WO2003025223A2 - Improvements in or relating to insecticide screening - Google Patents

Abstract

The present invention relates to the use of a cell, cell line or organism in which the activity of cyp6g1 or derivatives thereof or fragments or either thereof is increased relative to wildtype activity of cyp6g1 for the screening of putative pesticides. Also disclosed are cell, cell lines and organisms for use in the method.

Description

Improvements in or relating to insecticide screening

The present invention relates to the screening of compounds for biological activity, especially for use as pesticides. In particular, the invention relates to organisms for use in screening, to their use, and to screening methods .

Chemical pesticides, for example insecticides, currently used to control populations of pests are less than ideal . The insecticide DDT was initially used successfully against a wide range of insect species. The use of DDT today is limited because of its environmental toxicity, and because resistance mutations have arisen, conferred a selective advantage, and spread through many populations of pest species.

There is currently much research devoted to developing new pesticides. One of the difficulties in developing such chemicals is that it is difficult to predict before extensive use whether or not resistance will develop and spread rapidly in a pest population. There is also a risk that pre-existing mutations (including those selectively favoured by the use of earlier pesticides) may rapidly confer resistance to novel pesticides .

It would be of great benefit to the agrochemical and pest control industries to be able to predict the likely incidence of resistance to a new putative pesticide early in that putative pesticide's development so that resources are not unduly wasted on product development of a chemical entity that would rapidly encounter a major resistance problem in use. Moreover, an ability to predict likely patterns of resistance could be used to guide the direction of a product development programme. Additionally, a pest management strategy would be rendered more effective by an enhanced ability to assess the potential pesticide resistance status of a pest population in the field before any active pest management begins .

Chemical mutagenesis is a useful way of predicting likely mechanisms of resistance to novel insecticide classes. Mutagenesis has previously been used to predict mechanisms of resistance to the insect growth regulators cyromazine and methoprene in Drosophila melanogaster (Wilson and Ashok 1998, Proc. Nat Acad. Sci . USA 95:4855-4859; Daborn et al . 2000, J. Econ. Entomol. 93:911-919) and to isolate dieldrin-, diazinon-, malathion- and cyromazine-resistant mutants of Lucilia cuprina (McKenzie and Batterham 1998, Phil. Trans. R. Soc. Lond. B 353:1729-1734).

The neonicotinoids are an example of a successful class of insecticides, which include imidacloprid, and act on the nicotinic acetylcholine receptor as nicotine mimics or "agonists" (Bai et al . 1991, Pestic. Sci. 33:197-204; Liu and Casida 1993, Pestic Biochem. Physiol . 46:40-46; Buckingham et al. 1997, J. Exp. Biol . 26:697-703). To date, few cases of field-associated resistance to imidacloprid have been reported (Zhao et al . 2000, J Econ. Entomol. 93:1508-1514). We disclose herein work carried out in order to predict likely resistance mechanisms to neonicotinoid insecticides and other pesticides. Throughout the text of this document the following terms shall be used as defined:

"Organism" includes an organism at all stages of development, for example the term shall include eggs, larvae, nymphs and caterpillars as well as adult organisms. "Wildtype" is used to indicate the normal, naturally occurring genotype or phenotype. When "wildtype" is used to describe the level of expression of a pesticide resistance gene it is regarded as designating the mean expression level one would encounter in a wild pest population not previously exposed to significant pesticide use. In practice, for convenience, a specific laboratory strain of organism is often regarded as approximating to the wildtype. For example, the Canton-S strain of Drosophila melanogaster can be regarded as representative of the "wildtype" with regard to many genes, including those involved in pesticide resistance.

"Neonicotinoid" refers to any chemical entity that acts as an agonist to the nicotinic acetylcholine receptor of an organism. Neonicotinoids currently in use as pesticides include nitenpyram, dinotefuran, clothianidin, thiamethoxam, imidacloprid and acetamiprid. For the avoidance of doubt, "neonicotinoid" as used herein includes any other chemical entities, known or as yet unknown, that exhibit agonist activity to the nicotinic acetylcholine receptor of an organism.

"Pesticide" refers to any chemical entity used or potentially usable to control pest organisms. The term "pesticide" includes agents for the control of insects, that is insecticides, and also agents suitable for the control of other pest organisms.

"Cypβgl" is used to designate a specific gene of Drosophila melanogaster. The genomic sequence of Drosophila melanogaster cypδgl from Celera has GenBank Accession Number AE003823, and a cDNA sequence is provided as GenBank Accession Number AF083946. The genomic sequence of Drosophila melanogaster cyp6gl from the BAC clone has GenBank Accession Number AC007440. It will be appreciated that many other species will carry an orthologous gene, which may be differently named in that species, but will prima facie carry out a similar function. "Homologue" refers to a second gene which shows a significant level of sequence homology, for example, at least 30% homology at the nucleic acid level, with a second gene. A high degree of sequence homology between two genes may imply a functional equivalence.

"Orthologue" refers to a second gene which shows a significant level of sequence homology, for example, at least 30% homology at the nucleic acid level, with a second gene in a different species or other taxonomic grouping. An orthologue is regarded as an equivalently functional gene in a second organism. Gene position in the genome may sometimes be shared by orthologues between species or other taxonomic groupings and may therefore assist in the identification of orthologues . "Equivalent" is used in the context of genes to designate a second gene which is functionally equivalent to a first gene.

"Fragment" is used in the context of genes to refer to a continuous nucleic acid section of a gene of at least ten nucleotides in length, which section is specific to the gene. A gene fragment may include all or part of the coding or regulatory regions of a gene may span such regions . A gene fragment need not necessarily encode a functional protein. "Fragment" is used in the context of proteins to refer to a continuous section of a protein of at least four amino acids, which section is specific to the protein. A protein fragment may include all or part of a domain or functional region of a protein, for example a fragment may define a substrate binding region or active site. "Derivative" as defined herein in relation to genes refers to a gene having a nucleic acid sequence that differs from a given sequence by one or more substitutions, additions or deletions, that provide for functionally equivalent molecules. Due to degeneracy of nucleotide coding sequences, other DNA sequences that encode the same amino acid sequence as a particular gene exist.

"Derivative" as defined herein in relation to proteins refers to a protein having an amino acid sequence that differs from a given sequence by one or more substitutions, additions or deletions, that provide for functionally equivalent molecules. Protein derivatives may also be referred to as analogues. "Increase" and "decrease" of gene expression is used herein to refer to an increase or decrease that is detectable by Northern blotting or RT-PCR. In practice, and when considered relative to the wildtype expression level, this will include increases and decreases of more than 20% of the wildtype level . A decrease in gene expression includes a decrease to zero, that is a complete abolition of gene expression.

"Altered" is used in respect of enzymatic activity to refer to enzymatic activity, which is measurably increased to decreased in respect of at least one substrate.

"Altered" is used in respect of enzymatic specificity to refer to a change in the activities of an enzyme with respect to a first substrate that is not proportionate to a change in the activity of an enzyme with respect to a second substrate. The present invention provides the use of a cell, cell line or organism in which cypδgl activity or derivatives thereof or fragments of both thereof is increased relative to the wildtype expression of the same gene for the screening of putative pesticides. The invention disclosed herein is based on the surprising discovery in insects of a mechanism of cross resistance to DDT and imidacloprid. The discovery is surprising because DDT and imidacloprid belong to different chemical classes, that is, respectively pyrethroid and neonicotinoid, they have different chemical structures and act on different targets.

"Increased" as used herein in relation to expression includes inducibly increased, that is, for example increase initiated by the use of inducible promoters or inducible repressor elements.

Optionally, increased cyp6gl activity is obtainable by chemical mutagenesis followed by selection, or radiation induced mutagenesis followed by selection.

Alternatively, increased cyp6gl activity is obtainable by the insertion of nucleic acid into said organism, said nucleic acid comprising sequence encoding cyp6gl, derivatives thereof, fragments of either thereof, or expression control elements of any thereof.

Alternatively, increased cyp6gl activity may be obtainable by functional activation of cyp6gl genes of the cytochrome P450 complex or one of more derivatives thereof, or fragments of either thereof, or expression control elements of any thereof.

An increase in cyp6gl activity may be caused by increased expression of the cyp6gl gene or derivatives thereof or fragments of either thereof, or expression control elements of any thereof. This may comprise addition or activation of a promoter of cypδgl expression, which promoter may be constitutive or inducible. Methods of altering the expression of a gene are well known in the art and include the techniques of classical genetics, for example chemical mutagenesis and selection, and also techniques of molecular biology such as gene knockout technology in which one or more genes have been inactivated giving a "knock-out" animal. "Knock-out" animals can be generated by any method known in the art for disrupting a gene on the chromosome of an animal. Homologous recombination methods for disrupting genes in the genome are described, for example, in Capecchi (1989, Science 244:1288-1292) and Mansour et al . (1988, Nature 336:348-352). Alternatively the expression of a cyp6gl gene may be increased by the insertion of one or more control elements or one or more additional copies of the cyp6gl gene. Specific examples of such methods include the insertion into a cell of a nucleic acid which has a promoter operably linked to a cyp6gl gene coding region, said promoter being inducible or constitutively active, homologous or heterologous, and optionally tissue specific. Nucleic acid may be inserted into a cell in such a way that it is integrated into a chromosome and expressed chromosomally. Alternatively it may remain outside the chromosome and be expressed episomally. Additionally, the invention provides the use of a cell, cell line or organism in which the enzymatic activity or specificity of cyp6gl enzyme, derivative thereof or fragments of either thereof is increased relative to wildtype enzymatic activity or specificity for the screening of putative pesticides.

Said enzymatic activity or specificity may be changed by chemical mutagenesis of the encoding gene or derivative thereof or fragment of either thereof followed by selection, or radiation induced mutagenesis of the encoding gene or derivative thereof or fragment of either thereof, followed by selection.

Alternatively, said enzymatic activity or specificity may be changed by site directed mutagenesis of the encoding gene or derivative thereof or fragment of either thereof. Inhibitors of cyp6gl gene function may be inhibited by the use of antisense nucleic acids, this increasing cyp6gl gene function. The term "antisense" nucleic acid is used herein to refer to a nucleic acid capable of hybridising with another nucleic acid or portion thereof, preferably mRNA that encodes a cyp6gl inhibitor gene, by virtue of some sequence complementarity. The antisense nucleic acid may be complementary to a peptide coding and/or a non-peptide coding, for example, expression controlling, region of the cytochrome P450 gene. Preferably the antisense nucleic acid is produced intracellularly by the transcription of an exogenous sequence, which has been introduced into the cell (Old and Primrose, 1994, Principles of genetic manipulation: An introduction to genetic engineering. Blackwell Scientific ISBN 0 632 03712 1, page 398) .

Expression of cyp6gl or the activity or specificity of the encoded enzyme may be increased by site directed mutagenesis of an existing cyp6gl gene control element, in order to increase said gene control element's activity, or of a coding region in order to change the peptide sequence encoded. A number of techniques may be used to effect site- directed mutagenesis, for example, cassette mutagenesis, PCR- site- directed mutagenesis and primer extension site-directed mutagenesis (see Old and Primrose, supra for further details) .

The cell, cell lines or organisms in which cyp6gl gene expression or enzyme activity is greater than wildtype expression are useful for pesticide screening. The use of such cells, cell lines or organisms in assays for pesticide killing will provide useful information about whether or not specific cytochrome P450 genes encode enzymes involved in the degradation of specific pesticides or groups of pesticides. For example, if organisms in which a cytochrome P450 gene is knocked out show increased susceptibility to killing by a certain pesticide when compared to the susceptibility of a non-knocked out control organism, that indicates that that gene is normally involved in detoxifying that pesticide. On the other hand, if killing is enhanced, that suggests that the cytochrome P450 gene is involved in toxifying the pesticide.

If a cell, cell line or organism in which the expression of a cyp6gl is increased shows increased resistance to a particular pesticide when compared to the resistance present in a control organism with non-increased cyp6gl gene expression, that indicates that the cyp6gl gene is involved in detoxifying the pesticide. Furthermore, such a finding indicates that, if the pesticide were to be used extensively in the field, there might be selection for naturally occurring resistance involving increased cypδgl gene expression. A means of predicting such an occurrence would be useful because pesticide resistance is a major economic and environmental problem.

Methods of screening putative pesticides will comprise exposing a cell, cell line or organism to the putative pesticide and noting at what dose the putative pesticide has a detrimental affect on the organism. Such a detrimental affect is preferably killing. However, other "detrimental effects" as used herein include interference with normal behaviour (including breeding or feeding behaviour) , interference with growth or development, interference with egg hatching or interference with breeding success . Derivatives of genes may be made by altering gene sequences by substitutions, additions or deletions that provide for functionally equivalent molecules. Due to the degeneracy of nucleotide coding sequences, other DNA sequences which encode the same amino acid sequence as a gene may be used in the practice of the present invention. These include nucleotide sequences comprising all or portions of genes which are altered by the substitution of different codons that encode the same amino acid residue within the sequence, thus producing a silent change.

Alternatively, derivatives of genes may be made by altering gene sequences by substitutions, additions or deletions that provide for a protein in which the peptide sequence of amino acids has a corresponding amino acid substitution, addition or deletion, that is a non-silent change .

Organisms with mutations are present in the wild. Mutations arise naturally and apparently at random. When mutations arise they may be inherited and recombined with other mutations by asexual, and especially by sexual, reproduction. Natural selection will cause some mutations to be lost and others, especially those that confer a selective advantage, to be maintained and spread. A wild pest population will contain individual organisms with mutant forms of cyp6gl gene. These organisms can be isolated from the environment and the mutant genotype maintained in the laboratory. Mutations that are involved in pesticide resistance may be more common in wild populations that are, or have been, exposed to pesticides. Such populations may be a good source of resistant organisms for use in pesticide screening. Following capture, wild organisms carrying genotypes useful for pesticide screening may be identified by their genotype, detected for example by PCR-based techniques, or by their phenotype, for example, their ability to withstand otherwise lethal doses of pesticide. When identified, such organisms may be inbred in order to produce a stable genetic strain for use in pesticide screening. Many of the techniques described above for use in altering the expression levels of a cypδgl gene may also be used to make organisms in which a cyp6gl exhibits an altered enzymatic activity or specificity. For example, site directed mutagenesis may be used to make insertions, deletions or substitutions of the genetic sequence encoding an enzyme thereby effecting substitutions, deletions or insertions of the amino-acid, that is peptide, sequence of that enzyme. Alterations may be made to the active site, or elsewhere on the enzyme peptide in order to increase or decrease its enzymatic activity. For example, the activity of said enzyme may be increased by increasing the activity of the active site or by altering the regulation of enzymatic activity, for example, to render an inducibly active enzyme constitutively active.

In addition to altering the activity of a cyp6gl enzyme by manipulating the peptide sequence of that enzyme, it will be possible to alter said enzymes in vi tro activity by manipulating the expression and/or activity of functionally associated genes and their corresponding proteins. For example, it is known that the activity of many enzymes is dependent on their phosphorylation state . The phosphorylation state of an enzyme in vitro may be altered by manipulating the expression and/or activity of appropriate phosphatases and/or kinases . Other factors which might be manipulated in order to alter the activity of an enzyme include the availability of cellular energy stores (for example ATP) and enzyme cofactors . Reference herein to the gene cyp6gl, which is a name used to refer to the gene in Drosophila melanogaster, will include reference to equivalent, homologous or orthologous genes in or from an organism in which the same or an alternative nomenclature is used. The genomic sequence of Drosophila melanogaster cyp6gl from Celera has GenBank Accession Number AE003823, and a cDNA sequence is provided as GenBank Accession Number AF083946. The genomic sequence of Drosophila melanogaster cypδgl from the BAG clone has GenBank Accession Number AC007440. It will be appreciated that many other species will carry an orthologous gene, which may be differently named in that species, but will prima facie carry out a similar function. Cyp6gl equivalent, orthologous or homologous genes may be identified by techniques of molecular biology. For example, cyp6gl nucleic acids (either cyp6gl genomic clones or cyp6gl specific probes) can be used to identify genomic clones of genes equivalent, orthologous or homologous to cyp6gl, and can be obtained by any method known in the art, e.g., the polymerase chain reaction (PCR) using specific PCR primers or those degenerate in their nucleotide sequence, hybridizable to the 3' and 5¹ ends of the cyp6gl nucleotide sequence or cyp6gl like nucleotide sequence obtained from a gene sequence database, for example GenBank, and/or by cloning from a cDNA library or genomic library using an oligonucleotide probe specific for the gene sequence disclosed herein or obtained from a gene sequence database. Genomic clones can be identified by probing a genomic DNA library under appropriate hybridization conditions, e.g., high stringency conditions, low stringency conditions or moderate stringency conditions, depending on the relatedness of the probe to the genomic DNA being probed. For example, if the cyp6gl probe and the genomic DNA are from the same species, then high stringency hybridization conditions may be used. If the cyp6gl probe and the genomic DNA are from different species, then low stringency hybridization conditions may be used.

High, low and moderate stringency conditions are all well known in the art.

Procedures for low stringency hybridization are for example as follows (see also Shilo and Weinberg, 1981, Proc . Natl. Acad. Sci. USA 78:6789-6792): Filters containing DNA are pretreated for 6 hours at 40°C in a solution containing 35% formamide, 5X saline-sodium citrate buffer (SSC) (Sigma) , 50 mM Tris-HCl buffer (Sigma) (pH 7.5), 5mM ethylenediaminetetraacetic acid (EDTA) , 0.1% polyvinylpyrrolidone (PVP), 0.1% Ficoll^® (Amersham Pharmicia Biotech Inc) , 1% bovine serum albumen (BSA) , and 500μg/ml denatured salmon sperm DNA. Hybridizations are carried out in the same solution with the following modifications: 0.02% PVP, 0.02% Ficoll^®, 0.2% BSA, lOOμg/ml salmon sperm DNA, 10% (wt/vol) dextran sulfate, and 5-20 X 10⁶ cpm ³²P-labelled probe is used. Filters are incubated in hybridization mixture for 18-20 hours at 40°C, and then washed for 1.5 hours at 55°C in a solution containing 2X SSC, 25mM Tris-HCl (pH 7.4), 5mM EDTA, and 0.1% SDS . The wash solution is replaced with fresh solution and incubated an additional 1.5 hours at 60°C. Filters are blotted dry and exposed for autoradiography. If necessary, filters are washed for a third time at 65-68°C and re-exposed to film.

Procedures for high stringency hybridizations are for example as follows: Prehybridization of filters containing

DNA is carried out for 8 hours to overnight at 65°C in buffer composed of 6X SSC, 50mM Tris-HCl (pH7.5), ImM EDTA, 0.02% PVP, 0.02% Ficoll^®, 0.02% BSA, and 500μg/ml denatured salmon sperm DNA. Filters are hybridized for 48 hours at 65°C in prehybridization mixture containing lOOμg/ml denatured salmon sperm DNA and 5-20 X 10⁶ cpm of ³²P-labelled probe. Washing of filters is done at 37°C for 1 hour in a solution containing 2X SSC, 0.01% PVP, 0.01% Ficoll^®, and 0.01% BSA. This is followed by a wash in 0.1 X SSC at 50°C for 45 minutes before autoradiography. Moderate stringency conditions for hybridization are for example as follows: Filters containing DNA are pretreated for 6 hours at 55°C in a solution containing 6X SSC, 5X Denhardt ' s solution (Sigma), 0.5% SDS, and lOOμg/ml denatured salmon sperm DNA. Hybridizations are carried out in the same solution and 5-20 X 10 cmp ³²P-labelled probe is used. Filters are incubated in the hybridization mixture for 18-20 hours at 55°C, and then washed twice for 30 minutes at 60°C in a solution containing 1 X SSC and 0.1% SDS. The above three example protocols may be further adjusted, for example by adjusting the wash temperature, to give stringency conditions intermediate to the three examples given.

Any eukaryotic cell may potentially serve as a nucleic acid source for the molecular cloning of cypδgl or cypδgl- like genes. The nucleic acid sequences encoding such genes can be isolated from many common organisms. The DNA may be obtained by standard procedures known in the art, preferably from cloned genomic DNA, that is a DNA "library", from the desired cell (see, for example, Sambrook et al . , 1989,

Molecular Cloning, A Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York; Glover, D.M. (ed.), 1985, DNA Cloning: A Practical Approach, MRL Press, Ltd., Oxford, U.K. Vol. I, II). The gene should be molecularly cloned, that is inserted, into a suitable vector for propagation of the gene.

The cyp6gl derivatives and fragments for use in the invention can be produced by various methods known in the art. For example, the cloned cyp6gl gene sequence can be modified by any of numerous strategies known in the art (see for example Sambrook et al . , 1990, Molecular Cloning, A Laboratory Manual, 2d ed. , Cold Spring Harbor Laboratory, Cold Spring Harbor, New York) .

Alternatively, cyp6gl-encoding nucleic acid sequence can be mutated in vitro or in vivo, to create and/or destroy translation, initiation, and/or termination sequences, or to create variations in coding regions and/or form new restriction endonuclease sites or destroy pre-existing ones, to facilitate further in vitro modification. Any technique for mutagenesis known in the art can be used, including chemical mutagenesis, in vitro site-directed mutagenesis

(Hutchinson, C, et al . , 1978, J. Biol . Chem 253:6551), use of TAB^® linkers (Pharmacia), etc.

The invention optionally provides the use of an organism wherein that organism is selectively isolated from the environment.

The organism may be a pest of plants, animals or humans. Examples of pest species include aphids, thrips, locust, whitefly, black fly, leafhoppers, mosquitoes, nematodes, wasps, termites, rice hoppers, rice bugs, mealy bugs, white grubs, Colorado potato beetle, flea beetle, lice, mites, ants, fleas, tics, wireworms, ground beetles, leaf miners, butterflies, moths, weevils, spiders, spider mites, lacewings, gnats, midges, flies, bees, plant hoppers, biting insects, sucking insects and lawn pests. The term "pest species" includes parasites.

Alternatively the organism may be a species beneficial to a crop species (for example by acting as a predator, parasite or competitor to a pest species or by acting to improve soil condition or as a pollinator) . Examples of beneficial species include earthworms, butterflies, moths and bees. If a beneficial organism is rendered resistant to a pesticide then the harmful side effects of that pesticide may be reduced. The organism may be a plant, for example, a crop plant.

Preferably, said organism is an animal.

Said organism may be a mammal, for example a rodent, preferably a mouse rat or rabbit . Preferably, said organism is an invertebrate, for example a nematode, preferably Caenorhabditis elegans .

Preferably, said organism is an arthropod.

Preferably, said organism is an insect.

Preferably, said organism is a fly. Preferably, said organism is Drosophila melanogaster, Drosophila simulans, or Drosophila virilis.

The organism may be an egg, nymph, larva, maggot or caterpillar.

The invention further provides a transgenic cell, cell line or organism for use in screening putative pesticides into which a gene encoding cyp6gl or a homologue, orthologue or derivative thereof or a fragment of any thereof is inserted and operably linked to a genetic control element suitable for constitutively or inducibly causing the expression of said gene, homologue, orthologue, fragment or derivative .

Derivatives of cypδgl include those resulting from nucleotide deletions, substitutions and additions, including those that cause a change in expression or a change in activity or specificity of the encoded enzyme.

The invention also provides a transgenic cell, cell line or organism for use in screening of pesticides into which genetic control elements have been inserted so as to constitutively or inducibly alter the expression of endogenous cypδgl or equivalents, derivatives, orthologues or homologues thereof or fragments of any thereof.

Preferably, the cell, cell line or organism relates to a pest of plants, animals or humans. Alternatively, the cell, cell line or organism may be directly or indirectly beneficial to plants, animals or humans .

Alternatively said cell, cell line or organism may be of a plant .

Alternatively said cell, cell line or organism may be of an animal, for example a mammal, preferably a rodent, for example a mouse rat or rabbit.

Alternatively, said cell, cell line or organism may be of an invertebrate, for example a nematode, preferably, Caenorhabditis elegans .

Preferably, said cell, cell line or organism is of an arthropod.

Preferably, said cell, cell line or organism is of an insect.

Preferably, said cell, cell line or organism is of a fly.

Preferably, said cell, cell line or organism is of Drosophila melanogaster, Drosophila simulans or Drosophila virilis.

Said cell, cell line or organism may be of an adult organism or an egg, nymph, larva, maggot or caterpillar.

The invention further provides the use of a transgenic cell, cell line or organism, as defined above, in the screening of putative pesticides.

Preferably, said putative pesticide is a putative insecticide .

Preferably, said putative pesticide is a putative agonist of a nicotinic acetylcholine receptor of the target species (es) .

Preferably, said putative pesticide is predicted to be a neonicotinoid or is a derivative of a known neonicotinoid. The invention further provides an eukaryotic or prokaryotic cell comprising an exogenous cyp6gl gene, derivative, equivalent, homologue or orthologue thereof or a fragment of any thereof, operably linked to one or more gene control elements suitable to cause constitutive or inducible expression of the gene or gene derivative or fragment of either thereof .

The invention also provides an eukaryotic cell comprising exogenous control elements operably linked to a cypδgl gene or cypδgl gene derivative, equivalent, homologue or orthologue or fragment of any thereof and suitable to cause constitutive or inducible expression of said gene or gene derivative or fragment of either thereof .

The invention also provides CYP6G1 protein or CYP6G1 protein derivatives, homologues or orthologues, or fragments of any thereof substantially isolated from that material with which it is associated in vivo .

Said protein may be recombinantly produced. Alternatively, said protein may be isolated from a naturally occurring source.

Alternatively, said protein may be artificially synthesised.

For recombinant expression of CYP6G1 proteins and CYP6G1 protein derivatives and fragments, a nucleic acid containing all or a portion of the nucleotide sequence encoding the protein may be inserted into an appropriate expression vector, that is, a vector that contains the necessary elements for the transcription and translation of the inserted protein coding sequence. In a preferred embodiment, the regulatory elements, for example the promoters, are heterologous, that is, not the gene's native regulatory elements. Promoters which may be used include the SV40 early promoter (Bernoist and Chambon, 1981, Nature 290: 304-310), and the promoter contained in the 3 ' long terminal repeat of Rous sarcoma virus (Yamamoto et al . , Cell 22: 787-797).

A variety of host-vector systems known in the art are suitable for expressing protein-coding sequences . These include mammalian cell systems infected with a virus (for example, vaccinia virus or adenovirus) ; insect cell systems infected with a virus (for example, baculovirus) ; microorganisms, for example yeast, containing yeast vectors; or bacteria transformed with bacteriophage, DNA, plasmid DNA, or cosmid DNA.

When a CYP6G1 protein, or a derivative or fragment of either thereof, has been expressed recombinantly, it may be isolated and purified by one or more standard methods including ion exchange, affinity or sizing column chromatography, centrifugation, differential solubility, or by any other standard technique for the isolation of proteins. A CYP6G1 protein may also be isolated by any standard isolation method from natural sources.

Alternatively, a CYP6G1 protein or an analogue or derivative thereof or a fragment of any thereof may be synthesized by standard chemical methods known in the art (see for example Hunkapiller et al . , 1984, Nature 310:105- 111) .

The invention also includes derivatives and fragments related to CYP6G1. In certain embodiments of the invention, the derivative or fragment is able to act as a degradative enzyme. Derivatives or analogues of CYP6G1 can be tested for the desired activity by various procedures, for example adaptations of the procedure given in Example 3. Manipulations of the CYP6G1 sequence may also be made at the protein level . Included within the scope of the invention are CYP6G1 protein fragments or other derivatives which are differentially modified during or after translation, for example, by glycosylation, acetylation or phosphorylation. Any of numerous chemical modifications may be carried out by known techniques, including specific chemical cleavage by cyanogen bromide, trypsin, oxidation or reduction.

In addition, analogues and fragments of CYP6G1 may be chemically synthesized. For example, a peptide corresponding to a portion of a CYP6G1 protein that comprises the desired domain, or that mediates the desired activity in vitro, can be synthesized by use of a peptide synthesizer. Furthermore, if desired, non-classical amino acids or chemical amino acid analogues can be introduced as a substitution or addition into the CYP6G1 sequence.

The CYP6G1 derivative may be a chimeric protein (also known as a fusion protein) comprising a CYP6G1 protein or fragment thereof joined at its amino- or carboxy- terminus via a peptide bond to an amino acid sequence of a different protein. In one embodiment, such a chimeric protein is produced by recombinant expression of a nucleic acid encoding the protein, comprising a CYP6G1-coding sequence joined in- frame to a coding sequence for a different protein. Such a chimeric product can be made by ligating the appropriate nucleic acid sequences encoding the desired amino acid sequences to each other by methods known in the art, in the proper coding frame, and expressing the chimeric product by methods commonly known in the art. Alternatively, such a chimeric product may be made by protein synthetic techniques, for example, by use of a peptide synthesizer.

The invention also provides the use of a polyclonal or monoclonal antibody or fragment thereof that is capable of binding to CYP6G1 or a derivatives, homologue, orthologue or equivalent of CYP6G1 or a fragment of any thereof. CYP6G1 proteins, including functional derivatives and fragments thereof, may be used as an antigen to generate monoclonal or polyclonal antibodies . Various known methods for antibody protection can be used including cell culture of hybridomas; production of monoclonal antibodies in germ-free animals (PCT/US90/02545) ; the use of human hybridomas (Cole et al., Proc. Natl . Acad. Sci. U.S.A. (1983) 80:2026-2030; Cole et al . , in Monoclonal Antibodies and Cancer Therapy (1985) Alan R. Liss, pp. 77-96), and production of humanized antibodies (Jones et al . , Nature (1986) 321:522-525; US Pat. No. 5,530,101) .

Antibodies may be used to manufacture antibody fragments or derivatives, for example chimeric antibodies, humanised antibodies, single chain antibodies and Fab fragments. The invention provides methods of determining the susceptibility of a chemical entity to degradation by CYP6G1 comprising contacting an amount of said chemical entity with an amount of CYP6G1 protein or a derivative thereof or a fragment of either thereof for a period of time, and then assessing the extent of degradation of said chemical entity. Example 3 herein discloses an example of a method suitable for determining susceptibility of a chemical entity to degradation by CYP6G1.

The invention also provides a method of determining the susceptibility of a chemical entity to degradation by CYPδGl protein or a derivative, equivalent, homologue or orthologue, of CYP6G1 protein, or a fragment of any thereof comprising contacting the chemical entity with the protein and assessing the extent of degradation of the chemical entity. Preferably, said chemical entity is a pesticide or putative pesticide.

Preferably, said chemical entity is an insecticide or putative insecticide. Preferably, said chemical entity is predicted to be a neonicotinoid or is a derivative of a known neoinicotinoid.

The invention further provides a method of predicting an organism's likely resistance to a putative pesticide that can be detoxified by CYP6G1 or an equivalent, homologue or orthologue of CYP6G1 or a fragment of any thereof, comprising detecting mutations at or affecting expression of the cypδgl locus or the locus of a cyp6gl equivalent homologue or orthologue or a fragment thereof . The invention further provides a method of predicting an organisms likely resistance to a putative pesticide which can be detoxified by CYP6G1 or an equivalent, homologue or orthologue of CYP6G1 or a fragment of any thereof, comprising detecting mutations in or affecting the enzymatic activity of CYP6G1 or an equivalent, homologue or orthologue of CYP6G1 or a fragment thereof .

The invention provides a method of detecting mutations at or affecting expression of the cypδgl locus in an organism in order to predict said organism's likely resistance to a pesticide which can be detoxified by CYP6G1.

By way of example, levels of cypδgl mRNA expression can be detected by hybridisation assays, for example Northern blots or dot blots, or reverse transcriptase-PCR using primers that preferably generate a fragment spanning at least most of the cyp6gl gene. Levels of CYP6G1 protein expression may be detected by immunoassays (for example, Western blots, radioimmunoassys, ELISAs, "sandwich" immunoassays, immunoprecipitation assays, precipitin reactions and gel diffusion precipitin reactions) . Additionally, PCR may be used in the manner illustrated by Example 5 to detect the presence of a mutation known to be a common cause of altered expression or activity levels. The invention provides a method of manufacturing a pesticide comprising: a) synthesising a number of chemical entities, b) testing said chemical entities for effectiveness in killing one or more species of pest organism, said pest organism exhibiting enhanced activity of CYP6G1 or an equivalent, derivative, fragment, orthologue or homologue thereof, c) selecting a chemical entity showing effective killing. The invention further provides a pesticide compound manufactured by: a) synthesising a number of novel chemical entities, b) testing said chemical entities for effectiveness in killing one or more species of pest organism, said pest organism exhibiting enhanced activity of CYP6G1 or an equivalent, derivative, fragment, orthologue or homologue thereof, c) selecting a chemical entity showing effective killing.

The invention provides a pest management strategy comprising: a) collecting a representative sample of pest organisms from the field, b) measuring the incidence of mutations at or affecting the cypδgl locus or the locus of a cyp6gl equivalent, homologue or orthologue, c) selecting a suitable pesticide or alternative pest control agent on the basis of the incidence of mutations at or affecting the cypδgl locus or the locus of a cypδgl equivalent, homologue or orthologue in the pest population. The novel chemical entities or putative pesticides are preferably neonicotinoid. Suitable novel chemical entities will include analogues and derivatives of known neonicotinoids, including Nitenpyram,Dinotefuran, Clothianidin, Thiamethoxam, Imidacloprid and Acetamiprid, the chemical structures and formulae of which will be apparent to those skilled in the art.

Additionally, suitably novel chemical entities will include any compounds that possess at least one structural moiety in common with one or more known neonicotinoids. The chemical entities may be made by any suitable synthetic techniques, including techniques of combinatorial chemistry. The present invention in this context offers the particular advantage that a range of compounds may be screened in a relatively straightforward and rapid manner to select any of the compounds having desired activity. The invention provides a method of reducing crop sensitivity to pesticides comprising transforming crop plants with a DNA molecule encoding cypδgl or a derivative, equivalent, homologue or orthologue thereof or fragment of any thereof . The invention provides a method of reducing pesticide residues on crop plants or reducing environmental contamination by a pesticide, comprising transforming crop plants with a DNA molecule encoding cypδgl or a derivative, equivalent, homologue or orthologue thereof, or a fragment of any thereof.

The invention provides a method of bioremediation of land contaminated with one or more pesticides or chemically similar substances, comprising applying to said land a product comprising bacteria, algae or cyanobacteria transformed with a DNA molecule encoding cyp6gl or a derivative, homologue or orthologue thereof or a fragment of any thereof . The invention provides a method of treatment or prophylaxis for pesticide poisoning comprising administering to a poisoned or potentially poisoned human or mammal a medicament comprising CYP6G1 or a homologue, orthologue, equivalent or derivative of CYPδGl or a fragment of any thereof.

The invention disclosed herein is based on the isolation of two new imidacloprid-resistant mutants that map to the same chromosomal location as Rst(2)DDT alleles, a gene responsible for resistance to DDT, and the discovery that individual organisms bearing existing Rst(2)DDT alleles, such as Rst (2) DDT^Hlkone~R, display pre-existing cross-resistance to imidacloprid. Resistance to both compounds maps to the same location in the Drosophila melanogaster genome. This region contains a cluster of cytochrome P450 genes, which is consistent with the hypothesis that cytochrome P450 genes are involved in the molecular basis of resistance.

DDT resistance in Drosophila melanogaster has been mapped by numerous investigators. Crow (1954, J Econ. Entomol. 47:393-398) concluded that resistance was polygenic in the strain that he studied. Later work by Ogita (1960, Botyu-Kagaku 26:7-18; 1961, Botyu-Kagaku 26:88-93) showed that DDT resistance mapped to a single, dominant, locus at 65cM on the right arm of chromosome 2, and that new alleles could be generated with X-rays. Since then, several other investigators have derived similar map locations, but none of these has been sufficiently accurate to allow for cloning of the gene responsible. We have now discovered that the presence of a major locus for DDT resistance is at ~64.5±2cM. Much work on putatively cytochrome P450-mediated resistance has been performed on different strains, notably 91-R, which shows less than 10-fold multi-factorial resistance to DDT, with resistance being associated with each of the three large chromosomes (Dapkus and Merrell 1977, Genetics 87:685-697). It is therefore difficult to relate this work directly to the DDT resistance locus on chromosome 2 discussed here. Pesticide resistance can involve both changes in regulation as well as point mutations that increase the efficiency of DDT metabolism. Regulatory loci may also reside at genomic locations other than the sites of the structural cytochrome P450 genes responsible for the metabolism of the insecticide.

In order to predict the likely mechanism of resistance to the neonicotinoid insecticide imidacloprid and to investigate a possible relationship between imidacloprid resistance and DDT resistance, we isolated two new imidacloprid resistance mutants by chemical mutagenesis. Here we show for the first time that these new mutations map to the same location as previously described Rst(2)DDT alleles and also confer cross-resistance to DDT. Furthermore, we show that Drosophila melanogaster bearing these pre-existing Rst(2)DDT alleles are themselves cross- resistant to imidacloprid. Via recombinational mapping relative to P-elements of known genomic location we localized the Rst(2)DDT gene to a specific region of the polytene chromosome map, 48D5-6 to 48F3-6. This region contains a cluster of cytochrome P450 genes, one of which, cyp6gl, we show to be over-expressed in all the resistant strains. This suggests that increased expression of cypδgl, that is to say, increased levels of CYP6G1 protein, is capable of metabolising both DDT and imidacloprid. In the following examples we also determine if cyp6gl is over-transcribed in all resistant D. melanogaster strains, and if so, is resistance globally associated with a single resistance allele and whether over-transcription of cypδgl alone is both necessary and sufficient for resistance. Certain embodiments of the invention will now be described in detail, by way of example, with reference to the accompanying drawings, in which:

Fig. 1 illustrates the scheme of genetic crosses used to map imidacloprid resistance to a specific autosomal chromosome;

Fig. 2 illustrates mapping of imidacloprid resistance against visible mutants on chromosome II;

Fig. 3 illustrates mapping of DDT resistance against P- elements of known chromosomal location;

Fig. 4 shows survival curves for the resistant mutants exposed to a) imidacloprid b) DDT and c) acetamiprid and nitenpyram;-

Fig. 5 shows a Northern blot of polyA+ mRNA isolated from resistant and susceptible fly strains, probed with a PCR-derived probe for cypδgl;

Fig. 6 (A) shows microarray analysis of Drosophila cytochrome P450 genes with the inset showing that cypδgl is over-transcribed in Hikone-R and all other strains examined; and

Fig. 6 (B) shows cypδgl transcription, relative to the standard RP49, via quantitative RT-PCR (LightCycler, Roche) in a range of susceptible and resistant strains (see Table 1 for strain origins) ; Fig. 7 (A) shows recombinational mapping against both visible mutants (en, cinnabar eyes and vg, vestigial wings) , P-element insertions of known genomic location and restriction fragment length polymorphisms (RFLPs) , shows that resistance to DDT and the novel insecticides imidacloprid (IMI) , nitenpyram (NIT) and lufenuron (LUF) maps to a region encompassing cypδgl . Map estimates for each compound are given (solid bar) alongside the predicted cytological regions encompassed (in paretheses) ;

Fig. 7 (B) shows a map of the genomic structure of the cypδgl locus showing the intron-exon organization of the gene and the location of the Accord element insertion in the resistant (Hikone-R) allele; and Fig. 7 (C) shows a detailed map of promoter region and Accord insertion in the 5' of cypδgl;

Fig. 8 (A) shows an inserted transgenic copy of cypδgl, under the control of GAL4/UAS with a heat-shock driver, is over-transcribed following heat-shock; and^* Fig. 8 (B) shows that heat-shock induced over- transcription of cypδgl allows the transgenic strains to survive a discriminating dose of 10 μg/vial of DDT;

Fig. 9 shows a PCR strategy used to detect a specific resistance mutation; and Fig. 10 (A) shows a survey of a range of susceptible (S_x_

₂₀) and resistant (Rι-n) fly strains (see Table 1 for strain origins) with a PCR based diagnostic to detect the presence or absence of the Accord element in the 5' end of the cypδgl gene; Fig. 10 (B) shows phylogeny of a global collection of susceptible (Sι-₂o) a d resistant (Rχ-₂o) DDT-R alleles; and

Fig. 10 (C) shows a comparison of the first intron sequence of the putative ancestral susceptible allele (found in strains S16 and S17) with the common resistant allele supports the hypothesis that all global resistant alleles are derived from this susceptible ancestor.

With reference to Fig. 1, Xa/CyO; TM3 is a multiply marked balancer strain of Drosophila melanogaster where chromosomes II and III carrying ap^Xa co-segregate due to a chromosome transposition. The other copies of chromosomes II and III (CyO and TM3) assort independently. Males of Rst (2)DDT^EMS1 and Rst (2) DDT^EMS2 are crossed to Xa/CyO;TM3 females and progeny are reared on 1.2 μg/vial imidacloprid. Emerging resistant males are crossed to Xa/CyO;TM3 females and progeny again reared on 1.2 μg/vial imidacloprid. The numbers of each phenotypic class of emerging flies are recorded in Table 2. The absence of CyO in the resistant progeny indicates that imidacloprid resistance is on chromosome II in both Rst (2)DDT^EMS1and Rst (2) DDT^EMS2.

Referring now to Fig. 2, there are shown (a) mapping cross and (b) resulting map position of imidacloprid resistance in strains Rst (2 ) DDT^Hikone"R, Rst (2) DDT""^00113111"1, Rst (2)DDT^EMS1 and Rst (2)DDT^EMS2. Imidacloprid resistance maps to approximately 65 cM in all four strains, between the visible markers cinnabar (en) and vestigal (vg) . Mapping data are shown in Table 3.

As shown in Fig. 3, each P-element insert carries a white⁺ (w⁺) gene within the P-element construct. This gene is expressed, serving as a visible marker of the P-element. Crosses were performed in a white mutant (w) eye background, (a) Mapping cross in which females are generated which are heterozygous for Rst (2) DDT and a P-element of known chromosomal location. Recombinants are then scored for the presence or absence of the resistance gene, thus localizing the gene to one side or other of the P-element. (b) Resulting localization of the DDT resistance gene against a number of different P-elements. Arrows indicate the relative orientation of the resistance gene to the different P- elements. The number of recombinants scored for resistance to both DDT and imidacloprid is given in Table 4. Inset shows genes in the 48D3-48F3 region to which resistance maps. Referring to Fig. 4, the response of the respective heterozygotes is similar to that for the resistant homozygotes, showing that the resistance to compounds is largely dominant (see Table 1 for statistical analysis of this data) .

In the Northern blot of polyA+mRNA of Fig. 5, probed with a PCR-derived probe for cypδgl, the same lanes were also probed with a PCR-derived probe for rp49 (a ribosonal "housekeeping" gene, O'Connell and Rosbash 1984, Nucleic Acid Res. 12:5495-5513) to illustrate the amount of mRNA loaded. Note that cyp6gl is over-expressed in both laboratory generated (EMS1) and field derived (Hikone-R and Wisconsin 1) resistant strains but not in susceptible strains (yw and Canton S) .

Referring to Figures 6 and 8, Fig. 6A and 8A, B, and C, figure 6A illustrates diagrammatically the 5 'untranslated region (UTR) of the cyp6gl gene from imidacloprid susceptible, for example wildtype or Canton-S, Drosophila melanogaster. Also illustrated is the 5' UTR from an imidacloprid resistant Drosophila melanogaster. Note that this part of the figures is not illustrative of the 5' UTR of cyp6gl of all imidacloprid resistant Drosophila melanogaster, rather that it is illustrative of a common class of Drosophila melanogaster strains, for example Hikone-R, that are resistant to imidacloprid. The nucleotide sequences of the 5 ' UTR from the susceptible and resistant organisms are substantially identical except, as shown in Figure 6A the 5' UTR from the resistant organism carries a 42 base pair deletion at a known location (flanking sequence illustrated) . The forward, that is, sense and reverse, that is, antisense, PCR primers may be annealed to genomic DNA sequence of both susceptible and resistant organisms. The primers span the site of the 42bp deletion. A suitable PCR program is then used to amplify the region of nucleic acid lying between the primers. PCR products are then electrophoresed on agarose gel, stained with ethidium bromide and visualised under suitable illumination. Fig 6B shows such a gel. The lane marked R was loaded with PCR products from the reaction that used DNA from a resistant organism as a target. The lane marked S was loaded with PCR products from the reaction that used DNA from a susceptible strain as a target. The unmarked lane was loaded with a molecular weight marker. It can be seen that the PCR produces a smaller product when DNA from a resistant organism is used as an amplification target, as opposed to when DNA from a susceptible organism, is used as an amplification target. Figure 8 shows another mutation found in resistant strains and not susceptible Drosophila strains. All resistant strains carry an insertion at the 5' end of cypδgl showing homology to the terminal direct repeat of an Accord transposable element (Fig. 8B) . The inventors believe that it is this insertion that is responsible for resistance. Effectively therefore, resistance may be determined by assaying for the resistance insertion mutation that confers resistance or by assaying for the 42 bp deletion which is linked to the resistance mutation. The 42 bp deletion linked to resistance, described in relation to Figure 6, has effectively been dragged along with the resistance mutation. However, it is probably that the 42 bp deletion may not be carried through to all resistant strains along with the Accord resistance mutation. Accordingly, it is prudent to look for the Accord insertion when assaying for resistance, rather than looking for the 42 bp deletion alone.

The invention will now be illustrated by way of non- limiting examples. Materials and Methods

Drosophila strains

As standard, that is approximating to wildtype, the Drosophila melanogaster insecticide susceptible strain

Canton-S was used. This strain was also used for chemical mutagenesis. The Canton-S strain is known to have insecticide susceptibility that is similar to that of wildtype flies. We compared our two newly generated mutants (Rst (2)DDT^EMS1 and (Rst (2) DDT^EMS2) to two field derived DDT resistance alleles. First, Hikone-R (Rst (2) DDT^Hikone"R) , a field collected strain from Japan and second, Wisconsin-1 (Rst (₂)DDT^wisconsin"1) , a field collected strain from Door County, Wisconsin, USA. Strains used for mapping were obtained from Bloomington Drosophila stock centre, Indiana.

Mutagenesis and screening

Canton-S males were mutagenised with ethyl methanesulfonate (EMS) as described in Grigliatti (1986, Mutagenesis, In: Roberts (ed) Drosophila: a practical approach. IRL Press, Oxford 39-58) . Mutagenised males were outcrossed to Canton-S females and their progeny screened for imidacloprid resistance. Briefly, up to 200 eggs were placed in vials with 1.5 g of instant fly food (Carolina) and 6 ml of water containing 1.2 μg of imidacloprid. This dose is above the minimum dose required to kill 100% of flies LCχoo of Canton-S. Any emerging flies surviving this dose were backcrossed to Canton-S and re-screened.

Dose response curves and cross-resistance

Dose response curves with both imidacloprid and DDT for the EMS mutants were derived using the computer program POLO (Robertson et al . 1980; POLO: a user's guide to probit or logic analysis. United States Forestry Service Technical Report PSW) . Also bioassayed were heterozygotes generated by backcrossing resistant strains to Canton-S. Further, the existing DDT resistant strains were bioassayed with imidacloprid to check for cross-resistance. For imidacloprid, 50 eggs were added to each vial which contained imidacloprid and the number of emerging adults counted. For DDT, females 1-3 days post-eclosion were used in a topical assay. DDT was coated to the inside of glass scintillation vials by applying 200 μl of acetone containing varying concentrations of DDT and rolling the vial until the acetone had evaporated. Vials were plugged with cotton wool soaked in 5 % sucrose. 20 flies were assayed in each vial and mortality was scored after 24 hrs . For both assays, five replicates at each concentration were used, and each dose- response curve is constructed from at least five concentrations. Control mortality in the absence of insecticide was taken into account in deriving dose response curves .

Resistance mapping and Northern analysis

Insecticide resistance was mapped in the different strains in three stages.

First, each resistant strain was crossed to the multiply marked balancer strain w ; T(2;3) ap^Xa, ap^X/CyO; TM3 , Sb in order to determine which chromosome resistance was associated with (see Fig. 1 for diagram of mapping strategy) . Survival of both males and females in screened progeny of a cross between attached-X females and resistant males indicated that resistance was not sex-linked (data not shown) .

Second, having established that resistance mapped to the second chromosome in each case, three point mapping was performed against the visible markers cinnabar (en) and vestigial (vg) (Fig. 2a) .

Third, Rst (2)DDT^isconsin_1 flies were crossed to stocks containing P-elements of known chromosomal location (Fig. 3a) , to allow for more precise localization of resistance by recombinational mapping against each P-element.

Northern analysis of polyA+ mRNA was carried out with PCR derived probes from several cytochrome P450 genes previously reported to be involved in insecticide resistance. TRI Reagent (Sigma) was used to isolate total RNA from adults 1-3 days post-eclosion, and mRNA was then isolated using the PolyATtract mRNA Isolation System (Promega) . Probes were made using the Prime-It II Random Primer Labeling Kit (Stratagene) with [α-³²P]dCTP. Fractionation of RNA and Northern hybridizations were performed using standard methods .

Example 1 - Dominance and cross-resistance

Groups of flies of the Canton-S, EMSl, Wisconsin-1 and Hikone-R strains, and groups of flies resulting from EMSl X

Canton-S, Canton-S X EMSl, Wisconsin-1 X Canton-S, Canton-S X Wisconsin-1, Hikone-R X Canton-S and Canton-R X Hikone-R FI crosses were assayed as described above for imidacloprid and DDT resistance. The minimum dose sufficient to kill 50% of the flies, that is LC₅₀, was calculated for each group of flies .

Resistance to imidacloprid in the new EMS mutants was ~8 fold (LC₅₀ for Canton-S = 0.53 μg/vial with 90% confidence limits of 0.42 and 0.68 μg/vial and for EMSl = 4.11 (3.19- 4.97) μg/vial). The imidacloprid resistant mutants also showed ~7 fold cross-resistance to DDT (LC₅₀ for Canton-S = 1.45 (1.22-1.72) μg/vial and for EMSl = 10.5 (6.73-13.74) μg/vial) (Table 1) . The dose response curves for the new mutants show that resistance to both imidacloprid and DDT is dominant, as the response of the heterozygotes is similar to the resistant homozygotes (Fig. 4) . Conversely, the field isolated DDT resistant strain Wisconsin-1 shows cross- resistance to imidacloprid with similar levels of dominance to both compounds (Fig. 4, Table 1) .

Table 1. Dose-response data for DDT and imidacloprid-treated Drosophila melanogaster.

^a Total number of samples tested in group ^b Concentration of test compound (in μg/vial)

LC₅₀ is the minimum dose sufficient to kill 50% of flies. ^c SE is standard error. ^d Resistance ratio (RR) , i.e. level of resistance relative to Canton-S 90% CL = 90% confidence limits Similar experiments were carried out to determine cross- resistance to other neonicotinoid insecticides beyond imidacloprid and the results of these experiments are shown in Figure 4c.

Variable concentrations (micrograms per vial) of insecticide were added to artificial larval diet. A known number of eggs were then added to the vial and the number of emerging flies subsequently recorded. Results were expressed as percentage mortality (i.e. the number of flies emerging against the number of eggs added) .

The results (Fig. 4c) show dose-mortality curves for DDT (the compound with which was originally screened for resistance) , imidacloprid (the first neonicotinoid, that has been widely used and to which cyp6gl confers cross- resistance) and two new neonicotinoids (acetamiprid and nitenpyram) . This example is of utility as it demonstrates that cypδgl also confers cross-resistance to likely replacements of imidacloprid (i.e. using acetamiprid or nitenpyram on cyp6gl mediated resistance selected for by imidacloprid, would not overcome resistance) .

Example 2 - Resistance mapping and Northern analysis In both of the new EMS induced imidacloprid resistant mutants, that is, EMSl and EMS2, and also in both of the field derived DDT resistant strains, that is, Hikone-R and Wisconsin-1, resistance to imidacloprid and DDT was mapped to the second chromosome (Table 2) . Further, resistance in both EMS mutants and also the

Wisconsin-1 field strain mapped to - 65 cM by three point mapping against en and vg (Table 3, Fig. 2b) . Table 2. Imidacloprid-resistance in Rst (2) DDT^EMS1 and Rst (2)DDT^EMS2 maps to chromosome 2

^a Genotypes generated from crosses between w;T(2;3) apXa,apXa/CyO;TM3, Sb flies [Drosophila stock centre

(Bloomington, Indiana USA) stock number 2475] and EMS mutants . ^b Numbers refer to progeny of each genotype from the cross in Fig. 1 ^c Control flies were reared on medium that contained no imidacloprid ^d Screened flies were reared on medium containing imidacloprid

(1.2 μg/vial)

Table 3. Recombination mapping of imidacloprid resistance relative to the visible markers cinnabar (en) and vestigial (vg) .

^a Drosophila Stock Center (Bloomington, Indiana , USA) stock .

Strain cnvgbw has stock number 3984 ^b Rst (2) DDT^wisconsin-¹ was mapped using a en Rst (2 ) DDT*^1800113111-¹ vg strain .

Fitness was calculated from unselected lines using numbers predicted with the map positions of markers ^d The genetic distance between the resistance gene and the indicated marker was calculated, following adjustment for fitness, as recombinants/total x 100

More precise localization by recombinational mapping of Rst (2)DDT^wisconsιn"1 against P-elements of known location showed that resistance lies between P1080 and P491, defining a region of the chromosome from 48D5-6 to 48F3-6 (Table 4, Fig. 3b) . Examination of predicted open reading frames within this region of the genome showed that there is a cluster of P450 genes present (Fig. 3b) , consistent with the discovery that resistance is associated with a cytochrome P450 containing locus .

Table 4. Mapping of DDT resistance in Rst (2) DDT"^1300113111"1 relative to P-element insertions of known location.

Drosophila stock centre number (Bloomington, Indiana, USA) stock numbers, strain w,-vg has stock number 3132. ^b Every line resistant to DDT was also resistant to imidacloprid.

Thirteen P450 genes were examined by Northern analysis. These were chosen from the estimated 90 P450 genes in Drosophila melanogaster. Of the thirteen cytochrome P450 genes examined via Northern analysis only the message for cypδgl was significantly over-expressed. Further, the message for this gene was over-expressed in all the resistant strains examined (Fig. 5) . In contrast, cyp6g2 and cyp6t3, two genes in the same cluster, showed similar levels of expression between the resistant and susceptible strains, as did the ten other cytochrome P450 genes examined from different locations throughout the genome (Table 5) . Table 5. Drosophila melanogaster cytochrome P450 genes examined for over-expression

^a n.d/n.d. not detectable in susceptible or resistant strains, -/- equally expressed in susceptible and resistant strains, - /+ over-expressed in resistant strains ^b Difference in protein and/or RNA levels between resistant and susceptible strains or P450 involved in toxin metabolism

Example 3 - Use of recombinant CYP6G1 protein in an in vitro assay

Drosophila melanogaster cytochrome P450 CYP6G1 enzyme assays were performed in lOOμl of medium containing the following substances at the final concentrations indicated: 50mM N-2-hydroxyethylpiperazine-N' -ethanesulfonic acid (HEPES) pH 7.4

15mM MgCl₂

0. ImM Ethylenediaminetetraacetie acid (EDTA) containing 200μM reduced nicotine adenine dinucleotide phosphate (NADPH)

A NADPH regenerating system containing 2mM glucose- 6-phosphate and 2 units/ml glucose-6-phosphate dehydrogenase

0.5μM Recombinant house fly NADPH dependent cytochrome P450 reductase (Guzov et al . , 1996, J. Biol . Chem. 271:26637- 26645) lμM Recombinant house fly cytochrome b₅ (Guzov et al . , 1996, J. Biol. Chem. 271:26637-26645).

0.2μM CYP6G1 was added to the reaction medium, which was then incubated on ice for 15 minutes. Enzyme substrate (or putative substrate) was then added and the reaction allowed to start by incubating the medium to 30 ^*C for 5 to 60 minutes. Substrate (or putative substrate), for example DDT, aldrin, heptachlor, diazinon, imidacloprid or a novel chemical entity was added at lOOμM to give a final reaction volume of lOOμl.

Following incubation, the reaction was stopped by the addition of 20μl of 5N HCl . The reaction mixture was then extracted with 0.5 iso-octane and analysed by gas chromatography with electron capture detection (Andersen et al . , 1994, Biochemistry 33:2171-2177) to allow detection of reactants and/or expected breakdown products.

Alternatively, the substrate was radiolabelled, for example with ¹⁴C at 100,000 counts per minute (cpm), and the reaction mixture extracted with 0.5ml ethyl acetate supplemented with reference standards of un-metabolised substrate and/or expected breakdown products, concentrated by solvent evaporation if required, and separated by thin layer chromatography (TLC) in, for example, a 9:1 chloroform: acectone mixture. TLC plates were then exposed to X-ray film autoradiography) or bands of the TLC plate cut out and quantified for radioactivity by liquid scintillation counting.

Alternative assays may be appropriate to detect breakdown of specific compounds. For example, dimethylnirosamine may is broken down to inter alia formaldehyde which may be detected using the Nash reagent (Werringloer, 1978, Methods Enzymol . , 52C: 297-302) .

Example 4 - Inducible expression of cypβgl in Drosophila melanogaster

The galactose 4 (GAL4) system provides a method for directing ectopic gene expression. This example discloses data from the use of the GAL4 system to manipulate cypδgl expression in Drosophila melanogaster and directly implicate the over expression of cyp6gl in drosophila resistance to DDT and imidacloprid. GAL4 is a yeast transcriptional activator. When expressed in Drosophila melanogaster GAL4 binds to specific DNA sequences, called GAL4-responsive elements, and may be used to activate the expression of a linked transgene .

Briefly, we coupled the GAL4-responsive element known as upstream activating sequence (UAS) to the cypδgl gene using molecular biology cloning techniques . This DNA construct was then introduced into Drosophila melanogaster via P-element- mediated germline transformation. Over 150 Drosophila melanogaster strains exist in the art that express GAL4 in a cell-, tissue- or temporal-specific manner. They do this by having the gene for GAL4 linked to specific gene enhancers. By crossing flies from one of our strains with our UAS-cypδgl transgenic flies, the expression of GAL4 and consequently CYP6G1 can be controlled. The GAL4 system can also work in any other species for which germ line transformation techniques are available .

In more detail, the cyp6gl open reading frame was amplified from genomic DNA of the Canton-S strain using the polymerase chain reaction (PCR) (forward primer (SEQ. ID. NO. 1) : CGACAGCGGCCGCATGGTGTTGACCGAGGTC, reverse primer (SEQ. ID. NO. 2) : GCGATTCTAGATCATTGGAGCGATGGAGC) using rTth DNA Polymerase and supplier's instructions (PE Biosystems) . The forward PCR primer contains a restriction endonuclease recognition sites for Notl . The reverse PCR primer contains a restriction endonuclease recognition site for Xbal . Both restriction sites are underlined in the primer sequence given above. The PCR product was digested with Notl and Xbal, and ligated into the pUAST vector (Brand and Perrimon 1993,

Development 118:401-415), which had been digested with the same enzymes. Electro-competent XL1 Blue Escherichia coli cells were transformed with the plasmid construct, plated on L-Broth agar containing ampicilin. Plasmid DNA was purified from the resulting colonies. The plasmid insert from a number of colonies was DNA sequenced to check integrity. A plasmid construct (named pUAST-Cyp6gl) containing the expected DNA sequence was transformed into Drosophila melanogaster embryos of the y w strain by P element mediated germ-line transformation using the helper plasmid pπ25.7 (Rubin and Spradling, 1982, Science 218:248-353). Transformed flies (designated UAS-Cypδgl) were identified by the w⁺ eye marker and inbred lines were made using standard techniques (Spradling, 1986, P element-mediated transformation. In "Drosophila: a practical approach" D. B. Roberts (ed) . IRL Press Oxford. ppl75-198) . The UAS-Cyp6gl fly line was crossed to flies of the strain w;P{w⁺GAL4- HSP7θ}2/CyO (Bloomington strain number 2077) , which are transgenic flies containing a GAL4 construct linked to a heat shock promoter.

Adult progeny were heat-shocked 10 times at 37°C for 20 minutes with 20 minutes recovery at 25°C. This enhanced the expression of the GAL4 gene, leading to expression of cypδgl. Flies were then assayed for DDT resistance by being given a normally lethal dose of lOμg/vial DDT as detailed in the materials and methods section preceding the examples given in this specification. The results of this assay are shown in table 6, and demonstrate that significant levels of DDT resistance and therefore survival only exist in flies in which the heat shocks caused an up regulation of GAL4 and cyp6gl expression.

Table 6. Percentage mortality of 100 heat-shocked and non- heat-shocked Drosophila melanogaster treated with lOμg/vial DDT.

^a flies containing the GAL4 transgene linked to a heat-shock promoter ^b flies containing the cyp6gl transgene linked to GAL4 responsive promoter

Example 5 - Correlation between Cypβgl expression and DDT resistance in Drosophila

The cytochrome P450s are a large gene family involved in a wide variety of metabolic functions. In insects these enzymes play roles in key processes ranging from host plant utilization to xenobiotic resistance. Within the complete genome sequence of Drosophila, some 90 individual P450 genes have been identified. To determine the breadth of the correlation between cypδgl over-expression and DDT resistance in Drosophila we challenged a micro-array carrying PCR products from all identified P450 open reading frames in the genome .

The relative hybrization ratio of resistant (Hikone-R) versus susceptible (Canton-S) mRNA to an array containing PCR derived products of P450 gene open reading frames was plotted against absolute intensity (relative transcript abundance) for each gene. Array analysis, of the reference strain Hikone-R which was established in the early 1960s shows that only cyp6gl is over expressed relative to Canton-S, a susceptible reference strain (Fig. 6a) . Cyp6gl is over- transcribed in Hikone-R and all other strains examined (inset Fig. 6a) . Note this analysis not only reveals genes over- expressed in resistant strains but also shows transcripts such as cyp4gl that are over-abundant in all strains examined .

Cypδgl transcription, relative to the standard RP49 was measured via quantitative RT-PCR (LightCycler, Roche) in a range of susceptible and resistant strains (see Table 7 for strain origins) . Primers used in the PCR were RP49F-ATCCGCCCAGCATACAG (SEQ ID NO. 3) RP49R-TCCGACCAGGTTACAAGAA (SEQ ID NO. 4) 6G1F-CGGCTGAAGGACGAGGCTGTG (SEQ ID NO. 5) and 6G1R-GCTATGCTGTCCGTGGAGAACTGA (SEQ ID NO . 6) PCR conditions were RT 55°C, 30 min. , PCR 45 cycles of 95^*C 5 sec, 50^*C 10 sec, 72°C 25 sec and 83'C to read fluorescence, using reagents and following protocols in Lightcycler-RNA Amplification Kit SYBR Greenl (Roche) . All resistant strains showed 10-100 fold over-transcription of cypδgl relative to the range of susceptible strains examined.

Similarly, analysis of other DDT resistant strains revealed the same result, with only cypδgl being over transcribed relative to P450 gene expression in the susceptible standard. To measure the level of over- transcription associated with resistance we performed quantitative RT-PCR on RNA from a range of resistant and susceptible strains, relative to the standard RP49. This analysis confirms the relative over-expression of cypδgl in a range of strains and shows 10-100 fold more mRNA in resistant strains relative to a range of susceptible strains (Fig. 6b) .

Example 6 - Cross resistance conferred by DDT-R To examine the range of novel insecticides to which DDT- R confers cross-resistance, we mapped resistance to a chlorinated hydrocarbon (DDT) , two neonicotinoid nicotinic acetylcholine receptor agonists (imidacloprid and nitropyren) , and a novel insect growth regulator (lufenuron) . We measured recombination rates against both visible genetic markers and also P-element insertions of known location.

Recombinational mapping against both visible mutants (en, cinnabar eyes and vg, vestigial wings) , P-element insertions of known genomic location and restriction fragment length polymorphisms (RFLPs) , shows that resistance to DDT and the novel insecticides imidacloprid (IMI) , nitenpyram (NIT) and lufenuron (LUF) maps within the same genetic region encompassing the cyp6gl locus (Fig. 7a) . This suggests that a single P450 may be capable of metabolizing a wide range of insecticide structures. Map estimates for each compound are given (solid bar) alongside the predicted cytological regions encompassed (in parentheses) . To examine the population genetics of DDT-R in global populations of D. melanogaster, we completely sequenced two different resistant alleles, Hikone-R and WC2. Both alleles have an identical nucleotide sequence and both carry an insertion in the 5' end of cyp6gl showing homology to the terminal direct repeat of an Accord transposable element (Fig. 7b) which was located by PCR diagnosis using PCR primers : 5'F- GAAAGCCGGTTGTGTTTAATTAT (SEQ ID NO. 7) 5'R-CTTTTTGTGTGCTATGGTTTAGTTAG (SEQ ID NO. 8) and accF-GGGTGCAACAGAGTTTCAGGTA (SEQ ID NO . 9) to amplify a section of the first intron, and intlF- GAGTATAAAAACGCAAACAACATT (SEQ ID NO. 10) and intlR-TTAATCAAATGCCAGTGC (SEQ ID NO. 11) for phylogenetic analysis of the susceptible and resistant alleles.

Figure 7c shows a detailed map of promoter region and Accord insertion in the 5' of cypδgl. The native cypδgl promoter contains a downstream promoter element (DPE) and initiator (Inr) from where transcription is believed to start (+1) . The consensus sequence for this promoter type is CACTTTGCTGATGTCGCCTACCG (SEQ ID NO. 12) as shown. The 491 bp of Accord element is inserted 292 bases 5' of the initiation of transcription (-292) . An additional promoter sequence (score of 1.00 for promoter prediction in the Neural Network Promoter Prediction program, http://www.fruitfly.org/seq_tools/promoter.html) is also found internal to the Accord element (-359 to native cypδgl Inr and indicated by an arrow) . Sequences of the 5' region of cypδgl form Drosophila melanogaster resistance Hikone-R and susceptible Canton-S strains are provided as SEQ ID NOs . 13 and 14 respectively. To further examine the similarity of the resistance alleles within the 20 different DDT resistant strains we collected from around the globe (Table 7) , we surveyed resistant and susceptible strains for the presence or absence of the transposon. We also sequenced the first intron of the cyp6gl gene in the same resistant and susceptible strains. A PCR diagnostic for the presence of the transposon, based upon the length of the product generated, showed the Accord insertion was present in all 20 resistant alleles.

Table 7. Source (or donor) and resistance status of Drosophila melanogaster strains. S, susceptible; R, resistant .

s Name Origin R Name Origin

SI Canton-S Laboratory standard Rl Hikone-R Japan

S2 CA 1 South Africa R2 BOG 2 Columbia

S3 SA 4 South Africa R3 PYR 2 Spain

S4 BOG 1 Columbia R4 Hikone-A-W Japan

S5 BOG 3 Columbia R5 Hikone-A-S Japan

S6 PVM Portugal R6 EV New York, USA

S7 M 2 Australia R7 RVC 2 California, USA

S8 VAG 1 Greece R8 RVC 3 California, USA

S9 QI 2 Israel R9 Pi[[2]]<P> Wisconsin, USA

S10 Reids 1 Portugal R10 CO 4 New York, USA

Sll Reids 3 Portugal Rll C07 New York, USA

S12 Wild 3B Ohio, USA R12 MR-Haifa 12 Israel, USA

S13 Swedish-C Sweden R13 Wild IB New York, USA

S14 MWA 1 Wisconsin, USA Rl₄ Wild 2A Ohio, USA

S15 BV 1 Virginia, USA R15 Wild 5A Georgia, USA

S16 BS 1 Spain R16 Wild 5B Georgia, USA

S17 BER 1 Bermuda R17 Wild 5C Georgia, USA

S18 Florida9 Florida, USA R18 Wild 10E South Carolina, USA

S19 Harwich M. Kidwell, USA R19 Wild 11C North Carolina, USA

S20 Oregon-R-C Oregon, USA R20 Wild 11D North Carolina, USA R21 WC2 Vermont , USA

Example 7 - cypβgl alone confers DDT resistance

To prove that over-expression of cypδgl alone is responsible for DDT resistance, we produced resistance in transgenic flies carrying an inserted copy of cyp6gl driven by the GAL4/UAS system. Following P-element mediated germline transformation of constructs containing UAS-cyp6gl we were able to over-transcribe the inserted copy of the gene using heat-shock based GAL4 drivers. We again quantified the level of over-transcription from the cyp6gl transgene via quantitative RT-PCR relative to RP49 expression. Figure 8a shows an inserted transgenic copy of cyp6gl, under the control of GAL4/UAS with a heat-shock driver, can be over-transcribed following heat-shock. Ten 20 min. heat-shock (37°C) treatments (with a 20 min 25°C recovery between heat shocks) of two different transgenic fly lines (GAL4/UAS- Cyp6gl^x and GAL4/UAS-Cyp6gl², on the X and 2nd chromosome respectively) up-regulated the cyp6gl transcript by approximately 100 fold in both strains. These results show that transgenic over-expression leads to ~100 fold overabundance of cyp6gl transcript relative to susceptible non- transgenic fly strains.

Heat-shock induced over-transcription of cypδgl allows the transgenic strains to survive a discriminating dose of 10 μg/vial of DDT, whereas controls lacking the GAL4 drivers, and thus lacking over-expression of the inserted copy of the gene, were susceptible (Fig. 8b) Adult flies were exposed to DDT applied to the inside of 20 ml glass scintillation vials as described previously. These transgenic experiments prove that over-expression of cyp6gl alone is both necessary and sufficient for DDT resistance.

Example 8 - Detection of cypβgl expression mutants

The expression levels of cyp6gl in an organism may be altered by naturally occurring or induced mutations of the untranslated expression control regions of the cypδgl gene. In the Hikone-R and Wisconsin-1 field isolated strains and in all other field isolated strains that are resistant to imidacloprid that were examined, up regulation of cypδgl expression is linked common mutations. One common mutation is a specific 42 base pair (bp) deletion in the 5' untranslated region (5 'UTR) of the cypδgl gene, close to the start of the cypδgl open reading frame . The sequence of the deleted region is provided as SEQ ID NO. 15. It is likely that this deletion is of a region of nucleic acid to which an expression repressor element normally binds. When that repressor element binding site is deleted, the repressor element is unable to bind and cypδgl expression is released from its normal suppression.

Another common mutation is an insertion in the 5' end of cypδgl . The mutations are common in all field isolated imidacloprid-resistant strains of Drosophila melanogaster investigated so far and therefore detection of the mutations may be used as a method of predicting an organism's likely resistance to a putative pesticide that can be detoxified by CYPδGl . Additionally, a pest management strategy may comprise measuring the incidence of the above-mentioned mutations in a pest population in order to predict that population's susceptibility to a putative pesticide that is detoxified by CYP6G1. As the 42 bp deletion is only linked to resistance it is prudent to detect the Accord insertion in addition to or instead of the 42 bp deletion when assaying for potential resistant species.

a) To detect resistance via the 42 bp flanking deletion:

SEQ. ID. No. 16 gives the sequence of the 5' untranslated region of cyp6gl from a typical imidacloprid susceptible strain of Drosophila melanogaster, for example the iso-1 strains which is also genetically termed y, en bw,sp. SEQ. ID. No. 17 gives the sequence for the 5' untranslated region of cypβgl from a typical imidacloprid resistant strain of Drosophila melanogaster, for example Hikone-R. The genotype of an individual Drosophila melanogaster with respect to the 42 bp 5' UTR deletion may be determined by following the method given below:

1. Genomic DNA was isolated from individual Drosophila melanogaster using standard extraction techniques, for example Promega' s Wizard® genomic DNA purification kit.

2. PCR was carried out using Taq Supreme DNA polymerase kits (Helena BioSciences, Sunderland, Tyne and Wear, UK) and an Omn-E™ thermal cycler with tube temperature control

(Hybaid) . All other reagents were purchased from Promega UK. 2μl (approximately 0.1 to lμg) of the extracted DNA (the

^Λtemplate' ) was aliquoted into a thin-walled 0.5ml Eppendorf tube (Advanced Biotechnologies Ltd) The following where additionally added to the tube to give a total volume of 49.5μl water 24.5μl

10x MgCl₂-freeTaq buffer 5μl

330μM of each dNTP 5μl lOμM forward primer 5μl lOμM reverse primer 5μl 25mM MgCl 3μl

SEQ. ID. NO. 18 shows the forward primer used in PCR and SEQ. ID. NO. 19 shows the reverse primer used in PCR, according to the scheme shown in Figure 9A. The primers span the site of the 42bp deletion. SEQ. ID. NO. 18 GAGTATAAAAACGCAAACAACATT SEQ. ID. NO. 19 TTAATCAAATGCCAGTGC The tube was capped, "vortexed" and centrifuged to gather contents at the bottom of the tube. The tube was placed on the thermal cycler and incubated at 95 ^*C for 2 minutes . One Unit of Taq polymerase in 5μl of storage buffer was then added to the tube . The tube was then resealed and the following thermal cycling program was run with the thermal cycler heated lid switched on and pre-heated: 40 cycles of 95 "C for 1 minute

55 ^*C for 1 minute 72 ^*C for 2.5 minutes

5μl of the reaction mixture was then electrophoresed on a 1.0% agarose gel containing ethidium bromide at a final concentration of lOOmg l^"1. Molecular weight markers (Promega) were simultaneously electrophoresed in an adjacent lane to allow for PCR product size determination. Markers were added as recommended by the manufacturer.

Electrophoresis was at 100 Volts and approximately 50 milliamps for 1 hour. The gel was visualised by UV trans- illumination and images were captured, saved to floppy disk and printed using the Enhanced Analysis System (EASY, version 4.19, Scotlab, Coatbridge, Lanarkshire, UK).

Figure 9B shows a gel containing PCR products obtained using target DNA from a imidacloprid resistant fly with the 42 bp 5 'UTR deletion in the lane marked R, and PCR products obtained using target DNA from a imidacloprid-susceptible fly without the 42 bp 5 'UTR deletion in the lane marked S. The unmarked lane was loaded with a molecular weight marker. It can be seen that the PCR produces a smaller product when DNA from a resistant organism is used as an amplification target, as opposed to when DNA from a susceptible organism, is used as an amplification target.

The sequences flanking the 42bp deletion, as shown in Figure 9A are : SEQ. ID. NO. 20 TTAAGACGAA SEQ. ID. NO. 21 AAGATTTTCT

b) To detect resistance via the Accord insertion: PCR diagnosis may be carried out as described above in relation to the 42 bp deletion, but using PCR primers: 5'F- GAAAGCCGGTTGTGTTTAATTAT (SEQ ID NO . 7) 5'R-CTTTTTGTGTGCTATGGTTTAGTTAG (SEQ ID NO. 8) and accF-GGGTGCAACAGAGTTTCAGGTA (SEQ ID NO. 9) to amplify a section of the first intron, and intlF- GAGTATAAAAACGCAAACAACATT (SEQ ID NO . 10) and intlR-TTAATCAAATGCCAGTGC (SEQ ID NO. 11) for phylogenetic analysis of the susceptible and resistant alleles . Figure 10a shows a survey of a range of susceptible (Sa_._ ₂₀) and resistant (R1-20) fly strains (see Table 7 for strain origins) with a PCR based diagnostic to detect the presence or absence of the Accord element in the 5' end of the cyp6gl gene. Note the perfect correlation between the presence of the element (larger, Accord associated 250 bp PCR product) and resistance. All resistant cypδgl alleles show identical nucleotide sequence within the first intron, supporting a single global origin of DDT-R. The similarity of all the resistant alleles is also supported by a phylogeny of DNA sequences derived from the first intron of the cyp6gl gene. Figure 10b shows that the susceptible alleles belong to one of seven different clades of diverse geographic origin. In contrast, the resistant alleles all belong to a single well-supported clade, also containing a single susceptible genotype. This genotype is therefore the putative susceptible progenitor of the resistant allele which has spread globally, under the combined influences of insecticide selection and migration. The sequences were aligned using the Clustal-W algorithm implemented in MEGALIGN (DNASTAR; Lasergene) . A neighbour-joining tree of 675 nucleotides of the first intron of the cyp6gl gene was then constructed using MEGA 2.1 (Kumar 2000), using the Kimura-2 -parameter model of distance estimation. Missing sites (insertions or deletions) were excluded from the analysis. Bootstrap resampling was performed for 2,000 replicates, scores above 60 are shown. The major branches (those supported by bootstrap scores of >60) were also supported by a maximum likelihood tree constructed using PAUP*4.0bl0 (Swofford 2000) using the HKY85 + G + I model of DNA substitution.

As shown in Figure 10c, comparison of the first intron sequence of the putative ancestral susceptible allele (found in strains S16 and S17) with the common resistant allele supports the hypothesis that all global resistant alleles are derived from this susceptible ancestor. Note that only variable nucleotide positions are shown.

The observation that the nucleotide sequence of the first intron in cyp6gl (291 bp away from the site of the insertion) is identical in all the resistant alleles, supports the concept of this global spread and suggests strong linkage-disequilibrium or *hitch-hiking' of nucleotide variation with the spread of DDT resistance.

Although several studies have implicated the over- expression or alteration of individual P450s in insecticide resistance, our results raise several important new conclusions for the molecular basis and origins of metabolic resistance. First, given the number of P450 genes present in Drosophila and the potential complexity of their interactions, it is unexpected that a single allele of a single gene could be associated with such widespread insecticide resistance. Second, the Accord insertion brings with it an additional putative consensus promoter SEQ ID NO 12 (Fig. 7c) . This therefore raises the formal possibility that over-transcription is associated either with this additional promoter activity or with the disruption of spatial or temporal control elements within the 5' end of the cypδgl gene itself. Although the possibility that insecticide resistance might involve transposable elements has previously been raised, a previous association of a transposable element with a P450 gene thought to be associated with resistance was subsequently disproven. In the current study, although linkage between resistance and the Accord element is complete, the causal relationship between the element and over-transcription remains to be proven. Third, and finally, earlier work on amplified esterase genes in mosquitoes, suggested that a single global spread of one specific amplicon accounted for insecticide resistance in global populations of Culex pipiens mosquitoes. Further analysis of mosquito populations, however, showed that numerous different mutational events, and their resulting amplicons, in fact make up the extant global population of resistance alleles in mosquitoes. Thus, our description of an identical resistant allele in 20 DDT resistant strains of Drosophila of diverse geographic origin is the first truly global spread of a single insecticide resistance allele.

References :

The full titles of the papers referred to in the table are as below. Other references are provided in full throughout the specification.

Amichot M, Brun A, Cuany A, Helvig C, Salaun JP, Durst F, Berge JB (1994) Expression study of CYP genes in Drosophila strains resistant or sensitive to insecticides. Cytochrome P450. 8th International Conference. 689-692.

Berenbaum MR, Cohen MB, Schuler MA (1990) Cytochrome P450 in plant-insect interactions: inductions and deductions. In: Hagedorn HH, Hildebrand JG, Kidwell MG, Law JH (eds.) Molecular insect science, Plenum, New York, pp 257-262.

Brun A, Cuany A, Le Mouel T, Berge J, Amichot M (1996) Inducibility of the Drosophila melanogaster cytochrome P450 gene, CYP6A2, by phenobarbital in insecticide susceptible or resistant strains. Insect Biochem. Molec Biol. 26: 697-703.

Cariho FA, Koener JF, Plapp FW, Jr., Feyereisen R (1994) Constitutive overexpression of the cytochrome P450 gene CYP6A1 in a house fly strain with metabolic resistance to insecticides. Insect Biochem. Mol . Biol. 24: 411-418.

Guzov VM, Unnithan GC, Chernogolov AA, Feyereisen R (1998) CYP12A1, a mitochondrial cytochrome P450 from the house fly. Arch. Biochem. Biophys. 359: 231-240.

Maitra S, Dombrowski SM, Basu M, Raustol 0, Waters LC, Ganguly R (2000) Factors on the third chromosome affect the level of Cyp6a2 and Cyp6a8 expression in Drosophila melanogaster. Gene 248: 147-56.

Maitra S, Dombrowski SM, Waters LC, Ganguly R (1996) Three second chromosome-linked clustered Cyp6 genes show differential constitutive and barbital-induced expression in DDT-resistant and susceptible strains of Drosophila melanogaster. Gene 180: 165-171.

Snyder MJ, Stevens JL, Andersen JF, Feyereisen R (1995)

Expression of cytochrome P450 genes of the CYP4 family in midgut and fat body of the tobacco hornworm, Manduca sexta. Arch. Biochem. Biophys. 321: 13-20.

Tomita T, Liu N, Smith FF, Sridhar P, Scott JG (1995)

Molecular mechanisms involved in increased expression of a cytochrome P450 responsible for pyrethroid resistance in the housefly, Musca domestica. Insect Mol. Biol. 4: 135-140.

Waters LC, Zelhof AC, Shaw BJ, Ch'ang LY (1992) Possible involvement of the long terminal repeat of transposable element 17.6 in regulating expression of an insecticide resistance-associated P450 gene in Drosophila. Proc Na l . Acad. Sci. USA 89: 4855-4859.

Claims

1. Use of a cell, cell line or organism in which the activity of cyp6gl or derivatives thereof or fragments or either thereof is increased relative to wildtype activity of cypδgl for the screening of putative pesticides.

2. Use as claimed in claim 1, wherein the cell, cell line or organism is obtainable by chemical mutagenesis followed by selection, or radiation induced mutagenesis followed by selection.

3. Use as claimed in claim 1, wherein the cell, cell line or organism is obtainable by the insertion into said organism of nucleic acid comprising sequence encoding cypδgl protein, or expression control elements thereof or fragments of any thereof.

4. Use as claimed in claim 1, wherein the cell, cell line or organism is obtainable by the insertion into said organism of a transposable element .

5. Use according to claim 1 in which the transposable element comprises the Accord nucleotide sequence.

6. Use as claimed in any one of claim 1, wherein the cell, cell line or organism is obtainable by functional activation of the cyp6gl gene or derivatives thereof, or expression control elements thereof or fragments of any thereof.

7. Use according to claim 1, wherein increased activity of cypδgl is caused by increased enzymatic activity or specificity of cyp6gl enzyme or derivative thereof or f agment of either thereof .

8. Use as claimed in claim 7, wherein said activity or specificity of cypδgl enzyme is increased by chemical mutagenesis of cypδgl gene or a derivative thereof or a fragment of any thereof followed by selection, or radiation induced mutagenesis of cyp6gl gene or a derivative thereof or fragment of either thereof, followed by selection.

9. Use as claimed in claim 7, wherein said activity or specificity of cypδgl is increased by site directed mutagenesis of cyp6gl gene or a derivative or fragment of either thereof.

10. Use as claimed in claim 1, wherein increased activity of cyp6gl protein is detected by assaying for a deletion in the 5' end of the cyp6gl gene.

11. Use as claimed in claim 10, wherein the deletion comprises a 42 base pair deletion in the 5' untranslated region of the cypδgl gene.

12. Use as claimed in claim 10 or claim 11, wherein the deletion is flanked upstream by the sequence TTAAGACGAA and downstream by the sequence AAGATTTTCT.

13. Use as claimed in any one of claims 10 to 12, wherein the deletion is detected by PCR using PCR primer sets: GAGTATGGGGGCGCAAACAACATT and TTAATCAAATGCCAGTGC; GAAAGCCGGTTGTGTTTAATTAT, TTTTTGTGTGCTATGGTTTAGTTAG and GGGTGCAACAGAGTTTCAGGTA; or

GAGTATAAAAACGCAAACAACATT and TTAATCAAATGCCAGTGC.

14. Use as claimed in claim 1, wherein increased activity of cypδgl protein is detected by assaying for the insertion of a transposable element in the cypδgl gene.

15. Use as claimed in claim 14, wherein the insertion is of an element showing homology to the Accord transposable element .

16. Use as claimed in claim 14 or claim 15, wherein the insertion comprises a promoter region having the nucleotide sequence CACTTTGCTG ATGTCGCCTA CCG.

17. Use as claimed in any one of claims 14 to 16, wherein the insertion is detected by PCR using PCR primers: GAAAGCCGGT TGTGTTTAAT TAT, CTTTTTGTGT GCTATGGTTT AGTTAG and GGGTGCAACA GAGTTTCAGG TA.

18. Use according to claim 1, wherein increased activity of cypδgl protein is detected by assaying for elevated mRNA for cypδgl .

19. Use according to claim 18, wherein mRNA for cypδgl is assayed using Northern analysis.

20. Use according to claim 18, wherein mRNA for cyp6gl is assayed using quantitative reverse transcriptase PCR.

21. Use according to claim 1, wherein increased activity of cypδgl protein is detected by raising antibodies specific to cypδgl protein and performing ELISA anaysis.

22. Use as claimed in claim 1, wherein said cell, cell line or organism is selectively isolated from the environment.

23. Use as claimed in claim 1, wherein said cell, cell line or organism comprises a pest of plants, animals or humans.

24. Use as claimed in claim 1, wherein said cell, cell line or organism is directly or indirectly beneficial to plants, animals or humans.

25. Use as claimed in claim 1, wherein said cell, cell line or organism comprises plant material.

26. Use as claimed in claim 1, wherein said cell, cell line or organism comprises animal material .

27. Use as claimed claim 1, wherein said organism is an invertebrate.

28. Use as claimed in claim 1, wherein said organism is a nematode .

29. Use as claimed in claim 1, wherein said organism is Caenorhabditis elegans .

30. Use as claimed in claim 1, wherein said organism is an arthropod .

31. Use as claimed in claim 1, wherein said organism is an insect .

32. Use as claimed in claim 1, wherein said organism is a fly.

33. Use as claimed in claim 1, wherein said organism is Drosophila melanogaster.

34. Use as claimed in claim 1, wherein said organism is Drosophila simulans.

35. Use as claimed in claim 1, wherein said organism is Drosophila virilis.

36. Use as claimed in claim 1, wherein said organism is an egg.

37. Use as claimed in claim 1, wherein said organism is a nymph, larva, maggot or caterpillar.

38. Use as claimed in claim 1, wherein said putative pesticide is a putative insecticide.

39. Use as claimed in claim 38, wherein said putative pesticide is a putative agonist of the target species nicotinic acetylcholine receptor.

40. Use as claimed in any one of claims 38 or 39, wherein said putative pesticide is predicted to be a neonicotinoid or is a derivative of a known neonicotinoid.

41. A method of testing a putative pesticide for potential resistance thereto, comprising contacting a cell, cell line or organism in which the activity of cyp6gl or derivatives thereof or fragments or either thereof is increased relative to wildtype activity of cypδgl protein and detecting any detrimental effect on the cell, cell line or organism.

42. A method of testing a putative pesticide for potential resistance thereto, comprising contacting a cell, cell line or organism comprising a transposable element and detecting any detrimental effect on the cell, cell line or organism.

43. A method according to claim 42 in which the transposable element comprises the Accord transposable element.

44. A method according to claim 42 or claim 43 in which the transposable element comprises at least the nucleotide sequence CACTTTGCTG ATGTCGCCTA CCG or homologues thereof.

45. A method according to any one of claims 42 to 44 in which the transposable element is detected by PCR using PCR primers: GAAAGCCGGT TGTGTTTAAT TAT, CTTTTTGTGT GCTATGGTTT AGTTAG and GGGTGCAACA GAGTTTCAGG TA

46. A pesticide whose activity is detected using the method according to any one of claims 42 to 46.

47. A cell, cell line or organism for use according to claim 1 or in the method of claim 42, into which cell, cell line or organism a gene encoding cypδgl or a homologue, orthologue, derivative or equivalent thereof or fragment of any thereof is inserted and operably linked to a genetic control element suitable for constitutively or inducibly causing the expression of said gene, homologue, orthologue, equivalent or derivative or fragment thereof .

48. A cell, cell line or organism for use according to claim 1 or in the method of claim 42, into which cell, cell line or organism genetic control elements are inserted so as to constitutively or inducibly alter the expression of endogenous cypδgl or equivalents, derivatives, orthologues, homologues thereof or of fragments of any thereof.

49. A cell, cell line or organism for use according to claim 1 or in the method of claim 42, into which cell, cell line or organism a transposable element is inserted to inclease the expression of endogenous cypδgl or equivalents, derivatives, orthologues, homologues thereof or of fragments of any thereof .

50. A method of determining the degradation of a chemical entity by cypδgl protein or a derivative, homologue or orthologue thereof or a fragment of any thereof, comprising contacting the chemical entity with the protein and assessing the extent of degradation of the chemical entity.

51. A method as claimed in claim 50, wherein said chemical entity is a pesticide or putative pesticide.

52. A method as claimed in claim 50 or claim 51, wherein said chemical entity is an insecticide or putative insecticide .

53. A method as claimed in any one of claims 50 to 52, wherein said chemical entity is predicted to be a neonicotinoid or is a derivative or a known neonicotinoid.

54. A transgenic cell, cell line or organism for use in screening putative pesticides into which a gene encoding cyp6gl or a homologue, orthologue, derivative or equivalent thereof or fragment of any thereof is inserted and operably linked to a genetic control element suitable for constitutively or inducibly causing the expression of said gene, homologue, orthologue, equivalent or derivative or fragment thereof .

55. A transgenic cell, cell line or organism for use in screening of pesticides into which genetic control elements are inserted so as to constitutively or inducibly alter the expression of endogenous cypβgl or equivalents, derivatives, orthologues, homologues thereof or of fragments of any thereof .

56. A transgenic cell, cell line or organism for use in screening of pesticides into which a transposable element is inserted so as to increase the expression of endogenous cyp6gl or equivalents, derivatives, orthologues, homologues thereof or of fragments of any thereof.

57. A transgenic cell, cell line or organism according to claim 56 in which the transposable element shows homology to the Accord transposable element .

58. A transgenic cell, cell line or organism according to claim 56 in which the transposable element comprises the nucleotide sequence CACTTTGCTG ATGTCGCCTA CCG or homologues thereof .

59. Use of a transgenic cell, cell line or organism as claimed in claim 54 to 58 in the screening of putative pesticides.

60. Use as claimed in claim 59, wherein said putative pesticide is a putative insecticide.

61. Use as claimed in claim 59 or 60, wherein said putative pesticide is a putative agonist of the target species (es) nicotinic acetylcholine receptor.

62. Use as claimed in any one of claims 59 to 61, wherein said putative pesticide is predicted to be a neonicotinoid or is a derivative of a known neonicotinoid.