WO2003038105A2 - Sequences for the preparation of 5-ketogluconic acid from gluconic acid - Google Patents

Sequences for the preparation of 5-ketogluconic acid from gluconic acid Download PDF

Info

Publication number
WO2003038105A2
WO2003038105A2 PCT/IB2002/004864 IB0204864W WO03038105A2 WO 2003038105 A2 WO2003038105 A2 WO 2003038105A2 IB 0204864 W IB0204864 W IB 0204864W WO 03038105 A2 WO03038105 A2 WO 03038105A2
Authority
WO
WIPO (PCT)
Prior art keywords
present
sequence
sequences
amino acid
nucleotide sequence
Prior art date
Application number
PCT/IB2002/004864
Other languages
French (fr)
Other versions
WO2003038105A3 (en
Inventor
Andrei Novomirovich Miasnikov
Tuomas SALUSJÄRVI
Neustroev Kirill Nikolaevich
Original Assignee
Danisco A/S
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from GB0126397A external-priority patent/GB0126397D0/en
Priority claimed from GB0215980A external-priority patent/GB0215980D0/en
Application filed by Danisco A/S filed Critical Danisco A/S
Priority to AU2002363277A priority Critical patent/AU2002363277A1/en
Publication of WO2003038105A2 publication Critical patent/WO2003038105A2/en
Publication of WO2003038105A3 publication Critical patent/WO2003038105A3/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
    • C12P7/58—Aldonic, ketoaldonic or saccharic acids
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C51/00—Preparation of carboxylic acids or their salts, halides or anhydrides
    • C07C51/347—Preparation of carboxylic acids or their salts, halides or anhydrides by reactions not involving formation of carboxyl groups
    • C07C51/377—Preparation of carboxylic acids or their salts, halides or anhydrides by reactions not involving formation of carboxyl groups by splitting-off hydrogen or functional groups; by hydrogenolysis of functional groups
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
    • C12P7/42—Hydroxy-carboxylic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
    • C12P7/44—Polycarboxylic acids
    • C12P7/46—Dicarboxylic acids having four or less carbon atoms, e.g. fumaric acid, maleic acid

Definitions

  • the present invention relates to a process and sequences for use in said process.
  • the present invention relates to a process and the use of amino acid sequences and nucleic acid sequences in said process. More in particular, the present invention relates to a process of producing 5-ketogluconic acid and the use of amino acid sequences that have gluconate 5-dehydrogenase enzyme activity and nucleic acid sequences coding for said amino acid sequences.
  • Tartaric acid is a commercially useful chemical. To date, it is typically prepared by processing the cream of tartar, which is a by-product of the wine industry.
  • the present invention seeks to provide a new process for preparing 5-ketogluconic acid using novel sequences (amino acid sequences and/or nucleotide sequences), wherein the 5-ketogluconic acid is suitable for use in the preparation of tartaric acid.
  • the present invention also seeks to provide a new process for the synthesis of inter alia tartaric acid using novel sequences (amino acid sequences and nucleotide sequences)
  • the present invention also provides sequences (amino acid sequences and nucleotide sequences).
  • the present invention relates to a process and to amino acid sequences for use in said process wherein the amino acid sequences have gluconic acid 5-dehydrogenase activity.
  • the present invention also relates to nucleotide sequences encoding the same.
  • a process for preparing 5-ketogluconic acid using sequences (amino acid sequences and/or nucleotide sequences).
  • a process for preparing tartaric acid using sequences (amino acid sequences and/or nucleotide sequences.
  • a nucleotide sequence encoding said amino acid sequence is provided.
  • Expression systems comprising said nucleotide sequence. Methods of expressing said nucleotide sequence. Transformed transfected hosts/host cells comprising said nucleotide sequence.
  • a combination comprising 5-KGA and said amino acid sequence and/or said nucleotide sequence.
  • 5-KGA produced by the process of the present invention. Uses of 5-KGA.
  • expression As used with reference to the present invention, the terms "expression”, “expresses”, “expressed” and “expressable” are synonymous with the respective terms “transcription”, “transcribes”, “transcribed” and “transcribable”.
  • the terms "transformation” and “transfection” refer to a method of introducing nucleic acid sequences into hosts, host cells, tissues or organs.
  • Other aspects concerning the nucleotide sequence which can be used in the present invention include: a construct comprising the sequences of the present invention; a vector comprising the sequences for use in the present invention; a plasmid comprising the sequences for use in the present invention; a transformed cell comprising the sequences for use in the present invention; a transformed tissue comprising the sequences for use in the present invention; a transformed organ comprising the sequences for use in the present invention; a transformed host comprising the sequences for use in the present invention; a transformed organism comprising the sequences for use in the present invention.
  • the present invention also encompasses methods of expressing the nucleotide sequence for use in the present invention using the same, such as expression in a host cell; including methods for transferring same.
  • the present invention further encompasses methods of isolating the nucleotide sequence, such as isolating from a host cell.
  • amino acid sequence for use in the present invention includes: a construct encoding the amino acid sequences for use in the present invention; a vector encoding the amino acid sequences for use in the present invention; a plasmid encoding the amino acid sequences for use in the present invention; a transformed cell expressing the amino acid sequences for use in the present invention; a transformed tissue expressing the amino acid sequences for use in the present invention; a transformed organ expressing the amino acid sequences for use in the present invention; a transformed host expressing the amino acid sequences for use in the present invention; a transformed organism expressing the amino acid sequences for use in the present invention.
  • the present invention also encompasses methods of purifying the amino acid sequence for use in the present invention using the same, such as expression in a host cell; including methods of transferring same, and then purifying said sequence. It is to be noted that the present invention provides a new and useful use of an enzyme that hitherto has not been disclosed or suggested in the art.
  • the present invention relates to a process for preparing 5-ketogluconic acid from gluconic acid - or nontoxic salts thereof - comprising using an amino acid sequence comprising the sequence presented as SEQ ID NoJ or SEQ ID No .3 or a 125 variant, homologue, ftagment or a derivative of any thereof.
  • the sequence presented as SEQ ID No. 1 is that detemiined by mass spectroscopy as described herein.
  • the present invention relates to a process for preparing 5- ketogluconic acid from gluconic acid - or nontoxic salts thereof- comprising using an 130 amino acid sequence comprising the sequence presented as SEQ ID No.5.
  • the present invention relates to a process for preparing 5- ketogluconic acid from gluconic acid or nontoxic salts thereof comprising using the expression product of the nucleotide sequence presented as SEQ ID No.2 or SEQ ID 135 No.4 or a sequence encoding the sequence presented as SEQ ID No. 5 or a variant, homologue, fragment or a derivative of any thereof.
  • the present invention relates to a process for preparing 5- ketogluconic acid from gluconic acid or nontoxic salts thereof comprising using the 140 expression product of the nucleotide sequence presented as SEQ ID NoJ or SEQ ID No.4 or a variant, homologue, fragment or a derivative thereof.
  • the present invention relates to a process for preparing tartaric acid by converting 5-ketogluconic acid which has been produced by a process 145 comprising using the amino acid sequences presented as SEQ ID NoJ or SEQ ID NoJ or SEQ ID No. 5 or a variant, homologue, fragment or a derivative of any thereof.
  • the present invention relates to a process for producing tartaric 150 acid by converting 5-ketogluconic acid which has been produced by a process comprising using the expression product of the nucleotide sequence presented as SEQ ID No .2 or SEQ ID No.4 or SEQ ID No. 6 or a variant, homologue, fragment or a derivative of any thereof.
  • the present invention includes using the tartaric acid obtained from the present invention as or in the preparation of a food or a foodstuff - such as in particular as a starting material for making emulsifiers.
  • the present invention relates to 5-KGA as a product produced by 160 the process of the present invention.
  • Another aspect of the present invention includes methods for purifying and/or isolating 5-KGA.
  • the present invention relates to 5-KGA when produced by the process of the present invention in a purified and/or isolated form.
  • Another aspect of the present invention includes using 5-KGA when produced b -the process of the present invention as an ingredient in a product for consumption. 170
  • Another aspect of the present invention includes using 5-KGA when produced by the process of the present invention as an ingredient in products where the product can be a product for consumption or a pharmaceutical product.
  • the present invention relates to a method for preparing a product, the method comprising admixing 5-KGA when produced by the process of the present invention with another component to form said product.
  • the present invention relates to a composition comprising 5-KGA 180 and amino acid sequences and/or nucleotide sequences wherein 5-KGA is produced by the method of the present invention and the amino acid sequences are the sequences shown as SEQ ID No. 1 and or SEQ ID NoJ and/or SEQ ID No.5 while the nucleotide sequences are the sequences shown as SEQ ID No.2 and/or SEQ ID NoJ and/ or SEQ ID No. 6.
  • the amino acid sequences are the sequences shown as SEQ ID No. 1 and or SEQ ID NoJ and/or SEQ ID No.5 while the nucleotide sequences are the sequences shown as SEQ ID No.2 and/or SEQ ID NoJ and/ or SEQ ID No. 6.
  • the invention relates to an amino acid sequence comprising the sequence shown as SEQ ID NoJ or SEQ ID NoJ or SEQ ID No. 5 or a variant, homologue, fragment or derivative of any thereof- preferably wherein said sequence SEQ ID No. 1 is determined by mass spectroscopy as described herein. 190
  • the amino acid sequence or variant or homologue or fragment or derivative has gluconic acid 5-dehydrogenase activity.
  • gluconic acid 5- dehydrogenase is sometimes referred to as GA 5-DH.
  • the invention relates to the use of a nucleotide sequence shown as:
  • nucleotide sequence presented as SEQ ID No. 2 or SEQ ID No. 4 or SEQ ID No. 6; 200 (b) a nucleotide sequence that is a variant, homologue, derivative or fragment of the nucleotide sequence presented as SEQ ID No.2 or SEQ ID No.4 or SEQ ID No. 6;
  • nucleotide sequence that is the complement of a variant, homologue, derivative 205 or fragment of the nucleotide sequence presented as SEQ ID No. 2 or SEQ ID No. 4 or
  • nucleotide sequence that is capable of hybridising to the nucleotide sequence set out in SEQ ID No. 2 or SEQ ID No. 4 or SEQ ID No. 6;
  • nucleotide sequence that is capable of hybridising to a variant, homologue, 210 derivative or fragment of the nucleotide sequence presented as SEQ ID No. 2 or SEQ ID No.
  • nucleotide sequence that is the complement of a nucleotide sequence that is capable of hybridising to the nucleotide sequence set out in SEQ ID No. 2 or SEQ ID No. 4 or SEQ ID No. 6;
  • nucleotide sequence that is the complement of a nucleotide sequence that is capable of hybridising to a variant, homologue, derivative or fragment of the nucleotide sequence presented as SEQ ID No. 2 or SEQ ID No.4 or SEQ ID-No. 6; (i) a nucleotide sequence that is capable of hybridising to the complement of the nucleotide sequence set out in SEQ ID NoJ or SEQ ID No. 4 or SEQ ID No. 6;
  • nucleotide sequence that is capable of hybridising to the complement of a variant, homologue, derivative or fragment of the nucleotide sequence presented as SEQ ID No. 2 or SEQ ID No.4 or SEQ ID No. 6.
  • the nucleotide sequence of the present invention may comprise sequences that 225 encode for SEQ ID No. 3 or a variant, homologue or derivative thereof and SEQ ID No. 5 or a variant, homologue or derivative thereof.
  • nucleotide sequence which can be used in the process of the present invention is obtainable from (though it does not have to be actually obtained 230 from) a Gluconobacter suboxydans strain.
  • nucleotide. sequence which can be used in the process of the present invention is obtainable from (though it does not have to be actually obtained from) Gluconobacter suboxydans strain IFO 3255. 235
  • nucleotide sequence which can be used in the process of the present invention is obtainable from (though it does not have to be actually obtained from) Gluconobacter suboxydans strain IFO 12528.
  • Another aspect of the present invention includes an isolated and/or purified nucleotide sequence for use in the present invention.
  • Another aspect of the present invention includes an isolated and or purified amino acid sequence for use in the present invention.
  • the present invention is advantageous as it provides an enzymatic route for the synthesis of 5-ketogluconic acid. 255
  • the 5-ketogluconic acid obtained by the present invention may be converted to tartaric acid (2,3-dihydroxybutanedioic acid or 2,3-dihydroxysuccinic acid).
  • the present invention is particularly advantageous as it provides a 260 novel cost-effective process for the production of tartaric acid (TA), in particular L(+)-TA.
  • TA tartaric acid
  • L(+)-TA acid
  • tartaric acid has a number of commercial uses.
  • 265 KGA is associated with a number of problems: slow fermentation rate, concurrent production of 2-ketogluconic acid and partial consumption of 5-KGA by G. suboxydans. All of these phenomena result in low yields of 5-KGA.
  • the present invention overcomes these problems as it provides an amino acid sequence having PQQ-dependent GA 5-DH activity, as well as a nucleotide sequence encoding same.
  • Gram-negative bacterial hosts being more suitable than Gram-positive bacterial hosts.
  • Particularly suitable hosts are bacteria from the genera Escherichia, Pseudomonas, Acetobacter and Gluconobacter. Hosts having naturally high level of glucose dehydrogenase activity are more suitable than those not expressing glucose dehydrogenase or expressing it at low level.
  • the enzyme of the present invention is suitable for production of 5-KGA under physiological conditions.
  • the present invention also provides a composition comprising 5- 285 KGA and the amino acid sequences of the present invention and/or the nucleotide sequences of the present invention.
  • the products of the present invention may be used in various applications in the food industry - such as in bakery and drink products, they may also be used in other 290 applications such as a pharmaceutical composition, or even in the chemical industry.
  • the solubilised GA 5-DH could be efficiently fractionated by one of the protein purification methods well known in the art - cation exchange chromatography. This is
  • the amino acid sequences of the present invention are capable of acting on D-gluconate and to such a degree that good levels of 5-KGA are obtained that can be easily purified and/or isolated.
  • D- gluconate is a good substrate for the enzyme of the present invention.
  • the 350 relative activity of GA 5-DH on D-gluconate is at least about 10 % relative activity, at least about 15 % relative activity, at least about 20 % relative activity. Relative activity is measured according to the methods of Sugisawa and Hoshing (ibid). Moreover, we were able to identify and characterise a specific, useful end product.
  • GA 5-DH requires divalent cations (such as magnesium and calcium) for maximum activity.
  • SEQ ID No. 6 i.e. the sequence encoding SEQ ID No. 5 - is a small Open Reading Frame upstream of SEQ ID No. 3.
  • SEQ ID No. 6 is schematically presented in Figure 3 365 as "Small SU”.
  • amino acid sequences of the present invention have gluconic acid 5- 370 dehydrogenase activity.
  • the amino acid sequence (enzyme) of the present invention is sometimes referred to as GA 5-DH.
  • gluconate 5-dehydrogenase is the membrane-bound enzyme that has pyrroloquinoline quinone (PQQ) as a cofactor (E.C. 1.1.99.X). This enzyme detected by Shinagawa et al (ibid) has never been purified or characterised to a significant
  • SLDH membrane-bound D-sorbitol dehydrogenase
  • PQQ-dependent dehydrogenases are located on the outer surface of the cell membrane. This means that they can act upon extracellular substrates.
  • the electron acceptor for the PQQ-dependent enzyme is either ubiquinone or cytochrome 400 C. The difference in redox potential of the electron acceptors used by these enzymes is translated into the different equilibrium position of the reaction.
  • reaction may be as follows: alcohol + ubiquinone -> ketone + ubihydroquinone
  • the following assay may be used to characterise and identify actual and putative amino acid sequences which can be used according to the present invention.
  • buffer B 100 mM sodium acetate containing 100 mM of CaCl 2 , 100 mM MgCl 2 , 1 Omg/ml bovine serum albumin, pH 4J
  • Buffer Al OG (10 mM sodium acetate buffer, pH 4J , 1 mM CaCl 2 , 445 1 mM MgCl 2) 1% octyl glucoside)
  • reaction products are detected with HPLC using Ultrapack DEAE 2 SW (LKB, Pharmacia, Sweden) column (4.6 x 250 mm) equilibrated and eluted with diluted phosphoric acid (pH 2.55). Refrectometric detection is used. This method allows to discriminate between GA 5-DH activity and the activity of gluconate 2-dehydrogenase that is also present in membrane fractions of G. suboxydans.
  • the reaction mixture additionally contains 10 ⁇ l of crude lysate of G. suboxydans inactivated in boiling water bath for 5 min.
  • colourimetry is used instead of HPLC to monitor the progress of the reaction.
  • 100 ⁇ l of ferric sulphate-Dupanol reagent (0.5% ferric sulphate, 0.3% SDS, 8% phosphoric acid) is added, the reaction mixture was diluted with water to 2 ml and the absorption at 660 nM is measured.
  • the 5-ketogluconic acid is prepared from gluconic acid or from nontoxic salts of gluconic acid.
  • Gluconic acid can be produced by the biochemical and catalytic oxidation of glucose.
  • Glucose dehydrogenase catalyses the formation of D-glucono- ⁇ -lactone that is hydrolysed to gluconic acid either spontaneously or enzymatically via the action of gluconolactonase.
  • the enzymes may be obtained from various moulds or by bacteria of many bacterial genera, for example, Escherichia, Pseudomonas, Glucoinobacter, Acetobacter, etc.
  • Gluconic acid can also be prepared chemically from glucose - such as by the oxidation of glucose with halogens or by electrolysis.
  • nontoxic salts of gluconic acid means gluconic acid salts that have no detectable detrimental or harmful effect on the consumer.
  • Such nontoxic gluconic acid salts include one or more of a sodium salt, a potassium salt, a calcium salt, a magnesium salt, a zinc salt, a copper salt, etc
  • a preferred gluconic acid salt with respect to the process of the present invention is a sodium salt.
  • Tartaric acid (2,3-dihydroxybutanedioic acid or 2,3-dihydroxysuccinic acid) is a natural crystalline compound found in plants, especially those with tart characteristics such as unripe grapes.
  • Tartaric acid is mainly used in the form of its salts, e.g., cream of tartar (potassium acid tartrate) and Rochelle salt.
  • tartaric acid combined with sodium bicarbonate, is used in the manufacture of effervescent compounds such as fruit salts and antacids. These effervescent compounds cause the quick dissolution of active agents, such as analgesics and artificial sweeteners.
  • tartaric acid is used in wine production to adjust the natural acidity of wine and to enhance the flavour.
  • Tartaric acid is also added to carbonated soft drinks and fruit juices (natural and synthetic) to enhance the flavour. Furthermore, it is used in diet drinks because it is not metabolised and lacks caloric value. Tartaric acid is used in
  • tartaric acid can be used as dough strengthener to improve mixing tolerance, water absorption and gas retention, flavour, crystallation control resulting in improved loaf volume, texture, taste and grain.
  • a protein network is formed during the baking industry
  • Emulsifiers such as diacetyl tartaric acid esters can strengthen the gluten so that it is better able to retain the carbon dioxide produced.
  • diacetyl tartaric esters of monoglycerides a free carboxylic group gives it the ability to bind the gluten, thus improving gluten's ability to hold the gas bubbles. In other words, it has a greater hydrophilic part.
  • baked foodstuffs such as breads
  • Tartaric acid produced by the process of the present invention can be used as a starting material for making different emulsifiers.
  • Tartaric acid produced by the process of the present invention can be used as a starting material for making different emulsifiers.
  • tartaric acid may be prepared from 5 keto- gluconic acid by chemical processes. For example, by using the process described in 530 US-A-5763656.
  • amino acid sequences having gluconic acid 5-dehydrogenase having gluconic acid 5-dehydrogenase
  • Gluconobacter suboxydans are gram-negative, obligate aerobic bacteria belonging to the family Acetobacteraceae (Bergey's Manual of Systematic Bacteriology, Williams
  • Gluconobacter strains flourish in sugary niches such as ripe grapes, apples, dates, garden soil, baker's soil, honeybees, fruit, cider, beer and wine.
  • Gluconobacter strains are non-pathogenic towards man and other animals but are capable of, for example, causing bacterial rot of apples and pears which is accompanied by various shades of browning.
  • Gluconobacter strains are non-pathogenic towards man and other animals but are capable of, for example, causing bacterial rot of apples and pears which is accompanied by various shades of browning.
  • L-sorbose from D-sorbitol; D-gluconic acid, 5-ketogluconic acid and 2-ketogluconic acid from D-glucose; and dihydroxyacetone from glycerol. Klasen et al., (Biotechnology and Bioengineering, 1991, Nol 40, p 183-188) showed that in G. oxydans the activity of 5-ketogluconic acid and the catalyst vandate were 550 responsible for the production of tartaric acid and that G. oxydans was not able to produce tartaric acid by itself.
  • the sequence is in an isolated form.
  • isolated means that the sequence is at least substantially free from at least one other component with which the sequence is naturally associated in nature and as found in nature.
  • the sequence is in a purified form.
  • purified means that the sequence is in a relatively pure state - e.g. at least about 90% pure, or at least about 95% pure or at least about 98% pure.
  • the scope of the present invention encompasses nucleotide sequences encoding enzymes having the specific properties as defined herein.
  • nucleotide sequence refers to an oligonucleotide sequence or polynucleotide sequence, and variant, homologues, fragments and derivatives thereof (such as portions thereof).
  • the nucleotide sequence may be of genomic or synthetic or recombinant origin, which may be double-stranded or single-stranded whether 575 representing the sense or anti-sense strand.
  • nucleotide sequence in relation to the present invention includes genomic DNA, cDNA, synthetic DNA, and RNA. Preferably it means DNA, more preferably cDNA sequence coding for the present invention.
  • nucleotide sequence when relating to and when encompassed by the per se scope of the present invention does not include the native nucleotide sequence according to the present invention when in its natural environment and when it is linked to its naturally associated sequence(s) that is/are also in its/their
  • non-native nucleotide sequence means an entire nucleotide sequence that is in its native environment and when operatively linked to an entire promoter with which it is naturally associated, which promoter is also in its native environment.
  • amino acid sequence amino acid sequence
  • nucleotide sequence 590 encompassed by scope the present invention can be isolated and/or purified post expression of a nucleotide sequence in its native organism.
  • amino acid sequence encompassed by scope of the present invention may be expressed by a nucleotide sequence in its native organism but wherein the nucleotide sequence is not under the control of the promoter with which it is naturally associated wilriin that
  • nucleotide sequence encompassed by scope of the present invention is prepared using recombinant DNA techniques (i.e. recombinant DNA).
  • recombinant DNA i.e. recombinant DNA
  • the nucleotide sequence could be 600 synthesised, in whole or in part, using chemical methods well known in the art (see Caruthers MH et al, (1980) Nuc Acids Res Symp Ser 215-23 and Horn T et al., (1980) Nuc Acids Res Symp Ser 225-232).
  • a nucleotide sequence encoding either an enzyme which has the specific properties as defined herein or an enzyme which is suitable for modification may be identified and/or isolated and/or purified from any cell or organism producing said enzyme.
  • Various methods are well known within the art for the identification and or isolation 610 and/or purification of nucleotide sequences. By way of example, PCR amplification techniques to prepare more of a sequence may be used once a suitable sequence has been identified and/or isolated and/or purified.
  • a genomic DNA and/or cDNA library may be constructed 615 using chromosomal DNA or messenger RNA from the organism producing the enzyme. If the amino acid sequence of the enzyme is known, labelled oligonucleotide probes may be synthesised and used to identify enzyme-encoding clones from the genomic library prepared from the organism. Alternatively, a labelled oligonucleotide probe containing sequences homologous to another known enzyme gene could be 620 used to identify enzyme-encoding clones. In the latter case, hybridisation and washing conditions of lower stringency are used.
  • enzyme-encoding clones could be identified by inserting fragments of genomic DNA into an expression vector, such as a plasmid, transforming enzyme- 625 negative bacteria with the resulting genomic DNA library, and then plating the transformed bacteria onto agar plates containing a substrate for enzyme (i.e. maltose), thereby allowing clones expressing the enzyme to be identified.
  • an expression vector such as a plasmid, transforming enzyme- 625 negative bacteria with the resulting genomic DNA library
  • a substrate for enzyme i.e. maltose
  • the nucleotide sequence encoding the enzyme may be 630 prepared synthetically by established standard methods, e.g. the phosphoroamidite method described by Beucage S.L. et al., (1981) Tetrahedron Letters 22, p 1859- 1869, or the method described by Matthes et al, (1984) EMBO J. 3, p 801-805.
  • oligonucleotides are synthesised, e.g. in an automatic DNA synthesiser, purified, annealed, ligated and cloned in appropriate vectors. 635
  • the nucleotide sequence may be of mixed genomic and synthetic origin, mixed synthetic and cDNA origin, or mixed genomic and cDNA origin, prepared by ligating fragments of synthetic, genomic or cDNA origin (as appropriate) in accordance with standard techniques. Each ligated fragment corresponds to various parts of the entire 640 nucleotide sequence.
  • the DNA sequence may also be prepared by polymerase chain reaction (PCR) using specific primers, for instance as described in US 4,683,202 or in Saiki R K et al, (Science (1988) 239, pp 487-491).
  • amino acid sequence is synonymous with the term 650 "polypeptide" and/or the term “protein”. In some instances, the term “amino acid sequence” is synonymous with the term “peptide”. In some instances, the term “amino acid sequence” is synonymous with the term “enzyme”.
  • the amino acid sequence may be prepared/isolated from a suitable source, or it may 655 be made synthetically or it may be prepared by use of recombinant DNA techniques.
  • the enzyme encompassed in the present invention may be used in conjunction with other enzymes.
  • the present invention also covers a combination of enzymes wherein the combination comprises the enzyme of the present invention and another 660 enzyme, which may be another enzyme according to the present invention. This aspect is discussed in a later section.
  • amino acid protecting sequence when relating to and when encompassed by the per se scope of the present invention is not a native enzyme.
  • native 665 enzyme means an entire enzyme that is in its native environment and when it has been expressed by its native nucleotide sequence.
  • the present invention also encompasses the use of variants, homologues and derivatives of any amino acid sequence of an enzyme or of any nucleotide sequence encoding such an enzyme.
  • homologue means an entity having a certain homology with the 675 subject amino acid sequences and the subject nucleotide sequences.
  • homology can be equated with “identity”.
  • a homologous sequence is taken to include an amino acid sequence which may be at least 75, 80, 85 or 90% identical, preferably at least 95, 96,
  • homologues 680 97, 98 or 99% identical to the subject sequence.
  • the homologues will comprise the same active sites etc. as the subject amino acid sequence.
  • homology can also be considered in terms of similarity (i.e. amino acid residues having similar chemical properties/functions), in the context of the present invention it is preferred to express homology in terms of sequence identity.
  • an homologous sequence is taken to include a nucleotide sequence which may be at least 75, 80, 85 or 90% identical, preferably at least 95, 96, 97, 98 or 99% identical to a nucleotide sequence encoding an enzyme of the present invention (the subject sequence).
  • the homologues will comprise the same
  • 690 sequences that code for the active sites etc. as the subject sequence. Although homology can also be considered in terms of similarity (i.e. amino acid residues having similar chemical properties/functions), in the context of the present invention it is preferred to express homology in terms of sequence identity. 695 Homology comparisons can be conducted by eye, or more usually, with the aid of readily available sequence comparison programs. These commercially available computer programs can calculate % homology between two or more sequences.
  • % homology may be calculated over contiguous sequences, i.e. one sequence is 700 aligned with the other sequence and each amino acid in one sequence is directly compared with the corresponding amino acid in the other sequence, one residue at a time. This is called an "ungapped" alignment. Typically, such ungapped alignments are performed only over a relatively short number of residues.
  • BLAST and FASTA are available for offline and online searching (see Ausubel et al, 1999, Short Protocols in Molecular Biology, pages 7-58 to 7-60). However, for some applications, it is preferred to use the GCG Bestfit program.
  • a new tool, called BLAST 2 Sequences is also available for comparing protein and nucleotide sequence (see FEMS Microbiol Lett 1999
  • % homology can be measured in terms of identity
  • the alignment process itself is typically not based on an all-or-nothing pair comparison.
  • a 745 scaled similarity score matrix is generally used that assigns scores to each pairwise comparison based on chemical similarity or evolutionary distance.
  • An example of such a matrix commonly used is the BLOSUM62 matrix - the default matrix for the BLAST suite of programs.
  • GCG Wisconsin programs generally use either the public default values or a custom symbol comparison table if supplied (see user manual for
  • the public default values for the GCG package or in the case of other software, the default matrix, such as BLOSUM62.
  • percentage homologies may be calculated using the multiple alignment 755 feature in DNASISTM (Hitachi Software), based on an algorithm, analogous to CLUSTAL (Higgins DG & Sharp PM (1988), Gene 73(1), 237-244).
  • % homology preferably % sequence identity.
  • the software typically does this as part of 760 the sequence comparison and generates a numerical result.
  • sequences may also have deletions, insertions or substitutions of amino acid residues which produce a silent change and result in a functionally equivalent substance. Deliberate amino acid substitutions may be made on the basis of similarity
  • negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids include lysine and arginine; and amino acids with uncharged polar head groups having similar hydrophilicity values include
  • leucine isoleucine, valine, glycine, alanine, asparagine, glutamine, serine, threonine, phenylalanine, and tyrosine.
  • the present invention also encompasses homologous substitution (substitution and replacement are both used herein to mean the interchange of an existing amino acid
  • Non-homologous substitution may also occur i.e. from one class of residue to another or alternatively involving the inclusion of unnatural amino acids such as omithine (hereinafter referred to as Z), diaminobutyric acid omithine (hereinafter referred to as B), norleucine omithine
  • Z omithine
  • B diaminobutyric acid omithine
  • B norleucine omithine
  • O pyriylalanine
  • thienylalanine naphthylalanine
  • phenylglycine pyriylalanine 785 (hereinafter referred to as O), pyriylalanine, thienylalanine, naphthylalanine and phenylglycine. Replacements may also be made by unnatural amino acids.
  • Variant amino acid sequences may include suitable spacer groups that may be inserted between any two amino acid residues of the sequence including alkyl groups such as methyl, ethyl or propyl groups in addition to amino acid spacers such as glycine or ⁇ - alanine residues.
  • alkyl groups such as methyl, ethyl or propyl groups
  • amino acid spacers such as glycine or ⁇ - alanine residues.
  • a further form of variation involves the presence of one or more amino acid residues in peptoid form, will be well understood by those skilled in the
  • the peptoid form is used to refer to variant amino acid residues wherein the cc-carbon substituent group is on the residue's nitrogen atom rather than the ⁇ -carbon.
  • Processes for preparing peptides in the peptoid form are known in the art, for example Simon RJ et al, PNAS (1992) 89(20), 9367-9371 and Horwell DC, Trends Biotechnol. (1995) 13(4), 132-134.
  • nucleotide sequences for use in the present invention may include within them synthetic or modified nucleotides.
  • a number of different types of modification to oligonucleotides are known in the art. These include methylphosphonate and phosphorothioate backbones and/or the addition of acridine or polylysine chains at the
  • nucleotide sequences described herein may be modified by any method available in the art. Such modifications may be carried out in order to enhance the in vivo activity or life span of nucleotide sequences of the present invention.
  • the present invention also encompasses the use of nucleotide sequences that are complementary to the sequences presented herein, or any derivative, fragment or derivative thereof. If the sequence is complementary to a fragment thereof then that sequence can be used as a probe to identify similar coding sequences in other
  • Polynucleotides which are not 100% homologous to the sequences of the present invention but fall within the scope of the invention can be obtained in a number of ways. Other variants of the sequences described herein may be obtained for example by
  • DNA libraries made from a range of individuals for example individuals from different populations.
  • other homologues may be obtained and such homologues and fragments thereof in general will be capable of selectively hybridising to the sequences shown in the sequence listing herein.
  • sequences may be obtained by probing cDNA libraries made from or genomic DNA libraries from other species, and
  • Variants and strain/species homologues may also be obtained using degenerate PCR which will use primers designed to target sequences within the variants and homologues encoding conserved amino acid sequences within the sequences of the present invention.
  • conserved sequences can be predicted, for example, by aligning the amino acid sequences from several variants homologues. Sequence alignments can be performed
  • the primers used in degenerate PCR will contain one or more degenerate positions and will be used at stringency conditions lower than those used for cloning sequences with 840 single sequence primers against known sequences.
  • polynucleotides may be obtained by site directed mutagenesis of characterised sequences. This may be useful where for example silent codon sequence changes are required to optimise codon preferences for a particular host cell in which the 845 polynucleotide sequences are being expressed. Other sequence changes may be desired in order to introduce restriction enzyme recognition sites, or to alter the property or function of the polypeptides encoded by the polynucleotides.
  • Polynucleotides (nucleotide sequences) of the invention may be used to produce a 850 primer, e.g. a PCR primer, a primer for an alternative amplification reaction, a probe e.g. labelled with a revealing label by conventional means using radioactive or non- radioactive labels, or the polynucleotides may be cloned into vectors.
  • a 850 primer e.g. a PCR primer, a primer for an alternative amplification reaction, a probe e.g. labelled with a revealing label by conventional means using radioactive or non- radioactive labels, or the polynucleotides may be cloned into vectors.
  • Such primers, probes and other fragments will be at least 15, preferably at least 20, for example at least 25, 30 or 40 nucleotides in length, and are also encompassed by the term polynucleotides 855 of the invention as used herein.
  • Polynucleotides such as DNA polynucleotides and probes according to the invention may be produced recombinantly, synthetically, or by any means available to those of skill in the art. They may also be cloned by standard techniques. 860
  • primers will be produced by synthetic means, involving a stepwise m-uTufacture of the desired nucleic acid sequence one nucleotide at a time. Techniques for accomplishing this using automated techniques are readily available in the art.
  • Longer polynucleotides will generally be produced using recombinant means, for example using a PCR (polymerase chain reaction) cloning techniques.
  • the primers may be designed to contain suitable restriction enzyme recognition sites so that the amplified DNA can be cloned into a suitable cloning vector.
  • a variant, homologue, fragment or derivative of SEQ ID No. 3 may comprise at least one or more of the following sequences: a. GSGNSFEP and preferably near to the N terminal end b. ALGLVY and preferably about intermediate the N terminal end and 875 the C terminal end c. DHKG and preferably at the C terminal end.
  • the variant sequences etc. are at least as biologically active as the sequences presented herein.
  • biologically active refers to a sequence having a similar structural function (but not necessarily to the same degree), and/or similar regulatory function 885 (but not necessarily to the same degree), and/or similar biochemical function (but not necessarily to the same degree) of the naturally occurring sequence.
  • the present invention also encompasses sequences that are complementary to the nucleic acid sequences of the present invention or sequences that are capable of hybridising either to the sequences of the present invention or to sequences that are complementary thereto.
  • hybridisation shall include “the process by which a strand of nucleic acid joins with a complementary strand through base pairing” as well as the process of amplification as carried out in polymerase chain reaction (PCR) technologies.
  • the present invention also encompasses the use of nucleotide sequences that are capable of hybridising to the sequences that are complementary to the sequences presented herein, or any derivative, fragment or derivative thereof.
  • variant also encompasses sequences that are complementary to sequences 905 that are capable of hybridising to the nucleotide sequences presented herein.
  • variant encompasses sequences that are complementary to sequences that are capable of hybridising under stringent conditions (e.g. 50°C and OJxSSC ⁇ lxSSC - 0.15 M NaCl, 0.015 M Na 3 citrate pH 7.0 ⁇ ) to the nucleotide 910 sequences presented herein.
  • stringent conditions e.g. 50°C and OJxSSC ⁇ lxSSC - 0.15 M NaCl, 0.015 M Na 3 citrate pH 7.0 ⁇
  • the present mvention also relates to nucleotide sequences that can hybridise to the nucleotide sequences of the present invention (including complementary sequences of those presented herein). 920
  • the present invention also relates to nucleotide sequences that are complementary to sequences that can hybridise to the nucleotide sequences of the present invention (including complementary sequences of those presented herein).
  • polynucleotide sequences that are capable of hybridising to the nucleotide sequences presented herein under conditions of intermediate to maximal stringency.
  • the present invention covers nucleotide sequences that can 930 hybridise to the nucleotide sequence of the present invention, or the complement thereof, under stringent conditions (e.g. 50°C and OJxSSC).
  • stringent conditions e.g. 50°C and OJxSSC.
  • the present invention covers nucleotide sequences that can hybridise to the nucleotide sequence of the present invention, or the complement 935 thereof, under high stringent conditions (e.g. 65°C and OJxSSC).
  • high stringent conditions e.g. 65°C and OJxSSC.
  • an enzyme-encoding nucleotide sequence has been isolated, or a putative 940 enzyme-encoding nucleotide sequence has been identified, it may be desirable to mutate the sequence in order to prepare an enzyme of the present invention.
  • Mutations may be introduced using synthetic oligonucleotides. These oligonucleotides contain nucleotide sequences flanking the desired mutation sites.
  • sequence for use in the present invention is a recombinant sequence - i.e. a sequence that has been prepared using recombinant DNA techniques.
  • sequence for use in the present invention is a synthetic sequence - i.e. a sequence that has been prepared by in vitro chemical or enzymatic synthesis. It 965 includes, but is not limited to, sequences made with optimal codon usage for host organisms - such as the methylotrophic yeasts Pichia and Hansenula.
  • the nucleotide sequence for use in the present invention may be incorporated into a recombinant replicable vector.
  • the vector may be used to replicate and express the nucleotide sequence, in enzyme form, in and or from a compatible host cell.
  • Expression may be controlled using control sequences eg. regulatory sequences.
  • the enzyme produced by a host recombinant cell by expression of the nucleotide sequence may be secreted or may be contained intracellularly depending on the sequence and/or the vector used.
  • the coding sequences may be designed with signal sequences which direct secretion of the substance coding sequences through a 980 particular prokaryotic or eukaryotic cell membrane.
  • expression vector means a construct capable of in vivo or in vitro expression. 985 Preferably, the expression vector is incorporated into the genome of a suitable host organism. The term “incorporated” preferably covers stable incorporation into the genome. . . .
  • the nucleotide sequence of the present invention may be present in a vector in which the nucleotide sequence is operably linked to regulatory sequences capable of providing for the expression of the nucleotide sequence by a suitable host organism.
  • the vectors for use in the present invention may be transformed into a suitable host 995 cell as described below to provide for expression of a polypeptide of the present mvention.
  • vector eg. a plasmid, cosmid, or phage vector will often depend on the host cell into which it is to be introduced. 1000
  • the vectors for use in the present invention may contain one or more selectable marker genes- such as a gene, which confers antibiotic resistance eg. ampicillin, kanamycin, chloramphenicol or tetracyclin resistance.
  • selectable marker genes such as a gene, which confers antibiotic resistance eg. ampicillin, kanamycin, chloramphenicol or tetracyclin resistance.
  • the selection may be accomplished by co-transformation (as described in W091/17243).
  • Vectors may be used in vitro, for example for the production of RNA or used to transfect, transform, transduce or infect a host cell.
  • the invention provides a method of making nucleotide 1010 sequences of the present invention by introducing a nucleotide sequence of the present invention into a replicable vector, introducing the vector into a compatible host cell, and growing the host cell under conditions which bring about replication of the vector.
  • the vector may further comprise a nucleotide sequence enabling the vector to replicate in the host cell in question.
  • a nucleotide sequence enabling the vector to replicate in the host cell in question. Examples of such sequences are the origins of replication of plasmids pUC19, pACYC177, pUBl 10, pE194, pAMBl and pIJ702.
  • the nucleotide sequence for use in the present invention is operably linked to a regulatory sequence which is capable of providing for the expression of the nucleotide sequence, such as by the chosen host cell.
  • a regulatory sequence which is capable of providing for the expression of the nucleotide sequence, such as by the chosen host cell.
  • the present invention covers a vector comprising the nucleotide sequence of 1025 the present invention operably linked to such a regulatory sequence, i.e. the vector is an expression vector.
  • operably linked refers to a juxtaposition wherein the components described are in a relationship permitting them to function in their intended manner. 1030 A regulatory sequence "operably linked" to a coding sequence is ligated in such a way that expression of the coding sequence is achieved under condition compatible with the control sequences.
  • regulatory sequences includes promoters and enhancers and other 1035 expression regulation signals .
  • promoter is used in the normal sense of the art, e.g. an RNA polymerase binding site.
  • Enhanced expression of the nucleotide sequence encoding the enzyme of the present invention may also be achieved by the selection of heterologous regulatory regions, e.g. promoter, secretion leader and terminator regions.
  • heterologous regulatory regions e.g. promoter, secretion leader and terminator regions.
  • the nucleotide sequence according to the present invention is operably 1045 linked to at least a promoter.
  • Suitable promoters for directing the transcription of the nucleotide sequence in a bacterial, fungal or yeast host are well known in the art.
  • construct which is synonymous with terms such as “conjugate”, “cassette” and “hybrid” - includes a nucleotide sequence for use according to the present invention directly or indirectly attached to a promoter.
  • an indirect attachment is the provision of a suitable spacer group such as an intron sequence, such as the Shl-intron or the ADH intron, intermediate the promoter and the nucleotide sequence of the present invention.
  • a suitable spacer group such as an intron sequence, such as the Shl-intron or the ADH intron, intermediate the promoter and the nucleotide sequence of the present invention.
  • intron sequence such as the Shl-intron or the ADH intron
  • the terms do not cover the natural combination of the nucleotide sequence coding for the protein ordinarily associated with the wild type gene promoter and when they are both in their natural environment.
  • the construct may even contain or express a marker, which allows for the selection of 1065 the genetic construct.
  • the construct of the present invention comprises at least the nucleotide sequence of the present invention operably linked to a promoter.
  • host cell in relation to the present invention includes any cell that comprises either the nucleotide sequence or an expression vector as described above and which is used in the recombinant production of an enzyme having the specific 1075 properties as defined herein.
  • a further embodiment of the present invention provides host cells transformed or transfected with a nucleotide sequence that expresses the enzyme of the present invention.
  • the cells will be chosen to be compatible with the said vector and may for 1080 example be prokaryotic (for example bacterial), fungal, yeast or plant cells.
  • the host cells are not human cells.
  • suitable bacterial host organisms are gram positive or gram negative bacterial species.
  • eukaryotic hosts such as yeasts or other fungi may be preferred.
  • yeast cells are preferred over fungal cells because they are easier to manipulate.
  • some proteins are either poorly secreted from the yeast cell, or in some cases are not processed properly (e.g. hyperglycosylation in yeast). In these instances, a different fungal host organism should be selected.
  • suitable host cells - such as yeast, fungal and plant host cells - may provide 1095 for post-translational modifications (e.g. myristoylation, glycosylation, truncation, lapidation and tyrosine, serine or threonine phosphorylation) as may be needed to confer optimal biological activity on recombinant expression products of the present invention.
  • post-translational modifications e.g. myristoylation, glycosylation, truncation, lapidation and tyrosine, serine or threonine phosphorylation
  • the host cell may be a protease deficient or protease minus strain.
  • organism in relation to the present invention includes any organism that 1105 could comprise the nucleotide sequence coding for the enzyme according to the present invention and/or products obtained therefrom, and/or wherein a promoter can allow expression of the nucleotide sequence according to the present invention when present in the organism.
  • Suitable organisms may include a prokaryote, fungus, yeast or a plant.
  • transgenic organism in relation to the present invention includes any organism that comprises the nucleotide sequence coding for the enzyme according to the present invention and/or the products obtained therefrom, and/or wherein a promoter can 1115 allow expression of the nucleotide sequence according to the present invention within the organism.
  • a promoter can 1115 allow expression of the nucleotide sequence according to the present invention within the organism.
  • the nucleotide sequence is incorporated in the genome of the organism.
  • transgenic organism does not cover native nucleotide coding sequences in
  • the transgenic organism of the present invention includes an organism comprising any one of, or combinations of, the nucleotide sequence coding for the 1125 enzyme according to the present invention, constructs according to the present invention, vectors according to the present invention, plasmids according to the present invention, cells according to the present invention, tissues according to the present invention, or the products thereof.
  • the transgenic organism may also comprise the nucleotide sequence coding for the enzyme of the present invention under the control of a heterologous promoter.
  • the host organism can be a prokaryotic or a eukaryotic organism.
  • suitable prokaryotic hosts include E. coli and Bacillus subtilis.
  • Filamentous fungi cells may be transformed using various methods known in the art - 1145 such as a process involving protoplast formation and transformation of the protoplasts followed by regeneration of the cell wall in a manner known.
  • Methods known in the art - 1145 such as a process involving protoplast formation and transformation of the protoplasts followed by regeneration of the cell wall in a manner known.
  • Aspergillus as a host microorganism is described in EP 0 238 023.
  • Another host organism can be a plant.
  • a review of the general techniques used for 1150 transforming plants may be found in articles by Potrykus (Annu Rev Plant Physiol Plant Moi Biol [1991] 42:205-225) and Christou (Agro-Food-Industry Hi-Tech March/April 1994 17-27). Further teachings on plant transformation may be found in EP-A-0449375.
  • a host organism may be a fungus - such as a filamentous fungus.
  • suitable such hosts include any member belonging to the genera Thermomyces, Acremonium, Aspergillus, Penicillium, Mucor, Neurospora, Trichoderma and the like.
  • the host organism can be of the genus Aspergillus, such as Aspergillus niger.
  • a transgenic Aspergillus according to the present invention can also be prepared by following, for example, the teachings of Turner G. 1994 (Vectors for genetic manipulation. In: Martinelli S.D., Kinghorn J.R.( Editors) Aspergillus: 50 years on. Progress in industrial microbiology vol 29. Elsevier Amsterdam 1994. pp. 641-666).
  • the transgenic organism can be a yeast.
  • yeast- such as the species Saccharomyces cerevisi or Pichia pastoris (see FEMS Microbiol Rev (2000 24(l):45-66), may be used as a vehicle for heterologous gene expression.
  • transgenic Saccharomyces For the transformation of yeast, several transformation protocols have been developed.
  • a transgenic Saccharomyces according to the present mvention can be prepared by following the teachings of Hinnen et al., (1978, Proceedings of the National Academy .of Sciences- of the USA 75, 1929); Beggs, J D (1978, Nature, London, 275, 1205 104); and Ito, H et al (1983,J Bacteriology 153, 163-168).
  • the transformed yeast cells may be selected using various selective markers - such as auxotrophic markers dominant antibiotic resistance markers.
  • a host organism suitable for the present invention may be a plant.
  • a review of the general techniques may be found in articles by Potrykus (Annu Rev Plant Physiol Plant Moi Biol [1991] 42:205-225) and Christou (Agro-Food-Industry Hi-Tech March/April 1215 1994 17-27).
  • Host cells transformed with the nucleotide sequence of the present invention may be 1220 cultured under conditions conducive to the production of the encoded enzyme and which facilitate recovery of the enzyme from the cells and/or culture medium.
  • the medium used to cultivate the cells may be any conventional medium suitable for growing the host cell in questions and obtaining expression of the enzyme.
  • the protein produced by a recombinant cell may be displayed on the surface of the cell.
  • the enzyme may be secreted from the host cells and may conveniently be recovered 1230 from the culture medium using well-known procedures. SECRETION
  • the enzyme may be secreted from the expression host into the 1235 culture medium from where the enzyme may be more easily recovered.
  • the secretion leader sequence may be selected on the basis of the desired expression host.
  • Hybrid signal sequences may also be used with the context of the present mvention.
  • heterologous secretion leader sequences are those originating from the fungal amyloglucosidase (AG) gene (glaA - both 18 and 24 amino acid versions e.g. from Aspergillus), the a-factor gene (yeasts e.g. Saccharomyces, Kluyveromyces and Hansenula) or the ⁇ -amylase gene ⁇ Bacillus).
  • AG fungal amyloglucosidase
  • glaA both 18 and 24 amino acid versions e.g. from Aspergillus
  • a-factor gene e.g. Saccharomyces, Kluyveromyces and Hansenula
  • ⁇ -amylase gene ⁇ Bacillus ⁇ -amylase gene
  • ELISA enzyme-linked immunosorbent assay
  • RIA radioi munoassay
  • FACS fluorescent activated cell sorting
  • Suitable reporter molecules or labels include those radionuclides, enzymes, fluorescent, chemiluminescent, or chromogenic agents as well as substrates, cofactors, inhibitors, magnetic particles and the like.
  • Patents teaching the use of such labels 1265 include US-A-3,817,837; US-A-3,850,752; US-A-3,939,350; US-A-3,996,345; US- A-4,277,437; US-A-4,275,149 and US-A-4,366,241.
  • recombinant immunoglobulins may be produced as shown in US-A-4,816,567.
  • the amino acid sequence for use according to the present invention may be produced as a fusion protein, for example to aid in extraction and purification.
  • fusion protein partners include glutathione-S-transferase (GST), 6xHis, GAL4 (DNA 1275 binding and/or transcriptional activation domains) and ( ⁇ -galactosidase). It may also be convenient to include a proteolytic cleavage site between the fusion protein partner and the protein sequence of interest to allow removal of fusion protein sequences.
  • the fusion protein will not hinder the activity of the protein sequence.
  • the amino acid sequence may be ligated to a 1285 heterologous sequence to encode a fusion protein.
  • a 1285 heterologous sequence For example, for screening of peptide libraries for agents capable of affecting the substance activity, it may be useful to encode a chimeric substance expressing a heterologous epitope that is recognised by a commercially available antibody.
  • sequences for use according to the present invention may also be used in conjunction with one or more additional proteins of interest (POIs) or nucleotide sequences of interest (NOIs).
  • POIs proteins of interest
  • NOIs nucleotide sequences of interest
  • Non-limiting examples of POIs include: proteins or enzymes involved in starch metabolism, proteins or enzymes involved in glycogen metabolism, acetyl esterases, aminopeptidases, amylases, arabinases, arabinofuranosidases, carboxypeptidases, catalases, cellulases, chitinases, chymosin, cutinase, deoxyribonucleases, epimerases,
  • esterases 1300 esterases, ⁇ -galactosidases, ⁇ -galactosidases, ⁇ -glucanases, glucan lysases, endo- ⁇ - glucanases, glucoamylases, glucose oxidases, ⁇ -glucosidases, ⁇ -glucosidases, glucuronidases, hemicellulases, hexose oxidases, hydrolases, invertases, isomerases, laccases, Upases, lyases, mannosidases, oxidases, oxidoreductases, pectate lyases, pectin acetyl esterases, pectin depolymerases, pectin methyl esterases, pectinolytic enzymes,
  • peroxidases peroxidases, phenoloxidases, phytases, polygalacturonases, proteases, rhamno- galacturonases, ribonucleases, thaumatin, transferases, transport proteins, transglutaminases, xylanases, hexose oxidase (D-hexose: 0 2 -oxidoreductase, EC 1J .3.5) or combinations thereof.
  • the NOI may even be an antisense sequence for any of those sequences.
  • the POI may even be a fusion protein, for example to aid in extraction and purification.
  • the POI may even be fused to a secretion sequence. 1315
  • sequences can also facilitate secretion or increase the yield of secreted POI.
  • sequences could code for chaperone proteins as for example the product of Aspergillus niger cyp B gene described in UK patent application 9821198.0.
  • the NOI coding for POI may be engineered in order to alter their activity for a number of reasons, including but not limited to, alterations, which modify the processing and/or expression of the expression product thereof.
  • the NOI may also be modified to optimise expression in a particular host cell.
  • Other sequence changes may be desired in order to introduce restriction enzyme
  • the NOI coding for the POI may include within it synthetic or modified nucleotides- such as methylphosphonate and phosphorothioate backbones. 1330
  • the NOI coding for the POI may be modified to increase intracellular stability and half-life. Possible modifications include, but are not limited to, the addition of flanking sequences of the 5' and/or 3' ends of the molecule or the use of phosphorothioate or 2' O-methyl rather than phosphodiesterase linkages within the backbone of the molecule.
  • One aspect of the present invention relates to amino acids that are immunologically reactive with the amino acid of SEQ ID No. 1 or SEQ ID No. 3.
  • Antibodies may be produced by standard techniques, such as by immunisation with the substance of the invention or by using phage display library.
  • the term "antibody”, unless specified to the contrary, 1345 includes but is not limited to, polyclonal, monoclonal, chimeric, single chain, Fab fragments, fragments produced by a Fab expression library, as well as mimetics thereof.
  • Such fragments include fragments of whole antibodies which retain their binding activity for a target substance, Fv, F(ab') and F(ab') 2 fragments, as well as single chain antibodies (scFv), fusion proteins and other synthetic proteins which comprise 1350 the antigen-binding site of the antibody.
  • the antibodies and fragments thereof may be humanised antibodies. Neutralising antibodies, i.e., those which inhibit biological activity of the substance polypeptides, are especially preferred for diagnostics and therapeutics.
  • polyclonal antibodies are desired, a selected mammal (e.g., mouse, rabbit, goat, horse, etc.) is immunised with the sequence of the present invention (or a sequence comprising an immunological epitope thereof). Depending on the host species, various adjuvants may be used to increase immunological response.
  • a selected mammal e.g., mouse, rabbit, goat, horse, etc.
  • various adjuvants may be used to increase immunological response.
  • Serum from the immunised animal is collected and treated according to known procedures. If serum containing polyclonal antibodies to the sequence of the present invention (or a sequence comprising an immunological epitope thereof) contains antibodies to other antigens, the polyclonal antibodies can be purified by immunoaffinity chromatography. Techniques for producing and processing
  • polyclonal antisera are known in the art.
  • the invention also provides polypeptides of the invention or fragments thereof haptenised to another polypeptide for use as immunogens in animals or humans.
  • Monoclonal antibodies directed against the sequence of the present invention can also be readily produced by one skilled in the art and include, but are not limited to, the hybridoma technique Koehler and Milstein (1975 Nature 256:495-497), the human B-cell hybridoma technique (Kosbor et al, (1983) Immunol Today 4:72; Cote et al, (1983) Proc Natl Acad Sci 80:2026-2030) and the EBV-hybridoma technique (Cole et al, (1985) 1375 Monoclonal Antibodies and Cancer Therapy, Alan Rickman Liss Inc, pp 77-96).
  • Antibody fragments which contain specific binding sites for the substance may also be generated.
  • fragments include, but are not limited to, the F(ab') 2 fragments which can be produced by pepsin digestion of the antibody molecule and 1390 the Fab fragments which can be generated by reducing the disulfide bridges of the F(ab') 2 fragments.
  • Fab expression libraries may be constructed to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity (Huse WD et al, (1989) Science 256:1275-128 1).
  • the amino acid sequence is used for large scale applications.
  • amino acid sequence is produced in a quantity of from lg per litre to about 2g per litre of the total cell culture volume after cultivation of the host organism.
  • amino acid sequence is produced in a quantity of from 1 OOmg per litre 1405 to about 900mg per litre of the total cell culture volume after cultivation of the host organism.
  • amino acid sequence is produced in a quantity of from 250mg per litre to about 500mg per litre of the total cell culture volume after cultivation of the host 1410 organism.
  • the present invention also relates to a composition comprising 5- 1415 KGA and amino acid sequences and/or nucleotide sequences as described herein.
  • composition of the present invention can lead to improved aroma, flavour, mildness, consistency, texture, body, mouth feel, firmness, viscosity, gel fracture, structure and/or organoleptic properties and nutrition of products for consumption 1420 containing said composition. Furthermore, the composition of the present invention can also be used in combination with other components of products for consumption to deliver said improvements.
  • composition of the present invention is used to 1425 improve the aroma, flavour, mildness, consistency, texture, body, mouth feel, firmness, viscosity, gel fracture, structure, smoothness of the surface and/or organoleptic properties and nutrition of products for consumption containing said composition - the present invention also covers using the composition of the present invention as a component of pharmaceutical combinations with other components to 1430 deliver medical or physiological benefit to the consumer.
  • composition of the present invention may be used in combination 1435 with other components .
  • Examples of other components include one or more of: thickeners, gelling agents, emulsifiers, binders, crystal modifiers, sweetners (including artificial sweeteners), rheology modifiers, stabilisers, anti-oxidants, dyes, enzymes, carriers, vehicles, 1440 excipients, diluents, lubricating agents, flavouring agents, colouring matter, suspending agents, disintegrants, granulation binders etc. These other components may be natural. These other components may be prepared by use of chemical and/or enzymatic techniques.
  • thickener or gelling agent refers to a product that prevents separation by slowing or preventing the movement of particles, either droplets of immiscible liquids, air or insoluble solids.
  • stabilizer as used here is defined as an ingredient or combination of 1450 ingredients that keeps a product (e.g. a food product) from changing over time.
  • emulsifier refers to an ingredient (e.g. a food product ingredient) that prevents the separation of emulsions.
  • binder refers to an ingredient (e.g. a food ingredient) that binds the product together through a physical or chemical reaction.
  • crystal modifier refers to an ingredient (e.g. a food ingredient) that affects the crystallisation of either fat or water.
  • Carriers or “vehicles” mean materials suitable for compound administration and include any such material known in the art such as, for example, any liquid, gel, solvent, liquid diluent, solubiliser, or the like, which is non-toxic and which does not interact with any components of the composition in a deleterious manner.
  • nutritionally acceptable carriers include, for example, water, salt solutions, alcohol, silicone, waxes, petroleum jelly, vegetable oils, and the like.
  • excipients include one or more of: microcrystalline cellulose and other 1470 celluloses, lactose, sodium citrate, calcium carbonate, dibasic calcium phosphate, glycine, starch, milk sugar and high molecular weight polyethylene glycols.
  • disintegrants include one or more of: starch (preferably corn, potato or tapioca starch), sodium starch glycollate, croscarmellose sodium and certain complex 1475 silicates.
  • granulation binders include one or more of: polyvinylpyrrolidone, hydroxypropylmethylcellulose (HPMC), hydroxypropylcellulose (HPC), sucrose, maltose, gelatin and acacia.
  • lubricating agents include one or more of: magnesium stearate, stearic acid, glyceryl behenate and talc.
  • diluents include one or more of: water, ethanol, propylene glycol and 1485 glycerin, and combinations thereof.
  • the other components may be used simultaneously (e.g when they are in admixture together or even when they are delivered by different routes) or sequentially (e.g they may be delivered by different routes). 1490
  • the composition of the present invention when admixed with any other components, the lactic acid micro-organisms remain viable.
  • component suitable for animal or human consumption means a compound which is or can be added to the composition of the present invention as a supplement which may be of nutritional benefit, a fibre substitute or have a generally beneficial effect to the consumer.
  • the components may be prebiotics such as alginate, xanthan, 1500 pectin, locust bean gum (LBG), inulin, guar gum, galacto-oligosaccharide (GOS), fructo-oligosaccharide (FOS), lactosucrose, soybean oligosaccharides, palatinose, isomalto-oligosaccharides, gluco-oligosaccharides and xylo-oligosaccharides.
  • prebiotics such as alginate, xanthan, 1500 pectin, locust bean gum (LBG), inulin, guar gum, galacto-oligosaccharide (GOS), fructo-oligosaccharide (FOS), lactosucrose, soybean oligosaccharides, palatinose, isomalto-oligosaccharides, gluco-oligosaccharides and xylo-oligosaccharides.
  • composition of the present invention may be used as - or in the preparation of - a food.
  • the term "food” is used in a broad sense - and covers food for humans as well as food for animals (i.e. a feed). In a preferred aspect, the food is for human consumption.
  • the food may be in the from of a solution or as a solid - depending on the use and/or the mode of application and/or the mode of administration.
  • composition of the present invention may be used as a food ingredient.
  • the term "food ingredient” includes a formulation, which is or can be added to functional foods or foodstuffs and includes formulations which can be used at 1520 low levels in a wide variety of products that require, for example, acidifying or emulsifying.
  • the food ingredient may be in the from of a solution or as a solid - depending on the use and/or the mode of application and/or the mode of administration.
  • composition of the present invention may be - or may be added to - food
  • composition of the present invention may be - or may be added to - functional foods.
  • the term "functional food” means food which is capable of providing not only a nutritional effect and/or a taste satisfaction, but is also capable of delivering a further beneficial effect to consumer.
  • composition of the present invention can be used in the preparation of food products such as one or more of: confectionery products, dairy products, meat products, poultry products, fish products and bakery products.
  • composition of the present invention can be used as ingredients to soft drinks, a fruit juice or a beverage comprising whey protein, health teas, cocoa drinks, milk drinks and lactic acid bacteria drinks, yoghurt, drinking yoghurt and wine.
  • the foodstuff is a soft drink.
  • the composition of the present invention may be used as an acidulant to provide tartness and/or to act as a preservative.
  • the foodstuff is wine.
  • the composition of 1560 the present invention may promote graceful ageing and crispness of flavour.
  • the foodstuff is a bakery product - such as bread, Danish pastry, biscuits or cookies.
  • the composition of the present invention may improve the gluten, and give bakery products increased 1565 stability and a longer shelf life.
  • composition of the present invention may also be used in the production of emulsifiers - such as DATEM - which is used in the production of bread and improves the properties of both the dough and the bread.
  • DATEM is produced by esterification 1570 of mono- and diacylglycerols with mono- and diacetyltartaric acid.
  • the foodstuff is a confectionery product.
  • the composition of the present invention may enhance natural flavouring and or lower the pH level. Lowering the pH level may inhibit the development of 1575 micro-organisms and mould.
  • the composition of the present invention may also act as an antioxidant for fats, as a vitamin stabiliser, or to enhance freshness and colour in the fish industry.
  • the present invention also provides a method of preparing a food or a food ingredient, the method comprising admixing 5-KGA produced by the process of the present invention or the composition according to the present invention with another food ingredient.
  • the method for preparing or a food ingredient is also another aspect of the present invention.
  • the product (5-KGA and/or tartaric acid) and/or the composition according to the present invention may also be used as - or in the preparation of - a pharmaceutical.
  • the term "pharmaceutical” is used in a broad sense - and covers pharmaceuticals for humans as well as pharmaceuticals for animals (i.e. veterinary applications). In a preferred aspect, the pharmaceutical is for human use and/or for animal husbandry.
  • the pharmaceutical can be for therapeutic purposes - which may be curative or palliative or preventative in nature.
  • the pharmaceutical may even be for diagnostic purposes.
  • the product and/or the 1600 composition of the present invention may be used in conjunction with one or more of: a pharmaceutically acceptable carrier, a pharmaceutically acceptable diluent, a pharmaceutically acceptable excipient, a pharmaceutically acceptable adjuvant, a pharmaceutically active ingredient.
  • the pharmaceutical may be in the from of a solution or as a solid - depending on the use and/or the mode of application and/or the mode of administration.
  • the product and/or the composition of the present invention may be used as pharmaceutical ingredients.
  • the product and/or the composition of the present invention may be the sole active component or it may be at least one of a number (i.e. 2 or more) active components.
  • the pharmaceutical ingredient may be in the from of a solution or as a solid - depending on the use and/or the mode of application and/or the mode of administration.
  • the pharmaceutical ingredient may be in the from of an effervescent products to 1620 improve the dissolving properties of the pharmaceutical.
  • the product and/or the composition of the present invention may also be used as a 1625 solidifier.
  • the product and/or the composition may be used as an ⁇ additive to plaster/gypsum since it slows hardening thereby facilitating work.
  • the product and/or the composition may also be used as a splitting agent in synthetic racemic compounds to obtain optically active forms.
  • the product and/or the composition may also be used to prevents incrustation in vinyl chloride polymerisation
  • the product and/or the composition of the present invention may be used in any suitable form - whether when alone or when present in a composition.
  • 5- KGA and/or tartaric acid ingredients of the present invention i.e. ingredients - such as food ingredients, functional food ingredients or pharmaceutical ingredients
  • ingredients - such as food ingredients, functional food ingredients or pharmaceutical ingredients
  • Suitable examples of forms include one or more of: tablets, pills, capsules, ovules, solutions or suspensions, which may contain flavouring or colouring agents, for immediate-, delayed-, modified-, sustained-, pulsed- or controlled-release 1645 applications.
  • the tablets may also contain one or more of: excipients, disintegrants, granulation binders, or lubricating agents. 1650
  • nutritionally acceptable carriers for use in preparing the forms include, for example, water, salt solutions, alcohol, silicone, waxes, petroleum jelly and the like.
  • Preferred excipients for the forms include lactose, starch, a cellulose, milk sugar or high molecular weight polyethylene glycols.
  • 5-KGA and/or the composition of the present invention may be combined with various sweetening or flavouring agents, colouring 1660 matter or dyes, with emulsifying and/or suspending agents and with diluents such as water, ethanol, propylene glycol and glycerin, and combinations thereof.
  • the forms may also include gelatin capsules; fibre capsules, fibre tablets etc.
  • the present invention employs, unless otherwise indicated, conventional techniques of chemistry, molecular biology, microbiology, recombinant DNA and immunology, which are within the capabilities of a person of ordinary skill in the art.
  • Such 1670 techniques are explained in the literature. See, for example, J. Sambrook, E. F. Fritsch, and T. Maniatis, 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Books 1-3, Cold Spring Harbor Laboratory Press; Ausubel, F. M. et al. (1995 and periodic supplements; Current Protocols in Molecular Biology, ch. 9, 13, and 16, John Wiley & Sons, New York, N.Y.); B. Roe, J. Crabtree, and A.
  • the present invention relates inter alia to the use of an amino acid sequence and a nucleotide sequence and also to a construct comprising the same.
  • Figure 3 is a schematic representation of one of the sequences (i.e. a sequence comprising SEQ ID No. 3 and SEQ ID No. 5) of the present invention 1700 In more detail:
  • FIG. 1 Shows the dependence of the extraction level of GA 5-DH from the membrane fraction of G. suboxydans on «-octyl- ⁇ -D-glucoside concentration. "Total activity” is the activity of GA 5-DH in the suspension of G. suboxydans membranes 1705 before extraction
  • Figure 2 Shows the separation of GA 5-DH and ADH activities using native electrophoresis with 1.5 M-octyl- ⁇ -D-glucoside ( Figure 2(a)) or 1.5 % n-octyl- ⁇ -D- maltoside ( Figure 2(b)).
  • reaction mixture 1715 contained:
  • buffer B 100 mM sodium acetate containing 100 mM of CaCl 2 , 100 mM MgCl 2 , lOmg/ml bovine serum albumin, pH 4.1
  • the reaction mixture additionally contained 10 ⁇ l of crude lysate of G. suboxydans inactivated in boiling water bath for 5 min. In this case, colorimetry was used instead of HPLC to monitor the progress of the reaction. 100 ⁇ l of ferric sulphate-Dupanol reagent (0.5% ferric sulphate, 0.3% SDS, 8% phosphoric acid) was added, the reaction mixture was diluted with water to
  • the medium for cultivation of the G. suboxydans contained 1% of sodium gluconate, 1% of glucose, 0.3% of glycerol, 0.3% of yeast extract and 0.2% of peptone in tap water, pH 6.5. 500 ml of this medium in a 2 1 Erlenmeyer flask was inoculated with one colony of G. suboxydans IFO 12528 and placed onto a rotary shaker. After overnight growth (200 rpm, at 30°C) this culture was used to inoculate a 20 1
  • Discontinuous polyacrylamide gel electrophoresis system was used to separate GA 5- DH and alcohol dehydrogenase.
  • the 2.5% stacking gel contained 100 mM potassium acetate buffer (pH 6.8) and 1.5% rc-octyl- ⁇ -D-glucoside.
  • the 10% separation gel (0.3 xlO x 10 cm) contained 100 mM potassium acetate buffer, pH 4.3 and 1.5% n- octyl- ⁇ -D-glucoside.
  • Tank buffer was 100 mM ⁇ -alanine - acetic acid buffer, pH 4.5.
  • this preparation was used either directly of further purified 1835 by sodium dodecyl sulphate gel electrophoresis (SDS-PAGE, this method is well known in the art) and submitted in a form of a Coomassie-stained gel band.
  • SDS-PAGE sodium dodecyl sulphate gel electrophoresis
  • Amino acid sequence fragment 4 WAAETTP(L/I)K
  • oligonucleotide primers were designed by reverse translation of the amino acid sequences of Example 6 and used to prime PCRs with G. suboxydans 1870 DNA as the template .
  • oligonucleotides oGDN5-4-Ile ' TGGGCIGCIGAGACIACICCIATNAA
  • oGDN3 13-Gln 1875 TIACIACIGCIACIGCGTAGAAIGTYTG
  • oGDN5-4-He is a sense primer based on the peptide 4 (Example 6)
  • oGDN13-Gln is an anti-sense primer designed by reverse-translating amino acid sequence fragment 9.
  • the 800 bp PCR fragment was cloned into the vector pCR2.1. TOPO® (Invifrogen Corp.) resulting in the plasmid pCR (GAD800) and partially sequenced (through a commercial service of MedProbe 1880 A/S, Norway). Homology searches using the BLAST service of NCBI
  • PCR fragment is derived from a gene encoding a PQQ-dependent dehydrogenase.
  • a gene library was constructed from the chromosomal DNA of G. suboxydans using
  • DNA fragment mixture by preparative agarose gel electrophoresis. This fraction was ligated with BamHI hydrolysed ⁇ -ZAP® vector, the ligation mixture packaged with
  • Plasmid pTAC has been constructed by ligating a 1.82 kb Pvul-Nrul fragment of the plasmid pKK223-3 (Pharmacia-LKB) with a 1.44 kb Pvu ⁇ -Pvull fragment of the plasmid pUC19.
  • This construction scheme follows the scheme earlier used by Hibino et al, [Hibino, T., Misawa S., Wakiyama M., Maeda S., Yazaki K., Kumigai I., Ooi T. and Miura K. High-level expression of porcine muscle adenylate kinase in
  • GA 5-DH genes may be identified by using in 1960 silico screening using nucleotide and amino acid sequence data of GenBank and other public databases providing access to DNA and protein sequences.
  • a preferred in silico screening method includes the use of the deduced amino acid sequence of GA 5-DH and its comparison with a set of known and deduced amino acid sequences - such as using the BLASTP service (http://www.ncbi.imu.nih. gov/BLAST/ provided 1965 by National Center for Biotechnology Information (USA) or other similar computer services.
  • Antibodies are raised against the amino acid of the present invention by injecting 1980 rabbits with the purified enzyme and isolating the immunoglobulins from antiserum according to procedures described according to N Harboe and A Ingild ("Immunization, Isolation of Immunoglobulins, Estimation of Antibody Titre" In A Manual of Quantitative Immunoelectrophoresis, Methods and Applications, N H Axelsen, et al (eds.), Universitetsforlaget, Oslo, 1973) and by T G Cooper ("The 1985 Tools of Biochemistry", John Wiley & Sons, New York, 1977).
  • Tartaric acid may be prepared from the 5-ketogluconic acid prepared by the process of the present invention by, for example, chemical methods.
  • One such method is disclosed in Example 1 of GB0210421.4 filed 7 May 2002.
  • Example 1 of GB0210421.4 filed 7 May 2002 For convenience that example is now presented below:
  • a process for preparing 5-ketogluconic acid from gluconic acid or nontoxic salts of gluconic acid using an amino acid sequence comprising the sequence shown as SEQ ID No.1 or a variant, homologue, fragment or derivative thereof .
  • Tartaric acid according to paragraph 10 for use as a starting material for preparing emulsifiers.
  • a method of preparing a product for consumption comprising admixing 5-KGA produced by the process of any one of paragraphs 1-6 and/or tartaric acid
  • a composition comprising 5-KGA and amino acid sequences or nucleotide sequences wherein 5-KGA is produced by the method of any one of paragraphs 1 to 6.
  • amino acid sequence comprising the sequence shown as SEQ ID NoJ or a variant, homologue, fragment or derivative thereof, wherein said amino acid sequence is used in the process of paragraph 1.
  • amino acid sequence comprising the sequence shown as SEQ ID NoJ or a 2065 variant, homologue, fragment or derivative thereof, wherein said amino acid sequence is used in the process of paragraph 1.
  • An amino acid sequence comprising the sequence shown as SEQ ID NoJ. 2070 18.
  • An amino acid sequence comprising the sequence shown as SEQ ID NoJ. 19.
  • nucleotide sequence according to paragraph 21 wherein said nucleotide sequence comprises the sequence shown as SEQ ID NoJ or a variant, homologue, fragment or derivative thereof, wherein the nucleotide sequence is used in the process of paragraph 4, optionally being in an isolated and/or purified form.
  • nucleotide sequence according to paragraph 21 wherein said nucleotide sequence comprises the sequence shown as SEQ ID No.4 or a variant, homologue, fragment or derivative thereof, wherein the nucleotide sequence is used in the process of paragraph 5.
  • a nucleotide sequence comprising the sequence shown as SEQ ID NoJ, optionally being in an isolated and/or purified form.
  • a nucleotide sequence comprising the sequence shown as SEQ ID No.4, 2095 optionally being in an isolated and/or purified form.
  • nucleotide sequence according to any one of paragraphs 21 to 27 wherein the nucleotide sequence is operably linked to a promoter.
  • a construct comprising the nucleotide sequence according to any one of 2110 paragraphs 21 to 28.
  • a vector comprising the nucleotide sequence according to any one of paragraphs 21 to 28.
  • a plasmid comprising the nucleotide sequence according to any one of paragraphs 21 to 28.
  • a host cell according to paragraph 32 expressing the amino acid sequence encoded by the nucleotide sequence incorporated therein.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention relates to a process and amino acid sequences and to nucleic acid sequences for use in said process. The present invention further relates to 5-ketogluconic acid (5-KGA) which is produced by the process of the present invention and to the use in the process of said amino acid sequences having gluconate 5-dehydrogenase enzyme activity and nucleic acid sequences coding for same.

Description

SEQUENCES FIELD OF THE INVENTION The present invention relates to a process and sequences for use in said process.
In particular, the present invention relates to a process and the use of amino acid sequences and nucleic acid sequences in said process. More in particular, the present invention relates to a process of producing 5-ketogluconic acid and the use of amino acid sequences that have gluconate 5-dehydrogenase enzyme activity and nucleic acid sequences coding for said amino acid sequences.
TECHNICAL BACKGROUND AND PRIOR ART Tartaric acid is a commercially useful chemical. To date, it is typically prepared by processing the cream of tartar, which is a by-product of the wine industry.
The present invention seeks to provide a new process for preparing 5-ketogluconic acid using novel sequences (amino acid sequences and/or nucleotide sequences), wherein the 5-ketogluconic acid is suitable for use in the preparation of tartaric acid.
The present invention also seeks to provide a new process for the synthesis of inter alia tartaric acid using novel sequences (amino acid sequences and nucleotide sequences)
The present invention also provides sequences (amino acid sequences and nucleotide sequences).
SUMMARY OF THE INVENTION
In a broad aspect the present invention relates to a process and to amino acid sequences for use in said process wherein the amino acid sequences have gluconic acid 5-dehydrogenase activity. The present invention also relates to nucleotide sequences encoding the same.
Aspects of the present invention are presented in the claims and in the following commentary.
In brief, some aspects of the present invention relate to:
A process for preparing 5-ketogluconic acid using sequences (amino acid sequences and/or nucleotide sequences).
A process for preparing tartaric acid using sequences (amino acid sequences and/or nucleotide sequences. An amino acid sequence having gluconic acid 5-dehydrogenase activity.
A nucleotide sequence encoding said amino acid sequence.
Methods of preparing said amino acid sequence.
Methods of preparing said nucleotide sequence.
Expression systems comprising said nucleotide sequence. Methods of expressing said nucleotide sequence. Transformed transfected hosts/host cells comprising said nucleotide sequence.
Uses of said amino acid sequence.
Uses of said nucleotide sequence.
Uses of said amino acid sequence to prepare 5-ketogluconic acid (5-KGA). Use of said nucleotide sequence to prepare 5-KGA.
A combination comprising 5-KGA and said amino acid sequence and/or said nucleotide sequence.
Method of isolating and/or purifying 5-KGA.
5-KGA produced by the process of the present invention. Uses of 5-KGA.
Uses of tartaric acid
As used with reference to the present invention, the terms "produce", "producing", "produced", "producable" are synonymous with the respective terms "prepare", "preparing", "prepared", "generated" and "preparable".
As used with reference to the present invention, the terms "expression", "expresses", "expressed" and "expressable" are synonymous with the respective terms "transcription", "transcribes", "transcribed" and "transcribable".
As used with reference to the present invention, the terms "transformation" and "transfection" refer to a method of introducing nucleic acid sequences into hosts, host cells, tissues or organs. Other aspects concerning the nucleotide sequence which can be used in the present invention include: a construct comprising the sequences of the present invention; a vector comprising the sequences for use in the present invention; a plasmid comprising the sequences for use in the present invention; a transformed cell comprising the sequences for use in the present invention; a transformed tissue comprising the sequences for use in the present invention; a transformed organ comprising the sequences for use in the present invention; a transformed host comprising the sequences for use in the present invention; a transformed organism comprising the sequences for use in the present invention. The present invention also encompasses methods of expressing the nucleotide sequence for use in the present invention using the same, such as expression in a host cell; including methods for transferring same. The present invention further encompasses methods of isolating the nucleotide sequence, such as isolating from a host cell.
Other aspects concerning the amino acid sequence for use in the present invention include: a construct encoding the amino acid sequences for use in the present invention; a vector encoding the amino acid sequences for use in the present invention; a plasmid encoding the amino acid sequences for use in the present invention; a transformed cell expressing the amino acid sequences for use in the present invention; a transformed tissue expressing the amino acid sequences for use in the present invention; a transformed organ expressing the amino acid sequences for use in the present invention; a transformed host expressing the amino acid sequences for use in the present invention; a transformed organism expressing the amino acid sequences for use in the present invention. The present invention also encompasses methods of purifying the amino acid sequence for use in the present invention using the same, such as expression in a host cell; including methods of transferring same, and then purifying said sequence. It is to be noted that the present invention provides a new and useful use of an enzyme that hitherto has not been disclosed or suggested in the art.
105 In this respect, an enzyme was identified and superficially characterised by Shinagawa et al, (Journal of Molecular Catalysis B: Enzymatic 6 (1999) 341-350). Neither the gene nor enzyme were isolated and sequenced in that report.
Moreover, it has been reported that the presence of the co-factor NADP is required for 110 the enzymatic conversion of gluconic acid to 5-ketogluconic acid (Klasen et al, Journal of Bacteriology, 1995, Vol 177, p 2637-2643). Klasen et al., {Journal of Bacteriology, 1995, Nol 177, p 2637-2643) also taught that in G. oxydans the enzyme responsible for 5-ketogluconic acid production is gluconate 5-dehydrogenase (gluconate ΝADP 5-oxidoreductase). 115
For ease of reference, these and further aspects of the present invention are now discussed under appropriate section headings. However, the teachings under each section are not necessarily limited to each particular section.
120 DETAILED DISCLOSURE OF INVENTION
In one aspect, the present invention relates to a process for preparing 5-ketogluconic acid from gluconic acid - or nontoxic salts thereof - comprising using an amino acid sequence comprising the sequence presented as SEQ ID NoJ or SEQ ID No .3 or a 125 variant, homologue, ftagment or a derivative of any thereof. The sequence presented as SEQ ID No. 1 is that detemiined by mass spectroscopy as described herein.
In another aspect, the present invention relates to a process for preparing 5- ketogluconic acid from gluconic acid - or nontoxic salts thereof- comprising using an 130 amino acid sequence comprising the sequence presented as SEQ ID No.5.
In another aspect, the present invention relates to a process for preparing 5- ketogluconic acid from gluconic acid or nontoxic salts thereof comprising using the expression product of the nucleotide sequence presented as SEQ ID No.2 or SEQ ID 135 No.4 or a sequence encoding the sequence presented as SEQ ID No. 5 or a variant, homologue, fragment or a derivative of any thereof.
In yet another aspect, the present invention relates to a process for preparing 5- ketogluconic acid from gluconic acid or nontoxic salts thereof comprising using the 140 expression product of the nucleotide sequence presented as SEQ ID NoJ or SEQ ID No.4 or a variant, homologue, fragment or a derivative thereof.
In yet another aspect, the present invention relates to a process for preparing tartaric acid by converting 5-ketogluconic acid which has been produced by a process 145 comprising using the amino acid sequences presented as SEQ ID NoJ or SEQ ID NoJ or SEQ ID No. 5 or a variant, homologue, fragment or a derivative of any thereof.
In yet another aspect, the present invention relates to a process for producing tartaric 150 acid by converting 5-ketogluconic acid which has been produced by a process comprising using the expression product of the nucleotide sequence presented as SEQ ID No .2 or SEQ ID No.4 or SEQ ID No. 6 or a variant, homologue, fragment or a derivative of any thereof.
155 In another aspect, the present invention includes using the tartaric acid obtained from the present invention as or in the preparation of a food or a foodstuff - such as in particular as a starting material for making emulsifiers.
In another aspect, the present invention relates to 5-KGA as a product produced by 160 the process of the present invention.
Another aspect of the present invention includes methods for purifying and/or isolating 5-KGA.
165 In another aspect, the present invention relates to 5-KGA when produced by the process of the present invention in a purified and/or isolated form.
Another aspect of the present invention includes using 5-KGA when produced b -the process of the present invention as an ingredient in a product for consumption. 170
Another aspect of the present invention includes using 5-KGA when produced by the process of the present invention as an ingredient in products where the product can be a product for consumption or a pharmaceutical product.
175 In another aspect, the present invention relates to a method for preparing a product, the method comprising admixing 5-KGA when produced by the process of the present invention with another component to form said product.
In another aspect, the present invention relates to a composition comprising 5-KGA 180 and amino acid sequences and/or nucleotide sequences wherein 5-KGA is produced by the method of the present invention and the amino acid sequences are the sequences shown as SEQ ID No. 1 and or SEQ ID NoJ and/or SEQ ID No.5 while the nucleotide sequences are the sequences shown as SEQ ID No.2 and/or SEQ ID NoJ and/ or SEQ ID No. 6. 185
In another aspect the invention relates to an amino acid sequence comprising the sequence shown as SEQ ID NoJ or SEQ ID NoJ or SEQ ID No. 5 or a variant, homologue, fragment or derivative of any thereof- preferably wherein said sequence SEQ ID No. 1 is determined by mass spectroscopy as described herein. 190
The amino acid sequence or variant or homologue or fragment or derivative has gluconic acid 5-dehydrogenase activity. For ease of reference, gluconic acid 5- dehydrogenase is sometimes referred to as GA 5-DH.
195 In a yet further aspect, the invention relates to the use of a nucleotide sequence shown as:
(a) the nucleotide sequence presented as SEQ ID No. 2 or SEQ ID No. 4 or SEQ ID No. 6; 200 (b) a nucleotide sequence that is a variant, homologue, derivative or fragment of the nucleotide sequence presented as SEQ ID No.2 or SEQ ID No.4 or SEQ ID No. 6;
(c) a nucleotide sequence that is the complement of the nucleotide sequence set out in SEQ ID No. 2 or SEQ ID No. 4 or SEQ ID No. 6;
(d) a nucleotide sequence that is the complement of a variant, homologue, derivative 205 or fragment of the nucleotide sequence presented as SEQ ID No. 2 or SEQ ID No. 4 or
SEQ ID No. 6;
(e) a nucleotide sequence that is capable of hybridising to the nucleotide sequence set out in SEQ ID No. 2 or SEQ ID No. 4 or SEQ ID No. 6;
(f) a nucleotide sequence that is capable of hybridising to a variant, homologue, 210 derivative or fragment of the nucleotide sequence presented as SEQ ID No. 2 or SEQ ID
No. 4 or SEQ ID No. 6;
(g) a nucleotide sequence that is the complement of a nucleotide sequence that is capable of hybridising to the nucleotide sequence set out in SEQ ID No. 2 or SEQ ID No. 4 or SEQ ID No. 6;
215 (h) a nucleotide sequence that is the complement of a nucleotide sequence that is capable of hybridising to a variant, homologue, derivative or fragment of the nucleotide sequence presented as SEQ ID No. 2 or SEQ ID No.4 or SEQ ID-No. 6; (i) a nucleotide sequence that is capable of hybridising to the complement of the nucleotide sequence set out in SEQ ID NoJ or SEQ ID No. 4 or SEQ ID No. 6;
220 (j) a nucleotide sequence that is capable of hybridising to the complement of a variant, homologue, derivative or fragment of the nucleotide sequence presented as SEQ ID No. 2 or SEQ ID No.4 or SEQ ID No. 6.
The nucleotide sequence of the present invention may comprise sequences that 225 encode for SEQ ID No. 3 or a variant, homologue or derivative thereof and SEQ ID No. 5 or a variant, homologue or derivative thereof.
In a.preferred aspect, the nucleotide sequence which can be used in the process of the present invention is obtainable from (though it does not have to be actually obtained 230 from) a Gluconobacter suboxydans strain.
In one aspect, the nucleotide. sequence which can be used in the process of the present invention is obtainable from (though it does not have to be actually obtained from) Gluconobacter suboxydans strain IFO 3255. 235
In a more preferred aspect, the nucleotide sequence which can be used in the process of the present invention is obtainable from (though it does not have to be actually obtained from) Gluconobacter suboxydans strain IFO 12528.
240 Another aspect of the present invention includes an isolated and/or purified nucleotide sequence for use in the present invention.
Another aspect of the present invention includes an isolated and or purified amino acid sequence for use in the present invention.
245
PREFERABLE ASPECTS
Preferable aspects are presented in the accompanying claims and in the following description and Examples section. 250
ADVANTAGES
The present invention is advantageous as it provides an enzymatic route for the synthesis of 5-ketogluconic acid. 255
The 5-ketogluconic acid obtained by the present invention may be converted to tartaric acid (2,3-dihydroxybutanedioic acid or 2,3-dihydroxysuccinic acid).
Thus, in one aspect the present invention is particularly advantageous as it provides a 260 novel cost-effective process for the production of tartaric acid (TA), in particular L(+)-TA. As it is well known, tartaric acid has a number of commercial uses.
Certain strains of Gluconobacter suboxydans are known to oxidise glucose into the 5- ketogluconic acid (5-KGA). However, the use of such strains for manufacturing 5-
265 KGA is associated with a number of problems: slow fermentation rate, concurrent production of 2-ketogluconic acid and partial consumption of 5-KGA by G. suboxydans. All of these phenomena result in low yields of 5-KGA. The present invention overcomes these problems as it provides an amino acid sequence having PQQ-dependent GA 5-DH activity, as well as a nucleotide sequence encoding same.
270
Knowledge of the use of the sequences presented herein enables the skilled person to construct recombinant hosts over-expressing glucose dehydrogenase together with GA 5-DH. Such hosts can provide an efficient method for converting glucose into 5- KGA by fermentation in high yields. Many bacterial hosts would be suitable for
275 implementation of this technology, with Gram-negative bacterial hosts being more suitable than Gram-positive bacterial hosts. Particularly suitable hosts are bacteria from the genera Escherichia, Pseudomonas, Acetobacter and Gluconobacter. Hosts having naturally high level of glucose dehydrogenase activity are more suitable than those not expressing glucose dehydrogenase or expressing it at low level.
280
In addition, it is believed that the enzyme of the present invention is suitable for production of 5-KGA under physiological conditions.
Advantageously, the present invention also provides a composition comprising 5- 285 KGA and the amino acid sequences of the present invention and/or the nucleotide sequences of the present invention.
The products of the present invention may be used in various applications in the food industry - such as in bakery and drink products, they may also be used in other 290 applications such as a pharmaceutical composition, or even in the chemical industry.
SURPRISING FINDINGS
In order to prepare and to purify the amino acid sequence that can be used in the 295 process of the present invention we surprisingly had to diverge from the teachings of Shinagawa et al, {Journal of Molecular Catalysis B: Enzymatic 6 (1999) 341-350). In that paper, the authors reported on the production of 5-keto-D-gluconate by acetic acid bacteria. That production is catalysed by pyrroloquinoline quinone (PQQ)- dependent membrane-bound D-gluconate dehydrogenase. In turn, the authors say that 300 their findings are completely discrepant from the conclusion proposed by Klasen et al, {Journal of Bacteriology, 1995, Nol 177, p 2637-2643).
In our initial studies, we experienced a persistent problem with the purification of GA 5-DH from membranes. The method described by Shinagawa et al, {Journal of
305 Molecular Catalysis B: Enzymatic 6 (1999) 341-350) did not produce satisfactory results. Only a few percent of GA 5-DH activity was extracted using 1-2% octyl- thiglucoside. Out of a dozen different detergents that we tested only octyl glycoside and Triton X-100 extracted active GA 5-DH. However, the enzyme extracted with Triton X-100 was quite unstable, loosing activity in a matter of hours. The enzyme
310 extracted with the concentrations of octyl glucoside normally used for protein extraction (1-2%) proved very difficult to purify with ion-exchange chromatography.
We then found several solutions to this problem. Firstly, we found that when the enzyme is first extracted with Triton X-100 followed by a dialysis against octyl- 315 glycoside, the resulting preparation is both more stable and shows "much improved" chromatographic behaviour. This is a preferred aspect of the present invention.
Secondly, we found that similar results may be obtained by using exceptionally high concentrations of octyl-glycoside in extraction buffer - such as 5-10% instead of 1- 320 2% - typical detergent concentration for membrane protein extraction. This is another preferred aspect of the present invention.
The solubilised GA 5-DH could be efficiently fractionated by one of the protein purification methods well known in the art - cation exchange chromatography. This is
325 another preferred aspect of the present invention. Here, we found that all of the other well known methods anion-exchange chromatography, gel filtration, hydrophobic interaction chromatography etc. failed to achieve any significant further purification or resulted in low yields of activity making the use of these methods impractical. Partially purified material eluted from cation exchange chromatographic was not
330 suitable for sequencing. In addition, an enzyme with functional similarity to GA 5- DH - PQQ-dependent alcohol dehydrogenase was found to be the major contaminant.
We also surprisingly found that we could only effectively separate alcohol dehydrogenase and GA 5-DH using polyacrylamide gel electrophoresis (PAGE) 335 under native conditions. This is another preferred aspect of the present invention. Here, we found that separation in the presence of octyl-glycoside (the detergent used throughout purification) was incomplete and insufficient for obtaining material suitable for protein sequencing.
340 Surprisingly, we have found that similar electrophoresis in the presence of octyl- maltoside - detergent known to be used for biochemical separations resulted in much improved separation of GA 5-DH and alcohol dehydrogenase yielding material that could be used for elucidating partial amino acid sequence of GA 5-DH and from there the entire amino acid sequence of GA 5-DH.
345
Surprisingly we have found that advantageously, the amino acid sequences of the present invention are capable of acting on D-gluconate and to such a degree that good levels of 5-KGA are obtained that can be easily purified and/or isolated. Thus, D- gluconate is a good substrate for the enzyme of the present invention. Here, the 350 relative activity of GA 5-DH on D-gluconate is at least about 10 % relative activity, at least about 15 % relative activity, at least about 20 % relative activity. Relative activity is measured according to the methods of Sugisawa and Hoshing (ibid). Moreover, we were able to identify and characterise a specific, useful end product.
355 We have also found that GA 5-DH requires divalent cations (such as magnesium and calcium) for maximum activity.
Surprisingly, we have found that very good yields are obtained if a sequence comprising SEQ ID No. 3 is expressed with and/or also comprises the sequence 360 presented as SEQ ID No. 5.
Without wishing to be bound by theory we believe that SEQ ID No. 6 - i.e. the sequence encoding SEQ ID No. 5 - is a small Open Reading Frame upstream of SEQ ID No. 3. For ease of reference, SEQ ID No. 6 is schematically presented in Figure 3 365 as "Small SU".
GLUCONIC ACID 5-DEHYDROGENASE
The amino acid sequences of the present invention have gluconic acid 5- 370 dehydrogenase activity. The amino acid sequence (enzyme) of the present invention is sometimes referred to as GA 5-DH.
Two types of gluconic acid 5-dehydrogenase were known already. In this respect, the intracellular NAD+-dependent enzyme (EC 1JJ.69) from Gluconobacter suboxydans
375 had been characterised and purified by Klasen et al., (J. Bacteriol. 177, 2637-2643 (1995)). The same group had also cloned the gene encoding this enzyme. Another type of gluconate 5-dehydrogenase is the membrane-bound enzyme that has pyrroloquinoline quinone (PQQ) as a cofactor (E.C. 1.1.99.X). This enzyme detected by Shinagawa et al (ibid) has never been purified or characterised to a significant
380 extent.
Most recently, a membrane-bound D-sorbitol dehydrogenase (SLDH) from Gluconobacter suboxydans IF03255 was isolated and characterised (Moyazaki et ah, Biosci. Biotechnol. Biochem., 2002, 66 (2), 262-270). The gene (sldA) and the
385 enzyme were isolated and sequenced and the enzyme was shown to have 35-37% identity to the membrane-bound quinoprotein glucose dehydrogenases (GDH) from E.coli. The membrane-bound SLHD appears to require pyrrloquinolone quinone (PQQ) and a 126 amino acid hydrophobic residue sldB gene product for activity development in E. coli. The substrate specificity of the membrane-bound SLHD was
390 characterised by Sugisawa and Hoshino (Biosci. Biotechnol. Biochem., 2002, 66 (1), 55-64) who reported that D-gluconate is a very poor substrate of said enzyme which is oxidised at 6.65% Relative Activity. Furthermore, Sugisawa and Hoshino were unable to identify and or purify the end product of said reaction.
395 There are a number of important differences between the known enzymes.
In this respect, PQQ-dependent dehydrogenases are located on the outer surface of the cell membrane. This means that they can act upon extracellular substrates. The electron acceptor for the PQQ-dependent enzyme is either ubiquinone or cytochrome 400 C. The difference in redox potential of the electron acceptors used by these enzymes is translated into the different equilibrium position of the reaction.
The reactions of oxidation of primary alcohols catalysed by membrane-bound PQQ- dependent dehydrogenases are known to be essentially irreversible while the reactions 405 catalysed by NAD+ dependent dehydrogenases are completely reversible with equilibrium shifted towards alcohol rather than ketone under normal physiological conditions.
In this respect, it is believed that under normal physiological conditions the 410 equilibrium of the reaction: alcohol + NAD+ -> ketone + NADH
(E° - 0.048, calculated using standard redox potential of the sorbitol-fructose 415 pair as an example, Handbook of Biochemistry, 2nd edition, CRC Press, 1970) is strongly shifted towards NAD+ and alcohol. [This is the reaction catalysed by the NAD+ -dependent enzyme (EC 1J.1.69) as described by Klasen et al. (LBacteriol. 177, 2637-2643 (1995)]. Obviously, this makes such enzymatic reaction impractical 420 for producing the keto-form of the substrate by, for example, metabolic engineering.
In contrast to that, it is believed that the reaction may be as follows: alcohol + ubiquinone -> ketone + ubihydroquinone
425
(E°'= - 0.372) is essentially irreversibly shifted towards ketone formation. [This is the reaction catalysed by the gluconate 5-dehydrogenase that has pyrroloquinoline quinone (PQQ) 430 as a cofactor (E.G. 1J .99.X) as described by Shinagawa et al, (ibid). Cytochromes C have even higher standard oxidising potentials than ubiquinone.
GLUCONIC ACD35-DEHYDROGENASE ASSAY
435 The following assay may be used to characterise and identify actual and putative amino acid sequences which can be used according to the present invention.
The following reaction mixture is prepared:
440 • 20 μl of 200 mM sodium gluconate,
• 40 μl of buffer B (100 mM sodium acetate containing 100 mM of CaCl2, 100 mM MgCl2, 1 Omg/ml bovine serum albumin, pH 4J),
• 5 μL of2 μMPQQ
• 150 μl of Buffer Al OG (10 mM sodium acetate buffer, pH 4J , 1 mM CaCl2, 445 1 mM MgCl2) 1% octyl glucoside)
• 5- 10 μl of a crude lysate This mixture is pre-incubated for 5 min at room temperature followed by addition of 20 μl of 100 mM K3(Fe(CN)6). Incubation is carried out for one hour also at room temperature.
When the activity in crude lysates is assayed, the reaction products are detected with HPLC using Ultrapack DEAE 2 SW (LKB, Pharmacia, Sweden) column (4.6 x 250 mm) equilibrated and eluted with diluted phosphoric acid (pH 2.55). Refrectometric detection is used. This method allows to discriminate between GA 5-DH activity and the activity of gluconate 2-dehydrogenase that is also present in membrane fractions of G. suboxydans.
For assaying the purified preparations of GA 5-DH the reaction mixture additionally contains 10 μl of crude lysate of G. suboxydans inactivated in boiling water bath for 5 min. In this case, colourimetry is used instead of HPLC to monitor the progress of the reaction. 100 μl of ferric sulphate-Dupanol reagent (0.5% ferric sulphate, 0.3% SDS, 8% phosphoric acid) is added, the reaction mixture was diluted with water to 2 ml and the absorption at 660 nM is measured.
GLUCONIC ACID
The 5-ketogluconic acid is prepared from gluconic acid or from nontoxic salts of gluconic acid.
Gluconic acid can be produced by the biochemical and catalytic oxidation of glucose. Glucose dehydrogenase catalyses the formation of D-glucono-δ-lactone that is hydrolysed to gluconic acid either spontaneously or enzymatically via the action of gluconolactonase. The enzymes may be obtained from various moulds or by bacteria of many bacterial genera, for example, Escherichia, Pseudomonas, Glucoinobacter, Acetobacter, etc. Gluconic acid can also be prepared chemically from glucose - such as by the oxidation of glucose with halogens or by electrolysis.
As used herein, the term "nontoxic salts of gluconic acid" means gluconic acid salts that have no detectable detrimental or harmful effect on the consumer. Such nontoxic gluconic acid salts include one or more of a sodium salt, a potassium salt, a calcium salt, a magnesium salt, a zinc salt, a copper salt, etc A preferred gluconic acid salt with respect to the process of the present invention is a sodium salt. TARTARIC ACID
Tartaric acid (2,3-dihydroxybutanedioic acid or 2,3-dihydroxysuccinic acid) is a natural crystalline compound found in plants, especially those with tart characteristics such as unripe grapes.
Tartaric acid is mainly used in the form of its salts, e.g., cream of tartar (potassium acid tartrate) and Rochelle salt. In the pharmaceutical industry tartaric acid, combined with sodium bicarbonate, is used in the manufacture of effervescent compounds such as fruit salts and antacids. These effervescent compounds cause the quick dissolution of active agents, such as analgesics and artificial sweeteners. In the drinks industry, tartaric acid is used in wine production to adjust the natural acidity of wine and to enhance the flavour. Tartaric acid is also added to carbonated soft drinks and fruit juices (natural and synthetic) to enhance the flavour. Furthermore, it is used in diet drinks because it is not metabolised and lacks caloric value. Tartaric acid is used in
500 the production of foodstuffs such as confectionery, jams, jellies and ice-creams to confer an acidic taste. In confectionery making, tartaric acid is used to prevent sugar crystallisation. In the canning of fruits and vegetables tartaric acid is used to enhance the flavour and to inhibit the actions of enzymes that may cause changes in the colour or flavour of the canned food. Furthermore, the increased acidity within the cans
505 contributes to a more effective barrier against unwanted micro-organisms.
In the baking industry, tartaric acid can be used as dough strengthener to improve mixing tolerance, water absorption and gas retention, flavour, crystallation control resulting in improved loaf volume, texture, taste and grain. A protein network is formed during the
510 processing of wheat dough. Emulsifiers such as diacetyl tartaric acid esters can strengthen the gluten so that it is better able to retain the carbon dioxide produced. In the case of diacetyl tartaric esters of monoglycerides, a free carboxylic group gives it the ability to bind the gluten, thus improving gluten's ability to hold the gas bubbles. In other words, it has a greater hydrophilic part. Thus in baked foodstuffs, such as breads,
515 cakes, biscuits and candies, tartaric acid esters can be used to produce a firmer dough and to give a smoother texture and better flavour to the finished product.
Tartaric acid produced by the process of the present invention can be used as a starting material for making different emulsifiers. For example, by using the process 520 of making emulsifϊer compositions using tartaric acid and tartaric acid esters described in US 4,483,880.
PRODUCTION OF TARTARIC ACID
525 Current production of tartaric acid is based on utilisation of the "cream of tartar" - a by-product of the wine industry.
In accordance with the present invention, tartaric acid may be prepared from 5 keto- gluconic acid by chemical processes. For example, by using the process described in 530 US-A-5763656.
Gluconobacter suboxydans
In a preferred aspect, the amino acid sequences having gluconic acid 5-dehydrogenase
535 activity and/or the nucleotide sequences are obtainable from Gluconobacter suboxydans
Gluconobacter suboxydans are gram-negative, obligate aerobic bacteria belonging to the family Acetobacteraceae (Bergey's Manual of Systematic Bacteriology, Williams
540 and Willkins, Baltimore/London, 1984). Gluconobacter strains flourish in sugary niches such as ripe grapes, apples, dates, garden soil, baker's soil, honeybees, fruit, cider, beer and wine. Gluconobacter strains are non-pathogenic towards man and other animals but are capable of, for example, causing bacterial rot of apples and pears which is accompanied by various shades of browning. Gluconobacter strains
545 can be used to produce L-sorbose from D-sorbitol; D-gluconic acid, 5-ketogluconic acid and 2-ketogluconic acid from D-glucose; and dihydroxyacetone from glycerol. Klasen et al., (Biotechnology and Bioengineering, 1991, Nol 40, p 183-188) showed that in G. oxydans the activity of 5-ketogluconic acid and the catalyst vandate were 550 responsible for the production of tartaric acid and that G. oxydans was not able to produce tartaric acid by itself.
ISOLATED
555 In one aspect, preferably the sequence is in an isolated form. The term "isolated" means that the sequence is at least substantially free from at least one other component with which the sequence is naturally associated in nature and as found in nature.
560 PURIFIED
In one aspect, preferably the sequence is in a purified form. The term "purified" means that the sequence is in a relatively pure state - e.g. at least about 90% pure, or at least about 95% pure or at least about 98% pure.
565
NUCLEOTIDE SEQUENCE
The scope of the present invention encompasses nucleotide sequences encoding enzymes having the specific properties as defined herein.
570
The term "nucleotide sequence" as used herein refers to an oligonucleotide sequence or polynucleotide sequence, and variant, homologues, fragments and derivatives thereof (such as portions thereof). The nucleotide sequence may be of genomic or synthetic or recombinant origin, which may be double-stranded or single-stranded whether 575 representing the sense or anti-sense strand.
The term "nucleotide sequence" in relation to the present invention includes genomic DNA, cDNA, synthetic DNA, and RNA. Preferably it means DNA, more preferably cDNA sequence coding for the present invention.
580
In a preferred embodiment, the nucleotide sequence when relating to and when encompassed by the per se scope of the present invention does not include the native nucleotide sequence according to the present invention when in its natural environment and when it is linked to its naturally associated sequence(s) that is/are also in its/their
585 natural environment. For ease of reference, we shall call this preferred embodiment the "non-native nucleotide sequence". In this regard, the term "native nucleotide sequence" means an entire nucleotide sequence that is in its native environment and when operatively linked to an entire promoter with which it is naturally associated, which promoter is also in its native environment. However, the amino acid sequence
590 encompassed by scope the present invention can be isolated and/or purified post expression of a nucleotide sequence in its native organism. Preferably, however, the amino acid sequence encompassed by scope of the present invention may be expressed by a nucleotide sequence in its native organism but wherein the nucleotide sequence is not under the control of the promoter with which it is naturally associated wilriin that
595 organism. Typically, the nucleotide sequence encompassed by scope of the present invention is prepared using recombinant DNA techniques (i.e. recombinant DNA). However, in an alternative embodiment of the invention, the nucleotide sequence could be 600 synthesised, in whole or in part, using chemical methods well known in the art (see Caruthers MH et al, (1980) Nuc Acids Res Symp Ser 215-23 and Horn T et al., (1980) Nuc Acids Res Symp Ser 225-232).
PREPARATION OF THE NUCLEOTIDE SEQUENCE
605
A nucleotide sequence encoding either an enzyme which has the specific properties as defined herein or an enzyme which is suitable for modification may be identified and/or isolated and/or purified from any cell or organism producing said enzyme. Various methods are well known within the art for the identification and or isolation 610 and/or purification of nucleotide sequences. By way of example, PCR amplification techniques to prepare more of a sequence may be used once a suitable sequence has been identified and/or isolated and/or purified.
By way of further example, a genomic DNA and/or cDNA library may be constructed 615 using chromosomal DNA or messenger RNA from the organism producing the enzyme. If the amino acid sequence of the enzyme is known, labelled oligonucleotide probes may be synthesised and used to identify enzyme-encoding clones from the genomic library prepared from the organism. Alternatively, a labelled oligonucleotide probe containing sequences homologous to another known enzyme gene could be 620 used to identify enzyme-encoding clones. In the latter case, hybridisation and washing conditions of lower stringency are used.
Alternatively, enzyme-encoding clones could be identified by inserting fragments of genomic DNA into an expression vector, such as a plasmid, transforming enzyme- 625 negative bacteria with the resulting genomic DNA library, and then plating the transformed bacteria onto agar plates containing a substrate for enzyme (i.e. maltose), thereby allowing clones expressing the enzyme to be identified.
In a yet further alternative, the nucleotide sequence encoding the enzyme may be 630 prepared synthetically by established standard methods, e.g. the phosphoroamidite method described by Beucage S.L. et al., (1981) Tetrahedron Letters 22, p 1859- 1869, or the method described by Matthes et al, (1984) EMBO J. 3, p 801-805. In the phosphoroamidite method, oligonucleotides are synthesised, e.g. in an automatic DNA synthesiser, purified, annealed, ligated and cloned in appropriate vectors. 635
The nucleotide sequence may be of mixed genomic and synthetic origin, mixed synthetic and cDNA origin, or mixed genomic and cDNA origin, prepared by ligating fragments of synthetic, genomic or cDNA origin (as appropriate) in accordance with standard techniques. Each ligated fragment corresponds to various parts of the entire 640 nucleotide sequence. The DNA sequence may also be prepared by polymerase chain reaction (PCR) using specific primers, for instance as described in US 4,683,202 or in Saiki R K et al, (Science (1988) 239, pp 487-491).
AMINO ACID SEQUENCES
645 The scope of the present invention also encompasses amino acid sequences of enzymes having the specific properties as defined herein.
As used herein, the term "amino acid sequence" is synonymous with the term 650 "polypeptide" and/or the term "protein". In some instances, the term "amino acid sequence" is synonymous with the term "peptide". In some instances, the term "amino acid sequence" is synonymous with the term "enzyme".
The amino acid sequence may be prepared/isolated from a suitable source, or it may 655 be made synthetically or it may be prepared by use of recombinant DNA techniques.
The enzyme encompassed in the present invention may be used in conjunction with other enzymes. Thus the present invention also covers a combination of enzymes wherein the combination comprises the enzyme of the present invention and another 660 enzyme, which may be another enzyme according to the present invention. This aspect is discussed in a later section.
Preferably the amino acid„ sequence when relating to and when encompassed by the per se scope of the present invention is not a native enzyme. In this regard, the term "native 665 enzyme" means an entire enzyme that is in its native environment and when it has been expressed by its native nucleotide sequence.
VARIANTS/HOMOLOGUES/DERIVATIVES
670 The present invention also encompasses the use of variants, homologues and derivatives of any amino acid sequence of an enzyme or of any nucleotide sequence encoding such an enzyme.
Here, the term "homologue" means an entity having a certain homology with the 675 subject amino acid sequences and the subject nucleotide sequences. Here, the term "homology" can be equated with "identity".
In the present context, a homologous sequence is taken to include an amino acid sequence which may be at least 75, 80, 85 or 90% identical, preferably at least 95, 96,
680 97, 98 or 99% identical to the subject sequence. Typically, the homologues will comprise the same active sites etc. as the subject amino acid sequence. Although homology can also be considered in terms of similarity (i.e. amino acid residues having similar chemical properties/functions), in the context of the present invention it is preferred to express homology in terms of sequence identity.
685
In the present context, an homologous sequence is taken to include a nucleotide sequence which may be at least 75, 80, 85 or 90% identical, preferably at least 95, 96, 97, 98 or 99% identical to a nucleotide sequence encoding an enzyme of the present invention (the subject sequence). Typically, the homologues will comprise the same
690 sequences that code for the active sites etc. as the subject sequence. Although homology can also be considered in terms of similarity (i.e. amino acid residues having similar chemical properties/functions), in the context of the present invention it is preferred to express homology in terms of sequence identity. 695 Homology comparisons can be conducted by eye, or more usually, with the aid of readily available sequence comparison programs. These commercially available computer programs can calculate % homology between two or more sequences.
% homology may be calculated over contiguous sequences, i.e. one sequence is 700 aligned with the other sequence and each amino acid in one sequence is directly compared with the corresponding amino acid in the other sequence, one residue at a time. This is called an "ungapped" alignment. Typically, such ungapped alignments are performed only over a relatively short number of residues.
705 Although this is a very simple and consistent method, it fails to take into consideration that, for example, in an otherwise identical pair of sequences, one insertion or deletion will cause the following amino acid residues to be put out of alignment, thus potentially resulting in a large reduction in % homology when a global alignment is performed. Consequently, most sequence comparison methods
710 are designed to produce optimal alignments that take into consideration possible insertions and deletions without penalising unduly the overall homology score. This is achieved by inserting "gaps" in the sequence alignment to try to maximise local homology.
715 However, these more complex methods assign "gap penalties" to each gap that occurs in the alignment so that, for the same number of identical amino acids, a sequence alignment with as few gaps as possible - reflecting higher relatedness between the two compared sequences - will achieve a higher score than one with many gaps. "Afϊϊne gap costs" are typically used that charge a relatively high cost for the existence of a
720 gap and a smaller penalty for each subsequent residue in the gap. This is the most commonly used gap scoring system. High gap penalties will of course produce optimised alignments with fewer gaps. Most alignment programs allow the gap penalties to be modified. However, it is preferred to use the default values when using such software for sequence comparisons. For example when using the GCG
725 Wisconsin Bestfit package the default gap penalty for amino acid sequences is -12 for a gap and -4 for each extension.
Calculation of maximum % homology therefore firstly requires the production of an optimal alignment, taking into consideration gap penalties. A suitable computer
730 program for carrying out such an alignment is the GCG Wisconsin Bestfit package (Devereux et al 1984 Nuc. Acids Research 12 p387). Examples of other software than can perform sequence comparisons include, but are not limited to, the BLAST package (see Ausubel et al, 1999 Short Protocols in Molecular Biology, 4th Ed - Chapter 18), FASTA (Altschul et al, 1990 J. Moi. Biol. 403-410) and the
735 GENEWORKS suite of comparison tools. Both BLAST and FASTA are available for offline and online searching (see Ausubel et al, 1999, Short Protocols in Molecular Biology, pages 7-58 to 7-60). However, for some applications, it is preferred to use the GCG Bestfit program. A new tool, called BLAST 2 Sequences is also available for comparing protein and nucleotide sequence (see FEMS Microbiol Lett 1999
740 174(2): 247-50; FEMS Microbiol Lett 1999 177(1): 187-8 and tatiana@ncbi.nlm.nih.gov),
Although the final % homology can be measured in terms of identity, the alignment process itself is typically not based on an all-or-nothing pair comparison. Instead, a 745 scaled similarity score matrix is generally used that assigns scores to each pairwise comparison based on chemical similarity or evolutionary distance. An example of such a matrix commonly used is the BLOSUM62 matrix - the default matrix for the BLAST suite of programs. GCG Wisconsin programs generally use either the public default values or a custom symbol comparison table if supplied (see user manual for
750 further details). For some applications, it is preferred to use the public default values for the GCG package, or in the case of other software, the default matrix, such as BLOSUM62.
Alternatively, percentage homologies may be calculated using the multiple alignment 755 feature in DNASIS™ (Hitachi Software), based on an algorithm, analogous to CLUSTAL (Higgins DG & Sharp PM (1988), Gene 73(1), 237-244).
Once the software has produced an optimal alignment, it is possible to calculate % homology, preferably % sequence identity. The software typically does this as part of 760 the sequence comparison and generates a numerical result.
The sequences may also have deletions, insertions or substitutions of amino acid residues which produce a silent change and result in a functionally equivalent substance. Deliberate amino acid substitutions may be made on the basis of similarity
765 in polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or the amphipathic nature of the residues as long as the secondary binding activity of the substance is retained. For example, negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids include lysine and arginine; and amino acids with uncharged polar head groups having similar hydrophilicity values include
770 leucine, isoleucine, valine, glycine, alanine, asparagine, glutamine, serine, threonine, phenylalanine, and tyrosine.
Conservative substitutions may be made, for example according to the Table below. Amino acids in the same block in the second column and preferably in the same line 775 in the third column may be substituted for each other:
Figure imgf000017_0001
The present invention also encompasses homologous substitution (substitution and replacement are both used herein to mean the interchange of an existing amino acid
780 residue, with an alternative residue) that may occur i.e. like-for-like substitution such as basic for basic, acidic for acidic, polar for polar etc. Non-homologous substitution may also occur i.e. from one class of residue to another or alternatively involving the inclusion of unnatural amino acids such as omithine (hereinafter referred to as Z), diaminobutyric acid omithine (hereinafter referred to as B), norleucine omithine
785 (hereinafter referred to as O), pyriylalanine, thienylalanine, naphthylalanine and phenylglycine. Replacements may also be made by unnatural amino acids.
790 Variant amino acid sequences may include suitable spacer groups that may be inserted between any two amino acid residues of the sequence including alkyl groups such as methyl, ethyl or propyl groups in addition to amino acid spacers such as glycine or β- alanine residues. A further form of variation, involves the presence of one or more amino acid residues in peptoid form, will be well understood by those skilled in the
795 art. For the avoidance of doubt, "the peptoid form" is used to refer to variant amino acid residues wherein the cc-carbon substituent group is on the residue's nitrogen atom rather than the α-carbon. Processes for preparing peptides in the peptoid form are known in the art, for example Simon RJ et al, PNAS (1992) 89(20), 9367-9371 and Horwell DC, Trends Biotechnol. (1995) 13(4), 132-134.
800
The nucleotide sequences for use in the present invention may include within them synthetic or modified nucleotides. A number of different types of modification to oligonucleotides are known in the art. These include methylphosphonate and phosphorothioate backbones and/or the addition of acridine or polylysine chains at the
805 3' and/or 5' ends of the molecule. For the purposes of the present invention, it is to be understood that the nucleotide sequences described herein may be modified by any method available in the art. Such modifications may be carried out in order to enhance the in vivo activity or life span of nucleotide sequences of the present invention.
810
The present invention also encompasses the use of nucleotide sequences that are complementary to the sequences presented herein, or any derivative, fragment or derivative thereof. If the sequence is complementary to a fragment thereof then that sequence can be used as a probe to identify similar coding sequences in other
815 organisms etc.
Polynucleotides which are not 100% homologous to the sequences of the present invention but fall within the scope of the invention can be obtained in a number of ways. Other variants of the sequences described herein may be obtained for example by
820 probing DNA libraries made from a range of individuals, for example individuals from different populations. In addition, other homologues may be obtained and such homologues and fragments thereof in general will be capable of selectively hybridising to the sequences shown in the sequence listing herein. Such sequences may be obtained by probing cDNA libraries made from or genomic DNA libraries from other species, and
825 probing such libraries with probes comprising all or part of any one of the sequences in the attached sequence listings under conditions of medium to high stringency. Similar considerations apply to obtaining species homologues and allelic variants of the polypeptide or nucleotide sequences of the invention.
830 Variants and strain/species homologues may also be obtained using degenerate PCR which will use primers designed to target sequences within the variants and homologues encoding conserved amino acid sequences within the sequences of the present invention. Conserved sequences can be predicted, for example, by aligning the amino acid sequences from several variants homologues. Sequence alignments can be performed
835 using computer software known in the art. For example the GCG Wisconsin PileUp program is widely used. The primers used in degenerate PCR will contain one or more degenerate positions and will be used at stringency conditions lower than those used for cloning sequences with 840 single sequence primers against known sequences.
Alternatively, such polynucleotides may be obtained by site directed mutagenesis of characterised sequences. This may be useful where for example silent codon sequence changes are required to optimise codon preferences for a particular host cell in which the 845 polynucleotide sequences are being expressed. Other sequence changes may be desired in order to introduce restriction enzyme recognition sites, or to alter the property or function of the polypeptides encoded by the polynucleotides.
Polynucleotides (nucleotide sequences) of the invention may be used to produce a 850 primer, e.g. a PCR primer, a primer for an alternative amplification reaction, a probe e.g. labelled with a revealing label by conventional means using radioactive or non- radioactive labels, or the polynucleotides may be cloned into vectors. Such primers, probes and other fragments will be at least 15, preferably at least 20, for example at least 25, 30 or 40 nucleotides in length, and are also encompassed by the term polynucleotides 855 of the invention as used herein.
Polynucleotides such as DNA polynucleotides and probes according to the invention may be produced recombinantly, synthetically, or by any means available to those of skill in the art. They may also be cloned by standard techniques. 860
In general, primers will be produced by synthetic means, involving a stepwise m-uTufacture of the desired nucleic acid sequence one nucleotide at a time. Techniques for accomplishing this using automated techniques are readily available in the art.
865 Longer polynucleotides will generally be produced using recombinant means, for example using a PCR (polymerase chain reaction) cloning techniques. The primers may be designed to contain suitable restriction enzyme recognition sites so that the amplified DNA can be cloned into a suitable cloning vector.
870 By way of example, a variant, homologue, fragment or derivative of SEQ ID No. 3 may comprise at least one or more of the following sequences: a. GSGNSFEP and preferably near to the N terminal end b. ALGLVY and preferably about intermediate the N terminal end and 875 the C terminal end c. DHKG and preferably at the C terminal end.
BIOLOGICALLY ACTIVE
880 Preferably, the variant sequences etc. are at least as biologically active as the sequences presented herein.
As used herein "biologically active" refers to a sequence having a similar structural function (but not necessarily to the same degree), and/or similar regulatory function 885 (but not necessarily to the same degree), and/or similar biochemical function (but not necessarily to the same degree) of the naturally occurring sequence. HYBRIDISATION
890 The present invention also encompasses sequences that are complementary to the nucleic acid sequences of the present invention or sequences that are capable of hybridising either to the sequences of the present invention or to sequences that are complementary thereto.
895 The term "hybridisation" as used herein shall include "the process by which a strand of nucleic acid joins with a complementary strand through base pairing" as well as the process of amplification as carried out in polymerase chain reaction (PCR) technologies.
900 The present invention also encompasses the use of nucleotide sequences that are capable of hybridising to the sequences that are complementary to the sequences presented herein, or any derivative, fragment or derivative thereof.
- The term "variant" also encompasses sequences that are complementary to sequences 905 that are capable of hybridising to the nucleotide sequences presented herein.
Preferably, the term "variant" encompasses sequences that are complementary to sequences that are capable of hybridising under stringent conditions (e.g. 50°C and OJxSSC {lxSSC - 0.15 M NaCl, 0.015 M Na3citrate pH 7.0}) to the nucleotide 910 sequences presented herein.
More preferably, the term "variant" encompasses sequences that are complementary to sequences that are capable of hybridising under high stringent conditions (e.g. 65°C and O.lxSSC {lxSSC = 0.15 M NaCl, 0.015 M Na3citrate pH 7.0}) to the nucleotide 915 sequences presented herein.
The present mvention also relates to nucleotide sequences that can hybridise to the nucleotide sequences of the present invention (including complementary sequences of those presented herein). 920
The present invention also relates to nucleotide sequences that are complementary to sequences that can hybridise to the nucleotide sequences of the present invention (including complementary sequences of those presented herein).
925 Also included within the scope of the present invention are polynucleotide sequences that are capable of hybridising to the nucleotide sequences presented herein under conditions of intermediate to maximal stringency.
In a preferred aspect, the present invention covers nucleotide sequences that can 930 hybridise to the nucleotide sequence of the present invention, or the complement thereof, under stringent conditions (e.g. 50°C and OJxSSC).
In a more preferred aspect, the present invention covers nucleotide sequences that can hybridise to the nucleotide sequence of the present invention, or the complement 935 thereof, under high stringent conditions (e.g. 65°C and OJxSSC). SITE-DIRECTED MUTAGENESIS
Once an enzyme-encoding nucleotide sequence has been isolated, or a putative 940 enzyme-encoding nucleotide sequence has been identified, it may be desirable to mutate the sequence in order to prepare an enzyme of the present invention.
Mutations may be introduced using synthetic oligonucleotides. These oligonucleotides contain nucleotide sequences flanking the desired mutation sites.
945
A suitable method is disclosed in Morinaga et al, {Biotechnology (1984) 2, p646- 649). Another method of introducing mutations into enzyme-encoding nucleotide sequences is described in Nelson and Long (Analytical Biochemistry (1989), 180, p 147-151).
950
RECOMBINANT
In one aspect the sequence for use in the present invention is a recombinant sequence - i.e. a sequence that has been prepared using recombinant DNA techniques.
955
These recombinant DNA techniques are within the capabilities of a person of ordinary skill in the art. Such techniques are explained in the literature, for example, J. Sambrook, E. F. Fritsch, and T. Maniatis, 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Books 1-3, Cold Spring Harbor Laboratory Press.
960
SYNTHETIC
In one aspect the sequence for use in the present invention is a synthetic sequence - i.e. a sequence that has been prepared by in vitro chemical or enzymatic synthesis. It 965 includes, but is not limited to, sequences made with optimal codon usage for host organisms - such as the methylotrophic yeasts Pichia and Hansenula.
EXPRESSION OF ENZYMES
970 The nucleotide sequence for use in the present invention may be incorporated into a recombinant replicable vector. The vector may be used to replicate and express the nucleotide sequence, in enzyme form, in and or from a compatible host cell.
Expression may be controlled using control sequences eg. regulatory sequences.
975
The enzyme produced by a host recombinant cell by expression of the nucleotide sequence may be secreted or may be contained intracellularly depending on the sequence and/or the vector used. The coding sequences may be designed with signal sequences which direct secretion of the substance coding sequences through a 980 particular prokaryotic or eukaryotic cell membrane.
EXPRESSION VECTOR
The term "expression vector" means a construct capable of in vivo or in vitro expression. 985 Preferably, the expression vector is incorporated into the genome of a suitable host organism. The term "incorporated" preferably covers stable incorporation into the genome. . . .
990 The nucleotide sequence of the present invention may be present in a vector in which the nucleotide sequence is operably linked to regulatory sequences capable of providing for the expression of the nucleotide sequence by a suitable host organism.
The vectors for use in the present invention may be transformed into a suitable host 995 cell as described below to provide for expression of a polypeptide of the present mvention.
The choice of vector eg. a plasmid, cosmid, or phage vector will often depend on the host cell into which it is to be introduced. 1000
The vectors for use in the present invention may contain one or more selectable marker genes- such as a gene, which confers antibiotic resistance eg. ampicillin, kanamycin, chloramphenicol or tetracyclin resistance. Alternatively, the selection may be accomplished by co-transformation (as described in W091/17243).
1005
Vectors may be used in vitro, for example for the production of RNA or used to transfect, transform, transduce or infect a host cell.
Thus, in a further embodiment, the invention provides a method of making nucleotide 1010 sequences of the present invention by introducing a nucleotide sequence of the present invention into a replicable vector, introducing the vector into a compatible host cell, and growing the host cell under conditions which bring about replication of the vector.
1015 The vector may further comprise a nucleotide sequence enabling the vector to replicate in the host cell in question. Examples of such sequences are the origins of replication of plasmids pUC19, pACYC177, pUBl 10, pE194, pAMBl and pIJ702.
REGULATORY SEQUENCES
1020
In some applications, the nucleotide sequence for use in the present invention is operably linked to a regulatory sequence which is capable of providing for the expression of the nucleotide sequence, such as by the chosen host cell. By way of example, the present invention covers a vector comprising the nucleotide sequence of 1025 the present invention operably linked to such a regulatory sequence, i.e. the vector is an expression vector.
The term "operably linked" refers to a juxtaposition wherein the components described are in a relationship permitting them to function in their intended manner. 1030 A regulatory sequence "operably linked" to a coding sequence is ligated in such a way that expression of the coding sequence is achieved under condition compatible with the control sequences.
The term "regulatory sequences" includes promoters and enhancers and other 1035 expression regulation signals . The term "promoter" is used in the normal sense of the art, e.g. an RNA polymerase binding site.
1040 Enhanced expression of the nucleotide sequence encoding the enzyme of the present invention may also be achieved by the selection of heterologous regulatory regions, e.g. promoter, secretion leader and terminator regions.
Preferably, the nucleotide sequence according to the present invention is operably 1045 linked to at least a promoter.
Examples of suitable promoters for directing the transcription of the nucleotide sequence in a bacterial, fungal or yeast host are well known in the art.
1050 CONSTRUCTS
The term "construct" - which is synonymous with terms such as "conjugate", "cassette" and "hybrid" - includes a nucleotide sequence for use according to the present invention directly or indirectly attached to a promoter.
1055
An example of an indirect attachment is the provision of a suitable spacer group such as an intron sequence, such as the Shl-intron or the ADH intron, intermediate the promoter and the nucleotide sequence of the present invention. The same is true for the term "fused" in relation to the present invention which includes direct or indirect attachment.
1060 In some cases, the terms do not cover the natural combination of the nucleotide sequence coding for the protein ordinarily associated with the wild type gene promoter and when they are both in their natural environment.
The construct may even contain or express a marker, which allows for the selection of 1065 the genetic construct.
For some applications, preferably the construct of the present invention comprises at least the nucleotide sequence of the present invention operably linked to a promoter.
1070 HOST CELLS
The term "host cell" - in relation to the present invention includes any cell that comprises either the nucleotide sequence or an expression vector as described above and which is used in the recombinant production of an enzyme having the specific 1075 properties as defined herein.
Thus, a further embodiment of the present invention provides host cells transformed or transfected with a nucleotide sequence that expresses the enzyme of the present invention. The cells will be chosen to be compatible with the said vector and may for 1080 example be prokaryotic (for example bacterial), fungal, yeast or plant cells. Preferably, the host cells are not human cells.
Examples of suitable bacterial host organisms are gram positive or gram negative bacterial species. 1085 Depending on the nature of the nucleotide sequence encoding the enzyme of the present invention, and/or the desirability for further processing of the expressed protein, eukaryotic hosts such as yeasts or other fungi may be preferred. In general, yeast cells are preferred over fungal cells because they are easier to manipulate. 1090 However, some proteins are either poorly secreted from the yeast cell, or in some cases are not processed properly (e.g. hyperglycosylation in yeast). In these instances, a different fungal host organism should be selected.
The use of suitable host cells - such as yeast, fungal and plant host cells - may provide 1095 for post-translational modifications (e.g. myristoylation, glycosylation, truncation, lapidation and tyrosine, serine or threonine phosphorylation) as may be needed to confer optimal biological activity on recombinant expression products of the present invention.
1100 The host cell may be a protease deficient or protease minus strain.
ORGANISM
The term "organism" in relation to the present invention includes any organism that 1105 could comprise the nucleotide sequence coding for the enzyme according to the present invention and/or products obtained therefrom, and/or wherein a promoter can allow expression of the nucleotide sequence according to the present invention when present in the organism.
1110 Suitable organisms may include a prokaryote, fungus, yeast or a plant.
The term "transgenic organism" in relation to the present invention includes any organism that comprises the nucleotide sequence coding for the enzyme according to the present invention and/or the products obtained therefrom, and/or wherein a promoter can 1115 allow expression of the nucleotide sequence according to the present invention within the organism. Preferably the nucleotide sequence is incorporated in the genome of the organism.
The term "transgenic organism" does not cover native nucleotide coding sequences in
1120 their natural environment when they are under the control of their native promoter which is also in its natural environment.
Therefore, the transgenic organism of the present invention includes an organism comprising any one of, or combinations of, the nucleotide sequence coding for the 1125 enzyme according to the present invention, constructs according to the present invention, vectors according to the present invention, plasmids according to the present invention, cells according to the present invention, tissues according to the present invention, or the products thereof.
1130 For example the transgenic organism may also comprise the nucleotide sequence coding for the enzyme of the present invention under the control of a heterologous promoter.
TRANSFORMATION OF HOST CELLS/ORGANISM 1135 As indicated earlier, the host organism can be a prokaryotic or a eukaryotic organism. Examples of suitable prokaryotic hosts include E. coli and Bacillus subtilis.
Teachings on the transformation of prokaryotic hosts is well documented in the art, for example see Sa brook et al (Molecular Cloning: A Laboratory Manual, 2nd 1140 edition, 1989, Cold Spring Harbor Laboratory Press). If a prokaryotic host is used then the nucleotide sequence may need to be suitably modified before transformation - such as by removal of introns.
Filamentous fungi cells may be transformed using various methods known in the art - 1145 such as a process involving protoplast formation and transformation of the protoplasts followed by regeneration of the cell wall in a manner known. The use of Aspergillus as a host microorganism is described in EP 0 238 023.
Another host organism can be a plant. A review of the general techniques used for 1150 transforming plants may be found in articles by Potrykus (Annu Rev Plant Physiol Plant Moi Biol [1991] 42:205-225) and Christou (Agro-Food-Industry Hi-Tech March/April 1994 17-27). Further teachings on plant transformation may be found in EP-A-0449375.
1155 General teachings on the transformation of fungi, yeasts and plants are presented in following sections.
TRANSFORMED FUNGUS
1160 A host organism may be a fungus - such as a filamentous fungus. Examples of suitable such hosts include any member belonging to the genera Thermomyces, Acremonium, Aspergillus, Penicillium, Mucor, Neurospora, Trichoderma and the like.
Teachings on transforming filamentous fungi are reviewed in US-A-5741665 which 1165 states that standard techniques for transformation of filamentous fungi and culturing the fungi are well known in the art. An extensive review of techniques as applied to N. crassa is found, for example in Davis and de Serres, Methods Enzymol (1971) 17A: 79-143.
1170 Further teachings on transforming filamentous fungi are reviewed in US-A-5674707.
In one aspect, the host organism can be of the genus Aspergillus, such as Aspergillus niger.
1175 A transgenic Aspergillus according to the present invention can also be prepared by following, for example, the teachings of Turner G. 1994 (Vectors for genetic manipulation. In: Martinelli S.D., Kinghorn J.R.( Editors) Aspergillus: 50 years on. Progress in industrial microbiology vol 29. Elsevier Amsterdam 1994. pp. 641-666).
1180 Gene expression in filamentous fungi has been reviewed in Punt et al. (2002) Trends Biotechnol 2002 May;20(5):200-6, Archer & Peberdy Crit Rev Biotechnol (1997) 17(4):273-306. TRANSFORMED YEAST
1185
In another embodiment, the transgenic organism can be a yeast.
A review of the principles of heterologous gene expression in yeast are provided in, for example, Methods Moi Biol (1995), 49:341-54, and Curr Opin Biotechnol (1997) 1190 Oct;8(5):554-60
In this regard, yeast- such as the species Saccharomyces cerevisi or Pichia pastoris (see FEMS Microbiol Rev (2000 24(l):45-66), may be used as a vehicle for heterologous gene expression.
1195
A review of the principles of heterologous gene expression in Saccharomyces cerevisiae and secretion of gene products is given by E Hinchcliffe E Kenny (1993, "Yeast as a vehicle for the expression of heterologous genes", Yeasts, Vol 5, Anthony H Rose and J Stuart Harrison, eds, 2nd edition, Academic Press Ltd.).
1200
For the transformation of yeast, several transformation protocols have been developed. For example, a transgenic Saccharomyces according to the present mvention can be prepared by following the teachings of Hinnen et al., (1978, Proceedings of the National Academy .of Sciences- of the USA 75, 1929); Beggs, J D (1978, Nature, London, 275, 1205 104); and Ito, H et al (1983,J Bacteriology 153, 163-168).
The transformed yeast cells may be selected using various selective markers - such as auxotrophic markers dominant antibiotic resistance markers.
1210 TRANSFORMED PLANTS/PLANT CELLS
A host organism suitable for the present invention may be a plant. A review of the general techniques may be found in articles by Potrykus (Annu Rev Plant Physiol Plant Moi Biol [1991] 42:205-225) and Christou (Agro-Food-Industry Hi-Tech March/April 1215 1994 17-27).
CULTURING ANDPRODUCTION
Host cells transformed with the nucleotide sequence of the present invention may be 1220 cultured under conditions conducive to the production of the encoded enzyme and which facilitate recovery of the enzyme from the cells and/or culture medium.
The medium used to cultivate the cells may be any conventional medium suitable for growing the host cell in questions and obtaining expression of the enzyme.
1225
The protein produced by a recombinant cell may be displayed on the surface of the cell.
The enzyme may be secreted from the host cells and may conveniently be recovered 1230 from the culture medium using well-known procedures. SECRETION
Often, it is desirable for the enzyme to be secreted from the expression host into the 1235 culture medium from where the enzyme may be more easily recovered. According to the present invention, the secretion leader sequence may be selected on the basis of the desired expression host. Hybrid signal sequences may also be used with the context of the present mvention.
1240 Typical examples of heterologous secretion leader sequences are those originating from the fungal amyloglucosidase (AG) gene (glaA - both 18 and 24 amino acid versions e.g. from Aspergillus), the a-factor gene (yeasts e.g. Saccharomyces, Kluyveromyces and Hansenula) or the α-amylase gene {Bacillus).
1245 By way of example, the secretion of heterologous proteins in E. coli is reviewed in Methods Enzymol (1990) 182:132-43.
DETECTION
1250 A variety of protocols for detecting and measuring the expression of the amino acid sequence are known in the art. Examples include enzyme-linked immunosorbent assay (ELISA), radioi munoassay (RIA) and fluorescent activated cell sorting (FACS).
1255 A wide variety of labels and conjugation techniques are known by those skilled in the art and can be used in various nucleic and amino acid assays.
A number of companies such as Pharmacia Biotech (Piscataway, NJ), Promega (Madison, WI), and US Biochemical Corp (Cleveland, OH) supply commercial kits 1260 and protocols for these procedures.
Suitable reporter molecules or labels include those radionuclides, enzymes, fluorescent, chemiluminescent, or chromogenic agents as well as substrates, cofactors, inhibitors, magnetic particles and the like. Patents teaching the use of such labels 1265 include US-A-3,817,837; US-A-3,850,752; US-A-3,939,350; US-A-3,996,345; US- A-4,277,437; US-A-4,275,149 and US-A-4,366,241.
Also, recombinant immunoglobulins may be produced as shown in US-A-4,816,567.
1270 FUSION PROTEINS
The amino acid sequence for use according to the present invention may be produced as a fusion protein, for example to aid in extraction and purification. Examples of fusion protein partners include glutathione-S-transferase (GST), 6xHis, GAL4 (DNA 1275 binding and/or transcriptional activation domains) and (β-galactosidase). It may also be convenient to include a proteolytic cleavage site between the fusion protein partner and the protein sequence of interest to allow removal of fusion protein sequences.
Preferably, the fusion protein will not hinder the activity of the protein sequence.
1280 Gene fusion expression systems in E. coli have been reviewed in Curr Opin Biotechnol (1995) 6(5):501-6.
In another embodiment of the invention, the amino acid sequence may be ligated to a 1285 heterologous sequence to encode a fusion protein. For example, for screening of peptide libraries for agents capable of affecting the substance activity, it may be useful to encode a chimeric substance expressing a heterologous epitope that is recognised by a commercially available antibody.
1290 ADDITIONAL POIs
The sequences for use according to the present invention may also be used in conjunction with one or more additional proteins of interest (POIs) or nucleotide sequences of interest (NOIs).
1295
Non-limiting examples of POIs include: proteins or enzymes involved in starch metabolism, proteins or enzymes involved in glycogen metabolism, acetyl esterases, aminopeptidases, amylases, arabinases, arabinofuranosidases, carboxypeptidases, catalases, cellulases, chitinases, chymosin, cutinase, deoxyribonucleases, epimerases,
1300 esterases, α-galactosidases, β-galactosidases, α-glucanases, glucan lysases, endo-β- glucanases, glucoamylases, glucose oxidases, α-glucosidases, β-glucosidases, glucuronidases, hemicellulases, hexose oxidases, hydrolases, invertases, isomerases, laccases, Upases, lyases, mannosidases, oxidases, oxidoreductases, pectate lyases, pectin acetyl esterases, pectin depolymerases, pectin methyl esterases, pectinolytic enzymes,
1305 peroxidases, phenoloxidases, phytases, polygalacturonases, proteases, rhamno- galacturonases, ribonucleases, thaumatin, transferases, transport proteins, transglutaminases, xylanases, hexose oxidase (D-hexose: 02-oxidoreductase, EC 1J .3.5) or combinations thereof. The NOI may even be an antisense sequence for any of those sequences.
1310
The POI may even be a fusion protein, for example to aid in extraction and purification.
The POI may even be fused to a secretion sequence. 1315
Other sequences can also facilitate secretion or increase the yield of secreted POI. Such sequences could code for chaperone proteins as for example the product of Aspergillus niger cyp B gene described in UK patent application 9821198.0.
1320 The NOI coding for POI may be engineered in order to alter their activity for a number of reasons, including but not limited to, alterations, which modify the processing and/or expression of the expression product thereof. By way of further example, the NOI may also be modified to optimise expression in a particular host cell. Other sequence changes may be desired in order to introduce restriction enzyme
1325 recognition sites.
The NOI coding for the POI may include within it synthetic or modified nucleotides- such as methylphosphonate and phosphorothioate backbones. 1330 The NOI coding for the POI may be modified to increase intracellular stability and half-life. Possible modifications include, but are not limited to, the addition of flanking sequences of the 5' and/or 3' ends of the molecule or the use of phosphorothioate or 2' O-methyl rather than phosphodiesterase linkages within the backbone of the molecule.
1335
ANTIBODIES
One aspect of the present invention relates to amino acids that are immunologically reactive with the amino acid of SEQ ID No. 1 or SEQ ID No. 3.
1340
Antibodies may be produced by standard techniques, such as by immunisation with the substance of the invention or by using phage display library.
For the purposes of this invention, the term "antibody", unless specified to the contrary, 1345 includes but is not limited to, polyclonal, monoclonal, chimeric, single chain, Fab fragments, fragments produced by a Fab expression library, as well as mimetics thereof. Such fragments include fragments of whole antibodies which retain their binding activity for a target substance, Fv, F(ab') and F(ab')2 fragments, as well as single chain antibodies (scFv), fusion proteins and other synthetic proteins which comprise 1350 the antigen-binding site of the antibody. Furthermore, the antibodies and fragments thereof may be humanised antibodies. Neutralising antibodies, i.e., those which inhibit biological activity of the substance polypeptides, are especially preferred for diagnostics and therapeutics.
1355 If polyclonal antibodies are desired, a selected mammal (e.g., mouse, rabbit, goat, horse, etc.) is immunised with the sequence of the present invention (or a sequence comprising an immunological epitope thereof). Depending on the host species, various adjuvants may be used to increase immunological response.
1360 Serum from the immunised animal is collected and treated according to known procedures. If serum containing polyclonal antibodies to the sequence of the present invention (or a sequence comprising an immunological epitope thereof) contains antibodies to other antigens, the polyclonal antibodies can be purified by immunoaffinity chromatography. Techniques for producing and processing
1365 polyclonal antisera are known in the art. In order that such antibodies may be made, the invention also provides polypeptides of the invention or fragments thereof haptenised to another polypeptide for use as immunogens in animals or humans.
Monoclonal antibodies directed against the sequence of the present invention (or a 1370 sequence comprising an immunological epitope thereof) can also be readily produced by one skilled in the art and include, but are not limited to, the hybridoma technique Koehler and Milstein (1975 Nature 256:495-497), the human B-cell hybridoma technique (Kosbor et al, (1983) Immunol Today 4:72; Cote et al, (1983) Proc Natl Acad Sci 80:2026-2030) and the EBV-hybridoma technique (Cole et al, (1985) 1375 Monoclonal Antibodies and Cancer Therapy, Alan Rickman Liss Inc, pp 77-96).
In addition, techniques developed for the production of "chimeric antibodies", the splicing of mouse antibody genes to human antibody genes to obtain a molecule with appropriate antigen specificity and biological activity may be used (Morrison et al, 1380 (1984) Proc Natl Acad Sci 81:6851-6855; Neuberger et al, (1984) Nature 312:604- 608; Takeda et al, (1985) Nature 314:452-454).
Alternatively, techniques described for the production of single chain antibodies (US Patent No. 4,946,779) can be adapted to produce the substance specific single chain 1385 antibodies.
Antibody fragments which contain specific binding sites for the substance may also be generated. For example, such fragments include, but are not limited to, the F(ab')2 fragments which can be produced by pepsin digestion of the antibody molecule and 1390 the Fab fragments which can be generated by reducing the disulfide bridges of the F(ab')2 fragments. Alternatively, Fab expression libraries may be constructed to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity (Huse WD et al, (1989) Science 256:1275-128 1).
1395 LARGE SCALE APPLICATION
In one preferred embodiment of the present invention, the amino acid sequence is used for large scale applications.
1400 Preferably the amino acid sequence is produced in a quantity of from lg per litre to about 2g per litre of the total cell culture volume after cultivation of the host organism.
Preferably the amino acid sequence is produced in a quantity of from 1 OOmg per litre 1405 to about 900mg per litre of the total cell culture volume after cultivation of the host organism.
Preferably the amino acid sequence is produced in a quantity of from 250mg per litre to about 500mg per litre of the total cell culture volume after cultivation of the host 1410 organism.
COMPOSITION
As stated above, the present invention also relates to a composition comprising 5- 1415 KGA and amino acid sequences and/or nucleotide sequences as described herein.
The composition of the present invention can lead to improved aroma, flavour, mildness, consistency, texture, body, mouth feel, firmness, viscosity, gel fracture, structure and/or organoleptic properties and nutrition of products for consumption 1420 containing said composition. Furthermore, the composition of the present invention can also be used in combination with other components of products for consumption to deliver said improvements.
Although it is preferred that the composition of the present invention is used to 1425 improve the aroma, flavour, mildness, consistency, texture, body, mouth feel, firmness, viscosity, gel fracture, structure, smoothness of the surface and/or organoleptic properties and nutrition of products for consumption containing said composition - the present invention also covers using the composition of the present invention as a component of pharmaceutical combinations with other components to 1430 deliver medical or physiological benefit to the consumer.
COMBINATION WITH OTHER COMPONENTS
Accordingly, the composition of the present invention may be used in combination 1435 with other components .
Examples of other components include one or more of: thickeners, gelling agents, emulsifiers, binders, crystal modifiers, sweetners (including artificial sweeteners), rheology modifiers, stabilisers, anti-oxidants, dyes, enzymes, carriers, vehicles, 1440 excipients, diluents, lubricating agents, flavouring agents, colouring matter, suspending agents, disintegrants, granulation binders etc. These other components may be natural. These other components may be prepared by use of chemical and/or enzymatic techniques.
1445 As used herein the term "thickener or gelling agent" as used herein refers to a product that prevents separation by slowing or preventing the movement of particles, either droplets of immiscible liquids, air or insoluble solids.
The term "stabiliser" as used here is defined as an ingredient or combination of 1450 ingredients that keeps a product (e.g. a food product) from changing over time.
The term "emulsifier" as used herein refers to an ingredient (e.g. a food product ingredient) that prevents the separation of emulsions.
1455 As used herein the term "binder" refers to an ingredient (e.g. a food ingredient) that binds the product together through a physical or chemical reaction.
The term "crystal modifier" as used herein refers to an ingredient (e.g. a food ingredient) that affects the crystallisation of either fat or water.
1460
"Carriers" or "vehicles" mean materials suitable for compound administration and include any such material known in the art such as, for example, any liquid, gel, solvent, liquid diluent, solubiliser, or the like, which is non-toxic and which does not interact with any components of the composition in a deleterious manner.
1465
Examples of nutritionally acceptable carriers include, for example, water, salt solutions, alcohol, silicone, waxes, petroleum jelly, vegetable oils, and the like.
Examples of excipients include one or more of: microcrystalline cellulose and other 1470 celluloses, lactose, sodium citrate, calcium carbonate, dibasic calcium phosphate, glycine, starch, milk sugar and high molecular weight polyethylene glycols.
Examples of disintegrants include one or more of: starch (preferably corn, potato or tapioca starch), sodium starch glycollate, croscarmellose sodium and certain complex 1475 silicates. Examples of granulation binders include one or more of: polyvinylpyrrolidone, hydroxypropylmethylcellulose (HPMC), hydroxypropylcellulose (HPC), sucrose, maltose, gelatin and acacia.
1480
Examples of lubricating agents include one or more of: magnesium stearate, stearic acid, glyceryl behenate and talc.
Examples of diluents include one or more of: water, ethanol, propylene glycol and 1485 glycerin, and combinations thereof.
The other components may be used simultaneously (e.g when they are in admixture together or even when they are delivered by different routes) or sequentially (e.g they may be delivered by different routes). 1490
Preferably, when the composition of the present invention when admixed with any other components, the lactic acid micro-organisms remain viable.
As used herein the term "component suitable for animal or human consumption" 1495 means a compound which is or can be added to the composition of the present invention as a supplement which may be of nutritional benefit, a fibre substitute or have a generally beneficial effect to the consumer.
By way of example, the components may be prebiotics such as alginate, xanthan, 1500 pectin, locust bean gum (LBG), inulin, guar gum, galacto-oligosaccharide (GOS), fructo-oligosaccharide (FOS), lactosucrose, soybean oligosaccharides, palatinose, isomalto-oligosaccharides, gluco-oligosaccharides and xylo-oligosaccharides.
FOOD
1505
The composition of the present invention may be used as - or in the preparation of - a food. Here, the term "food" is used in a broad sense - and covers food for humans as well as food for animals (i.e. a feed). In a preferred aspect, the food is for human consumption.
1510
The food may be in the from of a solution or as a solid - depending on the use and/or the mode of application and/or the mode of administration.
FOOD INGREDIENT
1515
The composition of the present invention may be used as a food ingredient.
As used herein the term "food ingredient" includes a formulation, which is or can be added to functional foods or foodstuffs and includes formulations which can be used at 1520 low levels in a wide variety of products that require, for example, acidifying or emulsifying.
The food ingredient may be in the from of a solution or as a solid - depending on the use and/or the mode of application and/or the mode of administration.
1525 FOOD SUPPLEMENTS
The composition of the present invention may be - or may be added to - food
H siuipnpnllpemmpennttss
1530 FUNCTIONAL FOODS
The composition of the present invention may be - or may be added to - functional foods.
1535
As used herein, the term "functional food" means food which is capable of providing not only a nutritional effect and/or a taste satisfaction, but is also capable of delivering a further beneficial effect to consumer.
1540 Although there is no legal definition of a functional food, most of the parties with an interest in this area agree that they are foods marketed as having specific health effects.
FOOD PRODUCTS
1545
The composition of the present invention can be used in the preparation of food products such as one or more of: confectionery products, dairy products, meat products, poultry products, fish products and bakery products.
1550 By way of example, the composition of the present invention can be used as ingredients to soft drinks, a fruit juice or a beverage comprising whey protein, health teas, cocoa drinks, milk drinks and lactic acid bacteria drinks, yoghurt, drinking yoghurt and wine.
1555 For certain aspects, preferably the foodstuff is a soft drink. For example, the composition of the present invention may be used as an acidulant to provide tartness and/or to act as a preservative.
For certain aspects, preferably the foodstuff is wine. For example, the composition of 1560 the present invention may promote graceful ageing and crispness of flavour.
For certain aspects, preferably the foodstuff is a bakery product - such as bread, Danish pastry, biscuits or cookies. By way of example, the composition of the present invention may improve the gluten, and give bakery products increased 1565 stability and a longer shelf life.
The composition of the present invention may also be used in the production of emulsifiers - such as DATEM - which is used in the production of bread and improves the properties of both the dough and the bread. DATEM is produced by esterification 1570 of mono- and diacylglycerols with mono- and diacetyltartaric acid.
For certain aspects, preferably the foodstuff is a confectionery product. By way of example, the composition of the present invention may enhance natural flavouring and or lower the pH level. Lowering the pH level may inhibit the development of 1575 micro-organisms and mould. The composition of the present invention may also act as an antioxidant for fats, as a vitamin stabiliser, or to enhance freshness and colour in the fish industry.
1580 The present invention also provides a method of preparing a food or a food ingredient, the method comprising admixing 5-KGA produced by the process of the present invention or the composition according to the present invention with another food ingredient. The method for preparing or a food ingredient is also another aspect of the present invention.
1585
PHARMACEUTICAL
The product (5-KGA and/or tartaric acid) and/or the composition according to the present invention may also be used as - or in the preparation of - a pharmaceutical. 1590 Here, the term "pharmaceutical" is used in a broad sense - and covers pharmaceuticals for humans as well as pharmaceuticals for animals (i.e. veterinary applications). In a preferred aspect, the pharmaceutical is for human use and/or for animal husbandry.
1595 The pharmaceutical can be for therapeutic purposes - which may be curative or palliative or preventative in nature. The pharmaceutical may even be for diagnostic purposes.
When used as - or in the preparation of - a pharmaceutical, the product and/or the 1600 composition of the present invention may be used in conjunction with one or more of: a pharmaceutically acceptable carrier, a pharmaceutically acceptable diluent, a pharmaceutically acceptable excipient, a pharmaceutically acceptable adjuvant, a pharmaceutically active ingredient.
1605 The pharmaceutical may be in the from of a solution or as a solid - depending on the use and/or the mode of application and/or the mode of administration.
PHARMACEUTICAL INGREDIENT
1610 The product and/or the composition of the present invention may be used as pharmaceutical ingredients. Here, the product and/or the composition of the present invention may be the sole active component or it may be at least one of a number (i.e. 2 or more) active components.
1615 The pharmaceutical ingredient may be in the from of a solution or as a solid - depending on the use and/or the mode of application and/or the mode of administration.
The pharmaceutical ingredient may be in the from of an effervescent products to 1620 improve the dissolving properties of the pharmaceutical.
CHEMICAL INDUSTRY The product and/or the composition of the present invention may also be used as a 1625 solidifier. In particular, the product and/or the composition may be used as an ■ additive to plaster/gypsum since it slows hardening thereby facilitating work.
The product and/or the composition may also be used as a splitting agent in synthetic racemic compounds to obtain optically active forms.
1630
The product and/or the composition may also be used to prevents incrustation in vinyl chloride polymerisation
FORMS
1635
The product and/or the composition of the present invention may be used in any suitable form - whether when alone or when present in a composition. Likewise, 5- KGA and/or tartaric acid ingredients of the present invention (i.e. ingredients - such as food ingredients, functional food ingredients or pharmaceutical ingredients) may be 1640 used in any suitable form.
Suitable examples of forms include one or more of: tablets, pills, capsules, ovules, solutions or suspensions, which may contain flavouring or colouring agents, for immediate-, delayed-, modified-, sustained-, pulsed- or controlled-release 1645 applications.
By way of example, if the product and/or the composition are used in a tablet form — such as for use as a functional ingredient - the tablets may also contain one or more of: excipients, disintegrants, granulation binders, or lubricating agents. 1650
Examples of nutritionally acceptable carriers for use in preparing the forms include, for example, water, salt solutions, alcohol, silicone, waxes, petroleum jelly and the like.
1655 Preferred excipients for the forms include lactose, starch, a cellulose, milk sugar or high molecular weight polyethylene glycols.
For aqueous suspensions and/or elixirs, 5-KGA and/or the composition of the present invention may be combined with various sweetening or flavouring agents, colouring 1660 matter or dyes, with emulsifying and/or suspending agents and with diluents such as water, ethanol, propylene glycol and glycerin, and combinations thereof.
The forms may also include gelatin capsules; fibre capsules, fibre tablets etc.
1665 GENERAL RECOMBINANT DNA METHODOLOGY TECHNIQUES
The present invention employs, unless otherwise indicated, conventional techniques of chemistry, molecular biology, microbiology, recombinant DNA and immunology, which are within the capabilities of a person of ordinary skill in the art. Such 1670 techniques are explained in the literature. See, for example, J. Sambrook, E. F. Fritsch, and T. Maniatis, 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Books 1-3, Cold Spring Harbor Laboratory Press; Ausubel, F. M. et al. (1995 and periodic supplements; Current Protocols in Molecular Biology, ch. 9, 13, and 16, John Wiley & Sons, New York, N.Y.); B. Roe, J. Crabtree, and A. Kahn, 1996, DNA 1675 Isolation and Sequencing: Essential Techniques, John Wiley & Sons; M. J. Gait (Editor), 1984, Oligonucleotide Synthesis: A Practical Approach, Irl Press; and, D. M. J. Lilley and J. E. Dahlberg, 1992, Methods of Enzymology: DNA Structure Part A: Synthesis and Physical Analysis of DNA Methods in Enzymology, Academic Press. Each of these general texts is herein incorporated by reference.
1680
SUMMARY
In summation, the present invention relates inter alia to the use of an amino acid sequence and a nucleotide sequence and also to a construct comprising the same.
1685
EXAMPLES
The invention is now further illustrated in the following non-limiting examples. 1690 Drawings
In the following examples reference is made to the following drawings wherein: Figure 1 is a graph;
1695 Figure 2 shows two graphs
Figure 3 is a schematic representation of one of the sequences (i.e. a sequence comprising SEQ ID No. 3 and SEQ ID No. 5) of the present invention 1700 In more detail:
Figure 1. Shows the dependence of the extraction level of GA 5-DH from the membrane fraction of G. suboxydans on «-octyl-β-D-glucoside concentration. "Total activity" is the activity of GA 5-DH in the suspension of G. suboxydans membranes 1705 before extraction
Figure 2. Shows the separation of GA 5-DH and ADH activities using native electrophoresis with 1.5 M-octyl-β-D-glucoside (Figure 2(a)) or 1.5 % n-octyl-β-D- maltoside (Figure 2(b)).
1710
Example 1
Measurement of GA 5-DH activity
The activity was measured by one of the two assays. In both assays reaction mixture 1715 contained:
• 20 μl of 200 mM sodium gluconate
• 40 μl of buffer B (100 mM sodium acetate containing 100 mM of CaCl2, 100 mM MgCl2, lOmg/ml bovine serum albumin, pH 4.1),
• 5 μL of 2 μM PQQ
1720 • 150 μl of Buffer AIOG (10 mM sodium acetate buffer, pH 4.1, 1 mM CaCl2,
1 mM MgCl2, 1% R-octyl-β-D-glucoside)
• 5 - 10 μl of a crude lysate This mixture was pre-incubated for 5 min at room temperature followed by addition 1725 of 20 μl of 100 mM K3(Fe(CN)6). Incubation was carried out at room temperature for one hour. Sometimes, longer incubation times were also used.
When the activity in crude lysates was assayed, the reaction products were detected with HPLC using Ultrapack DEAE 2 SW (LKB, Pharmacia, Sweden) column (4.6 x 1730 250 mm) equilibrated and eluted with diluted phosphoric acid (pH 2.55). Refrectometric detection was used. This method allows to discriminate between GA 5-DH activity and the activity of gluconate 2-dehydrogenase that is also present in membrane fractions of G. suboxydans (Assay 1).
1735 For assaying purified preparations of GA 5-DH, the reaction mixture additionally contained 10 μl of crude lysate of G. suboxydans inactivated in boiling water bath for 5 min. In this case, colorimetry was used instead of HPLC to monitor the progress of the reaction. 100 μl of ferric sulphate-Dupanol reagent (0.5% ferric sulphate, 0.3% SDS, 8% phosphoric acid) was added, the reaction mixture was diluted with water to
1740 2 ml and the absorption at 660 nM was measured (Assay 2).
Example 2
Cultivation of G. suboxydans for isolation of GA 5-DH
1745 The medium for cultivation of the G. suboxydans contained 1% of sodium gluconate, 1% of glucose, 0.3% of glycerol, 0.3% of yeast extract and 0.2% of peptone in tap water, pH 6.5. 500 ml of this medium in a 2 1 Erlenmeyer flask was inoculated with one colony of G. suboxydans IFO 12528 and placed onto a rotary shaker. After overnight growth (200 rpm, at 30°C) this culture was used to inoculate a 20 1
1750 fermentor containing 5 1 of the same medium. The fermentation was carried out at 30°C with aeration (2 1/min) and stirring (700 rpm) until the pH value of the cultural broth decreased to 3.65 - 3.85 (approximately 20 h). The culture broth was centrifuged at 3000 g for 35 min at 4°C. The harvested cells were washed with 1 1 of Buffer A (10 mM sodium acetate buffer, pH 4J containing 1 mM CaCl2 and 1 mM
1755 MgCl2), collected by centrifugation, re-suspended in the minimal volume of the same buffer, and lyophilised.
Example 3
Optimisation of the extraction of GA 5-DH from the membranes of G. 1760 suboxydans.
About 1.5 g of lyophilised cells of G. suboxydans obtained as described in Example 1 were suspended in 5 ml of buffer A supplemented with 1 mM β-mercaptoethanol. The suspension was sonicated at 4°C until no intact cells could be observed under
1765 microscope (four 20-second pulses on our sonicator). The material was centrifuged at 15,000 g for 30 min. Precipitate was washed with buffer A, collected by centrifugation under the same conditions and re-suspended in 10 ml of buffer A (brief sonication helps to achieve uniform suspension). Six 1ml aliquots were taken from this suspension. «-Octyl-β-D-glucoside was added to each aliquot in concentrations 0,
1770 1, 3, 5, 7 and 10% and the extraction was allowed to proceed for 6 h at 4°C. The samples were clarified by centrifugation and the activity of GA 5-DH in the supernatant analysed using Assay 1 of Example 1. One more aliquot of the membrane suspension that was not treated with detergent or centrifuged was also assayed for GA 5-DH activity. The activity of the extracted GA 5-DH was expressed 1775 as percentage of the enzyme activity in this untreated sample.
The results of this experiment clearly indicated that an unexpectedly high concentration of n-octyl-β-D-glycoside was needed for efficient extraction of GA 5- DH. These results are summarised in Figure 1. In a separate control experiment we. 1780 have. found that rc-octyl-β-D-thioglucoside was also not efficient in extracting GA 5- DH activity when used at concentrations of 1 -2%.
Example 4
Purification of GA 5-DH by ion exchange chromatography
1785
1.5 grams of the lyophilised cells of G. suboxydans prepared as described in Example 2 were suspended in 5 ml of buffer A. supplemented with 1 mM β-mercaptoethanol and disrupted by sonication as described in Example 3. The precipitate was washed with buffer A, collected by centrifugation in the same conditions and re-suspended in
1790 5 ml of buffer A containing 1% ra-octyl-β-D-glucoside. The mixture was allowed to stand for 6 hours during which time much of the contaminating membrane proteins were extracted into the supernatant while most of the GA 5-DH remained bound to the membranes. The membrane fraction was collected by centrifugation for 15 min at 15000 g and re-suspended in 5 ml of buffer A containing 10% rø-octyl-β-D-glucoside.
1795 The extraction of GA 5-DH was allowed to proceed overnight followed by centrifugation (30 min, 15000 g).
Clear supernatant was applied onto a Mono S HR 5/5 column (Pharmacia) equilibrated with buffer A. The column was washed with IM sodium chloride in 1800 buffer A followed by buffer A and buffer A containing 1% «-octyl-β-D-glucoside. GA 5-DH was eluted by a linear gradient of sodium chloride (0-1M) in buffer A containing 1% «-octyl-β-D-glucoside. The GA 5-DH activity in the eluate was assayed by the Assay 2 of Example 1.
1805 The active fractions were pooled and both alcohol dehydrogenase and GA 5-DH activity were measured (alcohol dehydrogenase activity was measured using a modification of Assay 2 wherein sodium gluconate was replaced by ethanol at the same molar concentration). The ratio of alcohol dehydrogenase to GA 5-DH activity at this stage was typically 20:1.
1810
Example 5
Optimisation of separation of GA 5-DH and alcohol dehydrogenase by preparative polyacrylamide gel electrophoresis.
1815 Discontinuous polyacrylamide gel electrophoresis system was used to separate GA 5- DH and alcohol dehydrogenase. The 2.5% stacking gel contained 100 mM potassium acetate buffer (pH 6.8) and 1.5% rc-octyl-β-D-glucoside. The 10% separation gel (0.3 xlO x 10 cm) contained 100 mM potassium acetate buffer, pH 4.3 and 1.5% n- octyl-β-D-glucoside. Tank buffer was 100 mM β-alanine - acetic acid buffer, pH 4.5.
1820 The electrophoresis was continued until the tracking dye (rhodamine B) reached the end of the separation gel. The gel was cut into slices (approximately 2 mm), each slice was crushed and the enzymes were extracted with buffer A containing 1% n- octyl-β-D-glucoside overnight. When alcohol dehydrogenase and GA 5-DH activities were measured in these extracts it was found that although the two activities 1825 are separated on the gel, the separation is incomplete and GA 5-DH was still heavily contaminated with alcohol dehydrogenase ( Figure 2 (a)). The attempts to improve the separation by using different acrylamide concentrations or alternative buffers failed until, unexpectedly, we have found that the use of 1.5% κ-octyl-β-D-maltoside instead of n-octyl-β-D-glucoside can dramatically improve the performance of the 1830 system (Figure 2 (b)). The preparation of GA 5-DH obtained by this method was essentially free of alcohol dehydrogenase and displayed a single band when analysed by polyacrylamide gel electrophoresis in the presence of sodium dodecylsulphate.
For protein sequencing, this preparation was used either directly of further purified 1835 by sodium dodecyl sulphate gel electrophoresis (SDS-PAGE, this method is well known in the art) and submitted in a form of a Coomassie-stained gel band.
Example 6
Partial amino acid sequencing of the GA 5-DH.
1840
The sequencing of the GA 5-DH preparations described in Example 5 was done at the Laboratory of Protein Chemistry (Institute of Biotechnology, University of Helsinki) as a commercial service. Briefly, the sequencing technology may be summarised as follows. The protein was alkylated, hydrolysed with trypsin and the resulting peptides
1845 separated by mass-spectrometry. This technique provides only relatively short fragments of tentative amino acid sequence (with fairly high percentage of errors). Also, some amino acid residues are either indistinguishable (isoleucine and leucine) or difficult to distinguish (valine and proline, glutamine and lysine) by mass- spectrometry. Such ambiguous amino acid residues are marked as (I/L), (V/P) and
1850 (Q/K) respectively.
The amino acid sequence fragments that were considered most useful in cloning of GA 5-DH gene are listed below.
1855 Amino acid sequence fragment 1 P(L/I)WQHP(L/T)SAAR
Amino acid sequence fragment 2 V(L/I)WQHPTT
Amino acid sequence fragment 3 YSP(L/I)SE(L/I)TP
Amino acid sequence fragment 4 WAAETTP(L/I)K
Amino acid sequence fragment 5 FVHTG(L/I)HPR
1860 Amino acid sequence fragment 6 VYHTGS
Amino acid sequence fragment 7 VAFVYHTG(L/I)
Amino acid sequence fragment 8 SAQN
Amino acid sequence fragment 9 (Q K) TFYAVAVVK
1865 Example 7
Cloning of the GA 5-DH gene.
A large number of oligonucleotide primers were designed by reverse translation of the amino acid sequences of Example 6 and used to prime PCRs with G. suboxydans 1870 DNA as the template .
The largest fragment (about 800 bp) that was obtained reproducibly (although in low yield) was primed by the oligonucleotides oGDN5-4-Ile ' (TGGGCIGCIGAGACIACICCIATNAA) and oGDN3 13-Gln 1875 (TTIACIACIGCIACIGCGTAGAAIGTYTG). oGDN5-4-He is a sense primer based on the peptide 4 (Example 6) and oGDN13-Gln is an anti-sense primer designed by reverse-translating amino acid sequence fragment 9. The 800 bp PCR fragment was cloned into the vector pCR2.1. TOPO® (Invifrogen Corp.) resulting in the plasmid pCR (GAD800) and partially sequenced (through a commercial service of MedProbe 1880 A/S, Norway). Homology searches using the BLAST service of NCBI
(l ttp://www.ncbi.nlm.nih.aov/BLAST/) clearly indicated that the PCR fragment is derived from a gene encoding a PQQ-dependent dehydrogenase.
A gene library was constructed from the chromosomal DNA of G. suboxydans using
1885 λ-ZAP vector system (Stratagene). Library construction was done using procedures well known in the art. Briefly, the chromosomal DNA was partially hydrolysed with restriction endonuclease Sau3A and a 3-5 kb fraction was isolated from the resulting
DNA fragment mixture by preparative agarose gel electrophoresis. This fraction was ligated with BamHI hydrolysed λ-ZAP® vector, the ligation mixture packaged with
1890 the Gigapack® III Gold packaging extract and used to transfect the E. coli strain
■-- XL 1 -Blue MRF'. Ligation, transfection and subsequent library manipulations has been carried out according to the manufacturer's instructions (Stratagene).
Hybridisation screening of the resulting G. suboxydans library was done using the
1895 DNA insert of the plasmid pCR (GAD800). Again, all the experimental protocols used for hybridisation screening are available from Stratagene. A number of hybridisation-positive clones was isolated and analysed by restriction mapping. Most clones contained overlapping DNA inserts matching the restriction patterns expected on the basis of known sequences of pCR (GAD800). One representative clone
1900 pBK(GAD)-8 has been subjected to double stranded sequencing (purchased from Cytomix Ltd, UK). The resulting DNA sequence (SEQ ID No 4) contained two open reading frames encoding an amino acid sequences homologous to the sequences of a number of PQQ-dependent glucose dehydrogenases (SEQ ID No 3 and SEQ ID No 5). Homology is observed between GA 5-DH gene and the gene encoding sorbitol
1905 dehydrogenase from another strain of G.suboxydans (Miyazaki T., Tomiyama N., Shinjoh M., Hoshino T. Molecular cloning and functional expression of D-sorbitol dehydrogenase from Gluconobacter suboxydans IFO 3255, which requires pyrroloquinolinequinone and hydrophobic protein SldB for activity development in E.coli. Biosci.Biotechnol.Biochem. 66(2), 262-270 (2002) ). There are no teachings
1910 in this publication for the preparation of 5-KGA or tartaric acid.
Example 8.
Expression of the GA 5-DH gene in E. coli.
1915 Plasmid pTAC has been constructed by ligating a 1.82 kb Pvul-Nrul fragment of the plasmid pKK223-3 (Pharmacia-LKB) with a 1.44 kb Pvuϊ-Pvull fragment of the plasmid pUC19. This construction scheme follows the scheme earlier used by Hibino et al, [Hibino, T., Misawa S., Wakiyama M., Maeda S., Yazaki K., Kumigai I., Ooi T. and Miura K. High-level expression of porcine muscle adenylate kinase in
1920 Escherichia coli: Effects of the copy number of the gene and the translational initiation signals. J. Biotechnol. 32, 139-148 (1994)] resulting in a high-copy number vector containing the promoter and transcription terminator signals from the plasmid pKK223-3. The larger of the two open reading frames defined in Example 7 was amplified by PCR using oligonuclotide primers oGAD5'
1925 (GAGAATTCATGCCGAATACTTATGGCAGCAGAAC) and oGAD3'
(GACTGCAGCTCGAGAAGCTTTCAGCCCTTGTGATCAGGCAGTGCG), digested with EcoRI and Hzndlll and ligated with pTAC hydrolysed with the same restriction endonucleases. Resulting vector ρTAC(GAD) was used to transfect the E. coli strain XL-Blue MRF' containing plasmid ρREP4 (Qiagen, Germany). The
1930 transformants were grown in 100 ml of LB contaimng 1% glucose to ODβoo 0.4, cells were collected by centrifugation and used to inoculate the same volume of fresh LB medium (without glucose) containing 30 mg/1 of isopropyl-β-thiogalactoside and 15μM of PQQ. The cell suspension was further incubated at 37°C with shaking for 4 hours, the cells were collected by centrifugation , washed with buffer B (Example 1)
1935 suspended in 5 ml of the same buffer containing 15μM of PQQ and disrupted by sonication. 20 μl of 10% sodium gluconate solution (pH 4.0) was added to 80 μl of this suspension and the resulting reaction mixture incubated for overnight at room temperature. An identical reaction mixture containing the cells of XL-Blue MRF' transformed with pTAC (grown and treated in exactly the same way) was used as a
1940 control. 5-ketogluconic acid was identified in the reaction mixture containing the cell extract of XL-Blue MRF' transformed with pTAC (GAD) by TLC and HPLC. No 5- ketogluconic acid was formed in the reaction mixture containing the cell extract of the control strain.
1945 It would be possible to amplify a DNA fragment comprising both open reading frames by PCR using primers oGAD5b
(GTGGAATTCATGCCGAATACTTATGGCAGCAGAAC) and oGAD 3b (GACTGCAGCTCGAGAAGCTTTCAGCCCTTGTGATCAGGCAGTGCG) and inserting the resulting DNA fargment into the plasmid pTAC as described before
1950 which my lead to an increase in production.
Example 9
Identification and cloning of GA 5-DH genes from other organisms.
1955 Now that the nucleotide sequence of GA 5-DH gene (SEQ ID No 4) has been elucidated it is possible to clone other related GA 5-DH genes based on sequence homology.
For some aspects, it may be possible to identify other GA 5-DH genes by using in 1960 silico screening using nucleotide and amino acid sequence data of GenBank and other public databases providing access to DNA and protein sequences. A preferred in silico screening method includes the use of the deduced amino acid sequence of GA 5-DH and its comparison with a set of known and deduced amino acid sequences - such as using the BLASTP service (http://www.ncbi.imu.nih. gov/BLAST/ provided 1965 by National Center for Biotechnology Information (USA) or other similar computer services.
Using similar logic, other probable GA 5-DH genes can easily be identified. Testing the functionality of such candidates is a relatively easy task requiring only the 1970 amplification of the deduced coding sequence of the gene by PCR and its expression in a suitable vector, e.g. pTAC (Example 7). New GA 5-DH genes may also be identified by conventional DNA-DNA hybridisation using low stringency conditions.
1975
Example 10 Antibody production
Antibodies are raised against the amino acid of the present invention by injecting 1980 rabbits with the purified enzyme and isolating the immunoglobulins from antiserum according to procedures described according to N Harboe and A Ingild ("Immunization, Isolation of Immunoglobulins, Estimation of Antibody Titre" In A Manual of Quantitative Immunoelectrophoresis, Methods and Applications, N H Axelsen, et al (eds.), Universitetsforlaget, Oslo, 1973) and by T G Cooper ("The 1985 Tools of Biochemistry", John Wiley & Sons, New York, 1977).
Example 11
Preparation of tartaric acid
1990 Tartaric acid may be prepared from the 5-ketogluconic acid prepared by the process of the present invention by, for example, chemical methods. One such method is disclosed in Example 1 of GB0210421.4 filed 7 May 2002. For convenience that example is now presented below:
1995 0.5 ml of a solution containing potassium 5-ketogluconate (0.5 M), 20 mg of platinum on carbon (5%) and 4.5 ml sodium carbonate buffer (0.5 M, pH 9.55) was mixed in a 25 ml Erlenmeyer flask. The flask was equipped with a loose silicon rubber stopper. The mixture was agitated using magnetic stirrer (50 min-1) at room temperature (23 °C). Samples of 300 ml were taken every day and analysed by HPLC.
2000 The products were separated on a Polyspher® OA HY column (RT 300-6.5, Merck KGaA, Germany) at 23 °C, using 10 mM HC104 as the mobile phase at a flow rate of 0.5 ml/min. Tartaric acid and 5-ketogluconic acid were measured with a UV-detector. After a period of 5 days the molar yield of tartaric acid exceeded 80%. In a control reaction without platinum catalyst, tartaric acid was formed in about 15%
2005 yield.
SUMMARY PARAGRAPHS
Aspects of the present invention will now be described by way of summary 2010 paragraphs.
1. A process for preparing 5-ketogluconic acid from gluconic acid or nontoxic salts of gluconic acid using an amino acid sequence comprising the sequence shown as SEQ ID No.1 or a variant, homologue, fragment or derivative thereof .
2015
2. A process for preparing 5-ketogluconic acid from gluconic acid or nontoxic salts thereof using an amino acid sequence comprising the sequence shown as SEQ ID No.3 or a variant, homologue, fragment or derivative thereof .
2020 3. A process for preparing 5-ketogluconic acid using a nucleotide sequence encoding the amino acid sequence according to paragraph 1 or paragraph 2. 4. A process according to paragraph 3 wherein the nucleotide sequence is shown as SEQ ID No 2 or a variant, homologue, fragment or derivative thereof.
2025
5. A process according to paragraph 3 wherein the nucleotide sequence is shown as SEQ ID No 4 or a variant, homologue, fragment or derivative thereof.
• 6. A process for preparing 5-ketogluconic acid (5-KGA) using the amino acid 2030 sequence according to any one of paragraph 1 or 2, or the expression product of the nucleotide sequence according to any one of paragraphs 3 to 5 wherein 5- KGA is optionally isolated and/or purified.
7. 5-KGA as a product produced by the process of paragraph 6.
2035
8. A process according to any one of paragraphs 1 to 6 or a product according to paragraph 7 wherein 5-ketogluconic acid is converted to tartaric acid.
9. A process for preparing tartaric acid using the amino acid sequence according to 2040 any one of paragraphJ or 2, or the expression product of the nucleotide sequence according to any one of paragraphs 3 to 5.
10. Tartaric acid as a product produced by the process of paragraphs 8 or 9.
2045 11. Tartaric acid according to paragraph 10 for use as a starting material for preparing emulsifiers.
12. A method of preparing a product for consumption comprising admixing 5-KGA produced by the process of any one of paragraphs 1-6 and/or tartaric acid
2050 produced by the process of any one of paragraphs 8 or 9 with another component so as to form said product.
13. A product for consumption according to paragraph 12 wherein the product has a beneficial therapeutic effect.
2055
14. A composition comprising 5-KGA and amino acid sequences or nucleotide sequences wherein 5-KGA is produced by the method of any one of paragraphs 1 to 6.
2060 15. An amino acid sequence comprising the sequence shown as SEQ ID NoJ or a variant, homologue, fragment or derivative thereof, wherein said amino acid sequence is used in the process of paragraph 1.
16. An amino acid sequence comprising the sequence shown as SEQ ID NoJ or a 2065 variant, homologue, fragment or derivative thereof, wherein said amino acid sequence is used in the process of paragraph 1.
17. An amino acid sequence comprising the sequence shown as SEQ ID NoJ. 2070 18. An amino acid sequence comprising the sequence shown as SEQ ID NoJ. 19. An amino acid sequence according to paragraphs 15 to 18 having gluconate 5- dehydrogenase activity.
2075 20. An amino acid sequence according to paragraphs 15 to 19 in an isolated and/or purified form.
21. A nucleotide sequence encoding an amino acid sequence according to any one of paragraphs 15 to 20, optionally being in an isolated and or purified form.
2080
22. A nucleotide sequence according to paragraph 21 wherein said nucleotide sequence comprises the sequence shown as SEQ ID NoJ or a variant, homologue, fragment or derivative thereof, wherein the nucleotide sequence is used in the process of paragraph 4, optionally being in an isolated and/or purified form.
2085
23. A nucleotide sequence according to paragraph 21 wherein said nucleotide sequence comprises the sequence shown as SEQ ID No.4 or a variant, homologue, fragment or derivative thereof, wherein the nucleotide sequence is used in the process of paragraph 5.
2090
24. A nucleotide sequence comprising the sequence shown as SEQ ID NoJ, optionally being in an isolated and/or purified form.
25. A nucleotide sequence comprising the sequence shown as SEQ ID No.4, 2095 optionally being in an isolated and/or purified form.
26. A nucleotide sequence according to any one of paragraphs 8 to 12 wherein the nucleotide sequence is obtainable from Gluconobacter suboxydans.
2100 27. A nucleotide sequence that is complementary to a nucleotide sequence according to any one of paragraphs 21 to 26 or is capable of hybridising to the nucleotide sequence according to any one of paragraphs 21 to 26 or is complementary to the hybridisable nucleotide sequence, optionally being in an isolated and/or purified form.
2105
28. A nucleotide sequence according to any one of paragraphs 21 to 27 wherein the nucleotide sequence is operably linked to a promoter.
29. A construct comprising the nucleotide sequence according to any one of 2110 paragraphs 21 to 28.
30. A vector comprising the nucleotide sequence according to any one of paragraphs 21 to 28.
2115 1. A plasmid comprising the nucleotide sequence according to any one of paragraphs 21 to 28.
32. A host cell into which has been incorporated the nucleotide sequence according to any one of paragraphs 21 to 31.
2120 33. A host cell according to paragraph 32 expressing the amino acid sequence encoded by the nucleotide sequence incorporated therein.
34. A process for preparing an amino acid sequence according to any one of 2125 paragraphs 15 to 20, comprising the steps of expressing a nucleotide sequence coding for said amino acid sequence and using said amino acid sequence in the process of any one of paragraphs 1 to 3.
35. A process according to paragraph 34 wherein the nucleotide sequence is according 2130 to any one of paragraphs 15 to 20, and wherein the amino acid sequence is optionally isolated and/or purified.
36. A process for preparing 5-ketogluconic acid and/or tartaric acid substantially as described herein and with reference to the accompanying Examples.
2135

Claims

CLAIMS2345
1. A process comprising contacting gluconic acid or a nontoxic salt of gluconic acid with an amino acid 2350 sequence; wherein said amino acid sequence comprises the sequence represented as SEQ ID NoJ or a variant, homologue, fragment or derivative thereof;
2355 wherein SEQ ID No. 1 is the sequence when determined by mass spectrometry; and wherein the gluconic acid or the nontoxic salt thereof is converted to 5- ketogluconic acid. 2360
2. A process according to claim 1 wherein said amino acid sequence comprises the sequence represented as SEQ ID NoJ or a variant, homologue, fragment or derivative thereof.
2365 3. A process according to claim 1 or claim 2 wherein said amino acid sequence comprises the sequence represented as SEQ ID NoJ.
4. A process according to any one of the preceding claims wherein said amino acid sequence further comprises the sequence shown as SEQ ID No.5 or a variant,
2370 homologue, fragment or derivative thereof .
5. A process according to any one of the preceding claims wherein said amino acid sequence further comprises the sequence shown as SEQ ID No.5.
2375 6. A process according to any one of the preceding claims wherein said 5- ketogluconic acid is isolated and/or purified.
7. A process according to any one of the preceding claims wherein the 5- ketogluconic acid is used as or in the preparation of a food or foodstuff.
2380
8. A process according to any one of the preceding claims wherein said 5- ketogluconic acid is subsequently converted to tartaric acid.
9. A process according to claim 8 wherein said tartaric acid is used as or in the 2385 preparation of a food ingredient.
10. A process for preparing 5-ketogluconic acid and/or tartaric acid substantially as described herein and with reference to the accompanying Examples.
2390
PCT/IB2002/004864 2001-11-02 2002-11-01 Sequences for the preparation of 5-ketogluconic acid from gluconic acid WO2003038105A2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2002363277A AU2002363277A1 (en) 2001-11-02 2002-11-01 Sequences for the preparation of 5-ketogluconic acid from gluconic acid

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
GB0126397A GB0126397D0 (en) 2001-11-02 2001-11-02 Sequences
GB0126397.9 2001-11-02
GB0215980A GB0215980D0 (en) 2002-07-10 2002-07-10 Sequences
GB0215980.4 2002-07-10

Publications (2)

Publication Number Publication Date
WO2003038105A2 true WO2003038105A2 (en) 2003-05-08
WO2003038105A3 WO2003038105A3 (en) 2004-01-22

Family

ID=26246734

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2002/004864 WO2003038105A2 (en) 2001-11-02 2002-11-01 Sequences for the preparation of 5-ketogluconic acid from gluconic acid

Country Status (2)

Country Link
AU (1) AU2002363277A1 (en)
WO (1) WO2003038105A2 (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE102004010786A1 (en) * 2004-03-05 2005-09-22 Technische Universität Berlin Preparation of 5-keto-D-gluconic acid, useful as intermediate for L(+)-tartaric acid, comprises culturing microorganism that has been mutated to reduce activity of gluconic acid-2-dehydrogenase
WO2006084716A1 (en) * 2005-02-11 2006-08-17 Dsm Ip Assets B.V. Gene sms 14
WO2006084715A1 (en) * 2005-02-11 2006-08-17 Dsm Ip Assets B.V. Gene sms 13
CN110591954A (en) * 2019-09-25 2019-12-20 杭州宝晶生物股份有限公司 Sphingobacterium and application and method thereof in catalytic synthesis of L (+) -tartaric acid or salt thereof

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5763656A (en) * 1994-11-10 1998-06-09 Forschungszentrum Julich Gmbh Method of preparing tartaric acid
US5804423A (en) * 1995-02-07 1998-09-08 Forschungszentrum Julich Gmbh Microbiological method of making 5-ketogluconate

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5763656A (en) * 1994-11-10 1998-06-09 Forschungszentrum Julich Gmbh Method of preparing tartaric acid
US5804423A (en) * 1995-02-07 1998-09-08 Forschungszentrum Julich Gmbh Microbiological method of making 5-ketogluconate

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
KLASEN R ET AL: "BIOCHEMICAL CHARACTERIZATION AND SEQUENCE ANALYSIS OF THE GLUCONATE:NADP 5-OXIDOREDUCTASE GENE FROM GLUCONOBACTER OXYDANS" JOURNAL OF BACTERIOLOGY, WASHINGTON, DC, US, vol. 177, no. 10, 1 May 1995 (1995-05-01), pages 2637-2643, XP002010199 ISSN: 0021-9193 cited in the application *
SHINAGAWA EMIKO ET AL: "Production of 5-keto-D-gluconate by acetic acid bacteria is catalyzed by pyrroloquinoline quinone (PQQ)-dependent membrane-bound D-gluconate dehydrogenase" JOURNAL OF MOLECULAR CATALYSIS B ENZYMATIC, vol. 6, no. 3, 11 March 1998 (1998-03-11), pages 341-350, XP002258683 ISSN: 1381-1177 cited in the application *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE102004010786A1 (en) * 2004-03-05 2005-09-22 Technische Universität Berlin Preparation of 5-keto-D-gluconic acid, useful as intermediate for L(+)-tartaric acid, comprises culturing microorganism that has been mutated to reduce activity of gluconic acid-2-dehydrogenase
WO2006084716A1 (en) * 2005-02-11 2006-08-17 Dsm Ip Assets B.V. Gene sms 14
WO2006084715A1 (en) * 2005-02-11 2006-08-17 Dsm Ip Assets B.V. Gene sms 13
CN110591954A (en) * 2019-09-25 2019-12-20 杭州宝晶生物股份有限公司 Sphingobacterium and application and method thereof in catalytic synthesis of L (+) -tartaric acid or salt thereof

Also Published As

Publication number Publication date
WO2003038105A3 (en) 2004-01-22
AU2002363277A1 (en) 2003-05-12

Similar Documents

Publication Publication Date Title
US9273295B2 (en) Mutant citrobacter freundii phytase polypeptide
EP2236601B1 (en) Phytases
EP1797178B1 (en) Citrobacter freundii phytase and homologues
JP4751877B2 (en) Fungal lipolytic enzyme
AU2004206113B8 (en) Method
JP4804284B2 (en) Use of lipid acyltransferases
CN101606647B (en) A method for the production of an emulsifier using acyltransferase
US20070259397A1 (en) Enzymes
WO2003038105A2 (en) Sequences for the preparation of 5-ketogluconic acid from gluconic acid
GB2401365A (en) Protein having polyol dehydrogenase activity
CN107410501A (en) The method for producing milk powder
Bastida et al. C-Terminal truncation of α 1, 6-fucosyltransferase from Rhizobium sp. does not annul the transferase activity of the enzyme
AU2006203065B2 (en) Method

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SD SE SG SI SK SL TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR IE IT LU MC NL PT SE SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase in:

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP