WO2003014330A2 - Coryneform bacteria which produce chemical compounds ii - Google Patents

Coryneform bacteria which produce chemical compounds ii Download PDF

Info

Publication number
WO2003014330A2
WO2003014330A2 PCT/EP2002/008465 EP0208465W WO03014330A2 WO 2003014330 A2 WO2003014330 A2 WO 2003014330A2 EP 0208465 W EP0208465 W EP 0208465W WO 03014330 A2 WO03014330 A2 WO 03014330A2
Authority
WO
WIPO (PCT)
Prior art keywords
gene
nucleotide sequence
allele
lysine
orf
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2002/008465
Other languages
French (fr)
Other versions
WO2003014330A3 (en
Inventor
Brigitte Bathe
Caroline Reynen
Bettina Möckel
Georg Thierbach
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Evonik Operations GmbH
Original Assignee
Degussa GmbH
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to CA002456416A priority Critical patent/CA2456416A1/en
Application filed by Degussa GmbH filed Critical Degussa GmbH
Priority to EP02751164A priority patent/EP1414986B1/en
Priority to DE60229139T priority patent/DE60229139D1/en
Priority to BR0211745-2A priority patent/BR0211745A/en
Priority to KR1020047001926A priority patent/KR100943834B1/en
Priority to DK02751164T priority patent/DK1414986T3/en
Priority to AU2002355462A priority patent/AU2002355462A1/en
Priority to US10/358,393 priority patent/US20040043458A1/en
Publication of WO2003014330A2 publication Critical patent/WO2003014330A2/en
Publication of WO2003014330A3 publication Critical patent/WO2003014330A3/en
Anticipated expiration legal-status Critical
Priority to US12/553,647 priority patent/US20100255544A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00Preparation of nitrogen-containing organic compounds
    • C12P13/04Alpha- or beta- amino acids
    • C12P13/08Lysine; Diaminopimelic acid; Threonine; Valine
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20Bacteria; Culture media therefor

Definitions

  • Chemical compounds which means, in particular, L-amino acids, vitamins, nucleosides and nucleotides and D-amino acids, are used in human medicine, in the pharmaceuticals industry, in cosmetics, in the foodstuffs industry and in animal nutrition.
  • Improvements to the process can relate to fermentation measures, such as, for example, stirring and supply of oxygen, or the composition of the nutrient media, such as, for example, the sugar concentration during the fermentation, or the working up to the product form by, for example, ion exchange chromatography, or the intrinsic output properties of the microorganism itself.
  • Methods of mutagenesis, selection and mutant selection are used to improve the output properties of these microorganisms. Strains which are resistant to antimetabolites or are auxotrophic for metabolites of regulatory importance and which produce the particular compounds are obtained in this manner.
  • Methods of the recombinant DNA technique have also been employed for some years for improving the strain of Corynebacterium strains, by amplifying individual biosynthesis genes and investigating the effect on production.
  • a common method comprises amplification of certain biosynthesis genes in the particular microorganism by means of episomally replicating plasmids. This procedure has the disadvantage that during the fermentation, which in industrial processes is in general associated with numerous generations, the plasmids are lost spontaneously (segregational instability) .
  • Another method comprises duplicating certain biosynthesis genes by means of plasmids which do not replicate in the particular microorganism.
  • the plasmid including the cloned biosynthesis gene, is integrated into the chromosomal biosynthesis gene of the microorganism (Reinscheid et al . , Applied and Environmental Microbiology 60(1), 126-132 (1994); Jetten et al . , Applied Microbiology and Biotechnology 43(1) -.76-82 (1995)).
  • a disadvantage of this method is that the nucleotide sequences of the plasmid and of the antibiotic resistance gene necessary for the selection remain in the microorganism. This is a disadvantage, for example, for the disposal and utilization of the biomass .
  • the expert expects such strains to be unstable as a result of disintegration by "Campbell type cross over" in a corresponding number of generations such as are usual in industrial fermentations.
  • the inventors had the object of providing new measures for improved fermentative preparation of chemical compounds using coryneform bacteria.
  • the invention provides coryneform bacteria, in particular of the genus Corynebacterium, which produce one or more desired chemical compounds, characterized in that
  • b) optionally have at least a third copy of the open reading frame (ORF) , gene or allele in question at a further gene site, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the further gene site.
  • ORF open reading frame
  • the invention also provides processes for the preparation of one or more chemical compounds, which comprise the following steps :
  • ii) optionally have at least a third copy of the said open reading frame (ORF) , gene or allele at a further gene site, no nucieotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the further gene site,
  • ORF open reading frame
  • ORFs open reading frames
  • Chemical compounds are to be understood, in particular, as meaning amino acids, vitamins, nucleosides and nucleotides.
  • the biosynthesis pathways of these compounds are known and are available in the prior art.
  • Amino acids mean, preferably, L-amino acids, in particular the proteinogenic L-amino acids, chosen from the group consisting of L-aspartic acid, L-asparagine, L-threonine, L-serine, L-glutamic acid, L-glutamine, glycine, L-alanine, L-cysteine, L-valine, L-methionine, L-isoleucine, L- leucine, L-tyrosine, L-phenylalanine, L-histidine, L- lysine, L-tryptophan, L-proline and L-arginine and salts thereof, in particular L-lysine, L-methionine and L- threonine. L-Lysine is very particularly preferred.
  • Proteinogenic amino acids are understood as meaning the amino acids which occur in natural proteins, that is to say in proteins of microorganisms, plants, animals and humans.
  • Vitamins mean, in particular, vitamin Bl (thia ine) , vitamin B2 (riboflavin) , vitamin B5 (pantothenic acid) , vitamin B6 (pyridoxines) , vitamin B12 (cyanocobalamin) , nicotinic acid/nicotinamide, vitamin M (folic acid) and vitamin E (tocopherol) and salts thereof, pantothenic acid being preferred.
  • Nucleosides and nucleotides mean, inter alia, S-adenosyl- methionine, inosine-5 ' -monophosphoric acid and guanosine- 5 ' -monophosphoric acid and salts thereof.
  • the coryneform bacteria are, in particular, those of the genus Corynebacterium.
  • the species Corynebacterium glutamicum, Corynebacterium ammoniagenes and Corynebacterium thermoaminogenes are preferred.
  • Information on the taxonomic classification of strains of this group of bacteria is to be found, inter alia, in Kampfer and Kroppenstedt (Canadian Journal of Microbiology 42, 989-1005 (1996)) and in US-A-5, 250, 434.
  • Suitable strains of the species Corynebacterium glutamicum are, in particular, the known wild-type strains
  • Suitable strains of the species Corynebacterium ammoniagenes are, in particular, the known wild-type strains
  • Suitable strains of the species Corynebacterium thermoaminogenes are, in particular, the known wild-type strains
  • thermoaminogenes FERM BP-1539 Corynebacterium thermoaminogenes FERM BP-1540 Corynebacterium thermoaminogenes FERM BP-1541 and Corynebacterium thermoaminogenes FERM BP-1542
  • Strains with the designation "ATCC” can be obtained from the American Type Culture Collection (Manassas, VA, USA) . Strains with the designation “FERM” can be obtained from the National Institute of Advanced Industrial Science and Technology (AIST Tsukuba Central 6, 1-1-1 Higashi, Tsukuba Ibaraki, Japan) . The strains of Corynebacterium thermoaminogenes mentioned (FERM BP-1539, FERM BP-1540, FERM BP-1541 and FERM BP-1542) are described in US-A 5,250,434. Open reading frame (ORF) describes a section of a nucleotide sequence which codes or can code for a protein or polypeptide or ribonucleic acid to which no function can be assigned according to the prior art.
  • ORF Open reading frame
  • Alieles are in general understood as meaning alternative forms of a given gene. The forms are distinguished by differences in the nucleotide sequence.
  • endogenous that is to say species-characteristic, open reading frames, genes or alieles are preferably used. These are understood as meaning the open reading frames, genes or alieles or nucleotide sequences thereof present in the population of a species, such as, for example, Corynebacterium glutamicum.
  • a "singular copy of an open reading frame (ORF) , gene or allele naturally present at the particular desired site (locus) is understood as meaning the circumstances that a gene in general naturally occurs in one (1) copy in the form of its nucleotide sequence at its site or gene site in the corresponding wild-type or corresponding parent organism or starting organism. This site is preferably in the chromosome.
  • the lysC gene or an lysC FBR allele which codes for a "feed back" resistant aspartate kinase is present in one copy at the lysC site or lysC locus or lysC gene site and is flanked by the open reading frame orfX and the leuA gene on one side and by the asd gene on the other side.
  • “Feed back” resistant aspartokinases are understood as meaning aspartokinases which, compared with the wild-type form, have a lower sensitivity to inhibition by mixtures of lysine and threonine or mixtures of AEC
  • nucleotide sequence of the chromosome of Corynebacterium glutamicum is known and can be found in the patent application EP-A-1108790 and Access Number (Accession No.) AX114121 of the nucleotide sequence databank of the European Molecular Biologies Laboratories (EMBL, Heidelberg, Germany and Cambridge, UK) .
  • the nucleotide sequences of orfX, the leuA gene and the asd gene have the Access Numbers AX120364 (orfX) , AX123517 (leuA) and AX123519 (asd) .
  • tandem arrangement of two or more copies of an open reading frame (ORF) , gene or allele is referred to if these are arranged in a row directly adjacent in the same orientation.
  • a further gene site is understood as meaning a second gene site, the nucleotide sequence of which is different from the sequence of the ORF, gene or allele which has been at least duplicated at the natural site.
  • This further gene site, or the nucleotide sequence present at the further gene site is preferably in the chromosome and is in general not essential for growth and for production of the desired chemical compounds .
  • the "further gene sites” mentioned include, of course, not only the coding regions of the open reading frames or genes mentioned, but also the regions or nucleotide sequences lying upstream which are responsible for expression and regulation, such as, for example, ribosome binding sites, promoters, binding sites for regulatory proteins, binding sites for regulatory ribonucleic acids and attenuators.
  • regions in general lie in a range of 1-800, 1-600, 1- 400, 1-200, 1-100 or 1-50 nucleotides upstream of the coding region.
  • regions lying downstream such as, for example, transcription terminators, are also included.
  • regions in general lie in a range of 1-400, 1-200, 1-100, 1-50 or 1-25 nucleotides downstream of the coding region.
  • Intergenic regions in the chromosome that is to say nucleotide sequences without a coding function, can furthermore be used.
  • prophages or defective phages contained in the chromosome can be used for this .
  • a prophage is understood as meaning a bacteriophage, in particular the genome thereof, where this is replicated together with the genome of the host and the formation of infectious particles does not take place.
  • a defective phage is understood as meaning a prophage, in particular the genome thereof, which, as a result of various mutations, has lost the ability to form so-called infectious particles.
  • Defective phages are also called cryptic. Prophages and defective phages are often present in integrated form in the chromosome of their host. Further details exist in the prior art, for example in the textbook by Edward A. Birge (Bacterial and Bacteriophage Genetics, 3 rd ed. , Springer-Verlag, New York, USA, 1994) or in the textbook by S. Klaus et al . (Bakterienviren, Gustav Fischer Verlag, Jena, Germany, 1992) .
  • the nucleotide sequence of the desired ORF, gene or allele preferably including the expression and/or regulation signals, is isolated, at least two copies are arranged in a row, preferably in tandem arrangement, these are then transferred into the desired coryneform bacterium, preferably with the aid of vectors which do not replicate or replicate to only a limited extent in coryneform bacteria, and those bacteria in which two copies of the ORF, gene or allele are incorporated at the particular desired natural site instead of the singular copy originally present are isolated, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics remaining at the particular natural site (locus) .
  • the expression and/or regulation signals mentioned are in general in a range of 1-800, 1-600, 1-400, 1-200, 1-100 or 1-50 nucleotides upstream of the coding region.
  • the expression and/or regulation signals mentioned, such as, for example, the transcription terminators lying downstream of the coding region of the ORF, gene or allele, are in general in a range of 1-400, 1-200, 1-100, 1-50 or 1-25 nucleotides downstream of the coding region.
  • no residues of sequences of the vectors used or species-foreign DNA such as, for example, restriction cleavage sites, remain on the flanks of the ORFs, genes or alieles amplified according to the invention.
  • a maximum of 24, preferably a maximum of 12 , particularly preferably a maximum of 6 nucleotides of such DNA optionally remain on the flanks.
  • At least a third copy of the open reading frame (ORF) , gene or allele in question is optionally inserted at a further gene site, or several further gene sites, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the further gene site.
  • ORF open reading frame
  • no residues of sequences of the vectors used or species-foreign DNA such as, for example, restriction cleavage sites, remain at the further gene site.
  • a maximum of 24, preferably a maximum of 12, particularly preferably a maximum of 6 nucleotides of such DNA upstream or downstream of the ORF, gene or allele incorporated optionally remain at the further gene site.
  • the invention accordingly also provides a process for the production of coryneform bacteria which produce one or more chemical compounds, characterized in that
  • nucleotide sequence of a desired ORF, gene or allele preferably including the expression and/or regulation signals
  • nucleotide sequence obtained according to b) is incorporated in a vector which does not replicate or replicates to only a limited extent in coryneform bacteria
  • nucleotide sequence according to b) or c) is transferred into coryneform bacteria
  • coryneform bacteria which have at least two copies of the desired ORF, gene or allele at the particular desired natural site instead of the singular copy of the ORF, gene or allele originally present are isolated, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics remaining at the particular natural site (locus), and
  • the productivity of the coryneform bacteria or of the fermentative processes for the preparation of chemical compounds is improved in respect of one or more of the features chosen from the group consisting of concentration (chemical compound formed, based on the unit volume) , yield (chemical compound formed, based on the source of carbon consumed) and product formation rate (chemical compound formed, based on the time) by at least 0.5 - 1.0% or at least 1.0 to 1.5% or at least 1.5 - 2.0%.
  • Vectors which replicate to only a limited extent are understood as meaning plasmid vectors which, as a function of the conditions under which the host or carrier is cultured, replicate or do not replicate.
  • a temperature-sensitive plasmid for coryneform bacteria which can replicate only at temperatures below 31 -C has been described by Nakamura et al . (US-A-6, 303 , 383 ) .
  • the invention also provides coryneform bacteria, in particular of the genus Corynebacterium, which produce L- lysine, characterized in that
  • locus these have at least two copies of the said open reading frame (ORF) , gene or allele, preferably in tandem arrangement, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the particular site, and in that these
  • the invention also furthermore provides a process for the preparation of L-lysine, which comprises the following steps :
  • ii) optionally have at least a third copy of the open reading frame (ORF) , gene or allele of L-lysine production in question at a further gene site, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the further gene site,
  • ORF open reading frame
  • ORFs open reading frames
  • a "copy of an open reading frame (ORF) , gene or allele of lysine production” is to be understood as meaning all the, preferably endogenous , open reading frames , genes or alieles of which enhancement/over-expression can have the effect of improving lysine production. Enhancement is understood as meaning an increase in the intracellular concentration or activity of the particular gene product, protein or enzyme.
  • genes or alieles include, inter alia, the following open reading frames, genes or alieles: accBC, accDA, cstA, cysD, cysE, cysH, cysK, cysN, cysQ, dapA, dapB, dapC, dapD, dapE, dapF, ddh, dps, eno, gap, gap2 , gdh, gnd, lysC, lysC FBR , lysE, msiK, opcA, oxyR, ppc, ppc FBR , pgk, pknA, pknB, pknD, pknG, ppsA, ptsH, ptsl, ptsM, pyc, pyc P458S, sigC, sigD, sigE, sigH
  • lysC FBR alieles which code for a "feed back" resistant aspartate kinase.
  • Various lysC FBR alieles are summarized and are explained in Table 2.
  • lysC FBR alieles are preferred: lysC A279T
  • the lysC FBR allele lysC T311I replacement of threonine at position 311 of the aspartate kinase protein coded, according to SEQ ID NO: 2, by isoleucine
  • the nucleotide sequence of which is shown as SEQ ID NO: 3 is particularly preferred; the amino acid sequence of the aspartate kinase protein coded is shown as SEQ ID NO : 4.
  • genes or nucleotide sequences can be used as the "further gene site" which is not essential for growth or lysine production: aecD, ccpAl , ccpA2 , citA, citB, citE, fda, gluA, gluB, gluC, gluD, luxR, luxS, lysRl, lysR2 , lysR3 , menE, mqo, pck, pgi, poxB and zwa2 , in particular the genes aecD, gluA, gluB, gluC, gluD and pck.
  • Table 3 Intergenic regions in the chromosome, that is to say nucleotide sequences without a coding function, can furthermore be used.
  • prophages or defective phages contained in the chromosome can be used. Table 1
  • the invention accordingly also provides a process for the production of coryneform bacteria which produce L-lysine, characterized in that
  • nucleotide sequence of a desired ORF, gene or allele of lysine production, optionally including the expression and/or regulation signals, is isolated
  • nucleotide sequence obtained according to b) is incorporated in a vector which does not replicate or replicates to only a limited extent in coryneform bacteria,
  • nucleotide sequence according to b) or c) is transferred into coryneform bacteria
  • coryneform bacteria which have at least two copies of the desired ORF, gene or allele of lysine production at the particular desired natural site instead of the singular copy of the ORF, gene or allele originally present are isolated, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics remaining at the particular natural site (locus), and optionally
  • the invention also provides coryneform bacteria, in particular of the genus Corynebacterium, which produce L- methionine and/or L-threonine, characterized in that
  • b) optionally have at least a third copy of the open reading frame (ORF) , gene or allele of methionine production or threonine production mentioned at a further gene site, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the further gene site.
  • ORF open reading frame
  • the invention also furthermore provides a process for the preparation of L-methionine and/or L-threonine, which comprises the following steps:
  • an open reading frame (ORF) instead of the singular copy of an open reading frame (ORF) , gene or allele of methionine production or threonine production present at the particular desired site (locus) , have at least two copies of the open reading frame (ORF) , gene or allele in question, preferably in tandem arrangement, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the particular site, and
  • ii) optionally have at least a third copy of the open reading frame (ORF) , gene or allele of methionine production or threonine production in question at a further gene site, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the further gene site,
  • ORF open reading frame
  • ORFs open reading frames
  • a "copy of an open reading frame (ORF) , gene or allele of methionine production” is to be understood as meaning all the, preferably endogenous, open reading frames, genes or alieles of which enhancement/over-expression can have the effect of improving methionine production.
  • genes or alieles include, inter alia, the following open reading frames, genes or alieles: accBC, accDA, aecD, cstA, cysD, cysE, cysH, cysK, cysN, cysQ, dps, eno, fda, gap, gap2 , gdh, gnd, glyA, horn, hom FBR , lysC, lysC FBR , metA, metB, metE, metH, metY, msiK, opcA, oxyR, ppc, ppc FBR , pgk, pknA, pknB, pknD, pknG, ppsA, ptsH, ptsl, ptsM, pyc, pyc P458S, sigC, sigD,
  • the at least third, optionally fourth or fifth copy of the open reading frame (ORF) , gene or allele of methionine production in question can be integrated at a further site.
  • the following open reading frames, genes or nucleotide sequences, inter alia, can be used for this: brnE, brnF, brnQ, ccpAl, ccpA2 , citA, citB, citE, ddh, gluA, gluB, gluC, gluD, luxR, luxS, lysRl, lysR2 , lysR3 , menE, metD, metK, pck, pgi, poxB and zwa2.
  • Intergenic regions in the chromosome that is to say nucleotide sequences without a coding function, can furthermore be used.
  • prophages or defective phages contained in the chromosome can be used for this .
  • a "copy of an open reading frame (ORF) , gene or allele of threonine production” is to be understood as meaning all the, preferably endogenous, open reading frames, genes or alieles of which enhancement/over-expression can have the effect of improving threonine production.
  • genes or alieles include, inter alia, the following open reading frames, genes or alieles: accBC, accDA, cstA, cysD, cysE, cysH, cysI, cysN, cysQ, dps, eno, fda, gap, gap2, gdh, gnd, horn, hom FBR , lysC, lysC FBR , msiK, opcA, oxyR, ppc, ppc FBR , pgk, pknA, pknB, pknD, pknG, ppsA, ptsH, ptsl, ptsM, pyc, pyc P458S, sigC, sigD, sigE, sigH, sigM, tal, thyA, tkt, tpi
  • the at least third, optionally fourth or fifth copy of the open reading frame (ORF) , gene or allele of threonine production in question can be integrated at a site.
  • the following open reading frames, genes or nucleotide sequences, inter alia, can be used for this: ccpAl, ccpA2 , citA, citB, citE, ddh, gluA, gluB, gluC, gluD, glyA, ilvA, ilvBN, ilvC, ilvD, luxR, luxS, lysRl, lysR2 , lysR3 , mdh, menE, etA, metD, pck, poxB, sigB and zwa2.
  • the invention accordingly also provides a process for the production of coryneform bacteria which produce - methionine and/or L-threonine, characterized in that
  • nucleotide sequence of a desired ORF, gene or allele of methionine production or threonine production, optionally including the expression and/or regulation signals, is isolated
  • nucleotide sequence obtained according to b) is incorporated in a vector which does not replicate or replicates to only a limited extent in coryneform bacteria
  • nucleotide sequence according to b) or c) is transferred into coryneform bacteria
  • coryneform bacteria which have at least two copies of the desired ORF, gene or allele of methionine or threonine production at the particular desired natural site instead of the singular copy of the ORF, gene or allele originally present are isolated, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics remaining at the particular natural site (locus) , and optionally
  • the invention also provides coryneform bacteria, in particular of the genus Corynebacterium, which produce L- valine, characterized in that
  • b) optionally have at least a third copy of the open reading frame (ORF) , gene or allele of valine production mentioned at a further gene site, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the further gene site.
  • ORF open reading frame
  • the invention also furthermore provides a process for the preparation of L-valine, which comprises the following steps : a) fermentation of coryneform bacteria, in particular of the genus Corynebacterium, which
  • an open reading frame (ORF) instead of the singular copy of an open reading frame (ORF) , gene or allele of valine production present at the particular desired site (locus) , have at least two copies of the open reading frame (ORF) , gene or allele in question, preferably in tandem arrangement, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the particular site, and
  • ii) optionally have at least a third copy of the open reading frame (ORF) , gene or allele of valine production in question at a further gene site, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the further gene site,
  • ORF open reading frame
  • ORFs open reading frames
  • a "copy of an open reading frame (ORF) , gene or allele of valine production” is to be understood as meaning all the, preferably endogenous, open reading frames, genes or alieles of which enhancement/over-expression can have the effect of improving valine production.
  • genes or alieles include, inter alia, the following open reading frames, genes or alieles: brnE, brnF, brnEF, cstA, cysD, dps, eno, fda, gap, gap2, gdh, ilvB, ilvN, ilvBN, ilvC, ilvD, ilvE msiK, pgk, ptsH, ptsl, ptsM, sigC, sigD, sigE, sigH, sigM, tpi and zwal.
  • Table 8 include in particular the acetolactate synthase ilvBN alieles which code for a valine-resistant .
  • the at least third, optionally fourth or fifth copy of the open reading frame (ORF) , gene or allele of valine production in question can be integrated at a further site.
  • the following open reading frames, genes or nucleotide sequences, inter alia, can be used for this: aecD, ccpAl, ccpA2, citA, citB, citE, ddh, gluA, gluB, gluC, gluD, glyA, ilvA, luxR, lysRl, lysR2 , lysR3 , panB, panC, poxB and zwa2.
  • Table 9 Intergenic regions in the chromosome, that is to say nucleotide sequences without a coding function, can furthermore be used.
  • prophages or defective phages contained in the chromosome can be used for this.
  • the invention accordingly also provides a process for the production of coryneform bacteria which produce L-valine, characterized in that
  • nucleotide sequence of a desired ORF, gene or allele of valine production, optionally including the expression and/or regulation signals, is isolated
  • nucleotide sequence obtained according to b) is incorporated in a vector which does not replicate or replicates to only a limited extent in coryneform bacteria, d) the nucleotide sequence according to b) or c) is transferred into coryneform bacteria, and
  • coryneform bacteria which have at least two copies of the desired open ORF, gene or allele of valine production at the particular desired natural site instead of the singular copy of the ORF, gene or allele originally present are isolated, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics remaining at the particular natural site (locus) , and optionally
  • a strain is, for example, the strain DSMl39921ysC FBR : :lysC FBR .
  • the plasmid pKl8mobsacB2xlysCSma2/l, with the aid of which two copies of an lysC FBR allele can be incorporated into the lysC gene site of Corynebacterium glutamicum, is shown in Figure 1.
  • Such a strain is, for example, the strain ATCC21513_171ysE: :lysE.
  • FIG. 2 A plasmid with the aid of which two copies of an lysE gene can be incorporated into the lysE gene site of Corynebacterium glutamicum is shown in Figure 2. It carries the name pKl8mobsacB2xlysESmal/l .
  • a plasmid with the aid of which two copies of a zwal gene can be incorporated into the zwal gene site of Corynebacterium glutamicum is shown in Figure 3. It carries the name p l ⁇ mobsacBzwalzwal .
  • the coryneform bacteria produced according to the invention can be cultured continuously or discontinuously in the batch process (batch culture) or in the fed batch (feed process) or repeated fed batch process (repetitive feed process) for the purpose of production of chemical compounds.
  • batch culture batch culture
  • feed process fed batch
  • repetitive feed process repeated fed batch process
  • the culture medium to be used must meet the requirements of the particular strains in a suitable manner. Descriptions of culture media for various microorganisms are contained in the handbook "Manual of Methods for General Bacteriology” of the American Society for Bacteriology (Washington D.C. , USA, 1981).
  • Sugars and carbohydrates such as e.g. glucose, sucrose, lactose, fructose, maltose, molasses, starch and cellulose, oils and fats, such as e.g. soya oil, sunflower oil, groundnut oil and coconut fat, fatty acids, such as e.g. palmitic acid, stearic acid and linoleic acid, alcohols, such as e.g. glycerol and ethanol, and organic acids, such as e.g. acetic acid or lactic acid, can be used as the source of carbon. These substances can be used individually or as a mixture.
  • oils and fats such as e.g. soya oil, sunflower oil, groundnut oil and coconut fat
  • fatty acids such as e.g. palmitic acid, stearic acid and linoleic acid
  • alcohols such as e.g. glycerol and ethanol
  • organic acids such as e.g. acetic acid or lactic acid
  • Organic nitrogen-containing compounds such as peptones, yeast extract, meat extract, malt extract, corn steep liquor, soya bean flour and urea
  • inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate, can be used as the source of nitrogen.
  • the sources of nitrogen can be used individually or as a mixture.
  • Phosphoric acid, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium- containing salts can be used as the source of phosphorus .
  • the culture medium must furthermore comprise salts of metals, such as e.g. magnesium sulfate or iron sulfate, which are necessary for growth.
  • essential growth substances such as amino acids and vitamins, can be employed in addition to the above-mentioned substances .
  • Suitable precursors can moreover be added to the culture medium.
  • the starting substances mentioned can be added to the culture in the form of a single batch, or can be fed in during the culture in a suitable manner.
  • Basic compounds such as sodium hydroxide, potassium hydroxide, ammonia or aqueous ammonia, or acid compounds, such as phosphoric acid or sulfuric acid, can be employed in a suitable manner to control the pH of the culture.
  • Antifoams such as e.g. fatty acid polyglycol esters, can be employed to control the development of foam.
  • Suitable substances having a selective action such as e.g. antibiotics, can be added to the medium to maintain the stability of plasmids.
  • oxygen or oxygen-containing gas mixtures such as e.g. air, are introduced into the culture.
  • the temperature of the culture is usually 20 2 C to 45 a C, and preferably 25 a C to 40 a C. Culturing is continued until a maximum of the desired chemical compound has formed. This target is usually reached within 10 hours to 160 hours.
  • coryneform bacteria according to the invention in particular the coryneform bacteria which produce L-lysine, have an unexpectedly high stability. They were stable for at least 10-20, 20-30, 30-40, 40-50, preferably at least 50-60, 60-70, 70-80 and 80-90 generations or cell division cycles .
  • DSMl39921ysC FBR : :lysC FBR was deposited in the form of a pure culture on 5th June 2002 under number DSM15036 at the Deutsche Sammlung fur Mikroorganismen und Zellkulturen (DSMZ, Braunschweig, Germany) in accordance with the Budapest Treaty.
  • the plasmid pKl8mobsacB2xlysCSma2/l was deposited in the form of a pure culture of the strain E.
  • ATCC21513_171ysE was deposited in the form of a pure culture on 5th June 2002 under number DSM15037 at the Deutsche Sammlung fur Mikroorganismen und Zellkulturen (DSMZ, Braunschweig, Germany) in accordance with the Budapest Treaty.
  • Corynebacterium glutamicum strain ATCC21513_17zwal : zwal was deposited in the form of a pure culture on 5th June 2002 under number DSM15038 at the Deutsche Sammlung fur Mikroorganismen und Zellkulturen (DSMZ, Braunschweig, Germany) in accordance with the Budapest Treaty.
  • chromosomal DNA is isolated by the conventional methods (Eikmanns et al . , Microbiology 140: 1817 - 1828 (1994)).
  • the strain DSM13994 was produced by multiple, non-directed mutagenesis, selection and mutant selection from C. glutamicum ATCC13032.
  • the strain is resistant to the lysine analogue S- (2-aminoethyl) -L-cysteine and has a feed back- resistant aspartate kinase which is insensitive to inhibition by a mixture of lysine and threonine (in each case 25 mM) .
  • the nucleotide sequence of the lysC FBR allele is shown as SEQ ID NO: 3. It is also called lysC T311I in the following.
  • the amino acid sequence of the aspartate kinase protein coded is shown as SEQ ID NO: 4.
  • a pure culture of this strain was deposited on 16th January 2001 at the Deutsche Sammlung fur Mikroorganismen und Zellkulturen (DSMZ, Braunschweig, Germany) in accordance with the Budapest Treaty.
  • a DNA section which carries the lysC gene or allele is amplified.
  • the sequence of the lysC gene known for C. glutamicum (Kalinowski et al . , Molecular Microbiology, 5 (5), 1197 - 1204(1991); Accession Number X57226), the following primer oligonucleotides were chosen for the PCR:
  • lysC2end (SEQ ID NO: 16):
  • the primers shown are synthesized by MWG Biotech and the PCR reaction is carried out by the standard PCR method of Innis et al . (PCR Protocols. A Guide to Methods and Applications, 1990, Academic Press) .
  • the primers allow amplification of a DNA section of approx. 1.7 kb in length, which carries the lysC gene or allele.
  • the primers moreover contain the sequence for a cleavage site of the restriction endonuclease BamHI, which is marked by parentheses in the nucleotide sequence shown above.
  • DSM13994 is identified by electrophoresis in a 0.8% agarose gel, isolated from the gel and purified by conventional methods (QIAquick Gel Extraction Kit, Qiagen, Hilden) . Ligation of the fragment is then carried out by means of the Topo TA Cloning Kit (Invitrogen, Leek, The Netherlands, Cat. Number K4600-01) in the vector pCRII-TOPO. The ligation batch is transformed in the E. coli strain TOP10 (Invitrogen, Leek, The Netherlands) .
  • Selection of plasmid- carrying cells is made by plating out the transformation batch on kanamycin (50 mg/1) -containing LB agar with X-Gal (5-bromo-4-chloro-3-indolyl ⁇ -D-galactopyranoside, 64 mg/1) .
  • the plasmid obtained is checked by means of restriction cleavage, after isolation of the DNA, and identified in agarose gel.
  • the resulting plasmid is called pCRIITOPOlysC.
  • the nucleotide sequence of the amplified DNA fragment or PCR product is determined by the dideoxy chain termination method of Sanger et al . (Proceedings of the National
  • the base thymine is found at position 932 of the nucleotide sequence of the coding region of the lysC FBR allele of strain DSM13994 (SEQ ID NO: 3) .
  • the base cytosine is found at the corresponding position of the wild-type gene (SEQ ID NO: 1) .
  • the amino acid isoleucine is found at position 311 of the amino acid sequence of the aspartate kinase protein of strain DSM13994 (SEQ ID No: 4) .
  • the amino acid threonine is found at the corresponding position of the wild-type protein (SEQ ID No: 2) .
  • the lysC allele which contains the base thymine at position 932 of the coding region and accordingly codes for an aspartate kinase protein which contains the amino acid isoleucine at position 311 of the amino acid sequence, is called the lysC FBR allele lysC T311I in the following.
  • Plasmid DNA was isolated from the strain DSM14242, which carries the plasmid pCRIITOPOlysC, and cleaved with the restriction enzyme BamHI (Amersham-Pharmacia, Freiburg, Germany), after separation in an agarose gel (0.8%) the lysC FBR -containing DNA fragment approx.
  • the E. coli strain DH5 ⁇ (Grant et al.; Proceedings of the National Academy of Sciences USA, 87 (1990) 4645-4649) is then transformed with the ligation batch (Hanahan, In. DNA Cloning. A Practical Approach. Vol. 1, ILR-Press, Cold Spring Harbor, New York, 1989) . Selection of plas id- carrying cells is made by plating out the transformation batch on LB agar (Sambrook et al . , Molecular Cloning: A Laboratory Manual. 2 nd Ed., Cold Spring Harbor, New York, 1989) , which was supplemented with 25 mg/1 kanamycin.
  • Plasmid DNA is isolated from a transformant with the aid of the QIAprep Spin Miniprep Kit from Qiagen and checked by restriction cleavage with the enzyme HindiII and subsequent agarose gel electrophoresis.
  • the plasmid is called pKl8mobsacBlxlysCSma2.
  • the plasmid pCRII-TOPOlysC is in turn cleaved with the restriction enzyme BamHI (Amersham- Pharmacia, Freiburg, Germany) , after separation in an agarose gel (0.8%) the lysC FBR -containing fragment of approx. 1.7 kb was isolated from the agarose gel with the aid of the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) and employed for ligation with the vector pKl8mobsacBlxlysCSma2 described in this Example.
  • This is cleaved beforehand with the restriction enzyme BamHI and dephosphorylated with alkaline phosphatase (Alkaline
  • the E. coli strain DH5 ⁇ (Grant et al . ; Proceedings of the National Academy of Sciences USA, 87 (1990) 4645-4649) is then transformed with the ligation batch (Hanahan, In. DNA Cloning. A Practical Approach. Vol. 1, ILR-Press, Cold Spring Harbor, New York, 1989) . Selection of plasmid- carrying cells is made by plating out the transformation batch on LB agar (Sambrook et al., Molecular Cloning: A Laboratory Manual. 2 nd Ed., Cold Spring Harbor, New York, 1989), which was supplemented with 25 mg/1 kanamycin.
  • Plasmid DNA is isolated from a transformant with the aid of the QIAprep Spin Miniprep Kit from Qiagen and checked by restriction cleavage with the enzyme Hindlll and subsequent agarose gel electrophoresis.
  • the plasmid is called pKl8mobsacB2xlysCSma2/l.
  • a map of the plasmid is shown in Figure 1.
  • the plasmid pKl8mobsacB2xlysCSma2/l was deposited in the form of a pure culture of the strain E.
  • the vector pKl8mobsacB2xlysCSma2/l mentioned in Example 1.1 is transferred by a modified protocol of Schafer et al . (1990 Journal of Microbiology 172: 1663-1666) into the C. glutamicum strain DSM13992.
  • the Corynebacterium glutamicum strain DSM13992 was produced by multiple, non-directed mutagenesis, selection and mutant selection from C. glutamicum ATCC13032.
  • the strain is resistant to the antibiotic streptomycin and phenotypically resistant to the lysine analogue S- (2-aminoethyl) -L- cysteine.
  • the strain has a wild-type aspartate kinase (see SEQ ID NO:l and 2), which is sensitive to inhibition by a mixture of lysine and threonine (in each case 25 mM) .
  • a pure culture of this strain was deposited on 16th January 2001 at the Deutsche Sammlung fur Mikroorganismen und Zellkulturen (DSMZ, Braunschweig, Germany) in accordance with the Budapest Treaty.
  • the vector pKl8mobsacB2xlysCSma2/l cannot replicate independently in DSM13992 and is retained in the cell only if it has integrated into the chromosome.
  • the clones are cultured on LB agar with 10% sucrose, after incubation for 16 hours in LB liquid medium.
  • the plasmid pKl8mobsacB contains a copy of the sacB gene, which converts sucrose into levan sucrase, which is toxic to C. glutamicum.
  • lysCKl (SEQ ID NO: 5) :
  • lysCK2 (SEQ ID NO: 6) : 5 TCG GTT GCC TGA GTA ATG TC 3 V
  • the primers allow amplification of a DNA fragment approx. 1.9 kb in size in control clones with the original lysC locus.
  • DNA fragments with a size of approx. 3.6 kb are amplified.
  • the amplified DNA fragments are identified by means of electrophoresis in a 0.8% agarose gel. On the basis of the amplified fragment length, a distinction was made between clones with one chromosomal lysC gene copy and clones with two chromosomal lysC gene copies .
  • the LightCycler is a combined apparatus of Thermocycler and flourimeter.
  • a DNA section approx. 500 bp in length which contains the mutation site is amplified in the first phase by means of a PCR (Innis et al . , PCR Protocols. A Guide to Methods and Applications, 1990, Academic Press) using the following primer oligonucleotides.
  • lysC311-A (SEQ ID No: 10) :
  • the primers shown are synthesized for the PCR by MWG
  • Biotech and oligonucleotides shown for the hybridization are synthesized by TIB MOLBIOL (Berlin, Germany) .
  • a clone which contains the base thymine at position 932 of the coding regions of the two lysC copies and thus has two lysC FBR alieles lysC T311I was identified in this manner.
  • the strain was called C. glutamicum DSMl39921ysC FBR : : lysC FBR .
  • the strain was deposited as C. glutamicum DSMl39921ysC FBR : :lysC FBR on 5th June 2002 under number DSM15036 at the Deutsche Sammlung fur Mikroorganismen und Zellkulturen (DSMZ, Braunschweig, Germany) in accordance with the Budapest Treaty.
  • Plasmid DNA was isolated from the Escherichia coli strain DSM12871 (EP-A-1067193) , which carries the plasmid pEC71ysE.
  • the plasmid contains the lysE gene which codes for lysine export.
  • a pure culture of this strain was deposited on 10th June 1999 at the Deutsche Sammlung fiir Mikroorganismen und Zellkulturen (DSMZ, Braunschweig, Germany) in accordance with the Budapest Treaty.
  • the plasmid pEC711ysE is cleaved with the restriction enzyme BamHI (Amersham-Pharmacia, Freiburg, Germany) , after separation in an agarose gel (0.8%) the lysE fragment of approx.
  • 1.1 kb is isolated from the agarose gel with the aid of the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) , and the overhanging ends are completed with Klenow polymerase (Boehringer Mannheim) and employed for ligation with the mobilizable cloning vector pKl ⁇ mobsacB described by Schafer et al . , Gene, 14, 69-73 (1994).
  • This is cleaved beforehand with the restriction enzyme Smal and dephosphorylated with alkaline phosphatase (Alkaline Phosphatase, Boehringer Mannheim) , mixed with the lysE fragment of approx. 1.1 kb and the mixture is treated with T4 DNA Ligase (Amersham-Pharmacia, Freiburg, Germany) .
  • the E. coli strain DH5 ⁇ (Grant et al . ; Proceedings of the National Academy of Sciences USA, 87 (1990) 4645-4649) is then transformed with the ligation batch (Hanahan, In. DNA Cloning. A Practical Approach. Vol. 1, ILR-Press, Cold Spring Harbor, New York, 1989) . Selection of plasmid- carrying cells is made by plating out the transformation batch on LB agar (Sambrook et al . , Molecular Cloning: A Laboratory Manual. 2 nd Ed., Cold Spring Harbor, New York, 1989), which was supplemented with 25 mg/1 kanamycin.
  • Plasmid DNA is isolated from a transformant with the aid of the QIAprep Spin Miniprep Kit from Qiagen and checked by restriction cleavage with the enzymes BamHI and EcoRI and subsequent agarose gel electrophoresis.
  • the plasmid is called pKl ⁇ mobsacBlxlysESmal .
  • the plasmid pEC71ysE is in turn cleaved with the restriction enzyme BamHI (Amersham-Pharmacia, Freiburg, Germany) , after separation in an agarose gel (0.8%) the lysE fragment of approx. 1.1 kb was isolated from the agarose gel with the aid of the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) and employed for ligation with the vector pKl8mobsacBlxlysESmal described in this Example.
  • the E. coli strain DH5 ⁇ (Grant et al . ; Proceedings of the National Academy of Sciences USA, 87 (1990) 4645-4649) is then transformed with the ligation batch (Hanahan, In. DNA Cloning. A Practical Approach. Vol. 1, ILR-Press, Cold Spring Harbor, New York, 1989) . Selection of plasmid- carrying cells is made by plating out the transformation batch on LB agar (Sambrook et al . , Molecular Cloning: A Laboratory Manual. 2 nd Ed., Cold Spring Harbor, New York, 1989), which was supplemented with 25 mg/1 kanamycin.
  • Plasmid DNA is isolated from a transformant with the aid of the QIAprep Spin Miniprep Kit from Qiagen and checked by restriction cleavage with the enzymes EcoRI and Sail or Seal and subsequent agarose gel electrophoresis.
  • the plasmid is called pKl8mobsacB2xlysESmal/l .
  • a map of the plasmid is shown in Figure 2.
  • the vector pKl8mobsacB2xlysESmal/l mentioned in Example 2.1 is transferred by a modified protocol of Schafer et al .
  • the Corynebacterium glutamicum strain ATCC21513_17 was produced by multiple, non-directed mutagenesis, selection and mutant selection from C. glutamicum ATCC21513.
  • the strain is resistant to the lysine analogue S-(2- aminoethyl) -L-cysteine and both leucine- and homoserine- prototrophic.
  • the vector cannot replicate independently in ATCC21513_17 and is retained in the cell only if it has integrated into the chromosome.
  • the clones are cultured on LB agar with 10% sucrose, after incubation for 16 hours in LB liquid medium.
  • the plasmid pKl ⁇ mobsacB contains a copy of the sacB gene, which converts sucrose into levan sucrase, which is toxic to C. glutamicum.
  • the primers allow amplification of a DNA fragment approx. 1.2 kb in size in control clones with the original lysE locus.
  • DNA fragments with a size of approx. 2.3 kb are amplified.
  • the amplified DNA fragments are identified by means of electrophoresis in a 0.8% agarose gel. On the basis of the amplified fragment length, a distinction was made between clones with one chromosomal lysE gene copy and clones with two chromosomal lysE gene copies . It could thus be demonstrated that the strain ATCC21513_17 carries two complete copies of the lysE gene on the chromosome.
  • the strain was called C. glutamicum ATCC21513_171ysE: :lysE.
  • the strain was deposited as C. glutamicum ATCC21513_171ysE: : lysE on 5th June 2002 under number DSM15037 at the Deutsche Sammlung fiir Mikroorganismen und Zellkulturen (DSMZ, Braunschweig, Germany) in accordance with the Budapest Treaty.
  • Plasmid DNA was isolated from the Escherichia coli strain DSM13115 (EP-A-1111062) , which carries the plasmid pCR2.1zwalexp.
  • the plasmid contains the zwal gene which codes for cell growth factor 1.
  • a pure culture of this strain was deposited on 19th October 1999 at the Deutsche Sammlung fiir Mikroorganismen und Zellkulturen (DSMZ, Braunschweig, Germany) in accordance with the Budapest Treaty.
  • the plasmid pCR2. lzwalexp is cleaved with the restriction enzyme EcoRI (Amersham-Pharmacia, Freiburg, Germany) , and after separation in an agarose gel (0.8%) the zwal fragment of 1 kb is isolated from the agarose gel with the aid of the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) and employed for ligation with the mobilizable cloning vector pKl ⁇ mobsacB described by Schafer et al . , Gene, 14, 69-73 (1994) .
  • the E. coli strain DH5 (Grant et al . ; Proceedings of the National Academy of Sciences USA, 87 (1990) 4645-4649) is then transformed with the ligation batch (Hanahan, In. DNA Cloning. A Practical Approach. Vol. 1, ILR-Press, Cold Spring Harbor, New York, 1989) . Selection of plasmid- carrying cells is made by plating out the transformation batch on LB agar (Sambrook et al . , Molecular Cloning: A Laboratory Manual. 2 nd Ed., Cold Spring Harbor, New York, 1989), which was supplemented with 25 mg/1 kanamycin.
  • Plasmid DNA is isolated from a transformant with the aid of the QIAprep Spin Miniprep Kit from Qiagen and checked by restriction cleavage with the enzyme Nhel and subsequent agarose gel electrophoresis. Checking of the plasmid showed that two zwal fragments were cloned simultaneously and in the desired orientation in the cloning vector pKl ⁇ mobsac. The plasmid is called pK18mobsacBzwalzwal . A map of the plasmid is shown in Figure 3.
  • Example 3.1 The vector pKl ⁇ mobsacBzwalzwal mentioned in Example 3.1 is transferred by a modified protocol of Schafer et al . (1990 Journal of Microbiology 172: 1663-1666) into the C. glutamicum strain ATCC21513_17.
  • the Corynebacterium glutamicum strain ATCC21513_17 was produced by multiple, non-directed mutagenesis, selection and mutant selection from C. glutamicum ATCC21513.
  • the strain is resistant to the lysine analogue S- (2- aminoethyl) -L-cysteine and both leucine- and homoserine- prototrophic .
  • the vector cannot replicate independently in ATCC21513_17 and is retained in the cell only if it has integrated into the chromosome.
  • Selection of clones with integrated pKl ⁇ mobsacBzwalzwal is carried out by plating out the conjugation batch on LB agar (Sambrook et al . , Molecular Cloning: A Laboratory Manual. 2 nd Ed., Cold Spring Harbor, New York, 1989), which was supplemented with 15 mg/1 kanamycin and 50 mg/1 nalidixic acid. Clones which have grown on are plated out on LB agar plates with 25 mg/1 kanamycin and incubated for 16 hours at 33°C. To achieve excision of the plasmid with only one copy of the zwal gene, the clones are cultured on LB agar with 10% sucrose, after incubation for 16 hours in LB liquid medium. The plasmid pKl ⁇ mobsacB contains a copy of the sacB gene, which converts sucrose into levan sucrase, which is toxic to C. glutamicum.
  • the primers allow amplification of a DNA fragment approx. 1.3 kb in size in control clones with the original zwal locus.
  • DNA fragments with a size of approx. 2.3 kb are amplified.
  • the amplified DNA fragments are identified by means of electrophoresis in a 0.8% agarose gel. On the basis of the amplified fragment length, a distinction was made between clones with one chromosomal zwal gene copy and clones with two chromosomal zwal gene copies . It could thus be demonstrated that the strain ATCC21513_17 carries two complete copies of the zwal gene on the chromosome.
  • the strain was called C. glutamicum ATCC21513_17zwal : : zwal .
  • the strain was deposited as C. glutamicum ATCC21513_17zwal: : zwal on 5th June 2002 under number DSM15038 at the Deutsche Sammlung fiir Mikroorganismen und Zellkulturen (DSMZ, Braunschweig, Germany) in accordance with the Budapest Treaty.
  • the C. glutamicum strains DSMl39921ysC FBR : :lysC FBR , ATCC21513_171ysE: :lysE and ATCC21513_17zwal : : zwal obtained in Examples 1 to 3 are cultured in a nutrient medium suitable for the production of lysine and the lysine content in the culture supernatant was determined.
  • the strains are first incubated on an agar plate for 24 hours at 33 2 C.
  • a preculture is seeded (10 ml medium in a 100 ml conical flask) .
  • the medium MM is used as the medium for the preculture.
  • the preculture is incubated for 24 hours at 33 2 C at 240 rpm on a shaking machine.
  • a main culture is seeded from this preculture such that the initial OD (660 nm) of the main culture is 0.1 OD.
  • the Medium MM is also used for the main culture.
  • Culturing is carried out in a 10 ml volume in a 100 ml conical flask with baffles . Culturing is carried out at 33 a C and 80% atmospheric humidity.
  • the OD is determined at a measurement wavelength of 660 nm with a Bio ek 1000 (Beckmann
  • the -amount of lysine formed is determined with an amino acid analyzer from Eppendorf- BioTronik (Hamburg, Germany) by ion exchange chromatography and post-column derivation with ninhydrin detection.
  • the base pair numbers stated are approximate values obtained in the context of reproducibility of measurements .
  • Figure 1 Map of the plasmid pKl8mobsacB2xlysCSma2/l .
  • KmR Kanamycin resistance gene
  • lysC lysC FBR allele lysC T311I
  • sacB sacB gene RP4mob : mob region with the replication origin for the transfer (oriT)
  • Figure 2 Map of the plasmid pKl8mobsacB2xlysESmal/l .
  • KanR Kanamycin resistance gene
  • EcoRI Cleavage site of the restriction enzyme EcoRI
  • lysE lysE gene
  • sacB sacB gene
  • RP4mob mob region with the replication origin for the transfer (oriT)
  • Figure 3 Map of the plasmid pKl ⁇ mobsacBzwalzwal .
  • KanR Kanamycin resistance gene
  • Nhel Cleavage site of the restriction enzyme Nhel zwal : zwal gene
  • sacB sacB gene
  • RP4mob mob region with the replication origin for the transfer (oriT)
  • the microorganism identified under I. above was accompanied by:
  • This International Depositary Authority accepts the microorganism identified under I. above, which was received by it on 2002-06-05 (Date of the original deposit) 1 .
  • microorganism identified under I above was received by this International Depositary Authority on (date of original deposit) and a request to convert the original deposit to a deposit under the Budapest Treaty was received by it on (date of receipt of request for conversion).
  • the microorganism identified under I above was accompanied by
  • microorganism identified under I above was received by this International Depositary Autho ⁇ ty on (date of original deposit) and a request to convert the original deposit to a deposit under the Budapest Treaty was received by it on (date of receipt of request for conversion)
  • the microorganism identified under I. above was accompanied by:
  • This International Depositary Authority accepts the microorganism identified under I. above, which was received by it on 2002-06-05 (Date of the original deposit) 1 .
  • microorganism identified under I above was received by this International Depositary Authority on (date of original deposit) and a request to convert the original deposit to a deposit under the Budapest Treaty was received by it on (date of receipt of request for conversion).
  • the microorganism identified under I. above was accompanied by:
  • This International Depositary Authority accepts the microorganism identified under I. above, which was received by it on 2 001 - 04 - 2 0 (Date of the original deposit) 1 .
  • microorganism identified under I above was received by this International Depositary Authority on (date of original deposit) and a request to convert the original deposit to a deposit under the Budapest Treaty was received by it on (date of receipt of request for conversion).

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Virology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Purification Treatments By Anaerobic Or Anaerobic And Aerobic Bacteria Or Animals (AREA)

Abstract

The invention relates to coryneform bacteria, which instead of the singular copy of an open reading frame (ORF), gene or allele naturally present at the particular desired site (locus), have at least two copies of the open reading frame (ORF), gene or allele in question, preferably in tandem arrangement, and optionally at least a third copy of the open reading frame (ORF), gene or allele in question at a further gene site, and processes for the preparation of chemical compounds by fermentation of these bacteria.

Description

Coryneform Bacteria which Produce Chemical Compounds II
Prior Art
Chemical compounds, which means, in particular, L-amino acids, vitamins, nucleosides and nucleotides and D-amino acids, are used in human medicine, in the pharmaceuticals industry, in cosmetics, in the foodstuffs industry and in animal nutrition.
Numerous of these compounds are prepared by fermentation from strains of coryneform bacteria, in particular Corynebacterium glutamicum. Because of their great importance, work is constantly being undertaken to improve the preparation processes. Improvements to the process can relate to fermentation measures, such as, for example, stirring and supply of oxygen, or the composition of the nutrient media, such as, for example, the sugar concentration during the fermentation, or the working up to the product form by, for example, ion exchange chromatography, or the intrinsic output properties of the microorganism itself.
Methods of mutagenesis, selection and mutant selection are used to improve the output properties of these microorganisms. Strains which are resistant to antimetabolites or are auxotrophic for metabolites of regulatory importance and which produce the particular compounds are obtained in this manner.
Methods of the recombinant DNA technique have also been employed for some years for improving the strain of Corynebacterium strains, by amplifying individual biosynthesis genes and investigating the effect on production.
A common method comprises amplification of certain biosynthesis genes in the particular microorganism by means of episomally replicating plasmids. This procedure has the disadvantage that during the fermentation, which in industrial processes is in general associated with numerous generations, the plasmids are lost spontaneously (segregational instability) .
Another method comprises duplicating certain biosynthesis genes by means of plasmids which do not replicate in the particular microorganism. In this method, the plasmid, including the cloned biosynthesis gene, is integrated into the chromosomal biosynthesis gene of the microorganism (Reinscheid et al . , Applied and Environmental Microbiology 60(1), 126-132 (1994); Jetten et al . , Applied Microbiology and Biotechnology 43(1) -.76-82 (1995)). A disadvantage of this method is that the nucleotide sequences of the plasmid and of the antibiotic resistance gene necessary for the selection remain in the microorganism. This is a disadvantage, for example, for the disposal and utilization of the biomass . Moreover, the expert expects such strains to be unstable as a result of disintegration by "Campbell type cross over" in a corresponding number of generations such as are usual in industrial fermentations.
Object of the Invention
The inventors had the object of providing new measures for improved fermentative preparation of chemical compounds using coryneform bacteria.
Summary of the Invention
The invention provides coryneform bacteria, in particular of the genus Corynebacterium, which produce one or more desired chemical compounds, characterized in that
a) instead of the singular copy of an open reading frame (ORF) , gene or allele naturally present at the particular desired site (locus) , these have at least two copies of the said open reading frame (ORF) , gene or allele, preferably in tandem arrangement, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance . to antibiotics being present at the particular site, and in that these
b) optionally have at least a third copy of the open reading frame (ORF) , gene or allele in question at a further gene site, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the further gene site.
The invention also provides processes for the preparation of one or more chemical compounds, which comprise the following steps :
a) fermentation of coryneform bacteria, in particular of the genus Corynebacterium, which
i) instead of the singular copy of an open reading frame (ORF) , gene or allele naturally present at the particular desired site (locus) , have at least two copies of the said open reading frame (ORF) , gene or allele, preferably in tandem arrangement, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the particular site, and in that these
ii) optionally have at least a third copy of the said open reading frame (ORF) , gene or allele at a further gene site, no nucieotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the further gene site,
under conditions which allow expression of the said open reading frames (ORFs) genes or alieles,
b) concentration of the chemical compound (s) in the fermentation broth and/or in the cells of the bacteria,
c) isolation of the chemical compound (s) , optionally
d) with constituents from the fermentation broth and/or the biomass to the extent of > (greater than) 0 to
100%.
Detailed Description of the Invention
Chemical compounds are to be understood, in particular, as meaning amino acids, vitamins, nucleosides and nucleotides. The biosynthesis pathways of these compounds are known and are available in the prior art.
Amino acids mean, preferably, L-amino acids, in particular the proteinogenic L-amino acids, chosen from the group consisting of L-aspartic acid, L-asparagine, L-threonine, L-serine, L-glutamic acid, L-glutamine, glycine, L-alanine, L-cysteine, L-valine, L-methionine, L-isoleucine, L- leucine, L-tyrosine, L-phenylalanine, L-histidine, L- lysine, L-tryptophan, L-proline and L-arginine and salts thereof, in particular L-lysine, L-methionine and L- threonine. L-Lysine is very particularly preferred. Proteinogenic amino acids are understood as meaning the amino acids which occur in natural proteins, that is to say in proteins of microorganisms, plants, animals and humans.
Vitamins mean, in particular, vitamin Bl (thia ine) , vitamin B2 (riboflavin) , vitamin B5 (pantothenic acid) , vitamin B6 (pyridoxines) , vitamin B12 (cyanocobalamin) , nicotinic acid/nicotinamide, vitamin M (folic acid) and vitamin E (tocopherol) and salts thereof, pantothenic acid being preferred.
Nucleosides and nucleotides mean, inter alia, S-adenosyl- methionine, inosine-5 ' -monophosphoric acid and guanosine- 5 ' -monophosphoric acid and salts thereof.
The coryneform bacteria are, in particular, those of the genus Corynebacterium. Of the genus Corynebacterium, the species Corynebacterium glutamicum, Corynebacterium ammoniagenes and Corynebacterium thermoaminogenes are preferred. Information on the taxonomic classification of strains of this group of bacteria is to be found, inter alia, in Kampfer and Kroppenstedt (Canadian Journal of Microbiology 42, 989-1005 (1996)) and in US-A-5, 250, 434.
Suitable strains of the species Corynebacterium glutamicum (C. glutamicum) are, in particular, the known wild-type strains
Corynebacterium glutamicum ATCC13032 Corynebacterium acetoglutamicum ATCC15806
Corynebacterium acetoacidophilum ATCC13870 Corynebacterium lilium ATCC15990 Corynebacterium melassecola ATCC17965 Corynebacterium herculis ATCC13868 Arthrobacter sp ATCC243
Brevibacterium chang-fua ATCC14017 Brevibacterium flavum ATCC14067 Brevibacterium lactofermentum ATCC13869 Brevibacterium divaricatum ATCC14020 Brevibacterium taipei ATCC13744 and Microbacterium ammoniaphilum ATCC21645
and mutants or strains, such as are known from the prior art, produced therefrom which produce chemical compounds.
Suitable strains of the species Corynebacterium ammoniagenes (C. ammoniagenes ) are, in particular, the known wild-type strains
Brevibacterium ammoniagenes ATCC6871 Brevibacterium ammoniagenes ATCC15137 and
Corynebacterium sp. ATCC21084
and mutants or strains, such as are known from the prior art, produced therefrom which produce chemical compounds.
Suitable strains of the species Corynebacterium thermoaminogenes (C. thermoaminogenes ) are, in particular, the known wild-type strains
Corynebacterium thermoaminogenes FERM BP-1539 Corynebacterium thermoaminogenes FERM BP-1540 Corynebacterium thermoaminogenes FERM BP-1541 and Corynebacterium thermoaminogenes FERM BP-1542
and mutants or strains, such as are known from the prior art, produced therefrom which produce chemical compounds.
Strains with the designation "ATCC" can be obtained from the American Type Culture Collection (Manassas, VA, USA) . Strains with the designation "FERM" can be obtained from the National Institute of Advanced Industrial Science and Technology (AIST Tsukuba Central 6, 1-1-1 Higashi, Tsukuba Ibaraki, Japan) . The strains of Corynebacterium thermoaminogenes mentioned (FERM BP-1539, FERM BP-1540, FERM BP-1541 and FERM BP-1542) are described in US-A 5,250,434. Open reading frame (ORF) describes a section of a nucleotide sequence which codes or can code for a protein or polypeptide or ribonucleic acid to which no function can be assigned according to the prior art.
After assignment of a function to the nucleotide sequence section in question, it is in general referred to as a gene.
Alieles are in general understood as meaning alternative forms of a given gene. The forms are distinguished by differences in the nucleotide sequence.
In the context of the present invention, endogenous, that is to say species-characteristic, open reading frames, genes or alieles are preferably used. These are understood as meaning the open reading frames, genes or alieles or nucleotide sequences thereof present in the population of a species, such as, for example, Corynebacterium glutamicum.
A "singular copy of an open reading frame (ORF) , gene or allele naturally present at the particular desired site (locus) " is understood as meaning the circumstances that a gene in general naturally occurs in one (1) copy in the form of its nucleotide sequence at its site or gene site in the corresponding wild-type or corresponding parent organism or starting organism. This site is preferably in the chromosome.
Thus, for example, the lysC gene or an lysCFBR allele which codes for a "feed back" resistant aspartate kinase is present in one copy at the lysC site or lysC locus or lysC gene site and is flanked by the open reading frame orfX and the leuA gene on one side and by the asd gene on the other side.
"Feed back" resistant aspartokinases are understood as meaning aspartokinases which, compared with the wild-type form, have a lower sensitivity to inhibition by mixtures of lysine and threonine or mixtures of AEC
(aminoethylcysteine) and threonine or lysine by itself or AEC by itself. Strains which produce L-lysine typically contain such "feed back" resistant or desensitized aspartokinases .
The nucleotide sequence of the chromosome of Corynebacterium glutamicum is known and can be found in the patent application EP-A-1108790 and Access Number (Accession No.) AX114121 of the nucleotide sequence databank of the European Molecular Biologies Laboratories (EMBL, Heidelberg, Germany and Cambridge, UK) . The nucleotide sequences of orfX, the leuA gene and the asd gene have the Access Numbers AX120364 (orfX) , AX123517 (leuA) and AX123519 (asd) .
Further databanks, such as, for example, that of the National Center for Biotechnology Information (NCBI, Bethesda, MD, USA) or that of the Swiss Institute of Bioinformatics (Swissprot, Geneva, Switzerland) or that of the Protein Information Resource Database (PIR, Washington, DC, USA) can also be used.
"Tandem arrangement" of two or more copies of an open reading frame (ORF) , gene or allele is referred to if these are arranged in a row directly adjacent in the same orientation.
"A further gene site" is understood as meaning a second gene site, the nucleotide sequence of which is different from the sequence of the ORF, gene or allele which has been at least duplicated at the natural site. This further gene site, or the nucleotide sequence present at the further gene site, is preferably in the chromosome and is in general not essential for growth and for production of the desired chemical compounds . The "further gene sites" mentioned include, of course, not only the coding regions of the open reading frames or genes mentioned, but also the regions or nucleotide sequences lying upstream which are responsible for expression and regulation, such as, for example, ribosome binding sites, promoters, binding sites for regulatory proteins, binding sites for regulatory ribonucleic acids and attenuators. These regions in general lie in a range of 1-800, 1-600, 1- 400, 1-200, 1-100 or 1-50 nucleotides upstream of the coding region. In the same way, regions lying downstream, such as, for example, transcription terminators, are also included. These regions in general lie in a range of 1-400, 1-200, 1-100, 1-50 or 1-25 nucleotides downstream of the coding region.
Intergenic regions in the chromosome, that is to say nucleotide sequences without a coding function, can furthermore be used. Finally, prophages or defective phages contained in the chromosome can be used for this .
A prophage is understood as meaning a bacteriophage, in particular the genome thereof, where this is replicated together with the genome of the host and the formation of infectious particles does not take place. A defective phage is understood as meaning a prophage, in particular the genome thereof, which, as a result of various mutations, has lost the ability to form so-called infectious particles. Defective phages are also called cryptic. Prophages and defective phages are often present in integrated form in the chromosome of their host. Further details exist in the prior art, for example in the textbook by Edward A. Birge (Bacterial and Bacteriophage Genetics, 3rd ed. , Springer-Verlag, New York, USA, 1994) or in the textbook by S. Klaus et al . (Bakterienviren, Gustav Fischer Verlag, Jena, Germany, 1992) .
To produce the coryneform bacteria according to the invention, the nucleotide sequence of the desired ORF, gene or allele, preferably including the expression and/or regulation signals, is isolated, at least two copies are arranged in a row, preferably in tandem arrangement, these are then transferred into the desired coryneform bacterium, preferably with the aid of vectors which do not replicate or replicate to only a limited extent in coryneform bacteria, and those bacteria in which two copies of the ORF, gene or allele are incorporated at the particular desired natural site instead of the singular copy originally present are isolated, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics remaining at the particular natural site (locus) .
The expression and/or regulation signals mentioned, such as, for example, the ribosome binding sites, promoters, binding sites for regulatory proteins, binding sites for regulatory ribonucleic acids and attenuators lying upstream of the coding region of the ORF, gene or allele, are in general in a range of 1-800, 1-600, 1-400, 1-200, 1-100 or 1-50 nucleotides upstream of the coding region. The expression and/or regulation signals mentioned, such as, for example, the transcription terminators lying downstream of the coding region of the ORF, gene or allele, are in general in a range of 1-400, 1-200, 1-100, 1-50 or 1-25 nucleotides downstream of the coding region.
Preferably, also, no residues of sequences of the vectors used or species-foreign DNA, such as, for example, restriction cleavage sites, remain on the flanks of the ORFs, genes or alieles amplified according to the invention. In each case a maximum of 24, preferably a maximum of 12 , particularly preferably a maximum of 6 nucleotides of such DNA optionally remain on the flanks. At least a third copy of the open reading frame (ORF) , gene or allele in question is optionally inserted at a further gene site, or several further gene sites, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the further gene site.
Preferably, also, no residues of sequences of the vectors used or species-foreign DNA, such as, for example, restriction cleavage sites, remain at the further gene site. A maximum of 24, preferably a maximum of 12, particularly preferably a maximum of 6 nucleotides of such DNA upstream or downstream of the ORF, gene or allele incorporated optionally remain at the further gene site.
The invention accordingly also provides a process for the production of coryneform bacteria which produce one or more chemical compounds, characterized in that
a) the nucleotide sequence of a desired ORF, gene or allele, preferably including the expression and/or regulation signals, is isolated
b) at least two copies of the nucleotide sequence of the ORF, gene or allele are arranged in a row, preferably in tandem arrangement
c) the nucleotide sequence obtained according to b) is incorporated in a vector which does not replicate or replicates to only a limited extent in coryneform bacteria,
d) the nucleotide sequence according to b) or c) is transferred into coryneform bacteria, and
e) coryneform bacteria which have at least two copies of the desired ORF, gene or allele at the particular desired natural site instead of the singular copy of the ORF, gene or allele originally present are isolated, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics remaining at the particular natural site (locus), and
f) at least a third copy of the open reading frame (ORF) , gene or allele in question is optionally introduced at a further gene site, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics remaining at the further gene site.
By the measures according to the invention, the productivity of the coryneform bacteria or of the fermentative processes for the preparation of chemical compounds is improved in respect of one or more of the features chosen from the group consisting of concentration (chemical compound formed, based on the unit volume) , yield (chemical compound formed, based on the source of carbon consumed) and product formation rate (chemical compound formed, based on the time) by at least 0.5 - 1.0% or at least 1.0 to 1.5% or at least 1.5 - 2.0%.
Instructions on conventional genetic engineering methods, such as, for example, isolation of chromosomal DNA, plasmid DNA, handling of restriction enzymes etc., are found in Sambrook et al . (Molecular Cloning - A Laboratory Manual (1989) Cold Spring Harbor Laboratory Press) . Instructions on transformation and conjugation in coryneform bacteria are found, inter alia, in Thierbach et al. (Applied Microbiology and Biotechnology 29, 356-362 (1988)), in Schafer et al . (Journal of Bacteriology 172, 1663-1666 (1990) and Gene 145, 69-73 (1994)) and in Schwarzer and Puhler (Bio/Technology 9, 84-87 (1991)).
Vectors which replicate to only a limited extent are understood as meaning plasmid vectors which, as a function of the conditions under which the host or carrier is cultured, replicate or do not replicate. Thus, a temperature-sensitive plasmid for coryneform bacteria which can replicate only at temperatures below 31 -C has been described by Nakamura et al . (US-A-6, 303 , 383 ) .
The invention also provides coryneform bacteria, in particular of the genus Corynebacterium, which produce L- lysine, characterized in that
a) instead of the singular copy of an open reading frame (ORF) , a gene or allele of lysine production naturally present at the particular desired site
(locus) , these have at least two copies of the said open reading frame (ORF) , gene or allele, preferably in tandem arrangement, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the particular site, and in that these
b) optionally have at least a third copy of the said open reading frame (ORF) , gene or allele of L-lysine production at a further gene site, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the further gene site. The invention also furthermore provides a process for the preparation of L-lysine, which comprises the following steps :
a) fermentation of coryneform bacteria, in particular of the genus Corynebacterium, which
i) instead of the singular copy of an open reading frame (ORF) , gene or allele of lysine production present at the particular desired site (locus) , have at least two copies of the open reading frame (ORF) , gene or allele in question, preferably in tandem arrangement, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the particular site, and in that these
ii) optionally have at least a third copy of the open reading frame (ORF) , gene or allele of L-lysine production in question at a further gene site, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the further gene site,
under conditions which allow expression of the said open reading frames (ORFs) , genes or alieles,
b) concentration of the L-lysine in the fermentation broth, c) isolation of the L-lysine from the fermentation broth, optionally
d) with constituents from the fermentation broth and/or the biomass to the extent of > (greater than) 0 to 100%.
A "copy of an open reading frame (ORF) , gene or allele of lysine production" is to be understood as meaning all the, preferably endogenous , open reading frames , genes or alieles of which enhancement/over-expression can have the effect of improving lysine production. Enhancement is understood as meaning an increase in the intracellular concentration or activity of the particular gene product, protein or enzyme.
These include, inter alia, the following open reading frames, genes or alieles: accBC, accDA, cstA, cysD, cysE, cysH, cysK, cysN, cysQ, dapA, dapB, dapC, dapD, dapE, dapF, ddh, dps, eno, gap, gap2 , gdh, gnd, lysC, lysCFBR, lysE, msiK, opcA, oxyR, ppc, ppcFBR, pgk, pknA, pknB, pknD, pknG, ppsA, ptsH, ptsl, ptsM, pyc, pyc P458S, sigC, sigD, sigE, sigH, sigM, tal, thyA, tkt, tpi, zwal, zwf and zwf A213T. These are summarized and explained in Table 1.
These include, in particular, the lysCFBR alieles which code for a "feed back" resistant aspartate kinase. Various lysCFBR alieles are summarized and are explained in Table 2.
The following lysCFBR alieles are preferred: lysC A279T
(replacement of alanine at position 279 of the aspartate kinase protein coded, according to SEQ ID NO: 2, by threonine) , lysC A279V (replacement of alanine at position 279 of the aspartate kinase protein coded, according to SEQ ID NO: 2, by valine), lysC S301F (replacement of serine at position 301 of the aspartate kinase protein coded, according to SEQ ID NO: 2, by phenylalanine), lysC T308I (replacement of threonine at position 308 of the aspartate kinase protein coded, according to SEQ ID NO: 2, by isoleucine) , lysC S301Y (replacement of serine at position 308 of the aspartate kinase protein coded, according to SEQ ID NO: 2, by tyrosine) , lysC G345D (replacement of glycine at position 345 of the aspartate kinase protein coded, according to SEQ ID NO: 2, by aspartic acid), lysC R320G (replacement of arginine at position 320 of the aspartate kinase protein coded, according to SEQ ID NO: 2, by glycine) , lysC T311I (replacement of threonine at position 311 of the aspartate kinase protein coded, according to SEQ ID NO: 2, by isoleucine), lysC S381F (replacement of serine at position 381 of the aspartate kinase protein coded, according to SEQ ID NO: 2, by phenylalanine) .
The lysCFBR allele lysC T311I (replacement of threonine at position 311 of the aspartate kinase protein coded, according to SEQ ID NO: 2, by isoleucine), the nucleotide sequence of which is shown as SEQ ID NO: 3, is particularly preferred; the amino acid sequence of the aspartate kinase protein coded is shown as SEQ ID NO : 4.
The following open reading frames, genes or nucleotide sequences, inter alia, can be used as the "further gene site" which is not essential for growth or lysine production: aecD, ccpAl , ccpA2 , citA, citB, citE, fda, gluA, gluB, gluC, gluD, luxR, luxS, lysRl, lysR2 , lysR3 , menE, mqo, pck, pgi, poxB and zwa2 , in particular the genes aecD, gluA, gluB, gluC, gluD and pck. These are summarized and explained in Table 3. Intergenic regions in the chromosome, that is to say nucleotide sequences without a coding function, can furthermore be used. Finally, prophages or defective phages contained in the chromosome can be used. Table 1
Open reading frames, genes and alieles of lysine production
Figure imgf000018_0001
Figure imgf000019_0001
Figure imgf000020_0001
Figure imgf000021_0001
Figure imgf000022_0001
Table 2
lysC alieles which code for feed back resistant aspartate kinases
Figure imgf000023_0001
Figure imgf000024_0001
Table 3
Further gene sites for integration of open reading frames, genes and alieles of lysine production
Figure imgf000025_0001
Figure imgf000026_0001
Figure imgf000027_0001
The invention accordingly also provides a process for the production of coryneform bacteria which produce L-lysine, characterized in that
a) the nucleotide sequence of a desired ORF, gene or allele of lysine production, optionally including the expression and/or regulation signals, is isolated
b) at least two copies of the nucleotide sequence of the ORF, gene or allele of lysine production are arranged in a row, preferably in tandem arrangement
the nucleotide sequence obtained according to b) is incorporated in a vector which does not replicate or replicates to only a limited extent in coryneform bacteria,
d) the nucleotide sequence according to b) or c) is transferred into coryneform bacteria, and
e) coryneform bacteria which have at least two copies of the desired ORF, gene or allele of lysine production at the particular desired natural site instead of the singular copy of the ORF, gene or allele originally present are isolated, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics remaining at the particular natural site (locus), and optionally
f) at least a third copy of the open reading frame (ORF) , gene or allele of lysine production in question is introduced at a further gene site, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics remaining at the further gene site.
The invention also provides coryneform bacteria, in particular of the genus Corynebacterium, which produce L- methionine and/or L-threonine, characterized in that
a) instead of the singular copy of an open reading frame (ORF) , a gene or allele of methionine production or threonine production naturally present at the particular desired site (locus) , these have at least two copies of the said open reading frame (ORF) , gene or allele, preferably in tandem arrangement, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the particular site, and in that these
b) optionally have at least a third copy of the open reading frame (ORF) , gene or allele of methionine production or threonine production mentioned at a further gene site, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the further gene site.
The invention also furthermore provides a process for the preparation of L-methionine and/or L-threonine, which comprises the following steps:
a) fermentation of coryneform bacteria, in particular of the genus Corynebacterium, which
i) instead of the singular copy of an open reading frame (ORF) , gene or allele of methionine production or threonine production present at the particular desired site (locus) , have at least two copies of the open reading frame (ORF) , gene or allele in question, preferably in tandem arrangement, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the particular site, and
ii) optionally have at least a third copy of the open reading frame (ORF) , gene or allele of methionine production or threonine production in question at a further gene site, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the further gene site,
under conditions which allow expression of the said open reading frames (ORFs) , genes or alieles,
b) concentration of the L-methionine and/or L-threonine in the fermentation broth,
c) isolation of the L-methionine and/or L-threonine from the fermentation broth, optionally
d) with constituents from the fermentation broth and/or the biomass to the extent of > (greater than) 0 to 100%.
A "copy of an open reading frame (ORF) , gene or allele of methionine production" is to be understood as meaning all the, preferably endogenous, open reading frames, genes or alieles of which enhancement/over-expression can have the effect of improving methionine production.
These include, inter alia, the following open reading frames, genes or alieles: accBC, accDA, aecD, cstA, cysD, cysE, cysH, cysK, cysN, cysQ, dps, eno, fda, gap, gap2 , gdh, gnd, glyA, horn, homFBR, lysC, lysCFBR, metA, metB, metE, metH, metY, msiK, opcA, oxyR, ppc, ppcFBR, pgk, pknA, pknB, pknD, pknG, ppsA, ptsH, ptsl, ptsM, pyc, pyc P458S, sigC, sigD, sigE, sigH, sigM, tal, thyA, tkt, tpi, zwal, zwf and zwf A213T. These are summarized and explained in Table 4. These include, in particular, the lysCFBR alieles which code for a "feed back" resistant aspartate kinase (see Table 2) and the homFBR alieles which code for a "feed back" resistant homoserine dehydrogenase.
The at least third, optionally fourth or fifth copy of the open reading frame (ORF) , gene or allele of methionine production in question can be integrated at a further site. The following open reading frames, genes or nucleotide sequences, inter alia, can be used for this: brnE, brnF, brnQ, ccpAl, ccpA2 , citA, citB, citE, ddh, gluA, gluB, gluC, gluD, luxR, luxS, lysRl, lysR2 , lysR3 , menE, metD, metK, pck, pgi, poxB and zwa2. These are summarized and explained in Table 5. Intergenic regions in the chromosome, that is to say nucleotide sequences without a coding function, can furthermore be used. Finally, prophages or defective phages contained in the chromosome can be used for this .
Table 4
Open reading frames , genes and alieles of methionine production
Figure imgf000032_0001
Figure imgf000033_0001
Figure imgf000034_0001
Figure imgf000035_0001
Table 5
Further gene sites for integration of open reading frames, genes and alieles of methionine production
Figure imgf000036_0001
Figure imgf000037_0001
A "copy of an open reading frame (ORF) , gene or allele of threonine production" is to be understood as meaning all the, preferably endogenous, open reading frames, genes or alieles of which enhancement/over-expression can have the effect of improving threonine production.
These include, inter alia, the following open reading frames, genes or alieles: accBC, accDA, cstA, cysD, cysE, cysH, cysI, cysN, cysQ, dps, eno, fda, gap, gap2, gdh, gnd, horn, homFBR, lysC, lysCFBR, msiK, opcA, oxyR, ppc, ppcFBR, pgk, pknA, pknB, pknD, pknG, ppsA, ptsH, ptsl, ptsM, pyc, pyc P458S, sigC, sigD, sigE, sigH, sigM, tal, thyA, tkt, tpi, thrB, thrC, thrE, zwal, zwf and zwf A213T. These are summarized and explained in Table 6. These include, in particular, the lysCFBR alieles which code for a "feed back" resistant aspartate kinase (See Table 2) and the homFBR alieles which code for a "feed back" resistant homoserine dehydrogenase .
The at least third, optionally fourth or fifth copy of the open reading frame (ORF) , gene or allele of threonine production in question can be integrated at a site. The following open reading frames, genes or nucleotide sequences, inter alia, can be used for this: ccpAl, ccpA2 , citA, citB, citE, ddh, gluA, gluB, gluC, gluD, glyA, ilvA, ilvBN, ilvC, ilvD, luxR, luxS, lysRl, lysR2 , lysR3 , mdh, menE, etA, metD, pck, poxB, sigB and zwa2. These are summarized and explained in Table 7. Intergenic regions in the chromosome, that is to say nucleotide sequences without a coding function, can furthermore be used. Finally, prophages or defective phages contained in the chromosome can be used for this. Table 6
Open reading frames, genes and alieles of threonine production
Figure imgf000039_0001
Figure imgf000040_0001
Figure imgf000041_0001
Figure imgf000042_0001
Table 7
Further gene sites for integration of open reading frames, genes and alieles of threonine production
Figure imgf000043_0001
Figure imgf000044_0001
(growth factor 2) EP1108790 AX127146
The invention accordingly also provides a process for the production of coryneform bacteria which produce - methionine and/or L-threonine, characterized in that
a) the nucleotide sequence of a desired ORF, gene or allele of methionine production or threonine production, optionally including the expression and/or regulation signals, is isolated
b) at least two copies of the nucleotide sequence of the ORF, gene or allele of methionine production or threonine production are arranged in a row, preferably in tandem arrangement
c) the nucleotide sequence obtained according to b) is incorporated in a vector which does not replicate or replicates to only a limited extent in coryneform bacteria,
d) the nucleotide sequence according to b) or c) is transferred into coryneform bacteria, and
e) coryneform bacteria which have at least two copies of the desired ORF, gene or allele of methionine or threonine production at the particular desired natural site instead of the singular copy of the ORF, gene or allele originally present are isolated, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics remaining at the particular natural site (locus) , and optionally
f) at least a third copy of the open reading frame (ORF) , gene or allele of methionine production or threonine production in question is introduced at a further gene site, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics remaining at the further gene site.
The invention also provides coryneform bacteria, in particular of the genus Corynebacterium, which produce L- valine, characterized in that
a) instead of the singular copy of an open reading frame (ORF) , a gene or allele of valine production naturally present at the particular desired site (locus) , these have at least two copies of the said open reading frame (ORF) , gene or allele, preferably in tandem arrangement, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the particular site, and in that these
b) optionally have at least a third copy of the open reading frame (ORF) , gene or allele of valine production mentioned at a further gene site, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the further gene site.
The invention also furthermore provides a process for the preparation of L-valine, which comprises the following steps : a) fermentation of coryneform bacteria, in particular of the genus Corynebacterium, which
i) instead of the singular copy of an open reading frame (ORF) , gene or allele of valine production present at the particular desired site (locus) , have at least two copies of the open reading frame (ORF) , gene or allele in question, preferably in tandem arrangement, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the particular site, and
ii) optionally have at least a third copy of the open reading frame (ORF) , gene or allele of valine production in question at a further gene site, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the further gene site,
under conditions which allow expression of the said open reading frames (ORFs) , genes or alieles,
b) concentration of the L-valine in the fermentation broth,
c) isolation of the L-valine from the fermentation broth, optionally
d) with constituents from the fermentation broth and/or the biomass to the extent of > (greater than) 0 to 100%. A "copy of an open reading frame (ORF) , gene or allele of valine production" is to be understood as meaning all the, preferably endogenous, open reading frames, genes or alieles of which enhancement/over-expression can have the effect of improving valine production.
These include, inter alia, the following open reading frames, genes or alieles: brnE, brnF, brnEF, cstA, cysD, dps, eno, fda, gap, gap2, gdh, ilvB, ilvN, ilvBN, ilvC, ilvD, ilvE msiK, pgk, ptsH, ptsl, ptsM, sigC, sigD, sigE, sigH, sigM, tpi and zwal. These are summarized and explained in Table 8. These include in particular the acetolactate synthase ilvBN alieles which code for a valine-resistant .
The at least third, optionally fourth or fifth copy of the open reading frame (ORF) , gene or allele of valine production in question can be integrated at a further site. The following open reading frames, genes or nucleotide sequences, inter alia, can be used for this: aecD, ccpAl, ccpA2, citA, citB, citE, ddh, gluA, gluB, gluC, gluD, glyA, ilvA, luxR, lysRl, lysR2 , lysR3 , panB, panC, poxB and zwa2. These are summarized and explained in Table 9. Intergenic regions in the chromosome, that is to say nucleotide sequences without a coding function, can furthermore be used. Finally, prophages or defective phages contained in the chromosome can be used for this.
Table 8
Open reading frames, genes and alieles of valine production
Figure imgf000049_0001
Figure imgf000050_0001
Table 9
Further gene sites for integration of open reading frames, genes and alieles of valine production
Figure imgf000051_0001
Figure imgf000052_0001
The invention accordingly also provides a process for the production of coryneform bacteria which produce L-valine, characterized in that
a) the nucleotide sequence of a desired ORF, gene or allele of valine production, optionally including the expression and/or regulation signals, is isolated
b) at least two copies of the nucleotide sequence of the ORF, gene or allele of valine production are arranged in a row, preferably in tandem arrangement
c) the nucleotide sequence obtained according to b) is incorporated in a vector which does not replicate or replicates to only a limited extent in coryneform bacteria, d) the nucleotide sequence according to b) or c) is transferred into coryneform bacteria, and
e) coryneform bacteria which have at least two copies of the desired open ORF, gene or allele of valine production at the particular desired natural site instead of the singular copy of the ORF, gene or allele originally present are isolated, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics remaining at the particular natural site (locus) , and optionally
f) at least a third copy of the open reading frame (ORF) , gene or allele of valine production in question is introduced at a further gene site, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics remaining at the further gene site.
During work on the present invention, it was possible to incorporate two copies, arranged in tandem, of an lysCFBR allele at the lysC gene site of Corynebacterium glutamicum such that no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics remain at the lysC gene site. Such a strain is, for example, the strain DSMl39921ysCFBR: :lysCFBR.
The plasmid pKl8mobsacB2xlysCSma2/l, with the aid of which two copies of an lysCFBR allele can be incorporated into the lysC gene site of Corynebacterium glutamicum, is shown in Figure 1. During work on the present invention, it was furthermore possible to incorporate two copies, arranged in tandem, of the lysE gene at the lysE gene site of Corynebacterium glutamicum such that no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics remained at the lysE gene site. Such a strain is, for example, the strain ATCC21513_171ysE: :lysE.
A plasmid with the aid of which two copies of an lysE gene can be incorporated into the lysE gene site of Corynebacterium glutamicum is shown in Figure 2. It carries the name pKl8mobsacB2xlysESmal/l .
During work on the present invention, finally, it was possible to incorporate two copies, arranged in tandem, of the zwal gene at the zwal gene site of Corynebacterium glutamicum such that no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics remained at the zwal gene site. Such a strain is, for example, the strain ATCC21513_17zwal : : zwal .
A plasmid with the aid of which two copies of a zwal gene can be incorporated into the zwal gene site of Corynebacterium glutamicum is shown in Figure 3. It carries the name p lδmobsacBzwalzwal .
The coryneform bacteria produced according to the invention can be cultured continuously or discontinuously in the batch process (batch culture) or in the fed batch (feed process) or repeated fed batch process (repetitive feed process) for the purpose of production of chemical compounds. A summary of known culture methods is described in the textbook by Chmiel (Bioprozesstechnik 1. Einfϋhrung in die Bioverfahrenstechnik (Gustav Fischer Verlag, Stuttgart, 1991) ) or in the textbook by Storhas (Bioreaktoren und periphere Einrichtungen (Vieweg Verlag, Braunschweig/Wiesbaden, 1994)).
The culture medium to be used must meet the requirements of the particular strains in a suitable manner. Descriptions of culture media for various microorganisms are contained in the handbook "Manual of Methods for General Bacteriology" of the American Society for Bacteriology (Washington D.C. , USA, 1981).
Sugars and carbohydrates, such as e.g. glucose, sucrose, lactose, fructose, maltose, molasses, starch and cellulose, oils and fats, such as e.g. soya oil, sunflower oil, groundnut oil and coconut fat, fatty acids, such as e.g. palmitic acid, stearic acid and linoleic acid, alcohols, such as e.g. glycerol and ethanol, and organic acids, such as e.g. acetic acid or lactic acid, can be used as the source of carbon. These substances can be used individually or as a mixture.
Organic nitrogen-containing compounds, such as peptones, yeast extract, meat extract, malt extract, corn steep liquor, soya bean flour and urea, or inorganic compounds, such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate, can be used as the source of nitrogen. The sources of nitrogen can be used individually or as a mixture.
Phosphoric acid, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium- containing salts can be used as the source of phosphorus . The culture medium must furthermore comprise salts of metals, such as e.g. magnesium sulfate or iron sulfate, which are necessary for growth. Finally, essential growth substances, such as amino acids and vitamins, can be employed in addition to the above-mentioned substances . Suitable precursors can moreover be added to the culture medium. The starting substances mentioned can be added to the culture in the form of a single batch, or can be fed in during the culture in a suitable manner.
Basic compounds, such as sodium hydroxide, potassium hydroxide, ammonia or aqueous ammonia, or acid compounds, such as phosphoric acid or sulfuric acid, can be employed in a suitable manner to control the pH of the culture. Antifoams, such as e.g. fatty acid polyglycol esters, can be employed to control the development of foam. Suitable substances having a selective action, such as e.g. antibiotics, can be added to the medium to maintain the stability of plasmids. To maintain aerobic conditions, oxygen or oxygen-containing gas mixtures, such as e.g. air, are introduced into the culture. The temperature of the culture is usually 202C to 45 aC, and preferably 25aC to 40aC. Culturing is continued until a maximum of the desired chemical compound has formed. This target is usually reached within 10 hours to 160 hours.
It has been found that the coryneform bacteria according to the invention, in particular the coryneform bacteria which produce L-lysine, have an unexpectedly high stability. They were stable for at least 10-20, 20-30, 30-40, 40-50, preferably at least 50-60, 60-70, 70-80 and 80-90 generations or cell division cycles .
The following microorganisms have been deposited:
The Corynebacterium glutamicum strain
DSMl39921ysCFBR: :lysCFBR was deposited in the form of a pure culture on 5th June 2002 under number DSM15036 at the Deutsche Sammlung fur Mikroorganismen und Zellkulturen (DSMZ, Braunschweig, Germany) in accordance with the Budapest Treaty. The plasmid pKl8mobsacB2xlysCSma2/l was deposited in the form of a pure culture of the strain E. coli DH5ocmcr/ pKl8mobsacB2xlysCSma2/l (= DH5alphamcr/ pKl8mobsacB2xlysCSma2/l) on 20th April 2001 under number DSM14244 at the Deutsche Sammlung fur Mikroorganismen und Zellkulturen (DSMZ, Braunschweig, Germany) in accordance with the Budapest Treaty.
The Corynebacterium glutamicum strain
ATCC21513_171ysE: :lysE was deposited in the form of a pure culture on 5th June 2002 under number DSM15037 at the Deutsche Sammlung fur Mikroorganismen und Zellkulturen (DSMZ, Braunschweig, Germany) in accordance with the Budapest Treaty.
The Corynebacterium glutamicum strain ATCC21513_17zwal : : zwal was deposited in the form of a pure culture on 5th June 2002 under number DSM15038 at the Deutsche Sammlung fur Mikroorganismen und Zellkulturen (DSMZ, Braunschweig, Germany) in accordance with the Budapest Treaty.
Example 1
Generation of a tandem duplication of the lysCFBR allele lysC T311I in the chromosome of Corynebacterium glutamicum
1.1. Construction of the tandem vector pKl8mobsacB2xlysCSma2/l
From the Corynebacterium glutamicum strain DSM13994, chromosomal DNA is isolated by the conventional methods (Eikmanns et al . , Microbiology 140: 1817 - 1828 (1994)).
The strain DSM13994 was produced by multiple, non-directed mutagenesis, selection and mutant selection from C. glutamicum ATCC13032. The strain is resistant to the lysine analogue S- (2-aminoethyl) -L-cysteine and has a feed back- resistant aspartate kinase which is insensitive to inhibition by a mixture of lysine and threonine (in each case 25 mM) . The nucleotide sequence of the lysCFBR allele is shown as SEQ ID NO: 3. It is also called lysC T311I in the following. The amino acid sequence of the aspartate kinase protein coded is shown as SEQ ID NO: 4. A pure culture of this strain was deposited on 16th January 2001 at the Deutsche Sammlung fur Mikroorganismen und Zellkulturen (DSMZ, Braunschweig, Germany) in accordance with the Budapest Treaty.
With the aid of the polymerase chain reaction, a DNA section which carries the lysC gene or allele is amplified. On the basis of the sequence of the lysC gene known for C. glutamicum (Kalinowski et al . , Molecular Microbiology, 5 (5), 1197 - 1204(1991); Accession Number X57226), the following primer oligonucleotides were chosen for the PCR:
lysClbeg (SEQ ID No: 15):
5X TA(G GAT CC)T CCG GTG TCT GAC CAC GGT G 3
lysC2end: (SEQ ID NO: 16):
5 AC(G GAT CC)G CTG GGA AAT TGC GCT CTT CC 3N
The primers shown are synthesized by MWG Biotech and the PCR reaction is carried out by the standard PCR method of Innis et al . (PCR Protocols. A Guide to Methods and Applications, 1990, Academic Press) . The primers allow amplification of a DNA section of approx. 1.7 kb in length, which carries the lysC gene or allele. The primers moreover contain the sequence for a cleavage site of the restriction endonuclease BamHI, which is marked by parentheses in the nucleotide sequence shown above.
The amplified DNA fragment of approx. 1.7 kb in length which carries the lysCFBR allele lysC T311I of the strain
DSM13994 is identified by electrophoresis in a 0.8% agarose gel, isolated from the gel and purified by conventional methods (QIAquick Gel Extraction Kit, Qiagen, Hilden) . Ligation of the fragment is then carried out by means of the Topo TA Cloning Kit (Invitrogen, Leek, The Netherlands, Cat. Number K4600-01) in the vector pCRII-TOPO. The ligation batch is transformed in the E. coli strain TOP10 (Invitrogen, Leek, The Netherlands) . Selection of plasmid- carrying cells is made by plating out the transformation batch on kanamycin (50 mg/1) -containing LB agar with X-Gal (5-bromo-4-chloro-3-indolyl β-D-galactopyranoside, 64 mg/1) .
The plasmid obtained is checked by means of restriction cleavage, after isolation of the DNA, and identified in agarose gel. The resulting plasmid is called pCRIITOPOlysC.
The nucleotide sequence of the amplified DNA fragment or PCR product is determined by the dideoxy chain termination method of Sanger et al . (Proceedings of the National
Academy of Sciences USA, 74:5463-5467 (1977)) using the "ABI Prism 377" sequencing apparatus of PE Applied Biosysterns (Weiterstadt, Germany) . The sequence of the coding region of the PCR product is shown in SEQ ID No : 3. The amino acid sequence of the associated aspartate kinase protein is shown in SEQ ID NO: 4.
The base thymine is found at position 932 of the nucleotide sequence of the coding region of the lysCFBR allele of strain DSM13994 (SEQ ID NO: 3) . The base cytosine is found at the corresponding position of the wild-type gene (SEQ ID NO: 1) .
The amino acid isoleucine is found at position 311 of the amino acid sequence of the aspartate kinase protein of strain DSM13994 (SEQ ID No: 4) . The amino acid threonine is found at the corresponding position of the wild-type protein (SEQ ID No: 2) .
The lysC allele, which contains the base thymine at position 932 of the coding region and accordingly codes for an aspartate kinase protein which contains the amino acid isoleucine at position 311 of the amino acid sequence, is called the lysCFBR allele lysC T311I in the following.
The plasmid pCRIITOPOlysC, which carries the lysCFBR allele lysC T311I, was deposited in the form of a pure culture of the strain E. coli TOP 10/pCRIITOPOlysC under number DSM14242 on 20th April 2001 at the Deutsche Sammlung fur Mikroorganismen und Zellkulturen (DSMZ = German Collection of Microorganisms and Cell Cultures, Braunschweig, Germany) in accordance with the Budapest Treaty.
Plasmid DNA was isolated from the strain DSM14242, which carries the plasmid pCRIITOPOlysC, and cleaved with the restriction enzyme BamHI (Amersham-Pharmacia, Freiburg, Germany), after separation in an agarose gel (0.8%) the lysCFBR-containing DNA fragment approx. 1.7 kb long is isolated from the agarose gel with the aid of the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) , and the overhanging ends are completed with Klenow polymerase (Boehringer Mannheim) and employed for ligation with the mobilizable cloning vector pKlδmobsacB described by Schafer et al., Gene, 14, 69-73 (1994). This is cleaved beforehand with the restriction enzyme Smal and dephosphorylated with alkaline phosphatase (Alkaline Phosphatase, Boehringer Mannheim) , mixed with the lysCFBR-containing fragment of approx. 1.7 kb and the mixture is treated with T4 DNA Ligase (Amersham- harmacia, Freiburg, Germany) .
The E. coli strain DH5α (Grant et al.; Proceedings of the National Academy of Sciences USA, 87 (1990) 4645-4649) is then transformed with the ligation batch (Hanahan, In. DNA Cloning. A Practical Approach. Vol. 1, ILR-Press, Cold Spring Harbor, New York, 1989) . Selection of plas id- carrying cells is made by plating out the transformation batch on LB agar (Sambrook et al . , Molecular Cloning: A Laboratory Manual. 2nd Ed., Cold Spring Harbor, New York, 1989) , which was supplemented with 25 mg/1 kanamycin. Plasmid DNA is isolated from a transformant with the aid of the QIAprep Spin Miniprep Kit from Qiagen and checked by restriction cleavage with the enzyme HindiII and subsequent agarose gel electrophoresis. The plasmid is called pKl8mobsacBlxlysCSma2.
In a second step, the plasmid pCRII-TOPOlysC is in turn cleaved with the restriction enzyme BamHI (Amersham- Pharmacia, Freiburg, Germany) , after separation in an agarose gel (0.8%) the lysCFBR-containing fragment of approx. 1.7 kb was isolated from the agarose gel with the aid of the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) and employed for ligation with the vector pKl8mobsacBlxlysCSma2 described in this Example. This is cleaved beforehand with the restriction enzyme BamHI and dephosphorylated with alkaline phosphatase (Alkaline
Phosphatase, Boehringer Mannheim) , mixed with the lysCFBR- containing fragment of approx. 1.7 kb and the mixture is treated with T4 DNA Ligase (Amersham-Pharmacia, Freiburg, Germany) .
The E. coli strain DH5α (Grant et al . ; Proceedings of the National Academy of Sciences USA, 87 (1990) 4645-4649) is then transformed with the ligation batch (Hanahan, In. DNA Cloning. A Practical Approach. Vol. 1, ILR-Press, Cold Spring Harbor, New York, 1989) . Selection of plasmid- carrying cells is made by plating out the transformation batch on LB agar (Sambrook et al., Molecular Cloning: A Laboratory Manual. 2nd Ed., Cold Spring Harbor, New York, 1989), which was supplemented with 25 mg/1 kanamycin.
Plasmid DNA is isolated from a transformant with the aid of the QIAprep Spin Miniprep Kit from Qiagen and checked by restriction cleavage with the enzyme Hindlll and subsequent agarose gel electrophoresis. The plasmid is called pKl8mobsacB2xlysCSma2/l. A map of the plasmid is shown in Figure 1. The plasmid pKl8mobsacB2xlysCSma2/l was deposited in the form of a pure culture of the strain E. coli DH5αmcr/ pKl8mobsacB2xlysCSma2/l (= DH5alphamcr/ pK18mobsacB2xlysCSma2/l) on 20th April 2001 under number DSM14244 at the Deutsche Sammlung fur Mikroorganismen und Zellkulturen (DSMZ, Braunschweig, Germany) in accordance with the Budapest Treaty.
1.2. Generation of a tandem duplication of the lysCFBR allele lysC T311I in C. glutamicum strain DSM13992
The vector pKl8mobsacB2xlysCSma2/l mentioned in Example 1.1 is transferred by a modified protocol of Schafer et al . (1990 Journal of Microbiology 172: 1663-1666) into the C. glutamicum strain DSM13992.
The Corynebacterium glutamicum strain DSM13992 was produced by multiple, non-directed mutagenesis, selection and mutant selection from C. glutamicum ATCC13032. The strain is resistant to the antibiotic streptomycin and phenotypically resistant to the lysine analogue S- (2-aminoethyl) -L- cysteine. However, the strain has a wild-type aspartate kinase (see SEQ ID NO:l and 2), which is sensitive to inhibition by a mixture of lysine and threonine (in each case 25 mM) . A pure culture of this strain was deposited on 16th January 2001 at the Deutsche Sammlung fur Mikroorganismen und Zellkulturen (DSMZ, Braunschweig, Germany) in accordance with the Budapest Treaty.
The vector pKl8mobsacB2xlysCSma2/l cannot replicate independently in DSM13992 and is retained in the cell only if it has integrated into the chromosome.
Selection of clones with integrated pKl8mobsacB2xlysCSma2/l is carried out by plating out the conjugation batch on LB agar (Sambrook et al . , Molecular Cloning: A Laboratory Manual. 2nd Ed., Cold Spring Harbor, New York, 1989), which was supplemented with 15 mg/1 kanamycin and 50 mg/1 nalidixic acid. Clones which have grown on are plated out on LB agar plates with 25 mg/1 kanamycin and incubated for 16 hours at 33°C. To achieve excision of the plasmid with only one copy of the lysC gene, the clones are cultured on LB agar with 10% sucrose, after incubation for 16 hours in LB liquid medium. The plasmid pKl8mobsacB contains a copy of the sacB gene, which converts sucrose into levan sucrase, which is toxic to C. glutamicum.
Only those clones in which the pKl8mobsacB2xlysCSma2/l integrated has been excised again therefore grow on LB agar with sucrose. Approximately 40 to 50 colonies are tested for the phenotype "growth in the presence of sucrose" and "non-growth in the presence of kanamycin" . During the excision, either two copies of the lysC gene or only one can be excised together with the plasmid.
To demonstrate that two copies of lysC have remained in the chromosome, approximately 20 colonies which show the phenotype "growth in the presence of sucrose" and "non- growth in the presence of kanamycin" are investigated with the aid of the polymerase chain reaction by the standard
PCR method of Innis et al. (PCR Protocols. A Guide to Methods and Applications, 1990, Academic Press) . A DNA fragment which carries the lysC gene and surrounding regions is amplified here from the chromosomal DNA of the colonies. The following primer oligonucleotides are chosen for the PCR.
lysCKl (SEQ ID NO: 5) :
5X TCG GTG TCA TCA GAG CAT TG 3X
lysCK2 (SEQ ID NO: 6) : 5 TCG GTT GCC TGA GTA ATG TC 3V
The primers allow amplification of a DNA fragment approx. 1.9 kb in size in control clones with the original lysC locus. In clones with a second copy of the lysC gene in the chromosome at the lysC locus, DNA fragments with a size of approx. 3.6 kb are amplified.
The amplified DNA fragments are identified by means of electrophoresis in a 0.8% agarose gel. On the basis of the amplified fragment length, a distinction was made between clones with one chromosomal lysC gene copy and clones with two chromosomal lysC gene copies .
10 clones with two complete copies of the lysC gene on the chromosome are investigated with the aid of the LightCycler of Roche Diagnostics (Mannheim, Germany) in order to demonstrate whether the two copies are lysCFBR alieles with the mutation lysC T311I or whether the original wild-type lysC is present alongside an lysCFBR allele lysC T311I. The LightCycler is a combined apparatus of Thermocycler and flourimeter.
A DNA section approx. 500 bp in length which contains the mutation site is amplified in the first phase by means of a PCR (Innis et al . , PCR Protocols. A Guide to Methods and Applications, 1990, Academic Press) using the following primer oligonucleotides.
LC-lysCl-fbr (SEQ ID No : 7): 5" aaccgttctgggtatttccg 3
LC-lysC2-fbr (SEQ ID No: 8): 5 tccatgaactctgcggtaac 3
In the second phase, with two additional oligonucleotides of different lengths and marked with different fluorescent dyestuffs (LightCycler (LC) -Red640 and fluorescein) , which hybridize in the region of the mutation site, the presence of the mutation is detected with the aid of the "Fluorescence Resonance Energy Transfer" method (FRET) using a melting curve analysis (Lay et al . , Clinical Chemistry, 43:2262-2267 (1997)). lysC311-C (SEQ ID No : 9) :
5 LC-Red640 - gcaggtgaagatgatgtcggt - (P) 3
lysC311-A (SEQ ID No: 10) :
5X tcaagatctccatcgcgcggcggccgtcggaacga - fluorescein 3
The primers shown are synthesized for the PCR by MWG
Biotech and oligonucleotides shown for the hybridization are synthesized by TIB MOLBIOL (Berlin, Germany) .
A clone which contains the base thymine at position 932 of the coding regions of the two lysC copies and thus has two lysCFBR alieles lysC T311I was identified in this manner.
The strain was called C. glutamicum DSMl39921ysCFBR: : lysCFBR.
The strain was deposited as C. glutamicum DSMl39921ysCFBR: :lysCFBR on 5th June 2002 under number DSM15036 at the Deutsche Sammlung fur Mikroorganismen und Zellkulturen (DSMZ, Braunschweig, Germany) in accordance with the Budapest Treaty.
Example 2
Generation of a tandem duplication of the lysE gene in the chromosome of Corynebacterium glutamicum
2.1. Construction of the tandem vector pKl8mobsacB2xlysESmal/1
Plasmid DNA was isolated from the Escherichia coli strain DSM12871 (EP-A-1067193) , which carries the plasmid pEC71ysE.
The plasmid contains the lysE gene which codes for lysine export. A pure culture of this strain was deposited on 10th June 1999 at the Deutsche Sammlung fiir Mikroorganismen und Zellkulturen (DSMZ, Braunschweig, Germany) in accordance with the Budapest Treaty. The plasmid pEC711ysE is cleaved with the restriction enzyme BamHI (Amersham-Pharmacia, Freiburg, Germany) , after separation in an agarose gel (0.8%) the lysE fragment of approx. 1.1 kb is isolated from the agarose gel with the aid of the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) , and the overhanging ends are completed with Klenow polymerase (Boehringer Mannheim) and employed for ligation with the mobilizable cloning vector pKlδmobsacB described by Schafer et al . , Gene, 14, 69-73 (1994). This is cleaved beforehand with the restriction enzyme Smal and dephosphorylated with alkaline phosphatase (Alkaline Phosphatase, Boehringer Mannheim) , mixed with the lysE fragment of approx. 1.1 kb and the mixture is treated with T4 DNA Ligase (Amersham-Pharmacia, Freiburg, Germany) .
The E. coli strain DH5α (Grant et al . ; Proceedings of the National Academy of Sciences USA, 87 (1990) 4645-4649) is then transformed with the ligation batch (Hanahan, In. DNA Cloning. A Practical Approach. Vol. 1, ILR-Press, Cold Spring Harbor, New York, 1989) . Selection of plasmid- carrying cells is made by plating out the transformation batch on LB agar (Sambrook et al . , Molecular Cloning: A Laboratory Manual. 2nd Ed., Cold Spring Harbor, New York, 1989), which was supplemented with 25 mg/1 kanamycin.
Plasmid DNA is isolated from a transformant with the aid of the QIAprep Spin Miniprep Kit from Qiagen and checked by restriction cleavage with the enzymes BamHI and EcoRI and subsequent agarose gel electrophoresis. The plasmid is called pKlδmobsacBlxlysESmal .
In a second step, the plasmid pEC71ysE is in turn cleaved with the restriction enzyme BamHI (Amersham-Pharmacia, Freiburg, Germany) , after separation in an agarose gel (0.8%) the lysE fragment of approx. 1.1 kb was isolated from the agarose gel with the aid of the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) and employed for ligation with the vector pKl8mobsacBlxlysESmal described in this Example. This is cleaved beforehand with the restriction enzyme BamHI and dephosphorylated with alkaline phosphatase (Alkaline Phosphatase, Boehringer Mannheim) , mixed with the lysE fragment of approx. 1.1 kb and the mixture is treated with T4 DNA Ligase (Amersham-Pharmacia, Freiburg, Germany) .
The E. coli strain DH5α (Grant et al . ; Proceedings of the National Academy of Sciences USA, 87 (1990) 4645-4649) is then transformed with the ligation batch (Hanahan, In. DNA Cloning. A Practical Approach. Vol. 1, ILR-Press, Cold Spring Harbor, New York, 1989) . Selection of plasmid- carrying cells is made by plating out the transformation batch on LB agar (Sambrook et al . , Molecular Cloning: A Laboratory Manual. 2nd Ed., Cold Spring Harbor, New York, 1989), which was supplemented with 25 mg/1 kanamycin.
Plasmid DNA is isolated from a transformant with the aid of the QIAprep Spin Miniprep Kit from Qiagen and checked by restriction cleavage with the enzymes EcoRI and Sail or Seal and subsequent agarose gel electrophoresis. The plasmid is called pKl8mobsacB2xlysESmal/l . A map of the plasmid is shown in Figure 2.
2.2. Generation of a tandem duplication of the lysE gene in C. glutamicum strain ATCC21513_17
The vector pKl8mobsacB2xlysESmal/l mentioned in Example 2.1 is transferred by a modified protocol of Schafer et al .
(1990 Journal of Microbiology 172: 1663-1666) into the C. glutamicum strain ATCC21513_17.
The Corynebacterium glutamicum strain ATCC21513_17 was produced by multiple, non-directed mutagenesis, selection and mutant selection from C. glutamicum ATCC21513. The strain is resistant to the lysine analogue S-(2- aminoethyl) -L-cysteine and both leucine- and homoserine- prototrophic. The vector cannot replicate independently in ATCC21513_17 and is retained in the cell only if it has integrated into the chromosome.
Selection of clones with integrated pKl8mobsacB2xlysESmal/l is carried out by plating out the conjugation batch on LB agar (Sambrook et al . , Molecular Cloning: A Laboratory Manual. 2nd Ed., Cold Spring Harbor, New York, 1989), which was supplemented with 15 mg/1 kanamycin and 50 mg/1 nalidixic acid. Clones which have grown on are plated out on LB agar plates with 25 mg/1 kanamycin and incubated for 16 hours at 33 °C. To achieve excision of the plasmid with only one copy of the lysE gene, the clones are cultured on LB agar with 10% sucrose, after incubation for 16 hours in LB liquid medium. The plasmid pKlδmobsacB contains a copy of the sacB gene, which converts sucrose into levan sucrase, which is toxic to C. glutamicum.
Only those clones in which the pKl8mobsacB2xlysESmal/l integrated has been excised again therefore grow on LB agar with sucrose. Approximately 40 to 50 colonies are tested for the phenotype "growth in the presence of sucrose" and "non-growth in the presence of kanamycin" . During the excision, either two copies of the lysE gene or only one can be excised together with the plasmid.
To demonstrate that two copies of lysE have remained in the chromosome, approximately 20 colonies which show the phenotype "growth in the presence of sucrose" and "non- growth in the presence of kanamycin" are investigated with the aid of the polymerase chain reaction by the standard PCR method of Innis et al . (PCR Protocols. A Guide to Methods and Applications, 1990, Academic Press) . A DNA fragment which carries the lysE gene and surrounding regions is amplified here from the chromosomal DNA of the colonies. The following primer oligonucleotides are chosen for the PCR. lysEK-1 ( SEQ ID NO : 11 ) :
5N TGC TTG CAC AAG GAC TTC AC 3X
lysEK-2 (SEQ ID NO : 12) :
5X TAT GGT CCG CAA GCT CAA TG 3 "
The primers allow amplification of a DNA fragment approx. 1.2 kb in size in control clones with the original lysE locus. In clones with a second copy of the lysC gene in the chromosome at the lysE locus, DNA fragments with a size of approx. 2.3 kb are amplified.
The amplified DNA fragments are identified by means of electrophoresis in a 0.8% agarose gel. On the basis of the amplified fragment length, a distinction was made between clones with one chromosomal lysE gene copy and clones with two chromosomal lysE gene copies . It could thus be demonstrated that the strain ATCC21513_17 carries two complete copies of the lysE gene on the chromosome.
The strain was called C. glutamicum ATCC21513_171ysE: :lysE.
The strain was deposited as C. glutamicum ATCC21513_171ysE: : lysE on 5th June 2002 under number DSM15037 at the Deutsche Sammlung fiir Mikroorganismen und Zellkulturen (DSMZ, Braunschweig, Germany) in accordance with the Budapest Treaty.
Example 3
Generation of a tandem duplication of the zwal gene in the chromosome of Corynebacterium glutamicum
3.1. Construction of the tandem vector pKlδmobsacBzwalzwal
Plasmid DNA was isolated from the Escherichia coli strain DSM13115 (EP-A-1111062) , which carries the plasmid pCR2.1zwalexp. The plasmid contains the zwal gene which codes for cell growth factor 1. A pure culture of this strain was deposited on 19th October 1999 at the Deutsche Sammlung fiir Mikroorganismen und Zellkulturen (DSMZ, Braunschweig, Germany) in accordance with the Budapest Treaty.
The plasmid pCR2. lzwalexp is cleaved with the restriction enzyme EcoRI (Amersham-Pharmacia, Freiburg, Germany) , and after separation in an agarose gel (0.8%) the zwal fragment of 1 kb is isolated from the agarose gel with the aid of the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) and employed for ligation with the mobilizable cloning vector pKlδmobsacB described by Schafer et al . , Gene, 14, 69-73 (1994) . This is cleaved beforehand with the restriction enzyme EcoRI and dephosphorylated with alkaline phosphatase (Alkaline Phosphatase, Boehringer Mannheim) , mixed with the zwal fragment of 1 kb and the mixture is treated with T4 DNA Ligase (Amersham-Pharmacia, Freiburg, Germany) .
The E. coli strain DH5 (Grant et al . ; Proceedings of the National Academy of Sciences USA, 87 (1990) 4645-4649) is then transformed with the ligation batch (Hanahan, In. DNA Cloning. A Practical Approach. Vol. 1, ILR-Press, Cold Spring Harbor, New York, 1989) . Selection of plasmid- carrying cells is made by plating out the transformation batch on LB agar (Sambrook et al . , Molecular Cloning: A Laboratory Manual. 2nd Ed., Cold Spring Harbor, New York, 1989), which was supplemented with 25 mg/1 kanamycin.
Plasmid DNA is isolated from a transformant with the aid of the QIAprep Spin Miniprep Kit from Qiagen and checked by restriction cleavage with the enzyme Nhel and subsequent agarose gel electrophoresis. Checking of the plasmid showed that two zwal fragments were cloned simultaneously and in the desired orientation in the cloning vector pKlδmobsac. The plasmid is called pK18mobsacBzwalzwal . A map of the plasmid is shown in Figure 3.
3.2. Generation of a tandem duplication of the zwal gene in C. glutamicum strain ATCC21513_17
The vector pKlδmobsacBzwalzwal mentioned in Example 3.1 is transferred by a modified protocol of Schafer et al . (1990 Journal of Microbiology 172: 1663-1666) into the C. glutamicum strain ATCC21513_17.
The Corynebacterium glutamicum strain ATCC21513_17 was produced by multiple, non-directed mutagenesis, selection and mutant selection from C. glutamicum ATCC21513. The strain is resistant to the lysine analogue S- (2- aminoethyl) -L-cysteine and both leucine- and homoserine- prototrophic .
The vector cannot replicate independently in ATCC21513_17 and is retained in the cell only if it has integrated into the chromosome.
Selection of clones with integrated pKlβmobsacBzwalzwal is carried out by plating out the conjugation batch on LB agar (Sambrook et al . , Molecular Cloning: A Laboratory Manual. 2nd Ed., Cold Spring Harbor, New York, 1989), which was supplemented with 15 mg/1 kanamycin and 50 mg/1 nalidixic acid. Clones which have grown on are plated out on LB agar plates with 25 mg/1 kanamycin and incubated for 16 hours at 33°C. To achieve excision of the plasmid with only one copy of the zwal gene, the clones are cultured on LB agar with 10% sucrose, after incubation for 16 hours in LB liquid medium. The plasmid pKlδmobsacB contains a copy of the sacB gene, which converts sucrose into levan sucrase, which is toxic to C. glutamicum.
Only those clones in which the pKlδmobsacBzwalzwal integrated has been excised again therefore grow on LB agar with sucrose. Approximately 40 to 50 colonies are tested for the phenotype "growth in the presence of sucrose" and "non-growth in the presence of kanamycin" . During the excision, either two copies of the zwal gene or only one can be excised together with the plasmid.
To demonstrate that two copies of zwal have remained in the chromosome, approximately 20 colonies which show the phenotype "growth in the presence of sucrose" and "non- growth in the presence of kanamycin" are investigated with the aid of the polymerase chain reaction by the standard PCR method of Innis et al . (PCR Protocols. A Guide to Methods and Applications, 1990, Academic Press) . A DNA fragment which carries the zwal gene and surrounding regions is amplified here from the chromosomal DNA of the colonies. The following primer oligonucleotides are chosen for the PCR.
zwal-A2 (SEQ ID NO: 13):
5" CAC TTG TCC TCA CCA CTT TC 3
zwal-El (SEQ ID NO: 14) :
5 TTC TAG TGG GCG TAC TTT CG 3
The primers allow amplification of a DNA fragment approx. 1.3 kb in size in control clones with the original zwal locus. In clones with a second copy of the zwal gene in the chromosome at the zwal locus, DNA fragments with a size of approx. 2.3 kb are amplified.
The amplified DNA fragments are identified by means of electrophoresis in a 0.8% agarose gel. On the basis of the amplified fragment length, a distinction was made between clones with one chromosomal zwal gene copy and clones with two chromosomal zwal gene copies . It could thus be demonstrated that the strain ATCC21513_17 carries two complete copies of the zwal gene on the chromosome.
The strain was called C. glutamicum ATCC21513_17zwal : : zwal . The strain was deposited as C. glutamicum ATCC21513_17zwal: : zwal on 5th June 2002 under number DSM15038 at the Deutsche Sammlung fiir Mikroorganismen und Zellkulturen (DSMZ, Braunschweig, Germany) in accordance with the Budapest Treaty.
Example 4
Preparation of Lysine
The C. glutamicum strains DSMl39921ysCFBR: :lysCFBR, ATCC21513_171ysE: :lysE and ATCC21513_17zwal : : zwal obtained in Examples 1 to 3 are cultured in a nutrient medium suitable for the production of lysine and the lysine content in the culture supernatant was determined.
For this, the strains are first incubated on an agar plate for 24 hours at 332C. Starting from this agar plate culture, a preculture is seeded (10 ml medium in a 100 ml conical flask) . The medium MM is used as the medium for the preculture. The preculture is incubated for 24 hours at 332C at 240 rpm on a shaking machine. A main culture is seeded from this preculture such that the initial OD (660 nm) of the main culture is 0.1 OD. The Medium MM is also used for the main culture.
Medium MM
CSL 5 g/l
MOPS 20 g/l
Glucose (autoclaved separately) 50 g/l
Salts:
(NH4)2S04 25 g/l
KH2P04 0.1 g/l
MgS04 * 7 H20 1.0 g/l CaCl2 * 2 H20 10 mg/1
FeS04 * 7 H20 10 mg/1
MnS04 * H20 5 . 0 mg/1
Biotin (sterile-filtered) 0 . 3 mg/1
Thiamine * HCl (sterile-filtered) 0 . 2 mg/1
CaC03 25 g/l
The CSL (corn steep liquor) , MOPS
(morpholinopropanesulfonic acid) and the salt solution are brought to pH 7 with aqueous ammonia and autoclaved. The sterile substrate and vitamin solutions, as well as the CaC03 autoclaved in the dry state, are then added.
Culturing is carried out in a 10 ml volume in a 100 ml conical flask with baffles . Culturing is carried out at 33aC and 80% atmospheric humidity.
After 48 hours, the OD is determined at a measurement wavelength of 660 nm with a Bio ek 1000 (Beckmann
Instruments GmbH, Munich) . The -amount of lysine formed is determined with an amino acid analyzer from Eppendorf- BioTronik (Hamburg, Germany) by ion exchange chromatography and post-column derivation with ninhydrin detection.
The result of the experiment is shown in Table 10.
Table 10
Figure imgf000075_0001
Brief Description of the Figures :
The base pair numbers stated are approximate values obtained in the context of reproducibility of measurements .
Figure 1: Map of the plasmid pKl8mobsacB2xlysCSma2/l .
The abbreviations and designations used have the following meaning:
KmR: Kanamycin resistance gene
HindiII Cleavage site of the restriction enzyme HindiII
BamHI Cleavage site of the restriction enzyme BamHI
lysC: lysCFBR allele lysC T311I
sacB: sacB gene RP4mob : mob region with the replication origin for the transfer (oriT)
oπV: Replication origin V
Figure 2: Map of the plasmid pKl8mobsacB2xlysESmal/l .
The abbreviations and designations used have the following meaning :
KanR: Kanamycin resistance gene
Sail: Cleavage site of the restriction enzyme Sail
BamHI: Cleavage site of the restriction enzyme BamHI
EcoRI : Cleavage site of the restriction enzyme EcoRI
Seal : Cleavage site of the restriction enzyme Seal
lysE: lysE gene
sacB: sacB gene
RP4mob : mob region with the replication origin for the transfer (oriT)
oriV: Replication origin V
Figure 3: Map of the plasmid pKlδmobsacBzwalzwal .
The abbreviations and designations used have the following meaning:
KanR: Kanamycin resistance gene
EcoRI ; Cleavage site of the restriction enzyme EcoRI
Nhel: Cleavage site of the restriction enzyme Nhel zwal : zwal gene
sacB: sacB gene
RP4mob : mob region with the replication origin for the transfer (oriT)
oriV: Replication origin V
BUDAPEST TREATY ON THE INTERNATIONAL
RECOGNITION OF THE DEPOSIT OF MICROORGANISMS
FOR THE PURPOSES OF PATENT PROCEDURE
INTERNATIONAL FORM
Degussa AG
Kantstr. 2
33790 Halle (Westf.) RECEIPT IN THE CASE OF AN ORIGINAL DEPOSIT issued pursuant to Rule 7.1 by the INTERNATIONAL DEPOSITARY AUTHORITY identified at the bottom of this page
I. IDENTIFICATION OF THE MICROORGANISM
Identification reference given by the DEPOSITOR: Accession number given by the INTERNATIONAL DEPOSITARY AUTHORITY:
DSM139921ysCFBR::lysCFBR
DSM 15036
π. SCIENTIFIC DESCRIPTION AND/OR PROPOSED TAXONOMIC DESIGNATION
The microorganism identified under I. above was accompanied by:
( X ) a scientific description
( χ) a proposed taxonomic designation
(Mark with a cross where applicable).
HI. RECEIPT AND ACCEPTANCE
This International Depositary Authority accepts the microorganism identified under I. above, which was received by it on 2002-06-05 (Date of the original deposit)1.
IV. RECEIPT OF REQUEST FOR CONVERSION
The microorganism identified under I above was received by this International Depositary Authority on (date of original deposit) and a request to convert the original deposit to a deposit under the Budapest Treaty was received by it on (date of receipt of request for conversion).
V. INTERNATIONAL DEPOSITARY AUTHORITY
Name: DSMZ-DEUTSCHE SAMMLUNG VON Signature(s) of person(s) having the power to represent the
MIKROORGANISMEN UND ZELLKULTUREN GmbH International Depositary Authority or of authorized official(s):
Address: Mascheroder eg lb
D-38l24 Braunschweig
Date: 2002-06-06
' Where Rule 6.4 (d) applies, such date is the date on which the status of international depositary authority was acquired. Form DSMZ-BP/ (sole page) 12/2001 BUDAPEST !.^... . .._ „JTERNATIONAL
RECOGNITION OF THE DEPOSIT OF MICROORGANISMS FOR THE PURPOSES OF PATENT PROCEDURE
INTERNATIONAL FORM
Degussa AG
Kantstr. 2
33790 Halle (Westf.)
VIABILITY STATEMENT issued pursuant to Rule 102 by the INTERNATIONAL DEPOSITARY AUTHORITY identified at the bottom of this page
i. DEPOSΓTOR π. IDENTIFICATION OF THE MICROORGANISM
Name: Degussa AG Accession number given by the
Kantstr. 2 INTERNATIONAL DEPOSITARY AUTHORITY:
Address: 33790 Halle (Westf.)
DS 15036
Date of the deposit or the transfer1 :
2002-06-05 in VIABILITY STATEMENT
The viability of the microorganism identified under II above was tested on 2002-06-05 On that date, the said microorganism was
( χ)3 viable
( )3 no longer viable
IV. CONDITIONS UNDER WHICH THE VIABILITY TEST HAS BEEN PERFORMED"
V. INTERNATIONAL DEPOSITARY AUTHORITY
Name: DSMZ-DEUTSCHE SAMMLUNG VON Signature(s) of person(s) having the power to represent the
MIKROORGANISMEN UND ZELLKULTUREN GmbH International Depositary Authority or of authorized official(s):
Address: Mascheroder Weg lb D- 8124 Braunschweig
Date: 2002-06-06
' Indicate the date of original deposit or, where a new deposit or a transfer has been made, the most recent relevant date (date of the new deposit or date of the transfer)
2 to the cases referred to in Rule 102(a) (n) and (iii), refer to the most recent viability test.
3 Mark with a cross the applicable box.
4 Fill in if the information has been requested and if the results of the test were negative.
FormDSMZ-BP/9 (sole page) 12/2001
Figure imgf000080_0001
INTERNATIONAL FORM
Degussa AG
Kantstr. 2
33790 Halle (Westf.)
VIABILITY STATEMENT issued pursuant to Rule 10.2 by the INTERNATIONAL DEPOSITARY AUTHORnY identified at the bottom of this page
I DEPOSITOR π. IDENTIFICAΗON OF THE MICROORGANISM
Name: Degussa AG Accession number given by the
Kantstr. 2 INTERNATIONAL DEPOSITARY AUTHORITY:
Address: 33790 Halle (Westf.)
DS 15037
Date of the deposit or the transfer1:
2002-06-05 m. VIABILITY STATEMENT
The viability of the microorganism identified under II above was tested on 2002-06-05 On that date, the said microorganism was
(χ)3 viable
( )3 no longer viable
IV. CONDITIONS UNDER WHICH THE VIABILITY TEST HAS BEEN PERFORMED1
V. INTERNATIONAL DEPOSITARY AUTHORITY
Name: DSMZ-DEUTSCHE SAMMLUNG VON Signature(s) of person(s) having the power to represent the MIKROORGANISMEN UND ZELLKULTUREN GmbH International Depositary Authority or of authorized offιcial(s):
Address: Mascheroder Weg lb
D-3.8124 Braunschweig (X. tX&'tC
Date: 2002-06-06
1 Indicate the date of original deposit or, where a new deposit or a transfer has been made, the most recent relevant date (date of the new deposit or date of the transfer).
2 In the cases referred to in Rule 10.2(a) (ii) and (iii), refer to the most recent viability test.
3 Mark with a cross the applicable box.
4 Fill in if the information has been requested and if the results of the test were negative.
Form DSMZ-BP/9 (sole page) 12/2001 BUDAPEST INTERNATIONAL
RECOGNITION Of THE DEPOSIT OF MICROORGANISMS
FOR THE PURPOSES OF PATENT PROCEDURE
INTERNATIONAL FORM
Degussa AG
Kantstr. 2
33790 Halle (Westf.) RECEIPT IN THE CASE OF AN ORIGINAL DEPOSIT issued pursuant to Rule 7 1 by the INTERNATIONAL DEPOSITARY AUTHORITY identified at the bottom of this page
I IDENTIFICATION OF THE MICROORGANISM
Identification reference given by the DEPOSITOR Accession number given by the INTERNATIONAL DEPOSITARY AUTHORITY
ATCC21513_171ysE :lysE
DSM 15037
π SCIENTIFIC DESCRIPTION AND/OR PROPOSED TAXONOMIC DESIGNATION
The microorganism identified under I above was accompanied by
( X ) a scientific description
( JΓ) a proposed taxonomic designation
(Mark with a cross where applicable)
El RECEIPT AND ACCEPTANCE
This International Depositary Authoπty accepts the microorganism identified under I above, which was received by it on 2002-06-05 (Date of the original deposit)'
IV RECEIPT OF REQUEST FOR CONVERSION
The microorganism identified under I above was received by this International Depositary Authoπty on (date of original deposit) and a request to convert the original deposit to a deposit under the Budapest Treaty was received by it on (date of receipt of request for conversion)
V INTERNATIONAL DEPOSITARY AUTHORITY
Name DSMZ-DEUTSCHE SAMMLUNG VON Sιgnature(s) of person(s) having the power to represent the MIKROORGANISMEN UND ZELLKULTUREN GmbH International Depositary Authority or of authoπzed officials)
Address Mascheroder Weg lb
D-38124 Braunschweig x. cJ.'
Date 2002-06-06
1 Where Rule 64 id) applies, such date is the date on which the status of international depositary authoπty was acquired Form DSMZ-BP/4 (sole page) 12/2001 BUDAPEST TRE iRNATIONAL
RECOGNITION OF THE DEPOSIT OF MICROORGANISMS
FOR THE PURPOSES OF PATENT PROCEDURE
INTERNATIONAL FORM
Degussa AG
Kantstr. 2
33790 Halle (Westf.)
VIABILITY STATEMENT issued pursuant to Rule 10.2 by the INTERNATIONAL DEPOSITARY AUTHORITY identified at the bottom of this page
I. DEPOSnOR π. IDENTIFICATION OF THE MICROORGANISM
Name: Degussa AG Accession number given by the
Kantstr.2 INTERNATIONAL DEPOSITARY AUTHORITY:
Address: 33790 Halle (Westf.)
DSM 15038 Date of the deposit or the transfer':
2002-06-05 rn. VIABΓLΠΎ STATEMENT.
The viability of the microorganism identified under π above was tested on 2002-06-05 On that date, the said microorganism was
(χ)3 viable
( )! no longer viable
IV. CONDITIONS UNDER WHICH THE VIABILITY TEST HAS BEEN PERFORMED"
V. INTERNATIONAL DEPOSITARY AUTHORITY
Name: DSMZ-DEUTSCHE SAMMLUNG VON Signarure(s) of person(s) having the power to represent the
MIKROORGANISMEN UND ZELLKULTUREN GmbH International Depositary Authority or of authorized official(s):
Address: Mascheroder Weg lb
D-38124 Braunschweig (X. C je:< o
Date: 2002-06-06
1 Indicate the date of original deposit or, where a new deposit or a transfer has been made, the most recent relevant date (date of the new deposit or date of the transfer).
2 to the cases referred to in Rule 10.2(a) (ii) and (iii), refer to the most recent viability test.
3 Mark with a cross the applicable box.
4 Fill in if the information has been requested and if the results of the test were negative.
Form DSMZ-BP/9 (sole page) 12/2001 BUDAPEST TREATY ON THE INTERNATIONAL
RECOGNITION OF THE DEPOSIT OF MICROORGANISMS
FOR THE PURPOSES OF PATENT PROCEDURE
INTERNATIONAL FORM
Degussa AG
Kantstr. 2
33790 Halle (Westf.) RECEIPT IN THE CASE OF AN ORIGINAL DEPOSIT issued pursuant to Rule 7.1 by the INTERNATIONAL DEPOSITARY AUTHORITY identified at the bottom of this page
I. IDENTIFICATION OF THE MICROORGANISM
Identification reference given by the DEPOSITOR: Accession number given by the INTERNATIONAL DEPOSITARY AUTHORITY:
ATCC21513 17zwal::zwal
DSM 15038
π. SCIENTIFIC DESCRIPTION AND/OR PROPOSED TAXONOMIC DESIGNATION
The microorganism identified under I. above was accompanied by:
( X ) a scientific description
( x) a proposed taxonomic designation
(Mark with a cross where applicable).
UI. RECEIPT AND ACCEPTANCE
This International Depositary Authority accepts the microorganism identified under I. above, which was received by it on 2002-06-05 (Date of the original deposit)1.
IV. RECEIPT OF REQUEST FOR CONVERSION
The microorganism identified under I above was received by this International Depositary Authority on (date of original deposit) and a request to convert the original deposit to a deposit under the Budapest Treaty was received by it on (date of receipt of request for conversion).
V. INTERNATIONAL DEPOSITARY AUTHORITY
Name: DSMZ-DEUTSCHE SAMMLUNG VON Signature(s) of person(s) having the power to represent the
MIKROORGANISMEN UND ZELLKULTUREN GmbH International Depositary Authority or of authorized official(s):
Address: Mascheroder Weg lb D-38124 Braunschweig
Date: 2002-06-06
Where Rule 6.4 <d) applies, such date is the date on which the status of international depositary authority was acquired. JBUDAPESl TREA I Y UN 1 MLb JIJ TERNATIONAL
RECOGNITION OF THE DEPOSIT OF MICROORGANISMS
FOR THE PURPOSES OF PATENT PROCEDURE
INTERNATIONAL FORM
Degussa AG Kantstr . 2 33790 Halle/Kύnsebec
RECEIPT IN THE CASE OF AN ORIGINAL DEPOSIT issued pursuant to Rule 7.1 by the INTERNATIONAL DEPOSITARY AUTHORITY identified at the bottom of this page
I. IDENTIFICATION OF THE MICROORGANISM
Identification reference given by the DEPOSITOR: Accession number given by the INTERNATIONAL DEPOSITARY AUTHORITY:
DH5alphamcr/ pK18mobsacB2xlysCSma2/l DSM 14244
II. SCIENTIFIC DESCRIPTION AND/OR PROPOSED TAXONO C DESIGNATION
The microorganism identified under I. above was accompanied by:
(X ) a scientific description
(X ) a proposed taxonomic designation
(Mark with a cross where applicable).
III. RECEIPT AND ACCEPTANCE
This International Depositary Authority accepts the microorganism identified under I. above, which was received by it on 2 001 - 04 - 2 0 (Date of the original deposit)1.
IV. RECEIPT OF REQUEST FOR CONVERSION
The microorganism identified under I above was received by this International Depositary Authority on (date of original deposit) and a request to convert the original deposit to a deposit under the Budapest Treaty was received by it on (date of receipt of request for conversion).
V. INTERNATIONAL DEPOSITARY AUTHORITY
Name: DSMZ-DEUTSCHE SAMMLUNG VON Signature(s) of person(s) having the power to represent the
MIKROORGANISMEN UND ZELLKULTUREN GmbH International Depositary Authority or of authorized officials):
Address: Mascheroder Weg lb D-38124 Braunschweig X £ ^-ό>
Date: 2001- 04 - 26
1 Where Rule 6.4 <d) applies, such date is the date on which the status of international depositary authority was acquired. Form DSMZ-BP/4 (sole page) 0196 BUDAPEST TREATY ON THE INTERNATIONAL
RECOGNITION OF THE DEPOSIT OF MICROORGANISMS
FOR THE PURPOSES OF PATENT PROCEDURE
INTERNATIONAL FORM
Degussa AG Kantstr. 2 33790 Halle/Kunsebeck
VIABILITY STATEMENT issued pursuant to Rule 10.2 by the
INTERNATIONAL DEPOSITARY AUTHORITY identified at the bottom of this page
I. DEPOSITOR II. IDENTIFICATION OF THE MICROORGANISM
Name: Degussa AG Accession number given by the Kantstr . 2 INTERNATIONAL DEPOSITARY AUTHORITY: Address: 33790 Halle/Kϋnsebeck DSM 14244
Date of the deposit or the transfer': 2001 - 04 -20
m. VIABILITY STATEMENT
The viability of the microorganism identified under II above was tested on 2 001 - 04 - 2 0 2 . On that date, the said microorganism was
(X)' viable
( )' no longer viable
IV. CONDITIONS UNDER WHICH THE VIABILITY TEST HAS BEEN PERFORMED4
V. INTERNAΗONAL DEPOSITARY AUTHORITY
Name: DSMZ-DEUTSCHE SAMMLUNG VON Signature(s) of person(s) having the power to represent the
MIKROORGANISMEN UND ZELLKULTUREN GmbH International Depositary Authority or of authorized officials):
Address: Mascheroder Weg lb D-38124 Braunschweig
Figure imgf000085_0001
Date: 200 x1- 04 -2
Indicate the date of original deposit or, where a new deposit or a transfer has been made, the most recent relevant date (date of the new deposit or date of the transfer).
In the cases referred to in Rule 10.2(a) (ii) and (iii), refer to the most recent viability test.
Mark with a cross the applicable box.
Fill in if the information has been requested and if the results of the test were negative.

Claims

What is claimed is:
1. Coryneform bacteria which produce chemical compounds, wherein instead of the singular copy of an open reading frame (ORF) , gene or allele naturally present at the particular desired site (locus), these have at least two copies of the open reading frame (ORF) , gene or allele in question, preferably in tandem arrangement, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the particular site, and in that these optionally
have at least a third copy of the open reading frame (ORF) , gene or allele in question at a further gene site, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the further gene site.
2. Coryneform bacteria according to claim 1 which produce chemical compounds , wherein the coryneform bacteria belong to the genus Corynebacterium.
3. Coryneform bacteria of the genus Corynebacterium according to claim 2 which produce chemical compounds, wherein these belong to the species Corynebacterium glutamicum.
4. Coryneform bacteria according to claim 1 which produce chemical compounds, wherein the chemical compound is a compound chosen from the group consisting of L-amino acids, vitamins, nucleosides and nucleotides.
5. Coryneform bacteria according to claim 1 which produce chemical compounds, wherein the chemical compound is one or more L-amino acids chosen from the group consisting of L-aspartic acid, L-asparagine, L- threonine, L-serine, L-glutamic acid, L-glutamine, glycine, L-alanine, L-cysteine, L-valine, L-methionine, L-isoleucine, L-leucine, L-tyrosine, L-phenylalanine, L-histidine, L-lysine, L-tryptophan, L-proline and L- arginine.
6. Coryneform bacteria according to claim 1 which produce chemical compounds, wherein the chemical compound is the amino acid L-lysine.
7. Coryneform bacteria which produce L-lysine, wherein instead of the singular copy of an open reading frame (ORF) , gene or allele of lysine production naturally present at the particular desired site (locus) , these have at least two copies of the open reading frame (ORF) , gene or allele of lysine production in question, preferably in tandem arrangement, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the particular site, and in that these
optionally have at least a third copy of the open reading frame (ORF) , gene or allele of lysine production in question at a further gene site, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the further gene site.
8. Coryneform bacteria according to claim 7 which produce L-lysine, wherein the coryneform bacteria belong to the genus Corynebacterium.
9. Coryneform bacteria of the genus Corynebacterium according to claim 8 which produce L-lysine, wherein these belong to the species Corynebacterium glutamicum.
10. Coryneform bacteria according to claim 7 which produce L-lysine, wherein the copy of an open reading frame (ORF) , gene or allele of lysine production is one or more of the open reading frames, genes or alieles chosen from the group consisting of accBC, accDA, cstA, cysD, cysE, cysH, cysK, cysN, cysQ, dapA, dapB, dapC, dapD, dapE, dapF, ddh, dps, eno, gap, gap2, gdh, gnd, lysC, lysCFBR, lysE, msiK, opcA, oxyR, ppc, ppcFBR, pgk, pknA, pknB, pknD, pknG, ppsA, ptsH, ptsl, ptsM, pyc, pyc P458S, sigC, sigD, sigE, sigH, sigM, tal, thyA, tkt, tpi, zwal, zwf and zwf A213T.
11. Coryneform bacteria according to claim 7 which produce L-lysine, wherein the copy of an open reading frame (ORF) , gene or allele of lysine production is one or more of the genes or alieles chosen from the group consisting of lysCFBR lysE and zwal .
12. Coryneform bacteria according to claim 7 which produce L-lysine, wherein the copy of an open reading frame (ORF) , gene or allele of lysine production is the lysE gene.
13. Coryneform bacteria according to claim 7 which produce L-lysine, wherein the copy of an open reading frame (ORF) , gene or allele of lysine production is the zwal gene.
14. Coryneform bacteria according to claim 7 which produce L-lysine, wherein the copy of an open reading frame (ORF) , gene or allele of lysine production is an lysCFBR allele which codes for a feed back resistant form of aspartate kinase.
15. Coryneform bacteria according to claim 14 which produce L-lysine, wherein the feed back resistant form of aspartate kinase coded by the lysCFBR allele contains an amino acid sequence according to SEQ ID NO: 2, SEQ ID NO: 2 having one or more amino acid exchanges chosen from the group consisting of A279T, A279V, S301F, T308I, S301Y, G345D, R320G, T311I and S381F.
16. Coryneform bacteria according to claim 14 which produce L-lysine, wherein the feed back resistant form of aspartate kinase coded by the lysCFBR allele has an amino acid sequence according to SEQ ID NO: 4.
17. Coryneform bacteria according to claim 14 which produce L-lysine, wherein the coding region of the lysCFBR allele has the nucleotide sequence of SEQ ID NO: 3.
18. Coryneform bacteria according to claim 7 which produce L-lysine, wherein the further gene site is one or more of the sites chosen from the group consisting of aecD, ccpAl, ccpA2, citA, citB, citE, fda, gluA, gluB, gluC, gluD, luxR, luxS, lysRl, lysR2 , lysR3 , menE, mqo, pck, pgi and poxB.
19. Coryneform bacteria according to claim 7 which produce L-lysine, wherein the further gene site is one of more of the sites chosen from the group consisting of intergenic regions of the chromosome, prophages contained in the chromosome and defective phages contained in the chromosome.
20. Processes for the preparation of one or more chemical compounds, which comprise the following steps:
a) fermentation of coryneform bacteria, which i) instead of the singular copy of an open reading frame (ORF) , gene or allele naturally present at the particular desired site (locus) , have at least two copies of the said open reading frame (ORF) , gene or allele, preferably in tandem arrangement, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the particular site, and which
ii) optionally have at least a third copy of the said open reading frame (ORF) , gene or allele at a further gene site, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the further gene site,
under conditions which allow expression of the said open reading frames (ORFs) , genes or alieles,
b) concentration of the chemical compound (s) in the fermentation broth and/or in the cells of the bacteria,
c) isolation of the chemical compound (s) , optionally
d) with constituents from the fermentation broth and/or the biomass to the extent of > (greater than) 0 to 100%.
21. Process according to claim 20, wherein the coryneform bacteria belong to the genus Corynebacterium.
22. Process according to claim 20, wherein the coryneform bacteria of the genus Corynebacterium belong to the species Corynebacterium glutamicum.
23. Process according to claim 20, wherein the chemical compound is a compound chosen from the group consisting of L-amino acids, vitamins, nucleosides and nucleotides .
24. Process according to claim 20, wherein the chemical compound is one or more L-amino acids chosen from the group consisting of L-aspartic acid, L-asparagine, L- threonine, L-serine, L-glutamic acid, L-glutamine, glycine, L-alanine, L-cysteine, L-valine, L-methionine, L-isoleucine, L-leucine, L-tyrosine, L-phenylalanine, L-histidine, L-lysine, L-tryptophan, L-proline and L- arginine.
25. Process according to claim 20, wherein the chemical compound is L-lysine.
26. Process for the preparation of L-lysine, which comprises the following steps:
a) fermentation of coryneform bacteria, which
i) instead of the singular copy of an open reading frame (ORF) , gene or allele of lysine production naturally present at the particular desired site (locus) , have at least two copies of the said open reading frame (ORF) , gene or allele, preferably in tandem arrangement, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the particular site, and which optionally
ii) have at least a third copy of the said open reading frame (ORF) , gene or allele of lysine production at a further gene site, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics being present at the further gene site,
under conditions which allow expression of the said open reading frames (ORFs) , genes or alieles,
b) concentration of the L-lysine in the fermentation broth and/or in the cells of the bacteria,
c) isolation of the L-lysine, optionally
d) with constituents from the fermentation broth and/or the biomass to the extent of > (greater than) 0 to 100%.
27. Process for the preparation of L-lysine according to claim 26, wherein the coryneform bacteria belong to the genus Corynebacterium.
28. Process for the preparation of L-lysine according to claim 26, wherein the coryneform bacteria of the species Corynebacterium belong to the species Corynebacterium glutamicum.
29. Process for the preparation of L-lysine according to claim 26, wherein the copy of an open reading frame
(ORF) , a gene or allele of lysine production is one or more of the open reading frames, genes or alieles chosen from the group consisting of accBC, accDA, cstA, cysD, cysE, cysH, cysK, cysN, cysQ, dapA, dapB, dapC, dapD, dapE, dapF, ddh, dps, eno, gap, gap2, gdh, gnd, lysC, lysCFBR, lysE, msiK, opcA, oxyR, ppc, ppcFBR, pgk, pknA, pknB, pknD, pknG, ppsA, ptsH, ptsl, ptsM, pyc, pyc P458S, sigC, sigD, sigE, sigH, sigM, tal, thyA, tkt, tpi, zwal, zwf and zwf A213T.
30. Process for the preparation of L-lysine according to claim 26, wherein the copy of an open reading frame (ORF) , gene or allele of lysine production is one or more of the genes or alieles chosen from the group consisting of lysCFBR, lysE and zwal.
31. Process for the preparation of L-lysine according to claim 26, wherein the copy of an open reading frame (ORF) , gene or allele of lysine production is the lysE gene.
32. Process for the preparation of L-lysine according to claim 26, wherein the copy of an open reading frame (ORF) , gene or allele of lysine production is the zwal gene.
33. Process for the preparation of L-lysine according to claim 26, wherein the copy of an open reading frame (ORF) , gene or allele of lysine production is the lysCFBR allele which codes for a feed back resistant form of aspartate kinase.
34. Process for the preparation of L-lysine according to claim 33, wherein the feed back resistant form of aspartate kinase coded by the lysCBR allele contains an amino acid sequence according to SEQ ID NO: 2, SEQ ID NO: 2 having one or more amino acid exchanges chosen from the group consisting of A279T, A279V, S301F, T308I, S301Y, G345D, R320G, T311I and S381F.
35. rocess for the preparation of L-lysine according to claim 33, wherein the feed back resistant form of aspartate kinase coded by the lysCFBR allele has an amino acid sequence according to SEQ ID NO: 4.
36. Process for the preparation of L-lysine according to claim 33, wherein the coding region of the lysCFBR allele has the nucleotide sequence of SEQ ID NO: 3.
37. Process for the preparation of L-lysine according to claim 26, wherein the further gene site is one or more of the sites chosen from the group consisting of aecD, ccpAl, ccpA2, citA, citB, citE, fda, gluA, gluB, gluC, gluD, luxR, luxS, lysRl, lysR2 , lysR3 , menE, mqo, pck, pgi and poxB.
38. Process for the preparation of L-lysine according to claim 26, wherein the further gene site is one of more of the sites chosen from the group consisting of intergenic regions of the chromosome, prophages contained in the chromosome and defective phages contained in the chromosome.
39. rocess for the production of coryneform bacteria which produce one or more chemical compounds, wherein
a) the nucleotide sequence of a desired ORF, gene or allele, optionally including the expression and/or regulation signals, is isolated,
b) at least two copies of the nucleotide sequence of the ORF, gene or allele are arranged in a row, preferably in tandem arrangement,
c) the nucleotide sequence obtained according to b) is incorporated in a vector which does not replicate or replicates to only a limited extent in coryneform bacteria, d) the nucleotide sequence according to b) or c) is transferred into coryneform bacteria, and
e) coryneform bacteria which have at least two copies of the desired ORF, gene or allele at the particular desired natural site instead of the singular copy of the ORF, gene or allele originally present are isolated, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics remaining at the particular natural site (locus) , and optionally
f) at least a third copy of the open reading frame (ORF) , gene or allele in question is introduced at a further gene site, no nucleotide sequence which is capable of/enables episomal replication in microorganisms, no nucleotide sequence which is capable of/enables transposition and no nucleotide sequence which imparts resistance to antibiotics remaining at the further gene site.
40. The plasmid pKl8mobsacB2xlysCSma2/l shown in Figure 1 and deposited in the form of a pure culture of the strain E. coli DH5ocmcr/pKl8mobsacB2xlysCSma2/l
(=DH5alphamcr/pKl8mobsacB2xlysCSma2/l) under number DSM14244.
41. he Corynebacterium glutamicum strain
DSMl39921ysCFBR: :lysCFBR deposited in the form of a pure culture under number DSM15036.
42. The Corynebacterium glutamicum strain
ATCC21513_171ysE: : lysE deposited in the form of a pure culture under number DSM15037.
3. The Corynebacterium glutamicum strain
ATCC21513_17zwal : : zwal deposited in the form of a pure culture under number DSM15038.
PCT/EP2002/008465 2001-08-06 2002-07-30 Coryneform bacteria which produce chemical compounds ii Ceased WO2003014330A2 (en)

Priority Applications (9)

Application Number Priority Date Filing Date Title
AU2002355462A AU2002355462A1 (en) 2001-08-06 2002-07-30 Coryneform bacteria which produce chemical compounds ii
EP02751164A EP1414986B1 (en) 2001-08-06 2002-07-30 Coryneform bacteria which produce chemical compounds ii
DE60229139T DE60229139D1 (en) 2001-08-06 2002-07-30 CORYNEFORME BACTERIA MAKING CHEMICAL SUBSTANCES II
BR0211745-2A BR0211745A (en) 2001-08-06 2002-07-30 Corineform bacteria producing chemical compounds ii
KR1020047001926A KR100943834B1 (en) 2001-08-06 2002-07-30 Method for producing L-lysine using coryneform bacteria and L-lysine producing L-lysine
CA002456416A CA2456416A1 (en) 2001-08-06 2002-07-30 Coryneform bacteria which produce chemical compounds ii
DK02751164T DK1414986T3 (en) 2001-08-06 2002-07-30 Coryform bacteria that produce chemical compounds II
US10/358,393 US20040043458A1 (en) 2001-08-06 2003-02-05 Coryneform bacteria which produce chemical compounds II
US12/553,647 US20100255544A1 (en) 2001-08-06 2009-09-03 Coryneform bacteria which produce chemical compounds ii

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US30987701P 2001-08-06 2001-08-06
US60/309,877 2001-08-06

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US10/358,393 Continuation US20040043458A1 (en) 2001-08-06 2003-02-05 Coryneform bacteria which produce chemical compounds II

Publications (2)

Publication Number Publication Date
WO2003014330A2 true WO2003014330A2 (en) 2003-02-20
WO2003014330A3 WO2003014330A3 (en) 2003-12-18

Family

ID=23200062

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2002/008465 Ceased WO2003014330A2 (en) 2001-08-06 2002-07-30 Coryneform bacteria which produce chemical compounds ii

Country Status (12)

Country Link
US (2) US20040043458A1 (en)
EP (1) EP1414986B1 (en)
KR (1) KR100943834B1 (en)
CN (2) CN100336901C (en)
AT (1) ATE409752T1 (en)
AU (1) AU2002355462A1 (en)
BR (1) BR0211745A (en)
CA (1) CA2456416A1 (en)
DE (1) DE60229139D1 (en)
DK (1) DK1414986T3 (en)
ES (1) ES2314076T3 (en)
WO (1) WO2003014330A2 (en)

Cited By (39)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004069996A3 (en) * 2003-02-05 2004-12-09 Degussa Bacteria and process for producing chemical compounds by said bacteria
WO2005059154A3 (en) * 2003-12-18 2005-10-13 Basf Ag Methods for the preparation of a fine chemical by fermentation
WO2005121349A3 (en) * 2003-12-18 2006-04-13 Basf Ag Methods for the preparation of a fine chemical by fermentation
WO2006100211A1 (en) 2005-03-24 2006-09-28 Degussa Gmbh Mutant alleles of the zwf gene (g6pdh) from coryneform bacteria for increasing lysine production
US7135313B2 (en) 2001-10-16 2006-11-14 Degussa Ag Method for producing L-lysine or L-lysine containing feed additives with a cornebacteria containing a mutated lysC
WO2006125714A2 (en) 2005-05-24 2006-11-30 Evonik Degussa Gmbh Alleles of the opca gene from coryneform bacteria
WO2007037459A1 (en) * 2005-09-27 2007-04-05 Ajinomoto Co., Inc. An l-amino acid-producing bacterium and a method for producing l-amino acids
EP1881076A1 (en) * 2006-07-17 2008-01-23 Evonik Degussa GmbH Method for producing L-amino acids
DE102007005072A1 (en) 2007-02-01 2008-08-07 Evonik Degussa Gmbh Process for the fermentative production of cadaverine
DE102008001874A1 (en) 2008-05-20 2009-11-26 Evonik Degussa Gmbh Process for the preparation of L-amino acids
US7629142B2 (en) * 2004-01-30 2009-12-08 Ajinomoto Co., Inc. L-amino acid-producing microorganism and method for producing L-amino acid
WO2010149574A1 (en) 2009-06-25 2010-12-29 Evonik Degussa Gmbh Method for fermentatively preparing l-amino acids
EP2354235A1 (en) 2005-10-05 2011-08-10 Evonik Degussa GmbH Method for the fermentative production of L-amino acids involving the use of coryneform bacteria
WO2011124477A2 (en) 2010-03-30 2011-10-13 Evonik Degussa Gmbh METHOD FOR THE PRODUCTION OF L-ORNITHINE USING BACTERIA THAT OVEREXPRESS LysE
US8202706B2 (en) 2006-07-13 2012-06-19 Evonik Degussa Gmbh Method of production of L-amino acids
EP2479279A1 (en) 2011-01-20 2012-07-25 Evonik Degussa GmbH Method for producing sulphuric amino acids by means of fermentation
DE102011006716A1 (en) 2011-04-04 2012-10-04 Evonik Degussa Gmbh Microorganism and process for the fermentative production of an organic chemical compound
WO2013000827A1 (en) 2011-06-28 2013-01-03 Evonik Degussa Gmbh Variants of the promoter of the gap gene encoding glyceraldehyde-3-phosphate dehydrogenase
EP2628792A1 (en) 2012-02-17 2013-08-21 Evonik Industries AG Cell with reduced ppGppase activity
EP2631298A1 (en) 2012-02-22 2013-08-28 Evonik Industries AG Biotechnological method for producing butanol and butyric acid
CN103374540A (en) * 2013-08-13 2013-10-30 廊坊梅花生物技术开发有限公司 Corynebacterium glutamicum and application thereof
WO2013160124A1 (en) 2012-04-27 2013-10-31 Evonik Industries Ag Feedback-resistant alpha-isopropylmalate synthases
EP2674489A1 (en) 2012-06-15 2013-12-18 Evonik Industries AG Biotechnological 2-hydroxyisobutyric acid production
EP2700715A1 (en) 2012-08-20 2014-02-26 Evonik Degussa GmbH Method for manufacturing L-amino acids using improved strains of the enterobacteriaceae family by means of fermentation
EP2762571A1 (en) 2013-01-30 2014-08-06 Evonik Industries AG Microorganism and method for the production of amino acids by fermentation
EP2811028A1 (en) 2013-06-03 2014-12-10 Evonik Industries AG Process for producing L-leucine, L-valine, L-isoleucine, alpha-ketoisovalerate, alpha-keto-beta-methylvalerate, or alpha-ketoisocaproate employing recombinant Corynebacteria comprising the propionate-inducible ilvBN operon
EP2940144A1 (en) 2014-04-30 2015-11-04 Evonik Degussa GmbH Method for the production of l-lysine using an alkaliphilic bacterium
EP2940143A1 (en) 2014-04-30 2015-11-04 Evonik Degussa GmbH Method for the production of l-amino acids using an alkaliphilic bacterium
EP2940039A1 (en) 2014-04-30 2015-11-04 Evonik Degussa GmbH Method for the production of l-amino acids in coryne bacteria using a glycine splitting system
DE102014208199A1 (en) 2014-04-30 2015-11-05 Evonik Degussa Gmbh Process for the production of L-amino acids using an alkaliphilic bacterium
WO2017100376A2 (en) 2015-12-07 2017-06-15 Zymergen, Inc. Promoters from corynebacterium glutamicum
US9988624B2 (en) 2015-12-07 2018-06-05 Zymergen Inc. Microbial strain improvement by a HTP genomic engineering platform
WO2018226964A2 (en) 2017-06-07 2018-12-13 Zymergen Inc. Promoters from corynebacterium glutamicum and uses thereof in regulating ancillary gene expression
EP3415623A1 (en) 2017-06-14 2018-12-19 Evonik Degussa GmbH Method for production of fine chemicals using a corynebacterium secreting modified alpha-1,6-glucosidases
US10544411B2 (en) 2016-06-30 2020-01-28 Zymergen Inc. Methods for generating a glucose permease library and uses thereof
US10544390B2 (en) 2016-06-30 2020-01-28 Zymergen Inc. Methods for generating a bacterial hemoglobin library and uses thereof
WO2021048353A1 (en) * 2019-09-11 2021-03-18 Evonik Operations Gmbh Coryneform bacteria with a heterologous threonine transporter and their use in the production of l-threonine
US11208649B2 (en) 2015-12-07 2021-12-28 Zymergen Inc. HTP genomic engineering platform
EP4230723A4 (en) * 2020-10-16 2024-10-16 Tianjin Institute of Industrial Biotechnology, Chinese Academy of Sciences POLYPEPTIDE WITH ASPARTATE KINASE ACTIVITY AND ITS USE IN THE PRODUCTION OF AMINO ACIDS

Families Citing this family (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005123915A1 (en) * 2004-06-21 2005-12-29 Novozymes A/S Stably maintained multiple copies of at least two orf in the same orientation
DE102006048882A1 (en) * 2006-10-17 2008-04-24 Evonik Degussa Gmbh Alleles of the rel gene from coryneform bacteria
DE102006050489A1 (en) * 2006-10-26 2008-04-30 Evonik Degussa Gmbh Coryneform bacterium mutant useful for amino acid production comprises a gene coding for a 2-methylcitrate dehydratase polypeptide with an amino acid other than proline at position 272
US8647642B2 (en) 2008-09-18 2014-02-11 Aviex Technologies, Llc Live bacterial vaccines resistant to carbon dioxide (CO2), acidic PH and/or osmolarity for viral infection prophylaxis or treatment
KR101335853B1 (en) 2011-12-01 2013-12-02 씨제이제일제당 (주) A microorganism having L-amino acids and riboflavin productivity and a method of producing L-amino acids and riboflavin using the same
US10676723B2 (en) 2015-05-11 2020-06-09 David Gordon Bermudes Chimeric protein toxins for expression by therapeutic bacteria
CN105734004B (en) * 2016-03-02 2020-06-19 廊坊梅花生物技术开发有限公司 Recombinant strain and preparation method and application thereof
US11129906B1 (en) 2016-12-07 2021-09-28 David Gordon Bermudes Chimeric protein toxins for expression by therapeutic bacteria
US11180535B1 (en) 2016-12-07 2021-11-23 David Gordon Bermudes Saccharide binding, tumor penetration, and cytotoxic antitumor chimeric peptides from therapeutic bacteria
JP2022500024A (en) 2018-09-07 2022-01-04 アーチャー−ダニエルズ−ミッドランド カンパニー Engineered Corynebacteria strain
CN115786219B (en) * 2022-08-15 2026-02-24 江南大学 Recombinant corynebacterium glutamicum capable of producing tetrahydropyrimidine at high yield and application thereof

Family Cites Families (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1165619C (en) * 1995-06-07 2004-09-08 味之素株式会社 Process for producing L-lysine
RU2231552C2 (en) * 1997-10-04 2004-06-27 Форшунгсцентрум Юлих Гмбх Method for microbiological preparing amino acids of family aspartates and/or glutamates and agents used in method
DE19931317A1 (en) * 1999-07-07 2001-01-11 Degussa L-lysine-producing coryneform bacteria and method for producing L-lysine
EP1172437B1 (en) * 1999-04-19 2011-05-25 Kyowa Hakko Bio Co., Ltd. Novel desensitized aspartokinase
US20030049804A1 (en) * 1999-06-25 2003-03-13 Markus Pompejus Corynebacterium glutamicum genes encoding metabolic pathway proteins
DE19950409A1 (en) * 1999-10-20 2001-04-26 Degussa New nucleotide sequences coding for the pck gene
DE19959328A1 (en) * 1999-12-09 2001-06-13 Degussa New nucleotide sequences coding for the zwa1 gene
JP4623825B2 (en) * 1999-12-16 2011-02-02 協和発酵バイオ株式会社 Novel polynucleotide
CN1289781A (en) * 2000-08-30 2001-04-04 北京东方龙基生物技术有限公司 Truncated human insulin-like growth factor-I and its preparing process
AU2001295539A1 (en) * 2000-09-12 2002-03-26 Degussa A.G. Nucleotide sequences coding for the pknd gene

Cited By (69)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7160711B2 (en) 2001-08-06 2007-01-09 Degussa Ag Coryneform bacteria which produce chemical compounds I
US7135313B2 (en) 2001-10-16 2006-11-14 Degussa Ag Method for producing L-lysine or L-lysine containing feed additives with a cornebacteria containing a mutated lysC
WO2004069996A3 (en) * 2003-02-05 2004-12-09 Degussa Bacteria and process for producing chemical compounds by said bacteria
WO2005059154A3 (en) * 2003-12-18 2005-10-13 Basf Ag Methods for the preparation of a fine chemical by fermentation
WO2005121349A3 (en) * 2003-12-18 2006-04-13 Basf Ag Methods for the preparation of a fine chemical by fermentation
US8383363B1 (en) 2004-01-30 2013-02-26 Ajinomoto Co., Inc. L-amino acid-producing microorganism and method for producing L-amino acid
US7629142B2 (en) * 2004-01-30 2009-12-08 Ajinomoto Co., Inc. L-amino acid-producing microorganism and method for producing L-amino acid
WO2006100211A1 (en) 2005-03-24 2006-09-28 Degussa Gmbh Mutant alleles of the zwf gene (g6pdh) from coryneform bacteria for increasing lysine production
WO2006125714A2 (en) 2005-05-24 2006-11-30 Evonik Degussa Gmbh Alleles of the opca gene from coryneform bacteria
WO2007037459A1 (en) * 2005-09-27 2007-04-05 Ajinomoto Co., Inc. An l-amino acid-producing bacterium and a method for producing l-amino acids
EP2354235A1 (en) 2005-10-05 2011-08-10 Evonik Degussa GmbH Method for the fermentative production of L-amino acids involving the use of coryneform bacteria
US8202706B2 (en) 2006-07-13 2012-06-19 Evonik Degussa Gmbh Method of production of L-amino acids
EP1881076A1 (en) * 2006-07-17 2008-01-23 Evonik Degussa GmbH Method for producing L-amino acids
DE102007005072A1 (en) 2007-02-01 2008-08-07 Evonik Degussa Gmbh Process for the fermentative production of cadaverine
DE102008001874A1 (en) 2008-05-20 2009-11-26 Evonik Degussa Gmbh Process for the preparation of L-amino acids
DE102009030342A1 (en) 2009-06-25 2010-12-30 Evonik Degussa Gmbh Process for the fermentative production of organic chemical compounds
WO2010149574A1 (en) 2009-06-25 2010-12-29 Evonik Degussa Gmbh Method for fermentatively preparing l-amino acids
WO2011124477A2 (en) 2010-03-30 2011-10-13 Evonik Degussa Gmbh METHOD FOR THE PRODUCTION OF L-ORNITHINE USING BACTERIA THAT OVEREXPRESS LysE
DE102010003419A1 (en) 2010-03-30 2012-04-12 Evonik Degussa Gmbh Process for the fermentative production of L-ornithine
EP2479279A1 (en) 2011-01-20 2012-07-25 Evonik Degussa GmbH Method for producing sulphuric amino acids by means of fermentation
WO2012098042A1 (en) 2011-01-20 2012-07-26 Evonik Degussa Gmbh Process for the fermentative production of sulphurous amino acids
WO2012136506A2 (en) 2011-04-04 2012-10-11 Evonik Degussa Gmbh Microorganism and processes for the fermentative production of an organo-chemical compound
DE102011006716A1 (en) 2011-04-04 2012-10-04 Evonik Degussa Gmbh Microorganism and process for the fermentative production of an organic chemical compound
US9359413B2 (en) 2011-04-04 2016-06-07 Evonik Degussa Gmbh Microorganism and method for the fermentative production of an organic-chemical compound
US8912313B2 (en) 2011-06-28 2014-12-16 Evonik Degussa Gmbh Variants of the promoter of the gap gene coding for glyceraldehyde-3-phosphate dehydrogenase
WO2013000827A1 (en) 2011-06-28 2013-01-03 Evonik Degussa Gmbh Variants of the promoter of the gap gene encoding glyceraldehyde-3-phosphate dehydrogenase
DE102011118019A1 (en) 2011-06-28 2013-01-03 Evonik Degussa Gmbh Variants of the promoter of the glyceraldehyde-3-phosphate dehydrogenase-encoding gap gene
US9045762B2 (en) 2011-06-28 2015-06-02 Evonik Degussa Gmbh Variants of the promoter of the gap gene coding for glyceraldehyde-3-phosphate dehydrogenase
US9074229B2 (en) 2011-06-28 2015-07-07 Evonik Degussa Gmbh Variants of the promoter of the gap gene coding for glyceraldehyde-3-phosphate dehydrogenase
EP2628792A1 (en) 2012-02-17 2013-08-21 Evonik Industries AG Cell with reduced ppGppase activity
WO2013120685A1 (en) 2012-02-17 2013-08-22 Evonik Industries Ag A cell with reduced ppgppase activity
WO2013124401A1 (en) 2012-02-22 2013-08-29 Evonik Industries Ag Biotechnological method for producing butanol and butyric acid
EP2631298A1 (en) 2012-02-22 2013-08-28 Evonik Industries AG Biotechnological method for producing butanol and butyric acid
WO2013160124A1 (en) 2012-04-27 2013-10-31 Evonik Industries Ag Feedback-resistant alpha-isopropylmalate synthases
EP2674489A1 (en) 2012-06-15 2013-12-18 Evonik Industries AG Biotechnological 2-hydroxyisobutyric acid production
EP2700715A1 (en) 2012-08-20 2014-02-26 Evonik Degussa GmbH Method for manufacturing L-amino acids using improved strains of the enterobacteriaceae family by means of fermentation
WO2014029592A1 (en) 2012-08-20 2014-02-27 Evonik Degussa Gmbh Method for the fermentative production of l-amino acids using improved strains of the enterobacteriaceae family
EP2762571A1 (en) 2013-01-30 2014-08-06 Evonik Industries AG Microorganism and method for the production of amino acids by fermentation
WO2014117992A1 (en) 2013-01-30 2014-08-07 Evonik Industries Ag Microorganism and method for production of amino acids by fermentation
US10113190B2 (en) 2013-06-03 2018-10-30 Evonik Degussa Gmbh Method for producing L-leucine, L-valine, L-isoleucine, α-ketoisovalerate, α-keto-beta-methylvalerate, or α-ketoisocaproate using recombinant Corynebacteria that contain the ilvBN operon which can be induced by propionate
EP2811028A1 (en) 2013-06-03 2014-12-10 Evonik Industries AG Process for producing L-leucine, L-valine, L-isoleucine, alpha-ketoisovalerate, alpha-keto-beta-methylvalerate, or alpha-ketoisocaproate employing recombinant Corynebacteria comprising the propionate-inducible ilvBN operon
CN103374540A (en) * 2013-08-13 2013-10-30 廊坊梅花生物技术开发有限公司 Corynebacterium glutamicum and application thereof
EP2940144A1 (en) 2014-04-30 2015-11-04 Evonik Degussa GmbH Method for the production of l-lysine using an alkaliphilic bacterium
EP2940143A1 (en) 2014-04-30 2015-11-04 Evonik Degussa GmbH Method for the production of l-amino acids using an alkaliphilic bacterium
EP2940039A1 (en) 2014-04-30 2015-11-04 Evonik Degussa GmbH Method for the production of l-amino acids in coryne bacteria using a glycine splitting system
DE102014208199A1 (en) 2014-04-30 2015-11-05 Evonik Degussa Gmbh Process for the production of L-amino acids using an alkaliphilic bacterium
US10457933B2 (en) 2015-12-07 2019-10-29 Zymergen Inc. Microbial strain improvement by a HTP genomic engineering platform
US10808243B2 (en) 2015-12-07 2020-10-20 Zymergen Inc. Microbial strain improvement by a HTP genomic engineering platform
US9988624B2 (en) 2015-12-07 2018-06-05 Zymergen Inc. Microbial strain improvement by a HTP genomic engineering platform
US11352621B2 (en) 2015-12-07 2022-06-07 Zymergen Inc. HTP genomic engineering platform
US11312951B2 (en) 2015-12-07 2022-04-26 Zymergen Inc. Systems and methods for host cell improvement utilizing epistatic effects
US10336998B2 (en) 2015-12-07 2019-07-02 Zymergen Inc. Microbial strain improvement by a HTP genomic engineering platform
WO2017100376A2 (en) 2015-12-07 2017-06-15 Zymergen, Inc. Promoters from corynebacterium glutamicum
US11293029B2 (en) 2015-12-07 2022-04-05 Zymergen Inc. Promoters from Corynebacterium glutamicum
US11208649B2 (en) 2015-12-07 2021-12-28 Zymergen Inc. HTP genomic engineering platform
US10647980B2 (en) 2015-12-07 2020-05-12 Zymergen Inc. Microbial strain improvement by a HTP genomic engineering platform
US10745694B2 (en) 2015-12-07 2020-08-18 Zymergen Inc. Automated system for HTP genomic engineering
US10047358B1 (en) 2015-12-07 2018-08-14 Zymergen Inc. Microbial strain improvement by a HTP genomic engineering platform
US10883101B2 (en) 2015-12-07 2021-01-05 Zymergen Inc. Automated system for HTP genomic engineering
US11155807B2 (en) 2015-12-07 2021-10-26 Zymergen Inc. Automated system for HTP genomic engineering
US10968445B2 (en) 2015-12-07 2021-04-06 Zymergen Inc. HTP genomic engineering platform
US11085040B2 (en) 2015-12-07 2021-08-10 Zymergen Inc. Systems and methods for host cell improvement utilizing epistatic effects
US11155808B2 (en) 2015-12-07 2021-10-26 Zymergen Inc. HTP genomic engineering platform
US10544390B2 (en) 2016-06-30 2020-01-28 Zymergen Inc. Methods for generating a bacterial hemoglobin library and uses thereof
US10544411B2 (en) 2016-06-30 2020-01-28 Zymergen Inc. Methods for generating a glucose permease library and uses thereof
WO2018226964A2 (en) 2017-06-07 2018-12-13 Zymergen Inc. Promoters from corynebacterium glutamicum and uses thereof in regulating ancillary gene expression
EP3415623A1 (en) 2017-06-14 2018-12-19 Evonik Degussa GmbH Method for production of fine chemicals using a corynebacterium secreting modified alpha-1,6-glucosidases
WO2021048353A1 (en) * 2019-09-11 2021-03-18 Evonik Operations Gmbh Coryneform bacteria with a heterologous threonine transporter and their use in the production of l-threonine
EP4230723A4 (en) * 2020-10-16 2024-10-16 Tianjin Institute of Industrial Biotechnology, Chinese Academy of Sciences POLYPEPTIDE WITH ASPARTATE KINASE ACTIVITY AND ITS USE IN THE PRODUCTION OF AMINO ACIDS

Also Published As

Publication number Publication date
US20040043458A1 (en) 2004-03-04
CA2456416A1 (en) 2003-02-20
DK1414986T3 (en) 2009-01-19
CN100336901C (en) 2007-09-12
CN1541274A (en) 2004-10-27
CN101126075A (en) 2008-02-20
KR100943834B1 (en) 2010-02-24
EP1414986B1 (en) 2008-10-01
WO2003014330A3 (en) 2003-12-18
CN101126075B (en) 2012-05-09
ES2314076T3 (en) 2009-03-16
AU2002355462A1 (en) 2003-02-24
US20100255544A1 (en) 2010-10-07
KR20040041576A (en) 2004-05-17
BR0211745A (en) 2004-10-13
EP1414986A2 (en) 2004-05-06
DE60229139D1 (en) 2008-11-13
ATE409752T1 (en) 2008-10-15

Similar Documents

Publication Publication Date Title
EP1414986B1 (en) Coryneform bacteria which produce chemical compounds ii
EP1414970A2 (en) Production of l-lysine by genetically modified corynebacterium glutamicum strains
US7160711B2 (en) Coryneform bacteria which produce chemical compounds I
US7981640B2 (en) L-lysine-producing corynebacteria and process for the preparation of L-lysine
DK2236610T3 (en) Promoter and improved method for producing L-lysine using the same
WO2008033001A1 (en) A corynebacteria having enhanced l-lysine productivity and a method of producing l-lysine using the same
SK10202000A3 (en) L-lysine producing coryneform bacteria and method for the production of l-lysine
HUP0000747A2 (en) Process for the fermentative production of l-amino acids using coryneform bacteria
US6861246B2 (en) L-lysine-producing corynebacteria and process for the preparation of lysine
US6911329B2 (en) Process for the fermentative preparation of D-pantothenic acid using coryneform bacteria
HUP0001176A2 (en) Process for the fermentative production of l-amino acids using coryneform bacteria
SK16192001A3 (en) Process for the fermentative preparation of l-amino acids with amplifications of the tkt gene
WO2002066651A2 (en) Nucleotide sequences of the ribosomal protein s12 gene (rpsl) from corynebacterium glutamicum
KR20050018797A (en) Production of L-lysine by genetically modified Corynebacterium glutamicum strains
US20020028490A1 (en) Process for the production of L-amino acids by fermentation using coryneform bacteria
US20030087400A1 (en) Process for the fermentative production of L-lysine using coryneform bacteria
HUP0002020A2 (en) Process for producing l-amino acids using coryneform bacteria
US20020168732A1 (en) Process for the fermentative preparation of L-amino acids using coryneform bacteria
SK17952000A3 (en) Nucleotide sequences coding for the gpm gene and process for the fermentative production of l-amino acids

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 10358393

Country of ref document: US

AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SD SE SG SI SK SL TJ TM TN TR TT TZ UA UG US UZ VN YU ZA ZM ZW

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BY BZ CA CH CN CO CR CU CZ DE DM DZ EC EE ES FI GB GD GE GH HR HU ID IL IN IS JP KE KG KP KR LC LK LR LS LT LU LV MA MD MG MN MW MX MZ NO NZ OM PH PL PT RU SD SE SG SI SK SL TJ TM TN TR TZ UA UG US UZ VN YU ZA ZM

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ UG ZM ZW AM AZ BY KG KZ RU TJ TM AT BE BG CH CY CZ DK EE ES FI FR GB GR IE IT LU MC PT SE SK TR BF BJ CF CG CI GA GN GQ GW ML MR NE SN TD TG

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR IE IT LU MC NL PT SE SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2002751164

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2456416

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 20028154487

Country of ref document: CN

Ref document number: 1020047001926

Country of ref document: KR

WWP Wipo information: published in national office

Ref document number: 2002751164

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

NENP Non-entry into the national phase

Ref country code: JP

WWW Wipo information: withdrawn in national office

Ref document number: JP

WWG Wipo information: grant in national office

Ref document number: 2002751164

Country of ref document: EP