WO2003020964A1

WO2003020964A1 - Means and methods for determining the presence of active herpes virus

Info

Publication number: WO2003020964A1
Application number: PCT/EP2002/009279
Authority: WO
Inventors: Marion Cornelissen; Abeltje Polstra
Original assignee: Biomerieux B.V.
Priority date: 2001-08-31
Filing date: 2002-08-19
Publication date: 2003-03-13

Abstract

The invention relates to a method for the determination of an active herpes virus, and in particular HHV-8, a herpes virus that is associated with Kaposi's sarcoma, by determining the presence of mRNA of said herpes virus in a peripheral blood mononuclear cell in a sample taken from an individual.

Description

Means and methods for determining the presence of active herpes virus

The invention relates to the field of medicine. More specifically, the invention relates to the diagnosis of active herpes virus in an individual.

Homosexual men with HIV-1 infection are at increased risk for developing Kaposi's sarcoma, AIDS-KS. This has been shown to be due to co-infection with HHV-8, a gamma herpes virus. HHV-8 or Kaposi's sarcoma associated herpes virus as it is also known, was first discovered in 1994 in KS-tissue (10). Since then HHV- 8 DNA has also been associated with the development of multicentric Castleman's disease and primary effusion lymphoma (PEL) (8,9,29,31). Studies initially focused on HHV-8 and its association with KS, transmission of HHV-8 and the natural history of HHV-8 infection. As shown by Renwick et al. and Jacobsen et al. (18,28) seroconversion for HHV-8 during HIV infection increases the risk of developing KS, implying that HIV-1 has an impact on HHV-8. In situ hybridisation techniques have shown that most cells in KS are latently infected (13, 32) but lytic infection is clearly also present in a small proportion of cells (4,23,26). In the cells harbouring the latent virus the viral genome takes the form of a circular molecule and a small subset of viral genes is expressed. In the lytic phase the viral genome becomes linear and the expression of lytic genes commences. This is a common feature of all herpes viruses. To study lytic and latent HHV-8 gene expression reliable quantitative mRNA assays are needed. A disadvantage of present mRNA in situ hybridisation reactions is that a tissue sample has to be obtained from a patient. This is inconvenient, both for the patient undergoing medical treatment and for physicians because it is a time-consuming, expensive process requiring expensive equipment like for instance a microscope. It would be much more convenient to detect herpes virus in a sample which is easily obtained from a patient, for instance a blood sample. Indeed, HHV-8 DNA has been detected in peripheral blood mononuclear cells (PBMC's). A linear relationship exists between plasma HHV-8 DNA and PBMC HHV-8 DNA for persons with stage IV, palatal or visceral, Kaposi's sarcoma (21). However, herpes DNA was not always found in PBMC of patients infected with herpes virus. In only a part of those patients, herpes DNA was actually found in PBMC. Therefore, a diagnosis based on examination of herpes DNA in PBMC is not reliable. Thus, a negative test result for herpes DNA in a blood sample does not mean that a patient is not infected. Moreover, even if the test result is positive it is not known whether the cells are actively or latently infected. Measurement of the amount of herpes DNA does therefore not give adequate information about the virus activity in infected patients. The difference between latency and active replication of the virus is, however, very important for diagnosis of the disease state, and/or prediction of disease development in a patient. Contrary to DNA, the presence of HHV-8 mRNA indicates an active and /or productive process.

Thus, there is a need for an easy and reliable test for determining whether a patient (or a non-human animal) comprises an active herpes virus, without the need for laborious, expensive and inconvenient mRNA in situ hybridisation reactions in a tissue sample.

In one aspect the invention provides a method for determining whether an animal comprises an active herpes virus, comprising determining in a provided sample of said animal, whether a peripheral blood mononuclear cell from said sample comprises mRNA of said herpes virus. With a method of the invention, inconvenient tissue samples are no longer necessary. Determining the presence of herpes virus mRNA in said PBMC is predictive for said animal comprising said herpes virus. With a method of the invention it is also possible to determine whether a herpes virus is lytic or latent in said animal. Information resulting for a method of 'the invention can be used to determine whether a treatment is given to a patient and if so, the kind of treatment. Methods of the invention can provide information without the need for obtaining a tissue sample. A rapid and easy diagnosis of the presence of an active herpes virus in a patient has become possible.

After a sample, as for instance a blood sample, is obtained, a quick diagnosis is possible. Not only the presence of an herpes virus, but also its state (latent or active) can be determined. This can even be done in the same assay. One can quickly and easily determine whether a treatment is needed by a particular patient. If a patient is only latently infected, no treatment may be necessary yet. Easy and quick periodic monitoring of the state of said virus is now possible. When said virus gets into a lytic state, this can be detected in an early stage and treatment can be given instantly. It is now also possible to determine which treatment will give the best results. For instance, one can easily determine whether a patient is infected by one or several kind of herpes viruses, and if one or more of them are in an active state. This way, a specific treatment can be given for each individual.

By an active herpes virus is meant herein a herpes virus with is in a lytic phase, or is transforming from a latent phase into a lytic phase. As has been described above, the viral genome may be linear, or become linear in said lytic phase. As used herein the term animal is used to also encompass a human.

Methods to determine the presence of mRNA in a sample are known by the art and need not be explained here. For instance, mRNA can be detected by a probe which is attached to a label. Said label may be a fluorescent label. Alternatively, said probe may be attached to an enzyme. Said enzyme may drive a reaction which can be monitored easily. For instance, said enzymatic reaction may be involved with a change of color of the reaction sample. Peripheral blood mononuclear cells are typically present in the blood. A blood sample is therefore preferred in the invention. However, a peripheral blood mononuclear cell is present in any blood containing tissue. Thus, blood isolated from any part of the body may be used as a source of peripheral blood mononuclear cells. However, it is preferred that said blood is obtained from the peripheral blood supply.

To be capable of detecting herpes mRNA, amplification of said mRNA is preferred. Amplification reactions of nucleic acid are well known in the art. A preferred amplification method comprises NASBA. NASBA is an isothermal nucleic acid amplification reaction that can amplify mRNA in a dsDNA background (16). It is possible to pick-up mRNA in a dsDNA background without getting false positive results caused by genomic dsDNA, which can be the case with RT-PCR. A NASBA reaction is based on the simultaneous activity of AMV reverse transcriptase (RT), RNase H and T7 RNA polymerase together with two primers to produce amplification (19). In a NASBA reaction nucleic acids are only a template for an amplification reaction if they are single stranded in the primer-binding region. Because the NASBA reaction is isothermal (41°C), specific amplification of ssRNA is possible as long as denaturation of dsDNA is prevented in the sample preparation procedure. NASBA proved to be a successful tool in the detection of mRNA (5,12,16). In a preferred embodiment a method of the invention utilizes a molecular beacon probe. Preferably, said beacon probe is used in combination with a NASBA amplification. A molecular beacon probe can generate a specific fluorescent signal in parallel with amplification. In a preferred embodiment a method of the invention further comprises quantifying herpes virus mRNA. By combining the standard NASBA technology (34) with a molecular beacon that anneals during amplification to the target sequence, a real-time detection system (22) can be generated. Molecular beacons are stem-and-loop-structured oligonucleotides with a fluorescent label at the 5' end and a universal quencher at the 3' end (33). If the molecular beacon has its closed stem-and-loop structure, the fluorophore and quencher are in close proximity and fluorescence energy is transferred to the quencher. When the loop of the molecular beacon hybridises to its target, the molecular beacon undergoes a conformational change, resulting in a physical separation of the fluorophore and quencher. Emission of photons at the wavelength that is specific for the fluorophore is the result (33). Molecular beacons are highly specific for their target. When present in a NASBA amplification reaction, they hybridise with their amplified target RNA to form a stable hybrid. The intensity of the fluorescence upon hybridisation is a direct measure of the amplicon concentration.

In a preferred embodiment of the present invention said herpes virus comprises HHV-8. As HHV-8 is a herpes virus associated with Kaposi's sarcoma this provides it is possible to predict whether an individual is at risk of developing Karposi's sarcoma. Now that an easy determination of the presence of active HHV- 8 is provided, a quick diagnosis or prediction of Kaposi's sarcoma is also possible since this disease is associated with HHV-8. Individuals infected with active HHV-8 can now be treated in a very early stage, reducing the risks of Kaposi's sarcoma and improving the chances of complete recovery.

As is described in more detail in the examples, we have chosen four functionally different genes of HHV-8 for which we have developed four real-time NASBA assays: ORF 73, vGCR, vBcl-2 and vIL-6. Expression of said ORF 73 gene is indicative for a latent HHV-8 infection, whereas expression of vGCR, vBcl-2 and vIL-6 indicates the presence of HHV-8 in the lytic phase. We tested the assays on PBMC samples of two patients with KS but with different disease progression. We used the samples for all the four HHV-8 assays. In said assays we were able to detect mRNA of HHV-8 in PBMC of KS patients. Thus, in one aspect the invention provides a method of the invention, comprising determining the presence of an ORF 73 mRNA, a vGCR mRNA, a vBcl-2 mRNA, and/or a vIL-6 mRNA.

The present invention further provides a kit comprising a means for the detection of herpes virus by a method of the invention. Said kit comprises at least a means for specifically detecting herpes virus. Preferably, said means comprises a means for the detection of active herpes virus. Said kit may further comprise a means for amplification of mRNA, like for instance AMV reverse transcriptase, RNAse H and T7 RNA poly erase suitable for a NASBA reaction. Said kit preferably further comprises a beacon probe. In a preferred embodiment said kit further comprises a means for obtaining a peripheral blood mononuclear cell.

In another aspect the invention provides a use of a means for the detection of a herpes virus for detecting active herpes virus in peripheral blood mononuclear cells. In yet another aspect the invention provides a use of mRNA of a peripheral blood mononuclear cell for determining whether an animal comprises a herpes virus. Preferably, said mRNA is in solution.

Of course, a kit of the invention is particularly suitable for detecting active herpes virus in peripheral blood mononuclear cells. Thus, a use of a means for the detection of active herpes virus for detecting active herpes virus in peripheral blood mononuclear cells is also herewith provided. The following examples explain the invention in more detail. They are not meant to limit the invention in any way. A person skilled in the art can of course think of alternative embodiments which are still within the scope of the present invention.

Examples

Assay development:

The quantification is based on a standard curve with a known input of RNA. For this in vitro RNA was used that was made with four different constructs.

These constructs were made using a specific PCR product for each of the genes that were generated using specific primers and the BCP-1 cell line as input. The generated PCR products were cloned in plasmids with the TOPO-TA cloning kit (Invitrogen) and the inserts were verified by a direct sequence. The plasmids were transcribed and the generated in vitro RNA was used for the different standard curves. For a good comparison between the different samples an internal standard is needed. For this we chose one snRNA, snRNA is an abundant class of RNA found in the nucleus of eukaryotes. The Ul gene is constitutively expressed in all cells and the amount of U1A RNA gives a good indication of the total amount of RNA in the isolation/sample. So a quantitative NASBA assay was developed for U1A RNA. The sensitivity is not as great as the HHV-8 assays, only 10³ copies input per reaction, but because of the high expression level of U1A this is not a necessity. The sequence of the primers and the beacon are shown in table 1.

Real-Time amplification system: The amplification requires a sense and an anti sense primer and for realtime detection a unique beacon is added to the reaction. We developed a molecular beacon that could hybridise with the known sequences of the different genes chosen of HHV-8. The sequence of the primers and beacons for the different genes of HHV-8 are shown in table 1. All the beacons have FAM as the fluorescent label at the 5'end and a (4-(dimethylamino) phenyl) azo) benzoic acid (Dabcyl) as universal quencher at the 3'end. Neither the primers nor the beacon shared significant homology with any other known nucleotide sequences than the target genes. Each reaction consisted of 5 μl sample RNA and 10 μl of NASBA reaction mix. This mix consisted of 80 mM Tris-HCl [pH 8.5], 24 mM MgC12, 140 mM KC1, 1.0 M DTT, 2.0 M of each dNTP, 4.0 mM each of ATP, UTP and CTP, 3.0 M GTP, and 1.0 mM ITP in 30% DMSO. This solution also contained 1.0 μM each of anti-sense and sense primers for amplification, and the molecular beacons (beacons) for detection.

The reaction mixtures were incubated at 65°C for 5 min, and after cooling to 41°C for 5 min to allow for primer annealing, 5 μl of enzyme mix was added. This mix contained per reaction 375 mM sorbitol, 2.1 μg BSA, 0.08 U RNase H, 32 U T7 RNA polymerase and 6.4 U AMV reverse transcriptase. Reactions were incubated at 41°C for 120 min in a Cytoflurometer (Cytofluor 4000 Perseptive Biosystems) for real-time monitoring (i.e., as the reaction proceeds) of the amplification reaction.

The hybridisation reaction was monitored every minute in a 96-well thermostated fluorimeter. A calibration curve with 50, 10², 10³, 10⁴, 10⁵, 10⁶ and 10⁷ molecules HHV-8 target mRNA was included in each experiment. For real-time NASBA amplification, the time-to-positivity (TTP) principle is applicable, similar like for real-time PCR (17). The number of mRNA copies per sample input could be extrapolated from the standard curve.

RNA quantification:

For standardisation of the amount of RNA input the U1A assay was used, the primers and probe sequence are depicted in Table 1. This assay gives an idea of the input of RNA in the assay and was therefore included at each experiment. For each sample the U1A RNA amount was determined each time the other mRNA were measured and of all the different results the mean was taken as the input RNA amount. To normalise the input of all the samples the amount of RNA found of the different genes was divided by the mean amount of U1A RNA per sample found in that sample. The NASBA conditions are/were equal to those used for the HHV-8 assay with the exception of the primer concentration. With the UlA assay the primer concentration was 2 mM in the assay. To test the different assays in PBMCs we selected two patients from the Amsterdam Cohort. Both have been described elsewhere in detail (27). In short they were two HIV-1 infected men with Kaposi's sarcoma but with very different disease development. Patient 1 was diagnosed with KS in July of 1996 and died as a result of because of severe infiltration of KS in both lungs in January of 1997. Patient 2 had a completely different disease progression. He was diagnosed with KS in July of 1992 and over the course of two years complete remission was reached. One of the reasons for choosing these two patients is the diversity of the course of Kaposi's sarcoma. We tested three samples of patient 1 and seven samples of patient 2. All samples were taken after the KS diagnosis.

The frozen PBMC samples were thawed; the cells were collected and resuspended in Trizol buffer. For the isolation of both RNA and DNA in different fractions the Trizol™ method was used. The isolations were carried out according to the manufacturers' recommendations. Precipitated RNA was redissolved in 50 μl Baker H2O. For each time point about 10 million cells (7.6-11.1 * 10⁶ cells) were isolated. Because background RNA can disturb the amplification if present in large amounts it is necessary to dilute the samples. For the NASBA experiments the samples were diluted 10, 100 and 1000 times. Of these diluted samples 5 μl was used per reaction and 10 μl of reaction mix was added.

DNA quantification:

The DNA fractions of the PBMC samples were tested on the presence of HHV-8 DNA, using a PCR for ORF 73, described by Goudsmit et. al. (14). As a quantification of the amount of DNA input a limited dilution PCR for CCR5 was used. With limited dilution an estimation of copies of HHV-8 DNA was made in relation to the amount of cells. For both the ORF 73 and the CCR5 nested PCR the detection level was 5 molecules input per reaction. Results

Assay performance:

One assay was developed for ORF 73 and based on the amplification of a 192 bp region situated within the gene. ORF 73 is a gene that is unique in the viral genome and that is essential for maintenance of the virus in latently infected cells (3). It is only expressed in latent cells and thus gives a good indication of latent infected cells.

A second assay was developed for a lytic gene, vGCR, and amplifies a 168 bp region. vGCR is a receptor that binds several CXC and CC chemokines and that appears to be constitutively active (1) although some find that it is only expressed during lytic replication (20). It may contribute to pathogenesis by increasing the release of cellular growth factors such as VEGF (1). It has both angiogenic and transforming properties (2).

The final two assays were developed for the genes vBcl-2 and vIL-6. The assay for vBcl-2 amplifies a 216 bp region and for vIL-6 that region is 186 bp. vIL-6 and vBcl-2 are also two early lytic genes the expression increases within 10 hours after induction (18). vBcl-2 is a member of the Bcl-2 family and functional studies indicate that vBcl-2 prevents Bax-mediated toxicity or apoptosis and thus is an anti- apoptotic protein (11,30). vBcl-2 is primarily active during lytic replication and this expression pattern suggests that it may function to prolong the survival of lytic infected cells. vIL-6 is a secreted cytokine, which maintains proliferation of IL-6- dependent mouse and human myeloma cell lines (6,23,25). It prevents B9 cells apoptosis (23-25) and is involved in cell proliferation. Assay validation:

The newly developed assays could be used as a quantitative assay. Quantification of the assay was achieved by testing a standard curve of samples with a known amount of mRNA molecules within the same experiment as the unknown samples and extrapolation of the results to the standard curves depicted in figure 1. The isothermal (41 °C) amplification process resulted in the synthesis of large amounts of single stranded RNA (15) to which immediately upon synthesis the molecular beacon could hybridise. This resulted in relaxation of the molecular beacon secondary structure, whereby fluorophore and quencher were physically separated and emission of fluorescence was enabled. The read-out of the assay was in fluorescence units, resulting from the emission of photons from the fluorophore attached to the hybridised molecular beacon and detected in any thermostated fluorimeter. Typical amplification curves could be plotted in which an increase of fluorescence was observed, until most of the molecular beacon had hybridised with the synthesized amplicons and the fluorescence reached a maximum level (figure 1). The time-point at which the fluorescence signal became detectable over the background was linear over a range of at least six orders of magnitude of input RNA molecules, as shown by dilution series of in vitro synthesized RNA. Based on five serial dilutions, the linear quantification of the assay was determined to be between 10² to 10⁷ copies RNA per reaction for ORF 73 (R ² = 0.96,p < O.OOl.fig. la). For vGCR and vBcl-2 the linear quantification was also between 10² to 10⁷ copies RNA per reaction (R ² = 0.99 and R ² = 0.94 respectively, p < 0.001, fig. 1 b, c). For vIL-6 the linear quantification was between 10² to 10⁷ copies RNA per reaction (R ² = 0.95, p < 0.001, fig. Id). UlA has a linear quantification range of 10³ to 10⁸ molecules (R² = 0.99, p<0.001, fig. le)

In figure 1 the linear regression analysis is calculated from 10⁷ to 50 molecules input but for accurate quantification the lower quantification level (LQL) is 10² molecules. The analytical sensitivity of the assay (lower detection level, LDL) was 50 molecules for all four assays. In replicate independent experiments, the ttp value had a linear relationship with the logarithm of the amount of in vitro RNA added in the reaction. Subsequent experiments used serial 10-fold dilutions of invitro RNA (from 10⁷ to 10² and 50 copies per reaction) as a standard curve to determine the amount of HHV-8 RNA in samples.

Patient samples:

To evaluate the assay's ability to detect mRNA of HHV-8 in PBMC's samples from two KS patients were selected. Only PBMC samples after the KS diagnosis were available. In all the samples the HHV-8 DNA was detectable. We divided the ten samples in two groups: one with high HHV-8 DNA levels (greater or equal to 20,000 copies HHV-8 per 10^ cells) and one with low HHV-8 DNA levels (smaller than 20,000 copies HHV-8 per 10⁶ cells). All the four different mRNA were detectable in both groups. The results for the different assays are depicted in table 2. The amount of mRNA measured is spread over a wide range for both groups.

Discussion:

We have developed four real-time NASBA assays. For the detection of the synthesized amplicons, molecular beacon probes were added to the reaction, which enabled real-time detection and monitoring of the amplification reactions. The lower detection level of the assays was approximately 50 copies per reaction. Quantification was achieved within a linear range of at least six orders of magnitude (10 ² to 10⁷ molecules per reaction). In both the high and low HHV-8 DNA groups the mRNAs were measured and no clear trend was observed. This indicates that only a part of the viral load is active. The assays are a good tool to measure the activity of the virus in PBMC's, as DNA is only a marker for the presence of HHV-8.

The HHV-8 activity in the progression of KS and during recovery of disease can be studied with these NASBA assays. Our results show that the mRNA assays are more sensitive in detecting the HHV-8 activity than the HHV-8 DNA detection. Brief description of the drawings

Figure 1 a-d: Relationship of time-to-positivety (TTP) to HHV-8 mRNA copy number. The number of mRNA molecules present in the reaction in indicated on the x-axis and the ttp value in indicated on the y-axis. For the data obtained with 50, 10 to 10⁷ molecules, the values of ttp are the mean of five replicates of independent experiments. For the UlA (see figure le) the range of RNA input was 10³ to 10⁸. Error bars indicate the standard deviation for the values of ttp. The solid line was obtained by linear regression analysis of the data from 50 to 10⁷ molecules, and the dotted lines indicate the 95% confidence intervals for the regression. Insert: Amplification plot of a 10-fold dilution serial dilution of in vitro RNA for ORF 73, vGCR, vBcl-2 and vIL-6. The amount of input RNA 1*10⁷, 1*10⁶, 1*105, 1*10 , 1*103, 1*102, 5o and 0 (NT) molecules.

Figure le: Amplification plot of a 10-fold dilution serial dilution of UlA in vitro RNA, the amount of input RNA 1*10⁸, 1*10⁷, 1*10⁶, 1*10⁵, 1*10*, 1*10³ and 0 (NT) molecules.

References

1. Arvanitakis, L., E. Geras-Raaka, A. Varma, M. C. Gershengorn, and E. Cesarman. 1997. Human herpesvirus KSHV encodes a constitutively active G- protein- coupled receptor linked to cell proliferation. Nature 385:347-349.

2. Bais, C, B. Santomasso, 0. Coso, L. Arvanitakis, E. G. Raaka, J. S. Gutkind, A. S. Asch, E. Cesarman, M. C. Gerhengorn, and E. A. Mesri. 1998. G-protein-coupled receptor of Kaposi's sarcoma-associated herpesvirus is a viral oncogene and angiogenesis activator. Nature 391:86-89.

3. Ballestas, M. E., P. A. Chatis, and K. M. Kaye. 1999. Efficient persistence of extrachromosomal KSHV DNA mediated by latency- associated nuclear antigen. Science 284 :641-644.

4. Blasig, C, C. Zietz, B. Haar, F. Neipel, S. Esser, N. H. Brockmeyer, E. Tschachler, S. Colombini, B. Ensoli, and M. Sturzl. 1997. Monocytes in Kaposi's sarcoma lesions are productively infected by human herpesvirus 8. Journal of Virology 71:7963-7968.

5. Blok, M. J., V. J. Goossens, S. J. V. Vanherle, B. Top, N. Tacken, J. M. Middeldorp, M. H. L. Christiaans, J. P. Van Hooff, and C. A. Bruggeman. 1998. Diagnostic value of monitoring human cytomegalo virus late pp67 mRNA expression in renal-allograft recipients by nucleic acid sequence-based amplification. Journal of Clinical Microbiology 36:1341-1346.

6. Burger, R., F. Neipel, B. Fleckenstein, R. Savino, Ciliberto, G, J. R. Kalden, and M. Gramatzki. 1998. Human herpesvirus type 8 interleukin-6 homologue is functionally active on human myeloma cells. Blood 91:1858-1863.

7. Cesarman, E., Y. Chang, P. S. Moore, J. W. Said, and D. M. Knowles. 1995. Kaposi's sarcoma-associated herpesvirus-like DNA sequences in AIDS- related body-cavity-based lymphomas. New England Journal of Medicine 332:1186-1191. 8. Cesarman, E., P. S. Moore, P. H. Rao, G. Inghirami, D. M. Knowles, and Y. Chang. 1995. In vitro establishment and characterization of two acquired immunodeficiency syndrome-related lymphoma cell lines (BC-1 and BC-2) containing Kaposi's sarcoma-associated herpesvirus-like (KSHV) DNA sequences. Blood 86:2708-2714.

9. Chang, Y., E. Cesarman, M. S. Pessin, F. Lee, J. Culpepper, D. M. Knowles, and P. S. Moore. 1994. Identification of herpesvirus-like DNA sequences in AIDS- associated Kaposi's sarcoma. Science 266:1865-1869.

10. Cheng, E. H. Y., J. Nicholas, D. S. Bellows, G. S. Hayward, H.-G. Guo, M. S. Reitz, and J. M. Hardwick. 1997. A Bcl-2 homolog encoded by Kaposi sarcoma- associated virus, human herpesvirus 8, inhibits apoptosis but does not heterodimerize with Bax or Bak. Proceedings of the National Academy of Sciences of the United States of America 94:690-694.

11. Darke, B. M., S. K. Jackson, S. M. Hanna, and J. D. Fox. 1998. Detection of human TNF-alpha mRNA by NASBA(TM). Journal of Immunological Methods

212:19-28.

12. Decker, L. L., P. Shankar, G. Khan, R. B. Freeman, B. J. Dezube, J. Lieberman, and D. A. Thorley-Lawson. 1996. The Kaposi sarcoma-associated herpesvirus (KSHV) is present as an intact latent genome in KS tissue but replicates in the peripheral blood mononuclear cells of KS patients. Journal of Experimental Medicine 184:283-288.

13. Goudsmit, J., N. Renwick, N. H. T. M. Dukers, R. A. Coutinho, S. Heisterkamp, M. Bakker, T. F. Schulz, M. Cornelissen, and G. J. Weverling. 2000. Human herpesvirus 8 infections in the Amsterdam Cohort Studies (1984- 1997): Analysis seroconversions to ORF65 and ORF73. Proceedings of the National Academy of Sciences of the United States of America 97:4838-4843. 14. Guatelli, J. C, K. M. Whitfield, D. Y. Kwoh, K. J. Barringer, D. D. Richman, and T. R. Gingeras. 1990. Isothermal, in vitro amplification of nucleic acids by a multienzyme reaction modeled after retroviral replication. Proceedings of the National Academy of Sciences of the United States of America 87:1874-1878.

15. Heim, A., I. M. Grumbach, S. Zeuke, and B. Top. 1998. Highly sensitive detection of gene expression of an intronless gene: Amplification of mRNA, but not genomic DNA by nucleic acid sequence based amplification (NASBA). Nucleic Acids Research 26:2250-2251.

16. Higuchi, R., C. Fockler, G. Dollinger, and R. Watson. 1993. Kinetic PCR analysis: Real-time monitoring of DNA amplification reactions. Bio-Technology 11:1026-1030.

17. Jenner, R. G., M. M. Alba, C. Boshoff, and P. Kellam. 2001. Kaposi's sarcoma- associated herpesvirus latent and lytic gene expression as revealed by DNA arrays. Journal of Virology 75:891-902.

18. Kievits, T., B. Van Gemen, D. Van Strijp, R. Schukkink, M. Dircks, Adriaanse, H, L. Malek, R. Sooknanan, and P. Lens. 1991. NASBA(TM) isothermal enzymatic in vitro nucleic acid amplification optimized for the diagnosis of HIV-1 infection. Journal of Virological Methods 35:273-286.

19. Kirshner, J. R., K. Staskus, A. Haase, M. Lagunoff, and D. Ganem. 1999. Expression of the open reading frame 74 (G-protein-coupled receptor) gene of Kaposi's sarcoma (KS)-associated herpesvirus: Implications for KS pathogenesis. Journal of Virology 73:6006-6014.

20. Krigel, R. L., L. J. Laubenstein, and F. M. Muggia. 1983. Kaposi's sarcoma: a new staging classification. Cancer Treatment Reports 67:531-534.

21. Leone, G., H. Van Schijndel, B. Van Gemen, F. R. Kramer, and C. D. Schoen. 1998. Molecular beacon probes combined with amplification by NASBA enable homogeneous, real-time detection of RNA. Nucleic Acids Research 26:2150-2155. 22. Moore, P. S., C. Boshoff, R. A. Weiss, and Y. Chang. 1996. Molecular mimicry of human cytokine and cytokine response pathway genes by KSHV. Science 274:1739- 1744.

23. Neipel, F., J.-C. Albrecht, A: Ensser, Y.-Q. Huang, J. Jian, Li, A. E. Kien, and B. Fleckenstein. 1997. Human herpesvirus 8 encodes a homolog of interleukin-6.

Journal of Virology 71:839-842.

24. Nicholas, J., V. R. Ruvolo, W. H. Burns, G. Sandford, X. Wan, D. Ciufo, S. B. Hendrickson, H.-G. Guo, G. S. Hayward, and M. S. Reitz. 1997. Kaposi's sarcoma- associated human herpesvirus-8 encodes homologues of macrophage inflammatory protein-1 and interleukin-6. Nature Medicine 3:287-292.

25. Orenstein, J. M., S. Alkan, A. Blauvelt, K.-T. Jeang, M. D. Weinstein, D. Ganem, and B. Herndier. 1997. Visualization of human herpesvirus type 8 in Kaposi's sarcoma by light and transmission electron microscopy. AIDS 11:F35-F45.

26. Prins, J. M., C. J. A. Sol, N. Renwick, J. Goudsmit, J. Veenstra, and P. Reiss. 1999. Favourable effect of chemotherapy on clinical symptoms and human herpesvirus-8 DNA load in a patient with Kaposi's sarcoma presenting with fever and anemia. European Journal of Clinical Microbiology & Infectious Diseases 18:499-502.

27. Renwick, N, T. Halaby, G. J. Weverling, N. H. T. M. Dukers, Simpson, GR, R. A. Coutinho, L. M. A. Lange, T. F. Schulz, and J. Goudsmit. 1998. Seroconversion for human herpesvirus 8 during HIV infection is highly predictive of Kaposi's sarcoma. AIDS 12:2481-2488.

28. Rettig, M. B., H. J. Ma, R. A. Vescio, M. Pold, G. Schiller, Belson, D, A. Savage, C. Nishikubo, C. Wu, J. Fraser, J. W. Said, and J. R. Berenson. 1997. Kaposi's sarcoma-associated herpesvirus infection of bone marrow dendritic cells from multiple myeloma patients. Science 276:1851-1854. 29. Sarid, R., T. Sato, R. A. Bohenzky, J. J. Russo, and Y. Chang. 1997. Kaposi's sarcoma-associated herpesvirus encodes a functional Bcl-2 homologue. Nature Medicine 3 :293-298.

30. Soulier, J., L. Grollet, E. Oksenhendler, P. Cacoub, D. Cazals-Hatem, P. Babinet, M.-F. D'Agay, J.-P. Clauvel, M. Raphael, L. Degos, and F. Sigaux. 1995. Kaposi's sarcoma-associated herpesvirus-like DNA sequences in multicentric Castle an's disease. Blood 86:1276-1280.

31. Staskus, K. A., W. Zhong, K. Gebhard, B. Herndier, H. Wang, R. Renne, J. Beneke, J. Pudney, D. J. Anderson, D. Ganem, and A. T. Haase. 1997. Kaposi's sarcoma-associated herpesvirus gene expression in endothelial (spindle) tumor cells. Journal of Virology 71:715-719.

32. Tyagi, S. and F. R. Kramer. 1996. Molecular beacons: Probes that fluoresce . upon hybridization. Nature Biotechnology 14:303-308.

33. Van Gemen, B., V. P. Wiel, R. Van Beuningen, P. Sillekens, S. Jurriaans, Dries, C, R. Schoones, and T. Kievits . 1995. The one-tube quantitative HIV-1 RNA NASBA: Precision, accuracy, and application. PCR Methods & Applications 4:S177-S184.

Tabel 1. Sepuences of the primers and beacons for each of the assays

Primer Pl Primer P2 Beacon (cone, in assay) Anti sense primer Sense primer Stem-loop in lowercase italics

ORF7 AGAGACAATACACATATACACAATAAG GAA AGG ATG GAA GAC GAG ATC CA gcα cgc AGG AGT AAA GGC AGG CCC CGT GTC gcg tgc

3 vBcl-2 AAGCGAAACCACTGGGGTCCGATTG GTG AGA TTT CAC AGC ACC ACC GGT A gcα cgc TGA CCT TTG GCA GTT TTG TGG CC gcg tgc vIL-6 AGAACATAAAACGAAGCAAAGTGTCTCA GGA AAA TCA GTG ATA AAC GTG GA gcα cgc GGA AGA GCTCAATAAGCT GAC TA gcg tgc vGCR AACGAGGTTACTGCCAGACCCACGT CAG GCG GAA GGT AAG GGG GGT GA gcα cgc TGA TTG TTG CTG TGG TGC TGC T gcg tgc

UlA AG AGG CCC GGC ATG TGG TGC ATA A CAG TAT GCC AAG ACC GAC TCA GA cgt αcg AGA AGA GGA AGC CCA AGA GCC A cgt αcg

LTR AG AGG GGC GCC ACT GCT AGA GA CTC AAT AAA GCT TGC CTT GA cgα cgt AGT AGT GTG TGC CCG TCT GT αcg teg

The 3' antisense primer is elongated with T7-promotor recognition sequence: AAT TCT AATACG ACT CAC TAT AGG G

Table 2: Ratio log mRNA of HHV-8 vs UlA * 10e7 (below detection level is

depicted by ~). Samples from patient 1 are numbered 1.1 —1.3; samples

from patient 2: 2.1-2.7.

ORF 73 vGCR vBcl-2 vIL-6

High HHV-8 DNA

1.1 5.80 0.49 0.49 1.80

1.2 1.96 1.85 1.85 ~

1.3 2.35 0.96 3.52 2.26

2.1 2.47 ~ 4.59 ~

Low HHV-8 DNA

2.2 2.43 ~ 2.43 2.35

2.3 2.70 5.41 3.50 1.40

2.4 2.48 3.93 5.75 3.48

2.5 2.42 ~ 2.60 ~

2.6 1.61 ~ 3.61 4.41

2.7 ~ ~ ~ ~

Claims

1. A method for determining whether an animal comprises an active herpes virus, comprising determining in a sample from said animal, whether a peripheral blood mononuclear cell in said sample comprises mRNA of said herpes virus.

2. A method according to claim 1, wherein said sample is a blood sample.

3. A method according to claim 1 or 2, comprising an amplification reaction.

4. A method according to claim 3, wherein said amplification reaction comprises NASBA.

5. A method according to any one of claim 1-4, wherein said mRNA is quantified.

6. A method according to anyone of claims 1-5, wherein said herpes virus comprises HHV-8 or a functional part, derivative and/or analogue thereof.

7. A method according to claim 6, comprising determining the presence of an ORF 73 mRNA, an vGCR mRNA, an vBcl-2 mRNA, and/or an vIL-6 mRNA.

8. A diagnostic kit comprising a means for the detection of herpes virus by a method according to anyone of claims 1-7.

9. A diagnostic kit according to claim 8, wherein said means comprises a means for the detection of active herpes virus.

10.A diagnostic kit according to claim 8 or claim 9, further comprising a means for obtaining a peripheral blood mononuclear cell. ll.Use of a means for the detection of a herpes virus for detecting active herpes virus in peripheral blood mononuclear cells. 12.Use of mRNA of a peripheral blood mononuclear cell for determining whether an animal comprises a herpes virus. 13.Use according to claim 12, wherein said mRNA is in solution.