WO2003027292A2 - Regulation of human fatty acid-coa ligase-like enzyme - Google Patents
Regulation of human fatty acid-coa ligase-like enzyme Download PDFInfo
- Publication number
- WO2003027292A2 WO2003027292A2 PCT/EP2002/004282 EP0204282W WO03027292A2 WO 2003027292 A2 WO2003027292 A2 WO 2003027292A2 EP 0204282 W EP0204282 W EP 0204282W WO 03027292 A2 WO03027292 A2 WO 03027292A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- fatty acid
- enzyme
- coa ligase
- polynucleotide
- human fatty
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/93—Ligases (6)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
Definitions
- the invention relates to the regulation of human fatty acid-Co A ligase-like enzyme.
- Fatty acid CoA ligase enzymes catalyze the activation of short- and medium-chain fatty acids and xenobiotic carboxylic acids. Vessey & Hu, J. Biochem. Toxicol 10, 329-37, 1995; Vessey et al, J. Biochem. Toxicol. 11, 73-78, 1996; Vessey & Kelley,
- One embodiment of the invention is a human fatty acid-CoA ligase-like enzyme polypeptide comprising an amino acid sequence selected from the group consisting of: amino acid sequences which are at least about 61% identical to the amino acid sequence shown in SEQ ID NO: 2; and the amino acid sequence shown in SEQ ID NO: 2.
- Yet another embodiment of the invention is a method of screening for agents which decrease extracellular matrix degradation.
- a test compound is contacted with a human fatty acid-CoA ligase-like enzyme polypeptide comprising an amino acid sequence selected from the group consisting of:
- amino acid sequences which are at least about 61% identical to the amino acid sequence shown in SEQ ID NO: 2; and the amino acid sequence shown in SEQ ID NO: 2.
- Binding between the test compound and the human fatty acid-Co A ligase-like enzyme polypeptide is detected.
- a test compound which binds to the human fatty acid-CoA ligase-like enzyme polypeptide is thereby identified as a potential agent for decreasing extracellular matrix degradation.
- the agent can work by decreasing the activity of the human fatty acid-Co A ligase-like enzyme.
- Another embodiment of the invention is a method of screening for agents which decrease extracellular matrix degradation.
- a test compound is contacted with a polynucleotide encoding a human fatty acid-CoA ligase-like enzyme polypeptide, wherein the polynucleotide comprises a nucleotide sequence selected from the group consisting of:
- nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO: 1; and the nucleotide sequence shown in SEQ ID NO: 1.
- a test compound which binds to the polynucleotide is identified as a potential agent for decreasing extracellular matrix degradation.
- the agent can work by decreasing the amount of the human fatty acid-CoA ligase-like enzyme through interacting with the human fatty acid-CoA ligase-like enzyme mRNA.
- Another embodiment of the invention is a method of screening for agents which regulate extracellular matrix degradation.
- a test compound is contacted with a human fatty acid-CoA ligase-like enzyme polypeptide comprising an amino acid sequence selected from the group consisting of:
- amino acid sequences which are at least about 61% identical to the amino acid sequence shown in SEQ ID NO: 2; and the amino acid sequence shown in SEQ ID NO: 2.
- a human fatty acid-CoA ligase-like enzyme activity of the polypeptide is detected.
- a test compound which increases human fatty acid-Co A ligase-like enzyme activity of the polypeptide relative to human fatty acid-Co A ligase-like enzyme activity in the absence of the test compound is thereby identified as a potential agent for increasing extracellular matrix degradation.
- a test compound which decreases human fatty acid- Co A ligase-like enzyme activity of the polypeptide relative to human fatty acid-Co A ligase-like enzyme activity in the absence of the test compound is thereby identified as a potential agent for decreasing extracellular matrix degradation.
- Even another embodiment of the invention is a method of screening for agents which decrease extracellular matrix degradation.
- a test compound is contacted with a human fatty acid-CoA ligase-like enzyme product of a polynucleotide which comprises a nucleotide sequence selected from the group consisting of:
- nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO: 1; and the nucleotide sequence shown in SEQ ID NO: 1. Binding of the test compound to the human fatty acid-CoA ligase-like enzyme product is detected. A test compound which binds to the human fatty acid-CoA ligase-like enzyme product is thereby identified as a potential agent for decreasing extracellular matrix degradation.
- Still another embodiment of the invention is a method of reducing extracellular matrix degradation.
- a cell is contacted with a reagent which specifically binds to a polynucleotide encoding a human fatty acid-CoA ligase-like enzyme polypeptide or the product encoded by the polynucleotide, wherein the polynucleotide comprises a nucleotide sequence selected from the group consisting of:
- nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO: 1; and the nucleotide sequence shown in SEQ ID NO: 1.
- the invention thus provides a human fatty acid-CoA ligase-like enzyme that can be used to identify test compounds that may act, for example, as activators or inhibitors at the enzyme's active site.
- Human fatty acid-Co A ligase-like enzyme and fragments thereof also are useful in raising specific antibodies that can block the enzyme and effectively reduce its activity.
- Fig. 1 shows the DNA-sequence encoding a fatty acid-CoA ligase-like enzyme polypeptide (SEQ ID NO: 1).
- Fig. 2 shows the amino acid sequence deduced from the DNA-sequence of Fig.1 (SEQ ID NO: 2).
- Fig. 3 shows the amino acid sequence of the protein identified by trembl
- Fig. 4 shows the amino acid sequence of the protein identified by trembl
- Fig. 5 shows the amino acid sequence of the protein identified by swiss
- Fig. 6 shows the BLASTP - alignment of 551_protein (SEQ ID NO: 2) against
- Fig. 7 shows the BLASTP - alignment of 551_protein (SEQ ID NO: 2) against trembl
- Fig. 8 shows the BLASTP - alignment of 551_protein (SEQ ID NO: 2) against swiss
- Fig 9 shows the HMMPFAM - alignment of 55 l_protein (SEQ ID NO: 2) against pfam
- Fig 10 shows the BLASTP - alignment of 551jprotein (SEQ ID NO: 2) against pdb
- Fig. 11 shows the exon-intron structure of the fatty acid-CoA ligase-like enzyme gene.
- Fig. 12 shows the SNP search results.
- Fig. 13 shows the relative mRNA expression of a fatty acid-CoA ligase-like enzyme in tissues relevant for the pathophysiology of diabetes.
- the invention relates to an isolated polynucleotide from the group consisting of:
- amino acid sequences which are at least about 61% identical to the amino acid sequence shown in SEQ ID NO: 2; and the amino acid sequence shown in SEQ ID NO: 2.
- e a polynucleotide which represents a fragment, derivative or allelic variation of a polynucleotide sequence specified in (a) to (d) and encodes a human fatty acid-CoA ligase-like enzyme polypeptide.
- a novel fatty acid- CoA ligase-like enzyme can be used in therapeutic methods to treat cardiovascular disorders, obesity, cancer, or diabetes.
- Human fatty acid-CoA ligase-like enzyme comprises the amino acid sequence shown in SEQ ID NO: 2.
- a coding sequence for human fatty acid-CoA ligase-like enzyme is shown in SEQ ID NO: 1. This sequence is located on chromosome 16, at 16 ⁇ l2.3, part of the SA locus (16 ⁇ l3.11-12.3; see Reference 9).
- Related ESTs (BG401718);
- FIGS. 1 and 2 show two examples of BLAST hits, with Prosite AMP-binding domains highlighted and BLOCKS regions underlined.
- Human fatty acid-CoA ligase-like enzyme is 60% identical over 516 amino acids to trembl
- Human fatty acid-CoA ligase-like enzyme also is 57% identical over 516 amino acids to trembl
- the three dimensional structure is inferred by clear homology from residues 246 to 531 to luciferase (FIG. 5).
- Human fatty acid-CoA ligase-like enzyme of the invention is expected to be useful for the same purposes as previously identified fatty acid-CoA ligases. Human fatty acid-CoA ligase-like enzyme is believed to be useful in therapeutic methods to treat disorders such as cardiovascular disorders, obesity, cancer, and-diabetes. Human fatty acid-CoA ligase-like enzyme also can be used to screen for human fatty acid- Co A ligase-like enzyme activators and inhibitors. Polypeptides
- Human fatty acid-CoA ligase-like enzyme polypeptides comprise at least 6, 10, 15, 20, 25, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350 375, 400, 425, 450, 475, 500, 525, or 541 contiguous amino acids selected from the amino acid sequence shown in SEQ ID NO: 2 or a biologically active variant thereof, as defined below.
- a fatty acid-CoA ligase-like enzyme polypeptide of the invention therefore can be a portion of a fatty acid-CoA ligase-like enzyme protein, a full-length fatty acid-CoA ligase-like enzyme protein, or a fusion protein comprising all or a portion of a fatty acid-Co A ligase-like enzyme protein.
- naturally or non-naturally occurring fatty acid-CoA ligase-like enzyme polypeptide variants have amino acid sequences which are at least about 61, 65, or 70, preferably about 75, 80, 85, 90, 96, 96, 98, or 99% identical to the amino acid sequence shown in SEQ ID NO: 2 or a fragment thereof.
- Percent identity between a putative fatty acid-CoA ligase-like enzyme polypeptide variant and an amino acid sequence of SEQ ID NO: 2 is determined by conventional methods. See, for example, Altschul et al., Bull. Math. Bio. 48:603 (1986), and Henikoff and Henikoff, Proc. Natl. Acad. Sci. USA 89:10915 (1992). Briefly, two amino acid sequences are aligned to optimize the alignment scores using a gap opening penalty of 10, a gap extension penalty of 1, and the "BLOSUM62" scoring matrix of Henikoff and Henikoff (ibid.).
- the "FASTA”similarity search algorithm of Pearson and Lipman is a suitable protein alignment method for examining the level of identity shared by an amino acid sequence disclosed herein and the amino acid sequence of a putative variant.
- the trimmed initial regions are examined to determine whether the regions can be joined to for man approximate alignment with gaps.
- the highest scoring regions of the two amino acid sequences are aligned using a modification of the Needleman- Wunsch- Sellers algorithm (Needleman and Wunsch, J. Mol. Biol.48:444 (1970); Sellers, SIAM J. Appl. Math. 26:787 (1974)), which allows for amino acid insertions and deletions.
- FASTA FASTA program by modifying the scoring matrix file ("SMATRLX"), as explained in Appendix 2 of Pearson, Meth. Enzymol. 183:63 (1990).FASTA can also be used to determine the sequence identity of nucleic acid molecules using a ratio as disclosed above.
- the ktup value can range between one to six, preferably from three to six, most preferably three, with other parameters set as default.
- Variations in percent identity can be due, for example, to amino- acid substitutions, insertions, or deletions.
- Amino acid substitutions are defined as one for one amino acid replacements. They are conservative in nature when the substituted amino acid has similar structural and/or chemical properties. Examples of conservative replacements are substitution of a leucine with an isoleucine or valine, an aspartate with a glutamate, or a threonine with a serine.
- Amino acid insertions or deletions are changes to or within an amino acid sequence. They typically fall in the range of about 1 to 5 amino acids.
- DNASTAR software Whether an amino acid change results in a biologically active fatty acid-CoA ligase-like enzyme polypeptide can readily be determined by assaying for fatty acid CoA ligase activity, as described for example, in Vessey et al., J. Biochem. Mol. Toxicol. 12, 151-55, 1998.
- Fusion proteins are useful for generating antibodies against fatty acid-CoA ligase-like enzyme polypeptide amino acid sequences and for use in various assay systems. For example, fusion proteins can be used to identify proteins that interact with portions of a fatty acid-CoA ligase-like enzyme polypeptide. Protein affinity chromatography or library-based assays for protein-protein interactions, such as the yeast two-hybrid or phage display systems, can be used for this purpose. Such methods are well known in the art and also can be used as drug screens.
- a fatty acid-CoA ligase-like enzyme polypeptide fusion protein comprises two polypeptide segments fused together by means of a peptide bond.
- the first polypeptide segment comprises at least 6, 10, 15, 20, 25, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525 or 541 contiguous amino acids of SEQ ID NO: 2 or of a biologically active variant, such -as those described above.
- the first polypeptide segment also can comprise full-length fatty acid-CoA ligase-like enzyme protein.
- the second polypeptide segment can be a full-length protein or a protein fragment.
- Proteins commonly used in fusion protein construction include ⁇ -galactosidase, ⁇ - glucuronidase, green fluorescent protein (GFP), autofluorescent proteins, including blue fluorescent protein (BFP), glutathione-S-transferase (GST), luciferase, horseradish peroxidase (HRP), and chloramphenicol acetyltransferase (CAT).
- epitope tags are used in fusion protein constructions, including histidine (His) tags, FLAG tags, influenza hemagglutinin (HA) tags, Myc tags, VSV-G tags, and thioredoxin (Trx) tags.
- fusion constructions can include maltose binding protein (MBP), S-tag, Lex a DNA binding domain (DBD) fusions, GAL4 DNA binding domain fusions, and he ⁇ es simplex virus (HSV) BP16 protein fusions.
- MBP maltose binding protein
- S-tag S-tag
- GAL4 DNA binding domain
- HSV he ⁇ es simplex virus
- a fusion protein also can be engineered to contain a cleavage site located between the fatty acid-CoA ligase-like enzyme polypeptide-encoding sequence and the heterolo- gous protein sequence, so that the fatty acid-Co A ligase-like enzyme polypeptide can be cleaved and purified away from the heterologous moiety.
- a fusion protein can be synthesized chemically, as is known in the art.
- a fusion protein is produced by covalently linking two polypeptide segments or by standard procedures in the art of molecular biology.
- Recombinant DNA methods can be used to prepare fusion proteins, for example, by making a DNA construct which comprises coding sequences selected from SEQ ID NO: 1 in proper reading frame with nucleotides encoding the second polypeptide segment and expressing the DNA construct in a host cell, as is known in the art.
- Many kits for constructing fusion proteins are available from companies such as Promega Corporation (Madison, Wl),
- Species homologs of human fatty acid-CoA ligase-like enzyme polypeptide can be obtained using fatty acid-CoA ligase-like enzyme polypeptide polynucleotides
- a fatty acid-CoA ligase-like enzyme polynucleotide can be single- or double- stranded and comprises a coding sequence or the complement of a coding sequence for a fatty acid-CoA ligase-like enzyme polypeptide.
- a coding sequence for human fatty acid-Co A ligase-like enzyme is shown in SEQ ID NO: 1.
- nucleotide sequences encoding human fatty acid-CoA ligase-like enzyme polypeptides as well as homologous nucleotide sequences which are at least about 50, 55, 60, 65, 70, preferably about 75, 90, 96, 98, or 99% identical to the nucleotide sequence shown in SEQ ID NO: 1 or its complement also are fatty acid-Co A ligase- like enzyme polynucleotides. Percent sequence identity between the sequences of two polynucleotides is determined using computer programs such as ALIGN which employ the FASTA algorithm, using an affine gap search with a gap open penalty of -12 and a gap extension penalty of -2.
- cDNA Complementary DNA
- species homologs, and variants of fatty acid-CoA ligase-like enzyme polynucleotides that encode biologically active fatty acid-CoA ligase-like enzyme polypeptides also are fatty acid-CoA ligase-like enzyme polynucleotides.
- Polynucleotide fragments comprising at least 8, 9, 10, 11, 12, 15, 20, or 25 contiguous nucleotides of SEQ ID NO: 1 or its complement also are fatty acid-CoA ligase-like enzyme polynucleotides. These fragments can be used, for example, as hybridization probes or as antisense oligonucleotides.
- Variants and homologs of the fatty acid-CoA ligase-like enzyme polynucleotides described above also are fatty acid-CoA ligase-like enzyme polynucleotides.
- homologous fatty acid-CoA ligase-like enzyme polynucleotide sequences can be identified by hybridization of candidate polynucleotides to known fatty acid- CoA ligase-like enzyme polynucleotides under stringent conditions, as is known in the art. For example, using the following wash conditions ⁇ 2X SSC (0.3 M NaCl, 0.03 M sodium citrate, pH 7.0), 0.1% SDS, room temperature twice, 30 minutes each; then 2X SSC, 0.1% SDS, 50°C once, 30 minutes; then 2X SSC, room temperature twice, 10 minutes each—homologous sequences can be identified which contain at most about 25-30% basepair mismatches. More preferably, homologous nucleic acid strands contain 15-25% basepair mismatches, even more preferably 5-15% basepair mismatches.
- Species homologs of the fatty acid-Co A ligase-like enzyme polynucleotides disclosed herein also can be identified by making suitable probes or primers and screening cDNA expression libraries from other species, such as mice, monkeys, or yeast.
- Human variants of fatty acid-CoA ligase-like enzyme polynucleotides can be identified, for example, by screening human cDNA expression libraries. It is well known that the T m of a double-stranded DNA decreases by 1-1.5°C with every 1% decrease in homology (Bonner et al, J. Mol. Biol. 81, 123 (1973).
- Variants of human fatty acid-CoA ligase-like enzyme polynucleotides or fatty acid-CoA ligase- like enzyme polynucleotides of other species can therefore be identified by hybridizing a putative homologous fatty acid-CoA ligase-like enzyme polynucleotide with a polynucleotide having a nucleotide sequence of SEQ ID NO: 1 or the complement thereof to form a test hybrid.
- the melting temperature of the test hybrid is compared with the melting temperature of a hybrid comprising polynucleotides having perfectly complementary nucleotide sequences, and the number or percent of basepair mismatches within the test hybrid is calculated.
- Nucleotide sequences which hybridize to fatty acid-CoA ligase-like enzyme polynucleotides or their complements following stringent hybridization and/or wash conditions also are fatty acid-CoA ligase-like enzyme polynucleotides.
- Stringent wash conditions are well known and understood in the art and are disclosed, for example, in Sambrook et al, MOLECULAR CLONING: A LABORATORY MANUAL, 2d ed., 1989, at pages 9.50-9.51.
- T m of a hybrid between a fatty acid- CoA ligase-like enzyme polynucleotide having a nucleotide sequence shown in SEQ ID NO: 1 or the complement thereof and a polynucleotide sequence which is at least about 50, preferably about 75, 90, 96, or 98% identical to one of those nucleotide sequences can be calculated, for example, using the equation of Bolton and
- Stringent wash conditions include, for example, 4X SSC at 65°C, or 50% formamide, 4X SSC at 42°C, or 0.5X SSC, 0.1% SDS at 65°C.
- Highly stringent wash conditions include, for example, 0.2X SSC at 65°C.
- a fatty acid-CoA ligase-like enzyme polynucleotide can be isolated free of other cellular components such as membrane components, proteins, and lipids.
- Polynucleotides can be made by a cell and isolated using standard nucleic acid purification techniques, or synthesized using an amplification technique, such as the polymerase chain reaction (PCR), or by using an automatic synthesizer. Methods for isolating polynucleotides are routine and are known in the art. Any such technique for obtaining a polynucleotide can be used to obtain isolated fatty acid-CoA ligase- like enzyme polynucleotides.
- restriction enzymes and probes can be used to isolate polynucleotide fragments, which comprise fatty acid-Co A ligase-like enzyme nucleotide sequences.
- Isolated polynucleotides are in preparations that are free or at least 70, 80, or 90% free of other molecules.
- Human fatty acid-CoA ligase-like enzyme cDNA molecules can be made with standard molecular biology techniques, using fatty acid-CoA ligase-like enzyme mRNA as a template. Human fatty acid-CoA ligase-like enzyme cDNA molecules can thereafter be replicated using molecular biology techniques known in the art and disclosed in manuals such as Sambrook et al. (1989). An amplification technique, such as PCR, can be used to obtain additional copies of polynucleotides of the invention, using either human genomic DNA or cDNA as a template.
- fatty acid- CoA ligase-like enzyme polynucleotides can be synthesized using synthetic chemistry techniques to synthesize fatty acid- CoA ligase-like enzyme polynucleotides.
- the degeneracy of the genetic code allows alternate nucleotide sequences to be synthesized which will encode a fatty acid-CoA ligase-like enzyme polypeptide having, for example, an amino acid sequence shown in SEQ ID NO: 2 or a biologically active variant thereof.
- PCR-based methods can be used to extend the nucleic acid sequences disclosed herein to detect upstream sequences such as promoters and regulatory elements.
- restriction-site PCR uses universal primers to retrieve unknown sequence adjacent to a known locus (Sarkar, PCR Methods Applic. 2, 318-322, 1993). Genomic DNA is first amplified in the presence of a primer to a linker sequence and a primer specific to the known region. The amplified sequences are then subjected to a second round of PCR with the same linker primer and another specific primer internal to the first one. Products of each round of PCR are transcribed with an appropriate RNA polymerase and sequenced using reverse transcriptase.
- Inverse PCR also can be used to amplify or extend sequences using divergent primers based on a known region (Triglia et al., Nucleic Acids Res. 16, 8186, 1988).
- Primers can be designed using commercially available software, such as OLIGO 4.06 Primer Analysis software (National Biosciences Inc., Madison, Minn.), to be 22-30 nucleotides in length, to have a GC content of 50% or more, and to anneal to the target sequence at temperatures about 68-72°C.
- the method uses several restriction enzymes to generate a suitable fragment in the known region of a gene. The fragment is then circularized by intramolecular ligation and used as a PCR template.
- capture PCR involves PCR amplification of DNA fragments adjacent to a known sequence in human and yeast artificial chromosome DNA (Lagerstrom et al., PCR Methods Applic. 1, 111-119, 1991).
- multiple restriction enzyme digestions and ligations also can be used to place an engineered double-stranded sequence into an unknown fragment of the DNA molecule before performing PCR.
- Randomly-primed libraries are preferable, in that they will contain more sequences which contain the 5' regions of genes. Use of a randomly primed library may be especially preferable for situations in which an oligo d(T) library does not yield a full-length cDNA. Genomic libraries can be useful for extension of sequence into 5' non-transcribed regulatory regions.
- capillary electrophoresis systems can be used to analyze the size or confirm the nucleotide sequence of PCR or sequencing products.
- capillary sequencing can employ flowable polymers for electrophoretic separation, four different fluorescent dyes (one for each nucleotide) that are laser activated, and detection of the emitted wavelengths by a charge coupled device camera.
- Output/light intensity can be converted to electrical signal using appropriate software (e.g. GENOTYPER and Sequence NAVIGATOR, Perkin Elmer), and the entire process from loading of samples to computer analysis and electronic data display can be computer controlled.
- Capillary electrophoresis is especially preferable for the sequencing of small pieces of DNA that might be present in limited amounts in a particular sample.
- Human fatty acid-CoA ligase-like enzyme polypeptides can be obtained, for example, by purification from human cells, by expression of fatty acid-CoA ligase-like enzyme polynucleotides, or by direct chemical synthesis.
- Human fatty acid-CoA ligase-like enzyme polypeptides can be purified from any cell that expresses the polypeptide, including host cells that have been transfected with fatty acid-CoA ligase-like enzyme expression constructs.
- a purified fatty acid-CoA ligase-like enzyme polypeptide is separated from other compounds that normally associate with the fatty acid-CoA ligase-like enzyme polypeptide in the cell, such as certain proteins, carbohydrates, or lipids, using methods well-known in the art. Such methods include, but are not limited to, size exclusion chromatography, ammonium sulfate fractionation, ion exchange chromatography, affinity chromatography, and preparative gel electrophoresis.
- a preparation of purified fatty acid-CoA ligase-like enzyme polypeptides is at least 80% pure; preferably, the preparations are 90%, 95%, or 99% pure. Purity of the preparations can be assessed by any means known in the art, such as SDS-polyacrylamide gel electrophoresis. Expression of Polynucleotides
- the polynucleotide can be inserted into an expression vector that contains the necessary elements for the transcription and translation of the inserted coding sequence.
- Methods that are well known to those skilled in the art can be used to construct expression vectors containing sequences encoding fatty acid-CoA ligase-like enzyme polypeptides and appropriate transcriptional and translational control elements. These methods include in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. Such techniques are described, for example, in Sambrook et al. (1989) and in Ausubel et al, CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, N.Y., 1989.
- a variety of expression vector/host systems can be utilized to contain and express sequences encoding a fatty acid-Co A ligase-like enzyme polypeptide.
- microorganisms such as bacteria transformed with recombinant bacteriophage, plasmid, or cosmid DNA expression vectors; yeast transformed with yeast expression vectors, insect cell systems infected with virus expression vectors (e.g., baculovims), plant cell systems transformed with virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus,
- TMV TMV
- bacterial expression vectors e.g., Ti or pBR322 plasmids
- animal cell systems e.g., TMV, TMV, TMV, TMV, TMV, or with bacterial expression vectors (e.g., Ti or pBR322 plasmids), or animal cell systems.
- control elements or regulatory sequences are those non-translated regions of the vector ⁇ enhancers, promoters, 5' and 3' untranslated regions — which interact with host cellular proteins to carry out transcription and translation. Such elements can vary in their strength and specificity. Depending on the vector system and host utilized, any number of suitable transcription and translation elements, including constitutive and inducible promoters, can be used. For example, when cloning in bacterial systems, inducible promoters such as the hybrid lacZ promoter of the
- BLUESCRTPT phagemid (Stratagene, LaJolla, Calif.) or pSPORTl plasmid (Life Technologies) and the like can be used.
- the baculovims polyhedrin promoter can be used in insect cells. Promoters or enhancers derived from the genomes of plant cells (e.g., heat shock, RUBISCO, and storage protein genes) or from plant viruses (e.g., viral promoters or leader sequences) can be cloned into the vector. In mammalian cell systems, promoters from mammalian genes or from mammalian viruses are preferable.
- vectors based on SN40 or EBN can be used with an appropriate selectable marker.
- a number of expression vectors can be selected depending upon the use intended for the fatty acid-CoA ligase-like enzyme polypeptide. For example, when a large quantity of a fatty acid-Co A ligase-like enzyme polypeptide is needed for the induction of antibodies, vectors which direct high level expression of fusion proteins that are readily purified can be used. Such vectors include, but are not limited to, multifunctional E. coli cloning and expression vectors such as BLUESCRIPT (Stratagene).
- a sequence encoding the fatty acid-CoA ligase-like enzyme polypeptide can be ligated into the vector in frame with sequences for the amino-terminal Met and the subsequent 7 residues of ⁇ -galactosidase so that a hybrid protein is produced.
- pJJSf vectors Van Heeke & Schuster, J. Biol. Chem. 264, 5503-5509, 1989
- pGEX vectors Promega, Madison, Wis.
- GST glutathione S-transferase
- fusion proteins are soluble and can easily be purified from lysed cells by adso ⁇ tion to glutathione-agarose beads followed by elution in the presence of free glutathione.
- Proteins made in such systems can be designed to include heparin, thrombin, or factor Xa protease cleavage sites so that the cloned polypeptide of interest can be released from the GST moiety at will.
- yeast Saccharomyces cerevisiae a number of vectors containing constitutive or inducible promoters such as alpha factor, alcohol oxidase, and PGH can be used.
- constitutive or inducible promoters such as alpha factor, alcohol oxidase, and PGH.
- sequences encoding fatty acid- Co A ligase-like enzyme polypeptides can be driven by any of a number of promoters.
- viral promoters such as the 35S and 19S promoters of CaMV can be used alone or in combination with the omega leader sequence from TMV (Takamatsu, EMBO J. 6, 307-311, 1987).
- plant promoters such as the small subunit of RUBISCO or heat shock promoters can be used (Coruzzi et al, EMBO J. 3, 1671-1680, 1984; Broglie et al, Science 224, 838-843, 1984; Winter et al, Results Probl Cell Differ. 17, 85-105, 1991).
- constracts can be introduced into plant cells by direct DNA transformation or by pathogen-mediated transfection.
- pathogen-mediated transfection Such techniques are described in a number of generally available reviews (e.g., Hobbs or Murray, in MCGRAW HILL YEARBOOK OF SCIENCE AND TECHNOLOGY, McGraw Hill, New York, N.Y., pp. 191-196, 1992).
- An insect system also can be used to express a fatty acid-CoA ligase-like enzyme polypeptide.
- Autographa californica nuclear poly- hedrosis vims (AcNPV) is used as a vector to express foreign genes in Spodoptera frugiperda cells or in Trichoplusia larvae.
- Sequences encoding fatty acid-CoA ligase-like enzyme polypeptides can be cloned into a non-essential region of the viras, such as the polyhedrin gene, and placed under control of the polyhedrin promoter.
- fatty acid-CoA ligase-like enzyme polypeptides will render the polyhedrin gene inactive and produce recombinant virus lacking coat protein.
- the recombinant viruses can then be used to infect S. frugiperda cells or Trichoplusia larvae in which fatty acid-CoA ligase-like enzyme polypeptides can be expressed (Engelhard et al, Proc. Nat. Acad. Sci. 91, 3224-3227, 1994).
- Mammalian Expression Systems Mammalian Expression Systems
- a number of viral-based expression systems can be used to express fatty acid-CoA ligase-like enzyme polypeptides in mammalian host cells.
- sequences encoding fatty acid-CoA ligase-like enzyme polypeptides can be ligated into an adenoviras transcription/- translation complex comprising the late promoter and tripartite leader sequence. Insertion in a non-essential El or E3 region of the viral genome can be used to obtain a viable viras that is capable of expressing a fatty acid-Co A ligase-like enzyme polypeptide in infected host cells (Logan & Shenk, Proc. Natl. Acad. Sci. 81, 3655-3659, 1984).
- transcription enhancers such as the Rous sarcoma viras (RSV) enhancer, can be used to increase expression in mammalian host cells.
- RSV Rous sarcoma viras
- HACs Human artificial chromosomes
- 6M to 10M are constracted and delivered to cells via conventional delivery methods (e.g., liposomes, polycationic amino polymers, or vesicles).
- Specific initiation signals also can be used to achieve more efficient translation of sequences encoding fatty acid-CoA ligase-like enzyme polypeptides. Such signals include the ATG initiation codon and adjacent sequences. In cases where sequences encoding a fatty acid-CoA ligase-like enzyme polypeptide, its initiation codon, and upstream sequences are inserted into the appropriate expression vector, no additional transcriptional or translational control signals may be needed. However, in cases where only coding sequence, or a fragment thereof, is inserted, exogenous translational control signals (including the ATG initiation codon) should be provided. The initiation codon should be in the correct reading frame to ensure translation of the entire insert.
- Exogenous translational elements and initiation codons can be of various origins, both natural and synthetic.
- the efficiency of expression can be enhanced by the inclusion of enhancers which are appropriate for the particular cell system which is used (see Scharf et al, Results Probl Cell Differ. 20, 125-162, 1994).
- a host cell strain can be chosen for its ability to modulate the expression of the inserted sequences or to process the expressed fatty acid-CoA ligase-like enzyme polypeptide in the desired fashion.
- modifications of the polypeptide include, but are not limited to, acetylation, carboxylation, glycosylation, phosphorylation, lipidation, and acylation.
- Post-translational processing which cleaves a "prepro" form of the polypeptide also can be used to facilitate correct insertion, folding and/or function.
- Different host cells that have specific cellular machinery and characteristic mechanisms for post-translational activities e.g., CHO, HeLa, MDCK, HEK293, and WI38
- ATCC American Type Culture Collection
- Stable expression is preferred for long-term, high-yield production of recombinant proteins.
- cell lines which stably express fatty acid-CoA ligase-like enzyme polypeptides can be transformed using expression vectors which can contain viral origins of replication and/or endogenous expression elements and a selectable marker gene on the same or on a separate vector. Following the introduction of the vector, cells can be allowed to grow for 1-2 days in an enriched medium before they are switched to a selective medium. The pu ⁇ ose of the selectable marker is to confer resistance to selection, and its presence allows growth and recovery of cells which successfully express the introduced fatty acid-CoA ligase-like enzyme sequences. Resistant clones of stably transformed cells can be proliferated using tissue culture techniques appropriate to the cell type. See, for example, AN ⁇ MAL CELL CULTURE, R.I. Freshney, ed., 1986.
- Any number of selection systems can be used to recover transformed cell lines. These include, but are not limited to, the he ⁇ es simplex viras thymidine kinase (Wigler et al, Cell 11, 223-32, 1977) and adenine phosphoribosyltransferase (Lowy et al, Cell 22, 817-23, 1980) genes which can be employed in tk ' or aprf cells, respectively. Also, antimetabolite, antibiotic, or herbicide resistance can be used as the basis for selection. For example, dhfr confers resistance to methotrexate (Wigler et al, Proc. Natl. Acad. Sci.
- npt confers resistance to the aminoglycosides, neomycin and G-418 (Colbere-Garapin et al, J. Mol. Biol. 150, 1-14, 1981), and als zm ⁇ pat confer resistance to chlorsulfuron and phosphinotricin acetyltransferase, respectively (Murray, 1992, supra). Additional selectable genes have been described. For example, trpB allows cells to utilize indole in place of tryptophan, or hisD, which allows cells to utilize histinol in place of histidine (Hartman & Mulligan, Proc. Natl. Acad. Sci. 85, 8047-51, 1988).
- Visible markers such as anthocyanins, ⁇ -glucuronidase and its substrate GUS, and luciferase and its substrate luciferin, can be used to identify transformants and to quantify the amount of transient or stable protein expression attributable to a specific vector system (Rhodes et al, Methods Mol. Biol. 55, 121-131, 1995).
- marker gene expression suggests that the fatty acid-CoA ligase-like enzyme polynucleotide is also present, its presence and expression may need to be confirmed. For example, if a sequence encoding a fatty acid-CoA ligase- like enzyme polypeptide is inserted within a marker gene sequence, transformed cells containing sequences that encode a fatty acid-CoA ligase-like enzyme polypeptide can be identified by the absence of marker gene function. Alternatively, a marker gene can be placed in tandem with a sequence encoding a fatty acid-CoA ligase-like enzyme polypeptide under the control of a single promoter.
- Expression of the marker gene in response to induction or selection usually indicates expression of the fatty acid-Co A ligase-like enzyme polynucleotide.
- host cells which contain a fatty acid-CoA ligase-like enzyme polynucleotide and which express a fatty acid-CoA ligase-like enzyme polypeptide can be identified by a variety of procedures known to those of skill in the art. These procedures include, but are not limited to, DNA-DNA or DNA-RNA hybridizations and protein bioassay or immunoassay techniques that include membrane, solution, or chip-based technologies for the detection and/or quantification of nucleic acid or protein.
- the presence of a polynucleotide sequence encoding a fatty acid-CoA ligase-like enzyme polypeptide can be detected by DNA-DNA or DNA-RNA hybridization or amplification using probes or fragments or fragments of polynucleotides encoding a fatty acid-Co A ligase-like enzyme polypeptide.
- Nucleic acid amplification-based assays involve the use of oligonucleotides selected from sequences encoding a fatty acid-CoA ligase-like enzyme polypeptide to detect transformants that contain a fatty acid-CoA ligase-like enzyme polynucleotide.
- a variety of protocols for detecting and measuring the expression of a fatty acid-CoA ligase-like enzyme polypeptide, using either polyclonal or monoclonal antibodies specific for the polypeptide, are known in the art. Examples include enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), and fluorescence activated cell sorting (FACS).
- ELISA enzyme-linked immunosorbent assay
- RIA radioimmunoassay
- FACS fluorescence activated cell sorting
- a two-site, monoclonal-based immunoassay using monoclonal antibodies reactive to two non-interfering epitopes on a fatty acid-CoA ligase-like enzyme polypeptide can be used, or a competitive binding assay can be employed.
- Means for producing labeled hybridization or PCR probes for detecting sequences related to polynucleotides encoding fatty acid-CoA ligase-like enzyme polypeptides include oligolabeling, nick translation, end-labeling, or PCR amplification using a labeled nucleotide.
- sequences encoding a fatty acid-CoA ligase-like enzyme polypeptide can be cloned into a vector for the production of an mRNA probe.
- RNA probes are known in the art, are commercially available, and can be used to synthesize RNA probes in vitro by addition of labeled nucleotides and an appropriate RNA polymerase such as T7, T3, or SP6. These procedures can be conducted using a variety of commercially available kits (Amersham Pharmacia Biotech, Promega, and US Biochemical). Suitable reporter molecules or labels which can be used for ease of detection include radionuclides, enzymes, and fluorescent, chemiluminescent, or chromogenic agents, as well as substrates, cofactors, inhibitors, magnetic particles, and the like.
- Host cells transformed with nucleotide sequences encoding a fatty acid-CoA ligase- like enzyme polypeptide can be cultured under conditions suitable for the expression and recovery of the protein from cell culture.
- the polypeptide produced by a transformed cell can be secreted or contained intracellularly depending on the sequence and/or the vector used.
- expression vectors containing polynucleotides which encode fatty acid-CoA ligase- like enzyme polypeptides can be designed to contain signal sequences which direct secretion of soluble fatty acid-CoA ligase-like enzyme polypeptides through a prokaryotic or eukaryotic cell membrane or which direct the membrane insertion of membrane-bound fatty acid-CoA ligase-like enzyme polypeptide.
- purification facilitating domains include, but are not limited to, metal chelating peptides such as histidine-tryptophan modules that allow purification on immobilized metals, protein A domains that allow purification on immobilized immunoglobulin, and the domain utilized in the FLAGS extension/affinity purification system
- cleavable linker sequences such as those specific for Factor Xa or enterokinase (Invitrogen, San Diego, CA) between the purification domain and the fatty acid-CoA ligase-like enzyme polypeptide also can be used to facilitate purification.
- One such expression vector provides for expression of a fusion protein containing a fatty acid-CoA ligase-like enzyme polypeptide and 6 histidine residues preceding a thioredoxin or an enterokinase cleavage site. The histidine residues facilitate purification by IMAC (immobilized metal ion affinity chromatography, as described in Porath et al, Prot. Exp.
- enterokinase cleavage site provides a means for purifying the fatty acid- CoA ligase-like enzyme polypeptide from the fusion protein.
- Vectors that contain fusion proteins are disclosed in Kroll et al, DNA Cell Biol. 12, 441-453, 1993.
- Sequences encoding a fatty acid-CoA ligase-like enzyme polypeptide can be synthesized, in whole or in part, using chemical methods well known in the art (see
- a fatty acid-CoA ligase-like enzyme polypeptide itself can be produced using chemical methods to synthesize its amino acid sequence, such as by direct peptide synthesis using solid-phase techniques (Merrifield, J. Am. Chem. Soc. 85, 2149-2154, 1963; Roberge et al, Science 269,
- Protein synthesis can be performed using manual techniques or by automation. Automated synthesis can be achieved, for example, using Applied Materials
- Biosystems 431 A Peptide Synthesizer (Perkin Elmer).
- fragments of fatty acid-CoA ligase-like enzyme polypeptides can be separately synthesized and combined using chemical methods to produce a full-length molecule.
- the newly synthesized peptide can be substantially purified by preparative high performance liquid chromatography (e.g., Creighton, PROTEINS: STRUCTURES AND MOLECULAR PRINCIPLES, WH Freeman and Co., New York, N.Y., 1983).
- the composition of a synthetic fatty acid-Co A ligase-like enzyme polypeptide can be confirmed by amino acid analysis or sequencing (e.g., the Edman degradation procedure; see Creighton, supra). Additionally, any portion of the amino acid sequence of the fatty acid-CoA ligase-like enzyme polypeptide can be altered during direct synthesis and/or combined using chemical methods with sequences from other proteins to produce a variant polypeptide or a fusion protein.
- codons preferred by a particular prokaryotic or eukaryotic host can be selected to increase the rate of protein expression or to produce an RNA transcript having desirable properties, such as a half-life that is longer than that of a transcript generated from the naturally occurring sequence.
- nucleotide sequences disclosed herein can be engineered using methods generally known in the art to alter fatty acid-CoA ligase-like enzyme polypeptide- encoding sequences for a variety of reasons, including but not limited to, alterations which modify the cloning, processing, and/or expression of the polypeptide or mRNA product.
- DNA shuffling by random fragmentation and PCR reassembly of gene fragments and synthetic oligonucleotides can be used to engineer the nucleotide sequences.
- site-directed mutagenesis can be used to insert new restriction sites, alter glycosylation patterns, change codon preference, produce splice variants, introduce mutations, and so forth.
- Antibody as used herein includes intact immunoglobulin molecules, as well as fragments thereof, such as Fab, F(ab') 2 , and Fv, which are capable of binding an epitope of a fatty acid-CoA ligase-like enzyme polypeptide.
- Fab fragment antigen binding protein
- F(ab') 2 fragment antigen binding protein
- Fv fragment antigen binding protein binding protein
- An antibody which specifically binds to an epitope of a fatty acid-CoA ligase-like enzyme polypeptide can be used therapeutically, as well as in immunochemical assays, such as Western blots, ELISAs, radioimmunoassays, immunohistochemical assays, immunoprecipitations, or other immunochemical assays known in the art.
- immunochemical assays such as Western blots, ELISAs, radioimmunoassays, immunohistochemical assays, immunoprecipitations, or other immunochemical assays known in the art.
- Various immunoassays can be used to identify antibodies having the desired speci- ficity. Numerous protocols for competitive binding or immunoradiometric assays are well known in the art. Such immunoassays typically involve the measurement of complex formation between an immunogen and an antibody that specifically binds to the immunogen.
- an antibody which specifically binds to a fatty acid-CoA ligase-like enzyme polypeptide provides a detection signal at least 5-, 10-, or 20-fold higher than a detection signal provided with other proteins when used in an immunochemical assay.
- antibodies which specifically bind to fatty acid-CoA ligase-like enzyme polypeptides do not detect other proteins in immunochemical assays and can immunoprecipitate a fatty acid-CoA ligase-like enzyme polypeptide from solution.
- Human fatty acid-CoA ligase-like enzyme polypeptides can be used to immunize a mammal, such as a mouse, rat, rabbit, guinea pig, monkey, or human, to produce polyclonal antibodies.
- a fatty acid-CoA ligase-like enzyme polypeptide can be conjugated to a carrier protein, such as bovine serum albumin, thyroglobulin, and keyhole limpet hemocyanin.
- a carrier protein such as bovine serum albumin, thyroglobulin, and keyhole limpet hemocyanin.
- various adjuvants can be used to increase the immunological response.
- adjuvants include, but are not limited to, Freund's adjuvant, mineral gels (e.g., aluminum hydroxide), and surface active substances (e.g.
- BCG Bacilli Calmette-Guerin
- Corynebacterium parvum are especially useful.
- Monoclonal antibodies that specifically bind to a fatty acid-CoA ligase-like enzyme polypeptide can be prepared using any technique which provides for the production of antibody molecules by continuous cell lines in culture. These techniques include, but are not limited to, the hybridoma technique, the human B-cell hybridoma technique, and the EBV-hybridoma technique (Kohler et al, Nature 256, 495-497, 1985; Kozbor et al, J. Immunol. Methods 81, 31-42, 1985; Cote et al, Proc. Natl. Acad. Sci. 80, 2026-2030, 1983; Cole et al, Mol. Cell Biol. 62, 109-120, 1984).
- Monoclonal and other antibodies also can be "humanized” to prevent a patient from mounting an immune response against the antibody when it is used therapeutically.
- Such antibodies may be sufficiently similar in sequence to human antibodies to be used directly in therapy or may require alteration of a few key residues. Sequence differences between rodent antibodies and human sequences can be minimized by replacing residues which differ from those in the human sequences by site directed mutagenesis of individual residues or by grating of entire complementarity determining regions.
- humanized antibodies can be produced using recombinant methods, as described in GB2188638B.
- Antibodies that specifically bind to a fatty aoid-CoA ligase-like enzyme polypeptide can contain antigen binding sites which are either partially or fully humanized, as disclosed in U.S. 5,565,332.
- single chain antibodies can be adapted using methods known in the art to produce single chain antibodies that specifically bind to fatty acid-CoA ligase-like enzyme polypeptides.
- Antibodies with related specificity, but of distinct idiotypic composition can be generated by chain shuffling from random combinatorial immunoglobin libraries (Burton, Proc. Natl. Acad. Sci. 88, 11120-23, 1991).
- Single-chain antibodies also can be constructed using a DNA amplification method, such as PCR, using hybridoma cDNA as a template (Thirion et al, 1996, Eur. J. Cancer Prey. 5, 507-11).
- Single-chain antibodies can be mono- or bispecific, and can be bivalent or tetravalent. Construction of tetravalent, bispecific single-chain antibodies is taught, for example, in Coloma & Morrison, 1997, Nat. Biotechnol 15, 159-63. Construction of bivalent, bispecific single-chain antibodies is taught in
- a nucleotide sequence encoding a single-chain antibody can be constracted using manual or automated nucleotide synthesis, cloned into an expression construct using standard recombinant DNA methods, and introduced into a cell to express the coding sequence, as described below.
- single-chain antibodies can be produced directly using, for example, filamentous phage technology (Verhaar et al, 1995, Int. J. Cancer 61, 497-501; Nicholls et al, 1993, J. Immunol. Meth. 165, 81-91).
- Antibodies wliich specifically bind to fatty acid-CoA ligase-like enzyme polypeptides also can be produced by inducing in vivo production in the lymphocyte population or by screening immunoglobulin libraries or panels of highly specific binding reagents as disclosed in the literature (Orlandi et al, Proc. Natl. Acad. Sci. 86, 3833-3837, 1989; Winter et al, Nature 349, 293-299, 1991).
- antibodies can be constracted and used therapeutically in methods of the invention.
- chimeric antibodies can be constructed as disclosed in WO 93/03151.
- Binding proteins which are derived from immunoglobulins and which are multivalent and multispecific, such as the "diabodies" described in WO 94/13804, also can be prepared.
- Antibodies according to the invention can be purified by methods well known in the art. For example, antibodies can be affinity purified by passage over a column to which a fatty acid-CoA ligase-like enzyme polypeptide is bound. The bound antibodies can then be eluted from the column using a buffer with a high salt concentration.
- Antisense oligonucleotides are nucleotide sequences that are complementary to a specific DNA or RNA sequence. Once introduced into a cell, the complementary nucleotides combine with natural sequences produced by the cell to form complexes and block either transcription or translation. Preferably, an antisense oligonucleotide is at least 11 nucleotides in length, but can be at least 12, 15, 20, 25, 30, 35, 40, 45, or 50 or more nucleotides long. Longer sequences also can be used. Antisense oligonucleotide molecules can be provided in a DNA construct and introduced into a cell as described above to decrease the level of fatty acid-CoA ligase-like enzyme gene products in the cell.
- Antisense oligonucleotides can be deoxyribonucleotides, ribonucleotides, or a combi- nation of both. Oligonucleotides can be synthesized manually or by an automated synthesizer, by covalently linking the 5' end of one nucleotide with the 3' end of another nucleotide with non-phosphodiester internucleotide linkages such alkyl- phosphonates, phosphorothioates, phosphorodithioates, alkylphosphonothioates, alkylphosphonates, phosphoramidates, phosphate esters, carbamates, acetamidate, carboxymethyl esters, carbonates, and phosphate triesters. See Brown, Meth. Mol.
- Modifications of fatty acid-CoA ligase-like enzyme gene expression can be obtained by designing antisense oligonucleotides that will form duplexes to the control, 5', or regulatory regions of the fatty acid-CoA ligase-like enzyme gene. Oligonucleotides derived from the transcription initiation site, e.g., between positions -10 and +10 from the start site, are preferred. Similarly, inhibition can be achieved using "triple helix" base-pairing methodology. Triple helix pairing is useful because it causes inhibition of the ability of the double helix to open sufficiently for the binding of polymerases, transcription factors, or chaperons. Therapeutic advances using triplex
- An antisense oligonucleotide also can be designed to block translation of mRNA by preventing the transcript from binding to ribosomes.
- Antisense oligonucleotides which comprise, for example, 2, 3, 4, or 5 or more stretches of contiguous nucleotides which are precisely complementary to a fatty acid-Co A ligase-like enzyme polynucleotide, each separated by a stretch of contiguous nucleotides which are not complementary to adjacent fatty acid-Co A ligase-like enzyme nucleotides, can provide sufficient targeting specificity for fatty acid-CoA ligase-like enzyme mRNA.
- each stretch of complementary contiguous nucleotides is at least 4, 5, 6, 7, or 8 or more nucleotides in length.
- Non-complementary intervening sequences are preferably 1, 2,
- Antisense oligonucleotides can be modified without affecting their ability to hybridize to a fatty acid-CoA ligase-like enzyme polynucleotide. These modifications can be internal or at one or both ends of the antisense molecule.
- internucleoside phosphate linkages can be modified by adding cholesteryl or diamine moieties with varying numbers of carbon residues between the amino groups and terminal ribose.
- Modified bases and/or sugars such as arabinose instead of ribose, or a 3', 5 '-substituted oligonucleotide in which the 3' hydroxyl group or the 5' phosphate group are substituted, also can be employed in a modified antisense oligonucleotide.
- modified oligonucleotides can be prepared by methods well known in the art. See, e.g., Agrawal et al, Trends Biotechnol. 10, 152-158, 1992; Uhlmann et al, Chem. Rev. 90, 543-584, 1990; Uhlmann et al, Tetrahedron. Lett.
- Ribozymes are RNA molecules with catalytic activity. See, e.g., Cech, Science 236,
- Ribozymes can be used to inhibit gene function by cleaving an RNA sequence, as is known in the art (e.g., Haseloff et al, U.S. Patent 5,641,673).
- the mechanism of ribozyme action involves sequence-specific hybridization of the ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage. Examples include engineered hammerhead motif ribozyme molecules that can specifically and efficiently catalyze endonucleolytic cleavage of specific nucleotide sequences.
- the coding sequence of a fatty acid-CoA ligase-like enzyme polynucleotide can be used to generate ribozymes that will specifically bind to mRNA transcribed from the fatty acid-CoA ligase-like enzyme polynucleotide.
- Methods of designing and constructing ribozymes which can cleave other RNA molecules in trans in a highly sequence specific manner have been developed and described in the art (see Haseloff et al. Nature 334, 585-591, 1988).
- the cleavage activity of ribozymes can be targeted to specific RNAs by engineering a discrete "hybridization" region into the ribozyme.
- the hybridization region contains a sequence complementary to the target RNA and thus specifically hybridizes with the target (see, for example, Gerlach et al, EP 321 ,201).
- Specific ribozyme cleavage sites within a fatty acid-CoA ligase-like enzyme RNA target can be identified by scanning the target molecule for ribozyme cleavage sites which include the following sequences: GUA, GUU, and GUC. Once identified, short RNA sequences of between 15 and 20 ribonucleotides corresponding to the region of the target RNA containing the cleavage site can be evaluated for secondary stractural features which may render the target inoperable.
- RNA targets also can be evaluated by testing accessibility to hybridization with complementary oligonucleotides using ribo- nuclease protection assays. Longer complementary sequences can be used to increase the affinity of the hybridization sequence for the target.
- the hybridizing and cleavage regions of the ribozyme can be integrally related such that upon hybridizing to the target RNA through the complementary regions, the catalytic region of the ribozyme can cleave the target.
- Ribozymes can be introduced into cells as part of a DNA construct. Mechanical methods, such as microinjection, liposome-mediated transfection, electroporation, or calcium phosphate precipitation, can be used to introduce a ribozyme-containing DNA construct into cells in which it is desired to decrease fatty acid-CoA ligase-like enzyme expression. Alternatively, if it is desired that the cells stably retain the DNA construct, the construct can be supplied on a plasmid and maintained as a separate element or integrated into the genome of the cells, as is known in the art.
- a ribozyme-encoding DNA construct can include transcriptional regulatory elements, such as a promoter element, an enhancer or UAS element, and a transcriptional terminator signal, for controlling transcription of ribozymes in the cells.
- ribozymes can be engineered so that ribozyme expression will occur in response to factors that induce expression of a target gene. Ribozymes also can be engineered to provide an additional level of regulation, so that destruction of mRNA occurs only when both a ribozyme and a target gene are induced in the cells. Differentially Expressed Genes
- genes whose products interact with human fatty acid-CoA ligase-like enzyme may represent genes that are differentially expressed in disorders including, but not limited to, cardiovascular disorders, obesity, cancer, and diabetes.
- genes may represent genes that are differentially regulated in response to manipulations relevant to the progression or treatment of such diseases. Additionally, such genes may have a temporally modulated expression, increased or decreased at different stages of tissue or organism development. A differentially expressed gene may also have its expression modulated under control versus experimental conditions. In addition, the human fatty acid-CoA ligase-like enzyme gene or gene product may itself be tested for differential expression.
- the degree to which expression differs in a normal versus a diseased state need only be large enough to be visualized via standard characterization techniques such as differential display techniques.
- standard characterization techniques such as differential display techniques.
- Other such standard characterization techniques by which expression differences may be visualized include but are not limited to, quantitative RT (reverse transcriptase), PCR, and Northern analysis.
- Transcripts within the collected RNA samples that represent RNA produced by differentially expressed genes are identified by methods well known to those of skill in the art. They include, for example, differential screening (Tedder et al, Proc. Natl. Acad. Sci. U.S.A. 85, 208-12, 1988), subtractive hybridization (Hedrick et al, Nature 308, 149-53; Lee et al, Proc. Natl. Acad. Sci. U.S.A. 88, 2825, 1984), and, preferably, differential display (Liang & Pardee, Science 257, 967-71, 1992; U.S. Patent 5,262,311).
- the differential expression information may itself suggest relevant methods for the treatment of disorders involving the human fatty acid-CoA ligase-like enzyme.
- treatment may include a modulation of expression of the differentially expressed genes and/or the gene encoding the human fatty acid-CoA ligase-like enzyme.
- the differential expression information may indicate whether the expression or activity of the differentially expressed gene or gene product or the human fatty acid-CoA ligase-like enzyme gene or gene product are up-regulated or down- regulated.
- the invention provides assays for screening test compounds that bind to or modulate the activity of a fatty acid-CoA ligase-like enzyme polypeptide or a fatty acid-CoA ligase-like enzyme polynucleotide.
- a test compound preferably binds to a fatty acid-CoA ligase-like enzyme polypeptide or a fatty acid-CoA ligase-like enzyme polynucleotide.
- a test compound preferably binds to a fatty acid-
- CoA ligase-like enzyme polypeptide or polynucleotide More preferably, a test compound decreases or increases enzymatic activity by at least about 10, preferably about 50, more preferably about 75, 90, or 100% relative to the absence of the test compound.
- Test compounds can be pharmacologic agents already known in the art or can be compounds previously unknown to have any pharmacological activity.
- the com- pounds can be naturally occurring or designed in the laboratory. They can be isolated from microorganisms, animals, or plants, and can be produced recombinantly, or synthesized by chemical methods known in the art. If desired, test compounds can be obtained using any of the numerous combinatorial library methods known in the art, including but not limited to, biological libraries, spatially addressable parallel solid phase or solution phase libraries, synthetic library methods requiring deconvolution, the "one-bead one-compound” library method, and synthetic library methods using affinity chromatography selection.
- the biological library approach is limited to polypeptide libraries, while the other four approaches are applicable to polypeptide, non-peptide oligomer, or small molecule libraries of compounds. See Lam, Anticancer Drug Des. 12, 145, 1997.
- Test compounds can be screened for the ability to bind to fatty acid-CoA ligase-like enzyme polypeptides or polynucleotides or to affect fatty acid-CoA ligase-like enzyme activity or fatty acid-CoA ligase-like enzyme gene expression using high throughput screening.
- high throughput screening many discrete compounds can be tested in parallel so that large numbers of test compounds can be quickly screened.
- the most widely established techniques utilize 96-well microtiter plates. The wells of the microtiter plates typically require assay volumes that range from 50 to 500 ⁇ l.
- many instruments, materials, pipettors, robotics, plate washers, and plate readers are commercially available to fit the 96-well format.
- free format assays or assays that have no physical barrier between samples, can be used.
- an assay using pigment cells (melanocytes) in a simple homogeneous assay for combinatorial peptide libraries is described by
- Chelsky placed a simple homogenous enzyme assay for carbonic anhydrase inside an agarose gel such that the enzyme in the gel would cause a color change throughout the gel. Thereafter, beads carrying combinatorial compounds via a photolinker were placed inside the gel and the compounds were partially released by UV-light. Compounds that inhibited the enzyme were observed as local zones of inhibition having less color change. Yet another example is described by Salmon et al, Molecular Diversity 2, 57-63 (1996). In this example, combinatorial libraries were screened for compounds that had cytotoxic effects on cancer cells growing in agar.
- test samples are placed in a porous matrix.
- One or more assay components are then placed within, on top of, or at the bottom of a matrix such as a gel, a plastic sheet, a filter, or other form of easily manipulated solid support.
- a matrix such as a gel, a plastic sheet, a filter, or other form of easily manipulated solid support.
- the test compound is preferably a small molecule that binds to and occupies, for example, the active site of the fatty acid-CoA ligase-like enzyme polypeptide, such that normal biological activity is prevented.
- small molecules include, but are not limited to, small peptides or peptide-like molecules.
- either the test compound or the fatty acid-CoA ligase-like enzyme polypeptide can comprise a detectable label, such as a fluorescent, radioisotopic, chemiluminescent, or enzymatic label, such as horseradish peroxidase, alkaline phosphatase, or luciferase.
- a detectable label such as a fluorescent, radioisotopic, chemiluminescent, or enzymatic label, such as horseradish peroxidase, alkaline phosphatase, or luciferase.
- Detection of a test compound that is bound to the fatty acid-CoA ligase-like enzyme polypeptide can then be accomplished, for example, by direct counting of radioemmission, by scintillation counting, or by determining conversion of an appropriate substrate to a detectable product.
- binding of a test compound to a fatty acid-CoA ligase-like enzyme polypeptide can be determined without labeling either of the interactants.
- a microphysiometer can be used to detect binding of a test compound with a fatty acid-Co A ligase-like enzyme polypeptide.
- a microphysiometer e.g., CytosensorTM
- a microphysiometer is an analytical instrument that measures the rate at which a cell acidifies its environment using a light-addressable potentiometric sensor (LAPS). Changes in this acidification rate can be used as an indicator of the interaction between a test compound and a fatty acid-CoA ligase-like enzyme polypeptide
- Determining the ability of a test compound to bind to a fatty acid-CoA ligase-like enzyme polypeptide also can be accomplished using a technology such as real-time Bimolecular Interaction Analysis (BIA) (Sjolander & Urbaniczky, Anal. Chem. 63,
- BIA is a technology for studying biospecific interactions in real time, without labeling any of the interactants (e.g., BIAcoreTM). Changes in the optical phenomenon surface plasmon resonance (SPR) can be used as an indication of real-time reactions between biological molecules.
- SPR surface plasmon resonance
- a fatty acid-CoA ligase-like enzyme polypeptide can be used as a "bait protein" in a two-hybrid assay or three-hybrid assay (see, e.g., U.S. Patent 5,283,317; Zervos et al, Cell 72, 223-232, 1993; Madura et al, J. Biol. Chem. 268, 12046-12054, 1993; Bartel et al, BioTechniques 14, 920-924,
- the two-hybrid system is based on the modular nature of most transcription factors, which consist of separable DNA-binding and activation domains.
- the assay utilizes two different DNA constructs.
- polynucleotide encoding a fatty acid-CoA ligase-like enzyme polypeptide can be fused to a polynucleotide encoding the DNA binding domain of a known transcription factor (e.g., GAL-4).
- a DNA sequence that encodes an unidentified protein (“prey" or "sample” can be fused to a polynucleotide that codes for the activation domain of the known transcription factor.
- the DNA-binding and activation domains of the transcription factor are brought into close proximity. This proximity allows transcription of a reporter gene (e.g., LacZ), which is operably linked to a transcriptional regulatory site responsive to the transcription factor. Expression of the reporter gene can be detected, and cell colonies containing the functional transcription factor can be isolated and used to obtain the DNA sequence encoding the protein that interacts with the fatty acid-CoA ligase-like enzyme polypeptide.
- a reporter gene e.g., LacZ
- fatty acid-CoA ligase-like enzyme polypeptide or polynucleotide
- test compound can be bound to a solid support.
- Suitable solid supports include, but are not limited to, glass or plastic slides, tissue culture plates, microtiter wells, tubes, silicon chips, or particles such as beads (including, but not limited to, latex, polystyrene, or glass beads). Any method known in the art can be used to attach the enzyme polypeptide (or polynucleotide) or test compound to a solid support, including use of covalent and non-covalent linkages, passive abso ⁇ tion, or pairs of binding moieties attached respectively to the polypeptide (or polynucleotide) or test compound and the solid support. Test compounds are preferably bound to the solid support in an array, so that the location of individual test compounds can be tracked.
- Binding of a test compound to a fatty acid-CoA ligase-like enzyme polypeptide (or polynucleotide) can be accomplished in any vessel suitable for containing the reactants.
- suitable vessels include microtiter plates, test tubes, and microcentrifuge tubes.
- the fatty acid-CoA ligase-like enzyme polypeptide is a fusion protein comprising a domain that allows the fatty acid-CoA ligase-like enzyme polypeptide to be bound to a solid support.
- glutathione-S-transferase fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis, Mo.) or glutathione derivatized microtiter plates, which are then combined with the test compound or the test compound and the non-adsorbed fatty acid-CoA ligase-like enzyme polypeptide; the mixture is then incubated under conditions conducive to complex formation (e.g., at physiological conditions for salt and pH).
- Binding of the interactants can be determined either directly or indirectly, as described above. Alternatively, the complexes can be dissociated from the solid support before binding is determined.
- fatty acid- CoA ligase-like enzyme polypeptide or polynucleotide
- test compound can be immobilized utilizing conjugation of biotin and streptavidin.
- Biotinylated fatty acid- CoA ligase-like enzyme polypeptides (or polynucleotides) or test compounds can be prepared from biotin-NHS(N-hydroxysuccinimide) using techniques well known in the art (e.g., biotinylation kit, Pierce Chemicals, Rockford, 111.) and immobilized in the wells of streptavidin-coated 96 well plates (Pierce Chemical).
- antibodies which specifically bind to a fatty acid-CoA ligase-like enzyme poly- peptide, polynucleotide, or a test compound, but which do not interfere with a desired binding site, such as the active site of the fatty acid-CoA ligase-like enzyme polypeptide can be derivatized to the wells of the plate. Unbound target or protein can be trapped in the wells by antibody conjugation.
- GST-immobilized complexes include immunodetection of complexes using antibodies which specifically bind to the fatty acid-CoA ligase-like enzyme polypeptide or test compound, enzyme-linked assays which rely on detecting an activity of the fatty acid-CoA ligase-like enzyme polypeptide, and SDS gel electrophoresis under non-reducing conditions. Screening for test compounds which bind to a fatty acid-CoA ligase-like enzyme polypeptide or polynucleotide also can be carried out in an intact cell. Any cell which comprises a fatty acid-CoA ligase-like enzyme polypeptide or polynucleotide can be used in a cell-based assay system.
- a fatty acid-CoA ligase-like enzyme polynucleotide can be naturally occurring in the cell or can be introduced using techniques such as those described above. Binding of the test compound to a fatty acid-CoA ligase-like enzyme polypeptide or polynucleotide is determined as described above.
- Test compounds can be tested for the ability to increase or decrease the enzymatic activity of a human fatty acid-CoA ligase-like enzyme polypeptide. Enzymatic activity can be measured, for example, as described in Vessey et al, J. Biochem. Mol. Toxicol. 12, 151-55, 1998.
- Enzyme assays can be carried out after contacting either a purified fatty acid-CoA ligase-like enzyme polypeptide, a cell membrane preparation, or an intact cell with a test compound.
- a test compound that decreases an enzymatic activity of a fatty acid- CoA ligase-like enzyme polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% is identified as a potential therapeutic agent for decreasing fatty acid-CoA ligase-like enzyme activity.
- a test compound which increases an enzymatic activity of a human fatty acid-CoA ligase-like enzyme polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% is identified as a potential therapeutic agent for increasing human fatty acid-
- test compounds that increase or decrease fatty acid-CoA ligase-like enzyme gene expression are identified.
- a fatty acid-CoA ligase-like enzyme polynucleotide is contacted with a test compound, and the expression of an RNA or polypeptide product of the fatty acid-CoA ligase-like enzyme polynucleotide is determined.
- the level of expression of appropriate mRNA or polypeptide in the presence of the test compound is compared to the level of expression of mRNA or polypeptide in the absence of the test compound.
- the test compound can then be identified as a modulator of expression based on this comparison.
- test compound when expression of mRNA or polypeptide is greater in the presence of the test compound than in its absence, the test compound is identified as a stimulator or enhancer of the mRNA or polypeptide expression.
- test compound when expression of the mRNA or polypeptide is less in the presence of the test compound than in its absence, the test compound is identified as an inhibitor of the mRNA or polypeptide expression.
- the level of fatty acid-CoA ligase-like enzyme mRNA or polypeptide expression in the cells can be determined by methods well known in the art for detecting mRNA or polypeptide. Either qualitative or quantitative methods can be used.
- the presence of polypeptide products of a fatty acid-CoA ligase-like enzyme polynucleotide can be determined, for example, using a variety of techniques known in the art, including immunochemical methods such as radioimmunoassay, Western blotting, and immunohistochemistry.
- polypeptide synthesis can be dete ⁇ nined in vivo, in a cell culture, or in an in vitro translation system by detecting inco ⁇ oration of labeled amino acids into a fatty acid-Co A ligase-hke enzyme polypeptide.
- Such screening can be carried out either in a cell-free assay system or in an intact cell.
- Any cell that expresses a fatty acid-CoA ligase-hke enzyme polynucleotide can be used in a cell-based assay system.
- the fatty acid-CoA ligase-like enzyme polynucleotide can be naturally occurring in the cell or can be introduced using techniques such as those described above.
- Either a primary culture or an established cell line, such as CHO or human embryonic kidney 293 cells, can be used.
- compositions of the invention can comprise, for example, a fatty acid-CoA ligase-like enzyme polypeptide, fatty acid-CoA ligase-like enzyme polynucleotide, ribozymes or antisense oligonucleotides, antibodies which specifically bind to a fatty acid-CoA ligase-like enzyme polypeptide, or mimetics, activators, or inhibitors of a fatty acid-CoA ligase- like enzyme polypeptide activity.
- compositions can be administered alone or in combination with at least one other agent, such as stabilizing compound, which can be administered in any sterile, biocompatible pharmaceutical carrier, including, but not limited to, saline, buffered saline, dextrose, and water.
- agent such as stabilizing compound
- the compositions can be administered to a patient alone, or in combination with other agents, drags or hormones.
- compositions of the invention can be administered by any number of routes including, but not limited to, oral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, intraventricular, transdermal, subcutaneous, intraperitoneal, intranasal, parenteral, topical, sublingual, or rectal means.
- Pharmaceutical compositions for oral administration can be formulated using pharmaceutically acceptable carriers well known in the art in dosages suitable for oral administration. Such carriers enable the pharmaceutical compositions to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for ingestion by the patient.
- compositions for oral use can be obtained through combination of active compounds with solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores.
- Suitable excipients are carbohydrate or protein fillers, such as sugars, including lactose, sucrose, mannitol, or sorbitol; starch from corn, wheat, rice, potato, or other plants; cellulose, such as methyl cellulose, hydroxypropyhnethyl-cellulose, or sodium carboxymethylcellulose; gums including arabic and tragacanth; and proteins such as gelatin and collagen.
- disintegrating or solubilizing agents can be added, such as the cross-linked polyvinyl pyrrolidone, agar, alginic acid, or a salt thereof, such as sodium alginate.
- Dragee cores can be used in conjunction with suitable coatings, such as concentrated sugar solutions, which also can contain gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
- suitable coatings such as concentrated sugar solutions, which also can contain gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
- Dyestuffs or pigments can be added to the tablets or dragee coatings for product identification or to characterize the quantity of active compound, i.e., dosage.
- compositions that can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a coating, such as glycerol or sorbitol.
- Push-fit capsules can contain active ingredients mixed with a filler or binders, such as lactose or starches, lubricants, such as talc or magnesium stearate, and, optionally, stabilizers.
- the active compounds can be dissolved or suspended in suitable liquids, such as fatty oils, liquid, or liquid polyethylene glycol with or without stabilizers.
- compositions suitable for parenteral administration can be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks' solution, Ringer's solution, or physiologically buffered saline.
- Aqueous injection suspensions can contain substances that increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran.
- suspensions of the active compounds can be prepared as appropriate oily injection suspensions.
- Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes.
- Non-lipid polycationic amino polymers also can be used for delivery.
- the suspension also can contain suitable stabilizers or agents that increase the solubility of the compounds to allow for the preparation of highly concentrated solutions.
- penetrants appropriate to the particular barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
- compositions of the present invention can be manufactured in a manner that is known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping, or lyophilizing processes.
- the pharmaceutical composition can be provided as a salt and can be formed with many acids, including but not limited to, hydrochloric, sulfuric, acetic, lactic, tartaric, malic, succinic, etc. Salts tend to be more soluble in aqueous or other protonic solvents than are the corresponding free base forms.
- the preferred preparation can be a lyophilized powder which can contain any or all of the following: 1-50 mM histidine, 0.1%-2% sucrose, and 2-7% mannitol, at a pH range of 4.5 to 5.5, that is combined with buffer prior to use.
- compositions can be placed in an appropriate container and labeled for treatment of an indicated condition.
- labeling would include amount, frequency, and method of administration.
- Human fatty acid-CoA ligase-like enzyme can be regulated to treat cardiovascular disorders, obesity, cancer, and diabetes. Cardiovascular disorders
- Cardiovascular diseases include the following disorders of the heart and the vascular system: congestive heart failure, myocardial infarction, ischemic diseases of the heart, all kinds of atrial and ventricular arrhythmias, hypertensive vascular diseases, and peripheral vascular diseases.
- Heart failure is defined as a pathophysiologic state in which an abnormality of cardiac function is responsible for the failure of the heart to pump blood at a rate commensurate with the requirement of the metabolizing tissue. It includes all forms of pumping failure, such as high-output and low-output, acute and chronic, right-sided or left-sided, systolic or diastolic, independent of the underlying cause.
- MI Myocardial infarction
- Ischemic diseases are conditions in which the coronary flow is restricted resulting in a perfusion wliich is inadequate to meet the myocardial requirement for oxygen.
- This group of diseases includes stable angina, unstable angina, and asymptomatic ischemia.
- Arrhythmias include all forms of atrial and ventricular tachyarrhythmias (atrial tachycardia, atrial flutter, atrial fibrillation, atrio-ventricular reentrant tachycardia, preexcitation syndrome, ventricular tachycardia, ventricular flutter, and ventricular fibrillation), as well as bradycardic forms of arrhythmias.
- vascular diseases include primary as well as all kinds of secondary arterial hyper- tension (renal, endocrine, neurogenic, others).
- the disclosed gene and its product may be used as drag targets for the treatment of hypertension as well as for the prevention of all complications.
- Peripheral vascular diseases are defined as vascular diseases in which arterial and/or venous flow is reduced resulting in an imbalance between blood supply and tissue oxygen demand. It includes chronic peripheral arterial occlusive disease (PAOD), acute arterial thrombosis and embolism, inflammatory vascular disorders, Raynaud's phenomenon, and venous disorders.
- PAOD peripheral arterial occlusive disease
- acute arterial thrombosis and embolism inflammatory vascular disorders
- Raynaud's phenomenon Raynaud's phenomenon
- Obesity and overweight are defined as an excess of body fat relative to lean body mass. An increase in caloric intake or a decrease in energy expenditure or both can bring about this imbalance leading to su ⁇ lus energy being stored as fat. Obesity is associated with important medical morbidities and an increase in mortality. The causes of obesity are poorly understood and may be due to genetic factors, environmental factors or a combination of the two to cause a positive energy balance. In contrast, anorexia and cachexia are characterized by an imbalance in energy intake versus energy expenditure leading to a negative energy balance and weight loss. Agents that either increase energy expenditure and/or decrease energy intake, abso ⁇ tion or storage would be useful for treating obesity, overweight, and associated comorbidities. Agents that either increase energy intake and/or decrease energy expenditure or increase the amount of lean tissue would be useful for treating cachexia, anorexia and wasting disorders.
- This gene, translated proteins and agents which modulate this gene or portions of the gene or its products are useful for treating obesity, overweight, anorexia, cachexia, wasting disorders, appetite suppression, appetite enhancement, increases or decreases in satiety, modulation of body weight, and/or other eating disorders such as bulimia.
- this gene translated proteins and agents which modulate this gene or portions of the gene or its products are useful for treating obesity/overweight-associated comorbidities including hypertension, type 2 diabetes, coronary artery disease, hyper- lipidemia, stroke, gallbladder disease, gout, osteoarthritis, sleep apnea and respiratory problems, some types of cancer including endometrial, breast, prostate, and colon cancer, thrombolic disease, polycystic ovarian syndrome, reduced fertility, complications of pregnancy, menstrual irregularities, hirsutism, stress incontinence, and depression.
- obesity/overweight-associated comorbidities including hypertension, type 2 diabetes, coronary artery disease, hyper- lipidemia, stroke, gallbladder disease, gout, osteoarthritis, sleep apnea and respiratory problems, some types of cancer including endometrial, breast, prostate, and colon cancer, thrombolic disease, polycystic ovarian syndrome, reduced fertility, complications of pregnancy, menstrual irregularities,
- Cancer is a disease fundamentally caused by oncogenic cellular transformation. There are several hallmarks of transformed cells that distinguish them from their normal counte ⁇ arts and underlie the pathophysiology of cancer. These include uncontrolled cellular proliferation, unresponsiveness to normal death-inducing signals (immortalization), increased cellular motility and invasiveness, increased ability to recruit blood supply through induction of new blood vessel formation (angiogenesis), genetic instability, and dysregulated gene expression. Various combinations of these aberrant physiologies, along with the acquisition of drug-resistance frequently lead to an intractable disease state in which organ failure and patient death ultimately ensue.
- genomics-driven molecular target identification has opened up the possibility of identifying new cancer-specific targets for therapeutic intervention that will provide safer, more effective treatments for cancer patients.
- tumor-associated genes and their products can be tested for their role(s) in disease and used as tools to discover and develop innovative therapies.
- Genes playing important roles in any of the physiological processes outlined above can be characterized as cancer targets.
- Genes or gene fragments identified through genomics can readily be expressed in one or more heterologous expression systems to produce functional recombinant proteins. These proteins are characterized in vitro for their biochemical properties and then used as tools in high-throughput molecular screening programs to identify chemical modulators of their biochemical activities.
- Activators and/or inhibitors of target protein activity can be identified in this manner and subsequently tested in cellular and in vivo disease models for anti-cancer activity. Optimization of lead compounds with iterative testing in biological models and detailed pharmacokinetic and toxicological analyses form the basis for drag development and subsequent testing in humans.
- Diabetes mellitus is a common metabolic disorder characterized by an abnormal elevation in blood glucose, alterations in lipids and abnormalities (complications) in the cardiovascular system, eye, kidney and nervous system. Diabetes is divided into two separate diseases: type 1 diabetes (juvenile onset), which results from a loss of cells which make and secrete insulin, and type 2 diabetes (adult onset), which is caused by a defect in insulin secretion and a defect in insulin action.
- type 1 diabetes juvenile onset
- type 2 diabetes adult onset
- Type 1 diabetes is initiated by an autoimuune reaction that attacks the insulin secreting cells (beta cells) in the pancreatic islets.
- Agents that prevent this reaction from occurring or that stop the reaction before destruction of the beta cells has been accomplished are potential therapies for this disease.
- Other agents that induce beta cell proliferation and regeneration also are potential therapies.
- Type II diabetes is the most common of the two diabetic conditions (6% of the population).
- the defect in insulin secretion is an important cause of the diabetic condition and results from an inability of the beta cell to properly detect and respond to rises in blood glucose levels with insulin release.
- Therapies that increase the response by the beta cell to glucose would offer an important new treatment for this disease.
- the defect in insulin action in Type II diabetic subjects is another target for therapeutic intervention.
- Agents that increase the activity of the insulin receptor in muscle, liver, and fat will cause a decrease in blood glucose and a normalization of plasma lipids.
- the receptor activity can be increased by agents that directly stimulate the receptor or that increase the intracellular signals from the receptor.
- Other therapies can directly activate the cellular end process, i.e. glucose transport or various enzyme systems, to generate an insulin-like effect and therefore a produce beneficial outcome. Because overweight subjects have a greater susceptibility to Type II diabetes, any agent that reduces body weight is a possible therapy.
- Type I and Type diabetes can be treated with agents that mimic insulin action or that treat diabetic complications by reducing blood glucose levels.
- agents that reduces new blood vessel growth can be used to treat the eye complications that develop in both diseases.
- genomics-driven molecular target identification has opened up the possibility of identifying new cancer-specific targets for therapeutic intervention that will provide safer, more effective treatments for cancer patients.
- tumor-associated genes and their products can be tested for their role(s) in disease and used as tools to discover and develop innovative therapies.
- Genes playing important roles in any of the physiological processes outlined above can be characterized as cancer targets.
- Genes or gene fragments identified through genomics can readily be expressed in one or more heterologous expression systems to produce functional recombinant proteins. These proteins are characterized in vitro for their biochemical properties and then used as tools in high-throughput molecular screening programs to identify chemical modulators of their biochemical activities.
- Agonists and/or antagonists of target protein activity can be identified in this manner and subsequently tested in cellular and in vivo disease models for anti-cancer activity. Optimization of lead compounds with iterative testing in biological models and detailed pharmacokinetic and toxicological analyses form the basis for drug development and subsequent testing in humans.
- This invention further pertains to the use of novel agents identified by the screening assays described above. Accordingly, it is within the scope of this invention to use a test compound identified as described herein in an appropriate animal model.
- an agent identified as described herein e.g., a modulating agent, an antisense nucleic acid molecule, a specific antibody, ribozyme, or a fatty acid-CoA ligase-like enzyme polypeptide binding molecule
- an agent identified as described herein can be used in an animal model to determine the efficacy, toxicity, or side effects of treatment with such an agent.
- an agent identified as described herein can be used in an animal model to determine the mechanism of action of such an agent.
- this invention pertains to uses of novel agents identified by the above-described screening assays for treatments as described herein.
- a reagent which affects fatty acid-CoA ligase-like enzyme activity can be administered to a human cell, either in vitro or in vivo, to reduce fatty acid-CoA ligase-like enzyme activity.
- the reagent preferably binds to an expression product of a human fatty acid-CoA ligase-like enzyme gene. If the expression product is a protein, the reagent is preferably an antibody.
- an antibody can be added to a preparation of stem cells that have been removed from the body. The cells can then be replaced in the same or another human body, with or without clonal propagation, as is known in the art.
- the reagent is delivered using a liposome.
- the liposome is stable in the animal into which it has been administered for at least about
- a liposome comprises a lipid composition that is capable of targeting a reagent, particularly a polynucleotide, to a particular site in an animal, such as a human.
- the lipid composition of the liposome is capable of targeting to a specific organ of an animal, such as the lung, liver, spleen, heart brain, lymph nodes, and skin.
- a liposome useful in the present invention comprises a lipid composition that is capable of fusing with the plasma membrane of the targeted cell to deliver its contents to the cell.
- the transfection efficiency of a liposome is about
- a liposome is between about 100 and 500 nm, more preferably between about 150 and 450 nm, and even more preferably between about 200 and 400 nm in diameter.
- Suitable liposomes for use in the present invention include those liposomes standardly used in, for example, gene delivery methods known to those of skill in the art. More preferred liposomes include liposomes having a 'polycationic lipid composition and/or liposomes having a cholesterol backbone conjugated to polyethylene glycol.
- a liposome comprises a compound capable of targeting the liposome to a particular cell type, such as a cell-specific ligand exposed on the outer surface of the liposome.
- Complexing a liposome with a reagent such as an antisense oligonucleotide or ribozyme can be achieved using methods that are standard in the art (see, for example, U.S. Patent 5,705,151).
- polynucleotide is combined with about 8 nmol of liposomes, more preferably from about 0.5 ⁇ g to about 5 ⁇ g of polynucleotides are combined with about 8 nmol liposomes, and even more preferably about 1.0 ⁇ g of polynucleotides is combined with about 8 nmol liposomes.
- antibodies can be delivered to specific tissues in vivo using receptor-mediated targeted delivery.
- Receptor-mediated DNA delivery techniques are taught in, for example, Findeis et al. Trends in Biotechnol 11, 202-05 (1993);
- a therapeutically effective dose refers to that amount of active ingredient which increases or decreases fatty acid-CoA ligase-like enzyme activity relative to the fatty acid-CoA ligase-like enzyme activity which occurs in the absence of the therapeutically effective dose.
- the therapeutically effective dose can be estimated initially either in cell culture assays or in animal models, usually mice, rabbits, dogs, or pigs.
- the animal model also can be used to determine the appropriate concentration range and route of administration. Such information can then be used to determine useful doses and routes for administration in humans.
- Therapeutic efficacy and toxicity e.g., ED 5 o (the dose therapeutically effective in 50% of the population) and LD5 0 (the dose lethal to 50% of the population), can be determined by standard pharmaceutical procedures in cell cultures or experimental animals.
- the dose ratio of toxic to therapeutic effects is the therapeutic index, and it can be expressed as the ratio, LD 5 o/ED 5 o.
- compositions that exhibit large therapeutic indices are preferred.
- the data obtained from cell culture assays and animal studies is used in formulating a range of dosage for human use.
- the dosage contained in such compositions is preferably within a range of circulating concentrations that include the ED 5 o with little or no toxicity.
- the dosage varies within this range depending upon the dosage form employed, sensitivity of the patient, and the route of administration.
- Dosage and administration are adjusted to provide sufficient levels of the active ingredient or to maintain the desired effect.
- Factors that can be taken into account include the severity of the disease state, general health of the subject, age, weight, and gender of the subject, diet, time and frequency of administration, drag combination(s), reaction sensitivities, and tolerance/response to therapy.
- Long-acting pharmaceutical compositions can be administered every 3 to 4 days, every week, or once every two weeks depending on the half-life and clearance rate of the particular formulation.
- Normal dosage amounts can vary from 0.1 to 100,000 micrograms, up to a total dose of about 1 g, depending upon the route of administration.
- Guidance as to particular dosages and methods of delivery is provided in the literature and generally available to practitioners in the art. Those skilled in the art will employ different formulations for nucleotides than for proteins or their inhibitors. Similarly, delivery of polynucleotides or polypeptides will be specific to particular cells, conditions, locations, etc.
- polynucleotides encoding the antibody can be constracted and introduced into a cell either ex vivo or in vivo using well- established techniques including, but not limited to, transferrin-polycation-mediated DNA transfer, transfection with naked or encapsulated nucleic acids, liposome- mediated cellular fusion, intracellular transportation of DNA-coated latex beads, protoplast fusion, viral infection, electroporation, "gene gun,” and DEAE- or calcium phosphate-mediated transfection.
- Effective in vivo dosages of an antibody are in the range of about 5 ⁇ g to about 50 ⁇ g/kg, about 50 ⁇ g to about 5 mg/kg, about 100 ⁇ g to about 500 ⁇ g/kg of patient body weight, and about 200 to about 250 ⁇ g/kg of patient body weight.
- effective in vivo dosages are in the range of about 100 ng to about 200 ng, 500 ng to about 50 mg, about 1 ⁇ g to about 2 mg, about 5 ⁇ g to about 500 ⁇ g, and about 20 ⁇ g to about 100 ⁇ g of DNA.
- the reagent is preferably an antisense oligonucleotide or a ribozyme.
- Polynucleotides that express antisense oligonucleotides or ribozymes can be introduced into cells by a variety of methods, as described above.
- a reagent reduces expression of a fatty acid-CoA ligase-like enzyme gene or the activity of a fatty acid-CoA ligase-like enzyme polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% relative to the absence of the reagent.
- any of the pharmaceutical compositions of the invention can be administered in combination with other appropriate therapeutic agents.
- the combination of therapeutic agents can act synergistically to effect the treatment or prevention of the various disorders described above. Using this approach, one may be able to achieve therapeutic efficacy with lower dosages of each agent, thus reducing the potential for adverse side effects.
- any of the therapeutic methods described above can be applied to any subject in need of such therapy, including, for example, mammals such as dogs, cats, cows, horses, rabbits, monkeys, and most preferably, humans.
- Human fatty acid-CoA ligase-like enzyme also can be used in diagnostic assays for detecting diseases and abnormalities or susceptibility to diseases and abnormalities related to the presence of mutations in the nucleic acid sequences that encode the enzyme. For example, differences can be determined between the cDNA or genomic sequence encoding fatty acid-CoA ligase-like enzyme in individuals afflicted with a disease and in normal individuals. If a mutation is observed in some or all of the afflicted individuals but not in normal individuals, then the mutation is likely to be the causative agent of the disease.
- Sequence differences between a reference gene and a gene having mutations can be revealed by the direct DNA sequencing method.
- cloned DNA segments can be employed as probes to detect specific DNA segments.
- the sensitivity of this method is greatly enhanced when combined with PCR.
- a sequencing primer can be used with a double-stranded PCR product or a single-stranded template molecule generated by a modified PCR.
- the sequence determination is performed by conventional procedures using radiolabeled nucleotides or by automatic sequencing procedures using fluorescent tags.
- DNA sequence differences can be carried out by detection of alteration in electrophoretic mobility of DNA fragments in gels with or without denaturing agents. Small sequence deletions and insertions can be visualized, for example, by high resolution gel electrophoresis. DNA fragments of different sequences can be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific melting or partial melting temperatures (see, e.g., Myers et al, Science 230, 1242, 1985). Sequence changes at specific locations can also be revealed by nuclease protection assays, such as RNase and S 1 protection or the chemical cleavage method (e.g., Cotton et al, Proc. Natl.
- the detection of a specific DNA sequence can be performed by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes and Southern blotting of genomic DNA.
- direct methods such as gel-electrophoresis and DNA sequencing, mutations can also be detected by in situ analysis.
- Altered levels of fatty acid-CoA ligase-like enzyme also can be detected in various tissues.
- Assays used to detect levels of the receptor polypeptides in a body sample, such as blood or a tissue biopsy, derived from a host are well known to those of skill in the art and include radioimmunoassays, competitive binding assays, Western blot analysis, and ELISA assays.
- the polynucleotide of SEQ ID NO: 1 is inserted into the expression vector pCEV4 and the expression vector pCEV4-fatty acid CoA ligase polypeptide obtained is transfected into human embryonic kidney 293 cells. From these cells extracts are obtained and fatty acid CoA ligase activity is determined in the following assay:
- the cell extracts are added to reaction mixtures containing 200 mM Tris HC1, pH 8.
- the Pichia pastoris expression vector pPICZB (Invitrogen, San Diego, CA) is used to produce large quantities of recombinant human fatty acid-Co A ligase-like enzyme polypeptides in yeast.
- the fatty acid-CoA ligase-like enzyme-encoding DNA sequence is derived from SEQ ID NO: 1. Before insertion into vector pPICZB, the DNA sequence is modified by well known methods in such a way that it contains at its 5 '-end an initiation codon and at its 3 '-end an enterokinase cleavage site, a His6 reporter tag and a termination codon.
- the yeast is cultivated under usual conditions in 5 liter shake flasks and the recombinanfiy produced protein isolated from the culture by affinity chromatography (Ni-NTA-Resin) in the presence of 8 M urea.
- the bound polypeptide is eluted with buffer, pH 3.5, and neutralized. Separation of the polypeptide from the His6 reporter tag is accomplished by site-specific proteolysis using enterokinase (Invitrogen, San Diego, CA) according to manufacturer's instractions. Purified human fatty acid-Co A ligase-like enzyme polypeptide is obtained.
- Purified fatty acid-CoA ligase-like enzyme polypeptides comprising a glutathione-S- transferase protein and absorbed onto glutathione-derivatized wells of 96-well microtiter plates are contacted with test compounds from a small molecule library at pH 7.0 in a physiological buffer solution.
- Human fatty acid-CoA ligase-like enzyme polypeptides comprise the amino acid sequence shown in SEQ ID NO: 2.
- the test compounds comprise a fluorescent tag. The samples are incubated for 5 minutes to one hour. Control samples are incubated in the absence of a test compound.
- the buffer solution containing the test compounds is washed from the wells. Binding of a test compound to a fatty acid-CoA ligase-like enzyme polypeptide is detected by fluorescence measurements of the contents of the wells. A test compound that increases the fluorescence in a well by at least 15% relative to fluorescence of a well in which a test compound is not incubated is identified as a compound which binds to a fatty acid-CoA ligase-like enzyme polypeptide.
- test compound is administered to a culture of human cells transfected with a fatty acid-Co A ligase-like enzyme expression construct and incubated at 37°C for 10 to 45 minutes.
- a culture of the same type of cells that have not been transfected is incubated for the same time without the test compound to provide a negative control.
- RNA is isolated from the two cultures as described in Chirgwin et al, Biochem. 18, 5294-99, 1979).
- Northern blots are prepared using 20 to 30 ⁇ g total RNA and hybridized with a 32 P-labeled fatty acid-CoA ligase-like enzyme-specific probe at 65°C in Express-hyb (CLONTECH).
- the probe comprises at least 11 contiguous nucleotides selected from the complement of SEQ ID NO: 1.
- a test compound that decreases the fatty acid-CoA ligase-like enzyme-specific signal relative to the signal obtained in the absence of the test compound is identified as an inhibitor of fatty acid-CoA ligase-like enzyme gene expression.
- a test compound is administered to a culture of human cells transfected with a fatty acid-Co A ligase-like enzyme expression construct and incubated at 37°C for 10 to 45 minutes.
- a culture of the same type of cells that have not been transfected is incubated for the same time without the test compound to provide a negative control.
- Enzyme activity is measured using the method of Vessey et al, J. Biochem. Mol.
- a test compound which decreases the fatty acid-CoA ligase-like enzyme activity of the fatty acid-CoA ligase-like enzyme relative to the fatty acid-CoA ligase-like enzyme activity in the absence of the test compound is identified as an inhibitor of fatty acid-CoA ligase-like enzyme activity.
- fatty acid-CoA ligase-like enzyme in various tissues is determined by Reverse Transcription-Polymerase Chain Reaction (RT- PCR).
- fatty acid-Co A ligase-like enzyme is involved in the disease process of diabetes
- the following whole body panel is screened to show predominant or relatively high expression: subcutaneous and mesenteric adipose tissue, adrenal gland, bone marrow, brain, colon, fetal brain, heart, hypothalamus, kidney, liver, lung, mammary gland, pancreas, placenta, prostate, salivary gland, skeletal muscle, small intestine, spleen, stomach, testis, thymus, thyroid, trachea, and uterus.
- Human islet cells and an islet cell library also are tested.
- the expression of fatty acid-CoA ligase-like enzyme in cells derived from normal individuals with the expression of cells derived from diabetic individuals is compared.
- the analysis for diabetes is performed as follows:
- RNA used for Taqman quantitative analysis is either purchased (Clontech,CA) or extracted from tissues using TRIzol reagent (Life Technologies, MD) according to a modified vendor protocol which utilizes the Rneasy protocol (Qiagen, CA). 100 ⁇ g of each RNA is treated with DNase I using RNase free- DNase (Qiagen, CA) for use with RNeasy or QiaAmp columns. After elution and quantitation with Ribogreen (Molecular Probes Inc., OR) each sample is reverse transcribed using the GibcoBRL Superscript II First Strand Synthesis System for RT-PCR according to vendor protocol (Life Technologies, MD). The final concentration of RNA in the reaction mix is 50ng/ ⁇ L. Reverse transcription is performed with 50 ng of Random
- forward primer 5'-( AGTCAGTGACAGCCCCATACAA)-3' reverse primer: 5'-( GTCTCGAAGCTTGGCTCGTT)-3' probe: SYBR Green
- the expected length of the PCR product is -100 bp.
- the experiment is performed on an ABI Prism 7700 Sequence Detector (PE Applied Biosystems, CA). At the end of the run, fluorescence data acquired during PCR are processed as described in the ABI Prism 7700 user's manual. Fold change is calculated using the delta-delta CT method with normalization to the 18S values.
- Relative expression is calculated by normalizing to 18s (D Ct), then making the highest expressing tissue 100 and everything else relative to it. Copy number conversion is performed without normalization using the formula Cn ⁇ lO ⁇ 1"40007 ⁇ 3 - 623 . The results are shown in Fig. 13.
- fatty acid-CoA ligase-like enzyme is involved in cancer
- expression is determined in the following tissues: adrenal gland, bone marrow, brain, cerebellum, colon, fetal brain, fetal liver, heart, kidney, liver, lung, mammary gland, pancreas, placenta, prostate, salivary gland, skeletal muscle, small intestine, spinal cord, spleen, stomach, testis, thymus, thyroid, trachea, uterus, and peripheral blood lymphocytes.
- Expression in the following cancer cell lines also is determined: DU- 145 (prostate), NCI-H125 (lung), HT-29 (colon), COLO-205 (colon), A-549 (lung), NCI-H460 (lung), HT-116 (colon), DLD-1 (colon), MDA-MD-231 (breast), LS174T (colon), ZF-75 (breast), MDA-MN-435 (breast), HT-1080, MCF-7 (breast), and U87. Matched pairs of malignant and normal tissue from the same patient also are tested.
- fatty acid-CoA ligase-like enzyme is involved in the disease process of obesity
- expression is determined in the following tissues: subcutaneous adipose tissue, mesenteric adipose tissue, adrenal gland, bone marrow, brain (cerebellum, spinal cord, cerebral cortex, caudate, medulla, substantia nigra, and putamen), colon, fetal brain, heart, kidney, liver, lung, mammary gland, pancreas, placenta, prostate, salivary gland, skeletal muscle small intestine, spleen, stomach, testes, thymus, thyroid trachea, and uterus.
- Quantitative expression profiling is performed by the form of quantitative PCR analysis called "kinetic analysis” firstly described in Higuchi et al, BioTechnology 10, 413-17, 1992, and Higuchi et al, BioTechnology 11, 1026-30, 1993. The principle is that at any given cycle within the exponential phase of PCR, the amount of product is proportional to the initial number of template copies.
- the probe is cleaved by the 5 '-3' endonuclease activity of Taq DNA polymerase and a fluorescent dye released in the medium (Holland et al, Proc. Natl. Acad. Sci. U.S.A.
- the amplification of an endogenous control can be performed to standardize the amount of sample RNA added to a reaction.
- the control of choice is the 18S ribosomal RNA. Because reporter dyes with differing emission spectra are available, the target and the endogenous control can be independently quantified in the same tube if probes labeled with different dyes are used. All "real time PCR" measurements of fluorescence are made in the ABI Prism 7700.
- RNA extraction and cDN A preparation Total RNA from the tissues listed above are used for expression quantification. RNAs labeled "from autopsy” were extracted from autoptic tissues with the TRIzol reagent (Life Technologies, MD) according to the manufacturer's protocol.
- RNA Fifty ⁇ g of each RNA were treated with DNase I for 1 hour at 37°C in the following reaction mix: 0.2 U/ ⁇ l RNase-free DNase I (Roche Diagnostics, Germany); 0.4 U/ ⁇ l
- RNase inhibitor PE Applied Biosystems, CA
- 10 mM Tris-HCl pH 7.9 10 mM MgCl 2 ; 50 mM NaCl; and 1 mM DTT.
- RNA is extracted once with 1 volume of phenolxhloroform:- isoamyl alcohol (24:24:1) and once with chloroform, and precipitated with 1/10 volume of 3 M NaAcetate, pH5.2, and 2 volumes of ethanol.
- RNA from the autoptic tissues Fifty ⁇ g of each RNA from the autoptic tissues are DNase treated with the DNA-free kit purchased from Ambion (Ambion, TX). After resuspension and spectro- photometric quantification, each sample is reverse transcribed with the TaqMan
- RNA in the reaction mix is 200 ng/ ⁇ L. Reverse transcription is carried out with 2.5 ⁇ M of random hexamer primers.
- TaqMan quantitative analysis Specific primers and probe are designed according to the recommendations of PE Applied Biosystems; the probe can be labeled at the 5' end FAM (6-carboxy-fluorescein) and at the 3' end with TAMRA (6-carboxy- tetramethyl-rhodamine). Quantification experiments are performed on 10 ng of reverse transcribed RNA from each sample. Each determination is done in triplicate. Total cDNA content is normalized with the simultaneous quantification (multiplex PCR) of the 18S ribosomal RNA using the Pre-Developed TaqMan Assay Reagents (PDAR) Control Kit (PE Applied Biosystems, CA).
- PDAR Pre-Developed TaqMan Assay Reagents
- the assay reaction mix is as follows: IX final TaqMan Universal PCR Master Mix
- the experiment is performed on an ABI Prism 7700 Sequence Detector (PE Applied Biosystems, CA).
- fluorescence data acquired during PCR are processed as described in the ABI Prism 7700 user's manual in order to achieve better background subtraction as well as signal linearity with the starting target quantity.
- Overnight fasted normal rats or mice have elevated rates of gluconeogenesis as do streptozotocin-induced diabetic rats or mice fed ad libitum.
- Rats are made diabetic with a single intravenous injection of 40 mg/kg of streptozotocin while C57BL/KsJ mice are given 40-60 mg/kg i.p. for 5 consecutive days.
- Blood glucose is measured from tail-tip blood and then compounds are administered via different routes (p.o., i.p., i.v., s.c). Blood is collected at various times thereafter and glucose measured. Alternatively, compounds are administered for several days, then the animals are fasted overnight, blood is collected and plasma glucose measured. Compounds that inhibit glucose production will decrease plasma glucose levels compared to the vehicle- treated control group.
- Both ob/ob and db/db mice as well as diabetic Zucker rats are hyperglycemic, hyperinsulinemic and insulin resistant.
- the animals are pre-bled, their glucose levels measured, and then they are grouped so that the mean glucose level is the same for each group.
- Compounds are administered daily either q.d. or b.i.d. by different routes (p.o., i.p., s.c.) for 7-28 days. Blood is collected at various times and plasma glucose and insulin levels determined. Compounds that improve insulin sensitivity in these models will decrease both plasma glucose and insulin levels when compared to the vehicle-treated control group.
- Compounds that enhance insulin secretion from the pancreas will increase plasma insulin levels and improve the disappearance of plasma glucose following the administration of a glucose load.
- compounds are administered by different routes (p.o., i.p., s.c. or i.v.) to overnight fasted normal rats or mice.
- an intravenous glucose load 0.4 g/kg
- Plasma insulin levels are determined.
- Compounds that enhance insulin secretion will increase plasma insulin levels compared to animals given only glucose.
- mice When measuring glucose disappearance, animals are bled at the appropriate time after compound administration, then given either an oral or intraperitoneal glucose load (1 g/kg), bled again after 15, 30, 60 and 90 minutes and plasma glucose levels determined. Compounds that increase insulin levels will decrease glucose levels and the area-under-the glucose curve when compared to the vehicle-treated group given only glucose.
- test compounds which regulate phosphatidic acid phosphatase type 2c- like protein are administered by different routes (p.o., i.p., s.c, or i.v.) to overnight fasted normal rats or mice. At the appropriate time an intravenous glucose load (0.4g/kg) is given, blood is collected one minute later. Plasma insulin levels are determined. Test compounds thaf enhance insulin secretion will increase plasma insulin levels compared to animals given only glucose.
- mice When measuring glucose disappearance, animals are bled at the appropriate time after compound administration, then given either an oral or intraperitoneal glucose load (1 g/kg), bled again after 15, 30, 60, and 90 minutes and plasma glucose levels determined. Test compounds that increase insulin levels will decrease glucose levels and the area-under-the glucose curve when compared to the vehicle-treated group given only glucose.
- Overnight fasted normal rats or mice have elevated rates of gluconeogenesis as do streptozotocin-induced diabetic rats or mice fed ad libitum. Rats are made diabetic with a single intravenous injection of 40 mg/kg of streptozotocin while C57BL/KsJ mice are given 40-60 mg/kg i.p. for 5 consecutive days.
- Blood glucose is measured from tail-tip blood and then compounds are administered via different routes (p.o., i.p., i.v., s.c). Blood is collected at various times thereafter and glucose measured. Alternatively, compounds are administered for several days, then the animals are fasted overnight, blood is collected and plasma glucose measured. Compounds that inhibit glucose production will decrease plasma glucose levels compared to the vehicle- treated control group.
- Both ob/ob and db/db mice as well as diabetic Zucker rats are hyperglycemic, hyperinsulinemic and insulin resistant.
- the animals are pre-bled, their glucose levels measured, and then they are grouped so that the mean glucose level is the same for each group.
- Compounds are administered daily either q.d. or b.i.d. by different routes (p.o., i.p., s.c.) for 7-28 days. Blood is collected at various times and plasma glucose and insulin levels determined. Compounds that improve insulin sensitivity in these models will decrease both plasma glucose and insulin levels when compared to the vehicle-treated control group.
- Compounds that enhance insulin secretion from the pancreas will increase plasma insulin levels and improve the disappearance of plasma glucose following the administration of a glucose load.
- compounds are administered by different routes (p.o., i.p., s.c. or i.v.) to overnight fasted normal rats or mice.
- an intravenous glucose load (0.4g/kg) is given, blood is collected one minute later.
- Plasma insulin levels are determined.
- Compounds that enhance insulin secretion will increase plasma insulin levels compared to animals given only glucose.
- animals are bled at the appropriate time after compound administration, then given either an oral or intraperitoneal glucose load (1 g/kg), bled again after 15, 30, 60 and 90 minutes and plasma glucose levels determined.
- Compounds that increase insulin levels will decrease glucose levels and the area-under-the glucose curve when compared to the vehicle-treated group given only glucose.
- the cell line used for testing is the human colon cancer cell line HCT116.
- Cells are cultured in RPMI-1640 with 10-15% fetal calf serum at a concentration of 10,000 cells per milliliter in a volume of 0.5 ml and kept at 37°C in a 95% air/5%CO 2 atmosphere.
- Phosphorothioate oligoribonucleotides are synthesized on an Applied Biosystems Model 380B DNA synthesizer using phosphoroamidite chemistry. A sequence of 24 bases complementary to the nucleotides at position 1 to 24 of SEQ ID NO: 1 is used as the test oligonucleotide. As a control, another (random) sequence is used: 5'-TCA ACT GAC TAG ATG TAC ATG GAC-3'. Following assembly and deprotection, oligonucleotides are ethanol-precipitated twice, dried, and suspended in phosphate buffered saline at the desired concentration. Purity of the oligonucleotides is tested by capillary gel electrophoresis and ion exchange HPLC. The purified oligonucleotides are added to the culture medium at a concentration of 10 M once per day for seven days.
- test oligonucleotide for seven days results in significantly reduced expression of human fatty acid CoA ligase-like enzyme as determined by Western blotting. This effect is not observed with the control oligonucleotide. After 3 to 7 days, the number of cells in the cultures is counted using an automatic cell counter.
- the number of cells in cultures treated with the test oligonucleotide (expressed as 100%) is compared with the number of cells in cultures treated with the control oligonucleotide.
- the number of cells in cultures treated with the test oligonucleotide is not more than 30% of control, indicating that the inhibition of human fatty acid CoA ligase-like enzyme has an anti-proliferative effect on cancer cells.
- This non-tumor assay measures the ability of a compound to reduce either the endogenous level of a circulating hormone or the level of hormone produced in response to a biologic stimulus. Rodents are administered test compound
- Plasma is assayed for levels of the hormone of interest. If the normal circulating levels of the hormone are too low and/or variable to provide consistent results, the level of the hormone may be elevated by a pre-treatment with a biologic stimulus (i.e., LHRH may be injected i.m. into mice at a dosage of 30 ng/mouse to induce a burst of testosterone synthesis). The timing of plasma collection would be adjusted to coincide with the peak of the induced hormone response. Compound effects are compared to a vehicle-treated control group. An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-test.
- a biologic stimulus i.e., LHRH may be injected i.m. into mice at a dosage of 30 ng/mouse to induce a burst of testosterone synthesis.
- Hollow fibers are prepared with desired cell line(s) and implanted intra- peritoneally and/or subcutaneously in rodents.
- Compounds are administered p.o., i.p., i.v., i.m., or s.c.
- Fibers are harvested in accordance with specific readout assay protocol, these may include assays for gene expression (bDNA, PCR, or Taqman), or a specific biochemical activity (i.e., cAMP levels. Results are analyzed by Student's t-test or Rank Sum test after the variance between groups is compared by an F-test, with significance at p ⁇ 0.05 as compared to the vehicle control group.
- Rodents are administered test compound (p.o., i.p., i.v., i.m., or s.c.) according to a predetermined schedule and for a predetermined duration (i.e., 1 week).
- animals are weighed, the target organ is excised, any fluid is expressed, and the weight of the organ is recorded.
- Blood plasma may also be collected. Plasma may be assayed for levels of a hormone of interest or for levels of test agent.
- Organ weights may be directly compared or they may be normalized for the body weight of the animal. Compound effects are compared to a vehicle-treated control group.
- Hollow fibers are prepared with desired cell line(s) and implanted intra- peritoneally and/or subcutaneously in rodents. Compounds are administered p.o., i.p., i.v., i.m., or s.c. Fibers are harvested in accordance with specific readout assay protocol.
- Cell proliferation is determined by measuring a marker of cell number (i.e., MTT or LDH). The cell number and change in cell number from the starting inoculum are analyzed by Student's t-test or Rank Sum test after the variance between groups is compared by an F-test, with significance at p ⁇ 0.05 as compared to the vehicle control group.
- Hydron pellets with or without growth factors or cells are implanted into a micropocket surgically created in the rodent cornea.
- Compound administration may be systemic or local (compound mixed with growth factors in the hydron pellet).
- Corneas are harvested at 7 days post implantation imme- diately following intracardiac infusion of colloidal carbon and are fixed in
- Matrigel containing cells or growth factors, is injected subcutaneously. Compounds are administered p.o., i.p., i.v., i.m., or s.c. Matrigel plugs are harvested at predetermined time point(s) and prepared for readout. Readout is an ELISA-based assay for hemoglobin concentration and/or histological examination (i.e. vessel count, special staining for endothelial surface markers: CD31, factor-8). Readouts are analyzed by Student's t-test, after the variance between groups is compared by an F-test, with significance > determined at p ⁇ 0.05 as compared to the vehicle control group.
- Tumor cells or fragments are implanted subcutaneously on Day 0.
- Vehicle and/or compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule starting at a time, usually on Day 1, prior to the ability to measure the tumor burden.
- Body weights and tumor measurements are recorded 2-3 times weekly. Mean net body and tumor weights are calculated for each data collection day.
- Anti-tumor efficacy may be initially determined by comparing the size of treated (T) and control (C) tumors on a given day by a Student's t-test, after the variance between groups is compared by an F-test, with significance determined at p ⁇ 0.05.
- Tumor growth delays are expressed as the difference in the median time for the treated and control groups to attain a predetermined size divided by the median time for the control group to attain that size. Growth delays are compared by generating Kaplan-Meier curves from the times for individual tumors to attain the evaluation size. Significance is p ⁇ 0.05. 3.1.2. Intraperitoneal/Intracranial Tumor Models
- Tumor cells are injected intraperitoneally or intracranially on Day 0.
- Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a pre- determined schedule starting on Day 1. Observations of morbidity and/or mortality are recorded twice daily. Body weights are measured and recorded twice weekly. Morbidity/mortality data is expressed in terms of the median time of survival and the number of long-term survivors is indicated separately. Survival times are used to generate Kaplan-Meier curves. Significance is p ⁇ 0.05 by a log-rank test compared to the control group in the experiment.
- Tumor cells or fragments are implanted subcutaneously and grown to the desired size for treatment to begin. Once at the predetermined size range, mice are randomized into treatment groups. Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule. Tumor and body weights are measured and recorded 2-3 times weekly. Mean tumor weights of all groups over days post inoculation are graphed for comparison.
- An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-test to compare tumor sizes in the treated and control groups at the end of treatment. Significance is p ⁇ 0.05 as compared to the control group. Tumor measurements may be recorded after dosing has stopped to monitor tumor growth delay. Tumor growth delays are expressed as the difference in the median time for the treated and control groups to attain a predetermined size divided by the median time for the control group to attain that size. Growth delays are compared by generating Kaplan-Meier curves from the times for individual tumors to attain the evaluation size. Significance is p value ⁇ 0.05 compared to the vehicle control group.
- Tumor cells or fragments, of mammary adenocarcinoma origin are implanted directly into a surgically exposed and reflected mammary fat pad in rodents. The fat pad is placed back in its original position and the surgical site is closed. Hormones may also be administered to the rodents to support the growth of the tumors. Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule. Tumor and body weights are measured and recorded 2-3 times weekly. Mean tumor weights of all groups over days post inoculation are graphed for comparison. An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-test to compare tumor sizes in the treated and control groups at the end of treatment. Significance is p ⁇ 0.05 as compared to the control group.
- Tumor measurements may be recorded after dosing has stopped to monitor tumor growth delay.
- Tumor growth delays are expressed as the difference in the median time for the treated and control groups to attain a predetermined size divided by the median time for the control group to attain that size.
- Growth delays are compared by generating Kaplan-Meier curves from the times for individual tumors to attain the evaluation size. Significance is p value ⁇ 0.05 compared to the vehicle control group. In addition, this model provides an opportunity to increase the rate of spontaneous metastasis of this type of tumor. Metastasis can be assessed at termination of the study by counting the number of visible foci per target organ, or measuring the target organ weight. The means of these endpoints are compared by Student's t-test after conducting an F-test, with significance determined at p ⁇ 0.05 compared to the control group in the experiment. .3.2. Intraprostatic Assay
- Tumor cells or fragments, of prostatic adenocarcinoma origin are implanted directly into a surgically exposed dorsal lobe of the prostate in rodents.
- the prostate is externalized through an abdominal incision so that the tumor can be implanted specifically in the dorsal lobe while verifying that the implant does not enter the seminal vesicles.
- the successfully inoculated prostate is replaced in the abdomen and the incisions through the abdomen and skin are closed.
- Hormones may also be administered to the rodents to support the growth of the tumors.
- Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule.
- Body weights are measured and recorded 2-3 times weekly. At a predetermined time, the experiment is terminated and the animal is dissected.
- the size of the primary tumor is measured in three dimensions using either a caliper or an ocular micrometer attached to a dissecting scope.
- An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-test to compare tumor sizes in the treated and control groups at the end of treatment. Significance is p ⁇ 0.05 as compared to the control group. This model provides an opportunity to increase the rate of spontaneous metastasis of this type of tumor.
- Metastasis can be assessed at termination of the study by counting the number of visible foci per target organ (i.e., the lungs), or measuring the target organ weight (i.e., the regional lymph nodes). The means of these endpoints are compared by Student's t-test after conducting an F-test, with significance determined at p ⁇ 0.05 compared to the control group in the experiment.
- Tumor cells of pulmonary origin may be implanted infrabronchially by making an incision through the skin and exposing the trachea.
- the trachea is pierced with the beveled end of a 25 gauge needle and the tumor cells are inoculated into the main bronchus using a flat-ended 27 gauge needle with a 90° bend.
- Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule. Body weights are measured and recorded 2-3 times weekly. At a predetermined time, the experiment is terminated and the animal is dissected.
- the size of the primary tumor is measured in three dimensions using either a caliper or an ocular micrometer attached to a dissecting scope.
- An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-test to compare tumor sizes in the treated and control groups at the end of treatment. Significance is p ⁇ 0.05 as compared to the control group.
- This model provides an opportunity to increase the rate of spontaneous metastasis of this type of tumor. Metastasis can be assessed at termination of the study by counting the number of visible foci per target organ (i.e., the contralateral lung), or measuring the target organ weight. The means of these endpoints are compared by Student's t-test after conducting an F-test, with significance determined at p ⁇ 0.05 compared to the control group in the experiment.
- Tumor cells of gastrointestinal origin may be implanted intracecally by making an abdominal incision through the skin and externalizing the intestine. Tumor cells are inoculated into the cecal wall without penetrating the lumen of the intestine using a 27 or 30 gauge needle. Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule. Body weights are measured and recorded 2-3 times weekly. At a predetermined time, the experiment is terminated and the animal is dissected. The size of the primary tumor is measured in three dimensions using either a caliper or an ocular micrometer attached to a dissecting scope.
- An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-test to compare tumor sizes in the treated and control groups at the end of treatment. Significance is p ⁇ 0.05 as compared to the confrol group. This model provides an opportunity to increase the rate of spontaneous metastasis of this type of tumor. Metastasis can be assessed at termination of the study by counting the number of visible foci per target organ (i.e., the liver), or measuring the target organ weight. The means of these endpoints are compared by Student's t-test after conducting an F-test, with significance determined at p ⁇ 0.05 compared to the control group in the experiment.
- Tumor cells are inoculated s.c. and the tumors allowed to grow to a predetermined range for spontaneous metastasis studies to the lung or liver. These primary tumors are then excised. Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule which may include the period leading up to the excision of the primary tumor to evaluate therapies directed at inhibiting the early stages of tumor metastasis. Observations of morbidity and/or mortality are recorded daily. Body weights are measured and recorded twice weekly. Potential endpoints include survival time, numbers of visible foci per target organ, or target organ weight.
- survival time When survival time is used as the endpoint the other values are not determined. Survival data is used to generate Kaplan-Meier curves. Significance is p ⁇ 0.05 by a log-rank test compared to the confrol group in the experiment. The mean number of visible tumor foci, as determined under a dissecting microscope, and the mean target organ weights are compared by
- Tumor cells are injected into the tail vein, portal vein, or the left ventricle of the heart in experimental (forced) lung, liver, and bone metastasis studies, respectively.
- Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule. Observations of morbidity and/or mortality are recorded daily. Body weights are measured and recorded twice weekly. Potential endpoints include survival time, numbers of visible foci per target organ, or target organ weight. When survival time is used as the endpoint the other values are not determined. Survival data is used to generate Kaplan-Meier curves. Significance is p ⁇ 0.05 by a log-rank test compared to the control group in the experiment.
- the mean number of visible tumor foci, as determined under a dissecting microscope, and the mean target organ weights are compared by Student's t-test after conducting an F- test, with significance at p ⁇ 0.05 compared to the vehicle control group in the experiment for both endpoints.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- General Chemical & Material Sciences (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Urology & Nephrology (AREA)
- Vascular Medicine (AREA)
- Cardiology (AREA)
- Heart & Thoracic Surgery (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Microbiology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
Description
Claims
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US28418301P | 2001-04-18 | 2001-04-18 | |
US60/284,183 | 2001-04-18 | ||
US29457601P | 2001-06-01 | 2001-06-01 | |
US60/294,576 | 2001-06-01 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2003027292A2 true WO2003027292A2 (en) | 2003-04-03 |
WO2003027292A3 WO2003027292A3 (en) | 2003-12-11 |
Family
ID=26962464
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/EP2002/004282 WO2003027292A2 (en) | 2001-04-18 | 2002-04-18 | Regulation of human fatty acid-coa ligase-like enzyme |
Country Status (1)
Country | Link |
---|---|
WO (1) | WO2003027292A2 (en) |
-
2002
- 2002-04-18 WO PCT/EP2002/004282 patent/WO2003027292A2/en not_active Application Discontinuation
Non-Patent Citations (4)
Title |
---|
BARTON G J: "PROTEIN SEQUENCE ALIGMENT AND DATABASE SCANNING" PROTEIN STRUCTURE PREDICTION. A PRACTICAL APPROACH, XX, XX, 1996, pages 31-63, XP000829540 * |
DATABASE TREMBL [Online] Database accession no. AF126145 XP002222385 cited in the application * |
GEORGE D G ET AL: "CURRENT METHODS IN SEQUENCE COMPARISON AND ANALYSIS" MACROMOLECULAR SEQUENCING AND SYNTHESIS SELECTED METHODS AND APPLICATIONS, XX, XX, 1988, pages 127-149, XP000829541 * |
KNIGHTS K M ET AL: "XENOBIOTIC-COA LIGASES: KINETIC AND MOLECULAR CHARACTERIZATION" CURRENT DRUG METABOLISM, BENTHAM SCIENCE PUBLISHERS,, US, vol. 1, no. 1, July 2002 (2002-07), pages 49-66, XP001105301 ISSN: 1389-2002 * |
Also Published As
Publication number | Publication date |
---|---|
WO2003027292A3 (en) | 2003-12-11 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US20020115177A1 (en) | Regulation of human histone deacetylase | |
WO2002061092A2 (en) | Regulation of human lysyl oxidase | |
WO2002070675A2 (en) | Regulation of human histone acetyltransferase | |
WO2002048325A2 (en) | Regulation of human serine palmitoyltransferase | |
US20050170486A1 (en) | Nucleic acids encoding human inositolpolyphosphate 5-phosphatase | |
WO2002055712A2 (en) | Regulation of human alanine aminotransferase | |
US20040096868A1 (en) | Regulation of human gnat acetyltransferase-like protein | |
WO2002036731A2 (en) | Human lysosomal acid lipase | |
US20020103120A1 (en) | Regulation of human phosphodiesterase-like enzyme | |
WO2002042435A2 (en) | Regulation of human tyrosine phosphatase | |
US20040265827A1 (en) | Regulation of human steroid 5-alpha reductase | |
WO2003035857A1 (en) | Regulation of human nad-dependent alpha-glycerol-3-phosphate dehydrogenase | |
US20040053840A1 (en) | Regulation of human cyclophilin-like protein | |
WO2002053756A2 (en) | Regulation of human glucosamine-6-phosphate deaminase | |
WO2003027292A2 (en) | Regulation of human fatty acid-coa ligase-like enzyme | |
US20040058885A1 (en) | Nucleoside diphosphate hydrolase | |
WO2002053713A2 (en) | Cloning of a human sulfotransferase | |
WO2003025162A2 (en) | Regulation of human prolyl 4-hydroxylase alpha subunit precursor | |
US20040082051A1 (en) | Regulation of human uridine kinase | |
WO2002020747A2 (en) | Regulation of human tyrosine phosphatase-like enzyme | |
WO2002033062A1 (en) | REGULATION OF HUMAN ACYL-CoA DEHYDROGENASE | |
US20040101877A1 (en) | Regulation of human 3-ss-hydroxysteroid dehydrogenase-isomerase | |
WO2003000725A2 (en) | Regulation of human lipoate-protein ligase b-like enzyme | |
WO2003048350A1 (en) | Regulation of human lactate dehydrogenase | |
WO2003064642A1 (en) | Regulation of human thymidylate kinase |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BY BZ CA CH CN CO CR CU CZ DE DM DZ EC EE ES FI GB GD GE GH HR HU ID IL IN IS JP KE KG KP KR LC LK LR LS LT LU LV MA MD MG MN MW MX MZ NO NZ OM PH PL PT RU SD SE SG SI SK SL TJ TM TN TR TZ UA UG US UZ VN YU ZA ZM |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ UG ZM ZW AM AZ BY KG KZ RU TJ TM AT BE CH CY DE DK FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase in: |
Ref country code: JP |
|
WWW | Wipo information: withdrawn in national office |
Country of ref document: JP |