related serine protease inhibitor mRNA.
  • Another embodiment of the invention is a method of screening for agents which regulate extracellular matrix degradation.
  • a test compound is contacted with a nexin-related serine protease inhibitor polypeptide comprising an amino acid sequence selected from the group consisting of:
  • amino acid sequences which are at least about 32% identical to the amino acid sequence shown in SEQ ID NO: 2;
  • a nexin-related serine protease inhibitor activity of the polypeptide is detected.
  • a test compound which increases nexin-related serine protease inhibitor activity of the polypeptide relative to nexin-related serine protease inhibitor activity in the absence of the test compound is thereby identified as a potential agent for increasing extracellular matrix degradation.
  • a test compound which decreases nexin-related serine protease inhibitor activity of the polypeptide relative to nexin-related serine protease inhibitor activity in the absence of the test compound is thereby identified as a potential agent for decreasing extracellular matrix degradation.
  • Even another embodiment of the invention is a method of screening for agents which decrease extracellular matrix degradation.
  • a test compound is contacted with a nexin-related serine protease inhibitor product of a polynucleotide which comprises a nucleotide sequence selected from the group consisting of:
  • nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO: 1;
  • Binding of the test compound to the nexin-related serine protease inhibitor product is detected.
  • a test compound which binds to the nexin-related serine protease inhibitor product is thereby identified as a potential agent for decreasing extracellular matrix degradation.
  • Still another embodiment of the invention is a method of reducing extracellular matrix degradation.
  • a cell is contacted with a reagent which specifically binds to a polynucleotide encoding a nexin-related serine protease inhibitor polypeptide or the product encoded by the polynucleotide, wherein the polynucleotide comprises a nucleotide sequence selected from the group consisting of:
  • nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO: 1;
  • the invention thus provides a human nexin-related serine protease inhibitor that can be used to identify test compounds that may act, for example, as activators or inhibitors.
  • Human nexin-related serine protease inhibitor and fragments thereof also are useful in raising specific antibodies that can block the protein and effectively reduce its activity.
  • Fig. 1 shows the DNA-sequence encoding a nexin-related serine protease inhibitor polypeptide (SEQ ID NO: 1).
  • Fig. 2 shows the amino acid sequence deduced from the DNA-sequence of Fig.1 (SEQ ID NO: 2).
  • Fig. 3 shows the amino acid sequence of the protein identified by swiss
  • Fig. 4 shows the DNA-sequence encoding a nexin-related serine protease inhibitor polypeptide (SEQ ID NO: 4).
  • Fig. 5 shows the BLASTP - alignment of 514 against swiss
  • Fig. 6 shows the ETMMPFAM - alignment of 514 against pfam
  • Fig. 7 shows the HMMPFAM - alignment of 514 against pfam
  • Serpin serine protease inhibitor
  • Scoring matrix BLOSUM62 (used to infer consensus pattern).
  • Fig. 8 shows the Blocks search results.
  • Fig. 9 shows the Prosite search results.
  • Fig. 10 shows the Multiple alignments. Names: 514_protein, SEQ ID NO: 2; swiss.Q07235, Serine protease inhibitor, GDNjmouse; trembl.M17783 glia- derived nexin (GDN), human; swiss.P07093 glia derived nexin, human; swiss.P07092 GDN rat; trembl
  • ANTITHROMBIN-III human; swiss.P01008 antithrombin, ANT3_human; trembl
  • the invention relates to an isolated polynucleotide from the group consisting of:
  • a polynucleotide encoding a nexin-related serine protease inhibitor polypeptide comprising an amino acid sequence selected from the group consisting of: amino acid sequences which are at least about 32% identical to the amino acid sequence shown in SEQ ED NO: 2; and the amino acid sequence shown in SEQ ID NO: 2.
  • a polynucleotide which hybridizes under stringent conditions to a poly- nucleotide specified in (a) and (b) and encodes a nexin-related serine protease inhibitor polypeptide; d) a polynucleotide the sequence of which deviates from the polynucleotide sequences specified in (a) to (c) due to the degeneration of the genetic code and encodes a nexin-related serine protease inhibitor polypeptide; and
  • e a polynucleotide which represents a fragment, derivative or allelic variation of a polynucleotide sequence specified in (a) to (d) and encodes a nexin-related serine protease inhibitor polypeptide.
  • Human nexin-related serine protease inhibitor comprises the amino acid sequence shown in SEQ ED NO: 2.
  • a coding sequence for human nexin-related serine protease inhibitor is shown in SEQ ID NO: 1. This sequence is located on chromosome 13q4.3.
  • Related ESTs (AW593520; AI434823; AI741381; AA262235; BE684071) are expressed in pooled germ cell tumors, kidney, germinal center B cells, and pooled embryos.
  • SEQ ID NO: 2 hits several protease inhibitors with about 30% identity, including human protease nexin and antithrombin.
  • SEQ ED NO: 2 shares the same active site residues (RS) with both antithrombin and nexin protease inhibitors; thus, the protein of SEQ ID NO: 2 is likely to be a serine protease inhibitor with specific activity closely related to nexin and antithrombin.
  • Human nexin-related serine protease inhibitor of the invention is expected to be useful for the same purposes as previously identified serine protease inhibitors.
  • Human nexin-related serine protease inhibitor is believed to be useful in therapeutic methods to treat disorders such as cancer, CNS disorders, cardiovascular disorders, genitourinary disorders, hematological disorders, gastrointestinal disorders, COPD, and asthma.
  • Human nexin-related serine protease inhibitor also can be used to screen for human nexin-related serine protease inhibitor activators and inhibitors.
  • Human nexin-related serine protease inhibitor polypeptides according to the invention comprise at least 6, 10, 15, 20, 25, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, or 424 contiguous amino acids selected from the amino acid sequence shown in SEQ ID NO: 2 or a biologically active variant thereof, as defined below.
  • a nexin-related serine protease inhibitor polypeptide of the invention therefore can be a portion of a nexin-related serine protease inhibitor protein, a full-length nexin-related serine protease inhibitor protein, or a fusion protein comprising all or a portion of a nexin-related serine protease inhibitor protein.
  • naturally or non-naturally occurring nexin-related serine protease inhibitor polypeptide variants have amino acid sequences which are at least about 32, 35, 40, 45, 50, 55, 60, 65, or 70, preferably about 75, 80, 85, 90, 96, 96, 98, or 99% identical to the amino acid sequence shown in SEQ ID NO: 2 or a fragment thereof.
  • Percent identity between a putative nexin-related serine protease inhibitor polypeptide variant and an amino acid sequence of SEQ ID NO: 2 is determined by conventional methods. See, for example, Altschul et al, Bull. Math. Bio. 48:603 (1986), and Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89:10915 (1992). Briefly, two amino acid sequences are aligned to optimize the alignment scores using a gap opening penalty of 10, a gap extension penalty of 1, and the "BLOSUM62" scoring matrix of Henikoff &
  • FASTA similarity search algorithm of Pearson & Lip an is a suitable protein alignment method for examining the level of identity shared by an amino acid sequence disclosed herein and the amino acid sequence of a putative variant.
  • the FASTA algorithm is described by Pearson & Lipman, Proc. Nat'l Acad. Sci. USA 85:2444 (1988), and by Pearson, Meth. Enzymol. 183:63 (1990). Briefly, FASTA first characterizes sequence similarity by identifying regions shared by the query sequence (e.g., SEQ ID NO: 2) and a test sequence that have either the highest density of identities (if the ktup variable is
  • FASTA can also be used to determine the sequence identity of nucleic acid molecules using a ratio as disclosed above.
  • the ktup value can range between one to six, preferably from three to six, most preferably three, with other parameters set as default.
  • Variations in percent identity can be due, for example, to amino acid substitutions, insertions, or deletions.
  • Amino acid substitutions are defined as one for one amino acid replacements. They are conservative in nature when the substituted amino acid has similar structural and/or chemical properties. Examples of conservative replacements are substitution of a leucine with an isoleucine or valine, an aspartate with a glutamate, or a threonine with a serine.
  • Amino acid insertions or deletions are changes to or within an amino acid sequence. They typically fall in the range of about 1 to 5 amino acids. Guidance in determining which amino acid residues can be substituted, inserted, or deleted without abolishing biological or immunological activity of a human nexin-related serine protease inhibitor polypeptide can be found using computer programs well known in the art, such as DNASTAR software.
  • the invention additionally, encompasses nexin-related serine protease inhibitor polypeptides that are differentially modified during or after translation, e.g., by glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting blocking groups, proteolytic cleavage, linkage to an antibody molecule or other cellular ligand, etc. Any of numerous chemical modifications can be carried out by known techniques including, but not limited, to specific chemical cleavage by cyanogen bromide, trypsin, chymotrypsin, papain, N8 protease, ⁇ aBH 4 , acetylation, formylation, oxidation, reduction, metabolic synthesis in the presence of tunicamycin, etc.
  • Additional post-translational modifications encompassed by the invention include, for example, e.g., N-linked or O-linked carbohydrate chains, processing of N- terminal or C-terminal ends), attachment of chemical moieties to the amino acid backbone, chemical modifications of N-linked or O-linked carbohydrate chains, and addition or deletion of an N-terminal methionine residue as a result of prokaryotic host cell expression.
  • the nexin-related serine protease inhibitor polypeptides may also be modified with a detectable label, such as an enzymatic, fluorescent, isotopic or affinity label to allow for detection and isolation of the protein.
  • the invention also provides chemically modified derivatives of nexin-related serine protease inhibitor polypeptides that may provide additional advantages such as increased solubility, stability and circulating time of the polypeptide, or decreased immunogenicity (see U.S. Patent No. 4,179,337).
  • the chemical moieties for derivitization can be selected from water soluble polymers such as polyethylene glycol, ethylene glycol/propylene glycol copolymers, carboxymethylcellulose, dextran, polyvinyl alcohol, and the like.
  • the polypeptides can be modified at random or predetermined positions within the molecule and can include one, two, three, or more attached chemical moieties.
  • Whether an amino acid change or a polypeptide modification results in a biologically active nexin-related serine protease inhibitor polypeptide can readily be determined by assaying for assaying for serine protease activity in the presence and absence of a putative nexin-related serine protease inhibitor polypeptide. Assays for serine protease activity are well-known (see, e.g. , U.S. Patent 6,197,519).
  • Fusion proteins are useful for generating antibodies against nexin-related serine protease inhibitor polypeptide amino acid sequences and for use in various assay systems. For example, fusion proteins can be used to identify proteins that interact with portions of a human nexin-related serine protease inhibitor polypeptide. Protein affinity chromatography or library-based assays for protein-protein interactions, such as the yeast two-hybrid or phage display systems, can be used for this purpose. Such methods are well known in the art and also can be used as drug screens.
  • a human nexin-related serine protease inhibitor polypeptide fusion protein comprises two polypeptide segments fused together by means of a peptide bond.
  • the first polypeptide segment comprises a nexin-related serine protease inhibitor polypeptide, as described above.
  • the first polypeptide segment also can comprise full-length nexin-related serine protease inhibitor protein.
  • the second polypeptide segment can be a full-length protein or a protein fragment.
  • Proteins commonly used in fusion protein construction include ⁇ -galactosidase, ⁇ - glucuronidase, green fluorescent protein (GFP), autofluorescent proteins, including blue fluorescent protein (BFP), glutathione-S-transferase (GST), luciferase, horseradish peroxidase (HRP), and chloramphenicol acetyltransferase (CAT).
  • epitope tags are used in fusion protein constructions, including histidine (His) tags, FLAG tags, influenza hemagglutinin (HA) tags, Myc tags, NSN-G tags, and thioredoxin (Trx) tags.
  • fusion constructions can mclude maltose binding protein (MBP), S-tag, Lex a D ⁇ A binding domain (DBD) fusions, GAL4 D ⁇ A binding domain fusions, and herpes simplex virus (HSN) BP16 protein fusions.
  • MBP maltose binding protein
  • S-tag S-tag
  • GAL4 D ⁇ A binding domain fusions GAL4 D ⁇ A binding domain fusions
  • HSN herpes simplex virus
  • a fusion protein also can be engineered to contain a cleavage site located between the nexin-related serine protease inhibitor polypeptide-encoding sequence and the heterologous protein sequence, so that the nexin-related serine protease inhibitor polypeptide can be cleaved and purified away from the heterologous moiety.
  • a fusion protein can be synthesized chemically, as is known in the art.
  • a fusion protein is produced by covalently linking two polypeptide segments or by standard procedures in the art of molecular biology.
  • Recombinant D ⁇ A methods can be used to prepare fusion proteins, for example, by making a D ⁇ A construct which comprises coding sequences selected from SEQ ED NO: 1 in proper reading frame with nucleotides encoding the second polypeptide segment and expressing the DNA construct in a host cell, as is known in the art.
  • kits for constructing fusion proteins are available from companies such as Promega Corporation (Madison, WI), Stratagene (La Jolla, CA), CLONTECH (Mountain View, CA), Santa Cruz Biotechnology (Santa Cruz, CA), MBL International Corporation (MIC; Watertown, MA), and Quantum Biotechnologies (Montreal, Canada; 1-888-DNA-KITS).
  • Species homologs of human nexin-related serine protease inhibitor polypeptide can be obtained using nexin-related serine protease inhibitor polypeptide polynucleotides (described below) to make suitable probes or primers for screening cDNA expression libraries from other species, such as mice, monkeys, or yeast, identifying cDNAs which encode homologs of nexin-related serine protease inhibitor polypeptide, and expressing the cDNAs as is known in the art.
  • a human nexin-related serine protease inhibitor polynucleotide can be single- or double-stranded and comprises a coding sequence or the complement of a coding sequence for a nexin-related serine protease inhibitor polypeptide.
  • a coding sequence for human nexin-related serine protease inhibitor is shown in SEQ ED NO: 1.
  • nucleotide sequences encoding human nexin-related serine protease inhibitor polypeptides as well as homologous nucleotide sequences which are at least about 50, 55, 60, 65, 70, preferably about 75, 90, 96, 98, or 99% identical to the nucleotide sequence shown in SEQ ID NO: 1 or its complement also are nexin- related serine protease inhibitor polynucleotides. Percent sequence identity between the sequences of two polynucleotides is determined using computer programs such as ALIGN which employ the FASTA algorithm, using an affine gap search with a gap open penalty of -12 and a gap extension penalty of -2.
  • cDNA Complementary DNA
  • species homologs, and variants of nexin-related serine protease inhibitor polynucleotides that encode biologically active nexin-related serine protease inhibitor polypeptides also are nexin-related serine protease inhibitor polynucleo- tides.
  • Polynucleotide fragments comprising at least 8, 9, 10, 11, 12, 15, 20, or 25 contiguous nucleotides of SEQ ID NO: 1 or its complement also are nexin-related serine protease inhibitor polynucleotides. These fragments can be used, for example, as hybridization probes or as antisense oligonucleotides.
  • Nariants and homologs of the nexin-related serine protease inhibitor polynucleotides described above also are nexin-related serine protease inhibitor polynucleotides.
  • homologous nexin-related serine protease inhibitor polynucleotide sequences can be identified by hybridization of candidate polynucleotides to known nexin-related serine protease inhibitor polynucleotides under stringent conditions, as is known in the art.
  • wash conditions ⁇ 2X SSC (0.3 M ⁇ aCl, 0.03 M sodium citrate, pH 7.0), 0.1% SDS, room temperature twice, 30 minutes each; then 2X SSC, 0.1% SDS, 50°C once, 30 minutes; then 2X SSC, room temperature twice, 10 minutes each-homologous sequences can be identified which contain at most about 25-30% basepair mismatches. More preferably, homologous nucleic acid strands contain 15-25% basepair mismatches, even more preferably 5-15% basepair mismatches.
  • Species homologs of the nexin-related serine protease inhibitor polynucleotides disclosed herein also can be identified by making suitable probes or primers and screening cD ⁇ A expression libraries from other species, such as mice, monkeys, or yeast.
  • Human variants of nexin-related serine protease inhibitor polynucleotides can be identified, for example, by screening human cD ⁇ A expression libraries. It is well known that the T m of a double-stranded D ⁇ A decreases by 1-1.5 °C with every 1% decrease in homology (Bonner et al., J. Mol. Biol. 81, 123 (1973).
  • Nariants of human nexin-related serine protease inhibitor polynucleotides or nexin-related serine protease inhibitor polynucleotides of other species can therefore be identified by hybridizing a putative homologous nexin-related serine protease inhibitor polynucleotide with a polynucleotide having a nucleotide sequence of SEQ ID NO: 1 or the complement thereof to form a test hybrid.
  • the melting temperature of the test hybrid is compared with the melting temperature of a hybrid comprising polynucleotides having perfectly complementary nucleotide sequences, and the number or percent of basepair mismatches within the test hybrid is calculated.
  • Nucleotide sequences which hybridize to nexin-related serine protease inhibitor polynucleotides or their complements following stringent hybridization and/or wash conditions also are nexin-related serine protease inhibitor polynucleotides.
  • Stringent wash conditions are well known and understood in the art and are disclosed, for example, in Sambrook et al, MOLECULAR CLONING: A LABORATORY MANUAL, 2d ed., 1989, at pages 9.50-9.51.
  • T m of a hybrid between a nexin-related serine protease inhibitor polynucleotide having a nucleotide sequence shown in SEQ ID NO: 1 or the complement thereof and a polynucleotide sequence which is at least about 50, preferably about 75, 90, 96, or 98% identical to one of those nucleotide sequences can be calculated, for example, using the equation of Bolton and McCarthy, Proc. Natl. Acad. Sci. U.S.A. 48, 1390 (1962):
  • Stringent wash conditions include, for example, 4X SSC at 65°C, or 50% formamide,
  • a human nexin-related serine protease inhibitor polynucleotide can be isolated free of other cellular components such as membrane components, proteins, and lipids.
  • Polynucleotides can be made by a cell and isolated using standard nucleic acid purification techniques, or synthesized using an amplification technique, such as the polymerase chain reaction (PCR), or by using an automatic synthesizer. Methods for isolating polynucleotides are routine and are known in the art. Any such technique for obtaining a polynucleotide can be used to obtain isolated nexin-related serine protease inhibitor polynucleotides.
  • restriction enzymes and probes can be used to isolate polynucleotide fragments, which comprise nexin-related serine protease inhibitor nucleotide sequences.
  • Isolated polynucleotides are in preparations that are free or at least 70, 80, or 90% free of other molecules:
  • Human nexin-related serine protease inhibitor cDNA molecules can be made with standard molecular biology techniques, using nexin-related serine protease inhibitor mRNA as a template. Human nexin-related serine protease inhibitor cDNA molecules can thereafter be replicated using molecular biology techniques known in the art and disclosed in manuals such as Sambrook et al. (1989). An amplification technique, such as PCR, can be used to obtain additional copies of polynucleotides of the invention, using either human genomic DNA or cDNA as a template.
  • PCR-based methods can be used to extend the nucleic acid sequences disclosed herein to detect upstream sequences such as promoters and regulatory elements.
  • restriction-site PCR uses universal primers to retrieve unknown sequence adjacent to a known locus (Sarkar, PCR Methods Applic. 2, 318-322, 1993). Genomic DNA is first amplified in the presence of a primer to a linker sequence and a primer specific to the known region. The amplified sequences are then subjected to a second round of PCR with the same linker primer and another specific primer internal to the first one. Products of each round of PCR are transcribed with an appropriate RNA polymerase and sequenced using reverse transcriptase.
  • Inverse PCR also can be used to amplify or extend sequences using divergent primers based on a known region (Triglia et al, Nucleic Acids Res. 16, 8186, 1988).
  • Primers can be designed using commercially available software, such as OLIGO 4.06 Primer Analysis software (National Biosciences Inc., Madison, Minn.), to be 22-30 nucleotides in length, to have a GC content of 50% or more, and to anneal to the target sequence at temperatures about 68-72°C.
  • the method uses several restriction enzymes to generate a suitable fragment in the known region of a gene. The fragment is then circularized by intramolecular ligation and used as a PCR template.
  • capture PCR which involves PCR amplification of DNA fragments adjacent to a known sequence in human and yeast artificial chromosome DNA (Lagerstrom et al., PCR Methods Applic. 1, 111-119,
  • multiple restriction enzyme digestions and ligations also can be used to place an engineered double-stranded sequence into an unknown fragment of the DNA molecule before performing PCR.
  • Randomly-primed libraries are preferable, in that they will contain more sequences .which contain the 5' regions of genes. Use of a randomly primed library may be especially preferable for situations in which an oligo d(T) library does not yield a full-length cDNA. Genomic libraries can be useful for extension of sequence into 5 ' non-transcribed regulatory regions.
  • capillary electrophoresis systems can be used to analyze the size or confirm the nucleotide sequence of PCR or sequencing products.
  • capillary sequencing can employ flowable polymers for electrophoretic separation, four different fluorescent dyes (one for each nucleotide) that are laser activated, and detection of the emitted wavelengths by a charge coupled device camera.
  • Output/light intensity can be converted to electrical signal using appropriate software (e.g. GENOTYPER and Sequence NAVIGATOR, Perkin Elmer), and the entire process from loading of samples to computer analysis and electronic data display can be computer controlled.
  • Capillary electrophoresis is especially preferable for the sequencing of small pieces of DNA that might be present in limited amounts in a particular sample.
  • Human nexin-related serine protease inhibitor polypeptides can be obtained, for example, by purification from human cells, by expression of nexin-related serine protease inhibitor polynucleotides, or by direct chemical synthesis. Protein purification
  • Human nexin-related serine protease inhibitor polypeptides can be purified from any human cell which expresses the receptor, including host cells which have been transfected with nexin-related serine protease inhibitor polynucleotides.
  • a purified nexin-related serine protease inhibitor polypeptide is separated from other compounds that normally associate with the nexin-related serine protease inhibitor polypeptide in the cell, such as certain proteins, carbohydrates, or lipids, using methods well-known in the art. Such methods include, but are not limited to, size exclusion chromatography, ammonium sulfate fractionation, ion exchange chromatography, affinity chromatography, and preparative gel electrophoresis.
  • Human nexin-related serine protease inhibitor polypeptide can be conveniently isolated as a complex with its associated G protein, as described in the specific examples, below.
  • a preparation of purified nexin-related serine protease inhibitor polypeptides is at least 80% pure; preferably, the preparations are 90%o, 95%, or 99% pure. Purity of the preparations can be assessed by any means known in the art, such as SDS-polyacrylamide gel electrophoresis.
  • the polynucleotide can be inserted into an expression vector which contains the necessary elements for the transcription and translation of the inserted coding sequence.
  • Methods which are well known to those skilled in the art can be used to construct expression vectors containing sequences encoding nexin-related serine protease inhibitor polypeptides and appropriate transcriptional and translational control elements. These methods include in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. Such techniques are described, for example, in Sambrook et al. (1989) and in Ausubel et al, CURRENT PROTOCOLS IN
  • microorganisms such as bacteria transformed with recombinant bacteriophage, plasmid, or cosmid DNA expression vectors
  • yeast transformed with yeast expression vectors insect cell, systems infected with virus expression vectors (e.g., baculovirus), plant cell systems transformed with virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or with bacterial expression vectors (e.g., Ti or pBR322 plasmids), or animal cell systems.
  • virus expression vectors e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV
  • bacterial expression vectors e.g., Ti or pBR322 plasmids
  • control elements or regulatory sequences are those non-translated regions of the vector ⁇ enhancers, promoters, 5' and 3' untranslated regions ⁇ which interact with host cellular proteins to carry out transcription and translation. Such elements can vary in their strength and specificity.
  • any number of suitable transcription and translation elements including constitutive and inducible promoters, can be used.
  • inducible promoters such as the hybrid lacZ promoter of the BLUESCRIPT phagemid (Stratagene, LaJolla, Calif.) or pSPORTl plasmid (Life Technologies) and the like can be used.
  • the baculovirus polyhedrin promoter can be used in insect cells.
  • Promoters or enhancers derived from the genomes of plant cells e.g., heat shock, RUBISCO, and storage protein genes
  • plant viruses e.g., viral promoters or leader sequences
  • promoters from mammalian genes or from mammalian viruses are preferable. If it is necessary to generate a cell line that contains multiple copies of a nucleotide sequence encoding a human nexin-related serine protease inhibitor polypeptide, vectors based on SV40 or EBV can be used with an appropriate selectable marker.
  • Bacterial and yeast expression systems e.g., Bacterial and yeast expression systems
  • a number of expression vectors can be selected depending upon the use intended for the nexin-related serine protease inhibitor polypeptide. For example, when a large quantity of a human nexin-related serine protease inhibitor polypeptide is needed for the induction of antibodies, vectors which direct high level expression . of fusion proteins that are readily purified can be used.
  • vectors include, but are not limited to, multifunctional E. coli cloning and expression vectors such as BLUESCREPT (Stratagene).
  • a sequence encoding the nexin-related serine protease inhibitor polypeptide can be ligated into the vector in frame with sequences for the amino-terminal Met and the subsequent 7 residues of ⁇ -galactosidase so that a hybrid protein is produced.
  • pIN vectors Van Heeke & Schuster, J Biol. Chem. 264, 5503-5509, 1989
  • pGEX vectors Promega, Madison, Wis.
  • GST glutathione S-transferase
  • fusion proteins are soluble and can easily be purified from lysed cells by adsorption to glutathione-agarose beads followed by elution in the presence of free glutathione.
  • Proteins made in such systems can be designed to include heparin, thrombin, or factor Xa protease cleavage sites so that the cloned polypeptide of interest can be released from the GST moiety at will.
  • yeast Saccharomyces cerevisiae a number of vectors containing constitutive or inducible promoters such as alpha factor, alcohol oxidase, and PGH can be used.
  • constitutive or inducible promoters such as alpha factor, alcohol oxidase, and PGH.
  • nexin-related serine protease inhibitor polypeptides can be driven by any of a number of promoters.
  • viral promoters such as the 35S and 19S promoters of CaMV can be used alone or in combination with the omega leader sequence from TMV (Takamatsu, EMBO J. 6, 307-311, 1987).
  • plant promoters such as the small subunit of RUBISCO or heat shock promoters can be used (Coruzzi et al, EMBO J. 3, 1671-1680, 1984; Broglie et al, Science 224, 838-843, 1984; Winter et al., Results Probl. Cell Differ.
  • constructs can be introduced into plant cells by direct DNA transformation or by pathogen-mediated transfection. Such techniques are described in a number of generally available reviews (e.g., Hobbs or Murray, in MCGRAW HILL YEARBOOK OF SCIENCE AND TECHNOLOGY, McGraw Hill, New York, N.Y., pp. 191-196, 1992).
  • An insect system also can be used to express a human nexin-related serine protease inhibitor polypeptide.
  • Autographa californica nuclear polyhedrosis virus (AcNPV) is used as a vector to express foreign genes in Spodoptera frugiperda cells or in Trichoplusia larvae.
  • Sequences encoding nexin- related serine protease inhibitor polypeptides can be cloned into a non-essential region of the virus, such as the polyhedrin gene, and placed under control of the polyhedrin promoter. Successful insertion of nexin-related serine protease inhibitor polypeptides will render the polyhedrin gene inactive and produce recombinant virus lacking coat protein.
  • the recombinant viruses can then be used to infect S. frugiperda cells or Trichoplusia larvae in which nexin-related serine protease inhibitor polypeptides can be expressed (Engelhard et al., Proc. Nat. Acad. Sci. 91, 3224-3227, 1994).
  • a number of viral-based expression systems can be used to express nexin-related serine protease inhibitor polypeptides in mammalian host cells.
  • sequences encoding nexin-related serine protease inhibitor polypeptides can be ligated into an adenovirus transcription/- translation complex comprising the late promoter and tripartite leader sequence.
  • Insertion in a non-essential El or E3 region of the viral genome can be used to obtain a viable virus which is capable of expressing a human nexin-related serine protease inhibitor polypeptide in infected host cells (Logan & Shenk, Proc. Natl. Acad. Sci. 81, 3655-3659, 1984).
  • transcription enhancers such as the Rous sarcoma virus (RSV) enhancer, can be used to increase expression in mammalian host cells.
  • RSV Rous sarcoma virus
  • HACs Human artificial chromosomes
  • 6M to 10M are constructed and delivered to cells via conventional delivery methods (e.g., liposomes, polycationic amino polymers, or vesicles).
  • Specific initiation signals also can be used to achieve more efficient translation of sequences encoding nexin-related serine protease inhibitor polypeptides.
  • Such signals include the ATG initiation codon and adjacent sequences.
  • sequences encoding a human nexin-related serine protease inhibitor polypeptide, its initiation codon, and upstream sequences are inserted into the appropriate expression vector, no additional transcriptional or translational control signals may be needed.
  • exogenous translational control signals (including the ATG initiation codon) should be provided. The initiation codon should be in the co ⁇ ect reading frame to ensure translation of the entire insert.
  • Exogenous translational elements and initiation codons can be of various origins, both natural and synthetic.
  • the efficiency of expression can be enhanced by the inclusion of enhancers which are appropriate for the particular cell system which is used (see Scharf et al, Results Probl. Cell Differ. 20, 125-162, 1994).
  • a host cell strain can be chosen for its ability to modulate the expression of the inserted sequences or to process the expressed nexin-related serine protease inhibitor polypeptide in the desired fashion.
  • modifications of the polypeptide include, but are not limited to, acetylation, carboxylation, glycosylation, phosphorylation, lipidation, and acylation.
  • Post-translational processing which cleaves a "prepro" form of the polypeptide also can be used to facilitate co ⁇ ect insertion, folding and/or function.
  • Different host cells that have specific cellular machinery and characteristic mechanisms for post-translational activities e.g., CHO, HeLa, MDCK, HEK293, and WD 8) are available from the American Type Culture Collection (ATCC; 10801
  • Stable expression is prefe ⁇ ed for long-term, high-yield production of recombinant proteins.
  • cell lines which stably express nexin-related serine protease inhibitor polypeptides can be transformed using expression vectors which can contain viral origins of replication and/or endogenous expression elements and a selectable marker gene on the same or on a separate vector. Following the introduction of the vector, cells can be allowed to grow for 1-2 days in an enriched medium before they are switched to a selective medium.
  • the purpose of the selectable marker is to confer resistance to selection, and its presence allows growth and recovery of cells that successfully express the introduced nexin-related serine protease inhibitor sequences.
  • Resistant clones of stably transformed cells can be proliferated using tissue culture techniques appropriate to the cell type. See, for example, A IMAL CELL CULTURE, RL Freshney, ed., 1986.
  • any number of selection systems can be used to recover transformed cell lines. These include, but are not limited to, the herpes simplex virus thymidine kinase (Wigler et al., Cell 11, 223-32, 1977) and adenine phosphoribosyltransferase (Lowy et ah, Cell 22, 817-23, 1980) genes that can be employed in tk ⁇ or aprf cells, respectively. Also, antimetabolite, antibiotic, or herbicide resistance can be used as the basis for selection. For example, dhfr confers resistance to methotrexate (Wigler et al, Proc. Natl. Acad. Sci.
  • npt confers resistance to the aminoglycosides, neomycin and G-418 (Colbere-Garapin et al., J. Mol. Biol. 150, 1-14, 1981), and als and pat confer resistance to chlorsulfuron and phosphinotricin acetyltransferase, respectively (Mu ⁇ ay, 1992, supra). Additional selectable genes have been described. For example, trpB allows cells to utilize indole in place of tryptophan, or hisD, which allows cells to utilize histinol in place of histidine (Hartman & Mulligan, Proc. Natl. Acad. Sci. 85, 8047-51, 1988).
  • Visible markers such as anthocyanins, ⁇ -glucuronidase and its substrate GUS, and luciferase and its substrate luciferin, can be used to identify transformants and to quantify the amount of transient or stable protein expression attributable to a specific vector system (Rhodes et al., Methods Mol. Biol. 55, 121-131, 1995).
  • marker gene expression suggests that the nexin-related serine protease inhibitor polynucleotide is also present, its presence and expression may need to be confirmed. For example, if a sequence encoding a human nexin- related serine protease inhibitor polypeptide is inserted within a marker gene sequence, transformed cells containing sequences which encode an nexin-related serine protease inhibitor polypeptide can be identified by the absence of marker gene function. Alternatively, a marker gene can be placed in tandem with a sequence encoding an nexin-related serine protease inhibitor polypeptide under the control of a single promoter. Expression of the marker gene in response to induction or selection usually indicates expression of the nexin-related serine protease inhibitor polynucleotide.
  • host cells which contain a human nexin-related serine protease inhibitor polynucleotide and which express a human nexin-related serine protease inhibitor polypeptide can be identified by a variety of procedures known to those of skill in the art. These procedures include, but are not limited to, DNA-DNA or DNA-RNA hybridizations and protein bioassay or immunoassay techniques that include membrane, solution, or chip-based technologies for the detection and/or quantification of nucleic acid or protein.
  • the presence of a poly- nucleotide sequence encoding an nexin-related serine protease inhibitor polypeptide can be detected by DNA-DNA or DNA-RNA hybridization or amplification using probes or fragments or fragments of polynucleotides encoding a human nexin-related serine protease inhibitor polypeptide.
  • Nucleic acid amplification-based assays involve the use of oligonucleotides selected from sequences encoding an nexin- related serine protease inhibitor polypeptide to detect transformants which contain an nexin-related serine protease inhibitor polynucleotide.
  • a variety of protocols for detecting and measuring the expression of a human nexin- related serine protease inhibitor polypeptide, using either polyclonal or monoclonal antibodies specific for the polypeptide, are known in the art. Examples include enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), and fluorescence activated cell sorting (FACS).
  • ELISA enzyme-linked immunosorbent assay
  • RIA radioimmunoassay
  • FACS fluorescence activated cell sorting
  • a two-site, monoclonal-based immunoassay using monoclonal antibodies reactive to two non-interfering epitopes on a human nexin-related serine protease inhibitor polypeptide can be used, or a competitive binding assay can be employed. These and other assays are described in Hampton et al, SEROLOGICAL METHODS: A LABORATORY MANUAL, APS Press, St.
  • labels and conjugation techniques are known by those skilled in the art and can be used in various nucleic acid and amino acid assays.
  • Means for producing labeled hybridization or PCR probes for detecting sequences related to polynucleotides encoding nexin-related serine protease inhibitor polypeptides include oligolabeling, nick translation, end-labeling, or PCR amplification using a labeled nucleotide.
  • sequences encoding a human nexin-related serine protease inhibitor polypeptide can be cloned into a vector for the production of an mRNA probe.
  • RNA probes are known in the art, are commercially available, " and can be used to synthesize RNA probes in vitro by addition of labeled nucleotides and an appropriate RNA polymerase such as T7, T3, or SP6. These procedures can be conducted using a variety of commercially available kits (Amersham Pharmacia Biotech, Promega, and US Biochemical). Suitable reporter molecules or labels which can be used for ease of detection include radionuclides, enzymes, and fluorescent, chemiluminescent, or chromogenic agents, as well as substrates, cofactors, inhibitors, magnetic particles, and the like.
  • Host cells transformed with nucleotide sequences encoding a human nexin-related serine protease inhibitor polypeptide can be cultured under conditions suitable for the expression and recovery of the protein from cell culture.
  • the polypeptide produced by a transformed cell can be secreted or contained intracellularly depending on the sequence and/or the vector used.
  • expression vectors containing polynucleotides which encode nexin-related serine protease inhibitor polypeptides can be designed to contain signal sequences which direct secretion of soluble nexin-related serine protease inhibitor polypeptides through a prokaryotic or eukaryotic cell membrane or which direct the membrane insertion of membrane-bound nexin-related serine protease inhibitor polypeptide.
  • purification facilitating domains include, but are not limited to, metal chelating peptides such as histidine-tryptophan modules that allow purification on immobilized metals, protein A domains that allow purification on immobilized immunoglobulin, and the domain utilized in the FLAGS extension/affinity purification system (Immunex Corp., Seattle, Wash.).
  • cleavable linker sequences such as those specific for Factor Xa or enterokinase (Invitrogen, San Diego, CA) between the purification domain and the nexin-related serine protease inhibitor polypeptide also can be used to facilitate purification.
  • One such expression vector provides for expression of a fusion protein containing a human nexin-related serine protease inhibitor polypeptide and 6 histidine residues preceding a thioredoxin or an enterokinase cleavage site. The histidine residues facilitate purification by EMAC
  • Sequences encoding a human nexin-related serine protease inhibitor polypeptide can be synthesized, in whole or in part, using chemical methods well known in the art (see Caruthers et al., Nucl Acids Res. Symp. Ser. 215-223, 1980; Horn et al. Nucl.
  • nexin-related serine protease inhibitor polypeptide itself can be produced using chemical methods to synthesize its amino acid sequence, such as by direct peptide synthesis using solid-phase techniques (Merrifield, J Am. Chem. Soc. 85, 2149-2154, 1963; Roberge et al., Science 269, 202-204, 1995). Protein synthesis can be performed using manual techniques or by automation. Automated synthesis can be achieved, for example, using Applied Biosystems 431 A Peptide Synthesizer (Perkin Elmer).
  • fragments of nexin-related serine protease inhibitor polypeptides can be separately synthesized and combined using chemical methods to produce a full- length molecule.
  • the newly synthesized peptide can be substantially purified by preparative high performance liquid chromatography (e.g., Creighton, PROTEINS: STRUCTURES AND MOLECULAR PRINCIPLES, WH Freeman and Co., New York, N.Y., 1983).
  • the composition of a synthetic nexin-related serine protease inhibitor polypeptide can be confirmed by amino acid analysis or sequencing (e.g., the Edman degradation procedure; see Creighton, supra). Additionally, any portion of the amino acid sequence of the nexin-related serine protease inhibitor polypeptide can be altered during direct synthesis and/or combined using chemical methods with sequences from other proteins to produce a variant polypeptide or a fusion protein.
  • codons prefe ⁇ ed by a particular prokaryotic or eukaryotic host can be selected to increase the rate of protein expression or to produce an RNA transcript having desirable properties, such as a half-life which is longer than that of a transcript generated from the naturally occurring sequence.
  • nucleotide sequences disclosed herein can be engineered using methods generally known in the art to alter nexin-related serine protease inhibitor polypeptide- encoding sequences for a variety of reasons, including but not limited to, alterations which modify the cloning, processing, and/or expression of the polypeptide or mRNA product.
  • DNA shuffling by random fragmentation and PCR reassembly of gene fragments and synthetic oligonucleotides can be used to engineer the nucleotide sequences.
  • site-directed mutagenesis can be used to insert new restriction sites, alter glycosylation patterns, change codon preference, produce splice variants, introduce mutations, and so forth.
  • Antibody as used herein includes intact immunoglobulin molecules, as well as fragments thereof, such as Fab, F(ab') 2 , and Fv, which are capable of binding an epitope of a human nexin-related serine protease inhibitor polypeptide.
  • Fab fragment antigen binding protein
  • F(ab') 2 fragment antigen binding protein
  • Fv fragment antigen binding protein
  • epitopes which involve non-contiguous amino acids may require more, e.g., at least 15, 25, or 50 amino acids.
  • An antibody which specifically binds to an epitope of a human nexin-related serine protease inhibitor polypeptide can be used therapeutically, as well as in immuno- chemical assays, such as Western blots, ELISAs, radioimmunoassays, immuno- histochemical assays, immunoprecipitations, or other immunochemical assays known in the art.
  • immunoassays can be used to identify antibodies having the desired specificity. Numerous protocols for competitive binding or irnmuno- radiometric assays are well known in the art. Such immunoassays typically involve the measurement of complex formation between an immunogen and an antibody that specifically binds to the immunogen.
  • an antibody that specifically binds to a human nexin-related serine protease inhibitor polypeptide provides a detection signal at least 5-, 10-, or 20-fold higher than a detection signal provided with other proteins when used in an immunochemical assay.
  • antibodies that specifically bind to nexin-related serine protease inhibitor polypeptides do not detect other proteins in immunochemical assays and can immunoprecipitate a human nexin-related serine protease inhibitor polypeptide from solution.
  • Human nexin-related serine protease inhibitor polypeptides can be used to immunize a mammal, such as a mouse, rat, rabbit, guinea pig, monkey, or human, to produce polyclonal antibodies.
  • a human nexin-related serine protease inhibitor polypeptide can be conjugated to a carrier protein, such as bovine serum albumin, thyroglobulin, and keyhole limpet hemocyanin.
  • a carrier protein such as bovine serum albumin, thyroglobulin, and keyhole limpet hemocyanin.
  • various ' adjuvants can be used to increase the immunological response.
  • adjuvants include, but are not limited to, Freund's adjuvant, mineral gels (e.g., aluminum hydroxide), and surface active substances (e.g.
  • BCG Bacilli Calmette-Guerin
  • Corynebacterium parvum are especially useful.
  • Monoclonal antibodies that specifically bind to a human nexin-related serine protease inhibitor polypeptide can be prepared using any technique which provides for the production of antibody molecules by continuous cell lines in culture. These techniques include, but are not limited to, the hybridoma technique, the human B-cell hybridoma technique, and the EBV-hybridoma technique (Kohler et al., Nature 256, 495-497, 1985; Kozbor et al, J. Immunol. Methods 81, 31-42, 1985; Cote et al., Proc. Natl. Acad. Sci. 80, 2026-2030, 1983; Cole et al, Mol. Cell Biol. 62, 109-120, 1984).
  • Monoclonal and other antibodies also can be "humanized” to prevent a patient from mounting an immune response against the antibody when it is used therapeutically.
  • Such antibodies may be sufficiently similar in sequence to human antibodies to be used directly in therapy or may require alteration of a few key residues. Sequence differences between rodent antibodies and human sequences can be minimized by replacing residues which differ from those in the human sequences by site directed mutagenesis of individual residues or by grating of entire complementarity determining regions.
  • humanized antibodies can be produced using recombinant methods, as described in GB2188638B.
  • Antibodies that specifically bind to a human nexin-related serine protease inhibitor polypeptide can contain antigen binding sites which are either partially or fully humanized, as disclosed in U.S. 5,565,332.
  • single chain antibodies can be adapted using methods known in the art to produce single chain antibodies that specifically bind to nexin-related serine protease inhibitor polypeptides.
  • Antibodies with related specificity, but of distinct idiotypic composition can be generated by chain shuffling from random combinatorial immunoglobin libraries (Burton, Pr ⁇ c. Natl. Acad. Sci. 88, 11120-23, 1991).
  • Single-chain antibodies also can be constructed using a DNA amplification method, such as PCR, using hybridoma cDNA as a template (Thirion et al, 1996, Eur. J. Cancer Prev. 5, 507-11).
  • Single-chain antibodies can be mono- or bispecific, and can be bivalent or tetravalent. Construction of tetravalent, bispecific single-chain antibodies is taught, for example, in Coloma & Morrison, 1997, Nat. Biotechnol. 15,
  • a nucleotide sequence encoding a single-chain antibody can be constructed using manual or automated nucleotide synthesis, cloned into an expression construct using standard recombinant D ⁇ A methods, and introduced into a cell to express the coding sequence, as described below.
  • single-chain antibodies can be produced directly using, for example, filamentous phage technology (Verhaar et al, 1995, Int. J. Cancer 61, 497-501; ⁇ icholls et al, 1993, J Immunol. Meth. 165, 81- 91).
  • Antibodies which specifically bind to nexin-related serine protease inhibitor polypeptides also can be produced by inducing in vivo production in the lymphocyte population or by screening immunoglobulin libraries or panels of highly specific binding reagents as disclosed in the literature (Orlandi et al., Proc. Natl. Acad. Sci.
  • chimeric antibodies can be constructed as disclosed in WO 93/03151.
  • Binding proteins which are derived from immunoglobulins and which are multivalent and multispecific, such as the "diabodies" described in WO 94/13804, also can be prepared.
  • Antibodies according to the invention can be purified by methods well known in the art. For example, antibodies can be affinity purified by passage over a column to which a human nexin-related serine protease inhibitor polypeptide is bound. The bound antibodies can then be eluted from the column using a buffer with a high salt concentration.
  • Antisense oligonucleotides are nucleotide sequences that are complementary to a specific DNA or RNA sequence. Once introduced into a cell, the complementary nucleotides combine with natural sequences produced by the cell to form complexes and block either transcription or translation. Preferably, an antisense oligonucleotide is at least 11 nucleotides in length, but can be at least 12, 15, 20, 25, 30, 35, 40, 45, or 50 or more nucleotides long. Longer sequences also can be used. Antisense oligonucleotide molecules can be provided in a DNA construct and introduced into a cell as described above to decrease the level of nexin-related serine protease inhibitor gene products in the cell.
  • Antisense oligonucleotides can be deoxyribonucleotides, ribonucleotides, or a combination of both. Oligonucleotides can be synthesized manually or by an automated synthesizer, by covalently linking the 5' end of one nucleotide with the 3' end of another nucleotide with non-phosphodiester internucleotide linkages such alkylphosphonates, phosphorothioates, phosphorodithioates, alkylphosphonothioates, alkylphosphonates, phosphoramidates, phosphate esters, carbamates, acetamidate, carboxymethyl esters, carbonates, and phosphate triesters. See Brown, Meth. Mol. Biol. 20, 1-8, 1994; Sonveaux, Meth. Mol. Biol. 26, 1-72, 1994; Uhlmann et al, Chem. Rev. 90, 543-583, 1990.
  • nexin-related serine protease inhibitor gene expression can be obtained by designing antisense oligonucleotides that will form duplexes to the control, 5', or regulatory regions of the nexin-related serine protease inhibitor gene. Oligonucleotides derived from the transcription initiation site, e.g., between positions -10 and +10 from the start site, are prefe ⁇ ed. Similarly, inhibition can be achieved using "triple helix" base-pairing methodology. Triple helix pairing is useful because it causes inhibition of the ability of the double helix to open sufficiently for the binding of polymerases, transcription factors, or chaperons.
  • An antisense oligonucleotide also can be designed to block translation of mRNA by preventing the transcript from binding to ribosomes.
  • Antisense oligonucleotides which comprise, for example, 2, 3, 4, or 5 or more stretches of contiguous nucleotides which are precisely complementary to an nexin-related serine protease inhibitor polynucleotide, each separated by a stretch of contiguous nucleotides which are not complementary to adjacent nexin-related serine protease inhibitor nucleotides, can provide sufficient targeting specificity for nexin-related serine protease inhibitor mRNA.
  • each stretch of complementary contiguous nucleotides is at least 4, 5, 6, 1, or 8 or more nucleotides in length.
  • Non-complementary intervening sequences are preferably 1, 2, 3, or 4 nucleotides in length.
  • One skilled in the art can easily use the calculated melting point of an antisense-sense pair to determine the degree of mismatching which will be tolerated between a particular antisense oligonucleotide and a particular nexin-related serine protease inhibitor polynucleotide sequence.
  • Antisense oligonucleotides can be modified without affecting their ability to hybridize to a human nexin-related serine protease inhibitor polynucleotide. These modifications can be internal or at one or both ends of the antisense molecule.
  • internucleoside phosphate linkages can be modified by adding cholesteryl or diamine moieties with varying numbers of carbon residues between the amino groups and terminal ribose.
  • Modified bases and/or sugars such as arabinose instead of ribose, or a 3', 5 '-substituted oligonucleotide in which the 3' hydroxyl group or the 5' phosphate group are substituted, also can be employed in a modified antisense oligonucleotide.
  • modified oligonucleotides can be prepared by methods well known in the art. See, e.g., Agrawal et al, Trends Biotechnol. 10, 152-158, 1992; Uhlmann et al., Chem. Rev. 90, 543-584, 1990; Uhlmann et al., Tetrahedron. Lett. 215, 3539-3542, 1987.
  • Ribozymes are RNA molecules with catalytic activity. See, e.g., Cech, Science 236, 1532-1539; 1987; Cech, Ann. Rev. Biochem. 59, 543-568; 1990, Cech, Curr. Opin. Struct. Biol. 2, 605-609; 1992, Couture & Stinchcomb, Trends Genet. 12, 510-515, 1996. Ribozymes can be used to inhibit gene function by cleaving an RNA sequence, as is known in the art (e.g., Haseloff et al., U.S. Patent 5,641,673).
  • ribozyme action involves sequence-specific hybridization of the ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage.
  • Examples include engineered hammerhead motif ribozyme molecules that can specifically and efficiently catalyze endonucleolytic cleavage of specific nucleotide sequences.
  • the coding sequence of a human nexin-related serine protease inhibitor poly- nucleotide can be used to generate ribozymes that will specifically bind to mRNA transcribed from the nexin-related serine protease inhibitor polynucleotide.
  • Methods of designing and constructing ribozymes which can cleave other RNA molecules in trans in a highly sequence specific manner have been developed and described in the art (see Haseloff et al. Nature 334, 585-591, 1988).
  • the cleavage activity of ribozymes can be targeted to specific RNAs by engineering a discrete
  • hybridization region into the ribozyme.
  • the hybridization region contains a sequence complementary to the target RNA and thus specifically hybridizes with the target (see, for example, Gerlach et al, EP 321,201).
  • Specific ribozyme cleavage sites within a human nexin-related serine protease inhibitor RNA target can be identified by scanning the target molecule for ribozyme cleavage sites which include the following sequences: GUA, GUU, and GUC. Once identified, short RNA sequences of between 15 and 20 ribonucleotides co ⁇ esponding to the region of the target RNA containing the cleavage site can be evaluated for secondary structural features which may render the target inoperable. Suitability of candidate nexin-related serine protease inhibitor RNA targets also can be evaluated by testing accessibility to hybridization with complementary oligonucleotides using ribonuclease protection assays.
  • hybridizing and cleavage regions of the ribozyme can be integrally related such that upon hybridizing to the target RNA through the complementary regions, the catalytic region of the ribozyme can cleave the target.
  • Ribozymes can be introduced into cells as part of a DNA construct. Mechanical methods, such as microinjection, liposome-mediated transfection, electroporation, or calcium phosphate precipitation, can be used to introduce a ribozyme-containing DNA construct.
  • a ribozyme-encoding DNA construct can include transcriptional regulatory elements, such as a promoter element, an enhancer or UAS element, and a transcriptional terminator signal, for controlling transcription of ribozymes in the cells.
  • ribozymes can be engineered so that ribozyme expression will occur in response to factors that induce expression of a target gene. Ribozymes also can be engineered to provide an additional level of regulation, so that destruction of mRNA occurs only when both a ribozyme and a target gene are induced in the cells. Differentially expressed genes
  • genes whose products interact with human nexin-related serine protease inhibitor.
  • genes may represent genes that are differentially expressed in disorders including, but not limited to, cancer,
  • genes may represent genes that are differentially regulated in response to manipulations relevant to the progression or treatment of such diseases. Additionally, such genes may have a temporally modulated expression, increased or decreased at different stages of tissue or organism development. A differentially expressed gene may also have its expression modulated under control versus experimental conditions. En addition, the human nexin-related serine protease inhibitor gene or gene product may itself be tested for differential expression.
  • the degree to which expression differs in a normal versus a diseased state need only be large enough to be visualized via standard characterization techniques such as differential display techniques.
  • standard characterization techniques such as differential display techniques.
  • Other such standard characterization techniques by which expression differences may be visualized include but are not limited to, quantitative RT (reverse transcriptase), PCR, and Northern analysis.
  • RNA samples are obtained from tissues of experimental subjects and from co ⁇ esponding tissues of control subjects. Any RNA isolation technique that does not select against the isolation of mRNA may be utilized for the purification of such RNA samples. See, for example, Ausubel et al, ed., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, Inc. New York, 1987-1993. Large numbers of tissue samples may readily be processed using techniques well known to those of skill in the art, such as, for example, the single-step RNA isolation process of Chomczynski, U.S. Patent 4,843,155.
  • Transcripts within the collected RNA samples that represent RNA produced by differentially expressed genes are identified by methods well known to those of skill in the art. They include, for example, differential screening (Tedder et al., Proc. Natl. Acad. Sci. U.S.A. 85, 208-12, 1988), subrractive hybridization (Hedrick et al, Nature 308, 149-53; Lee et al., Proc. Natl. Acad. Sci. U.S.A. 88, 2825, 1984), and, preferably, differential display (Liang & Pardee, Science 257, 961-11, 1992; U.S. Patent 5,262,311).
  • the differential expression information may itself suggest relevant methods for the treatment of disorders involving the human nexin-related serine protease inhibitor.
  • treatment may include a modulation of expression of the differentially expressed genes and/or the gene encoding the human nexin-related serine protease inhibitor.
  • the differential expression information may indicate whether the expression or activity of the differentially expressed gene or gene product or the human nexin-related serine protease inhibitor gene or gene product are up-regulated or down-regulated.
  • the invention provides assays for screening test compounds that bind to or modulate the activity of a human nexin-related serine protease inhibitor polypeptide or a human nexin-related serine protease inhibitor polynucleotide.
  • a test compound preferably binds to a human nexin-related serine protease inhibitor polypeptide or polynucleotide. More preferably, a test compound decreases or increases functional activity by at least about 10, preferably about 50, more preferably about 75, 90, or
  • Test compounds can be pharmacologic agents already known in the art or can be compounds previously unknown to have any pharmacological activity.
  • the compounds can be naturally occurring or designed in the laboratory. They can be isolated from microorganisms, animals, or plants, and can be produced recombinantly, or synthesized by chemical methods known in the art. If desired, test compounds can be obtained using any of the numerous combinatorial library methods known in. the art, including but not limited to, biological libraries, spatially addressable parallel solid phase or solution phase libraries, synthetic library methods requiring deconvolution, the "one-bead one-compound” library method, and synthetic library methods using affinity chromatography selection.
  • the biological library approach is limited to polypeptide libraries, while the other four approaches are applicable to polypeptide, non-peptide oligomer, or small molecule libraries of compounds. See Lam, Anticancer Drug Des. 12, 145, 1997.
  • Test compounds can be screened for the ability to bind to nexin-related serine protease inhibitor polypeptides or polynucleotides or to affect nexin-related serine protease inhibitor activity or nexin-related serine protease inhibitor gene expression using high throughput screening.
  • high throughput screening many discrete compounds can be tested in parallel so that large numbers of test compounds can be quickly screened.
  • the most widely established techniques utilize 96-well microtiter plates. The wells of the microtiter plates typically require assay volumes that range from 50 to 500 ⁇ l.
  • many instruments, materials, pipettors, robotics, plate washers, and plate readers are commercially available to fit the
  • free format assays or assays that have no physical barrier between samples, can be used.
  • an assay using pigment cells (melanocytes) in a simple homogeneous assay for combinatorial peptide libraries is described by
  • Chelsky placed a simple homogenous enzyme assay for carbonic anhydrase inside an agarose gel such that the enzyme in the gel would cause a color change throughout the gel. Thereafter, beads carrying combinatorial compounds via a photolinker were placed inside the gel and the compounds were partially released by UN-light. Compounds that inhibited the enzyme were observed as local zones of inhibition having less color change.
  • test samples are placed in a porous matrix.
  • One or more assay components are then placed within, on top of, or at the bottom of a matrix such as a gel, a plastic sheet, a filter, or other form of easily manipulated solid support. When samples are introduced to the porous matrix they diffuse sufficiently slowly, such that the assays can be performed without the test samples running together.
  • the test compound is preferably a small molecule that binds to the nexin-related serine protease inhibitor polypeptide, such that normal biological activity is prevented.
  • small molecules include, but are not limited to, small peptides or peptide-like molecules.
  • either the test compound or the nexin-related serine protease inhibitor polypeptide can comprise a detectable label, such as a fluorescent, radio- isotopic, chemiluminescent, or enzymatic label, such as horseradish peroxidase, alkaline phosphatase, or luciferase.
  • a detectable label such as a fluorescent, radio- isotopic, chemiluminescent, or enzymatic label, such as horseradish peroxidase, alkaline phosphatase, or luciferase.
  • Detection of a test compound that is bound to the nexin-related serine protease inhibitor polypeptide can then be accomplished, for example, by direct counting of radioemmission, by scintillation counting, or by determining conversion of an appropriate substrate to a detectable product.
  • binding of a test compound to a human nexin-related serine protease inhibitor polypeptide can be determined without labeling either of the interactants.
  • a microphysiometer can be used to detect binding of a test compound with a human nexin-related serine protease inhibitor polypeptide.
  • a microphysiometer e.g., CytosensorTM
  • a microphysiometer is an analytical instrument that measures the rate at which a cell acidifies its environment using a light-addressable potentiometric sensor (LAPS).
  • Changes in this acidification rate can be used as an indicator of the interaction between a test compound and a human nexin-related serine protease inhibitor polypeptide (McConnell et al., Science 257, 1906-1912, 1992). Determining the ability of a test compound to bind to a human nexin-related serine protease inhibitor polypeptide also can be accomplished using a technology such as real-time Bimolecular Interaction Analysis (BIA) (Sjolander & Urbaniczky, Anal Chem. 63, 2338-2345, 1991, and Szabo et al, Curr. Opin. Struct. Biol. 5, 699-705, 1995).
  • BiA Bimolecular Interaction Analysis
  • BIA is a technology for studying biospecific interactions in real time, without labeling any of the interactants (e.g., BEAcoreTM). Changes in the optical phenomenon surface plasmon resonance (SPR) can be used as an indication of real-time reactions between biological molecules.
  • SPR surface plasmon resonance
  • a human nexin-related serine protease inhibitor polypeptide can be used as a "bait protein" in a two-hybrid assay or three-hybrid assay (see, e.g., U.S. Patent 5,283,317; Zervos et al, Cell 72, 223-232, 1993; Madura et al, J. Biol. Chem. 268, 12046-12054, 1993; Bartel et al, BioTechniques 14, 920-924, 1993; Iwabuchi et al, Oncogene 8, 1693-1696, 1993; and Brent
  • the two-hybrid system is based on the modular nature of most transcription factors, which consist of separable DNA-binding and activation domains.
  • the assay utilizes two different DNA constructs. For example, in one construct, polynucleotide encoding a human nexin-related serine protease inhibitor polypeptide can be fused to a polynucleotide encoding the DNA binding domain of a known transcription factor
  • a DNA sequence that encodes an unidentified protein (e.g., GAL-4).
  • a DNA sequence that encodes an unidentified protein can be fused to a polynucleotide that codes for the activation domain of the known transcription factor. If the "bait” and the “prey” proteins are able to interact in vivo to form an protein-dependent complex, the
  • DNA-binding and activation domains of the transcription factor are brought into close proximity. This proximity allows transcription of a reporter gene (e.g., LacZ), which is operably linked to a transcriptional regulatory site responsive to the transcription factor. Expression of the reporter gene can be detected, and cell colonies containing the functional transcription factor can be isolated and used to obtain the DNA sequence encoding the protein that interacts with the nexin-related serine protease inhibitor polypeptide.
  • a reporter gene e.g., LacZ
  • nexin-related serine protease inhibitor polypeptide or polynucleotide
  • test compound can be bound to a solid support.
  • Suitable solid supports include, but are not limited to, glass or plastic slides, tissue culture plates, microtiter wells, tubes, silicon chips, or particles such as beads (including, but not limited to, latex, polystyrene, or glass beads).
  • any method known in the art can be used to attach the polypeptide (or polynucleotide) or test compound to a solid support, including use of covalent and non-covalent linkages, passive absorption, or pairs of binding moieties attached respectively to the polypeptide (or polynucleotide) or test compound and the solid support.
  • Test compounds are preferably bound to the solid support in an a ⁇ ay, so that the location of individual test compounds can be tracked. Binding of a test compound to a human nexin-related serine protease inhibitor polypeptide (or polynucleotide) can be accomplished in any vessel suitable for containing the reactants. Examples of such vessels include microtiter plates, test tubes, and microcentrifuge tubes.
  • the nexin-related serine protease inhibitor polypeptide is a fusion protein comprising a domain that allows the nexin-related serine protease inhibitor polypeptide to be bound to a solid support.
  • glutathione-S-transferase fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis, Mo.) or glutathione derivatized microtiter plates, which are then combined with the test compound or the test compound and the non-adsorbed nexin-related serine protease inhibitor polypeptide; the mixture is then incubated under conditions conducive to complex formation (e.g., at physiological conditions for salt and pH).
  • Binding of the interactants can be determined either directly or indirectly, as described above. Alternatively, the complexes can be dissociated from the solid support before binding is determined.
  • nexin-related serine protease inhibitor polypeptide or polynucleotide
  • test compound can be immobilized utilizing conjugation of biotin and streptavidin.
  • Biotinylated nexin-related serine protease inhibitor polypeptides (or polynucleotides) or test compounds can be prepared from biotin-NHS(N- hydroxysuccinimide) using techniques well known in the art (e.g., biotinylation kit, Pierce Chemicals, Rockford, 111.) and immobilized in the wells of streptavidin-coated 96 well plates (Pierce Chemical).
  • biotinylation kit Pierce Chemicals, Rockford, 111.
  • streptavidin-coated 96 well plates Piereptavidin-coated 96 well plates
  • antibodies which specifically bind to a nexin-related serine protease inhibitor polypeptide, polynucleotide, or a test compound, but which do not interfere with a desired binding site can be derivatized to the wells of the plate.
  • Unbound target or protein can be trapped in the wells by antibody conjugation.
  • Methods for detecting such complexes include immunodetection of complexes using anti- bodies which specifically bind to the nexin-related serine protease inhibitor polypeptide or test compound, enzyme-linked assays which rely on detecting an activity of the nexin-related serine protease inhibitor polypeptide, and SDS gel electrophoresis under non-reducing conditions.
  • Screening for test compounds which bind to a human nexin-related serine protease inhibitor polypeptide or polynucleotide also can be carried out in an intact cell. Any cell which comprises a nexin-related serine protease inhibitor polypeptide or polynucleotide can be used in a cell-based assay system. A nexin-related serine protease inhibitor polynucleotide can be naturally occurring in the cell or can be introduced using techniques such as those described above. Binding of the test compound to a nexin-related serine protease inhibitor polypeptide or polynucleotide is determined as described above.
  • Test compounds can be tested for the ability to increase or decrease the functional activity of a human nexin-related serine protease inhibitor polypeptide.
  • Functional activity e.g., serine protease inhibiting activity, can be measured, for example, as is well known in the art. See, e.g., U.S. Patent 6,197,519.
  • Functional assays can be carried out after contacting either a purified nexin-related serine protease inhibitor polypeptide, a cell membrane preparation, or an intact cell with a test compound.
  • a test compound that decreases functional activity of a human nexin-related serine protease inhibitor polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% ⁇ is identified as a potential therapeutic agent for decreasing nexin-related serine protease inhibitor activity.
  • a test compound which increases functional activity of a human nexin-related serine protease inhibitor polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% is identified as a potential therapeutic agent for increasing human nexin-related serine protease inhibitor activity.
  • test compounds that increase or decrease nexin-related serine protease inhibitor gene expression are identified.
  • a nexin-related serine protease inhibitor polynucleotide is contacted with a test compound, and the expression of an RNA or polypeptide product of the nexin-related serine protease inhibitor polynucleotide is determined.
  • the level of expression of appropriate mRNA or polypeptide in the presence of the test compound is compared to the level of expression of mRNA or polypeptide in the absence of the test compound.
  • the test compound can then be identified as a modulator of expression based on this comparison.
  • test compound when expression of mRNA or polypeptide is greater in the presence of the test compound than in its absence, the test compound is identified as a stimulator or enhancer of the mRNA or polypeptide expression.
  • test compound when expression of the mRNA or polypeptide is less in the presence of the test compound than in its absence, the test compound is identified as " an inhibitor of the mRNA or polypeptide expression.
  • the level of nexin-related serine protease inhibitor mRNA or polypeptide expression in the cells can be determined by methods well known in the art for detecting mRNA or polypeptide. Either qualitative or quantitative methods can be used.
  • the presence of polypeptide products of a human nexin-related serine protease inhibitor polynucleotide can be determined, for example, using a variety of techniques known in the art, including immunochemical methods such as radioimmunoassay, Western blotting, and immunohistochemistry.
  • polypeptide synthesis can be determined in vivo, in a cell culture, or in an in vitro translation system by detecting incorporation of labeled amino acids into a human nexin-related serine protease inhibitor polypeptide.
  • Such screening can be carried out either in a cell-free assay system or in an intact cell.
  • Any cell that expresses a human nexin-related serine protease inhibitor polynucleotide can be used in a cell-based assay system.
  • the nexin-related serine protease inhibitor polynucleotide can be naturally occurring in the cell or can be introduced using techniques such as those described above.
  • Either a primary culture or an established cell line, such as CHO or human embryonic kidney 293 cells, can be used.
  • compositions of the invention can comprise, for example, a human nexin-related serine protease inhibitor polypeptide, nexin-related serine protease inhibitor polynucleotide, ribozymes or antisense oligonucleotides, antibodies which specifically bind to a nexin-related serine protease inhibitor polypeptide, or mimetics, activators, or inhibitors of a human nexin-related serine protease inhibitor polypeptide activity.
  • compositions can be administered alone or in combination with at least one other agent, such as stabilizing compound, which can be administered in any sterile, biocompatible pharmaceutical carrier, including, but not limited to, saline, buffered saline, dextrose, and water.
  • agent such as stabilizing compound
  • the compositions can be administered to a patient alone, or in combination with other agents, drugs or hormones.
  • compositions of the invention can be administered by any number of routes including, but not limited to, oral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, intraventricular, transdermal, subcutaneous, intraperitoneal, intranasal, parenteral, topical, sublingual, or rectal means.
  • Pharmaceutical compositions for oral administration can be formulated using pharmaceutically acceptable carriers well known in the art in dosages suitable for oral administration. Such carriers enable the pharmaceutical compositions to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for ingestion by the patient.
  • compositions for oral use can be obtained through combination of active compounds with solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores.
  • Suitable excipients are carbohydrate or protein fillers, such as sugars, including lactose, sucrose, mannitol, or sorbitol; starch from corn, wheat, rice, potato, or other plants; cellulose, such as methyl cellulose, hydroxypropylmethyl-cellulose, or sodium carboxymethylcellulose; gums including arabic and tragacanth; and proteins such as gelatin and collagen.
  • disintegrating or solubilizing agents can be added, such as the cross-linked polyvinyl py ⁇ olidone, agar, alginic acid, or a salt thereof, such as sodium alginate.
  • Dragee cores can be used in conjunction with suitable coatings, such as concentrated sugar solutions, which also can contain gum arabic, talc, polyvinylpy ⁇ olidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
  • suitable coatings such as concentrated sugar solutions, which also can contain gum arabic, talc, polyvinylpy ⁇ olidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
  • Dyestuffs or pigments can be added to the tablets or dragee coatings for product identification or to characterize the quantity of active compound, i.e., dosage.
  • compositions that can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a coating, such as glycerol or sorbitol.
  • Push-fit capsules can contain active ingredients mixed with a filler or binders, such as lactose or starches, lubricants, such as talc or magnesium stearate, and, optionally, stabilizers.
  • the active compounds can be dissolved or suspended in suitable liquids, such as fatty oils, liquid, or liquid polyethylene glycol with or without stabilizers.
  • compositions suitable for parenteral administration can be formulated in aqueous solutions, preferably in physiologically compatible buffers such as
  • Aqueous injection suspensions can contain substances that increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran.
  • suspensions of the active compounds can be prepared as appropriate oily injection suspensions.
  • Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes.
  • Non-lipid polycationic amino polymers also can be used for delivery.
  • the suspension also can contain suitable stabilizers or agents that increase the solubility of the compounds to allow for the preparation of highly concentrated solutions.
  • penetrants appropriate to the particular barrier to be permeated are used in the formulation. Such penetiants are generally known in the art.
  • compositions of the present invention can be manufactured in a manner that is known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping, or lyophilizing processes.
  • the pharmaceutical composition can be provided as a salt and can be formed with many acids, including but not limited to, hydrochloric, sulfuric, acetic, lactic, tartaric, malic, succinic, etc. Salts tend to be more soluble in aqueous or other protonic solvents than are the co ⁇ esponding free base forms.
  • the prefe ⁇ ed preparation can be a lyophilized powder which can contain any or all of the following: 1-50 mM histidine, 0.1%-2% sucrose, and 2-7% mannitol, at a pH range of 4.5 to 5.5, that is combined with buffer prior to use.
  • compositions After pharmaceutical compositions have been prepared, they can be placed in an appropriate container and labeled for treatment of an indicated condition. Such labeling would include amount, frequency, and method of admini- stration.
  • Human nexin-related serine protease inhibitor can be regulated to treat cancer, CNS disorders, cardiovascular disorders, genitourinary disorders, hematological disorders, gastrointestinal disorders, COPD, and asthma.
  • the novel human nexin-related serine protease inhibitor is highly expressed in the following cancer tissues: lung tumor, stomach tumor, ovary tumor, ileum tumor, colon tumor, breast tumor.
  • lung tumor, stomach tumor, ovary tumor, ileum tumor, colon tumor, breast tumor The expression in the above mentioned tissues and in particular the differential expression between diseased tissue lung tumor and healthy tissue " lung, between diseased tissue stomach tumor and healthy tissue stomach, between diseased tissue colon tumor and healthy tissue colon, between diseased tissue breast tumor and healthy tissue breast demonstrates that the novel human nexin-related serine protease inhibitor or mRNA can be used to diagnose cancer. Additionally, the activity of the novel human nexin-related serine protease inhibitor can be modulated to treat cancer.
  • Cancer disorders within the scope of the invention comprise any disease of an organ or tissue in mammals characterized by poorly controlled or uncontrolled multiplication of normal or abnormal cells in that tissue and its effect on the body as a whole.
  • Cancer diseases within the scope of the invention comprise benign neoplasms, dysplasias, hyperplasias as well as neoplasms showing metastatic growth or any other transformations, e.g., leukoplakias, which often precede a breakout of cancer.
  • Cells and tissues are cancerous when they grow more rapidly than normal cells, displacing or spreading into the surrounding healthy tissue or any other tissues of the body described as metastatic growth, assume abnormal shapes and sizes, show changes in their nucleocytoplasmatic ratio, nuclear polychromasia, and finally may cease.
  • Cancerous cells and tissues may affect the body as a whole when causing paraneo- plastic syndromes or if cancer occurs within a vital organ or tissue, normal function will be impaired or halted, with possible fatal results.
  • the ultimate involvement of a vital organ by cancer, either primary or metastatic, may lead to the death of the mammal affected. Cancer tends to spread, and the extent of its spread is usually related to an individual's chances of surviving the disease.
  • Cancers are generally said to be in one of three stages of growth: early, or localized, when a tumor is still confined to the tissue of origin, or primary site; direct extension, where cancer cells from the tumor have invaded adjacent tissue or have spread only to regional lymph nodes; or metastasis, in which cancer cells have migrated to distant parts of the body from the primary site, via the blood or lymph systems, and have established secondary sites of infection. Cancer is said to be malignant because of its tendency to cause death if not treated.
  • Benign tumors usually do not cause death, although they may if they interfere with a normal body function by virtue of their location, size, or paraneoplastic side effects. Hence, benign tumors fall under the definition of cancer within the scope of the invention as well.
  • cancer cells divide at a higher rate than do normal cells, but the distinction between the growth of cancerous and normal tissues is not so much the rapidity of cell division in the former as it is the partial or complete loss of growth restraint in cancer cells and their failure to differentiate into a useful, limited tissue of the type that characterizes the functional equilibrium of growth of normal tissue.
  • Cancer tissues may express certain molecular receptors and probably are influenced by the host's susceptibility and immunity and it is known that certain cancers of the breast and prostate, for example, are considered dependent on specific hormones for their existence.
  • the term "cancer” under the scope of the invention is not limited to simple benign neoplasia but includes any other benign and malign neoplasia, such as 1) carcinoma, 2) sarcoma, 3) carcinosarcoma, 4) cancers of the blood-forming tissues, 5) tumors of nerve tissues including the brain, and 6) cancer of skin cells.
  • Carcinoma occurs in epithelial tissues, which cover the outer body (the skin) and line mucous membranes and the inner cavitary structures of organs e.g. such as the breast, lung, the respiratory and gastrointestinal tracts, the endocrine glands, and the genitourinary system.
  • Ductal or glandular elements may persist in epithelial tumors, as in adenocarcinomas, e.g., thyroid adenocarcinoma, gastric adenocarcinoma, and uterine adenocarcinoma.
  • Cancers of the pavement-cell epithelium of the skin and of certain mucous membranes such as cancers of the tongue, lip, larynx, urinary bladder, uterine cervix, or penis, may be termed epidermoid or squamous-cell carcinomas of the respective tissues and are within the scope of the definition of cancer as well.
  • Sarcomas develop in connective tissues, including fibrous tissues, adipose (fat) tissues, muscle, blood vessels, bone, and cartilage such as osteogenic sarcoma, liposarcoma, fibrosarcoma, and synovial sarcoma.
  • Carcinosarcoma is cancer that develops in both epithelial and connective tissue.
  • Cancer disease within the scope of this definition may be primary or secondary, whereby primary indicates that the cancer originated in the tissue where it is found rather than was established as a secondary site through metastasis from another lesion.
  • Cancers and tumor diseases within the scope of this definition may be benign or malign and may affect all anatomical structures of the body of a mammal.
  • Cancer is a disease fundamentally caused by oncogenic cellular transformation. There are several hallmarks of transformed cells that distinguish them from their normal counterparts and underlie the pathophysiology of cancer. These include uncontrolled cellular proliferation, unresponsiveness to normal death-inducing signals (immortalization), increased cellular motility and invasiveness, increased ability to recruit blood supply through induction of new. blood vessel formation (angiogenesis), genetic instability, and dysregulated gene expression. Various combinations of these abe ⁇ ant physiologies, along with the acquisition of drug-resistance frequently lead to an intractable disease state in which organ failure and patient death ultimately ensue.
  • Genes or gene fragments identified through genomics can readily be expressed in one or more heterologous expression systems to produce functional recombinant proteins.
  • proteins are characterized in vitro for their biochemical properties and then used as tools in high-throughput molecular screening programs to identify chemical modulators of their biochemical activities.
  • Agonists and/or antagonists of target protein activity can be identified in this manner and subsequently tested in cellular and in vivo disease models for anti-cancer activity. Optimization of lead compounds with iterative testing in biological models and detailed pharmacokinetic and toxicological analyses form the basis for drug development and subsequent testing in humans.
  • the novel human nexin-related serine protease inhibitor is highly expressed in the following brain tissues: Alzheimer cerebral cortex, dorsal root ganglia, pons, occipital lobe, Alzheimer brain frontal lobe, Alzheimer brain, substantia nigra, hippocampus, tonsilla cerebelli , vermis cerebelli, corpus callosum, cerebral cortex, cerebellum (left), cerebral peduncles, retina, parietal lobe, and precentral gyrus, frontal lobe.
  • the expression in brain tissues and in particular the differential expression between diseased tissue Alzheimer cerebral cortex and healthy tissue cerebral cortex, between diseased tissue Alzheimer brain frontal lobe and healthy tissue frontal lobe, between diseased tissue Alzheimer brain and healthy tissue brain demonstrates that the novel human nexin-related serine protease inhibitor or mRNA can be used to diagnose nervous system diseases. Additionally, the activity of the novel human nexin-related serine protease inhibitor can be modulated to treat nervous system diseases.
  • Central and peripheral nervous system disorders also can be treated, such as primary and secondary disorders after brain injury, disorders of mood, anxiety disorders, disorders of thought and volition, disorders of sleep and wakefulness, diseases of the motor unit, such as neurogenic and myopathic disorders, neurodegenerative disorders such as Alzheimer's and Parkinson's disease, and processes of peripheral and chronic pain.
  • Pain that is associated with CNS disorders also can be treated. Pain which can be treated includes that associated with central nervous system disorders, such as multiple sclerosis, spinal cord injury, sciatica, failed back surgery syndrome, traumatic brain injury, epilepsy, Parkinson's disease, post-stroke, and vascular lesions in the brain and spinal cord (e.g., infarct, hemo ⁇ hage, vascular malformation).
  • central nervous system disorders such as multiple sclerosis, spinal cord injury, sciatica, failed back surgery syndrome, traumatic brain injury, epilepsy, Parkinson's disease, post-stroke, and vascular lesions in the brain and spinal cord (e.g., infarct, hemo ⁇ hage, vascular malformation).
  • Non- central neuropathic pain includes that associated with post mastectomy pain, reflex sympathetic dystrophy (RSD), trigeminal neuralgiaradioculopathy, post-surgical pain, HIV/ AEDS related pain, cancer pain, metabolic neuropathies (e.g., diabetic neuropathy, vasculitic neuropathy secondary to connective tissue disease), paraneo- plastic polyneuropathy associated, for example, with carcinoma of lung, or leukemia, or lymphoma, or carcinoma of prostate, colon or stomach, trigeminal neuralgia, cranial neuralgias, and post-herpetic neuralgia. Pain associated with cancer and cancer treatment also can be treated, as can headache pain (for example, migraine with aura, migraine without aura, and other migraine disorders), episodic and chronic tension-type headache, tension-type like headache, cluster headache, and chronic paroxysmal hemicrania.
  • headache pain for example, migraine with aura, migraine without aura, and other migraine disorders
  • episodic and chronic tension-type headache tension-type like headache, cluster headache,
  • the novel human nexin-related serine protease inhibitor is highly expressed in the following cardiovascular related tissues: coronary artery, coronary artery sclerotic, artery, vein, aorta, coronary artery smooth muscle primary cells. Expression in the above mentioned tissues and in particular the differential expression between diseased tissue coronary artery sclerotic and healthy tissue coronary artery demonstrates that the novel human nexin-related serine protease inhibitor or mRNA can be used to diagnose cardiovascular diseases. Additionally, the activity of the novel human nexin-related serine protease inhibitor can be modulated to treat cardiovascular diseases.
  • Cardiovascular diseases include the following disorders of the heart and the vascular system: congestive heart failure, myocardial infarction, ischemic diseases of the heart, all kinds of atrial and ventricular a ⁇ hythmias, hypertensive vascular diseases, and peripheral vascular diseases.
  • Heart failure is defined as a pathophysiologic state in which an abnormality of cardiac function is responsible for the failure of the heart to pump blood at a rate commensurate with the requirement of the metabolizing tissue. It includes all forms of pumping failure, such as high-output and low-output, acute and chronic, right-sided or left-sided, systolic or diastolic, independent of the underlying cause.
  • MI Myocardial infarction
  • Ischemic diseases are conditions in which the coronary flow is restricted resulting in a perfusion which inadequate to meet the myocardial requirement for oxygen.
  • This group of diseases includes stable angina, unstable angina, and asymptomatic ischemia.
  • a ⁇ hythmias include all forms of atrial and ventricular tachya ⁇ hythmias (atrial tachycardia, atrial flutter, atrial fibrillation, atrio-ventricular reentrant tachycardia, preexcitation syndrome, ventricular tachycardia, ventricular flutter, and ventricular fibrillation), as well as bradycardic forms of a ⁇ hythmias.
  • Nascular diseases include primary as well as all kinds of secondary arterial hypertension (renal, endocrine, neurogenic, others). The disclosed gene and its product may be used as drug targets for the treatment of hypertension as well as for the prevention of all complications.
  • Peripheral vascular diseases are defined as vascular diseases in which arterial and/or venous flow is reduced resulting in an imbalance between blood supply and tissue oxygen demand. It includes chronic peripheral arterial occlusive disease (PAOD), acute arterial thrombosis and embolism, inflammatory vascular disorders, Raynaud's phenomenon, and venous disorders.
  • PAOD peripheral arterial occlusive disease
  • acute arterial thrombosis and embolism inflammatory vascular disorders
  • Raynaud's phenomenon Raynaud's phenomenon
  • venous disorders venous disorders.
  • the novel human nexin-related serine protease inhibitor is highly expressed in the following tissues of the genitourinary system: prostate BPH, penis, ureter, ovary tumor, ovary, uterus, prostate.
  • the expression in the above mentioned tissues and in particular the differential expression between diseased tissue prostate BPH and healthy tissue prostate demonstrates that the novel human nexin-related serine protease inhibitor or mR ⁇ A can be used to diagnose genitourinary disorders.
  • the activity of the novel human nexin-related serine protease inhibitor can be modulated to treat genitourinary disorders.
  • Genitourological disorders comprise benign and malign disorders of the organs constituting the genitourological system of female and male, renal diseases such as acute or chronic renal failure, immunologically mediated renal diseases such as renal transplant rejection, lupus nephritis, immune complex renal diseases, glomerulopa- thies, nephritis, toxic nephropathy, obstructive uropathies such as benign prostatic hyperplasia (BPH), neurogenic bladder syndrome, urinary incontinence such as urge-, stress-, or overflow incontinence, pelvic pain, and erectile dysfunction.
  • Urinary incontinence such as urge-, stress-, or overflow incontinence, pelvic pain, and erectile dysfunction.
  • Urinary incontinence is the involuntary loss of urine.
  • Urge urinary incontinence is one of the most common types of Ul together with stress urinary incontinence (SUE), which is usually caused by a defect in the urethral closure mechanism.
  • UUI is often associated with neurological disorders or diseases causing neuronal damage, such as dementia, Parkinson's disease, multiple sclerosis, stroke, and diabetes, although it also occurs in individuals with no such disorders.
  • One of the usual causes of UUI is overactive bladder (OAB), which is a medical condition referring to the symptoms of frequency and urgency derived from abnormal contractions and instability of the detrusor muscle.
  • OAB overactive bladder
  • LUTS lower urinary tract symptoms
  • Storage symptoms contain pollakisuria (or pollakiuria, urinary frequency), nocturia, urinary urgency, and urinary incontinence (stress incontinence, urge incontinence, overflow incontinence, etc.).
  • Voiding symptoms contain difficulty in urination (urinary hesitancy, urinary prolongation, decreased urinary stream, urinary te ⁇ ninal dribbling, and urinary intermittency) and urinary retention.
  • BPH patients may serve also as treatments for Ul.
  • Benign prostate hyperplasia is the benign nodular hyperplasia of the periure- thral prostate gland commonly seen in men over the age of 50. The overgrowth occurs in the central area of the prostate called the transition zone, which wraps around the urethra. BPH causes variable degrees of bladder outlet obstruction, resulting in progressive lower urinary tract syndromes characterized by urinary frequency, urgency, and nocturia due to incomplete emptying and rapid refilling of the bladder. The actual cause of BPH is unknown but may involve age-related alterations in balance of steroidal sex hormones.
  • Nexin is a protease inhibitor that belongs to the serpin (serine protease inhibitor) family.
  • Serpin family protease inhibitors bind to the catalytic groove of the target protease, and inhibits its protease activity (Djie et al., J. Biol. Chem. 272, 16268-73, 1997).
  • Prostate specific antigen (PSA) is a kallikrein-like serine protease, and it is reported that the secretion of PSA is increased in BPH patients (Ellis et al, Urol. Clin. North Am. 20, 621-25, 1993).
  • reagents that modify the expression of human nexin-related serine protease inhibitor and reagents that bind to nexin-related serine protease inhibitor gene products can provide a treatment of BPH.
  • BBI Bowman-Birk inhibitor
  • Nexin is also a serine protease inhibitor; therefore, as is the case for BBI, nexin-related serine protease inhibitor is expected to be useful for treating BPH.
  • the novel human nexin-related serine protease inhibitor is highly expressed in the following tissues of the hematological system: bone ma ⁇ ow CD33+ cells, lymph node, cord blood CD71+ cells, bone ma ⁇ ow CDI 5+ cells, bone ma ⁇ ow CD71+ cells, thrornbocytes, bone ma ⁇ ow stromal cells.
  • the expression in the above- mentioned tissues demonstrates that the novel human nexin-related serine protease inhibitor or mRNA can be used to diagnose hematological diseases. Additionally, the activity of the novel human nexin-related serine protease inhibitor can be modulated to treat hematological disorders.
  • Hemoglobin in red blood cells is the key component for transporting oxygen from the lungs to the tissues.
  • the level of hemoglobin has fallen below 12 g/L. Therefore the oxygen carrying capacity of blood is reduced.
  • Common reasons for anemia include acute or chronic blood loss, insufficient levels of erythropoietin synthesis in the kidneys (e.g. in dialysis patients) or insufficient output of red blood cells from bone ma ⁇ ow after chemotherapy or HIV infection etc..
  • Cu ⁇ ent therapy of anemia is aimed at increasing the hematocrit either by transfusion or by stimulating erythropoiesis with agents such as erythropoietin. The treatment goal is to restore hemoglobin levels above 12g/L.
  • Neutropenia is an abnormally low white blood cell count which causes an increased incidence of infections.
  • causes of neutropenia include: drug-induced (e.g., following cancer chemotherapy), increased destruction of neutrophils (e.g., immune-mediated) or decreased bone ma ⁇ ow function (e.g., familial neutropenia).
  • Neutropenia following cancer chemotherapy is cu ⁇ ently treated with growth factors such as G-CSF or GM- CSF that stimulate granulopoiesis. The treatment goal is to raise the neutrophil count in order to reduce the susceptibility to infection.
  • Thrombocytopenia is a disorder where the number of platelets is inappropriately low. Since platelets play an essential role in thrombus formation to limit blood loss following vessel injury, insufficient platelet levels may lead to abnormal bleeding. There are many causes of thrombocytopenia including drug-induced thrombocytopenia (e.g., following cancer chemotherapy) and immune thrombocytopenia (due to increased degradation of platelets). Platelet transfusions or IL-11 can be used to restore platelet levels in order to reduce the bleeding risk.
  • Aplastic anemia is a life-threatening hematologic disorder characterized by absent or markedly diminished hematopoietic precursors in the bone marrow and resulting in neutropenia, anemia and thrombocytopenia.
  • a large number of agents can cause aplastic anemia (drugs, chemicals and toxins) radiation and certain infections can also induce aplastic anemia. More frequently, aplastic anemia occurs as an unpredictable idiosyncratic reaction to drugs such as anti-inflammatory agents, antibiotics, and antiepileptic drugs.
  • Aplastic anemia typically develops weeks or month during drug administration or delayed after drug administration has been discontinued.
  • aplastic anemia Several congenital and familiar forms of aplastic anemia have been described, including Fanconi's anemia, Shwachman-Diamond syndrome, familiar aplastic anemia, and aplasia associated with dyskeratosis congenita or amega- karyocytic thrombocytopenia.
  • novel human nexin-related serine protease inhibitor is highly expressed in the following tissues of the gastrointestinal system: rectum, stomach tumor, ileum, ileum tumor, colon tumor, stomach, and colon.
  • the expression in the above mentioned tissues and in particular the differential expression between diseased tissue ileum tumor and healthy tissue ileum demonstrates that the novel human nexin-related serine protease inhibitor or mRNA can be used to diagnose gastrointestinal disorders.
  • the activity of the novel human nexin-related serine protease inhibitor can be modulated to treat gastrointestinal disorders.
  • Gastrointestinal disorders comprise primary or secondary, acute or chronic diseases of the organs of the gastrointestinal tract which may be acquired or inherited, benign or malignant or metaplastic, and which may affect the organs of the gastrointestinal tract or the body as a whole. They include but are not limited to disorders of the esophagus, such as achalasia, vigorous achalasia, dysphagia, cricopharyngeal incoordination, pre-esophageal . dysphagia, diffuse esophageal spasm, globus sensation, Ba ⁇ ett's metaplasia, and gastroesophageal reflux.
  • disorders of the esophagus such as achalasia, vigorous achalasia, dysphagia, cricopharyngeal incoordination, pre-esophageal .
  • dysphagia diffuse esophageal spasm, globus sensation, Ba ⁇ ett's metaplasia, and gastroesophageal reflux.
  • stomachs include disorders of the stomach and duodenum, such as functional dyspepsia, inflammation of the gastric mucosa, gastritis, stress gastritis, chronic erosive gastritis, atrophy of gastric glands, metaplasia of gastric tissues, gastric ulcers, duodenal ulcers, and neoplasms of the stomach.
  • disorders of the stomach and duodenum such as functional dyspepsia, inflammation of the gastric mucosa, gastritis, stress gastritis, chronic erosive gastritis, atrophy of gastric glands, metaplasia of gastric tissues, gastric ulcers, duodenal ulcers, and neoplasms of the stomach.
  • Gastrointestinal disorders also include disorders of the pancreas, such as acute or chronic pancreatitis, insufficiency of the exocrinic or endocrinic tissues of the pancreas like steato ⁇ hea, diabetes, neoplasms of the exocrine or endocrine pancreas (e.g., multiple endocrine neoplasia syndrome, ductal adenocarcinoma, cystadenocarcinoma, islet cell tumors, insulinoma, gastrinoma, carcinoid tumors, and glucagonoma), Zollinger-Ellison syndrome, Vipoma syndrome, and malabsorption syndrome.
  • disorders of the pancreas such as acute or chronic pancreatitis, insufficiency of the exocrinic or endocrinic tissues of the pancreas like steato ⁇ hea, diabetes, neoplasms of the exocrine or endocrine pancreas (e.g.
  • Gastrointestinal disorders also include disorders of the bowel, such as chronic inflammatory diseases of the bowel, Crohn's disease, ileus, dia ⁇ hea and constipation, colonic inertia, megacolon, malabsorption syndrome, and ulcerative colitis, functional bowel disorders, such as irritable bowel syndrome, neoplasms of the bowel, such as familial polyposis, adenocarcinoma, primary malignant lymphoma, carcinoid tumors, Kaposi's sarcoma, polyps, and cancer of the colon and rectum.
  • disorders of the bowel such as chronic inflammatory diseases of the bowel, Crohn's disease, ileus, dia ⁇ hea and constipation, colonic inertia, megacolon, malabsorption syndrome, and ulcerative colitis
  • functional bowel disorders such as irritable bowel syndrome, neoplasms of the bowel, such as familial polyposis, adenocarcinoma, primary malignant
  • novel human nexin-related serine protease inhibitor is highly expressed in the following tissues of the respiratory system: lung tumor, lung right mid lobe, lung right lower lobe, lung right upper lobe, lung COPD.
  • the expression in the above mentioned tissues and in particular the differential expression between diseased tissue lung COPD and healthy tissue lung demonstrates that the novel human nexin-related serine protease inhibitor or mRNA can be used to diagnose COPD and/or asthma. Additionally, the activity of the novel human nexin-related serine protease inhibitor can be modulated to treat those diseases.
  • allergens typically elicit a specific IgE response and, although in most cases the allergens themselves have little or no intrinsic toxicity, they induce pathology when the IgE response in turn elicits an IgE- dependent or T cell-dependent hypersensitivity reaction.
  • Hypersensitivity reactions can be local or systemic and typically occur within minutes of allergen exposure in individuals who have previously been sensitized to an allergen.
  • the hypersensitivity reaction of allergy develops when the allergen is recognized by IgE antibodies bound to specific receptors on the surface of effector cells, such as mast cells, basophils, or eosinophils, which causes the activation of the effector cells and the release of mediators that produce the acute signs and symptoms of the reactions.
  • Allergic diseases include asthma, allergic rhinitis (hay fever), atopic dermatitis, and anaphylaxis.
  • Asthma is though to arise as a result of interactions between multiple genetic and environmental factors and is characterized by three major features: 1) intermittent and reversible airway obstruction caused by bronchoconstriction, increased mucus production, and thickening of the walls of the airways that leads to a na ⁇ owing of the airways, 2) airway hype ⁇ esponsiveness caused by a decreased control of airway caliber, and 3) airway inflammation.
  • Certain cells are critical to the inflammatory reaction of asthma and they include T cells and antigen presenting cells, B cells that produce IgE, and mast cells, basophils, eosinophils, and other cells that bind IgE.
  • effector cells accumulate at the site of allergic reaction in the airways and release toxic products that contribute to the acute pathology and eventually to the tissue destruction related to the disorder.
  • Other resident cells such as smooth muscle cells, lung epithelial cells, mucus-producing cells, and nerve cells may also be abnormal in individuals with asthma and may contribute to the pathology.
  • the airway obstruction of asthma presenting clinically as an intermittent wheeze and shortness of breath, is generally the most pressing symptom of the disease requiring immediate treatment, the inflammation and tissue destruction associated with the disease can lead to i ⁇ eversible changes that eventually make asthma a chronic disabling disorder requiring long-term management.
  • Cu ⁇ ent pharmacological treatments suffer their own set of disadvantages.
  • Com- monly used therapeutic agents such as beta agonists, can act as symptom relievers to transiently improve pulmonary function, but do not affect the underlying inflammation.
  • Agents that can reduce the underlying inflammation such as anti- inflammatory steroids, can have major drawbacks that range from immuno- suppression to bone loss (Goodman and Gilman's THE PHARMACOLOGIC BASIS OF THERAPEUTICS, Seventh Edition, MacMillan Publishing Company, NY, USA, 1985).
  • Glycophorin A Cho and Sharom, Cell. Immunol. 145, 223-39, 1992
  • cyclosporin Alexander et al, Lancet 339, 324-28, 1992
  • a nonapeptide fragment of IL-2 Zav'yalov et al, Immunol. Lett. 31, 285-88, 1992
  • cyclosporin is used as a immuno- suppressant after organ transplantation.
  • COPD chronic obstructive pulmonary (or airways) disease
  • COPD chronic obstructive pulmonary (or airways) disease
  • COPD chronic obstructive pulmonary (or airways) disease
  • Emphysema is characterized by destruction of alveolar walls leading to abnormal enlargement of the air spaces of the lung.
  • Chronic bronchitis is defined clinically as the presence of chronic productive cough for three months in each of two successive years.
  • airflow obstruction is usually progressive and is only partially reversible. By far the most important risk factor for development of COPD is cigarette smoking, although the disease does occur in non-smokers.
  • the inflammatory cell population comprises increased numbers of macrophages, neutrophils, and CD8 + lymphocytes.
  • Inhaled irritants such as cigarette smoke, activate macrophages which are resident in the respiratory tract, as well as epithelial cells leading to release of chemokines (e.g., interleukin-8) and other chemotactic factors.
  • chemokines e.g., interleukin-8
  • chemotactic factors act to increase the neutrophil/- monocyte trafficking from the blood into the lung tissue and airways.
  • Neutrophils and monocytes recruited into the airways can release a variety of potentially damaging mediators such as proteolytic enzymes and reactive oxygen species.
  • Matrix degradation and emphysema, along with airway wall thickemng, surfactant dysfunction, and mucus hypersecretion all are potential sequelae of this inflammatory response that lead to impaired airflow and gas exchange.
  • This invention further pertains to the use of novel agents identified by the screening assays described above. Accordingly, it is within the scope of this invention to use a test compound identified as described herein in an appropriate animal model.
  • an agent identified as described herein e.g., a modulating agent, an antisense nucleic acid molecule, a specific antibody, ribozyme, or a human nexin- related serine protease inhibitor polypeptide binding, molecule
  • an agent identified as described herein can be used in an animal model to determine the mechanism of action of such an agent.
  • this invention pertains to uses of novel agents identified by the above- described screening assays for treatments as described herein.
  • a reagent which affects nexin-related serine protease inhibitor activity can be administered to a human cell, either in vitro or in vivo, to reduce nexin-related serine protease inhibitor activity.
  • the reagent preferably binds to an expression product of a human nexin-related serine protease inhibitor gene. If the expression product is a protein, the reagent is preferably an antibody.
  • an antibody can be added to a preparation of stem cells that have been removed from the body. The cells can then be replaced in the same or another human body, with or without clonal propagation, as is known in the art.
  • the reagent is delivered using a liposome.
  • the liposome is stable in the animal into which it has been administered for at least about 30 minutes, more preferably for at least about 1 hour, and even more preferably for at least about 24 hours.
  • a liposome comprises a lipid composition that is capable of targeting a reagent, particularly a polynucleotide, to a particular site in an animal, such as a human.
  • the lipid composition of the liposome is capable of targeting to a specific organ of an animal, such as the lung, liver, spleen, heart brain, lymph nodes, and skin.
  • a liposome useful in the present invention comprises a lipid composition that is capable of fusing with the plasma membrane of the targeted cell to deliver its contents to the cell.
  • the transfection efficiency of a liposome is about 0.5 ⁇ g of DNA per 16 nmole of liposome delivered to about 10 cells, more preferably about 1.0 ⁇ g of DNA per 16 nmole of liposome delivered to about 10 cells, and even more preferably about 2.0 ⁇ g of DNA per 16 nmol of liposome delivered to about 10 6 cells.
  • a liposome is between about 100 and
  • 500 nm more preferably between about 150 and 450 nm, and even more preferably between about 200 and 400 nm in diameter.
  • Suitable liposomes for use in the present invention include those liposomes standardly used in, for example, gene delivery methods known to those of skill in the art. More prefe ⁇ ed liposomes include liposomes having a polycationic lipid composition and/or liposomes having a cholesterol backbone conjugated to polyethylene glycol.
  • a liposome comprises a compound capable of targeting the liposome to a particular cell type, such as a cell-specific ligand exposed on the outer surface of the liposome.
  • a liposome with a reagent such as an antisense oligonucleotide or ribozyme can be achieved using methods that are standard in the art (see, for example, U.S. Patent 5,705,151).
  • a reagent such as an antisense oligonucleotide or ribozyme
  • antibodies can be delivered to specific tissues in vivo using receptor-mediated targeted delivery.
  • Receptor-mediated DNA delivery techniques are taught in, for example, Findeis et al. Trends in Biotechnol. 11, 202-05 (1993); Chiou et al, GENE THERAPEUTICS: METHODS AND APPLICATIONS OF DIRECT GENE TRANSFER (J.A. Wolff, ed.) (1994); Wu & Wu, J. Biol. Chem. 263, 621-24 (1988); Wu et al, J. Biol. Chem. 269, 542-46 (1994); Zenke et al, Proc. Natl. Acad. Sci. U.S.A. 87, 3655-59 (1990); Wu et al, J. Biol. Chem. 266, 338-42 (1991).
  • a therapeutically effective dose refers to that amount of active ingredient which increases or decreases functional activity relative to the functional activity which occurs in the absence of the therapeutically effective dose.
  • the therapeutically effective dose can be estimated initially either in cell culture assays or in animal models, usually mice, rabbits, dogs, or pigs.
  • the animal model also can be used to determine the appropriate concentration range and route of administration. Such information can then be used to determine useful doses and routes for administration in humans.
  • Therapeutic efficacy and toxicity e.g., ED 50 (the dose therapeutically effective in
  • LD 50 the dose lethal to 50% of the population
  • the dose ratio of toxic to therapeutic effects is the therapeutic index, and it can be expressed as the ratio, LD 5 o/ED 50 .
  • compositions that exhibit large therapeutic indices are prefe ⁇ ed.
  • the data obtained from cell culture assays and animal studies is used in formulating a range of dosage for human use.
  • the dosage contained in such compositions is preferably within a range of circulating concentrations that include the ED 50 with little or no toxicity.
  • the dosage varies within this range depending upon the dosage form employed, sensitivity of the patient, and the route of administration. The exact dosage will be determined by the practitioner, in light of factors related to the subject that requires treatment. Dosage and administration are adjusted to provide sufficient levels of the active ingredient or to maintain the desired effect.
  • Factors that can be taken into account include the severity of the disease state, general health of the subject, age, weight, and gender of the subject, diet, time and frequency of administration, drug combination(s), reaction sensitivities, and tolerance/response to therapy.
  • Long-acting pharmaceutical compositions can be administered every 3 to 4 days, every week, or once every two weeks depending on the half-life and clearance rate of the particular formulation.
  • Normal dosage amounts can vary from 0.1 to 100,000 micrograms, up to a total dose of about 1 g, depending upon the route of administration.
  • Guidance as to particular dosages and methods of delivery is provided in the literature and generally available to practitioners in the art. Those skilled in the art will employ different formulations for nucleotides than for proteins or their inhibitors. Similarly, delivery of polynucleotides or polypeptides will be specific to particular cells, conditions, locations, etc.
  • polynucleotides encoding the antibody can be constructed and introduced into a cell either ex vivo or in vivo using well- established techniques including, but not limited to, transferrin-polycation-mediated DNA transfer, transfection with naked or encapsulated nucleic acids, liposome- mediated cellular fusion, intracellular transportation of DNA-coated latex beads, protoplast fusion, viral infection, electroporation, "gene gun,” and DEAE- or calcium phosphate-mediated transfection.
  • Effective in vivo dosages of an antibody are in the range of about 5 ⁇ g to about
  • effective in vivo dosages are in the range of about 100 ng to about 200 ng, 500 ng to about 50 mg, about 1 ⁇ g to about 2 mg, about 5 ⁇ g to about 500 ⁇ g, and about 20 ⁇ g to about 100 ⁇ g of DNA.
  • the reagent is preferably an antisense oligonucleotide or a ribozyme.
  • Polynucleotides that express antisense oligonucleotides or ribozymes can be introduced into cells by a variety of methods, as described above.
  • a reagent reduces expression of a human nexin-related serine protease inhibitor gene or the activity of a nexin-related serine protease inhibitor polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100%) relative to the absence of the reagent.
  • the effectiveness of the mechanism chosen to decrease the level of expression of a human nexin-related serine protease inhibitor gene or the activity of a human nexin-related serine protease inhibitor polypeptide can be assessed using methods well known in the art, such as hybridization of nucleotide probes to nexin-related serine protease inhibitor-specific mRNA, quantitative RT-PCR, immunologic detection of a human nexin-related serine protease inhibitor polypeptide, or measurement of functional activity.
  • any of the pharmaceutical compositions of the invention can be administered in combination with other appropriate therapeutic agents.
  • Selection of the appropriate agents for use in combination therapy can be made by one of ordinary skill in the art, according to conventional pharmaceutical principles.
  • the combination of therapeutic agents can act synergistically to effect the treatment or prevention of the various disorders described above. Using this approach, one may be able to achieve therapeutic efficacy with lower dosages of each agent, thus reducing the potential for adverse side effects.
  • any of the therapeutic methods described above can be applied to any subject in need of such therapy, including, for example, mammals such as dogs, cats, cows, horses, rabbits, monkeys, and most preferably, humans. Diagnostic methods
  • Human nexin-related serine protease inhibitor also can be used in diagnostic assays for detecting diseases and abnormalities or susceptibility to diseases and abnormalities related to the presence of mutations in the nucleic acid sequences that encode the protein. For example, differences can be determined between the cDNA or genomic sequence encoding nexin-related serine protease inhibitor in individuals afflicted with a disease and in normal individuals. If a mutation is observed in some or all of the afflicted individuals but not in normal individuals, then the mutation is likely to be the causative agent of the disease.
  • Sequence differences between a reference gene and a gene having mutations can be revealed by the direct DNA sequencing method.
  • cloned DNA segments can be employed as probes to detect specific DNA segments.
  • the sensitivity of this method is greatly enhanced when combined with PCR.
  • a sequencing primer can be used with a double-stranded PCR product or a single-stranded template molecule generated by a modified PCR.
  • the sequence determination is performed by conventional procedures using radiolabeled nucleotides or by automatic sequencing procedures using fluorescent tags.
  • DNA sequence differences can be carried out by detection of alteration in electrophoretic mobility of DNA fragments in gels with or without denaturing agents. Small sequence deletions and insertions can be visualized, for example, by high resolution gel electrophoresis. DNA fragments of different sequences can be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific melting or partial melting temperatures (see, e.g., Myers et al., Science 230, 1242, 1985). Sequence changes at specific locations can also be revealed by nuclease protection assays, such as RNase and S 1 protection or the chemical cleavage method (e.g., Cotton et al, Proc. Natl.
  • the detection of a specific DNA sequence can be performed by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes and Southern blotting of genomic DNA.
  • direct methods such as gel-electrophoresis and DNA sequencing, mutations can also be detected by in situ analysis.
  • Altered levels of nexin-related serine protease inhibitor also can be detected in various tissues.
  • Assays used to detect levels of the receptor polypeptides in a body sample, such as blood or a tissue biopsy, derived from a host are well known to those of skill in the art and include radioimmunoassays, competitive binding assays,
  • the polynucleotide of SEQ ID NO: 1 is inserted into the expression vector pCEV4 and the expression vector pCEV4-nexin-related serine protease inhibitor polypeptide obtained is transfected into human embryonic kidney 293 cells. From these cells extracts are obtained and thrombin inhibition is measured. The cell extracts are homogenized in thrombin dilution buffer. The homogenates (0.8 ⁇ g of cell extract in 80 ⁇ l) are mixed with 10 ⁇ l human alpha-thrombin (1 nM in 67 mM Tris> pH 8.0,
  • polypeptide of SEQ TD NO: 2 has a nexin-related serine protease inhibitor activity.
  • Pichia pastoris expression vector pPICZB (Invitrogen, San Diego, CA) is used to produce large quantities of recombinant human nexin-related serine protease inhibitor polypeptides in yeast.
  • DNA sequence is derived from SEQ ID NO: 1.
  • the DNA sequence is modified by well known methods in such a way that it contains at its 5 '-end an initiation codon and at its 3 '-end an enterokinase cleavage site, a His6 reporter tag and a termination codon.
  • the modified DNA sequence is ligated into pPICZB.
  • This expression vector is designed for inducible expression in Pichia pastoris, driven by a yeast promoter. The resulting pPICZ/md-His6 vector is used to transform the yeast.
  • the yeast is cultivated under usual conditions in 5 liter shake flasks and the recombinantly produced protein isolated from the culture by affinity chromatography (Ni-NTA-Resin) in the presence of 8 M urea.
  • the bound polypeptide is eluted with buffer, pH 3.5, and neutralized. Separation of the polypeptide from the His6 reporter tag is accomplished by site-specific proteolysis using enterokinase (Invitrogen, San Diego, CA) according to manufacturer's instructions. Purified human nexin-related serine protease inhibitor polypeptide is obtained.
  • Purified nexin-related serine protease inhibitor polypeptides comprising a glutatbione-S-transferase protein and absorbed onto glutatliione-derivatized wells of 96-well microtiter plates are contacted with test compounds from a small molecule library at pH 7.0 in a physiological buffer solution.
  • Human nexin-related serine protease inhibitor polypeptides comprise the amino acid sequence shown in SEQ ID NO: 2.
  • the test compounds comprise a fluorescent tag. The samples are incubated for 5 minutes to one hour. Control samples are incubated in the absence of a test compound.
  • the buffer solution containing the test compounds is washed from the wells. Binding of a test compound to a human nexin-related serine protease inhibitor polypeptide is detected by fluorescence measurements of the contents of the wells.
  • a test compound that increases the fluorescence in a well by at least 15% relative to fluorescence of a well in which a test compound is not incubated is identified as a compound which binds to a human nexin-related serine protease inhibitor polypeptide.
  • test compound is administered to a culture of human cells transfected with a nexin- related serine protease inhibitor expression construct and incubated at 37°C for 10 to
  • a culture of the same type of cells that have not been transfected is incubated for the same time without the test compound to provide a negative control.
  • RNA is isolated from the two cultures as described in Chirgwin et al, Biochem. 18, 5294-99, 1979).
  • Northern blots are prepared using 20 to 30 ⁇ g total RNA and hybridized with a 32 P-labeled nexin-related serine protease inhibitor-specific probe at 65°C in Express-hyb (CLONTECH).
  • the probe comprises at least 11 contiguous nucleotides selected from the complement of SEQ ID NO: 1.
  • a test compound that decreases the nexin-related serine protease inhibitor-specific signal relative to the signal obtained in the absence of the test compound is identified as an inhibitor of nexin-related serine protease inhibitor gene expression.
  • test compound is administered to a culture of human cells transfected with a nexin- related serine protease inhibitor expression construct and incubated at 37°C for 10 to 45 minutes.
  • a culture of the same type of cells that have not been transfected is . incubated for the same time without the test compound to provide a negative control.
  • Functional activity is measured using the method of U.S. Patent 6,197,519.
  • test compound which decreases the functional activity of the nexin-related serine protease inhibitor relative to the functional activity in the absence of the test compound is identified as an inhibitor of nexin-related serine protease inhibitor activity.
  • RT-PCR Reverse Transcription-Polymerase Chain Reaction
  • nexin-related serine protease inhibitor is involved in cancer
  • expression is determined in the following tissues: adrenal gland, bone ma ⁇ ow, brain, cerebellum, colon, fetal brain, fetal liver, heart, kidney, liver, lung, mammary gland, pancreas, placenta, prostate, salivary gland, skeletal muscle, small intestine, spinal cord, spleen, stomach, testis, thymus, thyroid, trachea, uterus, and peripheral blood lymphocytes.
  • Expression in the following cancer cell lines also is determined: DU- 145 (prostate), NCI-H125 (lung), HT-29 (colon), COLO-205 (colon), A-549 (lung),
  • NCI-H460 (lung), HT-116 (colon), DLD-1 (colon), MDA-MD-231 (breast), LS174T (colon), ZF-75 (breast), MDA-MN-435 (breast), HT-1080, MCF-7 (breast), and U87. Matched pairs of malignant and normal tissue from the same patient also are tested.
  • nexin-related serine protease inhibitor is involved in CNS . disorders, the following tissues are screened: fetal and adult brain, muscle, heart, lung, kidney, liver, thymus, testis, colon, placenta, trachea, pancreas, kidney, gastric mucosa, colon, liver, cerebellum, skin, cortex (Alzheimer's and normal), hypo- thalamus, cortex, amygdala, cerebellum, hippocampus, choroid, plexus, thalamus, and spinal cord.
  • nexin-related serine protease inhibitor is involved in the disease process of asthma
  • the following whole body panel is screened to show predominant or relatively high expression in lung or immune tissues: brain, heart, kidney, liver, lung, trachea, bone ma ⁇ ow, colon, small intestine, spleen, stomach, thymus, mammary gland, skeletal muscle, prostate, testis, uterus, cerebellum, fetal brain, fetal liver, spinal cord, placenta, adrenal gland, pancreas, salivary gland, thyroid, peripheral blood leukocytes, lymph node, and tonsil.
  • lung and immune system cells are screened to localize expression to particular cell subsets: lung microvascular endothelial cells, bronchial/tracheal epithelial cells, bronchial/tracheal smooth muscle cells, lung fibroblasts, T cells (T helper 1 subset, T helper 2 subset, NKT cell subset, and cytotoxic T lymphocytes), B cells, mononuclear cells (monocytes and macrophages), mast cells, eosinophils, neutrophils, and dendritic cells.
  • T cells T helper 1 subset, T helper 2 subset, NKT cell subset, and cytotoxic T lymphocytes
  • B cells mononuclear cells (monocytes and macrophages)
  • mast cells eosinophils, neutrophils, and dendritic cells.
  • the initial expression panel consists of RNA samples from respiratory tissues and inflammatory cells relevant to COPD: lung (adult and fetal), trachea, freshly isolated alveolar type II cells, cultured human bronchial epithelial cells, cultured small airway epithelial cells, cultured bronchial sooth muscle cells, cultured H441 cells (Clara-like), freshly isolated neutrophils and monocytes, and cultured monocytes (macrophage-like).
  • Body map profiling also is carried out, using total RNA panels purchased from Clontech.
  • the tissues are adrenal gland, bone ma ⁇ ow, brain, colon, heart, kidney, liver, lung, mammary gland, pancreas, prostate, salivary gland, skeletal muscle, small intestine, spleen, stomach, testis, thymus, trachea, thyroid, and uterus.
  • Quantitative expression profiling is performed by the form of quantitative PCR analysis called "kinetic analysis” firstly described in Higuchi et al, BioTechnology
  • the probe is cleaved by the 5 '-3' endonuclease activity of Taq DNA polymerase and a fluorescent dye released in the medium (Holland et al, Proc. Natl. Acad. Sci. U.S.A. 88, 7276-80, 1991). Because the fluorescence emission will increase in direct proportion to the amount of the specific amplified product, the exponential growth phase of PCR product can be detected and used to determine the initial template concentration (Heid et al, Genome Res. 6, 986-94, 1996, and Gibson et al, Genome Res. 6, 995-1001, 1996).
  • the amplification of an endogenous control can be performed to standardize the amount of sample RNA added to a reaction.
  • the control of choice is the 18S ribosomal RNA. Because reporter dyes with differing emission spectra are available, the target and the endogenous control can be independently quantified in the same tube if probes labeled with different dyes are used. All "real time PCR" measurements of fluorescence are made in the ABI Prism 7700.
  • RNA extraction and cDNA preparation Total RNA from the tissues listed above are used for expression quantification. RNAs labeled "from autopsy" were extracted from autoptic tissues with the TRIzol reagent (Life Technologies, MD) according to the manufacturer' s protocol. Fifty ⁇ g of each RNA were treated with DNase I for 1 hour at 37°C in the following reaction mix: 0.2 U/ ⁇ l RNase-free DNase I (Roche Diagnostics, Germany); 0.4 U/ ⁇ l RNase inhibitor (PE Applied Biosystems, CA); 10 mM Tris-HCl pH 7.9; lOmM MgCl 2 ; 50 mM NaCl; and 1 mM DTT.
  • RNA is extracted once with 1 volume of phenol:chloroform:isoamyl alcohol (24:24:1) and once with chloroform, and precipitated with 1/10 volume of 3 M sodium acetate, pH5.2, and 2 volumes of ethanol.
  • RNA from the autoptic tissues Fifty ⁇ g of each RNA from the autoptic tissues are DNase treated with the DNA-free kit purchased from. Ambion (Ambion, TX). After resuspension and spectro- photometric quantification, each sample is reverse transcribed with the TaqMan Reverse Transcription Reagents (PE Applied Biosystems, CA) according to the manufacturer's protocol. The final concentration of RNA in the reaction mix is 200 ng/ ⁇ L. Reverse transcription is carried out with 2.5 ⁇ M of random hexamer primers.
  • TaqMan quantitative analysis Specific primers and probe are designed according to the recommendations of PE Applied Biosystems; the probe can be labeled at the 5' end FAM (6-carboxy-fluorescein) and at the 3' end with TAMRA (6-carboxy- tetramethyl-rhodamine). Quantification experiments are performed on 10 ng of reverse transcribed RNA from each sample. Each determination is done in triplicate.
  • FAM 6-carboxy-fluorescein
  • TAMRA 6-carboxy- tetramethyl-rhodamine
  • Total cDNA content is normalized with the simultaneous quantification (multiplex PCR) of the 18S ribosomal RNA using the Pre-Developed TaqMan Assay Reagents
  • the assay reaction mix is as follows: IX final TaqMan Universal PCR Master Mix (from 2X stock) (PE Applied Biosystems, CA); IX PDAR control - 18S RNA (from 20X stock); 300 nM forward primer; 900 nM reverse primer; 200 nM probe; 10 ng cDNA; and water to 25 ⁇ l.
  • IX final TaqMan Universal PCR Master Mix from 2X stock
  • PE Applied Biosystems, CA PE Applied Biosystems, CA
  • IX PDAR control - 18S RNA from 20X stock
  • 300 nM forward primer from 900 nM reverse primer
  • 200 nM probe 10 ng cDNA
  • water water to 25 ⁇ l.
  • Each of the following steps are carried out once: pre PCR, 2 minutes at 50° C, and 10 minutes at 95°C.
  • the following steps are carried out 40 times: denaturation, 15 seconds at 95°C, annealing/extension, 1 minute at 60°C.
  • the experiment is performed on an ABI Prism 7700 Sequence Detector (PE Applied Biosystems, CA).
  • fluorescence data acquired during PCR are processed as described in the ABI Prism 7700 user's manual in order to achieve better background subtraction as well as signal linearity with the starting target quantity.
  • the cell line used for testing is the human colon cancer cell line HCT116.
  • Cells are cultured in RPMI-1640 with 10-15% fetal calf serum at a concentration of 10,000 cells per milliliter in a volume of 0.5 ml and kept at 37°C in a 95% air/5%CO atmosphere.
  • Phosphorothioate oligoribonucleotides are synthesized on an Applied Biosystems Model 380B DNA synthesizer using phosphoroamidite chemistry. A sequence of 24 bases complementary to the nucleotides at position 1 to 24 of SEQ ID NO: 1 is used as the test oligonucleotide. As a control, another (random) sequence is used: 5'-TCA
  • oligonucleotides are ethanol-precipitated twice, dried, and suspended in phosphate buffered saline at the desired concentration. Purity of the oligonucleotides is tested by capillary gel electrophoresis and ion exchange HPLC. The purified oligonucleo- tides are added to the culture medium at a concentration of 10 ⁇ M once per day for seven days. The addition of the test oligonucleotide for seven days results in significantly reduced expression of human nexin-related serine protease inhibitor as determined by Western blotting. This effect is not observed with the control oligonucleotide.
  • the number of cells in the cultures is counted using an automatic cell counter.
  • the number of cells in cultures treated with the test oligonucleotide (expressed as 100%o) is compared with the number of cells in cultures treated with the control oligonucleotide.
  • the number of cells in cultures treated with the test oligonucleotide is not more than 30%) of control, indicating that the inhibition of human nexin-related serine protease inhibitor has an anti-pro liferative effect on cancer cells.
  • This non-tumor assay measures the ability of a compound to reduce either the endogenous level of a circulating hormone or the level of hormone produced in response to a biologic stimulus.
  • Rodents are administered test compound (p.o., i.p., i.v., i.m., or s.c).
  • test compound p.o., i.p., i.v., i.m., or s.c.
  • Plasma is assayed for levels of the hormone of interest. If the normal circulating levels of the hormone are too low and/or variable to provide consistent results, the level of the hormone may be elevated by a pre-treatment with a biologic stimulus (i.e., LHRH may be injected i.m.
  • a biologic stimulus i.e., LHRH may be injected i.m.
  • Hollow fibers are prepared with desired cell line(s) and implanted intraperitoneally and/or subcutaneously in rodents. Compounds are administered p.o., i.p., i.v., i.m., or s.c. Fibers are harvested in accordance with specific readout assay protocol, these may include assays for gene expression (bDNA, PCR, or Taqman), or a specific biochemical activity (i.e., cAMP levels. Results are analyzed by Student's t-test or
  • Rodents are administered test compound (p.o., i.p., i.v., i.m., or s.c.) according to a predetermined schedule and for a predetermined duration (i.e., 1 week).
  • animals are weighed, the target organ is excised, any fluid is expressed, and the weight of the organ is recorded.
  • Blood plasma may also be collected. Plasma may be assayed for levels of a hormone of interest or for levels of test agent.
  • Organ weights may be directly compared or they may be normalized for the body weight of the animal. Compound effects are compared to a vehicle-treated control group. An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-test. Significance is p value ⁇ 0.05 compared to the vehicle control group. Hollow Fiber Proliferation Assay
  • Hollow fibers are prepared with desired cell line(s) and implanted intraperitoneally and/or subcutaneously in rodents. Compounds are administered p.o., i.p., i.v., i.m., or s.c. Fibers are harvested in accordance with specific readout assay protocol.
  • Cell proliferation is determined by measuring a marker of cell number (i.e., MTT or LDH). The cell number and change in cell number from the starting inoculum are analyzed by Student's t-test or Rank Sum test after the variance between groups is compared by an F-test, with significance at p ⁇ 0.05 as compared to the vehicle control group.
  • Hydron pellets with or without growth factors or cells are implanted into a micropocket surgically created in the rodent cornea.
  • Compound administration may be systemic or local (compound mixed with growth factors in the hydron pellet).
  • Corneas are harvested at 7 days post implantation immediately following intracardiac infusion of colloidal carbon and are fixed in 10%> formalin. Readout is qualitative scoring and/or image analysis. Qualitative scores are compared by Rank Sum test. Image analysis data is evaluated by measuring the area of neovascularization (in pixels) and group averages are compared by Student's t-test (2 tail). Significance is p ⁇ 0.05 as compared to the growth factor or cells only group.
  • Matrigel containing cells or growth factors, is injected subcutaneously. Compounds are administered p.o., i.p., i.v., i.m., or s.c. Matrigel plugs are harvested at predetermined time point(s) and prepared for readout. Readout is an ELISA-based assay for hemoglobin concentration and/or histological examination (i.e. vessel count, special staining for endothelial surface markers: CD31, factor-8). Readouts are analyzed by Student's t-test, after the variance between groups is compared by an F-test, with significance determined at p ⁇ 0.05 as compared to the vehicle control group.
  • Tumor cells or fragments are implanted subcutaneously on Day 0. Nehicle and/or compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule starting at a time, usually on Day 1, prior to the ability to measure the tumor burden. Body weights and tumor measurements are recorded 2-3 times weekly.
  • Anti- tumor efficacy may be initially determined by comparing the size of treated (T) and control (C) tumors on a given day by a Student's t-test, after the variance between groups is compared by an F-test, with significance determined at p ⁇ 0.05. The experiment may also be continued past the end of dosing in which case tumor measurements would continue to be recorded to monitor tumor growth delay.
  • Tumor growth delays are expressed as the difference in the median time for the treated and control groups to attain a predetermined size divided by the median time for the control group to attain that size. Growth delays are compared by generating Kaplan- Meier curves from the times for individual tumors to attain the evaluation size.
  • Tumor cells are injected intraperitoneally or intracranially on Day 0.
  • Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule starting on Day 1. Observations of morbidity and/or mortality are recorded twice daily. Body weights are measured and recorded twice weekly. Morbidity/mortality data is expressed in terms of the median time of survival and the number of long- term survivors is indicated separately. Survival times are used to generate Kaplan- Meier curves. Significance is p ⁇ 0.05 by a log-rank test compared to the control group in the experiment.
  • Tumor cells or fragments are implanted subcutaneously and grown to the desired size for treatment to begin. Once at the predetermined size range, mice are randomized into treatment groups. Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule. Tumor and body weights are measured and recorded 2-3 times weekly. Mean tumor weights of all groups over days post inoculation are graphed for comparison. An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-test to compare tumor sizes in the treated and control groups at the end of treatment. Significance is p ⁇ 0.05 as compared to the control group.
  • Tumor measurements may be recorded after dosing has stopped to monitor tumor growth delay.
  • Tumor growth delays are expressed as the difference in the median time for the treated and control groups to attain a predetermined size divided by the median time for the control group to attain that size. Growth delays are compared by generating Kaplan-Meier curves from the times for individual tumors to attain the evaluation size. Significance is p value ⁇ _0.05 compared to the vehicle control group.
  • Tumor cells or fragments, of mammary adenocarcinoma origin are implanted directly into a surgically exposed and reflected mammary fat pad in rodents. The fat pad is placed back in its original position and the surgical site is closed. Hormones may also be administered to the rodents to support the growth of the tumors. Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule. Tumor and body weights are measured and recorded 2-3 times weekly. Mean tumor weights of all groups over days post inoculation are graphed for comparison. An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-test to compare tumor sizes in the treated and control groups at the end of treatment. Significance is p ⁇ 0.05 as compared to the control group.
  • Tumor measurements may be recorded after dosing has stopped to momtor tumor growth delay.
  • Tumor growth delays are expressed as the difference in the median time for the treated and control groups to attain a predetermined size divided by the median time for the control group to attain that size. Growth delays are compared by generating Kaplan-Meier curves from the times for individual tumors to attain the evaluation size. Significance is p value ⁇ 0.05 compared to the vehicle control group.
  • this model provides an opportunity to increase the rate of spontaneous metastasis of this type of tumor. Metastasis can be assessed at termination of the study by counting the number of visible foci per target organ, or measuring the target organ weight. The means of these endpoints are compared by Student's t-test after conducting an F-test, with significance determined at p ⁇ 0.05 compared to the control group in the experiment.
  • Tumor cells or fragments, of prostatic adenocarcinoma origin are implanted directly into a surgically exposed dorsal lobe of the prostate in rodents.
  • the prostate is externalized through an abdominal incision so that the tumor can be implanted specifically in the dorsal lobe while verifying that the implant does not enter the seminal vesicles.
  • the successfully inoculated prostate is replaced in the abdomen and the incisions through the abdomen and skin are closed.
  • Hormones may also be administered to the rodents to support the growth of the tumors.
  • Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule.
  • Body weights are measured and recorded 2-3 times weekly. At a predetermined time, the experiment is terminated and the animal is dissected.
  • the size of the primary tumor is measured in three dimensions using either a caliper or an ocular micrometer attached to a dissecting scope.
  • An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-test to compare tumor sizes in the treated and control groups at the end of treatment. Significance is p ⁇ 0.05 as compared to the control group. This model provides an opportunity to increase the rate of spontaneous metastasis of this type of tumor.
  • Metastasis can be assessed at termination of the study by counting the number of visible foci per target organ (i.e., the lungs), or measuring the target organ weight (i.e., the regional lymph nodes). The means of these endpoints are compared by Student's t-test after conducting an F-test, with significance determined at p ⁇ 0.05 compared to the control group in the experiment.
  • Tumor cells of pulmonary origin may be implanted intrabronchially by making an incision through the skin and exposing the trachea.
  • the trachea is pierced with the beveled end of a 25 gauge needle and the tumor cells are inoculated into the main bronchus using a flat-ended 27 gauge needle with a 90° bend.
  • Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule. Body weights are measured and recorded 2-3 times weekly. At a predetermined time, the experiment is terminated and the animal is dissected.
  • the size of the primary tumor is measured in three dimensions using either a caliper or an ocular micrometer attached to a dissecting scope.
  • An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-test to compare tumor sizes in the treated and control groups at the end of treatment. Significance is p ⁇ 0.05 as compared to the control group.
  • This model provides an opportumty to increase the rate of spontaneous metastasis of this type of tumor. Metastasis can be assessed at termination of the study by counting the number of visible foci per target organ (i.e., the contralateral lung), or measuring the target organ weight. The means of these endpoints are compared by Student's t-test after conducting an F-test, with significance determined at p ⁇ 0.05 compared to the control group in the experiment.
  • Tumor cells of gastrointestinal origin may be implanted intracecally by making an abdominal incision through the skin and externalizing the intestine. Tumor cells are inoculated into the cecal wall without penetrating the lumen of the intestine using a
  • Metastasis can be assessed at termination of the study by counting the number of visible foci per target organ (i.e., the liver), or measuring the target organ weight. The means of these endpoints are compared by Student's t-test after conducting an F-test, with significance determined at p ⁇ 0.05 compared to the control group in the experiment.
  • Tumor cells are inoculated s.c. and the tumors allowed to grow to a predetermined range for spontaneous metastasis studies to the lung or liver. These primary tumors are then excised. Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule which may include the period leading up to the excision of the primary tumor to evaluate therapies directed at inhibiting the early stages of tumor metastasis. Observations of morbidity and/or mortality are recorded daily. Body weights are measured and recorded twice weekly. Potential endpoints include survival time, numbers of visible foci per target organ, or target organ weight. When survival time is used as the endpoint the other values are not determined.
  • Survival data is used to generate Kaplan-Meier curves. Significance is p ⁇ 0.05 by a log-rank test compared to the control group in the experiment. The mean number of visible tumor foci, as determined under a dissecting microscope, and the mean target organ weights are compared by Student's t-test after conducting an F-test, with significance determined at p ⁇ 0.05 compared to the control group in the experiment for both of these endpoints.
  • Tumor cells are injected into the tail vein, portal vein, or the left ventricle of the heart in experimental (forced) lung, liver, and bone metastasis studies, respectively.
  • Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule. Observations of morbidity and/or mortality are recorded daily. Body weights are measured and recorded twice weekly. Potential endpoints mclude survival time, numbers of visible foci per target organ, or target organ weight. When survival time is used as the endpoint the other values are not determined. Survival data is used to generate Kaplan-Meier curves.
  • Acute pain is measured on a hot plate mainly in rats.
  • Two variants of hot plate testing are used: In the classical variant animals are put on a hot surface (52 to 56°C) and the latency time is measured until the animals show nocifensive behavior, such as stepping or foot licking.
  • the other variant is an increasing temperature hot plate where the experimental animals are put on a surface of neutral temperature. Subsequently this surface is slowly but constantly heated until the animals begin to lick a bind paw. The temperature which is reached when hind paw licking begins is a measure for pain threshold.
  • Compounds are tested against a vehicle treated control group. Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i. , i.c.v., s.c, intradermal, transdermal) prior to pain testing.
  • application routes i.v., i.p., p.o., i. , i.c.v., s.c, intradermal, transdermal
  • Persistent pain is measured with the formalin or capsaicin test, mainly in rats. A solution of 1 to 5% formalin or 10 to 100 ⁇ g capsaicin is injected into one hind paw of the experimental animal. After formalin or capsaicin application the animals show nocifensive reactions like flinching, licking and biting of the affected paw. The number of nocifensive reactions within a time frame of up to 90 minutes is a measure for intensity of pain.
  • Compounds are tested against a vehicle treated control group. Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t., i.c.v., s.c, intradermal, transdermal) prior to formalin or capsaicin administration.
  • Neuropathic pain is induced by different variants of unilateral sciatic nerve injury mainly in rats. The operation is performed under anesthesia. The first variant of sciatic nerve injury is produced by placing loosely constrictive ligatures around the common sciatic nerve. The second variant is the tight ligation of about the half of the diameter of the common sciatic nerve.
  • the fourth variant involves an axotomy of two of the three terminal branches of the sciatic nerve (tibial and common peroneal nerves) leaving the remaining sural nerve intact whereas the last variant comprises the axotomy of only the tibial branch leaving the sural and common nerves uninjured. Control animals are treated with a sham operation.
  • the nerve injured animals develop a chronic mechanical allodynia, cold allodynioa, as well as a thermal hyperalgesia.
  • Mechanical allodynia is measured by means of a pressure transducer (electronic von Frey Anesthesiometer, IITC
  • Thermal hyperalgesia is measured by means of a radiant heat source (Plantar Test, Ugo Basile, Comerio, Italy), or by. means of a cold plate of 5 to 10°C where the nocifensive reactions of the affected hind paw are counted as a measure of pain intensity.
  • a further test for cold induced pain is the counting of nocifensive reactions, or duration of nocifensive responses after plantar administration of acetone to the affected hind limb.
  • Inflammatory Pain Inflammatory pain is induced mainly in rats by injection of 0.75 mg ca ⁇ ageenan or complete Freund's adjuvant into one hind paw. The animals develop an edema with mechanical allodynia as well as thermal hyperalgesia. Mechanical allodynia is measured by means of a pressure transducer (electronic von Frey Anesthesiometer, IITC Lnc-Life Science Instruments, Woodland Hills, SA,
  • Thermal hyperalgesia is measured by means of a radiant heat source (Plantar Test, Ugo Basile, Comerio, Italy, Paw thermal stimulator, G. Ozaki, University of California, USA).
  • Plant Test Ugo Basile, Comerio, Italy
  • Paw thermal stimulator G. Ozaki, University of California, USA
  • edema measurement two methods are being used. In the first method, the animals are sacrificed and the affected hindpaws sectioned and weighed. The second method comprises differences in paw volume by measuring water displacement in a plethysmometer (Ugo Basile, Comerio, Italy).
  • Compounds are tested against uninflamed as well as vehicle treated control groups. Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t., i.c.v., s.c, intradermal, transdermal) prior to pain testing.
  • application routes i.v., i.p., p.o., i.t., i.c.v., s.c, intradermal, transdermal
  • Compounds are tested against diabetic and non-diabetic vehicle treated control groups. Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t., i.c.v., s.c, intradermal, transde ⁇ nal) prior to pain testing.
  • application routes i.v., i.p., p.o., i.t., i.c.v., s.c, intradermal, transde ⁇ nal
  • 6-Hydroxydopamine (6-OH-DA) Lesion. Degeneration of the dopaminergic nigrostriatal and striatopallidal pathways is the cenfral pathological event in Parkinson's disease. This disorder has been mimicked experimentally in rats using single/sequential unilateral stereotaxic injections of 6-OH-DA into the medium forebrain bundle (MFB).
  • MFB medium forebrain bundle
  • mice Male Wistar rats (Harlan Winkelmann, Germany), weighing 200 ⁇ 250 g at the beginning of the experiment, are used. The rats are maintained in a temperature- and humidity-controlled environment under a 12 h light/dark cycle with free access to food and water when not in experimental sessions. The following in vivo protocols are approved by the governmental authorities. All efforts are made to minimize animal suffering, to reduce the number of animals used, and to utilize alternatives to in vivo techniques.
  • Animals are administered pargyline on the day of surgery (Sigma, St. Louis, MO, USA; 50 mg/kg i.p.) in order to inhibit metabolism of 6-OHDA by monoamine oxidase and desmethylimipramine HC1 (Sigma; 25 mg/kg i.p.) in order to prevent uptake of 6-OHDA by noradrenergic terminals. Thirty minutes later the rats are anesthetized with sodium pentobarbital (50 mg/kg) and placed in a stereotaxic frame.
  • Stepping Test Forelimb akinesia is assessed three weeks following lesion placement using a modified stepping test protocol.
  • the animals are held by the experimenter with one hand fixing the hindlimbs and slightly raising the hind part above the surface.
  • One paw is touching the table, and is then moved slowly sideways (5 s for 1 m), first in the forehand and then in the backhand direction.
  • the number of adjusting steps is counted for both paws in the backhand and forehand direction of movement.
  • the sequence of testing is right paw forehand and backhand adjusting stepping, followed by left paw forehand and backhand directions.
  • the test is repeated three times on three consecutive days, after an initial training period of three days prior to the first testing.
  • Forehand adjusted stepping reveals no consistent differences between lesioned and healthy control animals. Analysis is therefore restricted to backhand adjusted stepping.
  • Balance Test Balance adjustments following postural challenge are also measured during the stepping test sessions.
  • the rats are held in the same position as described in the stepping test and, instead of being moved sideways, tilted by the experimenter towards the side of the paw toucliing the table. This maneuver results in loss of balance and the ability of the rats to regain balance by forelimb movements is scored on a scale ranging from 0 to 3. Score 0 is given for a normal forelimb placement. When the forelimb movement is delayed but recovery of postural balance detected, score 1 is given. Score 2 represents a clear, yet insufficient, forelimb reaction, as evidenced by muscle contraction, but lack of success in recovering balance, and score 3 is given for no reaction of movement. The test is repeated three times a day on each side for three consecutive days after an initial training period of three days prior to the first testing.
  • Staircase Test (Paw Reaching).
  • a modified version of the staircase test is used for evaluation of paw reaching behavior three weeks following primary and secondary lesion placement.
  • Plexiglass test boxes with a central platform and a removable staircase on each side are used.
  • the apparatus is designed such that only the paw on the same side at each staircase can be used, thus providing a measure of independent forelimb use.
  • For each test the animals are left in the test boxes for 15 min.
  • the double staircase is filled with 7 x 3 chow pellets (Precision food pellets, formula: P, purified rodent diet, size 45 mg; Sandown Scientific) on each side.
  • MPTP leads to a marked decrease in the levels of dopamine and its metabolites, and in the number of dopaminergic terminals in the striatum as well as severe loss of the tyrosine hydroxylase (TH)-immunoreactive cell bodies in the substantia nigra, pars compacta.
  • TH tyrosine hydroxylase
  • mice are perfused transcardially with 0.01 M PBS (pH 7.4) for 2 min, followed by 4% paraformaldehyde (Merck) in PBS for 15 min.
  • PBS pH 7.4
  • PBS paraformaldehyde
  • TH free-floating tyrosine hydroxylase
  • Sections are mounted on to gelatin-coated slides, left to dry overnight, counter- stained with hematoxylin dehydrated in ascending alcohol concentrations and cleared in butylacetate. Coverslips are mounted on entellan.
  • Labandeira-Garcia (1997), with a CR-1 Rotamex system (Columbus Instruments, Columbus, OH) comprising an IBM-compatible personal computer, a CIO-24 data acquisition card, a control unit, and a four-lane rotarod unit.
  • the rotarod unit consists of a rotating spindle (diameter 7.3 cm) and individual compartments for each mouse.
  • the system software allows preprogramming of session protocols with varying rotational speeds (0-80 rpm). Infrared beams are used to detect when a mouse has fallen onto the base grid beneath the rotarod.
  • the system logs the fall as the end of the experiment for that mouse, and the total time on the rotarod, as well as the time of the fall and all the set-up parameters, are recorded.
  • the system also allows a weak cu ⁇ ent to be passed through the base grid, to aid training.
  • the object recognition task has been designed to assess the effects of experimental manipulations on the cognitive performance of rodents.
  • a rat is placed in an open field, in which two identical objects are present.
  • the rats inspects both objects during the first trial of the object recognition task.
  • a second trial after a retention interval of for example 24 hours, one of the two objects used in the first trial, the 'familiar' object, and a novel object are placed in the open field.
  • the inspection time at each of the objects is registered.
  • the basic measures in the OR task is the time spent by a rat exploring the two object the second trial. Good retention is reflected by higher exploration times towards the novel than the 'familiar' object.
  • Administration of the putative cognition enhancer prior to the first trial pre- dominantly allows assessment ⁇ of the effects on acquisition, and eventually on consolidation processes.
  • Administration of the testing compound after the first trial allows to assess the effects on consolidation processes, whereas administration before the second trial allows to measure effects on retrieval processes.
  • the passive avoidance task assesses memory performance in rats and mice.
  • the inhibitory avoidance apparatus consists of a two-compartment box with a light compartment and a dark compartment. The two compartments are separated by a guillotine door that can be operated by the experimenter. A threshold of 2 cm separates the two compartments when the guillotine door is raised. When the door is open, the illumination in the dark compartment is about 2 lux. The light intensity is about 500 lux at the center of the floor of the light compartment.
  • Two habituation sessions, one shock session, and a retention session are given, separated by inter-session intervals of 24 hours.
  • the rat In the habituation sessions and the retention session the rat is allowed to explore the apparatus for 300 sec. The rat is placed in the light compartment, facing the wall opposite to the guillotine door. After an accommodation period of 15 sec. the guillotine door is opened so that all parts of the apparatus can be visited freely. Rats normally avoid brightly lit areas and will enter the dark compartment within a few seconds.
  • the shock session the guillotine door between the compartments is lowered as soon as the rat has entered the dark compartment with its four paws, and a scrambled 1 mA footshock is administered for 2 sec. The rat is removed from the apparatus and put back into its home cage. The procedure during the retention session is identical to that of the habituation sessions.
  • the step-through latency that is the first latency of entering the dark compartment (in sec.) during the retention session is an index of the memory performance of the animal; the longer the latency to enter the dark compartment, the better the retention is.
  • the Morris water escape task measures spatial orientation learning in rodents. It is a test system that has extensively been used to investigate the effects of putative therapeutic on the cognitive functions of rats and mice.
  • the performance of an animal is assessed in a circular water tank with an escape platform that is submerged about 1 cm below the surface of the water. The escape platform is not visible for an animal swimming in the water tank.
  • Abundant extra-maze cues are provided by the furniture in the room, including desks, computer equipment, a second water tank, the presence of the experimenter, and by a radio on a shelf that is playing softly.
  • the animals receive four trials during five daily acquisition sessions.
  • a trial is started by placing an animal into the pool, facing the wall of the tank. Each of four starting positions in the quadrants north, east, south, and west is used once in a series of four trials; their order is randomized.
  • the escape platform is always in the same position.
  • a trial is terminated as soon as the animal had climbs onto the escape platform or when 90 seconds have elapsed, whichever event occurs first. The animal is allowed to stay on the platform for 30 seconds. Then it is taken from the platform and the next trial is started. If an animal did not find the platform within 90 seconds it is put on the platform by the experimenter and is allowed to stay there for 30 seconds.
  • an additional trial is given as a probe trial: the platform is removed, and the time the animal spends in the four quadrants is measured for 30 or 60 seconds.
  • the probe trial all animals start from the same start position, opposite to the quadrant where the escape platform had been positioned during acquisition.
  • rats or mice with specific brain lesions which impair cognitive functions, or animals treated with compounds such as scopolamine or MK-801, which interfere with normal learning, or aged animals which suffer from cognitive deficits, are used.
  • the T-maze spontaneous alternation task assesses the spatial memory performance in mice.
  • the start arm and the two goal arms of the T-maze are provided with guillotine doors which can be operated manually by the experimenter.
  • a mouse is put into the start arm at the beginning of training.
  • the guillotine door is closed.
  • the 'forced trial' either the left or right goal arm is blocked by lowering the guillotine door.
  • the mouse After the mouse has been released from the start arm, it will negotiate the maze, eventually enter the open goal arm, and return to the start position, where it will be confined for 5 seconds, by lowering the guillotine door.
  • the animal can choose freely between the left and right goal arm (all guillotine-doors opened) during 14 'free choice' trials. As soon a the mouse has entered one goal arm, the other one is closed. The mouse eventually returns to the start arm and is free to visit whichever go alarm it wants after having been confined to the start arm for 5 seconds. After completion of 14 free choice trials in one session, the animal is removed from the maze. During training, the animal is never handled.
  • the percent alternations out of 14 trials is calculated. This percentage and the total time needed to complete the first forced trial and the subsequent 14 free choice trials
  • Cognitive deficits are usually induced by an injection of scopolamine, 30 min before the start of the training session. Scopolamine reduced the per-cent alternations to chance level, or below.
  • a cognition enhancer which is always administered before the training session, will at least partially, antagonize the scopolamine-induced reduction in the spontaneous alternation rate.
  • mice Effects on plasma cholesterol levels including HDL cholesterol are typically assessed in humanized apo-A transgenic mice. Modulation of human target proteins can be determined in co ⁇ esponding transgenic mice (e.g., CETP transgenic mice). Triglyceri.de lowering is usually evaluated in ob/ob mice or Zucker rats. Animals are fed with normal diets or modified diets (e.g., enriched by 0.5 % cholesterol 20% coconut oil). Standard protocols consist of oral applications once daily for 7 to 10 days at doses ranging from 0,1 to 100 mg/kg. The compounds are dissolved (e.g., in Solutol/Ethanol/saline mixtures) and applied by oral gavage or intravenous injection.
  • Plasma cholesterol and triglyceride levels are determined with standardized clinical diagnostic kits (e.g., INFINITYTM cholesterol reagent and INFINETYTM triglyceride reagent; Sigma, St. Louis).
  • HDL cholesterol is determined after phosphotungstic acid precipitation of non-HDL lipoproteins or FPLC gel filtration with post-column derivatization of cholesterol using the reagents mentioned above.
  • Plasma levels of human apolipoprotein-AE in relevant humanized transgenic mice are measured by immunoturbidimetry (Sigma).
  • mice Male Wistar rats weighing 300-350 g (Harlan Winkelmann, Borchen, Germany) are anesthetized with thiopental "Nycomed'O (Nycomed, Munich, Germany) lOO mg kg-1 i.p. A tracheotomy is performed, and catheters are inserted into the femoral artery for blood pressure and heart rate measurements (Gould pressure transducer and recorder, model RS 3400) and into the femoral vein for substance administration. The animals are ventilated with room air and their body temperature is controlled. Test compounds are administered orally or intravenously.
  • Female conscious SHR (Moellegaard/Denmark, 220 - 290 g) are equipped with implantable radiotelemetry, and a data acquisition system (Data Sciences, St. Paul, MN, USA), comprising a chronically implantable transducer/transmitter unit equipped with a fluid-filled catheter is used.
  • the transmitter is implanted into the peritoneal cavity, and the sensing catheter is inserted into the descending aorta.
  • Cremophor®/ H2O (10/20/70 v/v/v) given orally by gavage.
  • the animals of control groups only receive the vehicle.
  • mean blood pressure and heart rate of treated and untreated control groups are measured.
  • a parasympathetic blockade is achieved by intermittent injections of atropine (0.1 mg per animal) (AfropinsulfafR, Eifelfango, Bad Neuenahr, Germany). After intubation the animals are artificially ventilated at constant volume (Engstr ⁇ mR 300, Engstr ⁇ m, Sweden) with room air enriched with 30%) oxygen to maintain an end-tidal CO2 concentration of about 5% (NormocapR, Datex, Finland).
  • a tip catheter for recording of left ventricular pressure is inserted into the ventricle via the carotid artery (PC350, Millar Instruments, Houston, TX, USA), a hollow catheter is inserted into the femoral artery and connected to a strain gauge (type 4-327-1, Telos Medical, Upland, CA, USA for recording of arterial blood pressure, two venous catheters are inserted into either femoral vein and one additional catheter into a forearm vein for application of the anaesthetic and drugs, respectively, and an oxymetry catheter for recording of oxygen saturation is inserted into the coronary sinus via the jugular vein (Schwarzer EVH4, M ⁇ nchen, Germany).
  • PC350 carotid artery
  • a hollow catheter is inserted into the femoral artery and connected to a strain gauge (type 4-327-1, Telos Medical, Upland, CA, USA for recording of arterial blood pressure
  • two venous catheters are inserted into either femoral vein and one additional catheter into
  • LCX left coronary artery
  • Statham, Oxnard, CA, USA is applied for measurement of coronary blood flow.
  • Arterial blood pressure, electrocardiogram (lead II), left ventricular pressure, first derivative of left ventricular pressure (dP/dt), heart rate, coronary blood flow, and oxygen saturation in the coronary sinus are continuously recorded on a pen recorder (Brush, Gould, Cleveland, OH, USA).
  • the maximum of dP/dt is used as measure of left ventricular contractility (dP/dtmax).
  • an interval of 60 min is allowed for stabilization before the test compound is intravenously applied as bolus injections. Care is taken that all measured cardiovascular parameters have returned to control level before injection of the next dose.
  • Each dose of the test compound is tested at least three times in different animals. The order of injection of the different doses is randomized in each animal.
  • BALB/c mice are injected with a single intravenous injection of 10 ⁇ g of 145-2C11 (purified hamster anti-mouse CD3 ⁇ monoclonal antibodies, PHARMENGEN).
  • a test compound is administered intraperitoneally 60 min prior to the anti-CD3 mAb injection.
  • Blood is collected 90 minutes after the antibody injection.
  • Serum is obtained by centrifugation at 3000 r.p.m. for 10 min.
  • IL-2 and EL-4 levels in the serum are determined by an ELISA. Tests for activity of B cells
  • mice are injected intravenously with 0.8 mg of purified goat anti-mouse IgD antibody or PBS (defined as day 0). Compound is administered infraperitoneally from day 0 to day 6. On day 7 blood is collected and serum is obtained by centrifugation at 3000 r.p.m. for 10 min. Serum total levels of IgE are determined by YAMAS A' s ELISA kit and their Ig subtypes are done by an Ig ELISA KIT (Rougier
  • mice are injected infraperitoneally with LPS (200 ⁇ g/mouse). Compound is administered infraperitoneally 1 hr before the LPS injection. Blood is collected at 90 min post-LPS injection and plasma is obtained. TNF- ⁇ concentration in the sample is determined using an ELISA kit.
  • BALB/c mice are injected intradermally with a 2.5 ml of air on days -6 and -3 to prepare airpouch.
  • On day 0 compound is administered infraperitoneally 60 min before eotaxin injection (3 ⁇ g/mouse, i.d.).
  • IL-5 300 ng/mouse
  • leukocytes in exudate is collected and the number of total cells is counted.
  • the differential cell counts in the exudate are performed by staining with May-Grunwald Gimsa solution. .
  • D10.G4.1 cells (1 x IO 7 cells/mouse) containing 2 mg of conalbumin in saline is administered i.v. to AKR mice. After 6 hr blood is collected and serum is obtained by centrifugation at 3000 r.p.m. for lOmin. IL-4 and IL-5 level in serum are determined by ELISA kits. Compound is administered infraperitoneally at -4 and +1 hr after these cells injection.
  • PCA Passive cutaneous anaphylaxis
  • the rats are killed, and the skin of the back is removed. Evans blue dye in the skin is extracted in formamide overnight at 63°C. Then an absorbance at 620 nm is measured to obtain the optical density of the leaked dye.
  • PEP Pulmonary inflation pressure
  • Wistar rats (200 ⁇ 250 g / Charles River Japan) are anesthetized infraperitoneally with ketamine. The abdomen is opened through a midline incision and the bladder and the proximal urethra are exposed. A constant degree of urethral obstruction is produced by tying a ligature around the urethra and a catheter with an outer diameter of 1 mm. The abdominal well is closed and the animals allowed to recover.
  • the rats are anesthetized with ketamine, and the ligature around the urethra is carefully removed to normalize the outlet resistance and enable repetitive micturition.
  • a polyethylene catheter is implanted in the bladder through the dome, and exteriorized at the scapular level. Animals are then allowed to recover for at least 48 hours.
  • Cytometric investigation is performed without anesthesia two days after bladder catheter implantation in control and obstructed animals.
  • the bladder catheter was connected via a T-tube to a strain gauge and a microinjection pump.
  • the conscious rats are held under partial restraint in a restraining device.
  • Warmed saline is infused into the bladder at a rate of 3 ml/hr for control and obstructed animals.
  • the rate of infusion is increased from 3 to 10 ml/hr to obtain similar interval times between micturitions in obstructed and control rats.
  • Overactivity of the obstructed bladders is assessed by measuring the cystometric parameters such as basal pressure, peak micturition pressure, threshold pressure, micturition interval, amplitude and frequency of spontaneous activity and micturition slope. Lluel et al, J. Urol. 160, 2253-57, 1998.
  • test compound is dissolved in an appropriate vehicle, such as a mixture of ethanol, Tween 80 (ICN Biomedicals Inc.), and saline (1:1:8, v/v/v), is administered intravenously through the catheter.
  • an appropriate vehicle such as a mixture of ethanol, Tween 80 (ICN Biomedicals Inc.), and saline (1:1:8, v/v/v
  • An organ bath assay is employed to measure the agonist-induced contraction of prostate for assessing the biological activity of test compounds (i.e., drug candidates).
  • Male Wistar rats (200 ⁇ 250 g / Charles River Japan) are anesthetized with ether and sacrificed by dislocating the necks. The whole prostate is excised and placed in oxygenated Modified Krebs-Henseleit solution (pH 7.4) of the following composition (112mM NaCl, 5.9mM KCl, 1.2mM MgCl 2 , 1.2mM NaH 2 PO 4 , 2mM CaCl 2 , 2.5mM NaHCO , 12mM glucose).
  • Ventricle prostate lobes were dissected into several strips depending on the size of prostate. Prostate strips are equilibrated for 60 min in organ bath chambers before any stimulation.
  • Isometric tension is recorded under an appropriate load. Contractile response to adrenergic agonists or electric field stimulation is determined several times until reproducible responses are obtained. Test compounds are pre-incubated prior to the agonistic or electric stimulation. The ratio of each contraction to the negative control is calculated and the effect of the test compounds on the prostate contraction is evaluated.
  • An organ bath assay is employed to measure the agonist-induced contraction of urinary bladder for assessing the biological activity of test compounds (i.e., drug candidates).
  • Male Wistar rats (200-250 g / Charles River Japan) are anesthetized with ether and sacrificed by dislocating the necks. The whole urinary bladder is excised and placed in oxygenated Modified Krebs-Henseleit solution (pH 7.4) of the following composition (112mM NaCl, 5.9mM KCl, 1.2mM MgCl 2 , 1.2mM NaH 2 PO 4 , 2mM CaCl 2 , 2.5mM NaHCO 3 , 12mM glucose).
  • Isometric tension is recorded under an appropriate load using longitudinal strips of rat detrusor muscle. Bladder strips are equilibrated for 60 minutes before each stimulation. Contractile response to 80 mM KCl is determined at 15 minute intervals until reproducible responses are obtained. The response to KCl is used as an internal standard to evaluate the effect of test compounds.
  • test compounds are investigated by incubating the strips with compounds for 30 minutes prior to stimulation with an appropriate agonist or electrical stimulation.
  • One of the preparations made from the same animal serves as a control, while others are used for evaluating test compounds.
  • the ratio of each contraction to the internal standard e.g., a KCl-induced contraction
  • Rats are anesthetized by intraperitoneal administration of urethane (Sigma) at 1.25 g/kg.
  • the abdomen is opened through a midline incision, and a polyethylene catheter (BECTON DICKINSON, PE50) is implanted into the bladder through the dome.
  • a polyethylene catheter BECTON DICKINSON, PE50
  • saline Otsuka
  • Rats are anesthetized by intramuscular administration of ketamine (75 mg/kg) and xylazine (15 mg/kg). The abdomen is opened through a midline incision, and a polyethylene catheter (BECTON DICKJNSON, PE50) is implanted into the bladder through the dome. The catheter is tunneled through subcutis of the animal by needle (14G) to neck. - I ll -
  • the inguinal region is incised, and a polyethylene catheter (BECTON DICKINSON, PE50) filled with saline (Otsuka) is inserted into a femoral vein.
  • the catheter is tunneled through subcutis of the animal by needle to neck.
  • CD34+ cells were purified by immunomagnetic separation system (MiniMACS, Miltenyi Biotec), according to the manufacture's instructions (Direct CD34 Progenitor Cell Isolation Kit, Miltenyi Biotec). The percentage of CD34+ cells were generally from 90-95%. Erythropoiesis/Anemia
  • l-2xl0 4 CD34 + cells were plated in triplicate in 24-well plates with 1ml Escoves modified Dulbecco medium (IMDM) (Invitrogen) containing 10%) fetal bovine serum (FCS, Invitrogen), 1%> Glutamine (Invitrogen) supplemented with SCF (25ng/ml) (PeproTech), different concentration of Erythropoietin (O.OlU/ml - lU/ml) (Erypo® FS 4000, Cilag) with or without compounds. Control cells were incubated with 0.1-IMDM (Invitrogen) containing 10%) fetal bovine serum (FCS, Invitrogen), 1%> Glutamine (Invitrogen) supplemented with SCF (25ng/ml) (PeproTech), different concentration of Erythropoietin (O.OlU/ml - lU/ml) (Erypo® FS 4
  • erythropoietin O.OlU/ml - lU/ml
  • BFU-E erythroid burst forming units
  • lxlO 5 Cord Blood CD34 + cells/ml were cultured in EMDM containing 15% BIT- 9500 (Cell Systems®), supplemented with IL-3 (10ng/ml) 3 IL-6 (lOng/ml) and SCF (25ng/ml) (PeproTech) and incubated at 37°C in a fully humidified atmosphere with
  • lxlO 5 Cord Blood CD34+ cells/ml were cultured in IMDM containing 15% BIT- 9500 supplemented with IL-3 (lOng/ml), IL-6 (lOng/ml) and SCF (25ng/ml) and incubated at 37°C in a fully humidified atmosphere with 5% CO 2 . 3 and 5 days after initiation of culture an equal volume of fresh medium supplemented with 2X cytokines were added. On day 6 to 7 cells were stained with PE-conjugated mAb against CD36 (Pharmingen) and CD36+ cells were purified using anti-PE microbeads and Mini MACS system (Miltenyi Biotec) according to the manufacture's instructions. l-2xl0 4 CD36+ cells were plated in triplicate 24well plates with 1ml IMDM containing 10% FCS, 1%> Glutamine supplemented with SCF
  • CD34+ cells isolated from peripheral blood, cord blood or from bone ma ⁇ ow were pre-incubated in quadruplicate in 24-well plates in 1ml medium (StemSpan) with 15% FCS, SCF (20 ng/ml) and GM-CSF (2,5 ng/ml) for 6 to 7 days at 37°C and 5.5% CO2. Then compounds (0.1.1 or 10 ⁇ M in DMSO) with or without G-CSF (0.25 ng/ml; Neupogen ®) were added and incubated for another 6 to 7 days.
  • the number of the early myelopoietic CD15+/CDl lb- cells and the number of the late myelopoietic CD15+/CD1 lb+ cells were determined by cell count (proliferation) and FACS (fluorescent associated cell sorting) analysis (differentiation) at day 13-14.
  • CD34+ cells isolated from peripheral blood, cord blood or from bone ma ⁇ ow were incubated in quadruplicate 24-well plates in 1 ml serum-free medium with 2% BSA, SCF (20 ng/ml) and compounds ( 0.1,1 or 10 ⁇ M in DMSO) with or without TPO (0-lOng/ml) for 12 to 13 days at 37°C and 5% CO 2 .
  • the number of the megakaryoid CD41+ cells (scatter profile) were determined by FACS analysis.
  • mice were used for compound testing.
  • other species e.g. rats, hamsters or guinea pigs have been used in addition.
  • repeated dosage is required for detection of changes in peripheral blood parameters.
  • blood samples were drawn for analysis of red and white blood cell counts as well as platelet counts using an automated blood analyzer.
  • erythropoiesis was assessed by manual hematocrit and reticulocyte count determination.
  • FACS leukocyte differentiation fluorescent associated cell sorting
  • mice were treated with compounds at different doses (based on pharmacokinetic data) once/day or bid per-orally or parenterally for up to
  • the WBC white blood cells count
  • the neutrophil count were monitored by FACS (CDllb+ ; scatter properties).
  • Immunocompromised Balb/c were generated by intravenous treatment with 5-FU (100 mg/kg i.p). 24 hours later the mice were treated with the test compound at different doses (based on pharmacokinetic data) once/day or bid per-orally or parenterally for up to 7 to 13 days.
  • Peripheral blood counts (WBC, RBC, PLT) have been determined after retroorbital plexus puncture at days 5,7,11 and 14.
  • WBC, RBC, PLT Peripheral blood counts
  • the expression of specific differentiation markers on stem and progenitor cells e.g. CD34, CD33, CD38, CDI lb
  • scatter properties were investigated.
  • Thrombopoietic compounds at different doses were administered orally or parenterally following chemotherapy (Carboplatin, 100 mg/kg i.p) immunocompromised mice. After repeated administration (once/day or bid for five to seven days) peripheral blood platelets (automated blood analyzer) have been determined after retroorbital plexus punction at day 5, 1, 11, and 14. EXAMPLE 18
  • mice are exposed to the smoke from 2 unfiltered cigarettes per day for 6 days per week for 14 weeks. Non-smoking, age-matched animals are used as controls. Animals are orally dosed with test compound or vehicle 1 hour before and 7 hours after smoke exposure. This twice-daily dosing regime is continued throughout the smoke exposure period. On day 7 of the weekly exposure, animals are given only 1 dose of test compound and are not exposed to cigarette smoke.
  • mice After the smoke exposure period, the mice are killed, their lungs inflated with phosphate-buffered formalin via their trachea, and then the lungs and heart are removed en bloc and fixed at 4°C for 48 hours. The lungs are then prepared for paraffin wax sectioning, and 4 mm sections are cut and mounted on glass slides.
  • LMI Linear Mean Intercept
  • the 12 areas cover a minimum of two lobes per slide. Non-parenchymal components (airways, blood vessels) are excluded from the analysis to prevent artifactual e ⁇ or.
  • the mean intercept length is calculated for each mouse. Development of emphysema is seen as an increase in LMI.
  • the potency of a test compound is evaluated by comparison of the tobacco smoke induced increase in LMI in animals dosed with either the test compound or just the vehicle used for adminisfration of the compound.
  • test compounds The potency of test compounds is evaluated by measuring the inhibition of elastolysis induced by human alveolar macrophages.
  • the cells are isolated from bronchoalveolar lavage samples taken from non-smokers, disease-free smokers, and smokers with COPD. Macrophage suspensions are added to test wells coated with tritiated elastin and incubated at 37°C for 3h to allow adherence of the cells. The wells are then carefully washed to remove non-adherent cells and fresh medium is added to each well. The cells are incubated at 37°C for up to 72 hours in the presence or absence of test compound. Every 24 hours the medium in each well is removed for analysis and replaced by fresh medium.
  • Radioactivity released into the medium is measured by liquid scintillation counting and the rate of elastin degradation is calculated.
  • the potency of a test compound is evaluated by comparing the rate of elastolysis measured with cells incubated in the presence or absence of the compound.
  • Total cellular RNA was isolated from cells by one of two standard methods: 1) guanidine isothiocyanate/cesium chloride density gradient centrifugation [Kellogg et al. (1990)]; or with the Tri-Reagent protocol according to the manufacturer's specifications (Molecular Research Center, Inc., Cincinnati, Ohio). Total RNA prepared by the Tri-reagent protocol was treated with DNAse I to remove genomic DNA contamination. For relative quantitation of the mRNA distribution, total RNA from each cell or tissue source was first reverse transcribed.
  • RNA Eighty-five ⁇ g of total RNA was reverse transcribed using 1 ⁇ mole random hexamer primers, 0.5 mM each of dATP, dCTP, dGTP and dTTP (Qiagen, Hilden, Germany) and 3000 U ElnaseQut (Invitrogen, Groningen, Netherlands) in a final volume of 680 ⁇ l.
  • the first strand synthesis buffer and Omniscript reverse transcriptase (2 u/ ⁇ l) were obtained from (Qiagen, Hilden, Germany). The reaction was incubated at 37°C for 90 minutes and cooled on ice. The volume was adjusted to 6800 ⁇ l with water, yielding a final concentration of 12.5 ng/ ⁇ l of starting RNA.
  • the forward primer sequence was: Primerl gcacttggcgaaagagattc
  • the reverse primer sequence was Primer2 gccataggcacaggtgaaag.
  • the CT (threshold cycle) value is calculated as described in the "Quantitative determination of nucleic acids" section.
  • the CF-value (factor for threshold cycle co ⁇ ection) is calculated as follows:
  • PCR reactions were set up to quantitate the housekeeping genes (HKG) for each cDNA sample.
  • CTn KG -values (threshold cycle for housekeeping gene) were calculated as described in the "Quantitative determination of nucleic acids" section.
  • CT HKG - n -mean value (CTH KGI -value + CT HKG2 -value + ...
  • a glia-derived neurite promoting factor with protease inhibitory activity belongs to the protease nexins. Cell 1986 Dec 5;47(5):687-93.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

Reagents that regulate human nexin-related serine protease inhibitor and reagents which bind to human nexin-related serine protease inhibitor gene products can play a role in preventing, ameliorating, or correcting dysfunctions or diseases including, but not limited to, cancer, CNS disorders, cardiovascular disorders, genitourinary disorders, hematological disorders, gastrointestinal disorders, COPD, and asthma.

Description

POLYNUCLEOTIDES ENCODING NEXIN-RELATED SERINE PROTEASE INHIBITOR
This application incorporates by reference co-pending US provisional applications Serial No. 60/333,157 filed November 27, 2001 and Serial No. 60/406,930 filed
August 30, 2002.
FIELD OF THE INVENTION
The invention relates to the regulation of human nexin-related serine protease inhibitor.
BACKGROUND OF THE INVENTION
Serine proteases are enzymes that break down proteins and have a serine and a histidine involved at the active site of the catalysis. This group includes enzymes active in digestion, blood clotting, immune reactions, and fertilization of the ovum. Serine proteases can be regulated to provide therapeutic uses. For. example, metastasizing cancer cells invade the extracellular matrix using plasma membrane protrusions that contact and dissolve the matrix with proteases.
Because of the importance of serine proteases in a variety of metabolic pathways and their implications in a number of diseases, there is a need in the art to identify nexin- related serine protease inhibitors, which can be used or regulated to provide therapeutic effects.
BRIEF SUMMARY OF THE INVENTION
It is an object of the invention to provide reagents and methods of regulating a human nexin-related serine protease inhibitor. This and other objects of the invention are provided by one or more of the embodiments described below. One embodiment of the invention is a nexin-related serine protease inhibitor polypeptide comprising an amino acid sequence selected from the group consisting of:
amino acid sequences which are at least about 32% identical to the amino acid sequence shown in SEQ ID NO: 2; and
the amino acid sequence shown in SEQ ID NO: 2.
Yet another embodiment of the invention is a method of screening for agents which decrease extracellular matrix degradation. A test compound is contacted with a nexin-related serine protease inhibitor polypeptide comprising an amino acid sequence selected from the group consisting of:
amino acid sequences which are at least about 32% identical to the amino acid sequence shown in SEQ ID NO: 2; and
the amino acid sequence shown in SEQ ID NO: 2.
Binding between the test compound and the nexin-related serine protease inhibitor polypeptide is detected. A test compound which binds to the nexin-related serine protease inhibitor polypeptide is thereby identified as a potential agent for decreasing extracellular matrix degradation. The agent can work by decreasing the activity of the nexin-related serine protease inhibitor.
Another embodiment of the invention is a method of screening for agents which decrease extracellular matrix degradation. A test compound is contacted with a polynucleotide encoding a nexin-related serine protease inhibitor polypeptide, wherein the polynucleotide comprises a nucleotide sequence selected from the group consisting of: nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO: 1; and
the nucleotide sequence shown in SEQ ID NO: 1.
Binding of the test compound to the polynucleotide is detected. A test compound which binds to the polynucleotide is identified as a potential agent for decreasing extracellular matrix degradation. The agent can work by decreasing the amount of the nexin-related serine protease inhibitor through interacting with the nexin-related serine protease inhibitor mRNA.
Another embodiment of the invention is a method of screening for agents which regulate extracellular matrix degradation. A test compound is contacted with a nexin-related serine protease inhibitor polypeptide comprising an amino acid sequence selected from the group consisting of:
amino acid sequences which are at least about 32% identical to the amino acid sequence shown in SEQ ID NO: 2; and
the amino acid sequence shown in SEQ ED NO: 2.
A nexin-related serine protease inhibitor activity of the polypeptide is detected. A test compound which increases nexin-related serine protease inhibitor activity of the polypeptide relative to nexin-related serine protease inhibitor activity in the absence of the test compound is thereby identified as a potential agent for increasing extracellular matrix degradation. A test compound which decreases nexin-related serine protease inhibitor activity of the polypeptide relative to nexin-related serine protease inhibitor activity in the absence of the test compound is thereby identified as a potential agent for decreasing extracellular matrix degradation. Even another embodiment of the invention is a method of screening for agents which decrease extracellular matrix degradation. A test compound is contacted with a nexin-related serine protease inhibitor product of a polynucleotide which comprises a nucleotide sequence selected from the group consisting of:
nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO: 1; and
the nucleotide sequence shown in SEQ ID NO: 1.
Binding of the test compound to the nexin-related serine protease inhibitor product is detected. A test compound which binds to the nexin-related serine protease inhibitor product is thereby identified as a potential agent for decreasing extracellular matrix degradation.
Still another embodiment of the invention is a method of reducing extracellular matrix degradation. A cell is contacted with a reagent which specifically binds to a polynucleotide encoding a nexin-related serine protease inhibitor polypeptide or the product encoded by the polynucleotide, wherein the polynucleotide comprises a nucleotide sequence selected from the group consisting of:
nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO: 1; and
the nucleotide sequence shown in SEQ ED NO: 1.
Nexin-related serine protease inhibitor activity in the cell is thereby decreased.
The invention thus provides a human nexin-related serine protease inhibitor that can be used to identify test compounds that may act, for example, as activators or inhibitors. Human nexin-related serine protease inhibitor and fragments thereof also are useful in raising specific antibodies that can block the protein and effectively reduce its activity.
BRIEF DESCRIPTION OF THE FIGURES
Fig. 1 shows the DNA-sequence encoding a nexin-related serine protease inhibitor polypeptide (SEQ ID NO: 1).
Fig. 2 shows the amino acid sequence deduced from the DNA-sequence of Fig.1 (SEQ ID NO: 2).
Fig. 3 shows the amino acid sequence of the protein identified by swiss|P07093|GDN_HUMANGlia derived nexin precursor (GDN) (Protease nexin I) (PN-1) (SEQ ID NO: 3).
Fig. 4 shows the DNA-sequence encoding a nexin-related serine protease inhibitor polypeptide (SEQ ID NO: 4).
Fig. 5 shows the BLASTP - alignment of 514 against swiss|P07093|GDN_ITUMANGlia derived nexin precursor (GDN) (Protease nexin E) (PN-1) (SEQ ED NO: 3). This hit is scoring at : 2e-46 (expectation value). Alignment length (overlap) : 401,
Identities : 31 %, Scoring matrix : BLOSUM62 (used to infer consensus pattern),
Database searched : nrdb_l_.
Fig. 6 shows the ETMMPFAM - alignment of 514 against pfam|hmm|se inSerpin
(serine protease inhibitor). This hit is scoring at : 35.9 E=8.1E-10. Scoring matrix : BLOSUM62 (used to infer consensus pattern).
Fig. 7 shows the HMMPFAM - alignment of 514 against pfam|hmm|serpin. Serpin (serine protease inhibitor). This hit is scoring at : 212.0 E=5.9E-62. Scoring matrix : BLOSUM62 (used to infer consensus pattern). Fig. 8 shows the Blocks search results.
Fig. 9 shows the Prosite search results.
Fig. 10 shows the Multiple alignments. Names: 514_protein, SEQ ID NO: 2; swiss.Q07235, Serine protease inhibitor, GDNjmouse; trembl.M17783 glia- derived nexin (GDN), human; swiss.P07093 glia derived nexin, human; swiss.P07092 GDN rat; trembl|S79838 antithrombin, AT-III, chicken; swiss.P32261 antithrombin, ANT3_mouse; pdb.lE04 BETA
ANTITHROMBIN-III, human; swiss.P01008 antithrombin, ANT3_human; trembl|D29832 antithrombin III (AT-III) variant, human; pironly|JX0364 antithrombin III, pig; trembl|M21642 antithrombin III, human; swiss|P41361 antithrombin, ANT3_bovine.
DETAILED DESCRIPTION OF THE INVENTION
The invention relates to an isolated polynucleotide from the group consisting of:
a) a polynucleotide encoding a nexin-related serine protease inhibitor polypeptide comprising an amino acid sequence selected from the group consisting of: amino acid sequences which are at least about 32% identical to the amino acid sequence shown in SEQ ED NO: 2; and the amino acid sequence shown in SEQ ID NO: 2.
b) a polynucleotide comprising the sequence of SEQ ID NO: 1 ;
c) a polynucleotide which hybridizes under stringent conditions to a poly- nucleotide specified in (a) and (b) and encodes a nexin-related serine protease inhibitor polypeptide; d) a polynucleotide the sequence of which deviates from the polynucleotide sequences specified in (a) to (c) due to the degeneration of the genetic code and encodes a nexin-related serine protease inhibitor polypeptide; and
e) a polynucleotide which represents a fragment, derivative or allelic variation of a polynucleotide sequence specified in (a) to (d) and encodes a nexin-related serine protease inhibitor polypeptide.
Furthermore, it has been discovered by the present applicant that a novel Nexin-
Related Serine Protein Inhibitor, particularly a human Nexin-Related Serine Protease Inhibitor, can be used in therapeutic methods to treat cancer, CNS disorder, cardiovascular disorder, genitourinary disorder, hematological disorder, gastrointestinal disorder, COPD, or asthma. Human nexin-related serine protease inhibitor comprises the amino acid sequence shown in SEQ ED NO: 2. A coding sequence for human nexin-related serine protease inhibitor is shown in SEQ ID NO: 1. This sequence is located on chromosome 13q4.3. Related ESTs (AW593520; AI434823; AI741381; AA262235; BE684071) are expressed in pooled germ cell tumors, kidney, germinal center B cells, and pooled embryos.
Prosite, BLOCKS and pFAM serpin regions all exist in SEQ ED NO: 2. SEQ ID NO: 2 hits several protease inhibitors with about 30% identity, including human protease nexin and antithrombin. SEQ ED NO: 2 shares the same active site residues (RS) with both antithrombin and nexin protease inhibitors; thus, the protein of SEQ ID NO: 2 is likely to be a serine protease inhibitor with specific activity closely related to nexin and antithrombin.
Human nexin-related serine protease inhibitor of the invention is expected to be useful for the same purposes as previously identified serine protease inhibitors. Human nexin-related serine protease inhibitor is believed to be useful in therapeutic methods to treat disorders such as cancer, CNS disorders, cardiovascular disorders, genitourinary disorders, hematological disorders, gastrointestinal disorders, COPD, and asthma. Human nexin-related serine protease inhibitor also can be used to screen for human nexin-related serine protease inhibitor activators and inhibitors.
Polypeptides
Human nexin-related serine protease inhibitor polypeptides according to the invention comprise at least 6, 10, 15, 20, 25, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, or 424 contiguous amino acids selected from the amino acid sequence shown in SEQ ID NO: 2 or a biologically active variant thereof, as defined below. A nexin-related serine protease inhibitor polypeptide of the invention therefore can be a portion of a nexin-related serine protease inhibitor protein, a full-length nexin-related serine protease inhibitor protein, or a fusion protein comprising all or a portion of a nexin-related serine protease inhibitor protein.
Biologically active variants
Human nexin-related serine protease inhibitor polypeptide variants that are biologically active, e.g., retain a serine protease inhibiting activity, also are nexin- related serine protease inhibitor polypeptides. Preferably, naturally or non-naturally occurring nexin-related serine protease inhibitor polypeptide variants have amino acid sequences which are at least about 32, 35, 40, 45, 50, 55, 60, 65, or 70, preferably about 75, 80, 85, 90, 96, 96, 98, or 99% identical to the amino acid sequence shown in SEQ ID NO: 2 or a fragment thereof. Percent identity between a putative nexin-related serine protease inhibitor polypeptide variant and an amino acid sequence of SEQ ID NO: 2 is determined by conventional methods. See, for example, Altschul et al, Bull. Math. Bio. 48:603 (1986), and Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89:10915 (1992). Briefly, two amino acid sequences are aligned to optimize the alignment scores using a gap opening penalty of 10, a gap extension penalty of 1, and the "BLOSUM62" scoring matrix of Henikoff &
Henikoff, 1992. Those skilled in the art appreciate that there are many established algorithms available to align two amino acid sequences. The "FASTA" similarity search algorithm of Pearson & Lip an is a suitable protein alignment method for examining the level of identity shared by an amino acid sequence disclosed herein and the amino acid sequence of a putative variant. The FASTA algorithm is described by Pearson & Lipman, Proc. Nat'l Acad. Sci. USA 85:2444 (1988), and by Pearson, Meth. Enzymol. 183:63 (1990). Briefly, FASTA first characterizes sequence similarity by identifying regions shared by the query sequence (e.g., SEQ ID NO: 2) and a test sequence that have either the highest density of identities (if the ktup variable is
1) or pairs of identities (if ktup=2), without considering conservative amino acid substitutions, insertions, or deletions. The ten regions with the highest density of identities are then rescored by comparing the similarity of all paired amino acids using an amino acid substitution matrix, and the ends of the regions are "trimmed" to include only those residues that contribute to the highest score. If there are several regions with scores greater than the "cutoff value (calculated by a predetermined formula based upon the length of the sequence the ktup value), then the trimmed initial regions are examined to determine whether the regions can be joined to form an approximate alignment with gaps. Finally, the highest scoring regions of the two amino acid sequences are aligned using a modification of the Needleman- Wunsch-
Sellers algorithm (Needleman & Wunsch, J. Mol. Biol.48:444 (1970); Sellers, SLAM J. Appl. Math.26:787 (1974)), which allows for amino acid insertions and deletions. Prefeπed parameters for FASTA analysis are: ktup=l, gap opening penalty=10, gap extension penalty=l, and substitution matrix=BLOSUM62. These parameters can be introduced into a FASTA program by modifying the scoring matrix file
("SMATRIX"), as explained in Appendix 2 of Pearson, Meth. Enzymol. 183:63 (1990).
FASTA can also be used to determine the sequence identity of nucleic acid molecules using a ratio as disclosed above. For nucleotide sequence comparisons, the ktup value can range between one to six, preferably from three to six, most preferably three, with other parameters set as default.
Variations in percent identity can be due, for example, to amino acid substitutions, insertions, or deletions. Amino acid substitutions are defined as one for one amino acid replacements. They are conservative in nature when the substituted amino acid has similar structural and/or chemical properties. Examples of conservative replacements are substitution of a leucine with an isoleucine or valine, an aspartate with a glutamate, or a threonine with a serine.
Amino acid insertions or deletions are changes to or within an amino acid sequence. They typically fall in the range of about 1 to 5 amino acids. Guidance in determining which amino acid residues can be substituted, inserted, or deleted without abolishing biological or immunological activity of a human nexin-related serine protease inhibitor polypeptide can be found using computer programs well known in the art, such as DNASTAR software.
The invention additionally, encompasses nexin-related serine protease inhibitor polypeptides that are differentially modified during or after translation, e.g., by glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting blocking groups, proteolytic cleavage, linkage to an antibody molecule or other cellular ligand, etc. Any of numerous chemical modifications can be carried out by known techniques including, but not limited, to specific chemical cleavage by cyanogen bromide, trypsin, chymotrypsin, papain, N8 protease, ΝaBH4, acetylation, formylation, oxidation, reduction, metabolic synthesis in the presence of tunicamycin, etc.
Additional post-translational modifications encompassed by the invention include, for example, e.g., N-linked or O-linked carbohydrate chains, processing of N- terminal or C-terminal ends), attachment of chemical moieties to the amino acid backbone, chemical modifications of N-linked or O-linked carbohydrate chains, and addition or deletion of an N-terminal methionine residue as a result of prokaryotic host cell expression. The nexin-related serine protease inhibitor polypeptides may also be modified with a detectable label, such as an enzymatic, fluorescent, isotopic or affinity label to allow for detection and isolation of the protein.
The invention also provides chemically modified derivatives of nexin-related serine protease inhibitor polypeptides that may provide additional advantages such as increased solubility, stability and circulating time of the polypeptide, or decreased immunogenicity (see U.S. Patent No. 4,179,337). The chemical moieties for derivitization can be selected from water soluble polymers such as polyethylene glycol, ethylene glycol/propylene glycol copolymers, carboxymethylcellulose, dextran, polyvinyl alcohol, and the like. The polypeptides can be modified at random or predetermined positions within the molecule and can include one, two, three, or more attached chemical moieties.
Whether an amino acid change or a polypeptide modification results in a biologically active nexin-related serine protease inhibitor polypeptide can readily be determined by assaying for assaying for serine protease activity in the presence and absence of a putative nexin-related serine protease inhibitor polypeptide. Assays for serine protease activity are well-known (see, e.g. , U.S. Patent 6,197,519).
Fusion proteins
Fusion proteins are useful for generating antibodies against nexin-related serine protease inhibitor polypeptide amino acid sequences and for use in various assay systems. For example, fusion proteins can be used to identify proteins that interact with portions of a human nexin-related serine protease inhibitor polypeptide. Protein affinity chromatography or library-based assays for protein-protein interactions, such as the yeast two-hybrid or phage display systems, can be used for this purpose. Such methods are well known in the art and also can be used as drug screens. A human nexin-related serine protease inhibitor polypeptide fusion protein comprises two polypeptide segments fused together by means of a peptide bond. The first polypeptide segment comprises a nexin-related serine protease inhibitor polypeptide, as described above. The first polypeptide segment also can comprise full-length nexin-related serine protease inhibitor protein.
The second polypeptide segment can be a full-length protein or a protein fragment. Proteins commonly used in fusion protein construction include β-galactosidase, β- glucuronidase, green fluorescent protein (GFP), autofluorescent proteins, including blue fluorescent protein (BFP), glutathione-S-transferase (GST), luciferase, horseradish peroxidase (HRP), and chloramphenicol acetyltransferase (CAT). Additionally, epitope tags are used in fusion protein constructions, including histidine (His) tags, FLAG tags, influenza hemagglutinin (HA) tags, Myc tags, NSN-G tags, and thioredoxin (Trx) tags. Other fusion constructions can mclude maltose binding protein (MBP), S-tag, Lex a DΝA binding domain (DBD) fusions, GAL4 DΝA binding domain fusions, and herpes simplex virus (HSN) BP16 protein fusions. A fusion protein also can be engineered to contain a cleavage site located between the nexin-related serine protease inhibitor polypeptide-encoding sequence and the heterologous protein sequence, so that the nexin-related serine protease inhibitor polypeptide can be cleaved and purified away from the heterologous moiety.
A fusion protein can be synthesized chemically, as is known in the art. Preferably, a fusion protein is produced by covalently linking two polypeptide segments or by standard procedures in the art of molecular biology. Recombinant DΝA methods can be used to prepare fusion proteins, for example, by making a DΝA construct which comprises coding sequences selected from SEQ ED NO: 1 in proper reading frame with nucleotides encoding the second polypeptide segment and expressing the DNA construct in a host cell, as is known in the art. Many kits for constructing fusion proteins are available from companies such as Promega Corporation (Madison, WI), Stratagene (La Jolla, CA), CLONTECH (Mountain View, CA), Santa Cruz Biotechnology (Santa Cruz, CA), MBL International Corporation (MIC; Watertown, MA), and Quantum Biotechnologies (Montreal, Canada; 1-888-DNA-KITS).
Identification of species homologs
Species homologs of human nexin-related serine protease inhibitor polypeptide can be obtained using nexin-related serine protease inhibitor polypeptide polynucleotides (described below) to make suitable probes or primers for screening cDNA expression libraries from other species, such as mice, monkeys, or yeast, identifying cDNAs which encode homologs of nexin-related serine protease inhibitor polypeptide, and expressing the cDNAs as is known in the art.
Polynucleotides
A human nexin-related serine protease inhibitor polynucleotide can be single- or double-stranded and comprises a coding sequence or the complement of a coding sequence for a nexin-related serine protease inhibitor polypeptide. A coding sequence for human nexin-related serine protease inhibitor is shown in SEQ ED NO: 1.
Degenerate nucleotide sequences encoding human nexin-related serine protease inhibitor polypeptides, as well as homologous nucleotide sequences which are at least about 50, 55, 60, 65, 70, preferably about 75, 90, 96, 98, or 99% identical to the nucleotide sequence shown in SEQ ID NO: 1 or its complement also are nexin- related serine protease inhibitor polynucleotides. Percent sequence identity between the sequences of two polynucleotides is determined using computer programs such as ALIGN which employ the FASTA algorithm, using an affine gap search with a gap open penalty of -12 and a gap extension penalty of -2. Complementary DNA (cDNA) molecules, species homologs, and variants of nexin-related serine protease inhibitor polynucleotides that encode biologically active nexin-related serine protease inhibitor polypeptides also are nexin-related serine protease inhibitor polynucleo- tides. Polynucleotide fragments comprising at least 8, 9, 10, 11, 12, 15, 20, or 25 contiguous nucleotides of SEQ ID NO: 1 or its complement also are nexin-related serine protease inhibitor polynucleotides. These fragments can be used, for example, as hybridization probes or as antisense oligonucleotides.
Identification of polynucleotide variants and homologs
Nariants and homologs of the nexin-related serine protease inhibitor polynucleotides described above also are nexin-related serine protease inhibitor polynucleotides. Typically, homologous nexin-related serine protease inhibitor polynucleotide sequences can be identified by hybridization of candidate polynucleotides to known nexin-related serine protease inhibitor polynucleotides under stringent conditions, as is known in the art. For example, using the following wash conditions~2X SSC (0.3 M ΝaCl, 0.03 M sodium citrate, pH 7.0), 0.1% SDS, room temperature twice, 30 minutes each; then 2X SSC, 0.1% SDS, 50°C once, 30 minutes; then 2X SSC, room temperature twice, 10 minutes each-homologous sequences can be identified which contain at most about 25-30% basepair mismatches. More preferably, homologous nucleic acid strands contain 15-25% basepair mismatches, even more preferably 5-15% basepair mismatches.
Species homologs of the nexin-related serine protease inhibitor polynucleotides disclosed herein also can be identified by making suitable probes or primers and screening cDΝA expression libraries from other species, such as mice, monkeys, or yeast. Human variants of nexin-related serine protease inhibitor polynucleotides can be identified, for example, by screening human cDΝA expression libraries. It is well known that the Tm of a double-stranded DΝA decreases by 1-1.5 °C with every 1% decrease in homology (Bonner et al., J. Mol. Biol. 81, 123 (1973). Nariants of human nexin-related serine protease inhibitor polynucleotides or nexin-related serine protease inhibitor polynucleotides of other species can therefore be identified by hybridizing a putative homologous nexin-related serine protease inhibitor polynucleotide with a polynucleotide having a nucleotide sequence of SEQ ID NO: 1 or the complement thereof to form a test hybrid. The melting temperature of the test hybrid is compared with the melting temperature of a hybrid comprising polynucleotides having perfectly complementary nucleotide sequences, and the number or percent of basepair mismatches within the test hybrid is calculated.
Nucleotide sequences which hybridize to nexin-related serine protease inhibitor polynucleotides or their complements following stringent hybridization and/or wash conditions also are nexin-related serine protease inhibitor polynucleotides. Stringent wash conditions are well known and understood in the art and are disclosed, for example, in Sambrook et al, MOLECULAR CLONING: A LABORATORY MANUAL, 2d ed., 1989, at pages 9.50-9.51.
Typically, for stringent hybridization conditions a combination of temperature and salt concentration should be chosen that is approximately 12-20°C below the calculated Tm of the hybrid under study. The Tm of a hybrid between a nexin-related serine protease inhibitor polynucleotide having a nucleotide sequence shown in SEQ ID NO: 1 or the complement thereof and a polynucleotide sequence which is at least about 50, preferably about 75, 90, 96, or 98% identical to one of those nucleotide sequences can be calculated, for example, using the equation of Bolton and McCarthy, Proc. Natl. Acad. Sci. U.S.A. 48, 1390 (1962):
Tm = 81.5°C - 16.6(logι0[Na+]) + 0.41(%G + C) - 0.63(%formamide) - 600/1), where = the length of the hybrid in basepairs.
Stringent wash conditions include, for example, 4X SSC at 65°C, or 50% formamide,
4X SSC at 42°C, or 0.5X SSC, 0.1% SDS at 65°C. Highly stringent wash conditions include, for example, 0.2X SSC at 65°C. Preparation of polynucleotides
A human nexin-related serine protease inhibitor polynucleotide can be isolated free of other cellular components such as membrane components, proteins, and lipids. Polynucleotides can be made by a cell and isolated using standard nucleic acid purification techniques, or synthesized using an amplification technique, such as the polymerase chain reaction (PCR), or by using an automatic synthesizer. Methods for isolating polynucleotides are routine and are known in the art. Any such technique for obtaining a polynucleotide can be used to obtain isolated nexin-related serine protease inhibitor polynucleotides. For example, restriction enzymes and probes can be used to isolate polynucleotide fragments, which comprise nexin-related serine protease inhibitor nucleotide sequences. Isolated polynucleotides are in preparations that are free or at least 70, 80, or 90% free of other molecules:
Human nexin-related serine protease inhibitor cDNA molecules can be made with standard molecular biology techniques, using nexin-related serine protease inhibitor mRNA as a template. Human nexin-related serine protease inhibitor cDNA molecules can thereafter be replicated using molecular biology techniques known in the art and disclosed in manuals such as Sambrook et al. (1989). An amplification technique, such as PCR, can be used to obtain additional copies of polynucleotides of the invention, using either human genomic DNA or cDNA as a template.
Alternatively, synthetic chemistry techniques can be used to synthesize nexin-related serine protease inhibitor polynucleotides. The degeneracy of the genetic code allows alternate nucleotide sequences to be synthesized which will encode a human nexin- related serine protease inhibitor polypeptide having, for example, an amino acid sequence shown in SEQ ID NO:2 or a biologically active variant thereof. Extending polyn ucleotides
Various PCR-based methods can be used to extend the nucleic acid sequences disclosed herein to detect upstream sequences such as promoters and regulatory elements. For example, restriction-site PCR uses universal primers to retrieve unknown sequence adjacent to a known locus (Sarkar, PCR Methods Applic. 2, 318-322, 1993). Genomic DNA is first amplified in the presence of a primer to a linker sequence and a primer specific to the known region. The amplified sequences are then subjected to a second round of PCR with the same linker primer and another specific primer internal to the first one. Products of each round of PCR are transcribed with an appropriate RNA polymerase and sequenced using reverse transcriptase.
Inverse PCR also can be used to amplify or extend sequences using divergent primers based on a known region (Triglia et al, Nucleic Acids Res. 16, 8186, 1988). Primers can be designed using commercially available software, such as OLIGO 4.06 Primer Analysis software (National Biosciences Inc., Plymouth, Minn.), to be 22-30 nucleotides in length, to have a GC content of 50% or more, and to anneal to the target sequence at temperatures about 68-72°C. The method uses several restriction enzymes to generate a suitable fragment in the known region of a gene. The fragment is then circularized by intramolecular ligation and used as a PCR template.
Another method which can be used is capture PCR, which involves PCR amplification of DNA fragments adjacent to a known sequence in human and yeast artificial chromosome DNA (Lagerstrom et al., PCR Methods Applic. 1, 111-119,
1991). In this method, multiple restriction enzyme digestions and ligations also can be used to place an engineered double-stranded sequence into an unknown fragment of the DNA molecule before performing PCR.
Another method which can be used to retrieve unknown sequences is that of Parker et al., Nucleic Acids Res. 19, 3055-3060, 1991). Additionally, PCR, nested primers, and PROMOTERFENDER libraries (CLONTECH, Palo Alto, Calif.) can be used to walk genomic DNA (CLONTECH, Palo Alto, Calif). This process avoids the need to screen libraries and is useful in finding intron/exon junctions.
When screening for full-length cDNAs, it is preferable to use libraries that have been size-selected to mclude larger cDNAs. Randomly-primed libraries are preferable, in that they will contain more sequences .which contain the 5' regions of genes. Use of a randomly primed library may be especially preferable for situations in which an oligo d(T) library does not yield a full-length cDNA. Genomic libraries can be useful for extension of sequence into 5 ' non-transcribed regulatory regions.
Commercially available capillary electrophoresis systems can be used to analyze the size or confirm the nucleotide sequence of PCR or sequencing products. For example, capillary sequencing can employ flowable polymers for electrophoretic separation, four different fluorescent dyes (one for each nucleotide) that are laser activated, and detection of the emitted wavelengths by a charge coupled device camera. Output/light intensity can be converted to electrical signal using appropriate software (e.g. GENOTYPER and Sequence NAVIGATOR, Perkin Elmer), and the entire process from loading of samples to computer analysis and electronic data display can be computer controlled. Capillary electrophoresis is especially preferable for the sequencing of small pieces of DNA that might be present in limited amounts in a particular sample.
Obtaining Polynucleotides
Human nexin-related serine protease inhibitor polypeptides can be obtained, for example, by purification from human cells, by expression of nexin-related serine protease inhibitor polynucleotides, or by direct chemical synthesis. Protein purification
Human nexin-related serine protease inhibitor polypeptides can be purified from any human cell which expresses the receptor, including host cells which have been transfected with nexin-related serine protease inhibitor polynucleotides. A purified nexin-related serine protease inhibitor polypeptide is separated from other compounds that normally associate with the nexin-related serine protease inhibitor polypeptide in the cell, such as certain proteins, carbohydrates, or lipids, using methods well-known in the art. Such methods include, but are not limited to, size exclusion chromatography, ammonium sulfate fractionation, ion exchange chromatography, affinity chromatography, and preparative gel electrophoresis.
Human nexin-related serine protease inhibitor polypeptide can be conveniently isolated as a complex with its associated G protein, as described in the specific examples, below. A preparation of purified nexin-related serine protease inhibitor polypeptides is at least 80% pure; preferably, the preparations are 90%o, 95%, or 99% pure. Purity of the preparations can be assessed by any means known in the art, such as SDS-polyacrylamide gel electrophoresis.
Expression of polynucleotides
To express a human nexin-related serine protease inhibitor polynucleotide, the polynucleotide can be inserted into an expression vector which contains the necessary elements for the transcription and translation of the inserted coding sequence. Methods which are well known to those skilled in the art can be used to construct expression vectors containing sequences encoding nexin-related serine protease inhibitor polypeptides and appropriate transcriptional and translational control elements. These methods include in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. Such techniques are described, for example, in Sambrook et al. (1989) and in Ausubel et al, CURRENT PROTOCOLS IN
MOLECULAR BIOLOGY, John Wiley & Sons, New York, N.Y., 1989. A variety of expression vector/host systems can be utilized to contain and express sequences encoding a human nexin-related serine protease inhibitor polypeptide. These include, but are not limited to, microorganisms, such as bacteria transformed with recombinant bacteriophage, plasmid, or cosmid DNA expression vectors; yeast transformed with yeast expression vectors, insect cell, systems infected with virus expression vectors (e.g., baculovirus), plant cell systems transformed with virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or with bacterial expression vectors (e.g., Ti or pBR322 plasmids), or animal cell systems.
The control elements or regulatory sequences are those non-translated regions of the vector ~ enhancers, promoters, 5' and 3' untranslated regions ~ which interact with host cellular proteins to carry out transcription and translation. Such elements can vary in their strength and specificity. Depending on the vector system and host utilized, any number of suitable transcription and translation elements, including constitutive and inducible promoters, can be used. For example, when cloning in bacterial systems, inducible promoters such as the hybrid lacZ promoter of the BLUESCRIPT phagemid (Stratagene, LaJolla, Calif.) or pSPORTl plasmid (Life Technologies) and the like can be used. The baculovirus polyhedrin promoter can be used in insect cells. Promoters or enhancers derived from the genomes of plant cells (e.g., heat shock, RUBISCO, and storage protein genes) or from plant viruses (e.g., viral promoters or leader sequences) can be cloned into the vector. In mammalian cell systems, promoters from mammalian genes or from mammalian viruses are preferable. If it is necessary to generate a cell line that contains multiple copies of a nucleotide sequence encoding a human nexin-related serine protease inhibitor polypeptide, vectors based on SV40 or EBV can be used with an appropriate selectable marker. Bacterial and yeast expression systems
En bacterial systems, a number of expression vectors can be selected depending upon the use intended for the nexin-related serine protease inhibitor polypeptide. For example, when a large quantity of a human nexin-related serine protease inhibitor polypeptide is needed for the induction of antibodies, vectors which direct high level expression . of fusion proteins that are readily purified can be used. Such vectors include, but are not limited to, multifunctional E. coli cloning and expression vectors such as BLUESCREPT (Stratagene). In a BLUESCREPT vector, a sequence encoding the nexin-related serine protease inhibitor polypeptide can be ligated into the vector in frame with sequences for the amino-terminal Met and the subsequent 7 residues of β-galactosidase so that a hybrid protein is produced. pIN vectors (Van Heeke & Schuster, J Biol. Chem. 264, 5503-5509, 1989) or pGEX vectors (Promega, Madison, Wis.) also can be used to express foreign polypeptides as fusion proteins with glutathione S-transferase (GST). In general, such fusion proteins are soluble and can easily be purified from lysed cells by adsorption to glutathione-agarose beads followed by elution in the presence of free glutathione. Proteins made in such systems can be designed to include heparin, thrombin, or factor Xa protease cleavage sites so that the cloned polypeptide of interest can be released from the GST moiety at will.
In the yeast Saccharomyces cerevisiae, a number of vectors containing constitutive or inducible promoters such as alpha factor, alcohol oxidase, and PGH can be used. For reviews, see Ausubel et al. (1989) and Grant et al., Methods Enzymol. 153, 516-544, 1987.
Plant and insect expression systems
If plant expression vectors are used, the expression of sequences encoding nexin- related serine protease inhibitor polypeptides can be driven by any of a number of promoters. For example, viral promoters such as the 35S and 19S promoters of CaMV can be used alone or in combination with the omega leader sequence from TMV (Takamatsu, EMBO J. 6, 307-311, 1987). Alternatively, plant promoters such as the small subunit of RUBISCO or heat shock promoters can be used (Coruzzi et al, EMBO J. 3, 1671-1680, 1984; Broglie et al, Science 224, 838-843, 1984; Winter et al., Results Probl. Cell Differ. 17, 85-105, 1991). These constructs can be introduced into plant cells by direct DNA transformation or by pathogen-mediated transfection. Such techniques are described in a number of generally available reviews (e.g., Hobbs or Murray, in MCGRAW HILL YEARBOOK OF SCIENCE AND TECHNOLOGY, McGraw Hill, New York, N.Y., pp. 191-196, 1992).
An insect system also can be used to express a human nexin-related serine protease inhibitor polypeptide. For example, in one such system Autographa californica nuclear polyhedrosis virus (AcNPV) is used as a vector to express foreign genes in Spodoptera frugiperda cells or in Trichoplusia larvae. Sequences encoding nexin- related serine protease inhibitor polypeptides can be cloned into a non-essential region of the virus, such as the polyhedrin gene, and placed under control of the polyhedrin promoter. Successful insertion of nexin-related serine protease inhibitor polypeptides will render the polyhedrin gene inactive and produce recombinant virus lacking coat protein. The recombinant viruses can then be used to infect S. frugiperda cells or Trichoplusia larvae in which nexin-related serine protease inhibitor polypeptides can be expressed (Engelhard et al., Proc. Nat. Acad. Sci. 91, 3224-3227, 1994).
Mammalian expression systems
A number of viral-based expression systems can be used to express nexin-related serine protease inhibitor polypeptides in mammalian host cells. For example, if an adenovirus is used as an expression vector, sequences encoding nexin-related serine protease inhibitor polypeptides can be ligated into an adenovirus transcription/- translation complex comprising the late promoter and tripartite leader sequence.
Insertion in a non-essential El or E3 region of the viral genome can be used to obtain a viable virus which is capable of expressing a human nexin-related serine protease inhibitor polypeptide in infected host cells (Logan & Shenk, Proc. Natl. Acad. Sci. 81, 3655-3659, 1984). If desired, transcription enhancers, such as the Rous sarcoma virus (RSV) enhancer, can be used to increase expression in mammalian host cells.
Human artificial chromosomes (HACs) also can be used to deliver larger fragments of DNA than can be contained and expressed in a plasmid. HACs of 6M to 10M are constructed and delivered to cells via conventional delivery methods (e.g., liposomes, polycationic amino polymers, or vesicles).
Specific initiation signals also can be used to achieve more efficient translation of sequences encoding nexin-related serine protease inhibitor polypeptides. Such signals include the ATG initiation codon and adjacent sequences. In cases where sequences encoding a human nexin-related serine protease inhibitor polypeptide, its initiation codon, and upstream sequences are inserted into the appropriate expression vector, no additional transcriptional or translational control signals may be needed. However, in cases where only coding sequence, or a fragment thereof, is inserted, exogenous translational control signals (including the ATG initiation codon) should be provided. The initiation codon should be in the coπect reading frame to ensure translation of the entire insert. Exogenous translational elements and initiation codons can be of various origins, both natural and synthetic. The efficiency of expression can be enhanced by the inclusion of enhancers which are appropriate for the particular cell system which is used (see Scharf et al, Results Probl. Cell Differ. 20, 125-162, 1994).
Host cells
A host cell strain can be chosen for its ability to modulate the expression of the inserted sequences or to process the expressed nexin-related serine protease inhibitor polypeptide in the desired fashion. Such modifications of the polypeptide include, but are not limited to, acetylation, carboxylation, glycosylation, phosphorylation, lipidation, and acylation. Post-translational processing which cleaves a "prepro" form of the polypeptide also can be used to facilitate coπect insertion, folding and/or function. Different host cells that have specific cellular machinery and characteristic mechanisms for post-translational activities (e.g., CHO, HeLa, MDCK, HEK293, and WD 8) are available from the American Type Culture Collection (ATCC; 10801
University Boulevard, Manassas, VA 20110-2209) and can be chosen to ensure the coπect modification and processing of the foreign protein.
Stable expression is prefeπed for long-term, high-yield production of recombinant proteins. For example, cell lines which stably express nexin-related serine protease inhibitor polypeptides can be transformed using expression vectors which can contain viral origins of replication and/or endogenous expression elements and a selectable marker gene on the same or on a separate vector. Following the introduction of the vector, cells can be allowed to grow for 1-2 days in an enriched medium before they are switched to a selective medium. The purpose of the selectable marker is to confer resistance to selection, and its presence allows growth and recovery of cells that successfully express the introduced nexin-related serine protease inhibitor sequences. Resistant clones of stably transformed cells can be proliferated using tissue culture techniques appropriate to the cell type. See, for example, A IMAL CELL CULTURE, RL Freshney, ed., 1986.
Any number of selection systems can be used to recover transformed cell lines. These include, but are not limited to, the herpes simplex virus thymidine kinase (Wigler et al., Cell 11, 223-32, 1977) and adenine phosphoribosyltransferase (Lowy et ah, Cell 22, 817-23, 1980) genes that can be employed in tk~ or aprf cells, respectively. Also, antimetabolite, antibiotic, or herbicide resistance can be used as the basis for selection. For example, dhfr confers resistance to methotrexate (Wigler et al, Proc. Natl. Acad. Sci. 77, 3567-70, 1980), npt confers resistance to the aminoglycosides, neomycin and G-418 (Colbere-Garapin et al., J. Mol. Biol. 150, 1-14, 1981), and als and pat confer resistance to chlorsulfuron and phosphinotricin acetyltransferase, respectively (Muπay, 1992, supra). Additional selectable genes have been described. For example, trpB allows cells to utilize indole in place of tryptophan, or hisD, which allows cells to utilize histinol in place of histidine (Hartman & Mulligan, Proc. Natl. Acad. Sci. 85, 8047-51, 1988). Visible markers such as anthocyanins, β-glucuronidase and its substrate GUS, and luciferase and its substrate luciferin, can be used to identify transformants and to quantify the amount of transient or stable protein expression attributable to a specific vector system (Rhodes et al., Methods Mol. Biol. 55, 121-131, 1995).
Detecting expression
Although the presence of marker gene expression suggests that the nexin-related serine protease inhibitor polynucleotide is also present, its presence and expression may need to be confirmed. For example, if a sequence encoding a human nexin- related serine protease inhibitor polypeptide is inserted within a marker gene sequence, transformed cells containing sequences which encode an nexin-related serine protease inhibitor polypeptide can be identified by the absence of marker gene function. Alternatively, a marker gene can be placed in tandem with a sequence encoding an nexin-related serine protease inhibitor polypeptide under the control of a single promoter. Expression of the marker gene in response to induction or selection usually indicates expression of the nexin-related serine protease inhibitor polynucleotide.
Alternatively, host cells which contain a human nexin-related serine protease inhibitor polynucleotide and which express a human nexin-related serine protease inhibitor polypeptide can be identified by a variety of procedures known to those of skill in the art. These procedures include, but are not limited to, DNA-DNA or DNA-RNA hybridizations and protein bioassay or immunoassay techniques that include membrane, solution, or chip-based technologies for the detection and/or quantification of nucleic acid or protein. For example, the presence of a poly- nucleotide sequence encoding an nexin-related serine protease inhibitor polypeptide can be detected by DNA-DNA or DNA-RNA hybridization or amplification using probes or fragments or fragments of polynucleotides encoding a human nexin-related serine protease inhibitor polypeptide. Nucleic acid amplification-based assays involve the use of oligonucleotides selected from sequences encoding an nexin- related serine protease inhibitor polypeptide to detect transformants which contain an nexin-related serine protease inhibitor polynucleotide.
A variety of protocols for detecting and measuring the expression of a human nexin- related serine protease inhibitor polypeptide, using either polyclonal or monoclonal antibodies specific for the polypeptide, are known in the art. Examples include enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), and fluorescence activated cell sorting (FACS). A two-site, monoclonal-based immunoassay using monoclonal antibodies reactive to two non-interfering epitopes on a human nexin-related serine protease inhibitor polypeptide can be used, or a competitive binding assay can be employed. These and other assays are described in Hampton et al, SEROLOGICAL METHODS: A LABORATORY MANUAL, APS Press, St.
Paul, Minn., 1990) and Maddox et al, J. Exp. Med. 158, 1211-1216, 1983).
A wide variety of labels and conjugation techniques are known by those skilled in the art and can be used in various nucleic acid and amino acid assays. Means for producing labeled hybridization or PCR probes for detecting sequences related to polynucleotides encoding nexin-related serine protease inhibitor polypeptides include oligolabeling, nick translation, end-labeling, or PCR amplification using a labeled nucleotide. Alternatively, sequences encoding a human nexin-related serine protease inhibitor polypeptide can be cloned into a vector for the production of an mRNA probe. Such vectors are known in the art, are commercially available, "and can be used to synthesize RNA probes in vitro by addition of labeled nucleotides and an appropriate RNA polymerase such as T7, T3, or SP6. These procedures can be conducted using a variety of commercially available kits (Amersham Pharmacia Biotech, Promega, and US Biochemical). Suitable reporter molecules or labels which can be used for ease of detection include radionuclides, enzymes, and fluorescent, chemiluminescent, or chromogenic agents, as well as substrates, cofactors, inhibitors, magnetic particles, and the like.
Expression and purification of polypeptides
Host cells transformed with nucleotide sequences encoding a human nexin-related serine protease inhibitor polypeptide can be cultured under conditions suitable for the expression and recovery of the protein from cell culture. The polypeptide produced by a transformed cell can be secreted or contained intracellularly depending on the sequence and/or the vector used. As will be understood by those of skill in the art, expression vectors containing polynucleotides which encode nexin-related serine protease inhibitor polypeptides can be designed to contain signal sequences which direct secretion of soluble nexin-related serine protease inhibitor polypeptides through a prokaryotic or eukaryotic cell membrane or which direct the membrane insertion of membrane-bound nexin-related serine protease inhibitor polypeptide.
As discussed above, other constructions can be used to join a sequence encoding a human nexin-related serine protease inhibitor polypeptide to a nucleotide sequence encoding a polypeptide domain which will facilitate purification of soluble proteins. Such purification facilitating domains include, but are not limited to, metal chelating peptides such as histidine-tryptophan modules that allow purification on immobilized metals, protein A domains that allow purification on immobilized immunoglobulin, and the domain utilized in the FLAGS extension/affinity purification system (Immunex Corp., Seattle, Wash.). Inclusion of cleavable linker sequences such as those specific for Factor Xa or enterokinase (Invitrogen, San Diego, CA) between the purification domain and the nexin-related serine protease inhibitor polypeptide also can be used to facilitate purification. One such expression vector provides for expression of a fusion protein containing a human nexin-related serine protease inhibitor polypeptide and 6 histidine residues preceding a thioredoxin or an enterokinase cleavage site. The histidine residues facilitate purification by EMAC
(immobilized metal ion affinity chromatography, as described in Porath et al., Prot. Exp. Purif 3, 263-281, 1992), while the enterokinase cleavage site provides a means for purifying the nexin-related serine protease inhibitor polypeptide from the fusion protein. Vectors that contain fusion proteins are disclosed in Kroll et al., DNA Cell Biol. 12, 441-453, 1993.
Chemical synthesis
Sequences encoding a human nexin-related serine protease inhibitor polypeptide can be synthesized, in whole or in part, using chemical methods well known in the art (see Caruthers et al., Nucl Acids Res. Symp. Ser. 215-223, 1980; Horn et al. Nucl.
Acids Res. Symp. Ser. 225-232, 1980). Alternatively, a human nexin-related serine protease inhibitor polypeptide itself can be produced using chemical methods to synthesize its amino acid sequence, such as by direct peptide synthesis using solid-phase techniques (Merrifield, J Am. Chem. Soc. 85, 2149-2154, 1963; Roberge et al., Science 269, 202-204, 1995). Protein synthesis can be performed using manual techniques or by automation. Automated synthesis can be achieved, for example, using Applied Biosystems 431 A Peptide Synthesizer (Perkin Elmer). Optionally, fragments of nexin-related serine protease inhibitor polypeptides can be separately synthesized and combined using chemical methods to produce a full- length molecule.
The newly synthesized peptide can be substantially purified by preparative high performance liquid chromatography (e.g., Creighton, PROTEINS: STRUCTURES AND MOLECULAR PRINCIPLES, WH Freeman and Co., New York, N.Y., 1983). The composition of a synthetic nexin-related serine protease inhibitor polypeptide can be confirmed by amino acid analysis or sequencing (e.g., the Edman degradation procedure; see Creighton, supra). Additionally, any portion of the amino acid sequence of the nexin-related serine protease inhibitor polypeptide can be altered during direct synthesis and/or combined using chemical methods with sequences from other proteins to produce a variant polypeptide or a fusion protein. As will be understood by those of skill in the art, it may be advantageous to produce nexin-related serine protease inhibitor polypeptide-encoding nucleotide sequences possessing non-naturally occurring codons. For example, codons prefeπed by a particular prokaryotic or eukaryotic host can be selected to increase the rate of protein expression or to produce an RNA transcript having desirable properties, such as a half-life which is longer than that of a transcript generated from the naturally occurring sequence.
The nucleotide sequences disclosed herein can be engineered using methods generally known in the art to alter nexin-related serine protease inhibitor polypeptide- encoding sequences for a variety of reasons, including but not limited to, alterations which modify the cloning, processing, and/or expression of the polypeptide or mRNA product. DNA shuffling by random fragmentation and PCR reassembly of gene fragments and synthetic oligonucleotides can be used to engineer the nucleotide sequences. For example, site-directed mutagenesis can be used to insert new restriction sites, alter glycosylation patterns, change codon preference, produce splice variants, introduce mutations, and so forth.
Antibodies
Any type of antibody known in the art can be generated to bind specifically to an epitope of a human nexin-related serine protease inhibitor polypeptide. "Antibody" as used herein includes intact immunoglobulin molecules, as well as fragments thereof, such as Fab, F(ab')2, and Fv, which are capable of binding an epitope of a human nexin-related serine protease inhibitor polypeptide. Typically, at least 6, 8,
10, or 12 contiguous amino acids are required to form an epitope. However, epitopes which involve non-contiguous amino acids may require more, e.g., at least 15, 25, or 50 amino acids.
An antibody which specifically binds to an epitope of a human nexin-related serine protease inhibitor polypeptide can be used therapeutically, as well as in immuno- chemical assays, such as Western blots, ELISAs, radioimmunoassays, immuno- histochemical assays, immunoprecipitations, or other immunochemical assays known in the art. Various immunoassays can be used to identify antibodies having the desired specificity. Numerous protocols for competitive binding or irnmuno- radiometric assays are well known in the art. Such immunoassays typically involve the measurement of complex formation between an immunogen and an antibody that specifically binds to the immunogen.
Typically, an antibody that specifically binds to a human nexin-related serine protease inhibitor polypeptide provides a detection signal at least 5-, 10-, or 20-fold higher than a detection signal provided with other proteins when used in an immunochemical assay. Preferably, antibodies that specifically bind to nexin-related serine protease inhibitor polypeptides do not detect other proteins in immunochemical assays and can immunoprecipitate a human nexin-related serine protease inhibitor polypeptide from solution.
Human nexin-related serine protease inhibitor polypeptides can be used to immunize a mammal, such as a mouse, rat, rabbit, guinea pig, monkey, or human, to produce polyclonal antibodies. If desired, a human nexin-related serine protease inhibitor polypeptide can be conjugated to a carrier protein, such as bovine serum albumin, thyroglobulin, and keyhole limpet hemocyanin. Depending on the host species, various' adjuvants can be used to increase the immunological response. Such adjuvants include, but are not limited to, Freund's adjuvant, mineral gels (e.g., aluminum hydroxide), and surface active substances (e.g. lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, and dinitrophenol). Among adjuvants used in humans, BCG (bacilli Calmette-Guerin) and Corynebacterium parvum are especially useful.
Monoclonal antibodies that specifically bind to a human nexin-related serine protease inhibitor polypeptide can be prepared using any technique which provides for the production of antibody molecules by continuous cell lines in culture. These techniques include, but are not limited to, the hybridoma technique, the human B-cell hybridoma technique, and the EBV-hybridoma technique (Kohler et al., Nature 256, 495-497, 1985; Kozbor et al, J. Immunol. Methods 81, 31-42, 1985; Cote et al., Proc. Natl. Acad. Sci. 80, 2026-2030, 1983; Cole et al, Mol. Cell Biol. 62, 109-120, 1984).
In addition, techniques developed for the production of "chimeric antibodies," the splicing of mouse antibody genes to human antibody genes to obtain a molecule with appropriate antigen specificity and biological activity, can be used (Morrison et al, Proc. Natl. Acad. Sci. 81, 6851-6855, 1984; Neuberger et al, Nature 312, 604-608,
1984; Takeda et al, Nature 314, 452-454, 1985). Monoclonal and other antibodies also can be "humanized" to prevent a patient from mounting an immune response against the antibody when it is used therapeutically. Such antibodies may be sufficiently similar in sequence to human antibodies to be used directly in therapy or may require alteration of a few key residues. Sequence differences between rodent antibodies and human sequences can be minimized by replacing residues which differ from those in the human sequences by site directed mutagenesis of individual residues or by grating of entire complementarity determining regions. Alternatively, humanized antibodies can be produced using recombinant methods, as described in GB2188638B. Antibodies that specifically bind to a human nexin-related serine protease inhibitor polypeptide can contain antigen binding sites which are either partially or fully humanized, as disclosed in U.S. 5,565,332.
Alternatively, techniques described for the production of single chain antibodies can be adapted using methods known in the art to produce single chain antibodies that specifically bind to nexin-related serine protease inhibitor polypeptides. Antibodies with related specificity, but of distinct idiotypic composition, can be generated by chain shuffling from random combinatorial immunoglobin libraries (Burton, Prόc. Natl. Acad. Sci. 88, 11120-23, 1991). Single-chain antibodies also can be constructed using a DNA amplification method, such as PCR, using hybridoma cDNA as a template (Thirion et al, 1996, Eur. J. Cancer Prev. 5, 507-11). Single-chain antibodies can be mono- or bispecific, and can be bivalent or tetravalent. Construction of tetravalent, bispecific single-chain antibodies is taught, for example, in Coloma & Morrison, 1997, Nat. Biotechnol. 15,
159-63. Construction of bivalent, bispecific single-chain antibodies is taught in Mallender & Noss, 1994, J. Biol. Chem. 269, 199-206.
A nucleotide sequence encoding a single-chain antibody can be constructed using manual or automated nucleotide synthesis, cloned into an expression construct using standard recombinant DΝA methods, and introduced into a cell to express the coding sequence, as described below. Alternatively, single-chain antibodies can be produced directly using, for example, filamentous phage technology (Verhaar et al, 1995, Int. J. Cancer 61, 497-501; Νicholls et al, 1993, J Immunol. Meth. 165, 81- 91).
Antibodies which specifically bind to nexin-related serine protease inhibitor polypeptides also can be produced by inducing in vivo production in the lymphocyte population or by screening immunoglobulin libraries or panels of highly specific binding reagents as disclosed in the literature (Orlandi et al., Proc. Natl. Acad. Sci.
86, 3833-3837, 1989; Winter et al, Nature 349, 293-299, 1991).
Other types of antibodies can be constructed and used therapeutically in methods of the invention. For example, chimeric antibodies can be constructed as disclosed in WO 93/03151. Binding proteins which are derived from immunoglobulins and which are multivalent and multispecific, such as the "diabodies" described in WO 94/13804, also can be prepared.
Antibodies according to the invention can be purified by methods well known in the art. For example, antibodies can be affinity purified by passage over a column to which a human nexin-related serine protease inhibitor polypeptide is bound. The bound antibodies can then be eluted from the column using a buffer with a high salt concentration.
Antisense oligonucleotides
Antisense oligonucleotides are nucleotide sequences that are complementary to a specific DNA or RNA sequence. Once introduced into a cell, the complementary nucleotides combine with natural sequences produced by the cell to form complexes and block either transcription or translation. Preferably, an antisense oligonucleotide is at least 11 nucleotides in length, but can be at least 12, 15, 20, 25, 30, 35, 40, 45, or 50 or more nucleotides long. Longer sequences also can be used. Antisense oligonucleotide molecules can be provided in a DNA construct and introduced into a cell as described above to decrease the level of nexin-related serine protease inhibitor gene products in the cell.
Antisense oligonucleotides can be deoxyribonucleotides, ribonucleotides, or a combination of both. Oligonucleotides can be synthesized manually or by an automated synthesizer, by covalently linking the 5' end of one nucleotide with the 3' end of another nucleotide with non-phosphodiester internucleotide linkages such alkylphosphonates, phosphorothioates, phosphorodithioates, alkylphosphonothioates, alkylphosphonates, phosphoramidates, phosphate esters, carbamates, acetamidate, carboxymethyl esters, carbonates, and phosphate triesters. See Brown, Meth. Mol. Biol. 20, 1-8, 1994; Sonveaux, Meth. Mol. Biol. 26, 1-72, 1994; Uhlmann et al, Chem. Rev. 90, 543-583, 1990.
Modifications of nexin-related serine protease inhibitor gene expression can be obtained by designing antisense oligonucleotides that will form duplexes to the control, 5', or regulatory regions of the nexin-related serine protease inhibitor gene. Oligonucleotides derived from the transcription initiation site, e.g., between positions -10 and +10 from the start site, are prefeπed. Similarly, inhibition can be achieved using "triple helix" base-pairing methodology. Triple helix pairing is useful because it causes inhibition of the ability of the double helix to open sufficiently for the binding of polymerases, transcription factors, or chaperons. Therapeutic advances using triplex DNA have been described in the literature (e.g., Gee et al., in Huber & Can, MOLECULAR AND TMMUNOLOGIC APPROACHES, Futura Publishing Co., Mt. Kisco, N.Y., 1994). An antisense oligonucleotide also can be designed to block translation of mRNA by preventing the transcript from binding to ribosomes.
Precise complementarity is not required for successful complex formation between an antisense oligonucleotide and the complementary sequence of a human nexin- related serine protease inhibitor polynucleotide. Antisense oligonucleotides which comprise, for example, 2, 3, 4, or 5 or more stretches of contiguous nucleotides which are precisely complementary to an nexin-related serine protease inhibitor polynucleotide, each separated by a stretch of contiguous nucleotides which are not complementary to adjacent nexin-related serine protease inhibitor nucleotides, can provide sufficient targeting specificity for nexin-related serine protease inhibitor mRNA. Preferably, each stretch of complementary contiguous nucleotides is at least 4, 5, 6, 1, or 8 or more nucleotides in length. Non-complementary intervening sequences are preferably 1, 2, 3, or 4 nucleotides in length. One skilled in the art can easily use the calculated melting point of an antisense-sense pair to determine the degree of mismatching which will be tolerated between a particular antisense oligonucleotide and a particular nexin-related serine protease inhibitor polynucleotide sequence.
Antisense oligonucleotides can be modified without affecting their ability to hybridize to a human nexin-related serine protease inhibitor polynucleotide. These modifications can be internal or at one or both ends of the antisense molecule. For example, internucleoside phosphate linkages can be modified by adding cholesteryl or diamine moieties with varying numbers of carbon residues between the amino groups and terminal ribose. Modified bases and/or sugars, such as arabinose instead of ribose, or a 3', 5 '-substituted oligonucleotide in which the 3' hydroxyl group or the 5' phosphate group are substituted, also can be employed in a modified antisense oligonucleotide. These modified oligonucleotides can be prepared by methods well known in the art. See, e.g., Agrawal et al, Trends Biotechnol. 10, 152-158, 1992; Uhlmann et al., Chem. Rev. 90, 543-584, 1990; Uhlmann et al., Tetrahedron. Lett. 215, 3539-3542, 1987.
Ribozymes
Ribozymes are RNA molecules with catalytic activity. See, e.g., Cech, Science 236, 1532-1539; 1987; Cech, Ann. Rev. Biochem. 59, 543-568; 1990, Cech, Curr. Opin. Struct. Biol. 2, 605-609; 1992, Couture & Stinchcomb, Trends Genet. 12, 510-515, 1996. Ribozymes can be used to inhibit gene function by cleaving an RNA sequence, as is known in the art (e.g., Haseloff et al., U.S. Patent 5,641,673). The mechanism of ribozyme action involves sequence-specific hybridization of the ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage. Examples include engineered hammerhead motif ribozyme molecules that can specifically and efficiently catalyze endonucleolytic cleavage of specific nucleotide sequences.
The coding sequence of a human nexin-related serine protease inhibitor poly- nucleotide can be used to generate ribozymes that will specifically bind to mRNA transcribed from the nexin-related serine protease inhibitor polynucleotide. Methods of designing and constructing ribozymes which can cleave other RNA molecules in trans in a highly sequence specific manner have been developed and described in the art (see Haseloff et al. Nature 334, 585-591, 1988). For example, the cleavage activity of ribozymes can be targeted to specific RNAs by engineering a discrete
"hybridization" region into the ribozyme. The hybridization region contains a sequence complementary to the target RNA and thus specifically hybridizes with the target (see, for example, Gerlach et al, EP 321,201).
Specific ribozyme cleavage sites within a human nexin-related serine protease inhibitor RNA target can be identified by scanning the target molecule for ribozyme cleavage sites which include the following sequences: GUA, GUU, and GUC. Once identified, short RNA sequences of between 15 and 20 ribonucleotides coπesponding to the region of the target RNA containing the cleavage site can be evaluated for secondary structural features which may render the target inoperable. Suitability of candidate nexin-related serine protease inhibitor RNA targets also can be evaluated by testing accessibility to hybridization with complementary oligonucleotides using ribonuclease protection assays. Longer complementary sequences can be used to increase the affinity of the hybridization sequence for the target. The hybridizing and cleavage regions of the ribozyme can be integrally related such that upon hybridizing to the target RNA through the complementary regions, the catalytic region of the ribozyme can cleave the target.
Ribozymes can be introduced into cells as part of a DNA construct. Mechanical methods, such as microinjection, liposome-mediated transfection, electroporation, or calcium phosphate precipitation, can be used to introduce a ribozyme-containing
DNA construct into cells in which it is desired to decrease nexin-related serine protease inhibitor expression. Alternatively, if it is desired that the cells stably retain the DNA construct, the construct can be supplied on a plasmid and maintained as a separate element or integrated into the genome of the cells, as is known in the art. A ribozyme-encoding DNA construct can include transcriptional regulatory elements, such as a promoter element, an enhancer or UAS element, and a transcriptional terminator signal, for controlling transcription of ribozymes in the cells.
As taught in Haseloff et al., U.S. Patent 5,641,673, ribozymes can be engineered so that ribozyme expression will occur in response to factors that induce expression of a target gene. Ribozymes also can be engineered to provide an additional level of regulation, so that destruction of mRNA occurs only when both a ribozyme and a target gene are induced in the cells. Differentially expressed genes
Described herein are methods for the identification of genes whose products interact with human nexin-related serine protease inhibitor. Such genes may represent genes that are differentially expressed in disorders including, but not limited to, cancer,
CNS disorders, cardiovascular disorders, genitourinary disorders, hematological disorders, gastrointestinal disorders, COPD, and asthma. Further, such genes may represent genes that are differentially regulated in response to manipulations relevant to the progression or treatment of such diseases. Additionally, such genes may have a temporally modulated expression, increased or decreased at different stages of tissue or organism development. A differentially expressed gene may also have its expression modulated under control versus experimental conditions. En addition, the human nexin-related serine protease inhibitor gene or gene product may itself be tested for differential expression.
The degree to which expression differs in a normal versus a diseased state need only be large enough to be visualized via standard characterization techniques such as differential display techniques. Other such standard characterization techniques by which expression differences may be visualized include but are not limited to, quantitative RT (reverse transcriptase), PCR, and Northern analysis.
To identify differentially expressed genes total RNA or, preferably, mRNA is isolated from tissues of interest. For example, RNA samples are obtained from tissues of experimental subjects and from coπesponding tissues of control subjects. Any RNA isolation technique that does not select against the isolation of mRNA may be utilized for the purification of such RNA samples. See, for example, Ausubel et al, ed., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, Inc. New York, 1987-1993. Large numbers of tissue samples may readily be processed using techniques well known to those of skill in the art, such as, for example, the single-step RNA isolation process of Chomczynski, U.S. Patent 4,843,155. Transcripts within the collected RNA samples that represent RNA produced by differentially expressed genes are identified by methods well known to those of skill in the art. They include, for example, differential screening (Tedder et al., Proc. Natl. Acad. Sci. U.S.A. 85, 208-12, 1988), subrractive hybridization (Hedrick et al, Nature 308, 149-53; Lee et al., Proc. Natl. Acad. Sci. U.S.A. 88, 2825, 1984), and, preferably, differential display (Liang & Pardee, Science 257, 961-11, 1992; U.S. Patent 5,262,311).
The differential expression information may itself suggest relevant methods for the treatment of disorders involving the human nexin-related serine protease inhibitor.
For example, treatment may include a modulation of expression of the differentially expressed genes and/or the gene encoding the human nexin-related serine protease inhibitor. The differential expression information may indicate whether the expression or activity of the differentially expressed gene or gene product or the human nexin-related serine protease inhibitor gene or gene product are up-regulated or down-regulated.
Screening methods
The invention provides assays for screening test compounds that bind to or modulate the activity of a human nexin-related serine protease inhibitor polypeptide or a human nexin-related serine protease inhibitor polynucleotide. A test compound preferably binds to a human nexin-related serine protease inhibitor polypeptide or polynucleotide. More preferably, a test compound decreases or increases functional activity by at least about 10, preferably about 50, more preferably about 75, 90, or
100% relative to the absence of the test compound.
Test compounds
Test compounds can be pharmacologic agents already known in the art or can be compounds previously unknown to have any pharmacological activity. The compounds can be naturally occurring or designed in the laboratory. They can be isolated from microorganisms, animals, or plants, and can be produced recombinantly, or synthesized by chemical methods known in the art. If desired, test compounds can be obtained using any of the numerous combinatorial library methods known in. the art, including but not limited to, biological libraries, spatially addressable parallel solid phase or solution phase libraries, synthetic library methods requiring deconvolution, the "one-bead one-compound" library method, and synthetic library methods using affinity chromatography selection. The biological library approach is limited to polypeptide libraries, while the other four approaches are applicable to polypeptide, non-peptide oligomer, or small molecule libraries of compounds. See Lam, Anticancer Drug Des. 12, 145, 1997.
Methods for the synthesis of molecular libraries are well known in the art (see, for example, DeWitt etal, Proc. Natl. Acad. Sci. U.S.A. 90, 6909, 1993; Erb et al. Proc. Natl. Acad. Sci. U.S.A. 91, 11422, 1994; Zuckennann etal, J. Med. Chem. 37, 2678,
1994; Cho et al, Science 261, 1303, 1993; Carell et al, Angew. Chem. Int. Ed. Engl. 33, 2059, 1994; Carell et al, Angew. Chem. Int. Ed. Engl. 33, 2061; Gallop et al, J. Med. Chem. 37, 1233, 1994). Libraries of compounds can be presented in solution (see, e.g., Houghten, BioTechniques 13, 412-421, 1992), or on beads (Lam, Nature 354, 82-84, 1991), chips (Fodor, Nature 364, 555-556, 1993), bacteria or spores
(Ladner, U.S. Patent 5,223,409), plasmids (Cull et al, Proc. Natl. Acad. Sci. U.S.A. 89, 1865-1869, 1992), or phage (Scott & Smith, Science 249, 386-390, 1990; Devlin, Science 249, 404-406, 1990); Cwirla et al, Proc. Natl Acad. Sci. 97, 6378-6382, 1990; Felici, J Mol. Biol. 222, 301-310, 1991; and Ladner, U.S. Patent 5,223,409).
High throughput screening
Test compounds can be screened for the ability to bind to nexin-related serine protease inhibitor polypeptides or polynucleotides or to affect nexin-related serine protease inhibitor activity or nexin-related serine protease inhibitor gene expression using high throughput screening. Using high throughput screening, many discrete compounds can be tested in parallel so that large numbers of test compounds can be quickly screened. The most widely established techniques utilize 96-well microtiter plates. The wells of the microtiter plates typically require assay volumes that range from 50 to 500 μl. In addition to the plates, many instruments, materials, pipettors, robotics, plate washers, and plate readers are commercially available to fit the
96-well format.
Alternatively, "free format assays," or assays that have no physical barrier between samples, can be used. For example, an assay using pigment cells (melanocytes) in a simple homogeneous assay for combinatorial peptide libraries is described by
Jayawickreme et al, Proc. Natl. Acad. Sci. U.S.A. 19, 1614-18 (1994). The cells are placed under agarose in petri dishes, then beads that carry combinatorial compounds are placed on the surface of the agarose. The combinatorial compounds are partially released the compounds from the beads. Active compounds can be visualized as dark pigment areas because, as the compounds diffuse locally into the gel matrix, the active compounds cause the cells to change colors. ,
Another example of a free format assay is described by Chelsky, "Strategies for Screening Combinatorial Libraries: Novel and Traditional Approaches," reported at the First Annual Conference of The Society for Biomolecular Screening in
Philadelphia, Pa. (Nov. 7-10, 1995). Chelsky placed a simple homogenous enzyme assay for carbonic anhydrase inside an agarose gel such that the enzyme in the gel would cause a color change throughout the gel. Thereafter, beads carrying combinatorial compounds via a photolinker were placed inside the gel and the compounds were partially released by UN-light. Compounds that inhibited the enzyme were observed as local zones of inhibition having less color change.
Yet another example is described by Salmon et al., Molecular Diversity 2, 57-63 (1996). In this example, combinatorial libraries were screened for compounds that had cytotoxic effects on cancer cells growing in agar. Another high throughput screening method is described in Beutel et al., U.S. Patent 5,976,813. In this method, test samples are placed in a porous matrix. One or more assay components are then placed within, on top of, or at the bottom of a matrix such as a gel, a plastic sheet, a filter, or other form of easily manipulated solid support. When samples are introduced to the porous matrix they diffuse sufficiently slowly, such that the assays can be performed without the test samples running together.
Binding assays
For binding assays, the test compound is preferably a small molecule that binds to the nexin-related serine protease inhibitor polypeptide, such that normal biological activity is prevented. Examples of such small molecules include, but are not limited to, small peptides or peptide-like molecules.
In binding assays, either the test compound or the nexin-related serine protease inhibitor polypeptide can comprise a detectable label, such as a fluorescent, radio- isotopic, chemiluminescent, or enzymatic label, such as horseradish peroxidase, alkaline phosphatase, or luciferase. Detection of a test compound that is bound to the nexin-related serine protease inhibitor polypeptide can then be accomplished, for example, by direct counting of radioemmission, by scintillation counting, or by determining conversion of an appropriate substrate to a detectable product.
Alternatively, binding of a test compound to a human nexin-related serine protease inhibitor polypeptide can be determined without labeling either of the interactants. For example, a microphysiometer can be used to detect binding of a test compound with a human nexin-related serine protease inhibitor polypeptide. A microphysiometer (e.g., Cytosensor™) is an analytical instrument that measures the rate at which a cell acidifies its environment using a light-addressable potentiometric sensor (LAPS). Changes in this acidification rate can be used as an indicator of the interaction between a test compound and a human nexin-related serine protease inhibitor polypeptide (McConnell et al., Science 257, 1906-1912, 1992). Determining the ability of a test compound to bind to a human nexin-related serine protease inhibitor polypeptide also can be accomplished using a technology such as real-time Bimolecular Interaction Analysis (BIA) (Sjolander & Urbaniczky, Anal Chem. 63, 2338-2345, 1991, and Szabo et al, Curr. Opin. Struct. Biol. 5, 699-705, 1995). BIA is a technology for studying biospecific interactions in real time, without labeling any of the interactants (e.g., BEAcore™). Changes in the optical phenomenon surface plasmon resonance (SPR) can be used as an indication of real-time reactions between biological molecules.
In yet another aspect of the invention, a human nexin-related serine protease inhibitor polypeptide can be used as a "bait protein" in a two-hybrid assay or three-hybrid assay (see, e.g., U.S. Patent 5,283,317; Zervos et al, Cell 72, 223-232, 1993; Madura et al, J. Biol. Chem. 268, 12046-12054, 1993; Bartel et al, BioTechniques 14, 920-924, 1993; Iwabuchi et al, Oncogene 8, 1693-1696, 1993; and Brent
W094/10300), to identify other proteins which bind to or interact with the nexin- related serine protease inhibitor polypeptide and modulate its activity.
The two-hybrid system is based on the modular nature of most transcription factors, which consist of separable DNA-binding and activation domains. Briefly, the assay utilizes two different DNA constructs. For example, in one construct, polynucleotide encoding a human nexin-related serine protease inhibitor polypeptide can be fused to a polynucleotide encoding the DNA binding domain of a known transcription factor
(e.g., GAL-4). In the other construct a DNA sequence that encodes an unidentified protein ("prey" or "sample") can be fused to a polynucleotide that codes for the activation domain of the known transcription factor. If the "bait" and the "prey" proteins are able to interact in vivo to form an protein-dependent complex, the
DNA-binding and activation domains of the transcription factor are brought into close proximity. This proximity allows transcription of a reporter gene (e.g., LacZ), which is operably linked to a transcriptional regulatory site responsive to the transcription factor. Expression of the reporter gene can be detected, and cell colonies containing the functional transcription factor can be isolated and used to obtain the DNA sequence encoding the protein that interacts with the nexin-related serine protease inhibitor polypeptide.
It may be desirable to immobilize either the nexin-related serine protease inhibitor polypeptide (or polynucleotide) or the test compound to facilitate separation of bound from unbound forms of one or both of the interactants, as well as to accommodate automation of the assay. Thus, either the nexin-related serine protease inhibitor polypeptide (or polynucleotide) or the test compound can be bound to a solid support. Suitable solid supports include, but are not limited to, glass or plastic slides, tissue culture plates, microtiter wells, tubes, silicon chips, or particles such as beads (including, but not limited to, latex, polystyrene, or glass beads). Any method known in the art can be used to attach the polypeptide (or polynucleotide) or test compound to a solid support, including use of covalent and non-covalent linkages, passive absorption, or pairs of binding moieties attached respectively to the polypeptide (or polynucleotide) or test compound and the solid support. Test compounds are preferably bound to the solid support in an aπay, so that the location of individual test compounds can be tracked. Binding of a test compound to a human nexin-related serine protease inhibitor polypeptide (or polynucleotide) can be accomplished in any vessel suitable for containing the reactants. Examples of such vessels include microtiter plates, test tubes, and microcentrifuge tubes.
In one embodiment, the nexin-related serine protease inhibitor polypeptide is a fusion protein comprising a domain that allows the nexin-related serine protease inhibitor polypeptide to be bound to a solid support. For example, glutathione-S-transferase fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis, Mo.) or glutathione derivatized microtiter plates, which are then combined with the test compound or the test compound and the non-adsorbed nexin-related serine protease inhibitor polypeptide; the mixture is then incubated under conditions conducive to complex formation (e.g., at physiological conditions for salt and pH).
Following incubation, the beads or microtiter plate wells are washed to remove any unbound components. Binding of the interactants can be determined either directly or indirectly, as described above. Alternatively, the complexes can be dissociated from the solid support before binding is determined.
Other techniques for immobilizing proteins or polynucleotides on a solid support also can be used in the screening assays of the invention. For example, either a human nexin-related serine protease inhibitor polypeptide (or polynucleotide) or a test compound can be immobilized utilizing conjugation of biotin and streptavidin. Biotinylated nexin-related serine protease inhibitor polypeptides (or polynucleotides) or test compounds can be prepared from biotin-NHS(N- hydroxysuccinimide) using techniques well known in the art (e.g., biotinylation kit, Pierce Chemicals, Rockford, 111.) and immobilized in the wells of streptavidin-coated 96 well plates (Pierce Chemical). Alternatively, antibodies which specifically bind to a nexin-related serine protease inhibitor polypeptide, polynucleotide, or a test compound, but which do not interfere with a desired binding site can be derivatized to the wells of the plate.
Unbound target or protein can be trapped in the wells by antibody conjugation.
Methods for detecting such complexes, in addition to those described above for the GST-immobilized complexes, include immunodetection of complexes using anti- bodies which specifically bind to the nexin-related serine protease inhibitor polypeptide or test compound, enzyme-linked assays which rely on detecting an activity of the nexin-related serine protease inhibitor polypeptide, and SDS gel electrophoresis under non-reducing conditions.
Screening for test compounds which bind to a human nexin-related serine protease inhibitor polypeptide or polynucleotide also can be carried out in an intact cell. Any cell which comprises a nexin-related serine protease inhibitor polypeptide or polynucleotide can be used in a cell-based assay system. A nexin-related serine protease inhibitor polynucleotide can be naturally occurring in the cell or can be introduced using techniques such as those described above. Binding of the test compound to a nexin-related serine protease inhibitor polypeptide or polynucleotide is determined as described above.
Functional activity
Test compounds can be tested for the ability to increase or decrease the functional activity of a human nexin-related serine protease inhibitor polypeptide. Functional activity, e.g., serine protease inhibiting activity, can be measured, for example, as is well known in the art. See, e.g., U.S. Patent 6,197,519.
Functional assays can be carried out after contacting either a purified nexin-related serine protease inhibitor polypeptide, a cell membrane preparation, or an intact cell with a test compound. A test compound that decreases functional activity of a human nexin-related serine protease inhibitor polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100%ι is identified as a potential therapeutic agent for decreasing nexin-related serine protease inhibitor activity. A test compound which increases functional activity of a human nexin- related serine protease inhibitor polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% is identified as a potential therapeutic agent for increasing human nexin-related serine protease inhibitor activity.
Gene expression
In another embodiment, test compounds that increase or decrease nexin-related serine protease inhibitor gene expression are identified. A nexin-related serine protease inhibitor polynucleotide is contacted with a test compound, and the expression of an RNA or polypeptide product of the nexin-related serine protease inhibitor polynucleotide is determined. The level of expression of appropriate mRNA or polypeptide in the presence of the test compound is compared to the level of expression of mRNA or polypeptide in the absence of the test compound. The test compound can then be identified as a modulator of expression based on this comparison. For example, when expression of mRNA or polypeptide is greater in the presence of the test compound than in its absence, the test compound is identified as a stimulator or enhancer of the mRNA or polypeptide expression. Alternatively, when expression of the mRNA or polypeptide is less in the presence of the test compound than in its absence, the test compound is identified as "an inhibitor of the mRNA or polypeptide expression.
The level of nexin-related serine protease inhibitor mRNA or polypeptide expression in the cells can be determined by methods well known in the art for detecting mRNA or polypeptide. Either qualitative or quantitative methods can be used. The presence of polypeptide products of a human nexin-related serine protease inhibitor polynucleotide can be determined, for example, using a variety of techniques known in the art, including immunochemical methods such as radioimmunoassay, Western blotting, and immunohistochemistry. Alternatively, polypeptide synthesis can be determined in vivo, in a cell culture, or in an in vitro translation system by detecting incorporation of labeled amino acids into a human nexin-related serine protease inhibitor polypeptide.
Such screening can be carried out either in a cell-free assay system or in an intact cell. Any cell that expresses a human nexin-related serine protease inhibitor polynucleotide can be used in a cell-based assay system. The nexin-related serine protease inhibitor polynucleotide can be naturally occurring in the cell or can be introduced using techniques such as those described above. Either a primary culture or an established cell line, such as CHO or human embryonic kidney 293 cells, can be used.
Pharmaceutical compositions
The invention also provides pharmaceutical compositions that can be administered to a patient to achieve a therapeutic effect. Pharmaceutical compositions of the invention can comprise, for example, a human nexin-related serine protease inhibitor polypeptide, nexin-related serine protease inhibitor polynucleotide, ribozymes or antisense oligonucleotides, antibodies which specifically bind to a nexin-related serine protease inhibitor polypeptide, or mimetics, activators, or inhibitors of a human nexin-related serine protease inhibitor polypeptide activity. The compositions can be administered alone or in combination with at least one other agent, such as stabilizing compound, which can be administered in any sterile, biocompatible pharmaceutical carrier, including, but not limited to, saline, buffered saline, dextrose, and water. The compositions can be administered to a patient alone, or in combination with other agents, drugs or hormones.
In addition to the active ingredients, these pharmaceutical compositions can contain suitable pharmaceutically-acceptable carriers comprising excipients and auxiliaries that facilitate processing of the active compounds into preparations which can be used pharmaceutically. Pharmaceutical compositions of the invention can be administered by any number of routes including, but not limited to, oral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, intraventricular, transdermal, subcutaneous, intraperitoneal, intranasal, parenteral, topical, sublingual, or rectal means. Pharmaceutical compositions for oral administration can be formulated using pharmaceutically acceptable carriers well known in the art in dosages suitable for oral administration. Such carriers enable the pharmaceutical compositions to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for ingestion by the patient.
Pharmaceutical preparations for oral use can be obtained through combination of active compounds with solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores. Suitable excipients are carbohydrate or protein fillers, such as sugars, including lactose, sucrose, mannitol, or sorbitol; starch from corn, wheat, rice, potato, or other plants; cellulose, such as methyl cellulose, hydroxypropylmethyl-cellulose, or sodium carboxymethylcellulose; gums including arabic and tragacanth; and proteins such as gelatin and collagen. If desired, disintegrating or solubilizing agents can be added, such as the cross-linked polyvinyl pyπolidone, agar, alginic acid, or a salt thereof, such as sodium alginate.
Dragee cores can be used in conjunction with suitable coatings, such as concentrated sugar solutions, which also can contain gum arabic, talc, polyvinylpyπolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures. Dyestuffs or pigments can be added to the tablets or dragee coatings for product identification or to characterize the quantity of active compound, i.e., dosage.
Pharmaceutical preparations that can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a coating, such as glycerol or sorbitol. Push-fit capsules can contain active ingredients mixed with a filler or binders, such as lactose or starches, lubricants, such as talc or magnesium stearate, and, optionally, stabilizers. In soft capsules, the active compounds can be dissolved or suspended in suitable liquids, such as fatty oils, liquid, or liquid polyethylene glycol with or without stabilizers.
Pharmaceutical formulations suitable for parenteral administration can be formulated in aqueous solutions, preferably in physiologically compatible buffers such as
Hanks' solution, Ringer's solution, or physiologically buffered saline. Aqueous injection suspensions can contain substances that increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran.
Additionally, suspensions of the active compounds can be prepared as appropriate oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes. Non-lipid polycationic amino polymers also can be used for delivery.
Optionally, the suspension also can contain suitable stabilizers or agents that increase the solubility of the compounds to allow for the preparation of highly concentrated solutions. For topical or nasal administration, penetrants appropriate to the particular barrier to be permeated are used in the formulation. Such penetiants are generally known in the art.
The pharmaceutical compositions of the present invention can be manufactured in a manner that is known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping, or lyophilizing processes. The pharmaceutical composition can be provided as a salt and can be formed with many acids, including but not limited to, hydrochloric, sulfuric, acetic, lactic, tartaric, malic, succinic, etc. Salts tend to be more soluble in aqueous or other protonic solvents than are the coπesponding free base forms. In other cases, the prefeπed preparation can be a lyophilized powder which can contain any or all of the following: 1-50 mM histidine, 0.1%-2% sucrose, and 2-7% mannitol, at a pH range of 4.5 to 5.5, that is combined with buffer prior to use.
Further details on techniques for formulation and administration can be found in the latest edition of REMINGTON'S PHARMACEUTICAL SCIENCES (Maack Publishing Co., Easton, Pa.). After pharmaceutical compositions have been prepared, they can be placed in an appropriate container and labeled for treatment of an indicated condition. Such labeling would include amount, frequency, and method of admini- stration.
Therapeutic indications and methods
Human nexin-related serine protease inhibitor can be regulated to treat cancer, CNS disorders, cardiovascular disorders, genitourinary disorders, hematological disorders, gastrointestinal disorders, COPD, and asthma.
Cancer
The novel human nexin-related serine protease inhibitor is highly expressed in the following cancer tissues: lung tumor, stomach tumor, ovary tumor, ileum tumor, colon tumor, breast tumor. The expression in the above mentioned tissues and in particular the differential expression between diseased tissue lung tumor and healthy tissue "lung, between diseased tissue stomach tumor and healthy tissue stomach, between diseased tissue colon tumor and healthy tissue colon, between diseased tissue breast tumor and healthy tissue breast demonstrates that the novel human nexin-related serine protease inhibitor or mRNA can be used to diagnose cancer. Additionally, the activity of the novel human nexin-related serine protease inhibitor can be modulated to treat cancer.
Cancer disorders within the scope of the invention comprise any disease of an organ or tissue in mammals characterized by poorly controlled or uncontrolled multiplication of normal or abnormal cells in that tissue and its effect on the body as a whole. Cancer diseases within the scope of the invention comprise benign neoplasms, dysplasias, hyperplasias as well as neoplasms showing metastatic growth or any other transformations, e.g., leukoplakias, which often precede a breakout of cancer.
Cells and tissues are cancerous when they grow more rapidly than normal cells, displacing or spreading into the surrounding healthy tissue or any other tissues of the body described as metastatic growth, assume abnormal shapes and sizes, show changes in their nucleocytoplasmatic ratio, nuclear polychromasia, and finally may cease.
Cancerous cells and tissues may affect the body as a whole when causing paraneo- plastic syndromes or if cancer occurs within a vital organ or tissue, normal function will be impaired or halted, with possible fatal results. The ultimate involvement of a vital organ by cancer, either primary or metastatic, may lead to the death of the mammal affected. Cancer tends to spread, and the extent of its spread is usually related to an individual's chances of surviving the disease. Cancers are generally said to be in one of three stages of growth: early, or localized, when a tumor is still confined to the tissue of origin, or primary site; direct extension, where cancer cells from the tumor have invaded adjacent tissue or have spread only to regional lymph nodes; or metastasis, in which cancer cells have migrated to distant parts of the body from the primary site, via the blood or lymph systems, and have established secondary sites of infection. Cancer is said to be malignant because of its tendency to cause death if not treated.
Benign tumors usually do not cause death, although they may if they interfere with a normal body function by virtue of their location, size, or paraneoplastic side effects. Hence, benign tumors fall under the definition of cancer within the scope of the invention as well. In general, cancer cells divide at a higher rate than do normal cells, but the distinction between the growth of cancerous and normal tissues is not so much the rapidity of cell division in the former as it is the partial or complete loss of growth restraint in cancer cells and their failure to differentiate into a useful, limited tissue of the type that characterizes the functional equilibrium of growth of normal tissue.
Cancer tissues may express certain molecular receptors and probably are influenced by the host's susceptibility and immunity and it is known that certain cancers of the breast and prostate, for example, are considered dependent on specific hormones for their existence. The term "cancer" under the scope of the invention is not limited to simple benign neoplasia but includes any other benign and malign neoplasia, such as 1) carcinoma, 2) sarcoma, 3) carcinosarcoma, 4) cancers of the blood-forming tissues, 5) tumors of nerve tissues including the brain, and 6) cancer of skin cells.
Carcinoma occurs in epithelial tissues, which cover the outer body (the skin) and line mucous membranes and the inner cavitary structures of organs e.g. such as the breast, lung, the respiratory and gastrointestinal tracts, the endocrine glands, and the genitourinary system. Ductal or glandular elements may persist in epithelial tumors, as in adenocarcinomas, e.g., thyroid adenocarcinoma, gastric adenocarcinoma, and uterine adenocarcinoma. Cancers of the pavement-cell epithelium of the skin and of certain mucous membranes, such as cancers of the tongue, lip, larynx, urinary bladder, uterine cervix, or penis, may be termed epidermoid or squamous-cell carcinomas of the respective tissues and are within the scope of the definition of cancer as well.
Sarcomas develop in connective tissues, including fibrous tissues, adipose (fat) tissues, muscle, blood vessels, bone, and cartilage such as osteogenic sarcoma, liposarcoma, fibrosarcoma, and synovial sarcoma.
Carcinosarcoma is cancer that develops in both epithelial and connective tissue. Cancer disease within the scope of this definition may be primary or secondary, whereby primary indicates that the cancer originated in the tissue where it is found rather than was established as a secondary site through metastasis from another lesion. Cancers and tumor diseases within the scope of this definition may be benign or malign and may affect all anatomical structures of the body of a mammal. By example, to they comprise cancers and tumor diseases of I) the bone maπow and bone maπow derived cells (leukemias), II) the endocrine and exocrine glands, such as the thyroid, parathyroid, pituitary, adrenal glands, salivary glands, and pancreas III) the breast, such as benign or malignant tumors in the mammary glands of either a male or a female, the mammary ducts, adenocarcinoma, medullary carcinoma, comedocarcinoma, Paget's disease of the nipple, inflammatory carcinoma of the young woman, IN) the lung, N) the stomach, NI) the liver and spleen, Nil) the small intestine, NIII) the colon, IX) the bone and its supportive and connective tissues such as malignant or benign bone tumor, such as malignant osteogenic sarcoma, benign osteoma, cartilage tumors, malignant chondrosarcoma or benign chondroma, bone maπow tumors such as malignant myeloma or benign eosinophilic granuloma, as well as metastatic tumors from bone tissues at other locations of the body; X) the mouth, throat, larynx, and the esophagus, XI) the urinary bladder and the internal and external organs and structures of the urogenital system of male and female such as the ovaries, uterus, cervix of the uterus, testes, and prostate gland, XII) the prostate, XIII) the pancreas, such as ductal carcinoma of the pancreas; XIN) the lymphatic tissue such as lymphomas and other tumors of lymphoid origin, XV) the skin, XVI) cancers and tumor diseases of all anatomical structures belonging to the respiratory systems including thoracal muscles and linings, XVII) primary or secondary cancer of the lymph nodes, XVIII) the tongue and of the bony structures of the hard palate or sinuses, XNIN) the mouth, cheeks, neck and salivary glands, XX) the blood vessels including the heart and their linings, XXI) the smooth or skeletal muscles and their ligaments and linings, XXII) the peripheral, the autonomous, the central nervous system including the cerebellum, and XXIII) the adipose tissue.
Cancer is a disease fundamentally caused by oncogenic cellular transformation. There are several hallmarks of transformed cells that distinguish them from their normal counterparts and underlie the pathophysiology of cancer. These include uncontrolled cellular proliferation, unresponsiveness to normal death-inducing signals (immortalization), increased cellular motility and invasiveness, increased ability to recruit blood supply through induction of new. blood vessel formation (angiogenesis), genetic instability, and dysregulated gene expression. Various combinations of these abeπant physiologies, along with the acquisition of drug-resistance frequently lead to an intractable disease state in which organ failure and patient death ultimately ensue.
Most standard cancer therapies target cellular proliferation and rely on the differential proliferative capacities between transformed and normal cells for their efficacy. This approach is hindered by the facts that several important normal cell types are also highly proliferative and that cancer cells frequently become resistant to these agents. Thus, the therapeutic indices for traditional anti-cancer therapies rarely exceed 2.0.
The advent of genomics-driven molecular target identification has opened up the possibility of identifying new cancer-specific targets for therapeutic intervention that will provide safer, more effective treatments for cancer patients. Thus, newly discovered tumor-associated genes and their products can be tested for their role(s) in disease and used as tools to discover and develop innovative therapies. Genes playing important roles in any of the physiological processes outlined above can be characterized as cancer targets.
Genes or gene fragments identified through genomics can readily be expressed in one or more heterologous expression systems to produce functional recombinant proteins.
These proteins are characterized in vitro for their biochemical properties and then used as tools in high-throughput molecular screening programs to identify chemical modulators of their biochemical activities. Agonists and/or antagonists of target protein activity can be identified in this manner and subsequently tested in cellular and in vivo disease models for anti-cancer activity. Optimization of lead compounds with iterative testing in biological models and detailed pharmacokinetic and toxicological analyses form the basis for drug development and subsequent testing in humans.
CNS disorders
The novel human nexin-related serine protease inhibitor is highly expressed in the following brain tissues: Alzheimer cerebral cortex, dorsal root ganglia, pons, occipital lobe, Alzheimer brain frontal lobe, Alzheimer brain, substantia nigra, hippocampus, tonsilla cerebelli , vermis cerebelli, corpus callosum, cerebral cortex, cerebellum (left), cerebral peduncles, retina, parietal lobe, and precentral gyrus, frontal lobe. The expression in brain tissues and in particular the differential expression between diseased tissue Alzheimer cerebral cortex and healthy tissue cerebral cortex, between diseased tissue Alzheimer brain frontal lobe and healthy tissue frontal lobe, between diseased tissue Alzheimer brain and healthy tissue brain demonstrates that the novel human nexin-related serine protease inhibitor or mRNA can be used to diagnose nervous system diseases. Additionally, the activity of the novel human nexin-related serine protease inhibitor can be modulated to treat nervous system diseases. Central and peripheral nervous system disorders also can be treated, such as primary and secondary disorders after brain injury, disorders of mood, anxiety disorders, disorders of thought and volition, disorders of sleep and wakefulness, diseases of the motor unit, such as neurogenic and myopathic disorders, neurodegenerative disorders such as Alzheimer's and Parkinson's disease, and processes of peripheral and chronic pain.
Pain that is associated with CNS disorders also can be treated. Pain which can be treated includes that associated with central nervous system disorders, such as multiple sclerosis, spinal cord injury, sciatica, failed back surgery syndrome, traumatic brain injury, epilepsy, Parkinson's disease, post-stroke, and vascular lesions in the brain and spinal cord (e.g., infarct, hemoπhage, vascular malformation). Non- central neuropathic pain includes that associated with post mastectomy pain, reflex sympathetic dystrophy (RSD), trigeminal neuralgiaradioculopathy, post-surgical pain, HIV/ AEDS related pain, cancer pain, metabolic neuropathies (e.g., diabetic neuropathy, vasculitic neuropathy secondary to connective tissue disease), paraneo- plastic polyneuropathy associated, for example, with carcinoma of lung, or leukemia, or lymphoma, or carcinoma of prostate, colon or stomach, trigeminal neuralgia, cranial neuralgias, and post-herpetic neuralgia. Pain associated with cancer and cancer treatment also can be treated, as can headache pain (for example, migraine with aura, migraine without aura, and other migraine disorders), episodic and chronic tension-type headache, tension-type like headache, cluster headache, and chronic paroxysmal hemicrania.
Cardiovascular disorders
The novel human nexin-related serine protease inhibitor is highly expressed in the following cardiovascular related tissues: coronary artery, coronary artery sclerotic, artery, vein, aorta, coronary artery smooth muscle primary cells. Expression in the above mentioned tissues and in particular the differential expression between diseased tissue coronary artery sclerotic and healthy tissue coronary artery demonstrates that the novel human nexin-related serine protease inhibitor or mRNA can be used to diagnose cardiovascular diseases. Additionally, the activity of the novel human nexin-related serine protease inhibitor can be modulated to treat cardiovascular diseases.
Cardiovascular diseases include the following disorders of the heart and the vascular system: congestive heart failure, myocardial infarction, ischemic diseases of the heart, all kinds of atrial and ventricular aπhythmias, hypertensive vascular diseases, and peripheral vascular diseases.
Heart failure is defined as a pathophysiologic state in which an abnormality of cardiac function is responsible for the failure of the heart to pump blood at a rate commensurate with the requirement of the metabolizing tissue. It includes all forms of pumping failure, such as high-output and low-output, acute and chronic, right-sided or left-sided, systolic or diastolic, independent of the underlying cause.
Myocardial infarction (MI) is generally caused by an abrupt decrease in coronary blood flow that follows a thrombotic occlusion of a coronary artery previously naπowed by arteriosclerosis. MI prophylaxis (primary and secondary prevention) is included, as well as the acute treatment of MI and the prevention of complications.
Ischemic diseases are conditions in which the coronary flow is restricted resulting in a perfusion which inadequate to meet the myocardial requirement for oxygen. This group of diseases includes stable angina, unstable angina, and asymptomatic ischemia.
Aπhythmias include all forms of atrial and ventricular tachyaπhythmias (atrial tachycardia, atrial flutter, atrial fibrillation, atrio-ventricular reentrant tachycardia, preexcitation syndrome, ventricular tachycardia, ventricular flutter, and ventricular fibrillation), as well as bradycardic forms of aπhythmias. Nascular diseases include primary as well as all kinds of secondary arterial hypertension (renal, endocrine, neurogenic, others). The disclosed gene and its product may be used as drug targets for the treatment of hypertension as well as for the prevention of all complications.
Peripheral vascular diseases are defined as vascular diseases in which arterial and/or venous flow is reduced resulting in an imbalance between blood supply and tissue oxygen demand. It includes chronic peripheral arterial occlusive disease (PAOD), acute arterial thrombosis and embolism, inflammatory vascular disorders, Raynaud's phenomenon, and venous disorders.
Genitourinary disorders
The novel human nexin-related serine protease inhibitor is highly expressed in the following tissues of the genitourinary system: prostate BPH, penis, ureter, ovary tumor, ovary, uterus, prostate. The expression in the above mentioned tissues and in particular the differential expression between diseased tissue prostate BPH and healthy tissue prostate demonstrates that the novel human nexin-related serine protease inhibitor or mRΝA can be used to diagnose genitourinary disorders. Additionally, the activity of the novel human nexin-related serine protease inhibitor can be modulated to treat genitourinary disorders.
Genitourological disorders comprise benign and malign disorders of the organs constituting the genitourological system of female and male, renal diseases such as acute or chronic renal failure, immunologically mediated renal diseases such as renal transplant rejection, lupus nephritis, immune complex renal diseases, glomerulopa- thies, nephritis, toxic nephropathy, obstructive uropathies such as benign prostatic hyperplasia (BPH), neurogenic bladder syndrome, urinary incontinence such as urge-, stress-, or overflow incontinence, pelvic pain, and erectile dysfunction. Urinary incontinence
Urinary incontinence (UE) is the involuntary loss of urine. Urge urinary incontinence (UUI) is one of the most common types of Ul together with stress urinary incontinence (SUE), which is usually caused by a defect in the urethral closure mechanism. UUI is often associated with neurological disorders or diseases causing neuronal damage, such as dementia, Parkinson's disease, multiple sclerosis, stroke, and diabetes, although it also occurs in individuals with no such disorders. One of the usual causes of UUI is overactive bladder (OAB), which is a medical condition referring to the symptoms of frequency and urgency derived from abnormal contractions and instability of the detrusor muscle.
The symptoms commonly associated with BPH are collectively called lower urinary tract symptoms (LUTS). LUTS are categorized into two groups, storage symptoms and voiding symptoms. Storage symptoms contain pollakisuria (or pollakiuria, urinary frequency), nocturia, urinary urgency, and urinary incontinence (stress incontinence, urge incontinence, overflow incontinence, etc.). Voiding symptoms contain difficulty in urination (urinary hesitancy, urinary prolongation, decreased urinary stream, urinary teπninal dribbling, and urinary intermittency) and urinary retention.
Many papers report that BPH is the main cause of LUTS for elderly men (Cabelin etal, Curr. Opin. Urol 70:301-306, 2000; Clifford et al, Eur. Urol 38:2-19, 2000; Holtgrewe, Urol. 5i(Suppl 4A):l-7, 1998; Jepsen et al, Urol. 57(Suppl 4A):13-18, 1998; Hines, Br. J. Urol. 77:494-501, 1996). Therefore, reagents that treat LUTS for
BPH patients may serve also as treatments for Ul.
There are several medications for urinary incontinence on the market today mainly to help treating UUI. Therapy for OAB is focused on drugs that affect peripheral neural control mechanisms or those that act directly on bladder detrusor smooth muscle contraction, with a major emphasis on development of anticholinergic agents. These agents can inhibit the parasympathetic nerves that control bladder voiding or can exert a direct spasmolytic effect on the detrusor muscle of the bladder. This results in a decrease in intravesicular pressure, an increase in capacity and a reduction in the frequency of bladder contraction. Orally active anticholinergic drugs such as propantheline (ProBanthine), tolterodine tartrate (Detrol) and oxybutynin (Ditropan) are the most commonly prescribed drugs. However, their most serious drawbacks are unacceptable side effects such as dry mouth, abnormal visions, constipation, and central nervous system disturbances. These side effects lead to poor compliance. Dry mouth symptoms alone are responsible for a 70% non-compliance rate with oxy- butynin. The inadequacies of present therapies highlight the need for novel, efficacious, safe, orally available drugs that have fewer side effects.
Benign prostate hyperplasia
Benign prostate hyperplasia (BPH) is the benign nodular hyperplasia of the periure- thral prostate gland commonly seen in men over the age of 50. The overgrowth occurs in the central area of the prostate called the transition zone, which wraps around the urethra. BPH causes variable degrees of bladder outlet obstruction, resulting in progressive lower urinary tract syndromes characterized by urinary frequency, urgency, and nocturia due to incomplete emptying and rapid refilling of the bladder. The actual cause of BPH is unknown but may involve age-related alterations in balance of steroidal sex hormones.
Nexin is a protease inhibitor that belongs to the serpin (serine protease inhibitor) family. Serpin family protease inhibitors bind to the catalytic groove of the target protease, and inhibits its protease activity (Djie et al., J. Biol. Chem. 272, 16268-73, 1997). Prostate specific antigen (PSA) is a kallikrein-like serine protease, and it is reported that the secretion of PSA is increased in BPH patients (Ellis et al, Urol. Clin. North Am. 20, 621-25, 1993). Considering these observations, it is highly plausible that the imbalance between the secretion of serine protease, PSA, and the secretion of serpin-family serine protease inhibitor, nexin, may be a cause of BPH. Therefore, reagents that modify the expression of human nexin-related serine protease inhibitor and reagents that bind to nexin-related serine protease inhibitor gene products can provide a treatment of BPH.
Bowman-Birk inhibitor (BBI) is a soybean-derived serine protease inhibitor that has been shown to suppress malignant transformation in vitro and to prevent cancer development in several species of experimental animals (Kennedy, Pharmacol. Ther. 78, 167-209, 1998). BBI treatment leads to a statistically significant decrease in prostate volume in BPH patients, suggesting that BBI could have beneficial effect for the treatment of BPH (Malkowics et al, The Prostate 48, 16-28, 2001). Nexin is also a serine protease inhibitor; therefore, as is the case for BBI, nexin-related serine protease inhibitor is expected to be useful for treating BPH.
Hematological disorders
The novel human nexin-related serine protease inhibitor is highly expressed in the following tissues of the hematological system: bone maπow CD33+ cells, lymph node, cord blood CD71+ cells, bone maπow CDI 5+ cells, bone maπow CD71+ cells, thrornbocytes, bone maπow stromal cells. The expression in the above- mentioned tissues demonstrates that the novel human nexin-related serine protease inhibitor or mRNA can be used to diagnose hematological diseases. Additionally, the activity of the novel human nexin-related serine protease inhibitor can be modulated to treat hematological disorders.
Anemia
Hemoglobin in red blood cells is the key component for transporting oxygen from the lungs to the tissues. In anemia the level of hemoglobin has fallen below 12 g/L. Therefore the oxygen carrying capacity of blood is reduced. Common reasons for anemia include acute or chronic blood loss, insufficient levels of erythropoietin synthesis in the kidneys (e.g. in dialysis patients) or insufficient output of red blood cells from bone maπow after chemotherapy or HIV infection etc.. Cuπent therapy of anemia is aimed at increasing the hematocrit either by transfusion or by stimulating erythropoiesis with agents such as erythropoietin. The treatment goal is to restore hemoglobin levels above 12g/L.
Neutropenia
Neutrophils play a key role in the defense against infections. Neutropenia is an abnormally low white blood cell count which causes an increased incidence of infections. Causes of neutropenia include: drug-induced (e.g., following cancer chemotherapy), increased destruction of neutrophils (e.g., immune-mediated) or decreased bone maπow function (e.g., familial neutropenia). Neutropenia following cancer chemotherapy is cuπently treated with growth factors such as G-CSF or GM- CSF that stimulate granulopoiesis. The treatment goal is to raise the neutrophil count in order to reduce the susceptibility to infection.
Thrombocytopenia
Thrombocytopenia is a disorder where the number of platelets is inappropriately low. Since platelets play an essential role in thrombus formation to limit blood loss following vessel injury, insufficient platelet levels may lead to abnormal bleeding. There are many causes of thrombocytopenia including drug-induced thrombocytopenia (e.g., following cancer chemotherapy) and immune thrombocytopenia (due to increased degradation of platelets). Platelet transfusions or IL-11 can be used to restore platelet levels in order to reduce the bleeding risk.
Aplastic anemia (Pancytepenia)
Aplastic anemia is a life-threatening hematologic disorder characterized by absent or markedly diminished hematopoietic precursors in the bone marrow and resulting in neutropenia, anemia and thrombocytopenia. A large number of agents can cause aplastic anemia (drugs, chemicals and toxins) radiation and certain infections can also induce aplastic anemia. More frequently, aplastic anemia occurs as an unpredictable idiosyncratic reaction to drugs such as anti-inflammatory agents, antibiotics, and antiepileptic drugs. Aplastic anemia typically develops weeks or month during drug administration or delayed after drug administration has been discontinued. Several congenital and familiar forms of aplastic anemia have been described, including Fanconi's anemia, Shwachman-Diamond syndrome, familiar aplastic anemia, and aplasia associated with dyskeratosis congenita or amega- karyocytic thrombocytopenia.
Gastrointestinal disorders
The novel human nexin-related serine protease inhibitor is highly expressed in the following tissues of the gastrointestinal system: rectum, stomach tumor, ileum, ileum tumor, colon tumor, stomach, and colon. The expression in the above mentioned tissues and in particular the differential expression between diseased tissue ileum tumor and healthy tissue ileum demonstrates that the novel human nexin-related serine protease inhibitor or mRNA can be used to diagnose gastrointestinal disorders. Additionally, the activity of the novel human nexin-related serine protease inhibitor can be modulated to treat gastrointestinal disorders.
Gastrointestinal disorders comprise primary or secondary, acute or chronic diseases of the organs of the gastrointestinal tract which may be acquired or inherited, benign or malignant or metaplastic, and which may affect the organs of the gastrointestinal tract or the body as a whole. They include but are not limited to disorders of the esophagus, such as achalasia, vigorous achalasia, dysphagia, cricopharyngeal incoordination, pre-esophageal . dysphagia, diffuse esophageal spasm, globus sensation, Baπett's metaplasia, and gastroesophageal reflux. They also include disorders of the stomach and duodenum, such as functional dyspepsia, inflammation of the gastric mucosa, gastritis, stress gastritis, chronic erosive gastritis, atrophy of gastric glands, metaplasia of gastric tissues, gastric ulcers, duodenal ulcers, and neoplasms of the stomach. Gastrointestinal disorders also include disorders of the pancreas, such as acute or chronic pancreatitis, insufficiency of the exocrinic or endocrinic tissues of the pancreas like steatoπhea, diabetes, neoplasms of the exocrine or endocrine pancreas (e.g., multiple endocrine neoplasia syndrome, ductal adenocarcinoma, cystadenocarcinoma, islet cell tumors, insulinoma, gastrinoma, carcinoid tumors, and glucagonoma), Zollinger-Ellison syndrome, Vipoma syndrome, and malabsorption syndrome. Gastrointestinal disorders also include disorders of the bowel, such as chronic inflammatory diseases of the bowel, Crohn's disease, ileus, diaπhea and constipation, colonic inertia, megacolon, malabsorption syndrome, and ulcerative colitis, functional bowel disorders, such as irritable bowel syndrome, neoplasms of the bowel, such as familial polyposis, adenocarcinoma, primary malignant lymphoma, carcinoid tumors, Kaposi's sarcoma, polyps, and cancer of the colon and rectum.
COPD and Asthma
The novel human nexin-related serine protease inhibitor is highly expressed in the following tissues of the respiratory system: lung tumor, lung right mid lobe, lung right lower lobe, lung right upper lobe, lung COPD. The expression in the above mentioned tissues and in particular the differential expression between diseased tissue lung COPD and healthy tissue lung demonstrates that the novel human nexin-related serine protease inhibitor or mRNA can be used to diagnose COPD and/or asthma. Additionally, the activity of the novel human nexin-related serine protease inhibitor can be modulated to treat those diseases.
Allergy is a complex process in which environmental antigens induce clinically adverse reactions. The inducing antigens, called allergens, typically elicit a specific IgE response and, although in most cases the allergens themselves have little or no intrinsic toxicity, they induce pathology when the IgE response in turn elicits an IgE- dependent or T cell-dependent hypersensitivity reaction. Hypersensitivity reactions can be local or systemic and typically occur within minutes of allergen exposure in individuals who have previously been sensitized to an allergen. The hypersensitivity reaction of allergy develops when the allergen is recognized by IgE antibodies bound to specific receptors on the surface of effector cells, such as mast cells, basophils, or eosinophils, which causes the activation of the effector cells and the release of mediators that produce the acute signs and symptoms of the reactions. Allergic diseases include asthma, allergic rhinitis (hay fever), atopic dermatitis, and anaphylaxis.
Asthma is though to arise as a result of interactions between multiple genetic and environmental factors and is characterized by three major features: 1) intermittent and reversible airway obstruction caused by bronchoconstriction, increased mucus production, and thickening of the walls of the airways that leads to a naπowing of the airways, 2) airway hypeπesponsiveness caused by a decreased control of airway caliber, and 3) airway inflammation. Certain cells are critical to the inflammatory reaction of asthma and they include T cells and antigen presenting cells, B cells that produce IgE, and mast cells, basophils, eosinophils, and other cells that bind IgE. These effector cells accumulate at the site of allergic reaction in the airways and release toxic products that contribute to the acute pathology and eventually to the tissue destruction related to the disorder. Other resident cells, such as smooth muscle cells, lung epithelial cells, mucus-producing cells, and nerve cells may also be abnormal in individuals with asthma and may contribute to the pathology. While the airway obstruction of asthma, presenting clinically as an intermittent wheeze and shortness of breath, is generally the most pressing symptom of the disease requiring immediate treatment, the inflammation and tissue destruction associated with the disease can lead to iπeversible changes that eventually make asthma a chronic disabling disorder requiring long-term management.
Despite recent important advances in our understanding of the pathophysiology of asthma, the disease appears to be increasing in prevalence and severity (Gergen and Weiss, Am. Rev. Respir. Dis. 146, 823-24, 1992). It is estimated that 30-40% of the population suffer with atopic allergy, and 15% of children and 5% of adults in the population suffer from asthma (Gergen and Weiss, 1992). Thus, an enormous burden is placed on our health care resources. However, both diagnosis and treatment of asthma are difficult. The severity of lung tissue inflammation is not easy to measure and the symptoms of the disease are often indistinguishable from those of respiratory infections, chronic respiratory inflammatory disorders, allergic rhinitis, or other respiratory' disorders. Often, the inciting allergen cannot be determined, malting removal of the causative environmental agent difficult.
Cuπent pharmacological treatments suffer their own set of disadvantages. Com- monly used therapeutic agents, such as beta agonists, can act as symptom relievers to transiently improve pulmonary function, but do not affect the underlying inflammation. Agents that can reduce the underlying inflammation, such as anti- inflammatory steroids, can have major drawbacks that range from immuno- suppression to bone loss (Goodman and Gilman's THE PHARMACOLOGIC BASIS OF THERAPEUTICS, Seventh Edition, MacMillan Publishing Company, NY, USA, 1985).
In addition, many of the present therapies, such as inhaled corticosteroids, are short- lasting, inconvenient to use, and must be used often on a regular basis, in some cases for life, making failure of patients to comply with the treatment a major problem and thereby reducing their effectiveness as a treatment.
Because of the problems associated with conventional therapies, alternative treatment strategies have been evaluated. Glycophorin A (Chu and Sharom, Cell. Immunol. 145, 223-39, 1992), cyclosporin (Alexander et al, Lancet 339, 324-28, 1992), and a nonapeptide fragment of IL-2 (Zav'yalov et al, Immunol. Lett. 31, 285-88, 1992) all inhibit interleukin-2 dependent T lymphocyte proliferation; however, they are known to have many other effects. For example, cyclosporin is used as a immuno- suppressant after organ transplantation. While these agents may represent alternatives to steroids in the treatment of asthmatics, they inhibit interleukin-2 dependent T lymphocyte proliferation and potentially critical immune functions associated with homeostasis. Other treatments that block the release or activity of mediators of broncho- chonstriction, such as cromones or anti-leukotrienes, have recently been introduced for the treatment of mild asthma, but they are expensive and not effective in all patients and it is unclear whether they have any effect on the chronic changes associated with asthmatic inflammation. What is needed in the art is the identification of a treatment that can act in pathways critical to the development of asthma that both blocks the episodic attacks of the disorder and preferentially dampens the hyperactive allergic immune response without immunocompromising the patient.
Chronic obstructive pulmonary (or airways) disease (COPD) is a condition defined physiologically as airflow obstruction that generally results from a mixture of emphysema and peripheral airway obstruction due to chronic bronchitis (Senior & Shapiro, Pulmonary Diseases and Disorders, 3d ed., New York, McGraw-Hill, 1998, pp. 659-681, 1998; Barnes, Chest 117, 10S-14S, 2000). Emphysema is characterized by destruction of alveolar walls leading to abnormal enlargement of the air spaces of the lung. Chronic bronchitis is defined clinically as the presence of chronic productive cough for three months in each of two successive years. In COPD, airflow obstruction is usually progressive and is only partially reversible. By far the most important risk factor for development of COPD is cigarette smoking, although the disease does occur in non-smokers.
Chronic inflammation of the airways is a key pathological feature of COPD (Senior & Shapiro, 1998). The inflammatory cell population comprises increased numbers of macrophages, neutrophils, and CD8+ lymphocytes. Inhaled irritants, such as cigarette smoke, activate macrophages which are resident in the respiratory tract, as well as epithelial cells leading to release of chemokines (e.g., interleukin-8) and other chemotactic factors. These chemotactic factors act to increase the neutrophil/- monocyte trafficking from the blood into the lung tissue and airways. Neutrophils and monocytes recruited into the airways can release a variety of potentially damaging mediators such as proteolytic enzymes and reactive oxygen species. Matrix degradation and emphysema, along with airway wall thickemng, surfactant dysfunction, and mucus hypersecretion, all are potential sequelae of this inflammatory response that lead to impaired airflow and gas exchange.
This invention further pertains to the use of novel agents identified by the screening assays described above. Accordingly, it is within the scope of this invention to use a test compound identified as described herein in an appropriate animal model. For example, an agent identified as described herein (e.g., a modulating agent, an antisense nucleic acid molecule, a specific antibody, ribozyme, or a human nexin- related serine protease inhibitor polypeptide binding, molecule) can be used in an animal model to determine the efficacy, toxicity, or side effects of treatment with such an agent. Alternatively, an agent identified as described herein can be used in an animal model to determine the mechanism of action of such an agent. Furthermore, this invention pertains to uses of novel agents identified by the above- described screening assays for treatments as described herein.
A reagent which affects nexin-related serine protease inhibitor activity can be administered to a human cell, either in vitro or in vivo, to reduce nexin-related serine protease inhibitor activity. The reagent preferably binds to an expression product of a human nexin-related serine protease inhibitor gene. If the expression product is a protein, the reagent is preferably an antibody. For treatment of human cells ex vivo, an antibody can be added to a preparation of stem cells that have been removed from the body. The cells can then be replaced in the same or another human body, with or without clonal propagation, as is known in the art.
In one embodiment, the reagent is delivered using a liposome. Preferably, the liposome is stable in the animal into which it has been administered for at least about 30 minutes, more preferably for at least about 1 hour, and even more preferably for at least about 24 hours. A liposome comprises a lipid composition that is capable of targeting a reagent, particularly a polynucleotide, to a particular site in an animal, such as a human. Preferably, the lipid composition of the liposome is capable of targeting to a specific organ of an animal, such as the lung, liver, spleen, heart brain, lymph nodes, and skin.
A liposome useful in the present invention comprises a lipid composition that is capable of fusing with the plasma membrane of the targeted cell to deliver its contents to the cell. Preferably, the transfection efficiency of a liposome is about 0.5 μg of DNA per 16 nmole of liposome delivered to about 10 cells, more preferably about 1.0 μg of DNA per 16 nmole of liposome delivered to about 10 cells, and even more preferably about 2.0 μg of DNA per 16 nmol of liposome delivered to about 106 cells. Preferably, a liposome is between about 100 and
500 nm, more preferably between about 150 and 450 nm, and even more preferably between about 200 and 400 nm in diameter.
Suitable liposomes for use in the present invention include those liposomes standardly used in, for example, gene delivery methods known to those of skill in the art. More prefeπed liposomes include liposomes having a polycationic lipid composition and/or liposomes having a cholesterol backbone conjugated to polyethylene glycol. Optionally, a liposome comprises a compound capable of targeting the liposome to a particular cell type, such as a cell-specific ligand exposed on the outer surface of the liposome.
Complexing a liposome with a reagent such as an antisense oligonucleotide or ribozyme can be achieved using methods that are standard in the art (see, for example, U.S. Patent 5,705,151). Preferably, from about 0.1 μg to about 10 μg of - polynucleotide is combined with about 8 nmol of liposomes, more preferably from about 0.5 μg to about 5 μg of polynucleotides are combined with about 8 nmol liposomes, and even more preferably about 1.0 μg of polynucleotides is combined with about 8 nmol liposomes.
In another embodiment, antibodies can be delivered to specific tissues in vivo using receptor-mediated targeted delivery. Receptor-mediated DNA delivery techniques are taught in, for example, Findeis et al. Trends in Biotechnol. 11, 202-05 (1993); Chiou et al, GENE THERAPEUTICS: METHODS AND APPLICATIONS OF DIRECT GENE TRANSFER (J.A. Wolff, ed.) (1994); Wu & Wu, J. Biol. Chem. 263, 621-24 (1988); Wu et al, J. Biol. Chem. 269, 542-46 (1994); Zenke et al, Proc. Natl. Acad. Sci. U.S.A. 87, 3655-59 (1990); Wu et al, J. Biol. Chem. 266, 338-42 (1991).
Determination of a therapeutically effective dose
The determination of a therapeutically effective dose is well within the capability of those skilled in the art. A therapeutically effective dose refers to that amount of active ingredient which increases or decreases functional activity relative to the functional activity which occurs in the absence of the therapeutically effective dose.
For any compound, the therapeutically effective dose can be estimated initially either in cell culture assays or in animal models, usually mice, rabbits, dogs, or pigs. The animal model also can be used to determine the appropriate concentration range and route of administration. Such information can then be used to determine useful doses and routes for administration in humans.
Therapeutic efficacy and toxicity, e.g., ED50 (the dose therapeutically effective in
50%) of the population) and LD50 (the dose lethal to 50% of the population), can be determined by standard pharmaceutical procedures in cell cultures or experimental animals. The dose ratio of toxic to therapeutic effects is the therapeutic index, and it can be expressed as the ratio, LD5o/ED50.
Pharmaceutical compositions that exhibit large therapeutic indices are prefeπed. The data obtained from cell culture assays and animal studies is used in formulating a range of dosage for human use. The dosage contained in such compositions is preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage varies within this range depending upon the dosage form employed, sensitivity of the patient, and the route of administration. The exact dosage will be determined by the practitioner, in light of factors related to the subject that requires treatment. Dosage and administration are adjusted to provide sufficient levels of the active ingredient or to maintain the desired effect. Factors that can be taken into account include the severity of the disease state, general health of the subject, age, weight, and gender of the subject, diet, time and frequency of administration, drug combination(s), reaction sensitivities, and tolerance/response to therapy. Long-acting pharmaceutical compositions can be administered every 3 to 4 days, every week, or once every two weeks depending on the half-life and clearance rate of the particular formulation.
Normal dosage amounts can vary from 0.1 to 100,000 micrograms, up to a total dose of about 1 g, depending upon the route of administration. Guidance as to particular dosages and methods of delivery is provided in the literature and generally available to practitioners in the art. Those skilled in the art will employ different formulations for nucleotides than for proteins or their inhibitors. Similarly, delivery of polynucleotides or polypeptides will be specific to particular cells, conditions, locations, etc.
If the reagent is a single-chain antibody, polynucleotides encoding the antibody can be constructed and introduced into a cell either ex vivo or in vivo using well- established techniques including, but not limited to, transferrin-polycation-mediated DNA transfer, transfection with naked or encapsulated nucleic acids, liposome- mediated cellular fusion, intracellular transportation of DNA-coated latex beads, protoplast fusion, viral infection, electroporation, "gene gun," and DEAE- or calcium phosphate-mediated transfection.
Effective in vivo dosages of an antibody are in the range of about 5 μg to about
50 μg/kg, about 50 μg to about 5 mg/kg, about 100 μg to about 500 μg/kg of patient body weight, and about 200 to about 250 μg/kg of patient body weight. For administration of polynucleotides encoding single-chain antibodies, effective in vivo dosages are in the range of about 100 ng to about 200 ng, 500 ng to about 50 mg, about 1 μg to about 2 mg, about 5 μg to about 500 μg, and about 20 μg to about 100 μg of DNA.
If the expression product is mRNA, the reagent is preferably an antisense oligonucleotide or a ribozyme. Polynucleotides that express antisense oligonucleotides or ribozymes can be introduced into cells by a variety of methods, as described above.
Preferably, a reagent reduces expression of a human nexin-related serine protease inhibitor gene or the activity of a nexin-related serine protease inhibitor polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100%) relative to the absence of the reagent. The effectiveness of the mechanism chosen to decrease the level of expression of a human nexin-related serine protease inhibitor gene or the activity of a human nexin-related serine protease inhibitor polypeptide can be assessed using methods well known in the art, such as hybridization of nucleotide probes to nexin-related serine protease inhibitor-specific mRNA, quantitative RT-PCR, immunologic detection of a human nexin-related serine protease inhibitor polypeptide, or measurement of functional activity.
In any of the embodiments described above, any of the pharmaceutical compositions of the invention can be administered in combination with other appropriate therapeutic agents. Selection of the appropriate agents for use in combination therapy can be made by one of ordinary skill in the art, according to conventional pharmaceutical principles. The combination of therapeutic agents can act synergistically to effect the treatment or prevention of the various disorders described above. Using this approach, one may be able to achieve therapeutic efficacy with lower dosages of each agent, thus reducing the potential for adverse side effects.
Any of the therapeutic methods described above can be applied to any subject in need of such therapy, including, for example, mammals such as dogs, cats, cows, horses, rabbits, monkeys, and most preferably, humans. Diagnostic methods
Human nexin-related serine protease inhibitor also can be used in diagnostic assays for detecting diseases and abnormalities or susceptibility to diseases and abnormalities related to the presence of mutations in the nucleic acid sequences that encode the protein. For example, differences can be determined between the cDNA or genomic sequence encoding nexin-related serine protease inhibitor in individuals afflicted with a disease and in normal individuals. If a mutation is observed in some or all of the afflicted individuals but not in normal individuals, then the mutation is likely to be the causative agent of the disease.
Sequence differences between a reference gene and a gene having mutations can be revealed by the direct DNA sequencing method. In addition, cloned DNA segments can be employed as probes to detect specific DNA segments. The sensitivity of this method is greatly enhanced when combined with PCR. For example, a sequencing primer can be used with a double-stranded PCR product or a single-stranded template molecule generated by a modified PCR. The sequence determination is performed by conventional procedures using radiolabeled nucleotides or by automatic sequencing procedures using fluorescent tags.
Genetic testing based on DNA sequence differences can be carried out by detection of alteration in electrophoretic mobility of DNA fragments in gels with or without denaturing agents. Small sequence deletions and insertions can be visualized, for example, by high resolution gel electrophoresis. DNA fragments of different sequences can be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific melting or partial melting temperatures (see, e.g., Myers et al., Science 230, 1242, 1985). Sequence changes at specific locations can also be revealed by nuclease protection assays, such as RNase and S 1 protection or the chemical cleavage method (e.g., Cotton et al, Proc. Natl. Acad. Sci. USA 85, 4397-4401, 1985). Thus, the detection of a specific DNA sequence can be performed by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes and Southern blotting of genomic DNA. In addition to direct methods such as gel-electrophoresis and DNA sequencing, mutations can also be detected by in situ analysis.
Altered levels of nexin-related serine protease inhibitor also can be detected in various tissues. Assays used to detect levels of the receptor polypeptides in a body sample, such as blood or a tissue biopsy, derived from a host are well known to those of skill in the art and include radioimmunoassays, competitive binding assays,
Western blot analysis, and ELISA assays.
All patents and patent applications cited in this disclosure are expressly incorporated herein by reference. The above disclosure generally describes the present invention. A more complete understanding can be obtained by reference to the following specific examples, which are provided for purposes of illustration only and are not intended to limit the scope of the invention.
EXAMPLE 1
Detection of nexin-related serine protease inhibitor activity
The polynucleotide of SEQ ID NO: 1 is inserted into the expression vector pCEV4 and the expression vector pCEV4-nexin-related serine protease inhibitor polypeptide obtained is transfected into human embryonic kidney 293 cells. From these cells extracts are obtained and thrombin inhibition is measured. The cell extracts are homogenized in thrombin dilution buffer. The homogenates (0.8 μg of cell extract in 80 μl) are mixed with 10 μl human alpha-thrombin (1 nM in 67 mM Tris> pH 8.0,
133 mM NaCl, 0.13% PEG-6000) per well in a 96-well microtiter plate and incubated for 30 min at 37°C. After preincubation, 10 μl S-2288 substrate (H-D-Ile- Pro-Arg-para-nitroanilide, Chromogenix, Molndal, Sweden; 1.25 mg/ml in H2O) is added, and the remaining amidolytic activity is determined by measuring the rate of hydrolysis at 405 nm over 30 min by using a TE ERMOmax microplate reader
(Molecular Devices). It is shown that the polypeptide of SEQ TD NO: 2 has a nexin- related serine protease inhibitor activity.
EXAMPLE 2
Expression of recombinant human nexin-related serine protease inhibitor
The Pichia pastoris expression vector pPICZB (Invitrogen, San Diego, CA) is used to produce large quantities of recombinant human nexin-related serine protease inhibitor polypeptides in yeast. The nexin-related serine protease inhibitor-encoding
DNA sequence is derived from SEQ ID NO: 1. Before' insertion into vector pPICZB, the DNA sequence is modified by well known methods in such a way that it contains at its 5 '-end an initiation codon and at its 3 '-end an enterokinase cleavage site, a His6 reporter tag and a termination codon. Moreover, at both termini recognition sequences for restriction endonucleases are added and after digestion of the multiple cloning site of pPICZ B with the coπesponding restriction enzymes the modified DNA sequence is ligated into pPICZB. This expression vector is designed for inducible expression in Pichia pastoris, driven by a yeast promoter. The resulting pPICZ/md-His6 vector is used to transform the yeast.
The yeast is cultivated under usual conditions in 5 liter shake flasks and the recombinantly produced protein isolated from the culture by affinity chromatography (Ni-NTA-Resin) in the presence of 8 M urea. The bound polypeptide is eluted with buffer, pH 3.5, and neutralized. Separation of the polypeptide from the His6 reporter tag is accomplished by site-specific proteolysis using enterokinase (Invitrogen, San Diego, CA) according to manufacturer's instructions. Purified human nexin-related serine protease inhibitor polypeptide is obtained.
EXAMPLE 3
Identification of test compounds that bind to nexin-related serine protease inhibitor polypeptides
Purified nexin-related serine protease inhibitor polypeptides comprising a glutatbione-S-transferase protein and absorbed onto glutatliione-derivatized wells of 96-well microtiter plates are contacted with test compounds from a small molecule library at pH 7.0 in a physiological buffer solution. Human nexin-related serine protease inhibitor polypeptides comprise the amino acid sequence shown in SEQ ID NO: 2. The test compounds comprise a fluorescent tag. The samples are incubated for 5 minutes to one hour. Control samples are incubated in the absence of a test compound.
The buffer solution containing the test compounds is washed from the wells. Binding of a test compound to a human nexin-related serine protease inhibitor polypeptide is detected by fluorescence measurements of the contents of the wells. A test compound that increases the fluorescence in a well by at least 15% relative to fluorescence of a well in which a test compound is not incubated is identified as a compound which binds to a human nexin-related serine protease inhibitor polypeptide.
EXAMPLE 4
Identification of a test compound which decreases nexin-related serine protease inhibitor gene expression
A test compound is administered to a culture of human cells transfected with a nexin- related serine protease inhibitor expression construct and incubated at 37°C for 10 to
45 minutes. A culture of the same type of cells that have not been transfected is incubated for the same time without the test compound to provide a negative control.
RNA is isolated from the two cultures as described in Chirgwin et al, Biochem. 18, 5294-99, 1979). Northern blots are prepared using 20 to 30 μg total RNA and hybridized with a 32P-labeled nexin-related serine protease inhibitor-specific probe at 65°C in Express-hyb (CLONTECH). The probe comprises at least 11 contiguous nucleotides selected from the complement of SEQ ID NO: 1. A test compound that decreases the nexin-related serine protease inhibitor-specific signal relative to the signal obtained in the absence of the test compound is identified as an inhibitor of nexin-related serine protease inhibitor gene expression.
EXAMPLE 5 '
Identification of a test compound which decreases nexin-related serine protease inhibitor activity
A test compound is administered to a culture of human cells transfected with a nexin- related serine protease inhibitor expression construct and incubated at 37°C for 10 to 45 minutes. A culture of the same type of cells that have not been transfected is . incubated for the same time without the test compound to provide a negative control. Functional activity is measured using the method of U.S. Patent 6,197,519.
A test compound which decreases the functional activity of the nexin-related serine protease inhibitor relative to the functional activity in the absence of the test compound is identified as an inhibitor of nexin-related serine protease inhibitor activity.
EXAMPLE 6
Tissue-specific expression of nexin-related serine protease inhibitor
The qualitative expression pattern of nexin-related serine protease inhibitor in various tissues is determined by Reverse Transcription-Polymerase Chain Reaction (RT-PCR).
Quantitative expression profiling
To demonstrate that nexin-related serine protease inhibitor is involved in cancer, expression is determined in the following tissues: adrenal gland, bone maπow, brain, cerebellum, colon, fetal brain, fetal liver, heart, kidney, liver, lung, mammary gland, pancreas, placenta, prostate, salivary gland, skeletal muscle, small intestine, spinal cord, spleen, stomach, testis, thymus, thyroid, trachea, uterus, and peripheral blood lymphocytes. Expression in the following cancer cell lines also is determined: DU- 145 (prostate), NCI-H125 (lung), HT-29 (colon), COLO-205 (colon), A-549 (lung),
NCI-H460 (lung), HT-116 (colon), DLD-1 (colon), MDA-MD-231 (breast), LS174T (colon), ZF-75 (breast), MDA-MN-435 (breast), HT-1080, MCF-7 (breast), and U87. Matched pairs of malignant and normal tissue from the same patient also are tested.
To demonstrate that nexin-related serine protease inhibitor is involved in CNS . disorders, the following tissues are screened: fetal and adult brain, muscle, heart, lung, kidney, liver, thymus, testis, colon, placenta, trachea, pancreas, kidney, gastric mucosa, colon, liver, cerebellum, skin, cortex (Alzheimer's and normal), hypo- thalamus, cortex, amygdala, cerebellum, hippocampus, choroid, plexus, thalamus, and spinal cord.
To demonstrate that nexin-related serine protease inhibitor is involved in the disease process of asthma, the following whole body panel is screened to show predominant or relatively high expression in lung or immune tissues: brain, heart, kidney, liver, lung, trachea, bone maπow, colon, small intestine, spleen, stomach, thymus, mammary gland, skeletal muscle, prostate, testis, uterus, cerebellum, fetal brain, fetal liver, spinal cord, placenta, adrenal gland, pancreas, salivary gland, thyroid, peripheral blood leukocytes, lymph node, and tonsil. Once this is established, the following lung and immune system cells are screened to localize expression to particular cell subsets: lung microvascular endothelial cells, bronchial/tracheal epithelial cells, bronchial/tracheal smooth muscle cells, lung fibroblasts, T cells (T helper 1 subset, T helper 2 subset, NKT cell subset, and cytotoxic T lymphocytes), B cells, mononuclear cells (monocytes and macrophages), mast cells, eosinophils, neutrophils, and dendritic cells. As a final step, the expression of nexin-related serine protease inhibitor in cells derived from normal individuals with the expression of cells derived from asthmatic individuals is compared.
To demonstrate that nexin-related serine protease inhibitor is involved in the disease process of COPD, the initial expression panel consists of RNA samples from respiratory tissues and inflammatory cells relevant to COPD: lung (adult and fetal), trachea, freshly isolated alveolar type II cells, cultured human bronchial epithelial cells, cultured small airway epithelial cells, cultured bronchial sooth muscle cells, cultured H441 cells (Clara-like), freshly isolated neutrophils and monocytes, and cultured monocytes (macrophage-like). Body map profiling also is carried out, using total RNA panels purchased from Clontech. The tissues are adrenal gland, bone maπow, brain, colon, heart, kidney, liver, lung, mammary gland, pancreas, prostate, salivary gland, skeletal muscle, small intestine, spleen, stomach, testis, thymus, trachea, thyroid, and uterus.
Quantitative expression profiling is performed by the form of quantitative PCR analysis called "kinetic analysis" firstly described in Higuchi et al, BioTechnology
10, 413-17, 1992, and Higuchi et al, BioTechnology 11, 1026-30, 1993. The principle is that at any given cycle within the exponential phase of PCR, the amount of product is proportional to the initial number of template copies.
If the amplification is performed in the presence of an internally quenched fluorescent oligonucleotide (TaqMan probe) complementary to the target sequence, the probe is cleaved by the 5 '-3' endonuclease activity of Taq DNA polymerase and a fluorescent dye released in the medium (Holland et al, Proc. Natl. Acad. Sci. U.S.A. 88, 7276-80, 1991). Because the fluorescence emission will increase in direct proportion to the amount of the specific amplified product, the exponential growth phase of PCR product can be detected and used to determine the initial template concentration (Heid et al, Genome Res. 6, 986-94, 1996, and Gibson et al, Genome Res. 6, 995-1001, 1996).
The amplification of an endogenous control can be performed to standardize the amount of sample RNA added to a reaction. In this kind of experiment, the control of choice is the 18S ribosomal RNA. Because reporter dyes with differing emission spectra are available, the target and the endogenous control can be independently quantified in the same tube if probes labeled with different dyes are used. All "real time PCR" measurements of fluorescence are made in the ABI Prism 7700.
RNA extraction and cDNA preparation. Total RNA from the tissues listed above are used for expression quantification. RNAs labeled "from autopsy" were extracted from autoptic tissues with the TRIzol reagent (Life Technologies, MD) according to the manufacturer' s protocol. Fifty μg of each RNA were treated with DNase I for 1 hour at 37°C in the following reaction mix: 0.2 U/μl RNase-free DNase I (Roche Diagnostics, Germany); 0.4 U/μl RNase inhibitor (PE Applied Biosystems, CA); 10 mM Tris-HCl pH 7.9; lOmM MgCl2; 50 mM NaCl; and 1 mM DTT.
After incubation, RNA is extracted once with 1 volume of phenol:chloroform:isoamyl alcohol (24:24:1) and once with chloroform, and precipitated with 1/10 volume of 3 M sodium acetate, pH5.2, and 2 volumes of ethanol.
Fifty μg of each RNA from the autoptic tissues are DNase treated with the DNA-free kit purchased from. Ambion (Ambion, TX). After resuspension and spectro- photometric quantification, each sample is reverse transcribed with the TaqMan Reverse Transcription Reagents (PE Applied Biosystems, CA) according to the manufacturer's protocol. The final concentration of RNA in the reaction mix is 200 ng/μL. Reverse transcription is carried out with 2.5 μM of random hexamer primers.
TaqMan quantitative analysis. Specific primers and probe are designed according to the recommendations of PE Applied Biosystems; the probe can be labeled at the 5' end FAM (6-carboxy-fluorescein) and at the 3' end with TAMRA (6-carboxy- tetramethyl-rhodamine). Quantification experiments are performed on 10 ng of reverse transcribed RNA from each sample. Each determination is done in triplicate.
Total cDNA content is normalized with the simultaneous quantification (multiplex PCR) of the 18S ribosomal RNA using the Pre-Developed TaqMan Assay Reagents
(PDAR) Control Kit (PE Applied Biosystems, CA).
The assay reaction mix is as follows: IX final TaqMan Universal PCR Master Mix (from 2X stock) (PE Applied Biosystems, CA); IX PDAR control - 18S RNA (from 20X stock); 300 nM forward primer; 900 nM reverse primer; 200 nM probe; 10 ng cDNA; and water to 25 μl. Each of the following steps are carried out once: pre PCR, 2 minutes at 50° C, and 10 minutes at 95°C. The following steps are carried out 40 times: denaturation, 15 seconds at 95°C, annealing/extension, 1 minute at 60°C.
The experiment is performed on an ABI Prism 7700 Sequence Detector (PE Applied Biosystems, CA). At the end of the run, fluorescence data acquired during PCR are processed as described in the ABI Prism 7700 user's manual in order to achieve better background subtraction as well as signal linearity with the starting target quantity.
EXAMPLE 7
Proliferation inhibition assay: Antisense oligonucleotides suppress the growth of cancer cell lines
The cell line used for testing is the human colon cancer cell line HCT116. Cells are cultured in RPMI-1640 with 10-15% fetal calf serum at a concentration of 10,000 cells per milliliter in a volume of 0.5 ml and kept at 37°C in a 95% air/5%CO atmosphere.
Phosphorothioate oligoribonucleotides are synthesized on an Applied Biosystems Model 380B DNA synthesizer using phosphoroamidite chemistry. A sequence of 24 bases complementary to the nucleotides at position 1 to 24 of SEQ ID NO: 1 is used as the test oligonucleotide. As a control, another (random) sequence is used: 5'-TCA
ACT GAC TAG ATG TAC ATG GAC-3'. Following assembly and deprotection, oligonucleotides are ethanol-precipitated twice, dried, and suspended in phosphate buffered saline at the desired concentration. Purity of the oligonucleotides is tested by capillary gel electrophoresis and ion exchange HPLC. The purified oligonucleo- tides are added to the culture medium at a concentration of 10 μM once per day for seven days. The addition of the test oligonucleotide for seven days results in significantly reduced expression of human nexin-related serine protease inhibitor as determined by Western blotting. This effect is not observed with the control oligonucleotide. After 3 to 7 days, the number of cells in the cultures is counted using an automatic cell counter. The number of cells in cultures treated with the test oligonucleotide (expressed as 100%o) is compared with the number of cells in cultures treated with the control oligonucleotide. The number of cells in cultures treated with the test oligonucleotide is not more than 30%) of control, indicating that the inhibition of human nexin-related serine protease inhibitor has an anti-pro liferative effect on cancer cells.
EXAMPLE 8
In vivo testing of compounds/target validation
Acute Mechanistic Assays
Reduction in Mitogenic Plasma Hormone Levels
.This non-tumor assay measures the ability of a compound to reduce either the endogenous level of a circulating hormone or the level of hormone produced in response to a biologic stimulus. Rodents are administered test compound (p.o., i.p., i.v., i.m., or s.c). At a predetermined time after administration of test compound, blood plasma is collected. Plasma is assayed for levels of the hormone of interest. If the normal circulating levels of the hormone are too low and/or variable to provide consistent results, the level of the hormone may be elevated by a pre-treatment with a biologic stimulus (i.e., LHRH may be injected i.m. into mice at a dosage of 30 ng/mouse to induce a burst of testosterone synthesis). The timing of plasma collection would be adjusted to coincide with the peak of the induced hormone response. Compound effects are compared to a vehicle-treated control group. An F- test is preformed to determine if the variance is equal or unequal followed by a Student's t-test. Significance is p value < 0.05 compared to the vehicle control group.
Hollow Fiber Mechanism of Action Assay
Hollow fibers are prepared with desired cell line(s) and implanted intraperitoneally and/or subcutaneously in rodents. Compounds are administered p.o., i.p., i.v., i.m., or s.c. Fibers are harvested in accordance with specific readout assay protocol, these may include assays for gene expression (bDNA, PCR, or Taqman), or a specific biochemical activity (i.e., cAMP levels. Results are analyzed by Student's t-test or
Rank Sum test after the variance between groups is compared by an F-test, with significance at p < 0.05 as compared to the vehicle control group.
Subacute Functional In Vivo Assays
Reduction in Mass of Hormone Dependent Tissues
This is another non-tumor assay that measures the ability of a compound to reduce the mass of a hormone dependent tissue (i.e., seminal vesicles in males and uteri in females). Rodents are administered test compound (p.o., i.p., i.v., i.m., or s.c.) according to a predetermined schedule and for a predetermined duration (i.e., 1 week). At termination of the study, animals are weighed, the target organ is excised, any fluid is expressed, and the weight of the organ is recorded. Blood plasma may also be collected. Plasma may be assayed for levels of a hormone of interest or for levels of test agent. Organ weights may be directly compared or they may be normalized for the body weight of the animal. Compound effects are compared to a vehicle-treated control group. An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-test. Significance is p value < 0.05 compared to the vehicle control group. Hollow Fiber Proliferation Assay
Hollow fibers are prepared with desired cell line(s) and implanted intraperitoneally and/or subcutaneously in rodents. Compounds are administered p.o., i.p., i.v., i.m., or s.c. Fibers are harvested in accordance with specific readout assay protocol. Cell proliferation is determined by measuring a marker of cell number (i.e., MTT or LDH). The cell number and change in cell number from the starting inoculum are analyzed by Student's t-test or Rank Sum test after the variance between groups is compared by an F-test, with significance at p < 0.05 as compared to the vehicle control group.
Anti-angiogenesis Models
Corneal Angiogenesis
Hydron pellets with or without growth factors or cells are implanted into a micropocket surgically created in the rodent cornea. Compound administration may be systemic or local (compound mixed with growth factors in the hydron pellet). Corneas are harvested at 7 days post implantation immediately following intracardiac infusion of colloidal carbon and are fixed in 10%> formalin. Readout is qualitative scoring and/or image analysis. Qualitative scores are compared by Rank Sum test. Image analysis data is evaluated by measuring the area of neovascularization (in pixels) and group averages are compared by Student's t-test (2 tail). Significance is p < 0.05 as compared to the growth factor or cells only group.
Matrigel Ansioεenesis
Matrigel, containing cells or growth factors, is injected subcutaneously. Compounds are administered p.o., i.p., i.v., i.m., or s.c. Matrigel plugs are harvested at predetermined time point(s) and prepared for readout. Readout is an ELISA-based assay for hemoglobin concentration and/or histological examination (i.e. vessel count, special staining for endothelial surface markers: CD31, factor-8). Readouts are analyzed by Student's t-test, after the variance between groups is compared by an F-test, with significance determined at p < 0.05 as compared to the vehicle control group.
Primary Antitumor Efficacy
Early Therapy Models
Subcutaneous Tumor
Tumor cells or fragments are implanted subcutaneously on Day 0. Nehicle and/or compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule starting at a time, usually on Day 1, prior to the ability to measure the tumor burden. Body weights and tumor measurements are recorded 2-3 times weekly.
Mean net body and tumor weights are calculated for each data collection day. Anti- tumor efficacy may be initially determined by comparing the size of treated (T) and control (C) tumors on a given day by a Student's t-test, after the variance between groups is compared by an F-test, with significance determined at p < 0.05. The experiment may also be continued past the end of dosing in which case tumor measurements would continue to be recorded to monitor tumor growth delay. Tumor growth delays are expressed as the difference in the median time for the treated and control groups to attain a predetermined size divided by the median time for the control group to attain that size. Growth delays are compared by generating Kaplan- Meier curves from the times for individual tumors to attain the evaluation size.
Significance is p < 0.05.
Intraperitoneal/Entracranial Tumor Models
Tumor cells are injected intraperitoneally or intracranially on Day 0. Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule starting on Day 1. Observations of morbidity and/or mortality are recorded twice daily. Body weights are measured and recorded twice weekly. Morbidity/mortality data is expressed in terms of the median time of survival and the number of long- term survivors is indicated separately. Survival times are used to generate Kaplan- Meier curves. Significance is p < 0.05 by a log-rank test compared to the control group in the experiment.
Established Disease Model
Tumor cells or fragments are implanted subcutaneously and grown to the desired size for treatment to begin. Once at the predetermined size range, mice are randomized into treatment groups. Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule. Tumor and body weights are measured and recorded 2-3 times weekly. Mean tumor weights of all groups over days post inoculation are graphed for comparison. An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-test to compare tumor sizes in the treated and control groups at the end of treatment. Significance is p < 0.05 as compared to the control group. Tumor measurements may be recorded after dosing has stopped to monitor tumor growth delay. Tumor growth delays are expressed as the difference in the median time for the treated and control groups to attain a predetermined size divided by the median time for the control group to attain that size. Growth delays are compared by generating Kaplan-Meier curves from the times for individual tumors to attain the evaluation size. Significance is p value <_0.05 compared to the vehicle control group.
Orthotopic Disease Models
Mammary Fat Pad Assay
Tumor cells or fragments, of mammary adenocarcinoma origin, are implanted directly into a surgically exposed and reflected mammary fat pad in rodents. The fat pad is placed back in its original position and the surgical site is closed. Hormones may also be administered to the rodents to support the growth of the tumors. Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule. Tumor and body weights are measured and recorded 2-3 times weekly. Mean tumor weights of all groups over days post inoculation are graphed for comparison. An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-test to compare tumor sizes in the treated and control groups at the end of treatment. Significance is p < 0.05 as compared to the control group.
Tumor measurements may be recorded after dosing has stopped to momtor tumor growth delay. Tumor growth delays are expressed as the difference in the median time for the treated and control groups to attain a predetermined size divided by the median time for the control group to attain that size. Growth delays are compared by generating Kaplan-Meier curves from the times for individual tumors to attain the evaluation size. Significance is p value< 0.05 compared to the vehicle control group. In addition, this model provides an opportunity to increase the rate of spontaneous metastasis of this type of tumor. Metastasis can be assessed at termination of the study by counting the number of visible foci per target organ, or measuring the target organ weight. The means of these endpoints are compared by Student's t-test after conducting an F-test, with significance determined at p < 0.05 compared to the control group in the experiment.
Intraprostatic Assay
Tumor cells or fragments, of prostatic adenocarcinoma origin, are implanted directly into a surgically exposed dorsal lobe of the prostate in rodents. The prostate is externalized through an abdominal incision so that the tumor can be implanted specifically in the dorsal lobe while verifying that the implant does not enter the seminal vesicles. The successfully inoculated prostate is replaced in the abdomen and the incisions through the abdomen and skin are closed. Hormones may also be administered to the rodents to support the growth of the tumors. Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule. Body weights are measured and recorded 2-3 times weekly. At a predetermined time, the experiment is terminated and the animal is dissected. The size of the primary tumor is measured in three dimensions using either a caliper or an ocular micrometer attached to a dissecting scope. An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-test to compare tumor sizes in the treated and control groups at the end of treatment. Significance is p < 0.05 as compared to the control group. This model provides an opportunity to increase the rate of spontaneous metastasis of this type of tumor. Metastasis can be assessed at termination of the study by counting the number of visible foci per target organ (i.e., the lungs), or measuring the target organ weight (i.e., the regional lymph nodes). The means of these endpoints are compared by Student's t-test after conducting an F-test, with significance determined at p < 0.05 compared to the control group in the experiment.
Intrabronchial Assay
Tumor cells of pulmonary origin may be implanted intrabronchially by making an incision through the skin and exposing the trachea. The trachea is pierced with the beveled end of a 25 gauge needle and the tumor cells are inoculated into the main bronchus using a flat-ended 27 gauge needle with a 90° bend. Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule. Body weights are measured and recorded 2-3 times weekly. At a predetermined time, the experiment is terminated and the animal is dissected. The size of the primary tumor is measured in three dimensions using either a caliper or an ocular micrometer attached to a dissecting scope. An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-test to compare tumor sizes in the treated and control groups at the end of treatment. Significance is p < 0.05 as compared to the control group. This model provides an opportumty to increase the rate of spontaneous metastasis of this type of tumor. Metastasis can be assessed at termination of the study by counting the number of visible foci per target organ (i.e., the contralateral lung), or measuring the target organ weight. The means of these endpoints are compared by Student's t-test after conducting an F-test, with significance determined at p < 0.05 compared to the control group in the experiment.
Intracecal Assay
Tumor cells of gastrointestinal origin may be implanted intracecally by making an abdominal incision through the skin and externalizing the intestine. Tumor cells are inoculated into the cecal wall without penetrating the lumen of the intestine using a
27 or 30 gauge needle. Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule. Body weights are measured and recorded 2-3 times weekly. At a predetermined time, the experiment is terminated and the animal is dissected. The size of the primary tumor is measured in three dimensions using either a caliper or an ocular micrometer attached to a dissecting scope. An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t- test to compare tumor sizes in the treated and control groups at the end of treatment. Significance is p < 0.05 as compared to the control group. This model provides an opportunity to increase the rate of spontaneous metastasis of this type of tumor. Metastasis can be assessed at termination of the study by counting the number of visible foci per target organ (i.e., the liver), or measuring the target organ weight. The means of these endpoints are compared by Student's t-test after conducting an F-test, with significance determined at p < 0.05 compared to the control group in the experiment.
Secondary (Metastatic) Antitumor Efficacy
Spontaneous Metastasis
Tumor cells are inoculated s.c. and the tumors allowed to grow to a predetermined range for spontaneous metastasis studies to the lung or liver. These primary tumors are then excised. Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule which may include the period leading up to the excision of the primary tumor to evaluate therapies directed at inhibiting the early stages of tumor metastasis. Observations of morbidity and/or mortality are recorded daily. Body weights are measured and recorded twice weekly. Potential endpoints include survival time, numbers of visible foci per target organ, or target organ weight. When survival time is used as the endpoint the other values are not determined. Survival data is used to generate Kaplan-Meier curves. Significance is p < 0.05 by a log-rank test compared to the control group in the experiment. The mean number of visible tumor foci, as determined under a dissecting microscope, and the mean target organ weights are compared by Student's t-test after conducting an F-test, with significance determined at p < 0.05 compared to the control group in the experiment for both of these endpoints.
Forced Metastasis
Tumor cells are injected into the tail vein, portal vein, or the left ventricle of the heart in experimental (forced) lung, liver, and bone metastasis studies, respectively. Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule. Observations of morbidity and/or mortality are recorded daily. Body weights are measured and recorded twice weekly. Potential endpoints mclude survival time, numbers of visible foci per target organ, or target organ weight. When survival time is used as the endpoint the other values are not determined. Survival data is used to generate Kaplan-Meier curves. Significance is p < 0.05 by a log-rank test compared to the control group in the experiment. The mean number of visible tumor foci, as determined under a dissecting microscope, and the mean target organ weights are compared by Student's t-test after conducting an F-test, with significance at p < 0.05 compared to the vehicle control group in the experiment for both endpoints. EXAMPLE 9
In vivo testing of compounds/target validation
Pain
Acute pain. Acute pain is measured on a hot plate mainly in rats. Two variants of hot plate testing are used: In the classical variant animals are put on a hot surface (52 to 56°C) and the latency time is measured until the animals show nocifensive behavior, such as stepping or foot licking. The other variant is an increasing temperature hot plate where the experimental animals are put on a surface of neutral temperature. Subsequently this surface is slowly but constantly heated until the animals begin to lick a bind paw. The temperature which is reached when hind paw licking begins is a measure for pain threshold.
Compounds are tested against a vehicle treated control group. Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i. , i.c.v., s.c, intradermal, transdermal) prior to pain testing.
Persistent pain. Persistent pain is measured with the formalin or capsaicin test, mainly in rats. A solution of 1 to 5% formalin or 10 to 100 μg capsaicin is injected into one hind paw of the experimental animal. After formalin or capsaicin application the animals show nocifensive reactions like flinching, licking and biting of the affected paw. The number of nocifensive reactions within a time frame of up to 90 minutes is a measure for intensity of pain.
Compounds are tested against a vehicle treated control group. Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t., i.c.v., s.c, intradermal, transdermal) prior to formalin or capsaicin administration. Neuropathic pain. Neuropathic pain is induced by different variants of unilateral sciatic nerve injury mainly in rats. The operation is performed under anesthesia. The first variant of sciatic nerve injury is produced by placing loosely constrictive ligatures around the common sciatic nerve. The second variant is the tight ligation of about the half of the diameter of the common sciatic nerve. In the next variant, a group of models is used in which tight ligations or transections are made of either the L5 and L6 spinal nerves, or the L% spinal nerve only. The fourth variant involves an axotomy of two of the three terminal branches of the sciatic nerve (tibial and common peroneal nerves) leaving the remaining sural nerve intact whereas the last variant comprises the axotomy of only the tibial branch leaving the sural and common nerves uninjured. Control animals are treated with a sham operation.
Postoperatively, the nerve injured animals develop a chronic mechanical allodynia, cold allodynioa, as well as a thermal hyperalgesia. Mechanical allodynia is measured by means of a pressure transducer (electronic von Frey Anesthesiometer, IITC
Inc-Life Science Instruments, Woodland Hills, SA, USA; Electronic von Frey System, Somedic Sales AB, Hδrby, Sweden). Thermal hyperalgesia is measured by means of a radiant heat source (Plantar Test, Ugo Basile, Comerio, Italy), or by. means of a cold plate of 5 to 10°C where the nocifensive reactions of the affected hind paw are counted as a measure of pain intensity. A further test for cold induced pain is the counting of nocifensive reactions, or duration of nocifensive responses after plantar administration of acetone to the affected hind limb. Chronic pain in general is assessed by registering the circadanian rhythms in activity (Surjo and Arndt, Universitat zu Koln, Cologne, Germany), and by scoring differences in gait (foot print patterns; FOOTPRINTS program, Klapdor et al., 1997. A low cost method to analyze footprint patterns. J. Neurosci. Methods 75, 49-54).
Compounds are tested against sham operated and vehicle treated control groups. Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t., i.c.v., s.c, intradermal, transdermal) prior to pain testing. Inflammatory Pain. Inflammatory pain is induced mainly in rats by injection of 0.75 mg caπageenan or complete Freund's adjuvant into one hind paw. The animals develop an edema with mechanical allodynia as well as thermal hyperalgesia. Mechanical allodynia is measured by means of a pressure transducer (electronic von Frey Anesthesiometer, IITC Lnc-Life Science Instruments, Woodland Hills, SA,
USA). Thermal hyperalgesia is measured by means of a radiant heat source (Plantar Test, Ugo Basile, Comerio, Italy, Paw thermal stimulator, G. Ozaki, University of California, USA). For edema measurement two methods are being used. In the first method, the animals are sacrificed and the affected hindpaws sectioned and weighed. The second method comprises differences in paw volume by measuring water displacement in a plethysmometer (Ugo Basile, Comerio, Italy).
Compounds are tested against uninflamed as well as vehicle treated control groups. Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t., i.c.v., s.c, intradermal, transdermal) prior to pain testing.
Diabetic neuropathic pain. Rats treated with a single intraperitoneal injection of 50 to 80 mg/kg streptozotocin develop a profound hyperglycemia and mechanical allodynia within 1 to 3 weeks. Mechanical allodynia is measured by means of a pressure transducer (electronic von Frey Anesthesiometer, IITC Inc-Life Science
Instruments, Woodland Hills, SA, USA).
Compounds are tested against diabetic and non-diabetic vehicle treated control groups. Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t., i.c.v., s.c, intradermal, transdeπnal) prior to pain testing.
Parkinson's disease
6-Hydroxydopamine (6-OH-DA) Lesion. Degeneration of the dopaminergic nigrostriatal and striatopallidal pathways is the cenfral pathological event in Parkinson's disease. This disorder has been mimicked experimentally in rats using single/sequential unilateral stereotaxic injections of 6-OH-DA into the medium forebrain bundle (MFB).
Male Wistar rats (Harlan Winkelmann, Germany), weighing 200±250 g at the beginning of the experiment, are used. The rats are maintained in a temperature- and humidity-controlled environment under a 12 h light/dark cycle with free access to food and water when not in experimental sessions. The following in vivo protocols are approved by the governmental authorities. All efforts are made to minimize animal suffering, to reduce the number of animals used, and to utilize alternatives to in vivo techniques.
Animals are administered pargyline on the day of surgery (Sigma, St. Louis, MO, USA; 50 mg/kg i.p.) in order to inhibit metabolism of 6-OHDA by monoamine oxidase and desmethylimipramine HC1 (Sigma; 25 mg/kg i.p.) in order to prevent uptake of 6-OHDA by noradrenergic terminals. Thirty minutes later the rats are anesthetized with sodium pentobarbital (50 mg/kg) and placed in a stereotaxic frame. In order to lesion the DA nigrostriatal pathway 4 μl of 0.01% ascorbic acid-saline containing 8 μg of 6-OHDA HBr (Sigma) are injected into the left medial fore-brain bundle at a rate of 1 μl min (2.4 mm anterior, 1.49 mm lateral, -2.7 mm ventral to
Bregma and the skull surface). The needle is left in place an additional 5 min to allow diffusion to occur.
Stepping Test. Forelimb akinesia is assessed three weeks following lesion placement using a modified stepping test protocol. In brief, the animals are held by the experimenter with one hand fixing the hindlimbs and slightly raising the hind part above the surface. One paw is touching the table, and is then moved slowly sideways (5 s for 1 m), first in the forehand and then in the backhand direction. The number of adjusting steps is counted for both paws in the backhand and forehand direction of movement. The sequence of testing is right paw forehand and backhand adjusting stepping, followed by left paw forehand and backhand directions. The test is repeated three times on three consecutive days, after an initial training period of three days prior to the first testing. Forehand adjusted stepping reveals no consistent differences between lesioned and healthy control animals. Analysis is therefore restricted to backhand adjusted stepping.
Balance Test. Balance adjustments following postural challenge are also measured during the stepping test sessions. The rats are held in the same position as described in the stepping test and, instead of being moved sideways, tilted by the experimenter towards the side of the paw toucliing the table. This maneuver results in loss of balance and the ability of the rats to regain balance by forelimb movements is scored on a scale ranging from 0 to 3. Score 0 is given for a normal forelimb placement. When the forelimb movement is delayed but recovery of postural balance detected, score 1 is given. Score 2 represents a clear, yet insufficient, forelimb reaction, as evidenced by muscle contraction, but lack of success in recovering balance, and score 3 is given for no reaction of movement. The test is repeated three times a day on each side for three consecutive days after an initial training period of three days prior to the first testing.
Staircase Test (Paw Reaching). A modified version of the staircase test is used for evaluation of paw reaching behavior three weeks following primary and secondary lesion placement. Plexiglass test boxes with a central platform and a removable staircase on each side are used. The apparatus is designed such that only the paw on the same side at each staircase can be used, thus providing a measure of independent forelimb use. For each test the animals are left in the test boxes for 15 min. The double staircase is filled with 7 x 3 chow pellets (Precision food pellets, formula: P, purified rodent diet, size 45 mg; Sandown Scientific) on each side. After each test the number of pellets eaten (successfully retrieved pellets) and the number of pellets taken (touched but dropped) for each paw and the success rate (pellets eaten/pellets taken) are counted separately. After three days of food deprivation (12 g per animal per day) the animals are tested for 11 days. Full analysis is conducted only for the last five days. MPTP treatment. The neurotoxin l-methyl-4-phenyl-l,2,3,6-tetrahydropyridine (MPTP) causes degeneration of mesencephalic dopaminergic (DAergic) neurons in rodents, non-human primates, and humans and, in so doing, reproduces many of the symptoms of Parkinson's disease. MPTP leads to a marked decrease in the levels of dopamine and its metabolites, and in the number of dopaminergic terminals in the striatum as well as severe loss of the tyrosine hydroxylase (TH)-immunoreactive cell bodies in the substantia nigra, pars compacta.
In order to obtain severe and long-lasting lesions, and to reduce mortality, animals receive single injections of MPTP, and are then tested for severity of lesion 7-10 days later. Successive MPTP injections are administered on days 1, 2 and 3. Animals receive application of 4 mg/kg MPTP hydrochloride (Sigma) in saline once daily. All injections are intraperitoneal (i.p.) and the MPTP stock solution is frozen between injections. Animals are decapitated on day 11.
Immunohistology. At the completion of behavioral experiments, all animals are anaesthetized with 3 ml thiopental (1 g/40 ml i.p., Tyrol Pharma). The mice are perfused transcardially with 0.01 M PBS (pH 7.4) for 2 min, followed by 4% paraformaldehyde (Merck) in PBS for 15 min. The brains are removed and placed in
4% paraformaldehyde for 24 h at 4 °C. For dehydration they are then transfeπed to a 20%) sucrose (Merck) solution in 0.1 M PBS at 4°C until they sink. The brains are frozen in methylbutan at -20°C for 2 min and stored at -70°C. Using a sledge microtome (mod. 3800-Frigocut, Leica), 25 μm sections are taken from the genu of the corpus callosum (AP 1.7 mm) to the hippocampus (AP 21.8 mm) and from AP
24.16 to AP 26.72. Forty-six sections are cut and stored in assorters in 0.25 M Tris buffer (pH 7.4) for immunohistochemistry.
A series of sections is processed for free-floating tyrosine hydroxylase (TH) immunohistochemistry. Following three rinses in 0.1 M PBS, endogenous peroxidase activity is quenched for 10 min in 0.3% H2O2 ±PBS. After rinsing in PBS, sections are preincubated in 10% normal bovine serum (Sigma) for 5 min as blocking agent and transfeπed to either primary anti-rat TH rabbit antiserum (dilution 1:2000).
Following overnight incubation at room temperature, sections for TH immuno- reactivity are rinsed in PBS (2 xlO min) and incubated in biotinylated anti-rabbit immunoglobulin G raised in goat (dilution 1:200) (Vector) for 90 min, rinsed repeatedly and transfeπed to Vectastain ABC (Vector) solution for 1 h. 3,.3' -Diaminobenzidine tetrahydrochloride (DAB; Sigma) in 0.1 M PBS, supplemented with 0.005%) H2O2 , serves as chromogen in the subsequent visualization reaction.
Sections are mounted on to gelatin-coated slides, left to dry overnight, counter- stained with hematoxylin dehydrated in ascending alcohol concentrations and cleared in butylacetate. Coverslips are mounted on entellan.
Rotarod Test. We use a modification of the procedure described by Rozas and
Labandeira-Garcia (1997), with a CR-1 Rotamex system (Columbus Instruments, Columbus, OH) comprising an IBM-compatible personal computer, a CIO-24 data acquisition card, a control unit, and a four-lane rotarod unit. The rotarod unit consists of a rotating spindle (diameter 7.3 cm) and individual compartments for each mouse. The system software allows preprogramming of session protocols with varying rotational speeds (0-80 rpm). Infrared beams are used to detect when a mouse has fallen onto the base grid beneath the rotarod. The system logs the fall as the end of the experiment for that mouse, and the total time on the rotarod, as well as the time of the fall and all the set-up parameters, are recorded. The system also allows a weak cuπent to be passed through the base grid, to aid training.
Dementia
The object recognition task. The object recognition task has been designed to assess the effects of experimental manipulations on the cognitive performance of rodents. A rat is placed in an open field, in which two identical objects are present. The rats inspects both objects during the first trial of the object recognition task. In a second trial, after a retention interval of for example 24 hours, one of the two objects used in the first trial, the 'familiar' object, and a novel object are placed in the open field. The inspection time at each of the objects is registered. The basic measures in the OR task is the time spent by a rat exploring the two object the second trial. Good retention is reflected by higher exploration times towards the novel than the 'familiar' object.
Administration of the putative cognition enhancer prior to the first trial pre- dominantly allows assessment of the effects on acquisition, and eventually on consolidation processes. Administration of the testing compound after the first trial allows to assess the effects on consolidation processes, whereas administration before the second trial allows to measure effects on retrieval processes.
The passive avoidance task. The passive avoidance task assesses memory performance in rats and mice. The inhibitory avoidance apparatus consists of a two-compartment box with a light compartment and a dark compartment. The two compartments are separated by a guillotine door that can be operated by the experimenter. A threshold of 2 cm separates the two compartments when the guillotine door is raised. When the door is open, the illumination in the dark compartment is about 2 lux. The light intensity is about 500 lux at the center of the floor of the light compartment.
Two habituation sessions, one shock session, and a retention session are given, separated by inter-session intervals of 24 hours. In the habituation sessions and the retention session the rat is allowed to explore the apparatus for 300 sec. The rat is placed in the light compartment, facing the wall opposite to the guillotine door. After an accommodation period of 15 sec. the guillotine door is opened so that all parts of the apparatus can be visited freely. Rats normally avoid brightly lit areas and will enter the dark compartment within a few seconds. Ln the shock session the guillotine door between the compartments is lowered as soon as the rat has entered the dark compartment with its four paws, and a scrambled 1 mA footshock is administered for 2 sec. The rat is removed from the apparatus and put back into its home cage. The procedure during the retention session is identical to that of the habituation sessions.
The step-through latency, that is the first latency of entering the dark compartment (in sec.) during the retention session is an index of the memory performance of the animal; the longer the latency to enter the dark compartment, the better the retention is. A testing compound in given half an hour before the shock session, together with 1 mg*kg_1 scopolamine. Scopolamine impairs the memory performance during the retention session 24 hours later. If the test compound increases the enter latency compared with the scopolamine-treated controls, is likely to possess cognition enhancing potential.
The Morris water escape task. The Morris water escape task measures spatial orientation learning in rodents. It is a test system that has extensively been used to investigate the effects of putative therapeutic on the cognitive functions of rats and mice. The performance of an animal is assessed in a circular water tank with an escape platform that is submerged about 1 cm below the surface of the water. The escape platform is not visible for an animal swimming in the water tank. Abundant extra-maze cues are provided by the furniture in the room, including desks, computer equipment, a second water tank, the presence of the experimenter, and by a radio on a shelf that is playing softly.
The animals receive four trials during five daily acquisition sessions. A trial is started by placing an animal into the pool, facing the wall of the tank. Each of four starting positions in the quadrants north, east, south, and west is used once in a series of four trials; their order is randomized. The escape platform is always in the same position. A trial is terminated as soon as the animal had climbs onto the escape platform or when 90 seconds have elapsed, whichever event occurs first. The animal is allowed to stay on the platform for 30 seconds. Then it is taken from the platform and the next trial is started. If an animal did not find the platform within 90 seconds it is put on the platform by the experimenter and is allowed to stay there for 30 seconds. After the fourth trial of the fifth daily session, an additional trial is given as a probe trial: the platform is removed, and the time the animal spends in the four quadrants is measured for 30 or 60 seconds. In the probe trial, all animals start from the same start position, opposite to the quadrant where the escape platform had been positioned during acquisition.
Four different measures are taken to evaluate the performance of an animal during acquisition training: escape latency, traveled distance, distance to platform, and swimming speed. The following measures are evaluated for the probe trial: time (s) in quadrants and traveled distance (cm) in the four quadrants. The probe trial provides additional information about how well an animal learned the position of the escape platform. If an animal spends more time and swims a longer distance in the quadrant where the platform had been positioned during the acquisition sessions than in any other quadrant, one concludes that the platform position has been learned well.
In order to assess the effects of putative cognition enhancing compounds, rats or mice with specific brain lesions which impair cognitive functions, or animals treated with compounds such as scopolamine or MK-801, which interfere with normal learning, or aged animals which suffer from cognitive deficits, are used.
The T-maze spontaneous alternation task. The T-maze spontaneous alternation task (TeMCAT) assesses the spatial memory performance in mice. The start arm and the two goal arms of the T-maze are provided with guillotine doors which can be operated manually by the experimenter. A mouse is put into the start arm at the beginning of training. The guillotine door is closed. In the first trial, the 'forced trial', either the left or right goal arm is blocked by lowering the guillotine door. After the mouse has been released from the start arm, it will negotiate the maze, eventually enter the open goal arm, and return to the start position, where it will be confined for 5 seconds, by lowering the guillotine door. Then, the animal can choose freely between the left and right goal arm (all guillotine-doors opened) during 14 'free choice' trials. As soon a the mouse has entered one goal arm, the other one is closed. The mouse eventually returns to the start arm and is free to visit whichever go alarm it wants after having been confined to the start arm for 5 seconds. After completion of 14 free choice trials in one session, the animal is removed from the maze. During training, the animal is never handled.
The percent alternations out of 14 trials is calculated. This percentage and the total time needed to complete the first forced trial and the subsequent 14 free choice trials
(in s) is analyzed. Cognitive deficits are usually induced by an injection of scopolamine, 30 min before the start of the training session. Scopolamine reduced the per-cent alternations to chance level, or below. A cognition enhancer, which is always administered before the training session, will at least partially, antagonize the scopolamine-induced reduction in the spontaneous alternation rate.
EXAMPLE 10
In vivo target validation
Effects on plasma cholesterol levels including HDL cholesterol are typically assessed in humanized apo-A transgenic mice. Modulation of human target proteins can be determined in coπesponding transgenic mice (e.g., CETP transgenic mice). Triglyceri.de lowering is usually evaluated in ob/ob mice or Zucker rats. Animals are fed with normal diets or modified diets (e.g., enriched by 0.5 % cholesterol 20% coconut oil). Standard protocols consist of oral applications once daily for 7 to 10 days at doses ranging from 0,1 to 100 mg/kg. The compounds are dissolved (e.g., in Solutol/Ethanol/saline mixtures) and applied by oral gavage or intravenous injection. Before and at the end of the application period, blood samples are typically drawn by retroorbital punctuation. Plasma cholesterol and triglyceride levels are determined with standardized clinical diagnostic kits (e.g., INFINITY™ cholesterol reagent and INFINETY™ triglyceride reagent; Sigma, St. Louis). HDL cholesterol is determined after phosphotungstic acid precipitation of non-HDL lipoproteins or FPLC gel filtration with post-column derivatization of cholesterol using the reagents mentioned above. Plasma levels of human apolipoprotein-AE in relevant humanized transgenic mice are measured by immunoturbidimetry (Sigma).
Long-term anti-atherosclerotic potency of drug candidates are evaluated in Apo E- knockout mice. Therefore, animals are fed a standard chow diet (4,5 % fat) or a Western diet (20 %> fat) containing 1 to 100 mg/kg of the respective compounds for 3 to 5 month. Arterial lesions are quantified in serial cryosections of the proximal aorta by staining with Oil Red O and counterstaining with hematoxylin. Lesion area size is determined using an digital imaging system.
EXAMPLE 11
In vivo testing of cardiovascular effects of test compounds
Hemodynamics in anesthetized rats
Male Wistar rats weighing 300-350 g (Harlan Winkelmann, Borchen, Germany) are anesthetized with thiopental "Nycomed'O (Nycomed, Munich, Germany) lOO mg kg-1 i.p. A tracheotomy is performed, and catheters are inserted into the femoral artery for blood pressure and heart rate measurements (Gould pressure transducer and recorder, model RS 3400) and into the femoral vein for substance administration. The animals are ventilated with room air and their body temperature is controlled. Test compounds are administered orally or intravenously.
Hemodynamics in conscious SHR
Female conscious SHR (Moellegaard/Denmark, 220 - 290 g) are equipped with implantable radiotelemetry, and a data acquisition system (Data Sciences, St. Paul, MN, USA), comprising a chronically implantable transducer/transmitter unit equipped with a fluid-filled catheter is used. The transmitter is implanted into the peritoneal cavity, and the sensing catheter is inserted into the descending aorta.
Single administration of test compounds is performed as a solution in Transcutol®/
Cremophor®/ H2O (10/20/70 = v/v/v) given orally by gavage. The animals of control groups only receive the vehicle. Before treatment, mean blood pressure and heart rate of treated and untreated control groups are measured.
Hemodynamics in anesthetized dogs
Studies are performed on anesthetized dogs of either sex (body weight between 20- 30 kg). Anesthesia is initiated by slow intravenous injection of 25 mg kg-1 sodium thiopental (Trapanal®, Byk Gulden, Konstanz, Germany). The anesthesia is contin- ued and maintained throughout the experiment by continuous infusion of 0.04 mg kg-1 h-1 fentanyl (Fentanyl®, Janssen, Neuss, Germany) and 0.25 mg kg- h 1 droperidol (DihydrobenzperidolR, Janssen, Neuss, Germany). During this anaesthesia, heart rate is as low as 35-40 bpm due to increased vagal tone. Therefore, a parasympathetic blockade is achieved by intermittent injections of atropine (0.1 mg per animal) (AfropinsulfafR, Eifelfango, Bad Neuenahr, Germany). After intubation the animals are artificially ventilated at constant volume (EngstrδmR 300, Engstrόm, Sweden) with room air enriched with 30%) oxygen to maintain an end-tidal CO2 concentration of about 5% (NormocapR, Datex, Finland).
The following catheters are implanted for measurement of cardiovascular parameters: a tip catheter for recording of left ventricular pressure is inserted into the ventricle via the carotid artery (PC350, Millar Instruments, Houston, TX, USA), a hollow catheter is inserted into the femoral artery and connected to a strain gauge (type 4-327-1, Telos Medical, Upland, CA, USA for recording of arterial blood pressure, two venous catheters are inserted into either femoral vein and one additional catheter into a forearm vein for application of the anaesthetic and drugs, respectively, and an oxymetry catheter for recording of oxygen saturation is inserted into the coronary sinus via the jugular vein (Schwarzer EVH4, Mϋnchen, Germany).
After a left-sided thoracotomy the ramus circumflexus of the left coronary artery (LCX) is freed from connective tissue, and an electromagnetic flow probe (Gould
Statham, Oxnard, CA, USA) is applied for measurement of coronary blood flow. Arterial blood pressure, electrocardiogram (lead II), left ventricular pressure, first derivative of left ventricular pressure (dP/dt), heart rate, coronary blood flow, and oxygen saturation in the coronary sinus are continuously recorded on a pen recorder (Brush, Gould, Cleveland, OH, USA). The maximum of dP/dt is used as measure of left ventricular contractility (dP/dtmax). After completion of the instrumentation, an interval of 60 min is allowed for stabilization before the test compound is intravenously applied as bolus injections. Care is taken that all measured cardiovascular parameters have returned to control level before injection of the next dose. Each dose of the test compound is tested at least three times in different animals. The order of injection of the different doses is randomized in each animal.
EXAMPLE 12
In vivo testing of compounds/target validation
Tests for activity of T cells
Mouse anti-CD3 induced cytokine production model
BALB/c mice are injected with a single intravenous injection of 10 μg of 145-2C11 (purified hamster anti-mouse CD3ε monoclonal antibodies, PHARMENGEN). A test compound is administered intraperitoneally 60 min prior to the anti-CD3 mAb injection. Blood is collected 90 minutes after the antibody injection. Serum is obtained by centrifugation at 3000 r.p.m. for 10 min. IL-2 and EL-4 levels in the serum are determined by an ELISA. Tests for activity of B cells
Mouse anti-IgD induced IgE production model
BALB/c mice are injected intravenously with 0.8 mg of purified goat anti-mouse IgD antibody or PBS (defined as day 0). Compound is administered infraperitoneally from day 0 to day 6. On day 7 blood is collected and serum is obtained by centrifugation at 3000 r.p.m. for 10 min. Serum total levels of IgE are determined by YAMAS A' s ELISA kit and their Ig subtypes are done by an Ig ELISA KIT (Rougier
Biotech's, Montreal, Canada).
Tests for activity of monocytes/macrophages
Mouse LPS-induced TNF-a production model
BALB/c mice are injected infraperitoneally with LPS (200 μg/mouse). Compound is administered infraperitoneally 1 hr before the LPS injection. Blood is collected at 90 min post-LPS injection and plasma is obtained. TNF-α concentration in the sample is determined using an ELISA kit.
Tests eosinophil activation
Mouse eotaxin-induced eosinophilia model
BALB/c mice are injected intradermally with a 2.5 ml of air on days -6 and -3 to prepare airpouch. On day 0 compound is administered infraperitoneally 60 min before eotaxin injection (3 μg/mouse, i.d.). IL-5 (300 ng/mouse) is injected intravenously 30 min before the eotaxin injection. After 4 hr of the eotaxin injection leukocytes in exudate is collected and the number of total cells is counted. The differential cell counts in the exudate are performed by staining with May-Grunwald Gimsa solution. .
Tests activation of Th2 cells
Mouse DIP cell transfer model
D10.G4.1 cells (1 x IO7 cells/mouse) containing 2 mg of conalbumin in saline is administered i.v. to AKR mice. After 6 hr blood is collected and serum is obtained by centrifugation at 3000 r.p.m. for lOmin. IL-4 and IL-5 level in serum are determined by ELISA kits. Compound is administered infraperitoneally at -4 and +1 hr after these cells injection.
Passive cutaneous anaphylaxis (PCA) test in rats
6 Weeks old male Wistar rats are sensitized intradermally (i.d.) on their shaved backs with 50 μl of 0.1 μg/ml mouse anti-DNP IgE monoclonal antibody (SPE-7) under a light anesthesia. After 24 hours, the rats are challenged intravenously with 1 ml of saline containing 0.6 mg DNP-BSA (30) (LSL CO., LTD) and 0.005 g of Evans blue. Compounds are injected infraperitoneally (i.p.) 0.5 hr prior to antigen injection. Rats without the sensitization, challenge, and compound treatment are used for a blank (control) and rats with sensitization, challenge and vehicle treatment are used to determine a value without inhibition. Thirty min after the challenge, the rats are killed, and the skin of the back is removed. Evans blue dye in the skin is extracted in formamide overnight at 63°C. Then an absorbance at 620 nm is measured to obtain the optical density of the leaked dye.
Percent inhibition of PCA with a compound is calculated as follows: % inhibition = {(mean vehicle value - sample value)/(mean vehicle value - mean control value)} x 100 Anaphylactic bronchoconstriction in rats
6 Weeks old male Wistar rats are sensitized intravenously (i.v.) with 10 μg mouse anti-DNP IgE, SPE-7, and 1 days later, the rats are challenged intravenously with 0.3 ml of saline containing 1.5 mg DNP-BSA (30) under anesthesia with urethan
(1000 mg/kg, i.p.) and gallamine (50 mg/kg, i.v.). The trachea is cannulated for artificial respiration (2 ml / stroke, 70 strokes / min). Pulmonary inflation pressure (PIP) is recorded through a side-arm of cannula connected to pressure transducer. Change in PEP reflects change of both resistance and compliance of the lungs. To evaluate the drugs, each drug is given i.v. 5 min before challenge.
EXAMPLE 13
Bladder outlet obstruction model
Wistar rats (200~250 g / Charles River Japan) are anesthetized infraperitoneally with ketamine. The abdomen is opened through a midline incision and the bladder and the proximal urethra are exposed. A constant degree of urethral obstruction is produced by tying a ligature around the urethra and a catheter with an outer diameter of 1 mm. The abdominal well is closed and the animals allowed to recover.
After 6 weeks, the rats are anesthetized with ketamine, and the ligature around the urethra is carefully removed to normalize the outlet resistance and enable repetitive micturition. A polyethylene catheter is implanted in the bladder through the dome, and exteriorized at the scapular level. Animals are then allowed to recover for at least 48 hours.
Cytometric investigation is performed without anesthesia two days after bladder catheter implantation in control and obstructed animals. The bladder catheter was connected via a T-tube to a strain gauge and a microinjection pump. The conscious rats are held under partial restraint in a restraining device. Warmed saline is infused into the bladder at a rate of 3 ml/hr for control and obstructed animals. The rate of infusion is increased from 3 to 10 ml/hr to obtain similar interval times between micturitions in obstructed and control rats. Overactivity of the obstructed bladders is assessed by measuring the cystometric parameters such as basal pressure, peak micturition pressure, threshold pressure, micturition interval, amplitude and frequency of spontaneous activity and micturition slope. Lluel et al, J. Urol. 160, 2253-57, 1998.
A test compound is dissolved in an appropriate vehicle, such as a mixture of ethanol, Tween 80 (ICN Biomedicals Inc.), and saline (1:1:8, v/v/v), is administered intravenously through the catheter.
EXAMPLE 14
Organ bath assay for measuring agonist-induced contraction of prostate
An organ bath assay is employed to measure the agonist-induced contraction of prostate for assessing the biological activity of test compounds (i.e., drug candidates). Male Wistar rats (200~250 g / Charles River Japan) are anesthetized with ether and sacrificed by dislocating the necks. The whole prostate is excised and placed in oxygenated Modified Krebs-Henseleit solution (pH 7.4) of the following composition (112mM NaCl, 5.9mM KCl, 1.2mM MgCl2, 1.2mM NaH2PO4, 2mM CaCl2, 2.5mM NaHCO , 12mM glucose). Ventricle prostate lobes were dissected into several strips depending on the size of prostate. Prostate strips are equilibrated for 60 min in organ bath chambers before any stimulation.
Isometric tension is recorded under an appropriate load. Contractile response to adrenergic agonists or electric field stimulation is determined several times until reproducible responses are obtained. Test compounds are pre-incubated prior to the agonistic or electric stimulation. The ratio of each contraction to the negative control is calculated and the effect of the test compounds on the prostate contraction is evaluated.
EXAMPLE 15
Organ bath assay for measuring agonist-induced contraction of urinary bladder
An organ bath assay is employed to measure the agonist-induced contraction of urinary bladder for assessing the biological activity of test compounds (i.e., drug candidates). Male Wistar rats (200-250 g / Charles River Japan) are anesthetized with ether and sacrificed by dislocating the necks. The whole urinary bladder is excised and placed in oxygenated Modified Krebs-Henseleit solution (pH 7.4) of the following composition (112mM NaCl, 5.9mM KCl, 1.2mM MgCl2, 1.2mM NaH2PO4, 2mM CaCl2, 2.5mM NaHCO3, 12mM glucose).
Isometric tension is recorded under an appropriate load using longitudinal strips of rat detrusor muscle. Bladder strips are equilibrated for 60 minutes before each stimulation. Contractile response to 80 mM KCl is determined at 15 minute intervals until reproducible responses are obtained. The response to KCl is used as an internal standard to evaluate the effect of test compounds.
The effects of test compounds are investigated by incubating the strips with compounds for 30 minutes prior to stimulation with an appropriate agonist or electrical stimulation. One of the preparations made from the same animal serves as a control, while others are used for evaluating test compounds. The ratio of each contraction to the internal standard (e.g., a KCl-induced contraction) is calculated, and the effects of the test compounds on the contraction are evaluated. EXAMPLE 16
In vivo testing of compounds/target validation
(1) Animals. Female Sprague-Dawley rats (200-250 g / Charles River Japan) are used.
(2) Catheter implantation. Rats are anesthetized by intraperitoneal administration of urethane (Sigma) at 1.25 g/kg. The abdomen is opened through a midline incision, and a polyethylene catheter (BECTON DICKINSON, PE50) is implanted into the bladder through the dome. In parallel, the inguinal region is incised, and a polyethylene catheter (BECTON DICKINSON, PE50) filled with saline (Otsuka) is inserted into a femoral vein.
(3) Investigation of bladder contraction. The bladder is filled via the catheter by incremental volume of saline until spontaneous bladder contractions occur. The intravesicular pressure is measured a pressure transducer and displayed continuously on a chart recorder. The activity of test compounds is assessed after intravenous adminisfration through a polyethylene cannula inserted into the femoral vein.
Measurement of bladder cystometry in conscious rats
(1) Animals. Female Sprague-Dawley rats (200-250 g / Charles River Japan) are used.
(2) Catheter implantation. Rats are anesthetized by intramuscular administration of ketamine (75 mg/kg) and xylazine (15 mg/kg). The abdomen is opened through a midline incision, and a polyethylene catheter (BECTON DICKJNSON, PE50) is implanted into the bladder through the dome. The catheter is tunneled through subcutis of the animal by needle (14G) to neck. - I ll -
In parallel, the inguinal region is incised, and a polyethylene catheter (BECTON DICKINSON, PE50) filled with saline (Otsuka) is inserted into a femoral vein. The catheter is tunneled through subcutis of the animal by needle to neck.
(3) Cystometric investigation. The bladder catheter is connected via T-tube to a pressure transducer (Viggo-Spectramed Pte Ltd, DT-XXAD) and a microiηjection pump (TERUMO). Saline is infused at room temperature into the bladder at a rate of 10 ml hr. Intravesicular pressure is recorded continuously on a chart pen recorder (Yokogawa). At least three reproducible micturition cycles are recorded before a test compound adminisfration. (4) Administration of test compounds. A test compound dissolved in the mixture of ethanol, Tween 80 (ICN Biomedicals Enc) and saline (1 : 1 : 8, v/v/v) is administered intravenously through the catheter.
EXAMPLE 17
In vitro testing of compounds/target validation
Isolation of CD34+ cells
Mononuclear cells from fresh blood (cord blood, peripheral blood, bone maπow) were separated by Ficoll Paque® (1.077 density, Amersham-Pharmacia) density gradient centrifugation, and CD34+ cells were purified by immunomagnetic separation system (MiniMACS, Miltenyi Biotec), according to the manufacture's instructions (Direct CD34 Progenitor Cell Isolation Kit, Miltenyi Biotec). The percentage of CD34+ cells were generally from 90-95%. Erythropoiesis/Anemia
Erythroid CD34+ Liquid Culture
l-2xl04 CD34+ cells were plated in triplicate in 24-well plates with 1ml Escoves modified Dulbecco medium (IMDM) (Invitrogen) containing 10%) fetal bovine serum (FCS, Invitrogen), 1%> Glutamine (Invitrogen) supplemented with SCF (25ng/ml) (PeproTech), different concentration of Erythropoietin (O.OlU/ml - lU/ml) (Erypo® FS 4000, Cilag) with or without compounds. Control cells were incubated with 0.1-
0.2%) DMSO instead of compounds. The cultures were incubated at 37°C in a fully humidified atmosphere with 5% CO2. After 9 to 14 days cells were harvested, counted and stained with phycoerythrin (PE)-conjugated mAb against Glycophorin A (Pharmingen) to analyze differentiation.
Erythroid Colony-forming assay
Five hundred CD34+ cells/ml were plated in triplicate 24-well plates with 1% methylcellulose in IMDM containing 30% FCS, 1% bovine serum albumin (BSA), 2 mM L-glutamine and 10-4M 2-mercaptoethanol (Methocult H4230, Cell
Systems®), IL-3 (lOng/ml ) (PeproTech) with different concentration of erythropoietin (O.OlU/ml - lU/ml) with or without compounds. The cultures were incubated at 37°C in a fully humidified atmosphere with 5% CO2. After 9 to 14 days erythroid burst forming units (BFU-E) were counted from each of the plates. Afterwards cells were dissolved from methylcellulose with 0.1% NaCl solution.
Cells were counted and stained with phycoerythrin (PE)-conjugated mAb against Glycophorin A (Pharmingen) to analyze differentiation. BFU-E culture
lxlO5 Cord Blood CD34+ cells/ml were cultured in EMDM containing 15% BIT- 9500 (Cell Systems®), supplemented with IL-3 (10ng/ml)3 IL-6 (lOng/ml) and SCF (25ng/ml) (PeproTech) and incubated at 37°C in a fully humidified atmosphere with
5% CO2. 3 and 5 days after initiation of culture an equal volume of fresh medium supplemented with 2X cytokines were added. On day 6 to 7 l-2xl04 erythroid progenitors were plated in triplicate in 24-well plates with 1ml EMDM containing 10%ι FCS, 1% glutamine supplemented with SCF (25ng/ml), different concentration of erythropoietin (O.OlU/ml - lU/ml) with or without compounds. Control cells were incubated with 0.1-0.2%> DMSO instead of compounds. The cultures were incubated at 37°C in a fully humidified atmosphere with 5% CO2. After 6 to 8 days cells were harvested and counted to analyze proliferation.
CD36+ cells
lxlO5 Cord Blood CD34+ cells/ml were cultured in IMDM containing 15% BIT- 9500 supplemented with IL-3 (lOng/ml), IL-6 (lOng/ml) and SCF (25ng/ml) and incubated at 37°C in a fully humidified atmosphere with 5% CO2. 3 and 5 days after initiation of culture an equal volume of fresh medium supplemented with 2X cytokines were added. On day 6 to 7 cells were stained with PE-conjugated mAb against CD36 (Pharmingen) and CD36+ cells were purified using anti-PE microbeads and Mini MACS system (Miltenyi Biotec) according to the manufacture's instructions. l-2xl04 CD36+ cells were plated in triplicate 24well plates with 1ml IMDM containing 10% FCS, 1%> Glutamine supplemented with SCF
(25ng/ml), different concentration of Erythropoietin (O.OlU/ml - lU/ml) with or without compounds. Control cells were incubated with 0.1-0.2%) DMSO instead of compounds. The cultures were incubated at 37°C in a fully humidified atmosphere with 5% CO2. After 6 to 8 days cells were harvested and counted to analyze proliferation. Myelopoiesis and Thrombocytopoiesis
Myeloid CD34+ Liquid Culture
5 x 10 CD34+ cells isolated from peripheral blood, cord blood or from bone maπow were pre-incubated in quadruplicate in 24-well plates in 1ml medium (StemSpan) with 15% FCS, SCF (20 ng/ml) and GM-CSF (2,5 ng/ml) for 6 to 7 days at 37°C and 5.5% CO2. Then compounds (0.1.1 or 10 μM in DMSO) with or without G-CSF (0.25 ng/ml; Neupogen ®) were added and incubated for another 6 to 7 days. The number of the early myelopoietic CD15+/CDl lb- cells and the number of the late myelopoietic CD15+/CD1 lb+ cells were determined by cell count (proliferation) and FACS (fluorescent associated cell sorting) analysis (differentiation) at day 13-14.
Megakaryoid CD34+ Liquid Culture
5 x 10 CD34+ cells isolated from peripheral blood, cord blood or from bone maπow were incubated in quadruplicate 24-well plates in 1 ml serum-free medium with 2% BSA, SCF (20 ng/ml) and compounds ( 0.1,1 or 10 μM in DMSO) with or without TPO (0-lOng/ml) for 12 to 13 days at 37°C and 5% CO2. The number of the megakaryoid CD41+ cells (scatter profile) were determined by FACS analysis.
Megakaryocytes will be examined by microscope if necessary.
Erythropoiesis/Anemia
Compounds which have demonstrated effects on the drug target in vitro have been administered to normal or anemic animals orally or parenterally. En most cases, mice were used for compound testing. In some cases, other species, e.g. rats, hamsters or guinea pigs have been used in addition. Usually, repeated dosage is required for detection of changes in peripheral blood parameters. During the dosage period and up to five days after the last administration blood samples were drawn for analysis of red and white blood cell counts as well as platelet counts using an automated blood analyzer. In addition, erythropoiesis was assessed by manual hematocrit and reticulocyte count determination. For specific analysis of leukocyte differentiation fluorescent associated cell sorting (FACS) was used.
Myelopoiesis and Throrhbocytopoiesis
Myelopoiesis
lmmunocompetent Balb/c mice were treated with compounds at different doses (based on pharmacokinetic data) once/day or bid per-orally or parenterally for up to
4 days. The WBC (white blood cells count) and the neutrophil count were monitored by FACS (CDllb+ ; scatter properties).
Immunocompromised Balb/c were generated by intravenous treatment with 5-FU (100 mg/kg i.p). 24 hours later the mice were treated with the test compound at different doses (based on pharmacokinetic data) once/day or bid per-orally or parenterally for up to 7 to 13 days. Peripheral blood counts (WBC, RBC, PLT) have been determined after retroorbital plexus puncture at days 5,7,11 and 14. For more detailed investigations the development of cellularity of femoral bone maπow and spleen were investigated by FACS analysis. The expression of specific differentiation markers on stem and progenitor cells (e.g. CD34, CD33, CD38, CDI lb) and scatter properties were investigated.
Thrombocytopoiesis
Thrombopoietic compounds at different doses (based on pharmacokinetic data) were administered orally or parenterally following chemotherapy (Carboplatin, 100 mg/kg i.p) immunocompromised mice. After repeated administration (once/day or bid for five to seven days) peripheral blood platelets (automated blood analyzer) have been determined after retroorbital plexus punction at day 5, 1, 11, and 14. EXAMPLE 18
Identification of test compound efficacy in an animal model of COPD
A/J mice are exposed to the smoke from 2 unfiltered cigarettes per day for 6 days per week for 14 weeks. Non-smoking, age-matched animals are used as controls. Animals are orally dosed with test compound or vehicle 1 hour before and 7 hours after smoke exposure. This twice-daily dosing regime is continued throughout the smoke exposure period. On day 7 of the weekly exposure, animals are given only 1 dose of test compound and are not exposed to cigarette smoke.
After the smoke exposure period, the mice are killed, their lungs inflated with phosphate-buffered formalin via their trachea, and then the lungs and heart are removed en bloc and fixed at 4°C for 48 hours. The lungs are then prepared for paraffin wax sectioning, and 4 mm sections are cut and mounted on glass slides.
Sections are then stained with haematoxylin and eosin. Morphometric analysis of lung sections is done by calculation of the Linear Mean Intercept (LMI) parameter using a semi-automated computer image analysis system. Each slide (1 per mouse) contains several sections originating from multiple lobes. Twelve non-overlapping areas (each area covering 1.53 x 10-3 cm2) are randomly selected for LMI analysis.
The 12 areas cover a minimum of two lobes per slide. Non-parenchymal components (airways, blood vessels) are excluded from the analysis to prevent artifactual eπor. The mean intercept length is calculated for each mouse. Development of emphysema is seen as an increase in LMI.
LMI data are expressed as the median and statistical comparisons are done using the non-parametric Mann-Witney U-test. A 'p' value of <=0.05 is considered to be statistically significant. The potency of a test compound is evaluated by comparison of the tobacco smoke induced increase in LMI in animals dosed with either the test compound or just the vehicle used for adminisfration of the compound. EXAMPLE 19
Identification of test compound efficacy in an in vitro functional test relevant to COPD
The potency of test compounds is evaluated by measuring the inhibition of elastolysis induced by human alveolar macrophages. The cells are isolated from bronchoalveolar lavage samples taken from non-smokers, disease-free smokers, and smokers with COPD. Macrophage suspensions are added to test wells coated with tritiated elastin and incubated at 37°C for 3h to allow adherence of the cells. The wells are then carefully washed to remove non-adherent cells and fresh medium is added to each well. The cells are incubated at 37°C for up to 72 hours in the presence or absence of test compound. Every 24 hours the medium in each well is removed for analysis and replaced by fresh medium. Radioactivity released into the medium is measured by liquid scintillation counting and the rate of elastin degradation is calculated. The potency of a test compound is evaluated by comparing the rate of elastolysis measured with cells incubated in the presence or absence of the compound.
EXAMPLE 20
Expression profiling
Total cellular RNA was isolated from cells by one of two standard methods: 1) guanidine isothiocyanate/cesium chloride density gradient centrifugation [Kellogg et al. (1990)]; or with the Tri-Reagent protocol according to the manufacturer's specifications (Molecular Research Center, Inc., Cincinnati, Ohio). Total RNA prepared by the Tri-reagent protocol was treated with DNAse I to remove genomic DNA contamination. For relative quantitation of the mRNA distribution, total RNA from each cell or tissue source was first reverse transcribed. Eighty-five μg of total RNA was reverse transcribed using 1 μmole random hexamer primers, 0.5 mM each of dATP, dCTP, dGTP and dTTP (Qiagen, Hilden, Germany) and 3000 U ElnaseQut (Invitrogen, Groningen, Netherlands) in a final volume of 680 μl. The first strand synthesis buffer and Omniscript reverse transcriptase (2 u/μl) were obtained from (Qiagen, Hilden, Germany). The reaction was incubated at 37°C for 90 minutes and cooled on ice. The volume was adjusted to 6800 μl with water, yielding a final concentration of 12.5 ng/μl of starting RNA.
For relative quantitation of the distribution of mRNA in cells and tissues the Perkin Elmer ABI Prism R™ 7700 Sequence Detection system or Biorad iCycler was used according to the manufacturer's specifications and protocols. PCR reactions were set up to quantitate expression of the test gene and the housekeeping genes HPRT (hypoxanthine phosphoribosyltransferase), GAPDH (glyceraldehyde-3 -phosphate dehydrogenase), β -actin, and others. Forward and reverse primers and probes were designed using the Perkin Elmer ABI Primer Express™ software and were synthesized by TibMolBiol (Berlin, Germany). The forward primer sequence was: Primerl gcacttggcgaaagagattc The reverse primer sequence was Primer2 gccataggcacaggtgaaag. Probe 1 tcctccacagacacacagatcctgc, labeled with FAM
(carboxyfluorescein succinimidyl ester) as the reporter dye and TAMRA (carboxy- tetramethylrhodamine) as the quencher, was used as a probe. The following reagents were prepared in a total of 25 μl: lx TaqMan buffer A, 5.5 mM MgCl2, 200 nM of dATP, dCTP, dGTP, and dUTP, 0.025 U/μl A pliTaq Gold™, 0.01 U/ μl AmpErase, and Probel, forward and reverse primers each at 200 nM, 200 nM,
FAM/TAMRA-labeled probe, and 5 μ 1 of template cDNA. Thermal cycling parameters were 2 min at 50°C, followed by 10 min at 95°C, followed by 40 cycles of melting at 95° C for 15 sec and annealing/extending at 60° C for 1 min. Calculation of coπected CT values
The CT (threshold cycle) value is calculated as described in the "Quantitative determination of nucleic acids" section. The CF-value (factor for threshold cycle coπection) is calculated as follows:
1. PCR reactions were set up to quantitate the housekeeping genes (HKG) for each cDNA sample.
CTnKG-values (threshold cycle for housekeeping gene) were calculated as described in the "Quantitative determination of nucleic acids" section. CTHKG-mean values (CT mean value of all HKG tested on one cDNAs) of all HKG for each cDNA are calculated (n = number of HKG): CTHKG-n-mean value = (CTHKGI -value + CTHKG2-value + ... + CTHKG-n-value) / n CTpannei mean value (CT mean value of all HKG in all tested cDNAs) = (CTHKGi-ttiean value + CTκκG2-mean value + ...+ CTHKG-y-mean value) / y (y = number of cDNAs)
CFCDNA-n (coπection factor for cDNA n) = CTpannei-mean value - CTHKG-Π- mean value CTcDNA-n (CT value of the tested gene for the cDNA n) + CFCDNA-Π (coπection factor for cDNA n) = CT Cor-oDNA-n (coπected CT value for a gene on cDNA n)
Calculation of relative expression
Definition : highest CTcor-cDNA-n ≠ 40 is defined as CTCOI-CDNA [high] Relative Expression = 2 (CTcor-cDNAChigh] " CTCO DNA-I,)
The following tissues were tested: Alzheimer cerebral cortex, prostate BPH, bone maπow CD33+ cells, coronary artery, coronary artery sclerotic, rectum, dorsal root ganglia, lung tumor, stomach tumor, pons, lung right mid lobe, lung right lower lobe, occipital lobe, ileum, lung right upper lobe, Alzheimer brain frontal lobe, neuroblastoma EMR32 cells, Alzheimer brain, substantia nigra, artery, hippocampus, penis, tonsilla cerebelli, aorta sclerotic, vermis cerebelli, liver tumor, corpus callosum, HEK CNS + APP, cerebral cortex, liver ciπhosis, cerebellum (left), ureter, skin, ovary tumor, HEK CNS, cerebral peduncles, ovary, ileum chronic inflammation, retina, heart atrium (left), neuroblastoma SK-N-MC cells, lymph node, cord blood CD71+ cells, parietal lobe, precential gyms, vein, aorta, erythrocytes, bone maπow CD 15+ cells, cerebellum (right), lung COPD, bone maπow CD71+ cells, cerebral meninges, fetal kidney, frontal lobe, breast, thrombocytes, temporal lobe, ileum tumor, thalamus, colon tumor, neuroblastoma SH5Y cells, bone maπow CD34+ cells, bone maπow stromal cells, coronary artery smooth muscle primary cells, kidney tumor, uterus, brain, fetal brain, HEP G2 cells, corpus cavernosum, esophagus, spinal cord, HEK 293 cells, breast tumor, glial tumor H4 cells, esophagus tumor, HUVEC cells, skeletal muscle, glial tumor H4 cells + APP, testis, interventricular septum, heart atrium (right), pericardium, heart ventricle (left), fetal lung fibroblast EMR-90 cells, Jurkat (T-cells), pancreas liver ciπhosis, postcentral gyrus, MDA MB 231 cells (breast tumor), kidney, fetal lung, stomach, spleen liver ciπhosis, small intestine, spleen, prostate, fetal heart, heart, adipose, leukocytes (peripheral blood), cervix, adrenal gland, trachea, thyroid tumor, placenta, thyroid, colon, fetal aorta, liver, fetal liver, bladder, thymus, cerebellum, mammary gland, HeLa cells (cervix tumor), salivary gland, bone marrow, pancreas, lung, and uterus tumor.
The results are shown in Table 1.
Table 1
Figure imgf000121_0001
Figure imgf000122_0001
Figure imgf000123_0001
Figure imgf000124_0001
Figure imgf000125_0001
REFERENCES
1. cDNA sequence coding for a rat glia-derived nexin and its homology to members of the serpin superfamily. Biochemistry 1987 Oct 6;26(20):6407-10.
2. A glia-derived neurite promoting factor with protease inhibitory activity belongs to the protease nexins. Cell 1986 Dec 5;47(5):687-93.
3. Protease nexin. Properties and a modified purification procedure. J Biol Chem
1985 Jun l0;260(ll):7029-34.

Claims

1. An isolated polynucleotide being selected from the group consisting of:
a) a polynucleotide encoding a nexin-related serine protease inhibitor polypeptide comprising an amino acid sequence selected form the group consisting of: i) amino acid sequences which are at least about 32% identical to the amino acid sequence shown in SEQ ID NO: 2; and ii) the amino acid sequence shown in SEQ ID NO: 2.
b) a polynucleotide comprising the sequence of SEQ ID NO: 1 ;
c) a polynucleotide which hybridizes under stringent conditions to a polynucleotide specified in (a) and (b) and encodes a nexin-related serine protease inhibitor polypeptide;
d) a polynucleotide the sequence of which deviates from the polynucleotide sequences specified in (a) to (c) due to the degeneration of the genetic code and encodes a nexin-related serine protease inhibitor polypeptide; and
e) a polynucleotide which represents a fragment, derivative or allelic variation of a polynucleotide sequence specified in (a) to (d) and encodes a nexin-related serine protease inhibitor polypeptide.
2. An expression vector containing any polynucleotide of claim 1.
3. A host cell containing the expression vector of claim 2.
4. A substantially purified nexin-related serine protease inhibitor polypeptide encoded by a polynucleotide of claim 1.
5. A method for producing a nexin-related serine protease inhibitor polypeptide, wherein the method comprises the following steps: a) culturing the host cell of claim 3 under conditions suitable for the expression of the nexin-related serine protease inhibitor polypeptide; and b) recovering the nexin-related serine protease inhibitor polypeptide from the host cell culture.
6. A method for detection of a polynucleotide encoding a nexin-related serine protease inhibitor polypeptide in a biological sample comprising the following steps: a) hybridizing any polynucleotide of claim 1 to a nucleic acid material of a biological sample, thereby forming a hybridization complex; and b) detecting said hybridization complex.
7. The method of claim 6, wherein before hybridization, the nucleic acid material of the biological sample is amplified.
8. A method for the detection of a polynucleotide of claim 1 or a nexin-related serine protease inhibitor polypeptide of claim 4 comprising the steps of: a) contacting a biological sample with a reagent which specifically interacts with the polynucleotide or the nexin-related serine protease inhibitor polypeptide and b) detecting the interaction.
A diagnostic kit for conducting the method of any one of claims 6 to 8.
10. A method of screening for agents which decrease the activity of a nexin- related serine protease inhibitor, comprising the steps of: a) contacting a test compound with any nexin-related serine protease inhibitor polypeptide encoded by any polynucleotide of claiml; b) detecting binding of the test compound to the nexin-related serine protease inhibitor polypeptide, wherein a test compound which binds to the polypeptide is identified as a potential therapeutic agent for decreasing the activity of a nexin-related serine protease inhibitor.
11. A method of screening for agents which regulate the activity of a nexin- related serine protease inhibitor, comprising the steps of: a) contacting a test compound with a nexin-related serine protease inhibitor polypeptide encoded by any polynucleotide of claim 1; and b) detecting a nexin-related serine protease inhibitor activity of the polypeptide, wherein a test compound which increases the nexin- related serine protease inhibitor activity is identified as a potential therapeutic agent for increasing the activity of the nexin-related serine protease inhibitor, and wherein a test compound which decreases the nexin-related serine protease inhibitor activity of the polypeptide is identified as a potential therapeutic agent for decreasing the activity of the nexin-related serine protease inhibitor.
12. A method of screening for agents which decrease the activity of a nexin- related serine protease inhibitor, comprising the step of: a) contacting a test compound with any polynucleotide of claim 1; b) and detecting binding of the test compound to the polynucleotide, wherein a test compound which binds to the polynucleotide is" identified as a potential therapeutic agent for decreasing the activity of nexin-related serine protease inhibitor.
- 13. A method of reducing the activity of nexin-related serine protease inhibitor, comprising the step of contacting a cell with a reagent which specifically binds to any polynucleotide of claim 1 or any nexin-related serine protease inhibitor polypeptide of claim 4, whereby the activity of nexin-related serine protease inhibitor is reduced.
14. A reagent that modulates the activity of a nexin-related serine protease inhibitor polypeptide or a polynucleotide wherein said reagent is identified by the method of any of the claim 10 to 12.
15. A pharmaceutical composition, comprising the expression vector of claim 2 or the reagent of claim 14 and a pharmaceutically acceptable carrier.
16. Use of the expression vector of claim 2 or the reagent of claim 14 in the preparation of a medicament for modulating the activity of a nexin-related serine protease inhibitor in a disease.
17. Use of claim 16 wherein the disease is cancer, a CNS disorder, a cardiovascular disorder, a genitourinary disorder, a hematological disorder, agastro- intestinal disorder, COPD or asthma.
PCT/EP2002/013203 2001-11-27 2002-11-25 Polynucleotides encoding nexin-related serine protease inhibitor WO2003046006A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2002352115A AU2002352115A1 (en) 2001-11-27 2002-11-25 Polynucleotides encoding nexin-related serine protease inhibitor

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US33315701P 2001-11-27 2001-11-27
US60/333,157 2001-11-27
US40693002P 2002-08-30 2002-08-30
US60/406,930 2002-08-30
US40726002P 2002-09-03 2002-09-03
US60/407,260 2002-09-03

Publications (1)

Publication Number Publication Date
WO2003046006A1 true WO2003046006A1 (en) 2003-06-05

Family

ID=27406901

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2002/013203 WO2003046006A1 (en) 2001-11-27 2002-11-25 Polynucleotides encoding nexin-related serine protease inhibitor

Country Status (2)

Country Link
AU (1) AU2002352115A1 (en)
WO (1) WO2003046006A1 (en)

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1991005048A1 (en) * 1989-10-03 1991-04-18 Stichting Centraal Laboratorium Van De Bloedtransfusiedienst Van Het Nederlandse Rode Kruis Mutants of the human plasminogen activator inhibitor 1 (pai-1), their preparation and use
EP0850252A1 (en) * 1996-04-12 1998-07-01 American National Red Cross Mutant plasminogen activator-inhibitor type 1 (pai-1) and uses thereof
WO2001068879A2 (en) * 2000-03-14 2001-09-20 Bayer Aktiengesellschaft Human 1-aminocyclopropane-carboxylate synthase
WO2001085912A2 (en) * 2000-05-05 2001-11-15 Exelixis, Inc. Presenilin enhancers
WO2002014359A2 (en) * 2000-08-10 2002-02-21 Zymogenetics, Inc. Human serpin zserp15
WO2002026981A2 (en) * 2000-09-27 2002-04-04 Lexicon Genetics Incorporated Human protease inhibitor proteins and polynucleotides encoding the same
WO2002050105A1 (en) * 2000-12-19 2002-06-27 Smithkline Beecham Corporation Novel compounds

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1991005048A1 (en) * 1989-10-03 1991-04-18 Stichting Centraal Laboratorium Van De Bloedtransfusiedienst Van Het Nederlandse Rode Kruis Mutants of the human plasminogen activator inhibitor 1 (pai-1), their preparation and use
EP0850252A1 (en) * 1996-04-12 1998-07-01 American National Red Cross Mutant plasminogen activator-inhibitor type 1 (pai-1) and uses thereof
WO2001068879A2 (en) * 2000-03-14 2001-09-20 Bayer Aktiengesellschaft Human 1-aminocyclopropane-carboxylate synthase
WO2001085912A2 (en) * 2000-05-05 2001-11-15 Exelixis, Inc. Presenilin enhancers
WO2002014359A2 (en) * 2000-08-10 2002-02-21 Zymogenetics, Inc. Human serpin zserp15
WO2002026981A2 (en) * 2000-09-27 2002-04-04 Lexicon Genetics Incorporated Human protease inhibitor proteins and polynucleotides encoding the same
WO2002050105A1 (en) * 2000-12-19 2002-06-27 Smithkline Beecham Corporation Novel compounds

Also Published As

Publication number Publication date
AU2002352115A1 (en) 2003-06-10

Similar Documents

Publication Publication Date Title
WO2002066627A1 (en) Regulation of human dipeptidyl peptidase 8
US20040241156A1 (en) Regulation of human aminopeptidase n
WO2003064639A1 (en) Regulation of human mitogen-activate protein kinase catalytic domain
WO2003018816A1 (en) Regulation of human dcamkl1-like serine/threonine protein kinase
US20050170486A1 (en) Nucleic acids encoding human inositolpolyphosphate 5-phosphatase
WO2003052088A2 (en) Regulation of human sialyltransferase
US20040152092A1 (en) Regulation of human phosphatidic acid phosphatase type 2c-like protein
EP1360281B1 (en) Regulation of human wee1-like serine/threonine protein kinase
WO2003064654A1 (en) Human serine/threonine protein kinase
WO2003046006A1 (en) Polynucleotides encoding nexin-related serine protease inhibitor
WO2004020620A1 (en) Regulation of human esterase
WO2003018815A2 (en) Regulation of human g protein-couple receptor kinase
US20040136976A1 (en) Regulation of human zinc carboxypeptidase b-like protein
WO2002033056A2 (en) Regulation of human serine-threonine protein kinase
WO2003059947A1 (en) Regulation of human neurotransmitter transporter
US20050255545A1 (en) Regulation of human hematopoietin receptor-like protein
US20040157282A1 (en) Regulation of human dual specificity protein phosphatase 7-like protein
WO2004029237A1 (en) Splice-variants of the human leukotriene a-4 hydrolase
WO2003056014A1 (en) Regulation of human mono (adp-ribosyl) transferase-like protein
WO2003070929A1 (en) Regulation of human zinc protease signature-containing protein
WO2003066862A1 (en) Cloning of a human prolylhydroxylase-like protein
WO2002090543A2 (en) Regulation of human phosphatidic acid phosphatase type 2c-like protein
WO2003000874A2 (en) Regulation of human serine/threonine protein kinase nek3
WO2003052093A1 (en) Regulation of human tetrahydrofolate dehydrogenase/cyclohydrolase
WO2003057869A1 (en) Regulation of human sulfatase

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SC SD SE SG SI SK SL TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR IE IT LU MC NL PT SE SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP