WO2003025126A2 - Compositions et procedes destines a l'amorcage de lymphocyte t et immunotherapie - Google Patents

Compositions et procedes destines a l'amorcage de lymphocyte t et immunotherapie Download PDF

Info

Publication number
WO2003025126A2
WO2003025126A2 PCT/US2002/029156 US0229156W WO03025126A2 WO 2003025126 A2 WO2003025126 A2 WO 2003025126A2 US 0229156 W US0229156 W US 0229156W WO 03025126 A2 WO03025126 A2 WO 03025126A2
Authority
WO
WIPO (PCT)
Prior art keywords
cells
antigen
cell
transfected
sign
Prior art date
Application number
PCT/US2002/029156
Other languages
English (en)
Other versions
WO2003025126A3 (fr
Inventor
Si-Yi Chen
Zhaoyang You
Original Assignee
Baylor College Of Medicine
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Baylor College Of Medicine filed Critical Baylor College Of Medicine
Priority to AU2002336522A priority Critical patent/AU2002336522A1/en
Publication of WO2003025126A2 publication Critical patent/WO2003025126A2/fr
Publication of WO2003025126A3 publication Critical patent/WO2003025126A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503—Immunoglobulin superfamily
    • C07K14/70525—ICAM molecules, e.g. CD50, CD54, CD102
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4748—Tumour specific antigens; Tumour rejection antigen precursors [TRAP], e.g. MAGE
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide

Definitions

  • the present invention relates generally to immunology and antigen presentation. More particularly, the present invention relates to compositions and methods to efficiently activate T cells and to methods for identifying T cell activation antigens and motifs .
  • the present invention was funded in part by government grant AI41959 from the National Institutes of Health. The Federal government may have certain rights in the invention.
  • CD4 + T-helpers play a critical role in inducing immune responses. Due to the scarce availability of antigen-specific CD4 + T h assays, however, only a few MHC class II-restricted antigens that are recognized by CD4 + T h have been identified. The importance of CD4 + Th cells in the induction of an effective antigen-specific response has been well documented (See, e.g., Abbas, A.K., Murphy, K.M. & Sher, A., Functional Diversity of Helper T Lymphocytes, Nature 383, 787-93 (1996)).
  • MHC class I-restricted antigens that are recognized by CD8 + cytotoxic T cells have been identified successfully (see, e.g., Rosenberg, S.A. A New Era For Cancer Immunotherapy Based On The Genes That Encode Cancer Antigens, Immunity 10, 281-7 (1999) ) .
  • CTLs cytotoxic T cells
  • MHC class II-restricted antigens that are recognized by CD4+ T have been identified, due to the lack of an efficient identification approach (see, e.g., Wang, R.F., Wang, X., Atwood, A.C., Topalian, S.L.
  • the steps to T cell activation include: adhesion between APCs and T cells to form an immunological synapse; class II-restricted antigen presentation by APCs; scanning of the APCs by T cells for MHC class II-antigen complexes present on the surface of the APCs; and activation of the T Cells by the presented antigen in conjunction with the proper co-stimulatory molecules (See, e.g., Banchereau, J. & Steinman, R.M., Dendritic Cells and the Control Of Immunity, Nature 392, 245-52 (1998)).
  • APC antigen presenting cell
  • DCs dendritic cells
  • DC-SIGN a newly discovered ICAM-3 receptor
  • DCs dendritic cells
  • DC-SIGN-mediated adhesion provides an opportunity for T cells to scan the APC surface to identify class II-restricted antigens and to stabilize the APC:T cell contact zone, the "immunological synapse", leading to the activation of the T cells.
  • the present invention includes cells, isolated and purified nucleic acids, vaccines, vectors, methods and the like for the efficient activation of T cells using APCs, including dendritic cells, having increased expression of DC-SIGN.
  • APCs including dendritic cells
  • One example of the present invention is a vaccine that includes an isolated APC, such as dendritic cell, that over-expresses DC-SIGN and an MHC restricted target antigen.
  • the antigen may be class I or class II-restricted, that is, the antigen may be presented by either a class I or a class II molecule, depending on the T cell receptor and type of T cell that responds to that antigen.
  • the antigen presenting cell may also be caused to over-express the invariant chain.
  • the antigen presentingcell may even be a human dendritic cell.
  • the antigen may be, e.g., a tumor, a pathogen, a viral or even a self-antigen.
  • the genes for the DC-SIGN, the MHC restricted antigen and the invariant chain may be the native genes expressed at a higher level, or may be inserted into the cell on an individual vector, on the same vector, or combinations thereof.
  • the DC-SIGN, antigen and/or invariant chain may be expressed with a modified viral or even a bacterial vector.
  • the antigen may be loaded on the MHC using methods known to those of skill in the art, including: natural processing, mutant MHC loading or even stripping the antigens from the MHC peptide groove and reloading with antigenic peptide alone, e.g., on fixed cells.
  • the present invention also provides compositions and methods to increase the expression of DC-SIGN by transfecting antigen presenting cells.
  • the transfected APCs of the present invention are able to form a robust immunological synapse with na ⁇ ve T cells ex vivo.
  • ex vivo it is meant that the event and site of T cell activation is in the absence of an animal's lymphoid system, which would otherwise provide the biological signals and environment for in vivo APC : T cell adhesion.
  • the present inventors have recognized that ex vivo APC:T cell adhesion is enhanced with APCs that have abundant DC-SIGN expressed on their surface.
  • One way to increase DC-SIGN surface expression is by the overexpression of DC-SIGN using an expression vector.
  • increased expression of a particular gene may be achieved by induction or de-repression of a natural copy of the gene or by the transient or stable transfection of the gene.
  • the transfection of the DC-SIGN gene may be achieved using a wide variety of vectors, as are known in the art of immune cell gene expression. Expression using a transfected gene may be transient or stable. Increased expression may also be achieved by increasing the copy number of the gene, affecting the regulation of the gene or introducing the gene into the germline of a host, e.g., by transgenic or homologous recombination insertion of the DC-SIGN gene.
  • the transfected APCs of the present invention activate T h cells or cytotoxic T lymphocytes (CTLs) in a more efficient manner and may be used for the activation of even na ⁇ ve T h cells or CTLs.
  • CTLs cytotoxic T lymphocytes
  • the present inventors have developed "retrogen" compositions for efficient antigen presentation by APCs.
  • “Retrogen” is defined herein as a modified antigen expressed within a cell that is processed and presented to T cells.
  • APCs may be transfected with a retrogen of the present invention such that the expression and processing of the retrogen leads to presentation of, e.g., MHC class I or class II-restricted antigens on the surface of the transfected antigen presenting cells.
  • the presented MHC class II antigens are thus made available to be scanned by T cells that are adhered to such transfected antigen presenting cells via DC-SIGN.
  • the retrogen compositions of the present invention also induce DC maturation.
  • the class I or class II-restricted antigens may be loaded onto the MHC directly at the cell surface, as will be known to those of skill in the art.
  • the present invention contemplates the modification of, e.g, tumor associated antigens for secretion and subsequent receptor-mediated internalization of the modified antigen (retrogen) by DCs.
  • modified antigen retrogen
  • DCs e.g., You, Z., Hester, J. , Rollins, L., Spagnoli, G., van der Bruggen, P., and Chen, S-Y, A Novel Retrogen Strategy For Presentation Of An Intracellular Tumor Antigen As An Exogenous Antigen By Dendritic Cells To Induce Potent Anti-Tumor Helper And Cytotoxic T Cells Responses, Cancer Research Jan. (2001); and You, Z. et al .
  • the expression of DC-SIGN enhances the initial contact of APCs with T cells and, in conjunction with the use of the retrogen strategy for efficient MHC class II antigen presentation and DC maturation, provides a method of the present invention for efficiently priming of CD4 + or CD8 + T cells ex vivo.
  • the retrogen may be derived from an tumor associated antigen, e.g., MAGE-3, that is more potent than native MAGE-3 for inducing CD4 + T h responses .
  • the APCs of the present invention co-express the MAGE-3 retrogen and DC-SIGN efficiently prime antigen-specific human CD4 + T cells ex vivo.
  • One embodiment of the present invention provides a method for priming T cells.
  • the method includes the steps of transfecting antigen presenting cells to co-express DC-SIGN and a retrogen and contacting the transfected antigen presenting cells with T cells.
  • the T cells may be T helper cells and, specifically, CD4 + T helper cells.
  • T cells may be cytotoxic T cells and, specifically, CD8 + T cells.
  • Antigen presenting cell contact with the CD4 + T helper cells (or CD8 + cytotoxic T cells) is enhanced by expression of DC-SIGN on the surface of antigen presenting cells.
  • the method of the present invention may further include transfecting the antigen presenting cells such that the antigen presenting cells express a retrogen to enhance MHC class I or class II antigen presentation by the antigen presenting cells.
  • the retrogen may be a tumor associated antigen modified to be secreted by the transfected antigen presenting cell.
  • the tumor associated antigen that is modified may be, for example, a MAGE, GAGE or DAGE tumor associated antigen or portion thereof.
  • the T cells may be primed ex-vivo.
  • a retrogen expressing a modified MAGE-3, for example, is more potent for enhancing MHC class II antigen presentation by dendritic cells than is unmodified MAGE- 3.
  • the secreted retrogen may be internalized by the transfected DCs, inducing the maturation of the DCs.
  • compositions and methods of the present invention may be used to induce an anti-tumor response, to identify an MHC class II restricted antigen or epitope, to generate a population of primed T cells, to generate antigen-specific CD4 + T cells ex vivo, to generate antigen-specific T cells for adoptive immunotherapy against a tumor or an infectious disease, to generate CD8 + T cells or cytotoxic T lymphocytes, and even to treat tumor-associated disease or pathogen-associated infection.
  • the priming of T cells may even be used to anergize the T cells for the treatment of an autoimmune disease.
  • inventions of the present invention include a method for antigen-specific priming of naive CD4 + T helper cells ex vivo, including the steps of: transfecting dendritic cells to co-express DC-SIGN and a retrogen and contacting the transfected DCs with naive CD4+ T helper cells.
  • DC-SIGN enhances contact between the DCs and the T cells and the retrogen induces MHC class II antigen presentation by the DCs to prime the naive T cells.
  • a method for inducing CD8+ cytotoxic T-cells that recognize MHC class I-restricted antigens is contemplated by another embodiment of the invention.
  • the method involves transfecting one or more dendritic cells to co-express DC-SIGN and a retrogen and contacting one or more of the transfected dendritic cells with one or more naive CD8 + cytotoxic T-cells.
  • One or more of the naive CD8 + cytotoxic T-cells become induced by contact with one or more of the DC-SIGN transfected dendritic cells.
  • the method may be used in a protocol to identify one or more MHC class I-restricted antigen.
  • the MHC class I-restricted antigen to be identified by the method may be associated with, for example, a tumor, an autoimmune disease, a virus or a pathogen.
  • the present invention includes an expression vector that expresses a gene for DC-SIGN, a vector that expressed a gene for a retrogen, or a single vector that expresses both. Upon transfection of a cell with the expression vector(s), the cell expresses DC-SIGN and the retrogen.
  • the present invention also includes a cell transfected with the expression vector disclosed herein.
  • the transfected cell may be, for example, a dendritic cell.
  • the cell may be further transfected with the invariant chain.
  • Transfected dendritic cells of the present invention may be used, for example, to prime na ⁇ ve CD4 + T helper cells or CD8 + cytotoxic T cells to generate antigen-specific primed T cells for adoptive immunotherapy against tumors or infectious disease or to treat autoimmune disorders.
  • the present invention may also be used to identify MHC class II restricted antigens.
  • One vector system of the present invention co-expresses an Ii-cDNA (invariant chain) for antigen MHC class-II presentation and DC-SIGN for enhancing DC and T- cell interaction.
  • a cDNA-Ii/DC-SIGN library derived from, e.g., human prostate cancer cells, was constructed and used to transfect human CD34 + -derived DCs.
  • the transfected DCs were used to prime na ⁇ ve autologous CD4 + T-cells ex vivo .
  • the primed CD4 + T-cells were then used to identify which transfected DCs contain class-II antigen (s) that can stimulate CD4 + T-cells. In this manner the T cell specific antigen is isolated, sequenced and a motif determined.
  • Figure 1 is schematic representations of exemplary expression vectors of the present invention.
  • Figure 2 is a table showing the expression levels of DC- SIGN and MAGE-3-Fc in infected CD34 + -derived DCs of the present invention.
  • Figure 3A is a horizontal bar graph showing the priming of human na ⁇ ve CD4 + CD45RA + T cells in accordance with the present invention.
  • Figure 3B is a horizontal bar graph showing the antigen specificity of primed CD4 + T cells of the present invention.
  • Figure 3C is a horizontal bar graph showing the effect on T cells transfected dendritic cells of the present invention.
  • Figure 3D is a horizontal bar graph showing IFN- ⁇ production in primed T cells of the present invention.
  • Figure 4 is a horizontal bar graph comparing different approaches to prime na ⁇ ve human CD4 + T cells.
  • Figure 5A is a horizontal bar graph showing inhibition of CD4 + T cell priming by an anti-ICAM-3 antibody.
  • Figure 5B is a horizontal bar graph showing enhanced IL-12 production by primed T cells of the present invention.
  • Figure 5C is a horizontal bar graph showing stimulation of primed CD4 + T cells of the present invention.
  • Figure 6 is a schematic representation of a method for the construction of a unidirectional functional immuno-screening cDNA library of the present invention.
  • Figure 7 is a schematic representation of a unidirectional functional imiauno-screening approach of the present invention.
  • Figure 8 is a horizontal bar graph showing the results of the first round screening of a tumor cDNA library of the present invention.
  • Figure 9 is a horizontal bar graph showing the results of the second round screening of the positive cDNA library pools 2 and 7 of the present invention.
  • Figure 10 is a horizontal bar graph identifying positive individual clones from the cDNA library sub-pool E of the present invention.
  • Figure 11 is the DNA sequence of clone 9 of the present invention.
  • Figure 12 is the alignment of the clone 9 a ino acid sequence of the present invention with the hTCPT amino acid sequence.
  • the present invention relates to compositions and methods for ex vivo activation of T cells for use in preventing or treating a number of pathological states such as viral diseases and cancer through immunotherapy.
  • Helper or cytotoxic T lymphocytes may be activated using dendritic cells as antigen presenting cells (APC) with a peptide of choice bound to selected major histocompatibility complex (MHC) molecules.
  • APC antigen presenting cells
  • MHC major histocompatibility complex
  • cytotoxic T cells or CD8 cells act as the main line of defense against viral infections .
  • CTLs recognize specifically and kill cells that are infected by, e.g., a virus.
  • the T cell receptors on the surface of CTLs cannot recognize foreign antigens directly, but rather, recognize antigen presented to the T cell receptors by class I MHC for activation to occur.
  • T helper cells recognize antigen in the context of class II MHC on APCs.
  • MHC major histocompatibility complex
  • HLA human leukocyte antigen
  • Antigen presenting MHC molecules are classified as either class I or class II molecules. Class II MHC molecules are expressed primarily on cells involved in initiating and sustaining immune responses, such as T lymphocytes, B lymphocytes, macrophages, etc.
  • Class II MHC molecules are recognized by helper T lymphocytes and induce proliferation of helper T lymphocytes and amplification of the immune response to the particular immunogenic peptide displayed on the class II MHC.
  • Class I MHC molecules are expressed on almost all nucleated cells and are recognized by CTLs. T cells that act as helper cells express CD4 and are primarily restricted to Class II molecules, whereas CD8-expressing cells, represented by cytotoxic effector cells, interact with class I molecules.
  • CTLs and T helper cells recognize antigen in the form of a peptide fragment bound to the MHC molecules rather than the intact foreign antigen itself.
  • the antigen must normally be endogenously synthesized by the cell and a portion of the protein antigen is degraded or processed into small peptide fragments in the cytoplasm. Some of these small peptides are translocated into a pre-Golgi compartment and interact with, e.g., class I heavy chains to facilitate proper folding and association with the ⁇ 2 microglobulin subunit of class I MHC.
  • the mature peptide-MHC class I complex is routed to the cell surface for presentation and recognition by specific CTLs .
  • MHC class I molecules present the peptide in the peptide binding groove created by the folding of the ⁇ l and ⁇ 2 domains of the class I heavy chain. Skilled immunologists will recognize that a similar chain of events transpires for class II antigen presentation of peptides on the ⁇ and ⁇ chains of class II.
  • the present invention may be used to overcome the first hurdle in the immune response, namely, the activation of na ⁇ ve T cells.
  • BCM Baylor College of Medicine
  • DC Dentritic Cell
  • DC-SIGN DC-Specific ICAM-3 Grabbing Non-integrin
  • T h T helper cell
  • MHC Major Histocompatibility Complex
  • PCR Polymerase Chain Reaction
  • mAb monoclonal antibody
  • peptide loading is the process by which antigenic peptides are loaded onto class I or class II MHC for antigen presentation. Peptide loading may occur naturally via antigen processing and presentation or may be achieved artificially using the expression of an MHC molecule without bound peptide (i.e., "empty” molecules), which may be produced under certain restrictive circumstances. These "empty” molecules are often unable to reach the cell surface, however, as Class I molecules without bound peptide are very thermolabile. Thus, the "empty" Class I molecules disassemble during their transport from the interior of the cell to the cell surface, however, addition of a peptide that fits within the groove of the MHC stabilizes the peptide-MHC complex and the complex is transported to the cell surface for presentation to T cells.
  • Cai, et al. U.S. Patent No. 6,255,073, relevant portions incorporated herein by reference.
  • Cai, et al. demonstrate materials and methods for loading peptides on MHC and the activation of T lymphocytes with specificity for particular antigenic peptides.
  • Celis, et al., U.S. Patent No. 5,846,827, relevant portions incorporated herein by reference also teach peptide loading for activating cytotoxic T lymphocytes (CTL) in vitro in conjunction with methods for using the activated CTL for therapy in vivo. Additionally, a method for killing specific CTL in vivo is presented using antigen presenting cells modified in vitro.
  • CTL cytotoxic T lymphocytes
  • immunogenic peptide is a peptide that includes an allele-specific motif such that the peptide will bind the MHC allele and be capable of inducing a T helper or a CTL response.
  • immunogenic peptides are capable of binding to an appropriate class I or class II MHC molecule and present the peptide in the proper context for a cytotoxic or helper T cell T cell Receptor, respectively.
  • the T cells respond in an antigen specific manner against the antigen from which the immunogenic peptide is derived and for which the T cell receptor is specific.
  • the term "gene” means the deoxyribonucleotide sequences comprising the coding region of a structural gene and the including sequences located adjacent to the coding region on both the 5' and 3' , ends for a distance of about 1 kb on either end such that the gene corresponds to the length of the full-length RNA.
  • the sequences which are located 5' of the coding region and which are -present on the mRNA are referred to as 5' non-translated sequences.
  • the sequences that are located 3' or downstream of the coding region and which are present on the mRNA are referred to as 3' non-translated sequences, these sequences.
  • the term "gene” encompasses both cDNA and genomic forms of a gene.
  • a genomic form or clone of a gene contains the coding region interrupted with non-coding sequences termed "introns” or “intervening regions” or “intervening sequences.”
  • Introns are segments of a gene that are transcribed into nuclear RNA (hnRNA) ; introns may contain regulatory elements such as enhancers . Introns are removed or “spliced out” from the nuclear or primary transcript; introns therefore are absent in the messenger RNA (mRNA) transcript.
  • mRNA messenger RNA
  • genomic forms of a gene may also include sequences located on both the 5' and 3' end of the sequences that are present on the RNA transcript. These sequences are referred to as "flanking" sequences or regions (these flanking sequences are located 5'or 3' to the non- translated sequences present on the mRNA transcript) .
  • the 5' flanking region may contain regulatory sequences such as promoters and enhancers that control or influence the transcription of the gene.
  • the 3' flanking region may contain sequences that direct the termination of transcriptions, post- transcriptional cleavage and polyadenylation.
  • portion refers to fragments of that protein.
  • the fragments may range in size from four amino acid residues to the entire amino acid sequence minus one amino acid.
  • Nucleic acid sequence or “nucleotide sequence” as used herein refers to an oligonucleotide or polynucleotide, and fragments or portions thereof, and to DNA or RNA of genomic or synthetic origin, which may be single- or double-stranded, and represent the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide, or protein sequence, and fragments or portions thereof, and to naturally occurring or synthetic molecules.
  • amino acid sequence is recited herein to refer to an amino acid sequence of a naturally occurring protein molecule
  • amino acid sequence and like terms, such as “polypeptide” or “protein” do not limit the amino acid sequence to the complete, native amino acid sequence associated with the recited protein molecule.
  • biologically active refers to a protein having structural, regulatory, or biochemical functions of a naturally occurring molecule.
  • immunologically active refers to the capability of the natural, recombinant, or synthetic proteins or any oligopeptide thereof including modified amino acids or peptide mimetics, to induce a specific immune response in appropriate animals or cells and activate specific T cells, whether T helper or cytotoxic T cells.
  • Definition of motifs specific for different MHC restricted alleles allows the identification of potential peptide epitopes from an antigenic protein whose amino acid sequence is known. Typically, identification of potential peptide epitopes is initially carried out using a computer to scan the amino acid sequence of a desired antigen for the presence of motifs.
  • the epitopic sequences are then synthesized.
  • the capacity to bind MHC Class molecules is measured in a variety of different ways using, for example, purified class I molecules and radioiodinated peptides and/or cells expressing empty class I molecules by, for instance, immunofluorescent staining and flow microfluorimetry, peptide-dependent class I assembly assays, and inhibition of CTL recognition by peptide competition.
  • Other alternatives described in the literature include inhibition of antigen presentation (Sette, et al . , J. Immunol., 141:3893
  • peptides that activate T cells in an activation assay are assayed for the ability of the peptides to induce specific primary or secondary CTL responses in vitro.
  • antigen-presenting cells that have been incubated with a peptide can be assayed for the ability to induce CTL responses in responder cell populations.
  • Mutant mammalian cell lines that are deficient in their ability to load class I molecules with internally processed peptides such as the mouse cell lines RMA-S, and the human somatic T cell hybridoma, T-2, which have been transfected with the appropriate human class I genes may be used.
  • a peptide is added to these cells to test for the capacity of the peptide to induce in vitro primary CTL responses.
  • immunogenic peptides having the motif required for MHC binding and the epitope recognized by the CTL may be synthesized.
  • the immunogenic peptides may be prepared synthetically, by recombinant DNA technology or isolated from natural sources such as whole viruses or tumors.
  • One of skill will recognize that the immunogenic peptides may vary the lengths, either in their neutral (uncharged) forms or in forms which are salts, and either free of modifications such as glycosylation, side chain oxidation, or phosphorylation or containing these modifications, subject to the condition that the modification not destroy the biological activity of the polypeptides as herein described.
  • Peptide may be as small as possible while still maintaining substantially all of the biological activity of the large peptide.
  • Peptides having the desired activity may be modified as necessary to provide certain desired attributes, e.g., improved pharmacological characteristics. It is important that the peptide increase or at least retain substantially all of the biological activity of the unmodified peptide to bind the desired MHC molecule and activate the appropriate T cell.
  • the peptides may be subject to various changes, such as substitutions, either conservative or non-conservative, where such changes might provide for certain advantages in their use, such as improved MHC binding.
  • conservative substitutions is meant replacing an amino acid residue with another that is biologically and/or chemically similar, e.g., one hydrophobic residue for another, or one polar residue for another.
  • substitutions include combinations such as Gly, Ala; Val, lie, Leu, Met; Asp, Glu; Asn, Gin; Ser, Thr; Lys, Arg; and Phe, Tyr.
  • the effect of single amino acid substitutions may also be probed using D-amino acids.
  • Such modifications may be made using well known peptide synthesis procedures.
  • the peptides of the invention can be prepared in a wide variety of ways. Because of their relatively short size, the peptides may be synthesized in solution or on a solid support in accordance with conventional techniques. Various automatic synthesizers are available commercially and may be used in accordance with known protocols.
  • purified or “to purify” refers to the removal of contaminants from a sample.
  • proteins of interest are purified by removal of contaminating proteins; they are also purified by the removal of substantially all proteins that are not of interest.
  • Recombinant polypeptides may be expressed in bacterial host cells and the polypeptides are purified by the removal of host cell proteins; the percent of recombinant polypeptides is thereby increased in the sample.
  • substantially purified refers to nucleic or amino acid sequences that are removed from their natural environment, isolated or separated, and are at least 60% free, preferably 75% free, and most preferably 90% free from other components with which they are naturally associated.
  • recombinant DNA molecule refers to a DNA molecule that is comprised of segments of DNA joined together by means of molecular biological techniques.
  • recombinant protein or “recombinant polypeptide” as used herein refers to a protein molecule that is expressed from a recombinant DNA molecule.
  • native protein refers to a protein that is isolated from a natural source as opposed to the production of a protein by recombinant means.
  • modulate refers to a change or an alteration in the biological activity of a cell, e.g., a T cell. Modulation may be an increase or a decrease in killing or helping activity, a change in any other biological, functional, e.g., an immunological state.
  • antagonist refers to molecules or compounds, e.g., peptides that anergize T cells, that inhibit the action of a cell (e.g., protein expression) . Antagonists may or may not be homologous to the targets of these compositions in respect to conformation, charge or other characteristics and in T cells may also be used to cause T cell anergy. It is contemplated that peptide antagonists bind their cognate MHC molecule but prevent T cell activation, however, it is not intended that the term be limited to a particular site or function.
  • a “variant" of a protein refers to an amino acid sequence that is altered by one or more amino acids .
  • the variant may have "conservative” changes, wherein a substituted amino acid has similar structural or chemical properties (e.g., replacement of leucine with isoleucine) . More rarely, a variant may have "nonconservative” changes (e.g., replacement of a glycine with a tryptophan) . Similar minor variations may also include amino acid deletions or insertions or both.
  • Guidance in determining which amino acid residues may be substituted, inserted, or deleted without abolishing biological or immunological activity relay be found using computer programs well known in the art, for example, DNASTAR software.
  • sample as used herein, is used in its broadest sense.
  • the term encompasses biological sample (s) suspected of containing nucleic acid encoding a protein or fragments thereof and may comprise a cell, chromosomes isolated from a cell (e.g., a spread of metaphase chromosomes), genomic DNA (in solution or bound to a solid support such as for Southern analysis) , RNA (in solution or bound to a solid support such as for northern analysis) , cDNA (in solution or bound to a solid support) , an extract from cells or a tissue, and the like.
  • the term "overproducing” is used in reference to the production of polypeptides in a host cell, and indicates that the host cell is producing more of the polypeptide by virtue of the introduction of nucleic acid sequences encoding the polypeptide than would be expressed by the host cell absent the introduction of these nucleic acid sequences .
  • the host cell expresses or overproduces the polypeptide.
  • Transformation describes a process by which exogenous DNA enters and changes a recipient cell. It may occur under natural or artificial conditions using various methods well known in the art. Transformation may rely on any known method for the insertion of foreign nucleic acid sequences into a prokaryotic or eukaryotic host cell. The method is selected based on the host cell being transformed and may include, but is not limited to, viral infection, electroporation, lipofection, and particle bombardment. Such "transfected" cells include transiently or stably transformed cells in which the inserted DNA is capable of replication either as an autonomously replicating plas id or as part of the host chromosome.
  • Transfection may be accomplished by a variety of means known to the art including calcium phosphate-DNA co-precipitation, DEAE-dextran-mediated transfection, polybrene-mediated transfection, electroporation, microinjection, liposome fusion, lipofection, protoplast fusion, retroviral infection, and biolistics .
  • stable transfection or "stably transfected” refers to the introduction and integration of foreign DNA into the genome of the transfected cell.
  • stable transfectant refers generally to a cell that has stably integrated foreign DNA into the genomic DNA. Cells that transiently express the inserted DNA or RNA do so for limited periods of time.
  • transient transfection or “transiently transfected” refers to the introduction of foreign DNA into a cell where the foreign DNA fails generally to integrate into the genome of the transfected cell.
  • the foreign DNA persists in the nucleus of the transfected cell for several days. During this time the foreign DNA is subject to the regulatory controls that govern the expression of endogenous genes in the chromosomes.
  • cell culture refers to any in vitro culture of cells. Included within this term are continuous cell lines (e.g., with an immortal phenotype) , primary cell cultures, finite cell lines (e.g., non-transformed cells), and any other cell population maintained in vitro. Cell cultures may comprise insect cells.
  • vector is used in reference to nucleic acid molecules that transfer DNA segment (s) from one cell to another.
  • vector refers to a recombinant DNA molecule containing a desired coding sequence and appropriate nucleic acid sequences necessary for the expression of the operably linked coding sequence in a particular host organism. Nucleic acid sequences necessary for expression in prokaryotes usually include a promoter, an operator (optional) , and a ribosome binding site, often along with other sequences. Eukaryotic cells are known to use promoters, enhancers, and termination and polyadenylation signals.
  • amplifiable nucleic acid is used in reference to nucleic acids that may be amplified by any amplification method. It is contemplated that "amplifiable nucleic acid” will usually comprise a "sample template.”
  • primer refers to an oligonucleotide, whether occurring naturally as in a purified restriction digest or produced synthetically, which is capable of acting as a point of initiation of synthesis when placed under conditions in which synthesis of a primer extension product which is complementary to a nucleic acid strand is induced, (i.e., in the presence of nucleotides and an inducing agent such as DNA polymerase and at a suitable temperature and pH) .
  • the primer may be single stranded for maximum efficiency in amplification but may alternatively be double stranded. If double stranded, the primer is first treated to separate its strands before being used to prepare extension products.
  • the primer may be an oligodeoxyribonucleotide .
  • the primer must be sufficiently long to prime the synthesis of extension products in the presence of the inducing agent. The exact lengths of the primers will depend on many factors, including temperature, source of primer and the use of the method.
  • probe refers to an oligonucleotide (i.e., a sequence of nucleotides), whether occurring naturally as in a purified restriction digest or produced synthetically, recombinantly or by PCR amplification, which is capable of hybridizing to another oligonucleotide of interest.
  • a probe may be single-stranded or double-stranded. Probes are useful in the detection, identification and isolation of particular gene sequences. It is contemplated that any probe used in the present invention will be labeled with any "reporter molecule,” so that is detectable in any detection system, including, but not limited to enzyme (e.g. ELISA, as well as enzyme-based histochemical assays) , fluorescent, radioactive and chemiluminescent systems. It is not intended that the present invention be limited to any particular detection system or label.
  • PCR polymerase chain reaction
  • the mixture is denatured and the primers then annealed to their complementary sequences within the target molecule.
  • the primers are extended with a polymerase so as to form a new pair of complementary strands.
  • the steps of denaturation, primer annealing and polymerase extension can be repeated many times (i.e., denaturation, annealing and extension constitute one "cycle", there can be numerous "cycles") to obtain a high concentration of an amplified segment of the desired target sequence.
  • the length of the amplified segment of the desired target sequence is determined by the relative positions of the primers with respect to each other, and therefore, this length is a controllable parameter.
  • the method is referred to as the "polymerase chain reaction” (PCR) .
  • PCR polymerase chain reaction
  • the desired amplified segments of the target sequence become the predominant sequences (in terms of concentration) in the mixture, they are said to be “PCR amplified.”
  • target when used in reference to the polymerase chain reaction, refers to the region of nucleic acid bounded by the primers used for polymerase chain reaction. Thus, the “target” is sorted out from other nucleic acid sequences.
  • a “segment” is defined as a region of nucleic acid within the target sequence.
  • PCR it is possible to amplify a single copy of a specific target sequence in genomic DNA to a level detectable by several different methodologies (e.g., hybridization with a labeled probe; incorporation of biotinylated primers followed by avidin-enzyme conjugate detection, incorporation 32 P-labeled deoxynucleotide triphosphates, such as DCTP or DATP, into the amplified segment) .
  • any oligonucleotide sequence can be amplified with the appropriate set of primer molecules.
  • the amplified segments created by the PCR process itself are, themselves, efficient templates for subsequent PCR amplifications.
  • PCR product refers to the resultant mixture of compounds after two or more cycles of the PCR steps of denaturation, annealing and extension are complete. These terms encompass the case where there has been amplification of one or more segments of one or more target sequences.
  • amplification reagents refers to those reagents (deoxyribonucleotide triphosphates, buffer, etc.), needed for amplification except for primers, nucleic acid template and the amplification enzyme. Typically, amplification reagents along with other reaction components are placed and contained in a reaction vessel (test tube, microwell, etc.).
  • the term “restriction endonucleases” and “restriction enzymes” refer to bacterial enzymes, each of which cut double-stranded DNA at or near a specific nucleotide sequence.
  • the term “recombinant DNA molecule” as used herein refers to a DNA molecule that includes segments of DNA joined together by molecular biological techniques.
  • DNA molecules are said to have "5' ends” and "3' ends” because mononucleotides are reacted to make oligonucleotides in a manner such that the 5' phosphate of one mononucleotide pentose ring is attached to the 3' oxygen of its neighbor in one direction via a phosphodiester linkage. Therefore, an end oligonucleotides referred to as the "5' end” if its 5' phosphate is not linked to the 3' oxygen of a mononucleotide pentose ring and as the "3' end” if its 3' oxygen is not linked to a 5' phosphate of a subsequent mononucleotide pentose ring.
  • a nucleic acid sequence even if internal to a larger oligonucleotide, also may be said to have 5' and 3' ends.
  • discrete elements arc referred to as being "upstream” or 5 ' of the "downstream” or 3' elements.
  • This terminology reflects the fact that transcription proceeds in a 5' to 3' fashion along the DNA strand.
  • the promoter and enhancer elements which direct transcription of a linked gene are generally located 5' or upstream of the coding region. However, enhancer elements can exert their effect even when located 3' of the promoter element and the coding region. Transcription termination and polyadenylation signals are located 3' or downstream of the coding region.
  • a gene encoding means a nucleic acid sequence comprising the coding region of a gene or in other words the nucleic acid sequence which encodes a gene product, such as a protein.
  • the terms refer to the order or sequence of deoxyribonucleotides along a strand of deoxyribonucleic acid. The order of these deoxyribonucleotides determines the order of amino acids along the polypeptide (protein) chain. The DNA sequence thus codes for the amino acid sequence.
  • the coding region may be present as a cDNA, genomic DNA or RNA form.
  • the oligonucleotide may be single-stranded (i.e., the sense strand) or double-stranded.
  • Suitable control elements such as enhancers/promoters, splice junctions, polyadenylation signals, etc. may be placed in close proximity to the coding region of the gene if needed to permit proper initiation of transcription and/or correct processing of the primary RNA transcript.
  • the coding region used in the expression vectors of the present invention may contain endogenous enhancers/promoters, splice junctions, intervening sequences, polyadenylation signals, combination of both endogenous and exogenous control elements, etc.
  • promoter/enhancer denotes a segment of DNA which contains sequences capable of providing both promoter and enhancer functions (i.e., the functions provided by a promoter element and an enhancer element, as discussed above) .
  • the enhancer/promoter may be "endogenous,” “exogenous,” or “heterologous .
  • An “endogenous” enhancer/promoter is naturally linked with a given gene in the genome.
  • An “exogenous” or “heterologous” enhancer/promoter is placed in juxtaposition to a gene by genetic manipulation (i.e., molecular biological techniques), such that transcription of that gene is directed by the linked enhancer/promoter.
  • Splicing signals mediate the removal of introns from the primary RNA transcript and consist of a splice donor and acceptor site (See e.g., J. Sambrook et al. Molecular Cloning - A Laboratory Manual, 2 nd ed., Cold Spring Harbor Laboratory Press, New York [1989], pp. 16.7-16.8).
  • a commonly used splice donor and acceptor site is the splice junction from the 16S RNA of SV40. Efficient expression of recombinant DNA sequences in eukaryotic cells requires expression of signals directing the efficient termination and polyadenylation of the resulting transcript.
  • Transcription termination signals are generally found downstream of the polyadenylation signal and are a few hundred nucleotides in length.
  • the term "poly A site” or "poly A sequence,” as used herein, denotes a DNA sequence that directs both the termination and polyadenylation of the nascent RNA transcript. Efficient polyadenylation of the recombinant transcript is desirable, as transcripts lacking a poly A tail are unstable and are rapidly degraded.
  • the poly A signal used in an expression vector may be "heterologous” or "endogenous.” An endogenous poly A signal is one that is found at the 3' end of the coding region of a given gene in the genome.
  • a heterologous poly A signal is one which is isolated from one gene and placed 3' to another gene.
  • a commonly used heterologous poly A signal is the SV40 poly A signal.
  • the SV40 poly A signal is contained on a 237 bp BamHI/Bcl restriction fragment, and directs both termination and polyadenylation.
  • Eukaryotic expression vectors may also contain "viral replicons," or "viral origins of replication.”
  • Viral replicons are viral DNA sequences that allow for the extrachromosomal replication of a vector in a host cell expressing the appropriate replication factors.
  • isolated and purified when used in relation to a nucleic acid, as in “an isolated and purified oligonucleotide” refers to a nucleic acid sequence that is identified and separated from at least one containment nucleic acid with which it is ordinarily associated in its natural source. Isolated nucleic acid is such present in a form or setting that is different from that in which it is found in nature (e.g., in an expression vector) .
  • non-isolated nucleic acids are nucleic acids such as DNA and RNA found in the state they exist in nature.
  • a given DNA sequence e.g., a gene
  • RNA sequences such as a specific mRNA sequence encoding a specific protein
  • Isolated nucleic acid encoding a mammalian protein includes, by way of example, such nucleic acid in cells ordinarily expressing, a protein where the nucleic acid is in a chromosomal location different from that of natural cells, or is otherwise flanked by a different nucleic acid sequence than that found in nature.
  • the isolated nucleic acid or oligonucleotide may be present in single-stranded or double-stranded form.
  • the oligonucleotide will contain at a minimum the sense or coding strand (i.e., the oligonucleotide may single-stranded) , but may contain both the sense and anti-sense strands (i.e., the oligonucleotide may be double-stranded).
  • CD4 + T cells play a critical role in initiating, regulating and maintaining antitumor immune responses.
  • An effective tumor vaccine or immunotherapy should therefore, have the ability to efficiently activate both CD4 + T-helper and CD8+ Cytotoxic T Lymphocytes (CTL) responses in order to enhance the antitumor effects of the therapy and the long-term immunity of the patent (Ossendorp, F., et al . , Journal of Experimental Medicine 187,693-702 (1998); Bennett, S.R., Carbone, F.R., Karamalis, F. , Miller, J.F. & Heath, W.R.
  • CTL Cytotoxic T Lymphocytes
  • compositions and methods for efficiently priming na ⁇ ve T cells ex vivo The invention combines two mechanisms to achieve efficient priming of na ⁇ ve T cells ex vivo: (1) constitutive expression of DC-SIGN to enhance greatly the chance for rare antigen-specific na ⁇ ve T cells to scan and interact with antigen-presenting DCs and (2) antigen presentation by DCs. It has been found that the compositions, methods and system of the present invention may be used to prime efficiently both CD4 + and CD8 + T cells.
  • the first mechanism is critical to form the immunological synapse between DCs and T cells that is generated by the orchestrated recruitment of specific receptors and co-stimulatory molecules in the contact areas when T cell receptors encounter antigenic peptides on DCs.
  • the modified cells of the present invention may even be used as vaccines.
  • the second mechanism is achieved in the present invention with, e.g., retrogens .
  • the retrogen strategy disclosed herein provides two important additional mechanisms for priming CD4 + T cells that recognize class II-restricted antigens.
  • efficient class II antigen presentation of intracellular tumor antigens becomes possible due to secretion by the retrogen and subsequent receptor-mediated endocytosis of an extracellular antigen for class II antigen presentation.
  • Fc receptor- mediated endocytosis triggers DC maturation, leading to the up- regulation of co-stimulatory and adhesion molecules.
  • the enhanced initial interaction between T cells and DCs, efficient class II antigen presentation and DC maturation signaling work in concert to allow the present invention to achieve efficient priming of na ⁇ ve CD4 + T cells ex vivo.
  • the ex vivo T h priming of the present invention has many significant applications for basic immunological study and immunotherapy.
  • the invention provides compositions and methods for identifying Class II-restricted antigens or epitopes from: DNA expression libraries, suspected gene pools or a particular gene, since antigen-specific CD4 + T cells may be generated with the invention.
  • the ability to generate antigen-specific CD4 + T cells ex vivo allows the study of immune responses against tumor antigens or other antigens.
  • the invention may also be used to generate antigen-specific h cell in numbers sufficient for adoptive immunotherapy against tumors and infectious diseases.
  • the invention may also be useful for treating tumors and/or pathogen infections.
  • One embodiment of the present invention is an antigen expression vector system to identify MHC class-II-restricted antigens.
  • the vector system of the invention co-expresses an Ii-cDNA (invariant chain) for antigen MHC class-II presentation and DC-SIGN for enhancing DC and T-cell interaction.
  • An Ii-cDNA /DC-SIGN library derived from human prostate cancer cells was constructed and transfected into human CD34 + -derived DCs. The transfected DCs were used to prime na ⁇ ve autologous CD4 + T-cells ex vivo . The primed CD4 + T-cells were then used to identify which transfected DCs contained class-II antigen (s) that stimulate CD4+ T-cells.
  • hTCTP human translationally controlled tumor protein
  • human samples including umbilical cord blood, buffy coat and bone marrow cells, were obtained from The Man's Hospital of Texas, Gulf Coast Regional Blood Center and adult volunteers at Baylor College of Medicine (BCM) .
  • BCM Baylor College of Medicine
  • the research was IRB approved at The Man' s Hospital of Texas and BCM.
  • Recombinant MAGE-3-Fc fusion protein was greater than 95% pure, as assessed by Coomassie blue staining.
  • SK-BR-3 and DU 145 tumor cells were obtained from ATCC.
  • SK-37-Mel and NA-Mel-6 were kindly provided to the present inventors by Dr. Pierre van der Bruggen, Ludwig Institute for Cancer Research, Brussels, Belgium.
  • MAGE-3-Fc fusion proteins were produced as follows : MAGE-3-Fc CDNA was amplified by PCR from a retroviral vector and cloned into the eukaryotic expression vector pcDNA3.1 (Invitrogen) (pcDNA3. l-MAGE-3-Fc) . Plasmid DNA was transfected into 293 cells using LipofectamineTM reagent (GIBCO BRL) . 48-72 hours after transfection, fusion protein was purified from cell lysates and medium at 40°C using a Protein A purification kit (Pierce) .
  • the cDNA encoding DC-SIGN was amplified by one tube RT-PCR (Roche) from human monocyte-derived dendritic cells total RNA with a pair of primers 5' AGAGTGGGGTGACATGAGTG 3' (SEQ ID NO.l), and GAAGTTCTGCTACGCAGGAG (SEQ ID NO. 2) .
  • the nucleotide sequence of the cloned DC-SIGN cDNA was confirmed by DNA sequencing.
  • the DC-SIGN cDNA was subsequently cloned into the expression vector pcDNA 3.1 (pcDNA3.1-DC-SIGN) with EcoRI/Xbal sites.
  • DC-SIGN cDNA was subcloned into the retroviral vector expressing MAGE-3-Fc or HBe-Fc.
  • DC-SIGN is expressed with the aid of the internal ribosomal entry site (IRES) . All clones were confirmed by DNA sequence analysis. Recombinant retroviruses were produced using PhoenixAMPHO packaging cells (provided by Dr. Nolan, Stanford University) .
  • the retroviral vectors pFB-MAGE-3-Fc-DC-SIGN, pFB-MAGE-3-Fc, and pFB-HBe-Fc-DC-SIGN were introduced into the PhoenixAMPHO packaging cells by transfection with GeneJammer (Stratagene) or FUGENETM 6 (Roche) transfection reagents. 24 hours after transfection, the medium containing transfection reagent was removed. The cells were gently washed with serum- free IMDM (GIBCO BRL) and 5 ml (100 mm dish) IMDM containing 2% fetal bovine serum (FBS) (GIBCO BRL) were added. The cells were incubated in an incubator for 24-36 hours.
  • Retroviral supernatant was harvested from 85-90% confluent PhoenixAMPHO cells by removing the medium from cells followed by passage through a 0.45 ⁇ m Millex-GV filter (Millipore) and then aliquoted in 2 ml aliquots and stored at 80°C.
  • CD34 + cells Human hematopoietic CD34 + cells were isolated from cord blood by positive selection of CD34-expressing cells using a direct CD34 progenitor cell isolation kit (Miltenyi Biotec) . The purity of the isolated CD34 + cells was evaluated by flow cytometry using both anti-CD34-PE and anti-CD45-FITC double staining. The purity of the CD34 + cell population ranged between 72% and 96%.
  • CD34 + cells were cultured and expanded in StemSpanTM SFEM (StemCell Technologies) medium in the presence of 80 ng/ml Flt-3 ligand, 100 ng/ml SCF, 10 ng/ml IL-3, 20 ng/ml IL-6, 30 ng/ml TPO and 25 ng/ml low density lipoproteins for 6-8 days.
  • the cells were replenished with fresh medium every 2 days.
  • CD34 + cells were placed in 24-well plates (plates were precoated with fibronectin CH296) at 2.5-5 x 10 5 cells/ml/well in the retroviral supernatant supplemented with 80 ng/ml Flt-3 ligand, 100 ng/ml SCF, 10 ng/ml IL-3, and 20 ng/ml IL-6.
  • the cells were incubated at 37 °C, 5% C02 for 4-6 hr and then 70% of the supernatant was gently removed and replaced with StemSpanTM SFEM in the presence of 80 ng/ml Flt-3 ligand, 100 ng/ml SCF, 10 ng/ml IL-3, and 20 ng/ml IL-6 for further incubation overnight. Transfection was repeated twice.
  • the cells were transferred into new 24-well plates and cultured in StemSpanTM SFEM supplemented with GM-CSF (1000 U/ml, Immunex) and IL-4 (5 ng/ml, BioSource International, Inc) in RPMI 1640 medium (GIBCO BRL) 10% FBS.
  • GM-CSF and IL-4 were added to the culture every 2 days, and the immature DCs were recovered on day 6.
  • Mature DCs were generated by stimulating immature DCs in complete medium containing GM-CSF and IL-4 with TNF- ⁇ (25 ng/ml) or soluble
  • CD40L (200 ng/ml, Immunex) for 24-48 hrs .
  • the phenotype of DCs was analyzed using PE-conjugated anti-HLA-DR, -CD40, -CD54, - CD80, -CD83 and -CD86 mAbs (PharMingen) .
  • the mature DC preparations contained less than 1% CD14 + , CD3 + , CD2 + and CD56 + cells .
  • PBLs Human peripheral blood lymphocytes
  • CD4 + CD45RA + na ⁇ ve T cells were isolated from the PBLs.
  • the cells were incubated with a cocktail of mAbs including anti-CD8 + , -CD14 + , -CD16 + , -CD19 + , - CD40 + , -CD56 + , -CD45RO and -HLA-DR at 6-12°C for 30-45 min.
  • the mixture of cells and mAbs was incubated with anti-mouse immunoglobin-coated magnetic beads at 6-12 °C for 30 minutes followed by magnetic depletion. This was repeated two times and CD4 + CD45RA + cells were frozen for further use.
  • the preparations were routinely >96% pure as determined by flow cytometry using both anti-CD45RA-PE and anti-CD4-FITC double staining.
  • Fresh CD4 + CD45RA + native T cells were re-stimulated at lOVml in 24-well plates (Costar) with 1 x 10 4 autologous irradiated transfected- or antigen (MAGE-3-Fc, MAGE-3, HBc/eAg) - pulsed- or tumor lysate-pulsed-DCs in AIM V medium (GIBCO BRL) containing 3% FBS .
  • the culture medium was renewed every 3 days.
  • these antigen-specific CD4 + T cells were further re- stimulated with 0.5 x 10 4 autologous irradiated transfected- or antigen-pulsed- or tumor lysate-pulsed-DCs.
  • CD4 + T cells were cultured in RPMI 1640 supplemented with 10% FBS, 3 ng/ml IL-2 (R&D system) and 0.5 ng/ml IL-4 (BioSource International) .
  • CD4 + T cells were re- stimulated weekly with the same autologous irradiated DCs at a ratio of 100:1 (CD4 + T cells: DCs).
  • the stimulated CD4 + T cells (2 x 10 s ) were co-cultured with irradiated DCs (2 x 10 3 ) in a 96-well plate (Costar) for 24-48 hr. Then 1 ⁇ Ci/ml 3H-thymidine (NEN) was added for overnight. The cells in triplicate wells were harvested onto fiberglass filters using Filter Mate Harvester (Packard) , and the filters were washed extensively. After drying the filters, MicroScint 20 (Packard) was added at 25 ⁇ l/well, and the filters were counted in TopCount NXT Microplate Scintillation and Luminescence Counters (Packard) .
  • DC-SIGN 5' AGAGTGGGGTGACATGAGTG (SEQ ID NO: 1), 3' GAAGTTCTGCTACGCAGGAG (SEQ ID NO: 2); Primer for MAGE-3-Fc: 5' ATGCCTCTTGAGCAGAGGAGTCAG (SEQ. ID NO.
  • the level of IL-12p70 was measured using the Quantikine HS human IL-12 Immunoassay (the sensitivity of the kit was 0.5 pg/ml, R&D Systems). All results are presented as means and standard errors (s.e.). Analysis of variance was used to determine the levels of differences between groups. Different groups were compared by the Student-Newman-Keuls test with SigmaStat 2.03 software (SPSS Inc.). P values were considered significant at 0.05.
  • MFDS MAGE-3-Fc
  • HF-DS irrelevant antigen control vector
  • CD34 + cells isolated from umbilical cord blood were transfected with recombinant retroviral MF-DS and other control vectors, and then differentiated into DCs.
  • competitive quantitative RT-PCR showed that the retrogen and DC-SIGN were constitutively co-expressed in CD34 + -derived DCs transfected with PMF-DS in the both immature and mature (with CD40L and TNF-cc stimulation) stages of DCs.
  • DC-SIGN expression in the DCs transfected with MF or blank vector was significantly lower, especially after DCs were stimulated with the anti-CD40L or TNF- ⁇ .
  • DC-SIGN and MAGE-3-Fc in CD34 + - derived DCs were determined by competitive quantitative RT-PCR and expressed as approximate copies of mRNA per 100 ng total mRNA.
  • DC-SIGN expression levels in MF-DS-transfected DCs were significantly higher, with (+) or without (-) CD40L or TNF- ⁇ stimulation, than those in MF-transfected or control vector- transfected DCs by the Student-Newman-Keuls test with SigmaStat 2.03 software (SPSS Inc.), P ⁇ 0.05.
  • human CD34 + cells isolated from umbilical cord blood were transfected with the retroviral MF-DS or control HB-DS vector.
  • the autologous native CD4 + CD45RA + T cells were also isolated and co-cultured with the transfected DCs ex vivo.
  • CD4 + T cells from the co- culture were re-stimulated with MF-DS-transfected DCs 10-14 days later.
  • CD4 + T cells co-cultured with MF-DS transfected DCs actively proliferated and produced high levels of IFN- ⁇ , while CD4 + T cells from the co-culture with HF-DS or CD4 + T cells that were not co-cultured did not respond to the stimulation.
  • Human CD34 + -derived DCs were transfected by the retroviral MF-DS or HF-DS vector, and co-cultured with autologous na ⁇ ve CD4 + CD45RA + T cells (DCs vs. CD4 + CD45RA + T cells: 1 x 10 4 vs. 1 x 10 5 ) .
  • CD4 + T cells were then re-stimulated with MF-DS-transfected DCs (DCs vs. CD4 + T cells: 5 x 10 3 vs. 5 x 10 5 ) .
  • the CD4 + T cell proliferation and IFN- ⁇ release were examined to determine CD4 + T cell responses. Data represent the mean +/- s.e. of three independent experiments .
  • CD4 + T cells from the co-culture with MF-DS-transfected DCs were stimulated with irrelevant recombinant antigen (HBe/cAg and human. IgG) -pulsed autologous DCs.
  • irrelevant recombinant antigen HBe/cAg and human. IgG
  • FIG. 3B the CD4 + T cells primed by MF-DS- transfected DCs were re-stimulated with autologous CD34 + -derived DCs transfected with MF-DS or HF-DS or mock-transfected.
  • CD4 + T cells primed by MF-DS-transfected DCs were also re-stimulated with autologous DCs pulsed with recombinant MAGE-3-Fc proteins, MAGE-3 proteins, HBe/cAg proteins and human IgG proteins for 4-6 days.
  • CD4 + T cells primed by HF-DS- or MF-DS-transfected DCs or HBe/cAg-pulsed DCs were re- stimulated with autologous MF-DS-transfected DCs for 4-6 days. IFN- ⁇ levels in the cultures were determined by ELISA. Data represent the mean +/- s.e. of three independent experiments.
  • the CD4 + T cells did not actively proliferate and produced low or background levels of IFN- ⁇ .
  • the CD4 + T cells actively proliferated and produced high levels of IFN- ⁇ when stimulated with autologous DCs pulsed with the recombinant MAGE-3 protein or MAGE3-Fc protein.
  • MF-DS-transfected DCs were incapable of stimulating CD4 + T cells primed by HF-DS-transfected DCs.
  • CD34 + -derived DCs were pulsed by MAGE-3-Fc fusion proteins or MAGE-3 positive tumor cell lysates (Nestle, F.O., et al., Vaccination Of Melanoma Patients With Peptide- Or Tumor Lysate-Pulsed Dendritic Cells [see comments] , Nature Medicine 4, 328-32 (1998)).
  • CD34 + -derived DCs were also transfected with MF-DS or MF, which can induce potent CD4 + T-helper responses by in vivo immunization.
  • the autologous CD4 + T cells were then primed by co-culturing with the same numbers of the antigen- pulsed or transfected DCs. After 10-14 days of co-culture, CD4 + T cells from the co-cultures were then restimulated with fresh MF-DS-transfected DCs. As shown in Figure 4, CD4 + T cells from the co-culture with MF-DS-transfected DCs proliferated actively and produced high levels of IFN- ⁇ , indicating the CD4 + T cells were primed.
  • CD4 + T cells from the co-culture with MF- transfected or recombinant MAGE3-Fc protein-pulsed DCs only proliferated modestly and produced lower levels of IFN- ⁇ .
  • CD4 + T cells (1 x 10 5 ) were primed by co-culturing with the same number (1 x 10 4 ) of DCs transfected with MF-DS, HF-DS, or MF or pulsed with recombinant MAGE-3-Fc, NA-6-Mel lysates, or normal DCs. After 10-14 days of co-culture, the CD4 + T cells were then re- stimulated with the same DCs (DCs vs. CD4 + T cells: 5 x 10 3 vs. 5 x 10 5 ) . The CD4 + T cell proliferation and IFN- ⁇ release were examined to determine CD4 + T cell responses. Data represent the mean +/- s.e. of three independent experiments.
  • the T cell responses were specific. Specificity was corroborated by the observation that the CD4 + T cells from the co-culture with MF-DS transfected DCs responded to recombinant MAGE-3-pulsed DCs, but not HBe/cAg-pulsed DCs. Moreover, CD4 + T cells from the co-culture with HF-DS-transfected responded to HF-DS-transfected or recombinant HBe/cAg-pulsed DCs, but did not respond to MF-DS-transfected DCs. Taken together, DCs co- expressing DC-SIGN and retrogen are more potent than other antigen-pulsed or transfected DCs for priming na ⁇ ve antigen- specific human CD4 + T cells ex vivo.
  • anti-ICAM-3 antibodies (30 ⁇ g/ml) were added in the co-culture of MF-DS-transfected DCs and CD4 + T cells. Anti-ICAM-3 antibodies have been shown to block the interaction of DC-SIGN on DCs with ICAM-3 on T- cells.
  • CD4 + T cells were primed by co-culturing with MF-DS- or MF-transfected DCs in the presence or absence of the anti- ICAM-3 antibody for 2 weeks. After the co-cultured CD4 + T cells were then stimulated with MF-DS-transfected DCs for 6 days, IFN- ⁇ release was examined by ELISA.
  • CD4 + T cells (2 x 10 5 ) primed by MF-DS- or HF- DS-transfected DCs were cocultured with DCs (1 x 10 4 ) pulsed with the recombinant MAGE-3 protein for 24 hrs .
  • the biologically active IL-12p70 was then measured in the medium of the co- cultures. Data represent the mean +/- s.e. of two independent experiments. It was observed, as shown in Fig. 5B, that MF-DS- transfected DCs stimulated stronger primed CD4 + T cell proliferation and cytokine production than that MF-transfected DCs at the same ratio.
  • Constitutive expression of DC-SIGN although it is naturally expressed on DCs, further enhances the retrogen ability to prime native CD4 + T cells and to stimulate primed T cells.
  • CD4 + T cells (5 x 10 5 ) primed by MF-DS- transfected DCs were restimulated with MF-DS- or MF-transfected DCs (5 x 10 3 ) for 4-6 days. IFN- ⁇ release was examined by ELISA. Data represent the mean +/- s.e. of three independent experiments. The capacity of CD4 + T cells primed by MF-DS transfected DCs to activate DCs was tested by monitoring biologically active IL-12p70 production by DCs.
  • pSN novel retroviral vector
  • MCS multiple cloning sites
  • pSN a synthesized DNA fragment GTCGACGAATTCGGATCCAAGCTTATCGATCGTACGCATATGGCGGCCGC (SEQ ID NO: 5) including Sal I, EcoR I, BamH I, Hind III, Cla I, BsiW I, Nde I and Not I restriction enzyme sequences was cloned into Sal I/Not I-cut pFB vector (Stratagene) .
  • Figure 6 summarizes the process for the creation of a cDNA library of the present invention.
  • a bicistronic expression cassette for the cDNA and DC-SIGN is placed under LTR control in a murine retroviral vector.
  • a DNA fragment containing the Sal I site-human Ii ⁇ - 8 o amino acids and EcoR I site was created by PCR with a pair of primers, using the human Ii cDNA (Dr. J. Pieters, Basel Institute for Immunology, Basel, Switzerland) as a template.
  • the primers used were: 5'- GTCGACATGGATGACCAGCGCGACCTT-3' (SEQ ID NO: 6), corresponding to the nucleotide sequence 1 to 21 of human Ii cDNA and Sal I sequence, and 5' -GAATTCCTTCATGCGCAGGTTCTCCAG-3' (SEQ ID NO: 7), corresponding to the nucleotide sequence 220 to 240 of the human Ii cDNA with an additional EcoR I site.
  • the fusion DNA fragment was cloned into Sal I/EcoR I -cut pSN retroviral vector.
  • the resultant vector was named pSI.
  • DC- SIGN with the aid of IRES, was cloned into BsiW I/Notl cut pSI vector.
  • the resultant vector, designated pID was used to construct a unidirectional cDNA library of the present invention.
  • the resultant vector, pID contained the EcoR I/BsiW I cloning site for unidirectional insertion of all cDNA to generate a complete unidirectional cDNA library with the co- expression of DC-SIGN, as shown in Figure 6.
  • mRNA from cells and tissue samples was isolated using an mRNA isolation kit (Roche) according to the manufacturer's protocol.
  • High quality cDNA for construction of the library was generated with a cDNA synthesis kit (Stratagene) .
  • cDNA with a size of 400bp and above were inserted at the EcoR I/BsiW I sites of pID.
  • XL-10 Gold cells (Stratagene) were transformed by electroporation with the ligated DNA and plated onto ampicillin agar plates (50 mg/ml) . Individual colonies were grouped into different pools. Plasmid DNAs from the culture of pooled bacterial colonies were isolated.
  • Retroviral cDNA library pools were generated by transfection of the plasmid DNA pools into the PhoenixAMPHO packaging cells (provided by Dr. Nolan, Stanford University) with GeneJammer (Stratagene) or FuGENETM 6 (Roche) transfection reagents. 24 hours after transfection, the cells were gently washed with serum-free IMDM (GIBCO BRL) and replaced with fresh IMDM containing 2% fetal bovine serum (FBS) (GIBCO BRL) . After incubation for 24-36 hours, the culture medium containing the retroviral vectors was harvested, filtered through a 0.45 mm Millex-GV filter (Millipore) , and then stored at -80°C in different vials .
  • GEBCO BRL serum-free IMDM
  • FBS fetal bovine serum
  • CD34 + cells Human umbilical cord blood samples were obtained from The Man's Hospital of Texas (with all required approvals). Human hematopoietic CD34 + cells were isolated from cord blood by using a CD34 isolation kit (Miltenyi Biotec) . About 72% to 96% of isolated cells were CD34+ positive, as determined by flow cytometry. CD34 + cells were cultured and expanded in StemSpanTM SFEM (StemCell Technologies) medium in the presence of 80 ng/ml Flt-3 ligand, 100 ng/ml SCF, 10 ng/ml IL-3, 20 ng/ml IL-6, 30 ng/ml TPO and 25 ng/ml low density lipoproteins for 6-8 days. The cells were replenished with fresh medium every 2 days. After expansion, a portion of the CD34 + cells was frozen in liquid nitrogen.
  • StemSpanTM SFEM StemSpanTM SFEM (StemCell Technologies) medium in the presence of 80 ng/ml Flt-3 lig
  • Human PBMCs were isolated from umbilical cord blood of healthy neonates by Percoll gradient centrifugation. Na ⁇ ve
  • CD4 + /CD45RA + T-cells were further isolated from PBMCs (Rissoan, 1999) . Briefly, the cells were incubated with a cocktail of mAbs including anti-CD8, -CD14, -CD16, -CD19, -CD40, -CD56, - CD45RO (BD PharMingen) and -HLA-DR (Immunotech) at 6-12°C for 30 - 45 minutes. The mixture of cells and mAbs was incubated with anti-mouse immunoglobulin-coated magnetic beads at 6 - 12°C for 30 minutes followed by magnetic depletion.
  • mAbs including anti-CD8, -CD14, -CD16, -CD19, -CD40, -CD56, - CD45RO (BD PharMingen) and -HLA-DR (Immunotech) at 6-12°C for 30 - 45 minutes.
  • the mixture of cells and mAbs was incubated
  • the cells were incubated at 37°C, 5% C0 2 for 4-6 hr and then 70% of the supernatant was gently removed and replaced with StemSpanTM SFEM in the presence of 80 ng/ml Flt-3 ligand, 100 ng/ml SCF, 10 ng/ml IL-3, and 20 ng/ml IL-6 for overnight incubation. After 3 consecutive transfections, the cells were transferred into new 24-well plates and cultured in StemSpanTM SFEM supplemented with GM-CSF (1000 U/ml, Immunex) and IL-4 (5 ng/ml, BioSource International, Inc) in RPMI 1640 medium (GIBCO BRL) containing 10% FBS.
  • StemSpanTM SFEM 80 ng/ml Flt-3 ligand, 100 ng/ml SCF, 10 ng/ml IL-3, and 20 ng/ml IL-6 for overnight incubation.
  • the cells were transferred into new 24-well plates and cultured in StemSpan
  • GM-CSF and IL-4 were added to the culture every 2 days, and immature DCs were recovered on day 6.
  • Mature DCs were generated by stimulating immature DCs in complete medium containing GM-CSF and IL-4 with TNF- ⁇ (25 ng/ml, R&D Systems) or soluble CD40L (200 ng/ml, Immunex) for 24-48 hours.
  • the phenotype of the DCs was analyzed using PE- conjugated anti-HLA-DR, -CD40, -CD54, -CD80, -CD83 and -CD86 mAbs (PharMingen) .
  • Preparations of mature DCs contained less than 1% CD14 + , CD3 + , CD2 + , and CD56 + cells.
  • Na ⁇ ve T cells (CD4 + /CD45RA +) were stimulated at lOVml in 24- well plates (Costar) with 1 x 10 4 autologous irradiated cDNA pool transfected DCs in AIM V medium (GIBCO BRL) containing 3% FBS. The culture medium was renewed every 3 days. On day 8, the antigen-specific CD4 + T cells were further re-stimulated with 0.5 x 104 autologous irradiated cDNA pool transfected DCs. On day 10-14, the antigen-specific CD4+ T cells were cultured in RPMI 1640 supplemented with 10% FBS, 3ng/ml IL-2 (R&D system) and
  • CD4 + T cells were re- stimulated weekly with the same autologous irradiated cDNA pool transfected DCs at a ratio of 100:1 (CD4 + T cells: DCs).
  • CD4 + T cells (2x10 s ) in triplicate wells were re-stimulated with irradiated DCs (2xl0 3 ) in RPMI 1640 containing 10% FBS in a 96-well plate (Costar) for 24-48 hours, and 1 mCi/ml 3 H-thymidine (NEN) was added into each well. After overnight incubation, the cells in triplicate wells were harvested onto fiberglass filters using Filter Mate Harvester (Packard) , and the filters were washed extensively. MicroScint 20 (Packard) was added at 25 ml/well, and the filters were counted in TopCount NXT Microplate Scintillation and Luminescence Counters (Packard) . IFN- ⁇ and IL-12 (p70) concentrations in culture medium were measured by ELISA (R&D Systems) .
  • a unidirectional functional immuno-screening procedure of the present invention is schematically represented
  • a part of cDNA library (l.OxlO 3 clones) was generated from mRNA of the human prostate tumor cell line DU 145 and divided into 10 pools (each pool contained 100 individual clones) .
  • Ten retroviral cDNA vector pools were then generated and transfected into human CD34+ cord blood-derived DCs.
  • DCs transfected with each pool were then co-cultured with autologous CD4+ T cells for 2 weeks .
  • the co-cultured T-cells were then re-stimulated with the DCs transfected with different pools for cell proliferation assays .
  • a part of the cDNA library (1000 clones) was generated from a prostate cancer cell line DU145 (ATCC) , and divided into 10 pools.
  • Human CD34 + -derived DCs transfected with different pools were co-cultured with autologous na ⁇ ve CD4 + /CD45RA + T cells (DCs vs. T-cells: lxlO 4 vs. 1x10 s ) . After 10-14 days of co-culture, the CD4 + T cells were then re- stimulated with different cDNA clones transfected DCs (DCs vs. T cells: 2xl0 3 vs. 2xl0 5 ) for 2-3 days for proliferation assays.
  • CD4 + T cells primed by the pools 2 and 7-transfected DCs showed strong responses when stimulated with the pools 2- and 7- transfected DCs, while CD4 + T cells primed by DCs transfected with other pools only showed weak or background responses .
  • Pools 2 and 7 may contain, therefore, one or more class-II- restricted antigens.
  • the positive pools 2 and 7 were further divided into 10 additional pools (about 20 individual clones each) .
  • the positive pools 2 were divided into 10 pools (20 clones each) .
  • Human CD34 + -derived DCs transfected with different pools were re-stimulated with CD4 + T cells by the DCs transfected with the pool 5 for 2-3 days for proliferation assays.
  • DCs transfected with the sub-pool E still induced strong CD4 + T-cell responses.
  • the 20 clones in the sub- pool E were individually transfected into DCs.
  • FIG 11 shows the DNA sequence of clone 9 (SEQ ID NO: 8) .
  • DNA sequencing analysis showed that clone 9 encodes an open reading frame (ORF) with 172 amino acid residues (SEQ ID NO: 9) .
  • Comparison with gene bank sequences revealed that two clones of clone 9 are 100% homologous with the sequence of the human Translationally Controlled Tumor Protein (hTCTP) (GeneBank Acc# NM-003295; SEQ ID NO: 8) .
  • hTCTP Human Translationally Controlled Tumor Protein
  • Figure 12 shows the alignment comparison of the amino acid sequence encoded by the DNA sequence of clone 9 (SEQ ID NO: 8) with the amino acid sequence of hTCTP.
  • hTCTP is capable of inducing potent CD4 + T-cell responses and may be a class-II-restricted tumor-associated antigen .

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Cell Biology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne des compositions et des procédés destinés à amorcer de manière efficace des cellules humaines naïves ex vivo et à identifier des antigènes de classe restreinte au CMH. Le lymphocyte T auxiliaire CD4+ et les lymphocytes T cytotoxiques CD8+ font partie des variétés de lymphocytes T pouvant être amorcés. Les compositions de l'invention contiennent des constructions génétiquement modifiées renfermant un gène destiné à la protéine DC-SIGN et (1) un gène destiné à un antigène modifié ('rétrogène') ou (2) un oligonucléotide soupçonné de coder un antigène de classe restreinte au MHC.
PCT/US2002/029156 2001-09-14 2002-09-13 Compositions et procedes destines a l'amorcage de lymphocyte t et immunotherapie WO2003025126A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2002336522A AU2002336522A1 (en) 2001-09-14 2002-09-13 Compositions and methods for t cell priming and immunotherapy

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US32212001P 2001-09-14 2001-09-14
US60/322,120 2001-09-14

Publications (2)

Publication Number Publication Date
WO2003025126A2 true WO2003025126A2 (fr) 2003-03-27
WO2003025126A3 WO2003025126A3 (fr) 2003-09-04

Family

ID=23253508

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2002/029156 WO2003025126A2 (fr) 2001-09-14 2002-09-13 Compositions et procedes destines a l'amorcage de lymphocyte t et immunotherapie

Country Status (2)

Country Link
AU (1) AU2002336522A1 (fr)
WO (1) WO2003025126A2 (fr)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1497412A2 (fr) * 2002-04-30 2005-01-19 Avior Therapeutics, Inc. Vecteurs d'adenovirus utilises en immunotherapie
WO2017123808A1 (fr) 2016-01-15 2017-07-20 The J. David Gladstone Institutes Méthodes de traitement de maladies par la régulation métabolique de la différenciation des lymphocytes t
EP3368691A4 (fr) * 2015-10-27 2019-04-03 Arizona Board of Regents on behalf of Arizona State University Identification à haut rendement d'antigènes et d'épitopes de reconnaissance des lymphocytes t

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5962320A (en) * 1993-04-20 1999-10-05 Leland Stanford Junior University Engineered antigen presenting cells and methods for their use
US6045802A (en) * 1994-10-03 2000-04-04 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Enhanced immune response to an antigen by a composition of a recombinant virus expressing the antigen with a recombinant virus expressing an immunostimulatory molecule

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5962320A (en) * 1993-04-20 1999-10-05 Leland Stanford Junior University Engineered antigen presenting cells and methods for their use
US6045802A (en) * 1994-10-03 2000-04-04 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Enhanced immune response to an antigen by a composition of a recombinant virus expressing the antigen with a recombinant virus expressing an immunostimulatory molecule

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
GEIJTENBEEK T.B.H. ET AL.: 'Identification of DC-SIGN, a novel dendritic cell-specific ICAM-3 receptor that supports primary immune responses' CELL vol. 100, March 2000, pages 575 - 585, XP000929197 *
POHLMANN S. ET AL.: 'DC-SIGN interactions with human immunodeficiency virus type 1 and 2 and simian immunodeficiency virus' J. VIROL. vol. 75, no. 10, May 2001, pages 4664 - 4672, XP002963637 *
YOU Z. ET AL.: 'A retrogen strategy for presentation of an intracellular tumor antigen as an exogenous antigen by dendritic cells induces protent antitumor T helper and CTL responses' CANCER RESEARCH vol. 61, no. 1, January 2001, pages 197 - 205, XP002963638 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1497412A2 (fr) * 2002-04-30 2005-01-19 Avior Therapeutics, Inc. Vecteurs d'adenovirus utilises en immunotherapie
EP1497412A4 (fr) * 2002-04-30 2006-11-22 Avior Therapeutics Inc Vecteurs d'adenovirus utilises en immunotherapie
EP3368691A4 (fr) * 2015-10-27 2019-04-03 Arizona Board of Regents on behalf of Arizona State University Identification à haut rendement d'antigènes et d'épitopes de reconnaissance des lymphocytes t
WO2017123808A1 (fr) 2016-01-15 2017-07-20 The J. David Gladstone Institutes Méthodes de traitement de maladies par la régulation métabolique de la différenciation des lymphocytes t
US11241455B2 (en) 2016-01-15 2022-02-08 The J. David Gladstone Institutes, A Testamentary Trust Established Under The Will Of J. David Gladstone Methods of treating disease by metabolic control of T-cell differentiation

Also Published As

Publication number Publication date
AU2002336522A1 (en) 2003-04-01
WO2003025126A3 (fr) 2003-09-04

Similar Documents

Publication Publication Date Title
JP7451858B2 (ja) クローディン６特異的免疫受容体およびｔ細胞エピトープ
JP7194230B2 (ja) クローディン－１８．２－特異的免疫受容体およびｔ細胞エピトープ
KR102319839B1 (ko) 항원-특이적 tcr의 신규 생성
US8518697B2 (en) Single chain trimers and uses therefor
KR20210019993A (ko) Τ 세포 수용체 및 이를 발현하는 조작된 세포
Osterroth et al. Stimulation of cytotoxic T cells against idiotype immunoglobulin of malignant lymphoma with protein-pulsed or idiotype-transduced dendritic cells
CN110785432A (zh) Tcr和肽
KR20210120019A (ko) 세포-특이적 전사 조절 서열 및 이의 용도
WO2003025126A2 (fr) Compositions et procedes destines a l'amorcage de lymphocyte t et immunotherapie
CN113993991A (zh) 宿主细胞中免疫蛋白酶体的过表达用于产生抗原呈递细胞
RU2650872C1 (ru) Искусственный ген MEL-TCI, кодирующий полиэпитопный белок-иммуноген MEL-TCI, рекомбинантная плазмидная ДНК pMEL-TCI, обеспечивающая экспрессию искусственного гена MEL-TCI и искусственный белок-иммуноген MEL-TCI, содержащий CTL- и Th-эпитопы антигенов меланомы, рестриктированные множественными аллелями HLA I и II класса
EA041619B1 (ru) Способ продуцирования человеческих антигенспецифических т-лимфоцитов
NZ735850B2 (en) Claudin-18.2-specific immunoreceptors and t cell epitopes
JP2002171981A (ja) 新規樹状細胞膜分子及びその用途

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BY BZ CA CH CN CO CR CU CZ DE DM DZ EC EE ES FI GB GD GE GH HR HU ID IL IN IS JP KE KG KP KR LC LK LR LS LT LU LV MA MD MG MN MW MX MZ NO NZ PL PT RO RU SE SG SI SK SL TJ TM TR TT TZ UA US UZ VN YU ZA

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ UG ZM ZW AM AZ BY KG KZ RU TJ TM AT BE BG CH CY CZ DK EE ES FI FR GB GR IE IT LU MC PT SE SK TR BF BJ CF CG CI GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase in:

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP