WO2003018802A1

WO2003018802A1 - Lipophorins

Info

Publication number: WO2003018802A1
Application number: PCT/AU2002/001126
Authority: WO
Inventors: Stephen Charles Trowell; Amir Masoumi
Original assignee: Commonwealth Scientific And Industrial Research Organisation
Priority date: 2001-08-21
Filing date: 2002-08-21
Publication date: 2003-03-06
Also published as: AUPR716101A0

Abstract

The present invention relates to the identification of lipophorin proteins and polynucleotides from Lucilia cuprina (greenbottle fly or blowfly). These lipophorins can be used in screening techniques for identifying arthropod control agents which disrupt the biological function of the lipophorin in a pest arthropod. Furthermore, the disclosed sequence information can be used in the design of arthropod control agents such as antisense oligonucleotides, including catalytic nucleic acids, and dsRNA to control arthropod pests.

Description

LIPOPHORINS

Field of the Invention

The present invention relates to the identification of lipophorin proteins and polynucleotides. More particularly, the present invention relates to the use of these proteins and polynucleotides in screening techniques for the identification of arthropod control agents. Such arthropod control agents can be used in the development of strategies for controlling arthropod populations.

Background of the Invention

Lipophorins have been detected in the haemolymph of every insect species where a systematic study has been undertaken, suggesting that the binding proteins are essential for proper JH signalling. Transport of lipids in the haemolymph of insects is carried out by a lipoprotein known as lipophorin. Unlike vertebrate plasma lipoproteins, lipophorin has additional roles in several physiological processes such as hydrocarbon transport, haemolymph clotting, immune responses, oogenesis, vision and juvenile hormone (JH) transport (Kanost et al, 1990, Coodin and Caveney, 1992, Trowell et al., 1994, Mandato et a , 1996, Kutty et al, 1996 and Daffre and Faye, 1997). Typically, lipophorin is a heterodimer of apoLpn-l (~230-280 kDa) and apoLpn-ll (~70-85 kDa) (also referred to as high-density lipophorin or HDLp). ApoLpn-l and -II are derived from a single precursor, known as pre- apolipophorin, in the fat body (Weers et al., 1993).

In addition to their involvement in a variety of homeostatic functions, insect lipophorins show another distinct difference to their vertebrate counterparts. Lipid association with lipophorin is reversible allowing the molecule to perform as a re-useable "shuttle" (Van der Horst et al, 1993). In contrast, vertebrate plasma lipoproteins are taken up into the target cells where their lipid load is subsequently stripped off and the protein is degraded (Goldstein et al, 1985). These observations suggest that lipophorins comprise a distinct group of lipoproteins which, while potentially derived from the same common ancestor protein as vertebrate counterparts, have evolved to function in a manner highly adapted to the insect internal environment.

Insect juvenile hormones (JHs) are sesquiterpenoid molecules related to methyl farnesoate which partly control metamorphosis and help regulate several aspects of the reproductive physiology of most, perhaps all, insects (Koeppe et al, 1985). Among other things they are involved in important physiological processes such as caste determination (Hardie and Lees, 1985) and regulation of diapause (Denlinger, 1985) although the details vary amongst species. JHs are synthesized by the corpora allata, endocrine organs attached to the insect brain. They must reach their targets, which include reproductive and epidermal tissues, via the haemolymph. Lipophorin(s) are known to function as JH binding proteins in the haemolymph of at least species from the Blattodea, Diptera, Coleoptera, Hymenoptera and Isoptera Orders. It is believed that binding proteins prevent non-specific absorption of lipophilic JHs to tissues, thereby ensuring effective distribution of the hormone to target cells throughout the insect. This proposal (Trowell, 1992) is based on the known function of mammalian carrier proteins for lipophilic hormones. Other functions of haemolymph JH binding proteins include protecting JH from degradation (Ferkovich et al, 1977; Peter et al, 1979; de Kort ef al, 1983; Engelmann et al, 1988; Szolajska, 1991 ; King and Tobe, 1993) and they may also be involved in regulating hormone titre (Goodman, 1990; King and Tobe 1993).

There is a need for the further arthropod control agents which can be used to control arthropod populations. In particular, there is a need for methods of identifying such arthropod population control agents. Knowledge of arthropod lipophorins as provided herein can be used for designing strategies for uncoupling arthropod development and/or arthropod reproduction and/or the rate of arthropod feeding, and hence provide effective means for controlling arthropod populations.

Summary of the Invention

The present inventors have characterized lipophorins, and the polynucleotides encoding these lipophorins, from a major insect pest species, namely Lucilia cuprina. Knowledge of these lipophorins can be used for designing strategies for uncoupling arthropod development and/or arthropod reproduction and/or the rate of arthropod feeding, and hence provide means for controlling arthropod populations.

In a first aspect, the present invention provides an isolated polynucleotide, the polynucleotide comprising a sequence selected from: i) a sequence of nucleotides shown in SEQ ID NO:4; ii) a sequence encoding a polypeptide as shown in SEQ ID NO:1 ; iii) a sequence capable of selectively hybridizing to i) or ii) under high stringency; and iv) a sequence of nucleotides which is greater than 60% identical to i) or ii). In a second aspect, the present invention provides an isolated polynucleotide, the polynucleotide comprising a sequence selected from: i) a sequence of nucleotides shown in SEQ ID NO:5; ii) a sequence encoding a polypeptide as shown in SEQ ID NO:2; iii) a sequence capable of selectively hybridizing to i) or ii) under high stringency; and iv) a sequence of nucleotides which is greater than 60% identical to i) or ii).

In a third aspect, the present invention provides an isolated polynucleotide, the polynucleotide comprising a sequence selected from: i) a sequence of nucleotides shown in SEQ ID NO:6; ii) a sequence encoding a polypeptide as shown in SEQ ID NO:3; iii) a sequence capable of selectively hybridizing to i) or ii) under high stringency; and iv) a sequence of nucleotides which is greater than 65% identical to i) or ii).

In a preferred embodiment, the polynucleotide of the first aspect encodes a polypeptide precursor, wherein the precursor can be proteolytically cleaved to produce a polypeptide encoded by the polynucleotide of the second aspect and a polypeptide encoded by the polynucleotide of the third aspect. In a further preferred embodiment, the polypeptide encoded by the polynucleotide is capable of binding at least one hydrophobic molecule. In one embodiment, the hydrophobic molecule is a lipid. Preferably, the lipid is a free fatty acid. Preferably, the free fatty acid is either di-acyl or tri-acyl glycerol. In another embodiment, the hydrophobic molecule is a juvenile hormone. The juvenile hormone can be any such known molecule, examples include, but are not limited to, JH III, JH II, JH I and JHB₃. As used herein the term juvenile hormone extends to JH intermediates, such as JH acid and JH diol, which bind the polypeptides encoded by the polynucleotides of the invention.

In another preferred embodiment, the polynucleotide encodes a polypeptide which has a biological activity which plays a role in a physiological process selected from the group consisting of: hydrophobic molecule binding, haemolymph clotting, an immune response, oogenesis, vision and juvenile hormone transport.

The polynucleotides of the present invention can be isolated from any arthropod species. In a preferred embodiment, the polynucleotide can be isolated from a Dipteran. Preferably, the Dipteran is a Lucilia sp. More preferably, the Lucilia sp is Lucilia cuprina.

Preferably, the polynucleotide is at least 70% identical, more preferably at least 80% identical, more preferably at least 85% identical, more preferably at least 90% identical, more preferably at least 95% identical, and even more preferably at least 99% identical to any one of SEQ ID NO's 4, 5 or 6.

In a fourth aspect, the present invention provides a process for producing a polypeptide, the process comprising cultivating a host cell expressing a polynucleotide of the invention under conditions providing for production of a polypeptide encoded by the polynucleotide, and recovering the expressed polypeptide.

In a fifth aspect, the present invention provides a polypeptide produced by a process according to the invention.

In a sixth aspect, the present invention provides a crystal of a polypeptide encoded by a polynucleotide according to the second or third aspects.

In a seventh aspect, the present invention provides a crystal of a polypeptide according to the fifth aspect.

In an eighth aspect, the present invention provides a substantially purified heterodimer formed between a polypeptide encoded by a polynucleotide of the second aspect and a polypeptide encoded by a polynucleotide of the third aspect.

In one embodiment, the heterodimer is produced by a method comprising i) expressing a polynucleotide according to the first aspect in a host cell comprising the polynucleotide to produce a precursor polypeptide, ii) cleaving the precursor polypeptide to produce a polypeptide that is at least 80% identical to SEQ ID NO:2 and a polypeptide that is at least 80% identical to SEQ ID NO:3 which associate to form the heterodimer. in another embodiment, the heterodimer is produced by a method comprising i) expressing a polynucleotide according to the second aspect and a polynucleotide according to the third aspect in a host cell comprising the polynucleotides to produce two polypeptide subunits, ii) allowing the two subunits to associate to form the heterodimer. In another embodiment, heterodimer is purified from a cell-free haemolymph preparation obtained from an arthropod.

In a ninth aspect, the present invention provides a crystal of a heterodimer according to the invention.

In a tenth aspect, the present invention provides a method of identifying an arthropod control agent, the method comprising i) exposing a heterodimer of the invention to a binding partner which binds the heterodimer, and a candidate agent, and ii) assessing the ability of the candidate agent to compete with the binding partner for binding to the heterodimer. In one example of the tenth aspect, the heterodimer can be incubated with radiolabeled JH and a candidate arthropod control agent under conditions generally outlined by Trowell et al. (1994). Agents which are potentially useful for controlling arthropod populations would be identified by the agents ability to block JH binding to the heterodimer. A similar assay could readily be developed for measuring the binding of the heterodimers of the present invention to other hydrophobic molecules.

Many reactions screening many potential arthropod control agents can be performed automatically in microtitre trays using robots to transfer the various solutions and measure the, for example, radioactivity in each well. Preferably, the binding partner is detectably labelled. The label can be any such molecule known in the art. Examples include, but are not limited to, radionuclides, enzymes, fluorescent, and chemiluminescent labels. Preferably, the detectable label is a radiolabel.

Preferably, the binding partner is juvenile hormone. In an eleventh aspect, the present invention provides a method of identifying an arthropod control agent, the method comprising i) exposing a heterodimer according to the invention to a candidate agent, and ii) assessing the ability of the candidate agent to modulate at least one biological activity of the heterodimer. In a twelfth aspect, the present invention provides a method of identifying an arthropod control agent, the method comprising i) determining the atomic coordinates defining the three-dimensional structure of a heterodimer according to the invention; ii) selecting a candidate agent by performing rational drug design with the atomic coordinates obtained in step (a), wherein said selecting is performed in conjunction with computer modelling; and iii) determining the ability of the candidate agent to modulate at least one biological activity of the heterodimer. In a thirteenth aspect, the present invention provides a method of selecting or designing an arthropod control agent comprising using the structural coordinates of a crystal of the ninth aspect to computationally evaluate a compound for its ability to modulate at least one biological activity of the heterodimer. Preferably, the at least one biological activity plays a role in a physiological process selected from the group consisting of: hydrophobic molecule binding, haemolymph clotting, an immune response, oogenesis, vision and juvenile hormone binding.

Preferably, the hydrophobic molecule is a free fatty acid. Preferably, the at least one biological activity is juvenile hormone binding.

In a fourteenth aspect, the present invention provides a method of identifying an arthropod control agent, the method comprising i) exposing a polypeptide encoded by a polynucleotide of the second aspect and/or a polypeptide encoded by a polynucleotide of the third aspect to a candidate agent, and ii) assessing the ability of the candidate agent to disrupt, and/or inhibit the formation of, a heterodimer of the polypeptide encoded by a polynucleotide of the second aspect and the polypeptide encoded by a polynucleotide of the third aspect.

In a fifteenth aspect, the present invention provides a method of identifying an arthropod control agent, the method comprising i) determining the atomic coordinates defining the three-dimensional structure of a polypeptide encoded by a polynucleotide according to the second or third aspects; ii) selecting a candidate agent by performing rational drug design with the atomic coordinates obtained in step (a), wherein said selecting is performed in conjunction with computer modelling; and iii) assessing the ability of the candidate agent to disrupt, and/or inhibit the formation of, a heterodimer of the polypeptide encoded by a polynucleotide of the second aspect and the polypeptide encoded by a polynucleotide of the third aspect.

Preferably, the method further comprises expressing a polynucleotide according to the second aspect and a polynucleotide according to the third aspect in a host cell comprising the polynucleotides.

In a sixteenth aspect, the present invention provides a method of selecting or designing an arthropod control agent comprising using the structural coordinates of a crystal of the sixth or seventh aspects to computationally evaluate a compound for its ability to disrupt, and/or inhibit the formation of, a heterodimer of a polypeptide encoded by a polynucleotide of the second aspect and a polypeptide encoded by a polynucleotide of the third aspect.

Preferably, the heterodimer is associated with at least one lipid. More preferably, the lipid is a free fatty acid. Even more preferably, the free fatty acid is either di-acyl or tri-acyl glycerol.

In a seventeenth aspect, the present invention provides a method of identifying an arthropod control agent, the method comprising i) exposing a polynucleotide of the invention to a candidate agent under conditions which allows expression of the polynucleotide, and ii) assessing the ability of the candidate agent to modulate levels of polypeptide produced by the polynucleotide.

Preferably, the agent inhibits production of the polypeptide.

Preferably, the agent is a dsRNA.

In an eighteenth aspect, the present invention provides a method of identifying an arthropod control agent, the method comprising i) exposing a polynucleotide of the invention to a candidate agent, and ii) assessing the ability of the candidate agent to hybridize and/or cleave the polynucleotide.

Upon the identification of a potential arthropod control agent using the methods of present invention, the agent can be considered as "a lead compound" which is tested by various means to determine if it is useful for controlling arthropod populations. Depending on the nature of the identified agent the testing means will vary significantly but will be well within the skill of those in the art. For example, dsRNA will generally be produced in an expression vector which is exposed to a target arthropod whilst non-nucleic acid agents may be incorporated into a suitable formulation and applied to a target arthropod.

In a nineteenth aspect, the present invention provides an arthropod control agent identified by a method of the invention.

In a twentieth aspect, the present invention provides a substantially purified polypeptide, the polypeptide being selected from: i) a polypeptide comprising a sequence provided in SEQ ID NO:1 ; or ii) a polypeptide comprising a sequence which is greater than 55% identical to (i).

In a twenty-first aspect, the present invention provides a substantially purified polypeptide, the polypeptide being selected from: i) a polypeptide comprising a sequence provided in SEQ ID NO:2; or ii) a polypeptide comprising a sequence which is greater than 55% identical to (i).

In a twenty-second aspect, the present invention provides a substantially purified polypeptide, the polypeptide being selected from: i) a polypeptide comprising a sequence provided in SEQ ID NO:3; or ii) a polypeptide comprising a sequence which is greater than 65% identical to (i).

Preferably, the polypeptide of the twentieth aspect is a polypeptide precursor, wherein the precursor can be proteolytically cleaved to produce the polypeptide of the twenty-first aspect and the polypeptide of the second-second aspect.

In a further preferred embodiment, the polypeptide is capable of binding at least one hydrophobic molecule. In one embodiment, the hydrophobic molecule is a lipid. Preferably, the lipid is a free fatty acid. Preferably, the free fatty acid is either di-acyl or tri-acyl glycerol. In another embodiment, the hydrophobic molecule is a juvenile hormone.

In another preferred embodiment, the polypeptide has a biological activity which plays a role in a physiological process selected from the group consisting of: hydrophobic molecule binding, haemolymph clotting, an immune response, oogenesis, vision and juvenile hormone transport. The polypeptides of the present invention can be substantially purified from any arthropod species. In a preferred embodiment, the polypeptide can be purified from a Dipteran. Preferably, the Dipteran is a Lucilia sp. More preferably, the Lucilia sp is Lucilia cuprina. Preferably, the polypeptide is at least 70% identical, more preferably at least 80% identical, more preferably at least 85% identical, more preferably at least 90% identical, more preferably at least 95% identical, and even more preferably at least 99% identical to any one of SEQ ID NO's 1 , 2 or 3.

In another aspect, the present invention provides an oligonucleotide, the oligonucleotide having a sequence that hybridizes selectively to a polynucleotide of the present invention.

In a preferred embodiment the oligonucleotide includes at least 8 nucleotides, more preferably at least 18 nucleotides and more preferably at least 25 nucleotides. In a further preferred embodiment the oligonucleotide is used as a primer, or probe where the oligonucleotide is conjugated with a label such as a radioisotope, an enzyme, biotin, a fluorescent molecule or a chemiluminescent molecule.

In a further aspect, the present invention provides an antisense polynucleotide which hybridizes under high stringency conditions to a polynucleotide of the invention.

Preferably, the antisense polynucleotide comprises a catalytic domain.

These are also know as catalytic nucleic acids, preferred examples include ribozymes and deoxyribozymes. In another aspect, the present invention provides a double stranded RNA

(dsRNA) molecule comprising a polynucleotide of the invention.

Preferably, the dsRNA is encoded by a single open reading frame and the resulting dsRNA molecule has a stem loop structure at one end of the molecule. In yet another aspect, the present invention provides a fusion protein comprising a polypeptide encoded by a polynucleotide of the invention fused to at least one other polypeptide sequence.

In a preferred embodiment, the at least one other polypeptide is selected from the group consisting of: a polypeptide that enhances the stability of the polypeptide of the invention, a polypeptide that act as an immunopotentiator to enhance an immune response to a polypeptide of the invention, and a polypeptide that assists in the purification of the fusion protein.

Another aspect of the invention provides an isolated polynucleotide that encodes a fusion protein of invention. In a further aspect of the invention, the present invention provides a vector comprising a polynucleotide of the invention, an antisense polynucleotide of the invention, or a polynucleotide(s) which upon expression forms a dsRNA molecule of the invention.

The vector may be a, for example, plasmid, virus or phage vector provided with an origin of replication, and preferably a promotor for the expression of the polynucleotide and optionally a regulator of the promotor. The vector may contain one or more selectable markers, for example an ampicillin resistance gene in the case of a bacterial plasmid or a neomycin resistance gene for a mammalian expression vector. The vector may be used in vitro, for example for the production of RNA or used to transfect or transform a host cell.

In one embodiment, the vector is a plasmid or a virus. Preferably, the viral vector is a baculovirus. In another embodiment, the vector is a capsoid vector. In another aspect, the present invention provides a host cell comprising a vector of the invention.

The host cell can may be any cell which is capable of being transformed, transfected etc with a recombinant polynucleotide and/or vector of the present invention. Preferred host cells include, but are not limited to, bacterial and arthropod cells. Preferably, the arthropod cell is an insect cell.

In the instance where a target arthropod feeds off plants, the present invention provides a transgenic plant comprising a polynucleotide, antisense polynucleotide or a polynucleotide encoding a dsRNA molecule according to the present invention, such that said polynucleotide, antisense polynucleotide or dsRNA molecule is capable of being expressed in said plant.

Furthermore, since there are many arthropods which feed off live animals, for instance mosquitoes and the larvae of Lucilia cuprina, the present invention provides a transgenic non-human animal comprising a polynucleotide, antisense polynucleotide or a polynucleotide encoding a dsRNA molecule according to the present invention, such that said polynucleotide, antisense polynucleotide or dsRNA molecule is capable of being expressed in said animal.

In yet a further aspect, the present invention provides an arthropod control composition, the composition comprising an arthropod control agent identified by a method of the invention, a polypeptide of the invention and/or a vector of the invention, and an agriculturally acceptable carrier.

In another aspect, the present invention provides a method of controlling an arthropod population, the method comprising exposing members of the arthropod population to an arthropod control composition according to the invention.

Preferably, the arthropod is an insect.

The present invention also provides kits for identifying an arthropod control agent. In one embodiment, the kit comprises at least one polynucleotide of the invention. In another embodiment, the kit comprises polypeptides according to the twenty-first and twenty-second aspects (or precursors therefor).

The kits of the invention will typically also comprises further reagents etc for identifying arthropod control agents. Further regents include means for determining the extent which a candidate agent modulates at least one biological activity of a heterodimer formed between the polypeptide of twenty- first aspect and the polypeptide of the twenty-second aspect, or means for determining the extent which a candidate agent disrupts, and/or inhibits the formation of, a heterodimer between the polypeptide of the twenty-first aspect and the polypeptide of the twenty-second aspect. Preferably, the kit further comprises detectably labelled juvenile hormone.

In numerous other aspects of the present invention, the polypeptides, polynucleotides, oligonucleotides, dsRNA molecules, vectors, host cells and arthropod control agents can be used in a multitude of ways to control arthropod populations. In each instance, the aim is to expose the arthropod to an agent which uncouples at least one biological activity of the polypeptides of the present invention resulting in the death of the arthropod or at least reduces its rate of reproduction or feeding.

As will be apparent, preferred features and characteristics of one aspect of the invention are applicable to many other aspects of the invention. The terms "comprise", "comprises" and "comprising" as used throughout the specification are intended to refer to the inclusion of a stated component or feature or group of components or features with or without the inclusion of a further component or feature or group of components or features. The invention is hereinafter described by way of the following non- limiting examples.

Key to Sequence Listing

SEQ ID NO 1 : Lucilia cuprina preapo-lipophorin. SEQ ID NO 2: Lucilia ci/prina apo-lipophorin-l.

SEQ ID NO 3: Lucilia cuprina apo-lipophorin-ll.

SEQ ID NO 4: Coding sequence for Lucilia cuprina preapo-lipophorin.

SEQ ID NO 5: Coding sequence for Lucilia cuprina apo-lipophorin-l.

SEQ ID NO 6: Coding sequence for Lucilia cuprina apo-lipophorin-ll. SEQ ID NO's 7-9: Oligonucleotide probe and PCR primers utilized in the isolation of the cDNA encoding Lucilia cuprina preapo-lipophorin.

SEQ ID NO 10: PCR fragment of Lucilia cuprina preapo-lipophorin.

SEQ ID NO 11 : Full length cDNA for Lucilia cuprina preapo-lipophorin.

Detailed Description of the Invention

General Techniques

Unless otherwise indicated, the recombinant DNA techniques utilized in the present invention are standard procedures, well known to those skilled in the art. Such techniques are described and explained throughout the literature in sources such as, J. Perbal, A Practical Guide to Molecular Cloning, John Wiley and Sons (1984), J. Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbour Laboratory Press (1989), T.A. Brown (editor), Essential Molecular Biology: A Practical Approach, Volumes 1 and 2, IRL Press (1991), D.M. Glover and B.D. Hames (editors), DNA Cloning: A Practical Approach, Volumes 1-4, IRL Press (1995 and 1996), and F.M. Ausubel et al. (Editors), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-lnterscience (1988, including all updates until present) and are incorporated herein by reference. Polynucleotides

By "isolated polynucleotide", we mean a polynucleotide separated from the polynucleotide sequences with which it is associated or linked in its native state. Preferably, the isolated polynucleotide is at least 60% free, preferably at least 75% free, and most preferably at least 90% free from other components with which they are naturally associated. Furthermore, the term "polynucleotide" is used interchangeably herein with the term "nucleic acid molecule".

The % identity of a polynucleotide is determined by GAP (Needleman and Wunsch, 1970) analysis (GCG program) with a gap creation penalty=5, and a gap extension penalty=0.3. The query sequence is at least 45 nucleotides in length, and the GAP analysis aligns the two sequences over a region of at least 45 nucleotides. Preferably, the query sequence is at least 150 nucleotides in length, and the GAP analysis aligns the two sequences over a region of at least 150 nucleotides. More preferably, the query sequence is at least 300 nucleotides in length and the GAP analysis aligns the two sequences over a region of at least 300 nucleotides.

The polynucleotide of the present invention may selectively hybridise to a polynucleotide that encodes a polypeptide of the present invention, or a sequence set out in SEQ ID NO:4, SEQ ID NO:5 or SEQ ID NO: 6, under high stringency. Furthermore, oligonucleotides of the present invention have a sequence that hybridizes selectively to a polynucleotide of the present invention. As used herein, high stringency conditions are those that (1) employ low ionic strength and high temperature for washing, for example, 0.015 M NaCI/0.0015 M sodium citrate/0.1% NaDodS0₄ at 50°C; (2) employ during hybridisation a denaturing agent such as formamide, for example, 50% (vol/vol) formamide with 0.1% bovine serum albumin, 0.1% Ficoll, 0.1% polyvinylpyrrolidone, 50 mM sodium phosphate buffer at pH 6.5 with 750 mM NaCI, 75 mM sodium citrate at 42°C; or (3) employ 50% formamide, 5 x SSC (0.75 M NaCI, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1%) sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm DNA (50 g/ml), 0.1% SDS and 10% dextran sulfate at 42°C in 0.2 x SSC and 0.1% SDS.

Polynucleotides of the present invention may possess, when compared to naturally occurring molecules, one or more mutations which are deletions, insertions, or substitutions of nucleotide residues. Mutants can be either naturally occurring (that is to say, isolated from a natural source) or synthetic (for example, by performing site-directed mutagenesis on the nucleic acid). It is thus apparent that polynucleotides of the invention can be either naturally occurring or recombinant. Preferably, the mutant encodes a polypeptide that maintains at least one biological activity of the naturally occurring lipophorin.

Oligonucleotides of the present invention can be RNA, DNA, or derivatives of either. The minimum size of such oligonucleotides is the size required for the formation of a stable hybrid between an oligonucleotide and a complementary sequence on a nucleic acid molecule of the present invention. The present invention includes oligonucleotides that can be used as, for example, probes to identify nucleic acid molecules, primers to produce nucleic acid molecules or arthropod control agents to inhibit lipophorin production or activity (e.g., as antisense-, triplex formation-, ribozyme- and/or RNA drug- based reagents). Oligonucleotide of the present invention used as a probe are typically conjugated with a label such as a radioisotope, an enzyme, biotin, a fluorescent molecule or a chemiluminescent molecule.

Polynucleotides of the invention include those which can readily be isolated from other arthropod species using the sequence information provided as SEQ ID NO's 4 to 6. Useful isolation procedures are well known in the art and described in detail in the references provided in the "General Techniques" section. Two examples briefly described below include using of library screening and methods that rely upon the polymerase chain reaction.

With regard to library screening, cDNA or genomic libraries are produced and used to infect Escherichia coli cells of a line supporting lytic infection (e.g. in the case of lambda strain lambda gt10 the strain used would be CβOOhfl Promega, Corporation, Madison, Wisconsin) which are plated out on a suitable agar (Sambrook, J. et al. 1989). Plaque lifts may be taken onto nitrocellulose or nylon (e.g. Hybond N+, Amersham Pharmacia Biotech Inc., Piscataway, N.J.) or other suitable filters. Assemblages of the order of 50,000-100,000 or more independent phage may be readily screened at a single time. To do this, the filters are probed with the labelled probes which comprises at least a portion of the polynucleotide sequence provided as SEQ ID NO's 4 to 6. Then to recover polynucleotide sequences encoding lipophorins it is necessary to perform the probing and washing procedures at range of stringencies including low stringency. Therefore, probing and washing is conducted in the range of 0.1-5 times SSC (Sambrook, J. et al. 1989) and in the temperature range 65- 45°C. Isolated clones can be sequenced using techniques known in the art.

An alternative approach for isolating further polynucleotide sequences encoding homologous lipophorins is to use the polymerase chain reaction (PCR) to amplify homologous probes from the target arthropod and then to label and use these probes to isolate clones from the appropriate cDNA library or genomic library, as described above. In such a process, degenerate PCR primers can be designed to include all possible nucleotide combinations encoding the known amino acids at putative highly or moderately well- conserved positions within the sequence.

Polypeptides

By "substantially purified" we mean a polypeptide that has been separated from the nucleic acids, other polypeptides, and other contaminating molecules with which it is associated in its native state. Notably, lipophorins typically associate with lipids, and evidence suggests such lipids may be required for correct protein folding. Accordingly, "substantially purified" polypeptides of the present invention may also be associated with a lipid(s), for example, diacyl and/or triacyl glycerol. The % identity of a polypeptide is determined by GAP (Needleman and

Wunsch, 1970) analysis (GCG program) with a gap creation penalty=5, and a gap extension penalty=0.3. The query sequence is at least 15 amino acids in length, and the GAP analysis aligns the two sequences over a region of at least 15 amino acids. More preferably, the query sequence is at least 50 amino acids in length, and the GAP analysis aligns the two sequences over a region of at least 50 amino acids. Even more preferably, the query sequence is at least 100 amino acids in length and the GAP analysis aligns the two sequences over a region of at least 100 amino acids. More preferably, the query sequence is at least 250 amino acids in length and the GAP analysis aligns the two sequences over a region of at least 250 amino acids. Even more preferably, the query sequence is at least 500 amino acids in length and the GAP analysis aligns the two sequences over a region of at least 500 amino acids.

As used herein a "biologically active fragment" of a polypeptide of the present invention is a portion of the polypeptide which has lipophorin activity. As used herein a "lipophorin" can be a heterodimer as disclosed herein or a subunit thereof. The lipophorin may or may not be associated with hydrophobic molecules such as lipids. In a preferred embodiment, the lipophorin is a heterodimer according to the eighth aspect and is associated with at least one lipid.

Polypeptides of the present invention can either be naturally occurring (e.g. SEQ ID NO's:1 , 2 or 3) or mutants and/or fragments (especially biologically active fragments) thereof.

Amino acid sequence mutants can be prepared by introducing appropriate nucleotide changes into DNA, or by in vitro synthesis of the desired polypeptide. Such mutants include, for example, deletions, insertions or substitutions of residues within the amino acid sequence. A combination of deletion, insertion and substitution can be made to arrive at the final construct, provided that the final protein product possesses the desired characteristics.

In designing amino acid sequence mutants, the location of the mutation site and the nature of the mutation will depend on characteristic(s) to be modified. The sites for mutation can be modified individually or in series, e.g., by (1) substituting first with conservative amino acid choices and then with more radical selections depending upon the results achieved, (2) deleting the target residue, or (3) inserting other residues adjacent to the located site.

Amino acid sequence deletions generally range from about 1 to 30 residues, more preferably about 1 to 10 residues and typically about 1 to 5 contiguous residues.

Substitution mutants have at least one amino acid residue in the polypeptide molecule removed and a different residue inserted in its place. The sites of greatest interest for substitutional mutagenesis include sites identified as the binding site(s), such as sites involved in lipid and/or juvenile hormone binding. Other sites of interest are those in which particular residues obtained from various species are identical. These positions may be important for biological activity. These sites, especially those falling within a sequence of at least three other identically conserved sites, are preferably substituted in a relatively conservative manner. Such conservative substitutions are shown in Table 1.

Preferred mutants of the present invention include those which act in a dominant-negative fashion when present in an arthropod. More specifically, mutant polypeptides of the present invention can be produced which will form a heterodimer with a naturally occurring lipophorin polypeptide, however, the mutant is designed such that the heterodimer is unable to perform at least one biological activity of the naturally occurring heterodimer. Preferably, the mutant heterodimer is unable to bind hydrophobic molecules or juvenile hormone.

TABLE 1

Furthermore, if desired, unnatural amino acids or chemical amino acid analogues can be introduced as a substitution or addition into the polypeptides of the present invention. Such amino acids include, but are not limited to, the D-isomers of the common amino acids, 2,4-diaminobutyric acid, α-amino isobutyric acid, 4-aminobutyric acid, 2-aminobutyric acid, 6-amino hexanoic acid, 2-amino isobutyric acid, 3-amino propionic acid, ornithine, norleucine, norvaline, hydroxyproline, sarcosine, citrulline, homocitrulline, cysteic acid, t- butylglycine, t-butylalanine, phenylglycine, cyclohexylalanine, β-alanine, fluoro- amino acids, designer amino acids such as β-methyl amino acids, Cα-methyl amino acids, Nα-methyl amino acids, and amino acid analogues in general.

Also included within the scope of the invention are polypeptides of the present invention which are differentially modified during or after synthesis, e.g., by biotinylation, benzylation, glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to an antibody molecule or other cellular ligand, etc. These modifications may serve to increase the stability and/or bioactivity of the polypeptide of the invention.

Polypeptides of the present invention can be produced in a variety of ways, including production and recovery of natural proteins, production and recovery of recombinant proteins, and chemical synthesis of the proteins. In one embodiment, an isolated polypeptide of the present invention is produced by culturing a cell capable of expressing the polypeptide under conditions effective to produce the polypeptide, and recovering the polypeptide. A preferred cell to culture is a host cell of the present invention. Effective culture conditions include, but are not limited to, effective media, bioreactor, temperature, pH and oxygen conditions that permit protein production. An effective medium refers to any medium in which a cell is cultured to produce a polypeptide of the present invention. Such medium typically comprises an aqueous medium having assimilable carbon, nitrogen and phosphate sources, and appropriate salts, minerals, metals and other nutrients, such as vitamins. Cells of the present invention can be cultured in conventional fermentation bioreactors, shake flasks, test tubes, microtiter dishes, and petri plates. Culturing can be carried out at a temperature, pH and oxygen content appropriate for a recombinant cell. Such culturing conditions are within the expertise of one of ordinary skill in the art.

Arthropod Control Agents and Methods of Screening Therefor

Suitable arthropod control agents include compounds that interact directly with a binding and/or active site(s) of a polypeptide, or combination thereof, of the present invention, thereby hindering at least one biological activity, formation or stability of a heterodimer of a polypeptide of the second aspect and a polypeptide of the third aspect.

Arthropod control agents identified using the methods of the present invention can be used to disrupt at least one biological activity which plays a role in a physiological process selected from the group consisting of: hydrophobic molecule binding, haemolymph clotting, an immune response, oogenesis, vision and juvenile hormone binding. Preferably, this results in death of the arthropod or at least a reduction in its rate of reproduction or feeding. For instance, the lipophorins of the present invention play a role in the regulation juvenile hormone signalling. During development, disruption of juvenile signalling by increasing JH levels will result in increased JH titres and the blocking of a vital moult, whereas decreasing JH levels, particularly by reducing the levels of JH associated with the lipophorins of the present invention which increases JH exposure to JH degrading enzymes, will result in a drop in JH titre and a precocious moult. Accordingly, agents which either enhance or inhibit lipophorin activity or levels can be useful in controlling arthropod populations.

As used herein a "lead compound" is an arthropod control agent which is subject to trials with the goal of ultimately being formulated in, for example, a composition and sold as an agent for controlling arthropod pest populations. The lead compound, when exposed to an arthropod, more preferably an insect, disrupts lipophorin activity and/or levels within the arthropod leading to a reduction in reproduction rates, death, feeding rates etc.

Known screening techniques can be used to identify arthropod control agents which modulate the activity, or production of, a lipophorin of the present invention. For instance, a heterodimer of a polypeptide according to the second aspect and a polypeptide according to the third aspect can be incubated with radiolabeled JH and a candidate arthropod control agent under conditions generally outlined by Trowell et al. (1994). Agents which are potentially useful for controlling arthropod populations would be identified by the agents ability to block JH binding to the heterodimer. A similar assay could readily be developed for measuring the binding of the heterodimers of the present invention to hydrophobic molecules. Candidate agents can be included in such an assay to determine if they are suitable arthropod control agents. Many reactions screening many potential arthropod control agents can be performed automatically in microtitre trays using robots to transfer the various solutions and measure the adsorbance of each well.

Another method for screening for agonists/antagonists involves mixing the heterodimer with a binding partner (which is capable of binding to the heterodimer) and measuring their binding to each other in the presence or absence of a potential agonist/antagonist. Alternatively, the method of screening involves the use of one of the subunits as the binding partner for the other subunit, and measuring their binding to each other in the presence or absence of a potential agonist antagonist. The heterodimer/subunit or the binding partner can be detectably labeled using known labels such as those selected from the group consisting of: radioisotopes, fluorophores and chromophores. Most preferably, the binding partner is labeled juvenile hormone. This binding assay may be in the form of an ELISA plate assay. There are other binding formats known to those of skill in the art, including coprecipitation, centrifugation and surface plasmon resonance.

One potential antagonist is a small molecule which binds to the juvenile hormone binding site of the heterodimer, making it inaccessible to hydrophobic molecules. Another potential antagonist is a small molecule which binds to one subunit, preventing formation of the heterodimer. Examples of small molecules include, but are not limited to, small peptides, peptide-like molecules, plant secondary metabolites or synthetic organic chemicals.

As described herein, suitable antisense polynucleotide and dsRNA molecules can be designed based on the sequences of the lipophorin encoding polynucleotides of the present invention. Such antisense polynucleotide and dsRNA molecules can be used as arthropod control agents which inhibit the production of lipophorin from the cell of an arthropod which has been transformed with the antisense polynucleotide or dsRNA molecule.

Such antisense polynucleotides and dsRNA molecules can also be screened for use as an arthropod control agent using the methods of the present invention. For instance, a lipophorin encoding polynucleotide of the present invention can be expressed in a cell system, or a cell-free expression system, resulting in the production of lipophorin. Candidate antisense polynucleotides and dsRNA molecules designed based on the sequences of the lipophorin encoding polynucleotides of the present invention can be incorporated into the system and the resulting affects on lipophorin mRNA levels or lipophorin polypeptide levels or activity, can readily be measured using techniques known in the art.

Suitable inhibitors of lipophorin activity are compounds that interact directly with a binding site of the heterodimer, or a subunit thereof. However, lipophorin inhibitors can also interact with other regions of the protein to inhibit lipophorin activity, for example, by allosteric interaction.

Some arthropod control agents identified by the methods of the present invention may also interact with other molecules in the JH system. For instance, some arthropod control agents may, at least partially, act on JH receptors and/or JH-degrading enzymes such as JH esterase or JH epoxide hydrolase.

Phage Libraries for Arthropod Control Agent Screening

Phage libraries can be constructed which when infected into host E. coli produce random peptide sequences of approximately 10 to 15 amino acids. Specifically, the phage library can be mixed in low dilutions with permissive E. coli in low melting point LB agar which is then poured on top of LB agar plates. After incubating the plates at 37°C for a period of time, small clear plaques in a lawn of E. coli will form which represents active phage growth and lysis of the E. coli. A representative of these phages can be absorbed to nylon filters by placing dry filters onto the agar plates. The filters can be marked for orientation, removed, and placed in washing solutions to block any remaining absorbent sites. The filters can then be placed in a solution containing, for example, a radioactively labeled polypeptide of the present invention (e.g., a polypeptide having an amino acid sequence comprising SEQ ID NO;s:1 , 2 or 3). After a specified incubation period, the filters can be thoroughly washed and developed for autoradiography. This allows plagues containing the phage that bind to the radioactive polypeptide to be detected. These phages can be further cloned and then retested for their ability to bind to the lipophorin as before. Once the phages have been purified, the binding sequence contained within the phage can be determined by standard DNA sequencing techniques. Once the DNA sequence is known, synthetic peptides can be generated which represents these sequences. >

The effective peptide(s) can be synthesized in large quantities for use in in vivo models and eventually as an arthropod control agent to disrupt lipophorin activity. It should be emphasized that synthetic peptide production is relatively non-labor intensive, easily manufactured, quality controlled and thus, large quantities of the desired product can be produced rather cheaply.

Protein-Structure Based Design of Arthropod Control Agents Crystals of a polypeptide of the present invention are grown by a number of techniques including batch crystallation, vapour diffusion (either by sitting drop or hanging drop) and by microdialysis. Seeding of the crystals in some instances could be required to obtain X-ray quality crystals. Standard micro and/or macro seeding of crystals may therefore be used. Once a crystal is grown, X-ray diffraction data can be collected using standard techniques.

Once the three-dimensional structure of a polypeptide of the present invention, or a heterodimer thereof, is determined, a potential antagonist or agonist can be examined through the use of computer modeling using a docking program such as GRAM, DOCK, or AUTODOCK (Dunbrack et al., 1997). This procedure can include computer fitting of potential ligands to the lipophorin to ascertain how well the shape and the chemical structure of the potential ligand will complement or interfere with lipophorin activity. Computer programs can also be employed to estimate the attraction, repulsion, and steric hindrance of the ligand to the polypeptide of the present invention, or a heterodimer thereof. Generally the tighter the fit (e.g., the lower the steric hindrance, and/or the greater the attractive force) the more potent the potential arthropod control agent will be since these properties are consistent with a tighter binding constant. Furthermore, the more specificity in the design of a potential arthropod control agent the more likely that the arthropod control agent will not interfere with other proteins. This will minimize potential side- effects due to unwanted interactions with other proteins.

Initially a potential compound could be obtained, for example, by screening a random peptide library produced by a recombinant bacteriophage as described above, or a chemical library. A compound selected in this manner could be then be systematically modified by computer modeling programs until one or more promising potential compounds are identified.

Such computer modeling allows the selection of a finite number of rational chemical modifications, as opposed to the countless number of essentially random chemical modifications that could be made, and of which any one might lead to a useful arthropod control agent. Each chemical modification requires additional chemical steps, which while being reasonable for the synthesis of a finite number of compounds, quickly becomes overwhelming if all possible modifications needed to be synthesized. Thus through the use of the three-dimensional structure and computer modeling, a large number of these compounds can be rapidly screened on the computer monitor screen, and a few likely candidates can be determined without the laborious synthesis of untold numbers of compounds.

The prospective arthropod control agent can be placed into any standard binding assay, as outlined above, to test its effect on lipophorin activity.

For all of the arthropod control agent screening assays described herein further refinements to the structure of the arthropod control agent will generally be necessary and can be made by the successive iterations of any and/or all of the steps provided by the particular arthropod control agent screening assay.

Catalytic Nucleic Acids The term catalytic nucleic acid refers to a DNA molecule or DNA- containing molecule (also known in the art as a "deoxyribozyme") or an RNA or RNA-containing molecule (also known as a "ribozyme") which specifically recognizes a distinct substrate and catalyzes the chemical modification of this substrate. The nucleic acid bases in the catalytic nucleic acid can be bases A, C, G, T and U, as well as derivatives thereof. Derivatives of these bases are well known in the art.

Typically, the catalytic nucleic acid contains an antisense sequence for specific recognition of a target nucleic acid, and a nucleic acid cleaving enzymatic activity (also referred to herein as the "catalytic domain"). The types of ribozymes that are particularly useful in this invention are the hammerhead ribozyme (Haseloff and Gerlach 1988, Perriman et al., 1992) and the hairpin ribozyme (Shippy et al., 1999).

The ribozymes of this invention and DNA encoding the ribozymes can be chemically synthesized using methods well known in the art. The ribozymes can also be prepared from a DNA molecule (that upon transcription, yields an RNA molecule) operably linked to an RNA polymerase promoter, e.g., the promoter for T7 RNA polymerase or SP6 RNA polymerase. Accordingly, also provided by this invention is a nucleic acid molecule, i.e., DNA or cDNA, coding for the ribozymes of this invention. When the vector also contains an RNA polymerase promoter operably linked to the DNA molecule, the ribozyme can be produced in vitro upon incubation with RNA polymerase and nucleotides. In a separate embodiment, the DNA can be inserted into an expression cassette or transcription cassette. After synthesis, the RNA molecule can be modified by ligation to a DNA molecule having the ability to stabilize the ribozyme and make it resistant to RNase. Alternatively, the ribozyme can be modified to the phosphothio analog for use in liposome delivery systems. This modification also renders the ribozyme resistant to endonuclease activity.

dsRNA dsRNA is particularly useful for specifically inhibiting the production of a particular protein. Although not wishing to be limited by theory, Dougherty and Parks (1995) have provided a model for the mechanism by which dsRNA can be used to reduce protein production. This model has more recently been modified and expanded by Waterhouse et al. (1998). This technology relies on the presence of dsRNA molecules that contain a sequence that is essentially identical to the mRNA of the gene of interest, in this case an mRNA encoding a polypeptide according to the first, second or third aspects of the invention. Conveniently, the dsRNA can be produced in a single open reading frame in a recombinant vector or host cell, where the sense and anti-sense sequences are flanked by an unrelated sequence which enables the sense and anti-sense sequences to hybridize to form the dsRNA molecule with the unrelated sequence forming a loop structure. The design and production of suitable dsRNA molecules for the present invention is well within the capacity of a person skilled in the art, particularly considering Dougherty and Parks (1995), Waterhouse et al. (1998), WO 99/32619, WO 99/53050, WO 99/49029, and WO 01/34815.

Recombinant Vectors

One embodiment of the present invention includes a recombinant vector, which includes at least one isolated polynucleotide molecule of the present invention, inserted into any vector capable of delivering the polynucleotide molecule into a host cell. Such a vector contains heterologous polynucleotide sequences, that is polynucleotide sequences that are not naturally found adjacent to polynucleotide molecules of the present invention and that preferably are derived from a species other than the species from which the polynucleotide molecule(s) are derived. The vector can be either RNA or DNA, either prokaryotic or eukaryotic, and typically is a virus or a plasmid. One type of recombinant vector comprises a polynucleotide molecule of the present invention operably linked to an expression vector. The phrase operably linked refers to insertion of a polynucleotide molecule into an expression vector in a manner such that the molecule is able to be expressed when transformed into a host cell. As used herein, an expression vector is a DNA or RNA vector that is capable of transforming a host cell and of effecting expression of a specified polynucleotide molecule. Preferably, the expression vector is also capable of replicating within the host cell. Expression vectors can be either prokaryotic or eukaryotic, and are typically viruses or plasmids. Expression vectors of the present invention include any vectors that function (i.e., direct gene expression) in recombinant cells of the present invention, including in bacterial, fungal, endoparasite, arthropod, other animal, and plant cells.

In particular, expression vectors of the present invention contain regulatory sequences such as transcription control sequences, translation control sequences, origins of replication, and other regulatory sequences that are compatible with the recombinant cell and that control the expression of polynucleotide molecules of the present invention. In particular, recombinant molecules of the present invention include transcription control sequences. Transcription control sequences are sequences which control the initiation, elongation, and termination of transcription. Particularly important transcription control sequences are those which control transcription initiation, such as promoter, enhancer, operator and repressor sequences. Suitable transcription control sequences include any transcription control sequence that can function in at least one of the recombinant cells of the present invention. A variety of such transcription control sequences are known to those skilled in the art. Preferred transcription control sequences include those which function in bacterial, yeast, arthropod and mammalian cells, such as, but not limited to, tac, lac, trp, trc, oxy-pro, omp/lpp, rrnB, bacteriophage lambda, bacteriophage T7, T7lac, bacteriophage T3, bacteriophage SP6, bacteriophage SP01 , metallothionein, alpha-mating factor, Pichia alcohol oxidase, alphavirus subgenomic promoters (such as Sindbis virus subgenomic promoters), antibiotic resistance gene, baculovirus, Heliothis zea insect virus, vaccinia virus, herpesvirus, raccoon poxvirus, other poxvirus, adenovirus, cytomegalovirus (such as intermediate early promoters), simian virus 40, retrovirus, actin, retroviral long terminal repeat, Rous sarcoma virus, heat shock, phosphate and nitrate transcription control sequences as well as other sequences capable of controlling gene expression in prokaryotic or eukaryotic cells. Additional suitable transcription control sequences include tissue-specific promoters and enhancers as well as lymphokine-inducible promoters (e.g., promoters inducible by interferons or interleukins). Transcription control sequences of the present invention can also include naturally occurring transcription control sequences naturally associated with arthropods.

Recombinant molecules of the present invention may also (a) contain secretory signals (i.e., signal segment nucleic acid sequences) to enable an expressed polypeptide of the present invention to be secreted from the cell that produces the polypeptide and/or (b) contain fusion sequences which lead to the expression of nucleic acid molecules of the present invention as fusion proteins. Examples of suitable signal segments include any signal segment capable of directing the secretion of a protein of the present invention. Preferred signal segments include, but are not limited to, tissue plasminogen activator (t-PA), interferon, interleukin, growth hormone, histocompatibility and viral envelope glycoprotein signal segments, as well as natural signal sequences. In addition, a nucleic acid molecule of the present invention can be joined to a fusion segment that directs the encoded protein to the proteosome, such as a ubiquitin fusion segment.

Known arthropod-specific viruses systems can be used to deliver molecules of the present invention. These can be as diverse as large DNA viruses such as the baculoviruses and small RNA viruses. Wild-type viruses are generally ingested by arthropods. Proteins on the surface of the virus bind to cells of the arthropod's gut causing the contents of the virus to enter the cells. The nucleic acid in the virus then performs two tasks. Firstly, it encodes viral proteins that are required for the assembly of more viruses identical the original virus, and secondly, more copies of the nucleic acid are produced for incorporation into the new virus. When a virus is modified as a vector for producing a protein of interest some additional nucleic acid is inserted into the virus' nucleic acid and may or may not replace some of the virus' original nucleic acid. The site of insertion of the nucleic acid is chosen to ensure that it will be transcribed (if necessary) and translated into the required protein in the virus infected cells. Abundant expression of the protein might require other modifications such as suitable promoter sites in the nucleic acid. It is generally intended that the modified virus would infect a large number of cells in the target arthropod with abundant expression of the protein in all those cells. It is also generally intended that the expression of the proteins hastens or otherwise enhances the detrimental effects on the arthropod of viral infection. Such viruses can be formulated to allow them to be sprayed or otherwise distributed on a crop plant (or other material one wishes to protect from arthropod attack) and ingested by arthropods when they start to feed on the crop.

Also known are vector systems that are derived from viruses. An example is the capsoid system (Hanzlik et al., 1999; WO 97/46666). The capsoid system is based on small RNA viruses. These small RNA viruses consist of one or a few RNA molecules which associate with a capsid protein encoded by that RNA. Molecules of the capsid protein assemble into regular geometric structures that enclose and protect the RNA. The same protein also provides the function of binding to cells in the gut of arthropods and causing the viral RNA to enter the gut cell. Within the cell more copies of the RNA are made and these are expressed to make more of the viral protein. The RNA and protein assemble into new virus particles that can infect other cells and arthropods. The capsoid system uses some of the functions of the wild-type virus to deliver a protein to arthropod gut cells but does not have all the functions required to sustain a viral infection. It also has features that allow it to be produced by a transgenic plant rather than needing to be produced elsewhere and sprayed on to a crop. The plant is transformed with a gene that causes the plant to produce the capsid protein. The transgenic plant also produces an RNA molecule that contains the necessary sequences to associate with the capsid protein to produce a virus-like particle. When an arthropod feeds on the plant it ingests the virus-like particles. The capsid protein binds to the arthropod's gut cells and the RNA enters the cell. That RNA can be engineered to resemble a messenger RNA causing the cell to translate the message into a protein.

A variation of the capsoid system has the transgenic plant expressing the protein of interest and the capsid protein as a fusion product from a single gene. It is the protein rather than the corresponding RNA that is delivered. Simply feeding an unprotected protein such as lipophorin to an arthropod is unlikely to be effective because the protein would most likely be digested by normal gut processes. The capsid protein domains assemble into virus-like structures with the lipophorin domain protected from digestion within the lumen of the virus-like structure. The lipophorin protein is only exposed after the capsid domains have bound to gut cells. The fusion of the virus-like structure with the target cell's membrane causes the lipophorin domains to be presented to the inside of the cell where they remain protected from digestion in the gut.

Host Cells

Another embodiment of the present invention includes a recombinant cell comprising a host cell comprising one or more recombinant molecules of the present invention. Transformation of a polynucleotide molecule into a cell can be accomplished by any method by which a polynucleotide molecule can be inserted into the cell. Transformation techniques include, but are not limited to, transfection, electroporation, microinjection, lipofection, adsorption, and protoplast fusion. A recombinant cell may remain unicellular or may grow into a tissue, organ or a multicellular organism. Transformed polynucleotide molecules of the present invention can remain extrachromosomal or can integrate into one or more sites within a chromosome of the transformed (i.e., recombinant) cell in such a manner that their ability to be expressed is retained.

Suitable host cells to transform include any cell that can be transformed with a polynucleotide of the present invention. Host cells of the present invention either can be endogenously (i.e., naturally) capable of producing proteins of the present invention or can be capable of producing such proteins after being transformed with at least one polynucleotide molecule of the present invention. Host cells of the present invention can be any cell capable of producing at least one protein of the present invention, and include bacterial, fungal (including yeast), parasite, arthropod, animal and plant cells. Preferred host cells include bacterial, mycobacterial, yeast, arthropod and mammalian cells. More preferred host cells include Salmonella, Escherichia, Bacillus, Listeria, Saccharomyces, Spodoptera, Mycobacteria, Trichoplusia, BHK (baby hamster kidney) cells, MDCK cells (normal dog kidney cell line for canine herpesvirus cultivation), CRFK cells (normal cat kidney cell line for feline herpesvirus cultivation), CV-1 cells (African monkey kidney cell line used, for example, to culture raccoon poxvirus), COS (e.g., COS-7) cells, and Vero cells. Particularly preferred host cells are E. coli, including E. coli K-12 derivatives; Salmonella typhi; Salmonella typhimurium, including attenuated strains; Spodoptera frugiperda; Trichoplusia ni; BHK cells; MDCK cells; CRFK cells; CV-1 cells; COS cells; Vero cells; and non-tumorigenic mouse myoblast G8 cells (e.g., ATCC CRL 1246). Additional appropriate mammalian cell hosts include other kidney cell lines, other fibroblast cell lines (e.g., human, murine or chicken embryo fibroblast cell lines), myeloma cell lines, Chinese hamster ovary cells, mouse NIH/3T3 cells, LMTK cells and/or HeLa cells.

Recombinant DNA technologies can be used to improve expression of a transformed polynucleotide molecule by manipulating, for example, the number of copies of the polynucleotide molecule within a host cell, the efficiency with which those polynucleotide molecules are transcribed, the efficiency with which the resultant transcripts are translated, and the efficiency of post-translational modifications. Recombinant techniques useful for increasing the expression of polynucleotide molecules of the present invention include, but are not limited to, operatively linking polynucleotide molecules to high-copy number plasmids, integration of the polynucleotide molecule into one or more host cell chromosomes, addition of vector stability sequences to plasmids, substitutions or modifications of transcription control signals (e.g., promoters, operators, enhancers), substitutions or modifications of translational control signals (e.g., ribosome binding sites, Shine-Dalgamo sequences), modification of polynucleotide molecules of the present invention to correspond to the codon usage of the host cell, and the deletion of sequences that destabilize transcripts.

Compositions and Agriculturally Acceptable Carriers

As used herein, an "arthropod control composition", is a formulation which comprises an arthropod control agent of the present invention, where upon exposure of the composition to an arthropod results in the disruption of lipophorin activity.

Agriculturally suitable and/or environmentally acceptable compositions for arthropod control are known in the art. Agricultural compositions for the control of arthropod pests of plants and/or animals must be suitable for agricultural use and dispersal in fields. Similarly, compositions for the control of other arthropod pests should be environmentally acceptable. In addition to appropriate solid or, more preferably, liquid carriers, agricultural compositions may include sticking and adhesive agents, emulsifying and wetting agents, but no components which deter arthropod feeding or any arthropod control agent functions. It may also be desirable to add components which protect the arthropod control agent from UV inactivation or components which serve as adjuvants to increase the potency and/or virulence of an entomopathogen. Agricultural compositions for arthropod pest control may also include agents which stimulate arthropod feeding.

In one embodiment, a composition of the present invention can be used to protect an animal from arthropod infestation by administering such composition in order to prevent infestation. Such administration could be oral, or by application to the environment (e.g., spraying). In another embodiment, an arthropod, such as a L. cuprina, can ingest compositions, or products thereof, present in the blood of a host animal that has been administered with a composition of the present invention. Compositions of the present invention can be administered to any animal susceptible to arthropod infestation (i.e., a host animal), including warmblooded animals. Preferred animals to treat include mammals and birds, with cats, dogs, humans, cattle, chinchillas, ferrets, goats, mice, minks, rabbits, raccoons, rats, sheep, squirrels, swine, chickens, ostriches, quail and turkeys as well as other furry animals, pets, zoo animals, work animals and/or food animals, being more preferred. Particularly preferred animals to protect are sheep and cattle.

In accordance with the present invention, a host animal is treated by administering to the animal a composition of the present invention in such a manner that the arthropod control agent enters the arthropod. A host animal is preferably treated in such a way that the compound or product thereof enters the blood stream of the animal. The arthropod is then exposed to the composition or product when they feed from the animal. For example, the arthropod control agents administered to an animal are administered in such a way that they enter the blood stream of the animal, where they can be taken up by feeding arthropods. In another embodiment, when a host animal is administered with a polypeptide or polynucleotide of the present invention, the treated animal mounts an immune response resulting in the production of antibodies against the lipophorin (i.e., anti-lipophorin antibodies) which circulate in the animal's blood stream and are taken up by arthropods upon feeding.

Compositions of the present invention also include excipients. Excipients are also referred to herein as "agriculturally acceptable carriers". An excipient can be any material that the animal, plant or environment to be treated can tolerate. Examples of such excipients include water, saline, Ringer's solution, dextrose solution, Hank's solution, and other aqueous physiologically balanced salt solutions. Nonaqueous vehicles, such as fixed oils, sesame oil, ethyl oleate, or triglycerides may also be used. Other useful formulations include suspensions containing viscosity enhancing agents, such as sodium carboxymethylcellulose, sorbitol, or dextran. Excipients can also contain minor amounts of additives, such as substances that enhance isotonicity and chemical stability. Examples of buffers include phosphate buffer, bicarbonate buffer and Tris buffer, while examples of preservatives include thimerosal or o-cresol, formalin and benzyl alcohol. Standard formulations can either be liquid injectables or solids which can be taken up in a suitable liquid as a suspension or solution for injection. Thus, in a non-liquid formulation, the excipient can comprise dextrose, human serum albumin, dog serum albumin, cat serum albumin, preservatives, etc., to which sterile water or saline can be added prior to administration.

In one embodiment of the present invention, the composition can include compounds that increase the half-life of a composition in the treated animal, plant or environment, examples include, but are not limited to, polymeric controlled release vehicles, biodegradable implants, liposomes, bacteria, viruses, other cells, oils, esters, and glycols.

One embodiment of the present invention is a controlled release formulation that is capable of slowly releasing a composition of the present invention into/onto an animal, plant or the environment. As used herein, a controlled release formulation comprises a composition of the present invention in a controlled release vehicle. Suitable controlled release vehicles include, but are not limited to, biocompatible polymers, other polymeric matrices, capsules, microcapsules, microparticles, bolus preparations, osmotic pumps, diffusion devices, liposomes, lipospheres, and transdermal delivery systems. Other controlled release formulations of the present invention include liquids that, upon administration to an animal, form a solid or a gel in situ. Preferred controlled release formulations are biodegradable (i.e., bioerodible).

A preferred controlled release formulation of the present invention is capable of releasing a composition of the present invention into the blood of an animal at a constant rate sufficient to attain effective dose levels of the composition to protect an animal from arthropod infestation. The composition is preferably released over a period of time ranging from about 1 to about 12 months. A preferred controlled release formulation of the present invention is capable of effecting a treatment preferably for at least about 1 month, more preferably for at least about 3 months, even more preferably for at least about 6 months, even more preferably for at least about 9 months, and even more preferably for at least about 12 months.

The concentration of the arthropod control agent that will be required to produce effective compositions for the control of an arthropod pest will depend on the type of arthropod and the formulation of the composition. The effective concentration of the arthropod control agent within the composition can readily be determined experimentally, as will be understood by the skilled artisan. For example, the effective concentration of a virus can be readily determined using techniques known to the art. Acceptable protocols to administer compositions of the present invention to animals in an effective manner include individual dose size, number of doses, frequency of dose administration, and mode of administration. Determination of such protocols can be accomplished by those skilled in the art. A suitable single dose is a dose that is capable of protecting an animal from arthropod infestation when administered one or more times over a suitable time period. For example, a preferred single dose of a composition comprising a polypeptide, polynucleotide or arthropod control agent of the present invention is from about 1 microgram to about 10 milligrams of the composition per kilogram body weight of the animal. Boosters can be administered from about 2 weeks to several years after the original administration. A preferred administration schedule is one in which from about 10 μg to about 1 mg of the composition per kg body weight of the animal is administered from about one to about two times over a time period of from about 2 weeks to about 12 months. Modes of administration can include, but are not limited to, subcutaneous, intradermal, intravenous, intranasal, oral, transdermal, intraocular and intramuscular routes.

Transgenic Non-Human Animals

Techniques for producing transgenic animals are well known in the art. A useful general textbook on this subject is Houdebine, Transgenic animals - Generation and Use (Harwood Academic, 1997).

Heterologous DNA can be introduced, for example, into fertilized mammalian ova. For instance, totipotent or pluripotent stem cells can be transformed by microinjection, calcium phosphate mediated precipitation, liposome fusion, retroviral infection or other means, the transformed cells are then introduced into the embryo, and the embryo then develops into a transgenic animal. In a highly preferred method, developing embryos are infected with a retrovirus containing the desired DNA, and transgenic animals produced from the infected embryo. In a most preferred method, however, the appropriate DNAs are coinjected into the pronucleus or cytoplasm of embryos, preferably at the single cell stage, and the embryos allowed to develop into mature transgenic animals.

Another method used to produce a transgenic animal involves microinjecting a nucleic acid into pro-nuclear stage eggs by standard methods. Injected eggs are then cultured before transfer into the oviducts of pseudopregnant recipients.

Transgenic animals may also be produced by nuclear transfer technology as described by Schnieke et al. (1997) and Cibelli et al. (1998). Using this method, fibroblasts from donor animals are stably transfected with a plasmid incorporating the coding sequences for a binding domain or binding partner of interest under the control of regulatory. Stable transfectants are then fused to enucleated oocytes, cultured and transferred into female recipients.

Transgenic Plants

The term "plant" refers to whole plants, plant organs (e.g. leaves, stems roots, etc), seeds, plant cells and the like. Plants contemplated for use in the practice of the present invention include both monocotyledons and dicotyledons. Exemplary dicotyledons include cotton, corn, tomato, tobacco, potato, bean, soybean, and the like.

Transgenic plants, as defined in the context of the present invention include plants (as well as parts and cells of said plants) and their progeny which have been genetically modified using recombinant DNA techniques to cause or enhance production of at least one protein, polynucleotide, dsRNA or antisense polynucleotide of the present invention in the desired plant or plant organ. A polynucleotide of the present invention may be expressed constitutively in the transgenic plants during all stages of development.

Depending on the use of the plant or plant organs, the proteins may be expressed in a stage-specific manner. Furthermore, depending on the use, the polynucleotides may be expressed tissue-specifically. The choice of the plant species is determined by the intended use of the plant or parts thereof and the amenability of the plant species to transformation. Regulatory sequences which are known or are found to cause expression of a polynucleotide of interest in plants may be used in the present invention. The choice of the regulatory sequences used depends on the target crop and/or target organ of interest. Such regulatory sequences may be obtained from plants or plant viruses, or may be chemically synthesized. Such regulatory sequences are well known to those skilled in the art.

Other regulatory sequences such as terminator sequences and polyadenylation signals include any such sequence functioning as such in plants, the choice of which is known to the skilled addressee. An example of such sequences is the 3' flanking region of the nopaline synthase (nos) gene of Agrobacterium tumefaciens.

Several techniques are available for the introduction of an expression construct containing a polyucleotide sequence of interest into the target plants. Such techniques include but are not limited to transformation of protoplasts using the calcium/polyethylene glycol method, electroporation and microinjection or (coated) particle bombardment. In addition to these so-called direct DNA transformation methods, transformation systems involving vectors are widely available, such as viral and bacterial vectors (e.g. from the genus Agrobacterium). After selection and/or screening, the protoplasts, cells or plant parts that have been transformed can be regenerated into whole plants, using methods known in the art. The choice of the transformation and/or regeneration techniques is not critical for this invention.

Examples Materials and Methods Touchdown PCR

Touchdown PCR (Don et al, 1991; Digan et al, 1992) was performed using standard conditions except that after the initial thermal cycle (95°C 5 min, 60°C 1 min) the second to 9^th thermal cycles consisted of 95°C for 3 minutes, followed by a stepped decrease from 85°C to 40°C over 8 minutes, followed by 8 minutes at 40°C then 1 minute at 48°C, 1 minute at 56°C, 1 minute at 64°C and 3 minutes at 72°C. Cycles 10 to 39 were 1 min at 95°C, 1 min at 60°C and 1 min at 72°C. A final finishing cycle was 72°C for 10 minutes.

Following this procedure a portion of the PCR products were separated on a 12% polyacrylamide gel, electroblotted to a nylon membrane and probed, using standard procedures, with a degenerate oligonucleotide probe 5'- AA(AG)GTIGCIAA(AG)AA(AG)TA(TC)AA(AG)AC-3' (SEQ ID NO: 7) which was homologous to amino acids 8-15 of the N-terminus of ApoLpnll (Trowell et al., 1994). The probe was end-labeled with γ³²P-ATP.

cDNA Libraries of Lucilia cuprina

Three L. cuprina cDNA libraries were used to obtain the entire pre- apolipophorin coding sequence. The random primed cDNA sequences used in the preparation of Library-1 and Library-2 were obtained through standard techniques. The cDNA clones in Library-1 were prepared from heads of adult blowflies, ligated in the λgt10 vector. Library-2 contained cDNA sequences obtained from the fat body of third-instar insects, and ligated in the λgt11 vector. An oligo-dT-primed embryonic cDNA library in λ-ZAP (Library-3) was also screened in order to obtain the 3' end of the lipophorin coding sequence. Library-3 was provided by Dr Philip Batterham (Department of Genetics, University of Melbourne, Australia).

Library Screening

Random-primed probes were labeled with α-³²P-dATP (DuPont, New

England Biolabs or Bresatec) using Bresatec's GIGAprime DNA Labelling Kit or New England Biolabs' NEBIot Kit. Labelling procedures were as described in manufacturers' protocols provided with kits.

Approximately 2.5 x 10⁵ phage were used for each primary screening.

Generally, purification included two or three rounds of screening on 90 mm plates where the number of plaques varied between 2 x 10³ and 1 x 10¹ per plate as the purification progressed. Phage DNA from 150 mm and 90 mm plates were transferred onto 137 mm and 87 mm Amersham NitroBind nitrocellulose membranes, respectively.

Prehybridisation and hybridisation steps were carried out in a HybAid oven (HybAid™ Mini Oven MKII) at 60°C. Membranes were incubated in prehybridisation solution containing 10χ Denhardt's solution (0.2% Ficoll 400

0.2% PVP (polyvinylpyrolidine); 0.2% BSA (Bovine Serum Albumin)); 6^χ SSC

0.1%) SDS (sodium dodecyl sulfate); 0.1 mg/ml salmon sperm denatured DNA;

0.05% sodium pyrophosphate, for at least 4 hours. Labeled probe was denatured by boiling for 10 min and cooling on ice before addition. Denatured probe was added to the prehybridisation mix. Hybridisation was carried out overnight. Membranes were washed after hybridisation in order to remove non- specifically hybridised probe. Each washing step was carried out for 30 minutes under the same conditions as hybridisation. Membranes were washed twice with 4χ SSC; 0.1% SDS and then once in 2x SSC; 0.1% SDS. After washing, membranes were sealed in plastic bags. Autoradiographs were obtained by exposing and developing Fuji XR-100 X-Ray films at -80 °C. The exposure time varied according to the signal strength.

Handling and Analysis of Positive Clones Each single positive plaque as determined by hybridisation was cored out from the plate using a sterile Pasteur pipette, and removed to a 1.5 ml Eppendorf tube containing 0.5 ml of SM buffer (50 mM Tris; 8 mM MgS0₄.7H₂0; 100 mM NaCI; 0.01% Gelatine (Sigma); pH 7.5). A drop of chloroform were added and phage was eluted by gentle shaking of the tube for 4 hours at RT. 10 μl of phage eluate was diluted at 1:10 ratio in ddH₂0 to form DNA template mix. This was denatured by boiling for 10 min and subsequent chilling on ice. 50 μl PCR amplification mixes were set up in 0.5 ml Eppendorf tubes and contained Taq DNA polymerase buffer, 1.5mM MgC , 0.2mM dNTPs, 1μM of each primer, approximately 0.2 to 1 mM of template, 0.5 units of Taq DNA polymerase and sterile H₂0.

Before adding the thermostable DNA polymerase, the reaction mix in each tube was overlayed with an equal volume of light mineral oil (Sigma). Tubes were incubated in a Corbett Research FTS-320 Thermal Sequencer with the following program; 1 x 95°C for 5 min; 26 x 95°C for 35 s, 60°C for 2 min, 72°C for 2 min; 1 x 72°C for 5 min.

Cloning DNA Fragments into Plasmid Vectors

DNA fragments were cloned into the multiple cloning site of pBluescript II SK⁺ (pBSK⁺) vector (Stratagene). When fragments were to be cloned into a specific site, digested ends of vectors were dephosphorylated using calf intestinal alkaline phosphatase (CIP, Promega). Ligation mix (final volume of 10 μl) was either incubated at 16 °C overnight or at room temperature for 4 hours. The ratio of compatible ends used for ligation was adjusted in such a way that the population of insert ends was about three times greater than that of the vector. Dye-Primer Cycle Sequencing

Cycle sequencing of double-stranded DNA fragments was carried out using M13 Reverse and -21 M13 Dye Primers (Applied Biosystems) according to the manufacturer's manual. Reaction mixes were removed to capillary PCR tubes and after sealing were incubated in a thermal sequencer machine (Corbett Research FTS-1 S Capillary Thermal Sequencer) typically with the following cycling program; 1 x 95°C for 5 min; 17 x 95°C for 30 s, 55°C for 30 s, 70°C for 60 s; 15 x 95°C for 30 s, 70°C for 60 s.

Reaction mixes were analysed using an Applied Biosystems ABI 373 A sequencer.

Dye-Terminator Cycle Sequencing

In this method, only a single Dye-Terminator reaction is required for each DNA sample. Reactions were set-up using Applied Biosystems' Dye- Terminator Cycle Sequencing protocol. The cycling program used was 30 x 96°C for 30 s, 50°C for 15 s, 60°C for 4 min.

Computer-Aided Tools

The Wisconsin Package (GCG) v8.1-UNIX (Program Manual for the Wisconsin Package, Genetic Computer Group, 575 Science Drive, Madison, Wisconsin, WI 53711 , USA) and EGCG Extensions to the Wisconsin Package v8.1.0 (Program Manual for the EGCG Package, Peter Rice, The Sanger Centre, Hinxton Hall, Cambridge, CB10 1 RQ, England) were used to manipulate and analyse electronic data generated from sequencing experiments. GCG and EGCG packages were also accessed through the Australian National Genomic Information Service (http://www.angis.su.oz.au).

Results and Discussion

Isolation of Partial cDNA of . cuprina lipophorin Prior to the experiments described here, the inventors had attempted to isolate a L. cuprina lipophorin cDNA by expression cloning and by screening with degenerate primers and with riboprobes synthesised off Clone 14 (see below). It was only by using a highly specific and unique synthetic oligonucleotide that the inventors were able to obtain an entree to this gene. The N-terminal amino acid sequences of ApoLpn I and II were obtained experimentally as described in Trowell et al. (1994). Based on the amino acid sequence of ApoLpn I, a pair of degenerate PCR primers was designed to amplify the region of genomic DNA encoding amino acids 2-20 of ApoLpn I.

The sequence-specific portion of the forward primer was 5'-

AT(ACT)GC(ACGT)GA(CT)GA(CT)AC-3'. A synthetic tag with the concocted sequence (5'-CGCGGTGGAGC-3') was appended to the 5' end of this primer in order to raise the annealing temperature (the entire sequence has been designated SEQ ID NO:8).

The sequence-specific portion of the reverse primers was 5'- (GA)TT(TC)TT(TGCA)GC(TGCA)CC(AG)TA(TGCA)GT-3' with the synthetic tag 5'-CCTAGCCG-3' being appended to the 5' end for the reasons described above (the entire sequence has been designated SEQ ID NO:9).

Touchdown PCR was performed using these primers. The results indicated a diffuse hybridising band, consistent with amplification of a 57-mer. A portion of the PCR product was used as target in a further PCR amplification step using the same primers as specified above but with a conventional thermal cycle (95°C 1 min, 65°C 1 min, 72°C 1 min x 35). The PCR product was cloned, transformed into E. coli (JPA101) and sequenced, one clone (referred to herein as Clone 14) yielded the sequence ATAGCAGATGATACTTCAAAAGTAGCAAAAAAATATAAAACTTACGGCGCC AAAAAT (SEQ ID NO: 10), which encodes amino acids 2-20 of the N-terminus of ApoLpn I.

An oligonucleotide of this sequence was synthesised and purified and end-labeled with ³²P. It was then used to probe nitrocellulose lifts of a random- primed cDNA library of L cuprina (Library-1). From 120,000 plaques, a single hybridising clone (2.7kb) was recovered and purified.

Subsequent single-stranded sequencing revealed that this clone (Clone 19, also referred to herein as pLc19) contained the entire coding sequence for ApoLpn II plus a significant portion of the N-terminal part of ApoLpn I. The encoded features included: • some 5'untranslated sequence the initiatior methionine followed by an extensive open reading frame a predicted cleavable signal sequence followed by the N-terminal amino acid sequence of ApoLpn II an open reading frame consistent with a polypeptide of 70 kDa • a predicted dibasic peptidase cleavage site immediately upstream of the experimentally verified N-terminal amino acid sequence of ApoLpn I • approximately 400 bp of additional open reading frame.

Complete Characterization of the L. cuprina Lipophorin cDNA sequence

An 800 base-pair HincW fragment from the 3' end of clone pLc19 was used to initiate a cDNA walk. Three clones were isolated from Library-2 by three rounds of screening. Plasmids carrying the cDNA inserts were designated as pLc20, pLc24 and pLc25. Relationships between clones were confirmed by sequencing both ends of newly isolated clones, and aligning them with those previously characterised. These clones, together with clone pLd 9, provided 4.3 kb of the entire coding region.

Library-3 was also screened, using 3'-end sequence of clone pLc25 as a probe. cDNA fragments represented in this library were oligo-dT-primed and hence, any recovered clone was expected to carry the remaining 3' end of the pre-apolipophorin coding region. Clone pLc52 containing a cDNA insert of 5.2 kb was isolated first.

Deduced amino acid sequence of this cDNA was compared with that of pre- apolipophorin of D. melanogaster (Kutty et al, 1996). This revealed the presence of a 0.9 kb non-lipophorin fused sequence at the 3' end of clone pLc52. The genuine lipophorin sequence upstream of the fused area was used as a probe for another round of screening which eventually resulted in isolation of clone pLc60. The cDNA insert in the latter clone was 5.5 kb in size. This insert contained a poly-A tail region at its 3' end, located approximately 150 bp downstream of an AATAAA poly-A tail signal. The distance between the two consisted of a non-coding sequence. The deduced amino acid sequence from the C-terminus showed a level of identity to that of the cognate sequence from D. melanogaster. Namely, 79% identity (90% similarity) over the last 125 amino acids. On this basis, it was concluded that pLc60 cDNA contained the 3' end of the pre-apolipophorin coding region of L. cuprina.

The entire pre-apolipophorin cDNA of L. cuprina contained 10341 nucleotides (SEQ ID NO:11). The size of the L. cuprina mRNA was confirmed to be approximately 10.5 kb by Northern blot analysis (data not shown).

The ATG start codon was located at position 187-189, following a 5' non- coding region. The 3' end of the single 9999 bp ORF encoding both apolipophorins was flanked by the TAA stop codon at position 10186-10188. The stop codon was followed by a consensus AATAAA poly-adenylation signal located 126 bp upstream of the start of the poly-A tail. The cDNA of L cuprina contained a single continuous ORF that included regions corresponding to N-terminal sequences of experimentally purified apoLpn-l/ll. In addition, a putative cleavage site was detected immediately before the predicted N-terminus of apoLpn-l. The 9999 nucleotide ORF which encoded the pre-apolipophorin of L cuprina was notionally translated into a protein containing 3333 amino acids. The deduced pre-apolipophorin sequence contained a 31 amino acid signal peptide at its N-terminus.

Residues 703-706 of the L cuprina pre-apolipophorin, situated immediately before the experimentally determined N-terminus of apoLpn-l, comprised a four-residue sequence, RSRR, which represented a putative cleavage site for di-basic protease enzymes of subtilisin family (R-X-[KR]-R;

Steiner e a/., 1992).

ApoLpn-ll of L cuprina was found to consist of 675 amino acids, and have a predicted molecular size of 74,822 Da and a pi of 9.21.

ApoLpn-l, the larger sub-unit of lipophorin, consists of 2627 amino acids with a molecular mass of 293,675 Da and a predicted pi of 6.02.

Sequences Related to Lipophorin of L. cuprina The most closely related known protein to that of the present invention is the retinoid and fatty acid binding glycoprotein (RFABG, Kutty ef al, 1996), also known as pre-apolipophorin of D. melanogaster. The pre-lipophorin protein of L cuprina (SEQ ID NO:1) and D. melanogaster are 51 % identical, while at the nucleotide level (L cuprina - SEQ ID NO:4), the two sequences were 59%) identical. Apolipophorin-I of L. cuprina (SEQ ID NO: 2) and D. melanogaster are 50.3% identical, while at the nucleotide level (L. cuprina - SEQ ID NO:5), the two sequences were 58% identical. Apolipophorin-ll of L. cuprina (SEQ ID NO:3) and D. melanogaster are 61.3% identical, while at the nucleotide level (L cuprina - SEQ ID NO:4), the two sequences were 63% identical.

It will be appreciated by persons skilled in the art that numerous variations and/or modifications may be made to the invention as shown in the specific embodiments without departing from the spirit or scope of the invention as broadly described. The present embodiments are, therefore, to be considered in all respects as illustrative and not restrictive.

All publications discussed above are incorporated herein in their entirety. Any discussion of documents, acts, materials, devices, articles or the like which has been included in the present specification is solely for the purpose of providing a context for the present invention. It is not to be taken as an admission that any or all of these matters form part of the prior art base or were common general knowledge in the field relevant to the present invention as it existed, particularly in Australia, before the priority date of each claim of this application.

References

Cibelli J. B., Stice S. L, Golueke P. J., Kane J. J., Jerry J., Blackwell C, Ponce de Leon F. A. and Robl J. M. (1998) Science, 280, 1256-1258.

Coodin, S. and Caveney, S. (1992) J. Insect Physiol. 38, 853-862.

Daffre, S. and Faye, I. (1997) FEBS Letters. 408, 127-130.

de Kort C. A. D., Peter M. G. and Koopmanschap A. B. (1983) Insect Biochem. 13, 481-487.

Denlinger D. L. (1985) Hormonal control of diapause. In Comprehensive Insect Physiology, Biochemistry and Pharmacology: Endocrinology II. (Edited by Kerkut G. A. and Gilbert L. I.), Vol. 8, pp. 353-412. Pergamon Press, Oxford.

Digan, M. A., Roberts, D. N., Enderlin, F. E., Woodworth, A. R. and Kramer, S. J. (1992) Proc. Natl Acad. Sci. USA 89, 11074-11078.

Don, R. H., Cox, P. T., Wainwright, B. J., Baker, K. and Mattick, J. S. (1991) Nucl. Acids Res. 19, 14.

Dougherty, W.G. and Parks, T.D. (1995) Curr. Opin. Cell Biol. 7, 399-405.

Dunbrack, R.L, Jr, Gerioff, D.L., Bower, M., Chen, X., Lichtarge, O. and Cohen, F.E. (1997). Folding and Design, 2:R27-42.

Engelmann F., Mala J. and Borst D. (1988) Arch. Insect Biochem. Physiol. 8, 11-23.

Ferkovich S. M., Oberlander H. and Rutter R. R. (1977) J. Insect Physiol. 23, 297-302.

Goldstein, J.L., Brown, M.S., Anderson, R.G., Russell, D.W.and Schneider, W. J. (1985) Ann Rev Cell Biol 1 , 1 -39. Goodman W. G. (1990) Biosynthesis, titer regulation and transport of juvenile hormones. In Morphogenetic Hormones of Arthropods. Part 1 ; Discoveries, Syntheses, Metabolism, Evolution, Modes of Action, and Techniques Edited by Gupta A. P.), Vol. 1 , pp. 85-124 Rutgers University Press, New Brunswick, NJ.

Hanzlik, T.N., Abdel-Aal, Y.A., Harshman, L.G. and Hammock, B.D. (1989) J. Biol. Chem. 264, 12419-12425.

Hardie J. and Lees A. D. (1985) Endocrine control of polymorphism and polyphenism. In Comprehensive Insect Physiology, Biochemistry and Pharmacology: Endocrinology II. (Edited by Kerkut G. A. and Gilbert L. I.), Vol. 8, pp. 4471-490. Pergamon Press, Oxford.

Haseloff, J. and Gerlach, W.L. (1988) Nature 334, 585-591.

Kanost, M. R., Kawooya, J. K., Law, J. H., Ryan, R. O., Van Heusden, M. C. and Ziegler, R. (1990) Adv. Insect Physiol. 22, 299-396.

King L. E. and Tobe S. S. (1993) J. Insect Physio. 39, 241-251.

Koeppe J. K., Fuchs M., Chen T. T., Hunt L. M., Kovalick G. E. and Briers T. (1985) The role of juvenile hormone in reproduction. In Comprehensive Insect Physiology, Biochemistry and Pharmacology: Endocrinology II (Edited by Kerkut G. A. and Gilbert L. I.) Vol. 8 pp. 166-203. Pergamon Press, Oxford.

Kutty, R. K., Kutty, G., Kambadur, R., Duncan, T., Hoonin, E. V., Rodriguez, I. R., Odenwald, W. F. and Wiggert, B. (1996) J. Biol. Chem. 271 , 20641-20649.

Mandato, C.A., Diehl-Jones, W.L. and Downer, R.G.H. (1996) J. Insect Physiol. 42, 143-148.

Needleman, S.B. and Wunsch, CD. (1970) J. Mol. Biol. 48, 443-453.

Perriman, R., Delves, A. and Gerlach, W.L. (1992) Gene 113, 157-163. Peter M. G., Gunawan S., Gellissen G. and Emmerich H. (1979) Z Naturforsch. 34c, 588-598.

Sambrook J. et al., (1989) Molecular Cloning: A Laboratory Manual. T.A. Brown (editor). Cold Spring Harbour Laboratory Press.

Schnieke A. E., Kind A. J., Ritchie W. A., Mycock K., Scott A.R., Ritchie M., Wilmut I., Colman A. and Campbell K.H. (1997) Science 278, 2130-2133.

Shippy, R., Lockner, R., Farnsworth, M. and Hampel, A. (1999) Mol. Biotech. 12, 117-129.

Steiner, D. F., Smeekens, S. P., Ohagi, S. and Chan, S.J. (1992) J. Biol. Chem. 267, 23435-23438.

Szolajska E. (1991) Acta Biochem. Polon. 38, 321-333.

Trowell S. C. (1992) Comp. Biochem. Physiol. 103B, 795-807.

Trowell S. C, Hines, E. R., Herlt, A. J. and Rickards, R. W. (1994) Comp. Biochem. Physiol. 109B, 339-357.

Van der Horst, D. J., Weers, P. M. M. and Van Marrewijk, W. J. A. (1993). Lipoproteins and Lipid Transport, in Stanley-Sammuelson, D.W. and Nelson, D.R. (eds). Insect Lipids: Chemistry, Biochemistry and Biology. University of Nebraska Press, Lincoln, 1-24.

Waterhouse, P.M., Graham, M.W., and Wang, M.-B. (1998) Proc. Natl. Acad. Sci. 95, 13959-13964.

Weers, P. M. M., Van Marrewijk, W. J. A., Beenakkers, A. M. T. and Van der Horst, D. J. (1993) J. Biol Chem. 268, 4300-4303.

Claims

CLAIMS:

1. An isolated polynucleotide, the polynucleotide comprising a sequence selected from: i) a sequence of nucleotides shown in SEQ ID NO:4; ii) a sequence encoding a polypeptide as shown in SEQ ID NO:1 ; iii) a sequence capable of selectively hybridizing to i) or ii) under high stringency; and iv) a sequence of nucleotides which is greater than 80% identical to i) or ii).

2. An isolated polynucleotide, the polynucleotide comprising a sequence selected from: i) a sequence of nucleotides shown in SEQ ID NO:5; ii) a sequence encoding a polypeptide as shown in SEQ ID NO:2; iii) a sequence capable of selectively hybridizing to i) or ii) under high stringency; and iv) a sequence of nucleotides which is greater than 80% identical to i) or ii).

3. An isolated polynucleotide, the polynucleotide comprising a sequence selected from: i) a sequence of nucleotides shown in SEQ ID NO:6; ii) a sequence encoding a polypeptide as shown in SEQ ID NO:3; iii) a sequence capable of selectively hybridizing to i) or ii) under high stringency; and iv) a sequence of nucleotides which is greater than 80% identical to i) or ii).

4. The polynucleotide of claim 1 which encodes a polypeptide precursor, wherein the precursor can be proteolytically cleaved to produce a polypeptide encoded by the polynucleotide of claim 2 and a polypeptide encoded by the polynucleotide of claim 3.

5. The polynucleotide according to any one of claims 1 to 4, wherein the polypeptide encoded by the polynucleotide is capable of binding at least one hydrophobic molecule.

6. The polynucleotide of claim 5, wherein the hydrophobic molecule is a lipid.

7. The polynucleotide of claim 6, wherein the lipid is a free fatty acid.

8. The polynucleotide of claim 7, wherein the free fatty acid is either di-acyl or tri-acyl glycerol.

9. The polynucleotide of claim 5, wherein the hydrophobic molecule is a juvenile hormone.

10. The polynucleotide according to any one of claims 1 to 9, wherein the polynucleotide encodes a polypeptide which has a biological activity which plays a role in a physiological process selected from the group consisting of: hydrophobic molecule binding, haemolymph clotting, an immune response, oogenesis, vision and juvenile hormone transport.

11. The polynucleotide according to any one of claims 1 to 10 which is isolated from a Dipteran.

12. The polynucleotide of claim 11 , wherein the Dipteran is a Lucilia sp.

13. The polynucleotide according to any one of claims 1 to 12 which comprises a sequence that is at least 95% identical to SEQ ID NO's:4, 5 or 6.

14. A process for producing a polypeptide, the process comprising cultivating a host cell expressing a polynucleotide according to any one of claims 1 to 13 under conditions providing for production of a polypeptide encoded by the polynucleotide, and recovering the expressed polypeptide.

15. A polypeptide produced by a process according to claim 14.

16. A crystal of a polypeptide encoded by a polynucleotide according to claim 2 or claim 3.

17. A crystal of a polypeptide according to claim 15.

18. A substantially purified heterodimer formed between a polypeptide encoded by a polynucleotide of claim 2 and a polypeptide encoded by a polynucleotide of claim 3.

19. The heterodimer of claim 18, produced by a method comprising i) expressing a polynucleotide according to claim 1 in a host cell comprising the polynucleotide to produce a precursor polypeptide, ii) cleaving the precursor polypeptide to produce a polypeptide that is at least 80% identical to SEQ ID NO:2 and a polypeptide that is at least 80% identical to SEQ ID NO:3 which associate to form the heterodimer.

20. The heterodimer of claim 18, produced by a method comprising i) expressing a polynucleotide according to claim 2 and a polynucleotide according to claim 3 in a host cell comprising the polynucleotides to produce two polypeptide subunits, ii) allowing the two subunits to associate to form the heterodimer.

21. A crystal of a heterodimer according to any one of claims 18 to 20.

22. A method of identifying an arthropod control agent, the method comprising i) exposing a heterodimer according to any one of claims 18 to 20 to a binding partner which binds the heterodimer, and a candidate agent, and ii) assessing the ability of the candidate agent to compete with the binding partner for binding to the heterodimer.

23. The method of claim 22, wherein the binding partner is detectably labelled.

24. The method of claim 22 or claim 23, wherein the binding partner is juvenile hormone.

25. A method of identifying an arthropod control agent, the method comprising i) exposing a heterodimer according to any one of claims 18 to 20 to a candidate agent, and ii) assessing the ability of the candidate agent to modulate at least one biological activity of the heterodimer.

26. A method of identifying an arthropod control agent, the method comprising i) determining the atomic coordinates defining the three-dimensional structure of a heterodimer according to any one of claims 18 to 20; ii) selecting a candidate agent by performing rational drug design with the atomic coordinates obtained in step (a), wherein said selecting is performed in conjunction with computer modelling; and iii) determining the ability of the candidate agent to modulate at least one biological activity of the heterodimer.

27. A method of selecting or designing an arthropod control agent comprising using the structural coordinates of a crystal of claim 21 to computationally evaluate a compound for its ability to modulate at least one biological activity of the heterodimer.

28. The method according to any one of claims 25 to 27, wherein the at least one biological activity plays a role in a physiological process selected from the group consisting of: hydrophobic molecule binding, haemolymph clotting, an immune response, oogenesis, vision and juvenile hormone binding.

29. The method of claim 28, wherein the hydrophobic molecule is a free fatty acid.

30. A method of identifying an arthropod control agent, the method comprising i) exposing a polypeptide encoded by a polynucleotide of claim 2 and/or a polypeptide encoded by a polynucleotide of claim 3 to a candidate agent, and ii) assessing the ability of the candidate agent to disrupt, and/or inhibit the formation of, a heterodimer of the polypeptide encoded by a polynucleotide of claim 2 and the polypeptide encoded by a polynucleotide of claim 3.

31. A method of identifying an arthropod control agent, the method comprising i) determining the atomic coordinates defining the three-dimensional structure of a polypeptide encoded by a polynucleotide according to claim 2 or claim 3; ii) selecting a candidate agent by performing rational drug design with the atomic coordinates obtained in step (a), wherein said selecting is performed in conjunction with computer modelling; and iii) assessing the ability of the candidate agent to disrupt, and/or inhibit the formation of, a heterodimer of the polypeptide encoded by a polynucleotide of claim 2 and the polypeptide encoded by a polynucleotide of claim 3.

32. The method of claim 30 or claim 31 , wherein the method further comprises expressing a polynucleotide according to claim 2 and a polynucleotide according to claim 3 in a host cell comprising the polynucleotides.

33. A method of selecting or designing an arthropod control agent comprising using the structural coordinates of a crystal of claim 16 or claim 17 to computationally evaluate a compound for its ability to disrupt, and/or inhibit the formation of, a heterodimer of a polypeptide encoded by a polynucleotide of claim 2 and a polypeptide encoded by a polynucleotide of claim 3.

34. The method according to any one of claims 22 to 33, wherein the heterodimer is associated with at least one lipid.

35. The method of claim 34, wherein the lipid is a free fatty acid.

36. The method of claim 35, wherein the free fatty acid is either di-acyl or tri- acyl glycerol.

37. A method of identifying an arthropod control agent, the method comprising i) exposing a polynucleotide according to any one of claims 1 to 13 to a candidate agent under conditions which allows expression of the polynucleotide, and ii) assessing the ability of the candidate agent to modulate levels of polypeptide produced by the polynucleotide.

38. The method of claim 37, wherein the agent inhibits production of the polypeptide.

39. The method of claim 37 or claim 38, wherein the agent is a dsRNA.

40. A method of identifying an arthropod control agent, the method comprising i) exposing a polynucleotide according to any one of claims 1 to 13 to a candidate agent, and ii) assessing the ability of the candidate agent to hybridize and/or cleave the polynucleotide.

41. An arthropod control agent identified by a method according to any one of claims 22 to 40.

42. An antisense polynucleotide which hybridizes under high stringency conditions to a polynucleotide according to any one of claims 1 to 13.

43. The antisense polynucleotide of claim 42, which comprises a catalytic domain.

44. A double stranded RNA (dsRNA) molecule comprising a polynucleotide according to any one of claims 1 to 13.

45. The dsRNA molecule of claim 44, wherein the dsRNA is encoded by a single open reading frame and the resulting dsRNA molecule has a stem loop structure at one end of the molecule.

46. A fusion protein comprising a polypeptide encoded by a polynucleotide according to any one of claims 1 to 13 fused to at least one other polypeptide sequence.

47. An isolated polynucleotide that encodes a fusion protein of claim 46.

48. A vector comprising a polynucleotide according to any one of claims 1 to 13 or claim 47.

49. The vector of claim 48, wherein the polynucleotide is operably linked to a promoter.

50. A vector comprising an antisense polynucleotide according to claim 42 or claim 43.

51. The vector of claim 50, wherein the antisense polynucleotide is operably linked to a promoter.

52. A vector comprising a polynucleotide(s) which upon expression forms a dsRNA molecule according to claim 44 or claim 45.

53. The vector of claim 52, wherein the polynucleotide(s) is operably linked to a promoter.

54. The vector according to any one of claims 48 to 53, wherein the vector is a plasmid or a virus.

55. The vector of claim 54, wherein the viral vector is a baculovirus.

56. The vector according to any one of claims 48 to 53, wherein the vector is a capsoid vector.

57. A host cell comprising a vector according to any one of claims 48 to 56.

58. The host cell of claim 57 which a bacterial cell.

59. The host cell of claim 57 which is an arthropod cell.

60. The host cell of claim 57 which is an insect cell.

61. A substantially purified polypeptide, the polypeptide being selected from: i) a polypeptide comprising a sequence provided in SEQ ID NO:1; or ii) a polypeptide comprising a sequence which is greater than 80% identical to (i).

62. A substantially purified polypeptide, the polypeptide being selected from: i) a polypeptide comprising a sequence provided in SEQ ID NO:2; or ii) a polypeptide comprising a sequence which is greater than 80% identical to (i).

63. A substantially purified polypeptide, the polypeptide being selected from: i) a polypeptide comprising a sequence provided in SEQ ID NO:3; or ii) a polypeptide comprising a sequence which is greater than 90% identical to (i).

64. The polypeptide of claim 61 which is a polypeptide precursor, wherein the precursor can be proteolytically cleaved to produce the polypeptide of claim 62 and the polypeptide of claim 63.

65. The polypeptide according to any one of claims 61 to 64 which comprises a sequence that is at least 95% identical to SEQ ID NO's:1 , 2 or 3.

66. A transgenic plant, the plant comprising a polynucleotide according to any one of claims 1 to 13 or claim 47, wherein the plant expresses the polynucleotide.

67. A transgenic plant, the plant comprising an antisense polynucleotide according to claim 42 or claim 43, wherein the plant expresses the antisense polynucleotide.

68. A transgenic plant, the plant comprising a polynucleotide(s) which, upon expression, form a dsRNA molecule according to claim 44 or claim 45, wherein the plant produces the dsRNA molecule.

69. A transgenic non-human animal, the animal comprising a polynucleotide according to any one of claims 1 to 13 or claim 47, wherein the animal expresses the polynucleotide.

70. A transgenic non-human animal, the animal comprising an antisense polynucleotide according to claim 42 or claim 43, wherein the animal expresses the antisense polynucleotide.

71. A transgenic non-human animal, the animal comprising a polynucleotide(s) which, upon expression, forms a dsRNA molecule according to claim 44 or claim 45, wherein the animal produces the dsRNA molecule.

72. An arthropod control composition, the composition comprising an arthropod control agent identified by a method according to any one of claims 22 to 40, and an agriculturally acceptable carrier.

73. An arthropod control composition, the composition comprising a polypeptide according to any one of claims 61 to 65, and an agriculturally acceptable carrier.

74. An arthropod control composition, the composition comprising a vector according to any one of claims 48 to 56, and an agriculturally acceptable carrier.

75. A method of controlling an arthropod population, the method comprising exposing members of the arthropod population to an arthropod control composition according to any one of claims 72 to 74.

76. The method of claim 75, wherein the arthropod is an insect.

77. A kit for identifying an arthropod control agent, the kit comprising at least one polynucleotide according to any one of claims 1 to 13.

78. A kit for identifying an arthropod control agent, the kit comprising polypeptides according to claim 62 and claim 63.

79. The kit of claim 78, further comprising means for determining the extent which a candidate agent modulates at least one biological activity of a heterodimer formed between the polypeptide of claim 62 and the polypeptide of claim 63.

80. The kit of claim 78, further comprising means for determining the extent which a candidate agent disrupts, and/or inhibits the formation of, a heterodimer between the polypeptide of claim 62 and the polypeptide of claim 63.