WO2003006621A2

WO2003006621A2 - Super osteocalcin promoter for the treatment of calcified tumors and tissues

Info

Publication number: WO2003006621A2
Application number: PCT/US2002/022216
Authority: WO
Inventors: Leland W. K. Chung; Fan Yeung
Original assignee: University Of Virginia Patent Foundation
Priority date: 2001-07-13
Filing date: 2002-07-12
Publication date: 2003-01-23
Also published as: WO2003006621A3; AU2002354572A8; AU2002354572A1

Abstract

The present invention is directed to an improved tissue specific promoter for gene expression and uses thereof. More particulary, the invention relates to an improved recombinant human osteocalcin (hOC) promoter that displays over 8-fold higher activity than the full-length hOC promoter and in a tissue-specific manner. In one embodiment the super hOC promoter is operably linked to a nucleic acid sequence encoding a heterologous protein, ribozyme, dominant-negative or antisense RNA for expression of those gene products in calcified tumors or bone tissues. In one embodiment hOC promoter activation by extracellular matrices and soluble factors secreted by prostate cancer and bone cells is used as a biomarker for the diagnosis and prognosis of prostate cancer.

Description

Super Osteocalcin Promoter for the Treatment of Calcified Tumors and Tissues

US Government Rights

This invention was made with United States Government support under Grant No. CA 85555, awarded by National Institutes of Health and under Grant No. NCC8-171, awarded by NASA. The United States Government has certain rights in the invention.

Related Application This application claims priority under 35 USC § 199(e) to US

Provisional Application Serial Nos. 60/305,360, filed July 13, 2001, the disclosure of which is incorporated herein.

Field of the Invention The present invention is directed to an improved tissue specific promoter for gene expression and uses thereof. More particularly, this invention relates to nucleic acid sequences encoding a recombinant functional promoter for the osteocalcin gene that has significantly higher activity relative to the foil length human OC promoter and the use of such nucleic acid sequences for heterologous nucleic acid sequence expression.

Background of the Invention

Osteocalcin (OC) is the major non-collagenous bone matrix protein expressed in bone. OC expression is transcriptionally regulated by vitamin D (vitD3) and limited exclusively to cells of the osteoblast lineage, including mature osteoblasts, osteocytes and hypertrophic chondrocytes. OC is synthesized, secreted and deposited by mature osteoblasts at the time of bone mineralization. It serves as a phenotypic marker for mature osteoblasts. Despite its well-characterized specificity of expression in transgenic mouse, the precise function of OC in bone remodeling remains unclear. The location of OC at the bone-forming surfaces and the increased bone mineralization observed in OC gene knockout mice supports a role of OC in suppression of bone mineralization. Due to its tissue specificity, regulation of OC expression has been studied extensively in bone cells. Many regulatory elements have been identified in the proximal 800-bp region of the promoters. These include OSE1 , OSE2 (Ducy and Karsenty (1995) Mol Cell Biol 15(4), 1858-69), AP-1/VDRE (Goldberg et al. (1996) J Cell Biochem 60(4), 447-57), and GRE (Meyer et al. (1997) J Biol Chem 272(49), 30709-14.). OSE1 and OSE2 were identified in mouse OC (mOC) promoter and are responsible for its restricted activity in osteoblasts. Both of these cis-elements are occupied by osteoblast-specific transcription factors, OSF1 and Runx2, respectively. Runx2 binds the OSE2 site and regulates the mouse OC (mOC) promoter in a tissue- specific manner. It belongs to the RUNT domain transcription factor family and it has an indispensable role in osteoblast differentiation, maturation and bone formation. In contrast to the mOC promoter, the human OC (hOC) promoter is highly inducible by vitD3. As a result, studies have mostly stressed its regulation by vitD3 in bone cells. Little is known about the basal regulation of the gene. Vitamin D response element (VDRE) has been mapped to the proximal promoter and it is contiguous to an AP-1 site. Studies suggest that the occupancy of this AP-1 site interferes with the action of vitamin D receptor (VDR) by blocking the interaction between VDR and its cognate binding sites (Lian et al. (1991) J Cell Biochem 45(1 ), 9-14). Furthermore, various AP-1 family members were shown to associate with the AP-1 VDRE site at different stages during osteoblast development and thus have different effects on the activity of the OC promoter. In proliferating osteoblasts, c-Fos and c-Jun heterodimers suppress the rat OC (rOC) promoter activity, while the expression of Fra-2 and Jun-D in the post-proliferate osteoblasts induces rOC promoter activity by facilitating VDR/RXR binding. Because of the specificity of OC expression, this promoter has been used to deliver therapeutic genes to tumors and fractured bones for the treatment of both localized and disseminated tumors and for bone repair, respectively. In a recent study (Hsieh et al., (2002) Cancer Res 62(1 1):3084-92) applicants demonstrated that the Ad vector, with viral replication being driven by the hOC promoter, dramatically caused tumor regression. Furthermore, applicants have shown that the replication of this virus can be markedly enhanced by treatment with a synthetic vitamin D3 analogue. These results suggest that Ad-hOC-El A and -E1B with viral replication driven by a bi-cistronic hOC promoter is a potent anti-tumor vector. This vector has been demonstrated to cause tumor regression in the prostate and exerted marked destruction of human renal cancer cells in culture. It is anticipated that the effectiveness of this therapeutic strategy will be enhanced through the use of the super hOC promoter of the present invention. Since many tumor types have the ability to calcify, and such tumors may produce osteocalcin, recombinant genes under the control of the OC promoter are well suited for treating such tumors.

For example, prostate cancer is the second leading cause of cancer death in Northern American men and the molecular mechanisms responsible for prostate cancer growth, androgen-independent (Al) progression and acquisition of bone metastatic potential are poorly characterized. However, bone matrix proteins such as OC, bone sialoproteins and osteopontin are shown to be prevalently expressed, and some of these markers (e.g. OC and BSP) are expressed in high levels in primary and metastatic prostate cancer specimens. One reported theory proposes that prostate cancer acquires "bone-like properties" to thrive and grow in the bone microenvironment. Therefore, prostate cancer is one type of cancer wherein a therapeutic construct comprising an osteocalcin promoter linked to a therapeutic agent can be used as an effective strategy for treating cancer. This hypothesis has been tested in an experimental model of human prostate cancer wherein a systemically delivered adenoviral vector (having viral replication driven by a mOC promoter) markedly depressed the growth of pre-existing prostate tumors in the skeleton. Furthermore, 100% of the treated animals showed decreased serum PSA levels and 40% of the treated animals were "cured" by such treatment regimen (defined by no tumor nor serum PSA rebound in these mice after and during a 15-week follow-up period).

The present invention is directed to further defining the human osteocalcin promoter (hOC) with specific emphasis on regions in OC-promoter that may be responsible for regulating down-stream therapeutic gene expression. After exploring different regions in OC, the critical cis-elements in the ΛOC promoter were identified that are responsible for inducing promoter activity in prostate and bone cells. More particularly, a recombinant OC promoter has been generated, wherein the inhibitory element of the hOC promoter was deleted, resulting in a hOC promoter having over 8-fold higher activity than the full-length ΛOC promoter.

Summary of the Invention: An extensive evaluation of the ΛOC promoter was conducted in which the functional hierarchy of the cis-acting elements, OSE1, OSE2, and AP-1 /VDRE was defined in an androgen-independent human prostate cancer PC-3 cell line. By juxtaposing dimers of these three elements, a minimum ΛOC promoter was produced, named super hOC promoter. This promoter displays over 8-fold higher activity than the full-length ΛOC promoter in a tissue-specific manner in the androgen-independent human prostate cancer PC3 cell line. The present invention also encompasses expression vectors comprising the super hOC promoter sequences and host cells transformed with these expression vectors. In one embodiment the super hOC promoter is operably linked to a nucleic acid sequence encoding a heterologous protein, ribozyme, dominant-negative or antisense RNA and used in delivering therapeutic genes to both localized and disseminated tumors; and conversely, super hOC can also be used to deliver therapeutic proteins to fractured bones for bone repair.

In another embodiment, hOC expression in prostate cancer cells can be used as a novel biomarker that is indicative of prostate cancer progression. Both autocrine and paracrine mediators that are secreted by prostate cancer and bone stromal cells can activate hOC promoter activity. By assessing the extent of OC promoter activity in response to these factors obtained from cancer cells, tissues, or urine/blood specimens, the extent of activation of hOC promoter activity may differentiate an indolent from a virulent form of prostate cancer. This same principle may apply to other solid tumors that exhibit a tendency to calcify and mineralize.

Brief Description of the Drawings Figs. 1A-1C. OSE1 and AP-1/VDRE (AV) are critical regulatory elements for basal hOC promoter activity in PC3 cells. Fig. 1 A provides a schematic drawing and accompanying data representing the results of the deletion analysis of the hOC promoter. Single, double and triple deletions of OSEl , OSE2, and AV sites were generated in the hOC promoter by recombinant PCR method. The activity of the 800-bp wild type hOC promoter (hOC/luc) was set to 100% in PC3 cells. The activity of various deletion constructs was then presented as % of the wild type promoter activity. Note, AV and OSEl but not OSE2 are required for the maintenance of the basal hOC promoter activity. Fig. IB provides a schematic drawing and accompanying data representing the results of interaction between the OSEl and AV sites. To evaluate the activities and interactions of the cis-elements, dimers of the cis-elements were inserted upstream to an artificial TATA box in different combinations and transfected into PC3 cells. The normalized Relative Luciferase Activities (RLA) of various constructs were divided by the normalized activity of the control (pGL3/TATA) in PC3 cells and expressed as fold of control. Fig. I C is a bar graph representing the results of juxtaposing OSEl , OSE2 and AP-1/VDRE elements to generate a reconstituted hOC promoter. The activities of the control (hOC/luc) in PC3 (34,850 ± 7,434 RLA) and LNCaP (2,311 ± 311.7 RLA) were set to be 1 respectively, and the activities of AV₂-OSE2₂-OSEl₂/TATA were expressed as x-fold of the control.

Fig. 2. is a bar graph demonstrating that conditioned media (CM) isolated from prostate cancer cell lines (LNCaP, DU145, PC3 and ARCaP) and bone cell lines (KeesII and MG63) can activate hOC promoter activity in a concentration- dependent manner in transfected C4-2B cells. There appears to be a positive relationship between induction of hOC promoter activity and the invasiveness of the prostate cancer cells from which the conditioned media were obtained. For example, ARCaP conditioned media induced markedly hOC promoter activity and ARCaP cells are considered to be the most invasive prostate cancer cell line. Conversely, LNCaP LNCaP is one of the least invasive prostate cancer cell lines, and this cell line secretes conditioned media which exert low OC promoter inductive activity.

Fig. 3A & 3B. Fig. 3A is a bar graph demonstrating that extracellular matrices can confer hOC promoter inductive activity via isotype-specific integrins. In this case, hOC promoter activity in prostate cancer cells can be activated through vitronectin (VN)-αvβ3 and collagen 1 (Coll)- α2βl -mediated pathways. The inclusion of conditioned media (CM, from cultured ARCaP cells) further enhanced hOC promoter activity in prostate cancer cells. Interestingly, however, the integrin antibodies (anti-α_vβ₃ and -α₂β, Ab) can only partially block the conditioned media- activated hOC promoter activity. To further examined the effect of Coll in mediating hOC promoter activity, a deletion study was conducted. As shown in Figure 3B, when a human prostate cancer cell line C4-2B was placed on Col I, all hOC activity is mediated by the 3 cis-DNA elements, AP-1/VDRE, OSEl and OSE2. These data taken together suggest that in addition to the cis-element identified, there must be other yet unidentified DNA elements within hOC promoter that are sensitive to ECMs and conditioned media-mediated upregulation of hOC promoter activity in prostate cancer cells (see Example 2).

Fig. 4. A proposed mechanism depicting the regulation of hOC promoter by a host of transcription factors under the control of soluble factors secreted by prostate cancer cells and bone stomal cells. The reciprocal cellular interactions between prostate and bone stromal cells could result in the secretion of soluble autocrine and paracrine factors. These factors could be responsible for inducing the expression of critical transcription factors, such as Fra-2 and Runx2, which could alter hOC promoter activity in prostate cancer and bone stromal cells.

Detailed Description of the Invention Definitions

In describing and claiming the invention, the following terminology will be used in accordance with the definitions set forth below.

The term "peptide" encompasses a sequence of 3 or more amino acids wherein the amino acids are naturally occurring or synthetic (non-naturally occurring) amino acids.

Naturally occurring amino acid residues in peptides are abbreviated as recommended by the IUPAC-IUB Biochemical Nomenclature Commission as follows: Phenylalanine is Phe or F; Leucine is Leu or L; Isoleucine is He or I; Methionine is Met or M; Norleucine is Nle; Valine is Val or V; Serine is Ser or S; Proline is Pro or P; Threonine is Thr or T; Alanine is Ala or A; Tyrosine is Tyr or Y; Histidine is His or H; Glutamine is Gin or Q; Asparagine is Asn or N; Lysine is Lys or K; Aspartic Acid is Asp or D; Glutamic Acid is Glu or E; Cysteine is Cys or C; Tryptophan is Trp or W; Arginine is Arg or R; Glycine is Gly or G, and X is any amino acid. Other naturally occurring amino acids include, by way of example, 4- hydroxyproline, 5-hydroxylysine, and the like.

Synthetic or non-naturally occurring amino acids refer to amino acids which do not naturally occur in vivo but which, nevertheless, can be incorporated into the peptide structures described herein.

As used herein, "nucleic acid," "DNA," and similar terms also include nucleic acid analogs, i.e. analogs having other than a phosphodiester backbone. For example, the so-called "peptide nucleic acids," which are known in the art and have peptide bonds instead of phosphodiester bonds in the backbone, are considered within the scope of the present invention.

A "polylinker" is a nucleic acid sequence that comprises a series of three or more different restriction endonuclease recognition sequences closely spaced to one another (i.e. less than 10 nucleotides between each site). As used herein, the term "vector" is used in reference to nucleic acid molecules that have the capability of replicating autonomously or otherwise maintaining themselves in a host cell, and optionally may be capable of transferring DNA segment(s) from one cell to another. Vectors can be used to introduce foreign DNA into host cells where it can be replicated (i.e., reproduced) in large quantities. Examples of vectors include plasmids, cosmids, lambda phage vectors, viral vectors (such as retro viral vectors).

An "expression vector" is defined herein as a vector that comprises all the necessary regulatory elements for expressing a protein product in a host cell, when a protein coding region is operably linked to the regulatory elements. A plasmid, as used herein, is a circular piece of DNA that has the capability of replicating autonomously in a host cell. A plasmid typically also includes one or more marker genes that are suitable for use in the identification and selection of cells transformed with the plasmid.

A "marker" is an atom or molecule that permits the specific detection of a molecule comprising that marker in the presence of similar molecules without such a marker. Markers include, for example radioactive isotopes, antigenic determinants, nucleic acids available for hybridization, chromophors, fluorophors, chemiluminescent molecules, electrochemically detectable molecules, molecules that provide for altered fluorescence-polarization or altered light-scattering and molecules that allow for enhanced survival of an cell or organism (i.e. a selectable marker). A reporter gene is a gene that encodes for a marker. A promoter is a DNA sequence that directs the transcription of a DNA sequence, such as the nucleic acid coding sequence of a gene. Promoters can be inducible (the rate of transcription changes in response to a specific agent), tissue specific (expressed only in some tissues), temporal specific (expressed only at certain times) or constitutive (expressed in all tissues and at a constant rate of transcription). As used herein, the term "osteocalcin promoter" includes nucleic acid sequences that will express an operably linked sequence only in those cells/tissues that express the natural osteocalcin gene and not in other cells/tissues. In one preferred embodiment, the osteocalcin promoter consists of the sequence of SEQ ID NO: 2 or functional fragments or derivatives thereof including the sequence of SEQ ID NO: l.

As used herein, the terms "complementary" or "complementarity" are used in reference to polynucleotides (i.e., a sequence of nucleotides) related by the base-pairing rules. For example, for the sequence "A-G-T," is complementary to the sequence "T-C-A." As used herein, the term "hybridization" is used in reference to the pairing of complementary nucleic acids. Hybridization and the strength of hybridization (i.e., the strength of the association between the nucleic acids) is impacted by such factors as the degree of complementarity between the nucleic acids, stringency of the conditions involved, the length of the formed hybrid, and the G:C ratio within the nucleic acids.

As used herein, the term "purified" and like terms relate to the isolation of a molecule or compound in a form that is substantially free (i.e. at least 60% free, preferably 75% free, and most preferably 90% free) from other components with which they are naturally associated. A "linker" is a molecule (or group of molecules) that serves to chemically link two disparate entities. For example a peptide linker chemically links two polypeptides via a peptide bond. "Operably linked" refers to a juxtaposition wherein the components are configured so as to perform their usual function. Thus, promoters operably linked to a coding sequence are capable of effecting the expression of the coding sequence.

As used herein, the term "pharmaceutically acceptable carrier" encompasses any of the standard pharmaceutical carriers, such as a phosphate buffered saline solution, water and emulsions such as an oil/water or water/oil emulsion, and various types of wetting agents.

As used herein, the term "super ΛOC promoter" refers to the nucleic acid sequence of SEQ ID NO: 1 or derivatives thereof that retain the high level of transcriptional activity of SEQ ID NO : 1.

The Invention

The present invention is directed to the identification and use of critical cis-elements in the human osteocalcin (hOC) promoter to produce a functional promoter that efficiently drives gene expression in a tissue specific manner. In accordance with one embodiment this promoter is used to express therapeutic gene products in tumors and calcified benign and normal tissues, including bone.

The full-length 800bp human OC promoter was obtained through PCR and chromosomal walking. The use of this promoter to express heterologous gene products has previously been reported in US Patent Nos. 5,772,993, the disclosure of which is incorporated herein. Further analysis of the osteocalcin promoter revealed the importance of cis-acting elements for conferring high level and tissue-specific activation of AOC promoter in androgen-independent prostate cancer PC3 and C4-2 cell lines and human osteosarcoma MG63 cell lines. In one embodiment of the present invention a purified recombinant

DNA sequence is provided, that functions as a tissue specific promoter. More particularly, the recombinant promoter sequence comprises a unique combination of the native hOC cis-acting elements to produce a promoter having enhanced activity relative to the native promoter. In accordance with one embodiment this improved promoter sequence consists of the sequence of SEQ ID NO: 1.

It is anticipated that minor alterations to the DNA sequence of SEQ ID NO: 1, can be made that will retain the promoter's ability to transcribe a gene operably linked to the recombinant promoter. Accordingly, a nucleic acid gene construct comprising the sequence of SEQ ID NO: 1 or sequences that differ from SEQ ID NO: 1 by 1 to 25, or 1 to 10, more preferably 1 to 5 nucleotide alterations that still encode a functional osteocalcin promoter (i.e. cable of expressing an operably link sequence in a tissue specific manner) are within the scope of the present invention. These nucleotide alterations may include single nucleotide deletions or insertions, or substitutions of one nucleotide for another. Typically the nucleotide alteration is a simple transition from a purine to a pyrimidine or vice versa. In one embodiment a nucleic acid sequence is provided comprising the sequence of SEQ ID NO: 1 or sequences that differ from SEQ ID NO: 1 by 1 to 20, more preferably 1 to 5 nucleotide alterations, that do not alter the transcriptional activity of the promoter of SEQ ID NO: 1.

The preferred osteocalcin promoter element of this invention consists of the nucleic acid sequence of SEQ ID NO: 1, as well as fragments of that sequence that retain osteocalcin specific activity. The present invention also encompasses sequences of 100 to 300 nucleotides and comprising a sequence substantially homologous to the sequence of SEQ ID NO: 1 such that they will hybridize to those sequences under stringent conditions. Preferably those sequences will also have osteocalcin specific activity. Nucleic acid duplex or hybrid stability is expressed as the melting temperature or Tm, which is the temperature at which a nucleic acid duplex dissociates into its component single stranded DNAs. The equation for calculating the Tm of nucleic acids is well known in the art. As indicated by standard references, a simple estimate of the Tm value may be calculated by the equation: Tm (°C) = 81.5 + 0.41 (% G+C), when a nucleic acid is in aqueous solution at 1M NaCl (see e.g., Anderson and Young, Quantitative Filter Hybridization, in Nucleic Acid Hybridization (1985)). Other references include more sophisticated computations which take into account the length of the probe, as well as structural and sequence characteristics into account for the calculation of Tm. This melting temperature is used to define the stringency conditions of the hybridization and washes for hybridization reactions. Typically a 1% mismatch results in a 1°C decrease in the Tm, and the temperature of the final wash in the hybridization reaction is reduced accordingly (for example, if two sequences have > 95% identity, the final wash temperature is decreased from the Tm by 5°C). In practice, the change in Tm can be between 0.5°C and 1.5°C per 1% mismatch.

In accordance with one embodiment, the present invention is directed to the nucleic acid sequence of SEQ ID NO: 1 and nucleic acid sequences that hybridize to those sequences (or fragments thereof) under stringent or highly stringent conditions. In accordance with the present invention highly stringent conditions are defined as conducting the hybridization and wash conditions at no lower than -5°C Tm. Stringent conditions are defined as hybridizing at 68°C in 5x SSC/5x Denhardt's solution/1.0% SDS, and washing in 0.2x SSC/0.1 % SDS at 68°C . Moderately stringent conditions include hybridizing at 68°C in 5x SSC/5x Denhardt's solution 1.0% SDS and washing in 3x SSC/0.1% SDS at 42°C. Additional guidance regarding such conditions is readily available in the art, for example, by Sambrook et al, 1989, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, N.Y.; and Ausubel et al. (eds.), 1995, Current Protocols in Molecular Biology, (John Wiley & Sons, N.Y.) at Unit 2.10.

The hOC promoter of the present invention, when operably linked to a heterologous gene, will result in the expression of that gene in osteoblast cells as well as in androgen-independent metastatic human prostate cells. Therefore the super hOC promoter can be operably linked to various cytotoxic agents and administered to patients as a means of treating prostate and other forms of cancer that express the native OC gene (i.e. calcified tumors). Accordingly, the present invention encompasses various nucleic acid constructs and vectors that comprise a promoter sequence consisting of SEQ ID NO: 1 , and the use of such constructs to deliver therapeutic genes to tumors and fractured bones for the treatment of both localized and disseminated tumors and for bone repair, respectively.

In one embodiment a nucleic acid construct is provided wherein the sequence of SEQ ID NO: 1 is operably linked to a polylinker. Polylinkers are well known to those skilled in the art and typically comprise three or more different restriction sites that are unique to the vector construct. In this manner a protein encoding sequence can be inserted into the nucleic acid construct using one of the convenient restriction sites of the polylinker to operably link a protein encoding sequence to the promoter of SEQ ID NO: 1. The resulting constπϊet'lanfthen ^'blπiSed to transfect cells, and the expression of the inserted gene will be limited to cells that normally express the osteocalcin gene.

The present invention also encompasses a pack or kit comprising a gene construct for regulating gene expression in vitro or in vivo. More particularly, the kit provides vector constructs for use in expressing genes only in target tissues that express osteocalcin. In one embodiment the kit comprises an expression vector, wherein the vector comprises a promoter operably linked to a polylinker, and the promoter consists of the nucleic acid sequence of SEQ ID NO: 1. Alternatively, the kit may comprise an expression vector comprising a promoter operably linked to a heterologous gene, wherein the promoter consists of the nucleic acid sequence of SEQ ID NO: 1. In one preferred embodiment the expression vector is selected from the group consisting of plasmids, recombinant retroviral vectors and recombinant adenovirus vectors. The nucleic acid constructs of the kit can be packaged in a variety of containers, e.g. , vials, tubes, microtiter well plates, bottles, and the like. Other reagents can be included in separate containers and provided with the kit; e.g., positive control samples, negative control samples, buffers, cell culture media, etc. Preferably, the kits will also include instructions for use.

The expression vectors contemplated by the present invention are at least capable of directing the replication, and preferably also expression, of a structural gene operatively linked to the vector. In one embodiment, a vector contemplated by the present invention includes a procaryotic replicon, i.e., a DNA sequence having the ability to direct autonomous replication and maintenance of the recombinant DNA molecule extrachromosomally in a procaryotic host cell, such as a bacterial host cell. Such replicons are well known in the art and include OriC. In addition, those embodiments that include a procaryotic replicon may also include a gene whose expression confers a selective advantage such as amino acid nutrient dependency or drug resistance to the transformed bacterial host cell that allows selection of transformed clones. Typical bacterial drug resistance genes are those that confer resistance to antibiotics such as ampicillin, tetracycline, kanamycin, and the like. Expression vectors compatible with eukaryotic cells, preferably those compatible with cells of vertebrate or mammalian species, can also be used to form the recombinant DNA molecules of the present invention. Eukaryotic cell expression vectors are well known in the art and are available from several commercial sources. Typically, such vectors are provided containing convenient restriction sites (i.e. a polylinker) for insertion of the desired gene construct.

In preferred embodiments, the eukaryotic cell expression vectors used to construct the recombinant DNA molecules of the present invention include a selectable phenotypic marker that is effective in a eukaryotic cell, such as a drug resistance selection marker or selective marker based on nutrient dependency. For example, drug resistance markers suitable for use in the present invention include the the neomycin phosphotransferase (neo) gene. (Southern et al., J. Mol. Appl. Genet., 1 :327-341, 1982), and the hygromycin resistance gene.

In accordance with one embodiment the osteocalcin promoter is used to regulate the expression of a heterologous gene. The method comprises the step of operably linking the super hOC promoter upstream of the gene's coding region prior to introducing the gene construct into the cell. In one embodiment, an expression vector is provided wherein the super hOC promoter is operably linked to a polylinker and the polylinker site is used to operably link the heterologous gene to the promoter. Once the gene has been inserted into the polylinker of the vector, the construct is transfected into a cell in vitro or in vivo using techniques known to those skilled in the art. In one preferred embodiment the super hOC promoter consists of the nucleic acid sequence of SEQ ID NO: 1.

In one embodiment the heterologous gene encodes a product that is directly or indirectly toxic to mammalian cells. For example, the heterologous gene may encode a conditionally lethal product such as Herpes Simplex thymidine kinase (HSVTK) or E. coli guanine phosphoribosyl transferase. In one embodiment the heterologous gene is thymidine kinase, and more preferably herpes simplex virus thymidine kinase. Cells that express the conditionally lethal gene product will be selectively killed upon exposure to a drug such as acyclovir or any of its analogues (FIAU, FIAC, DHPG). These drugs are known to be phosphorylated by HSVTK (but not by cellular thymidine kinase) to their corresponding active nucleotide triphosphate Expression vectors compatible with eukaryotic cells, preferably those compatible with cells of vertebrate or mammalian species, can also be used to form the recombinant DNA molecules of the present invention. Eukaryotic cell expression vectors are well known in the art and are available from several commercial sources. Typically, such vectors are provided containing convenient restriction sites (i.e. a polylinker) for insertion of the desired gene construct.

In one embodiment the heterologous gene encodes a product that is directly or indirectly toxic to mammalian cells. For example, the heterologous gene may encode a conditionally lethal product such as Herpes Simplex thymidine kinase (HSVTK) or E. coli guanine phosphoribosyl transferase. In one embodiment the heterologous gene is thymidine kinase, and more preferably herpes simplex virus thymidine kinase. Cells that express the conditionally lethal gene product will be selectively killed upon exposure to a drug such as acyclovir or any of its analogues (FIAU, FIAC, DHPG). These drugs are known to be phosphorylated by HSVTK (but not by cellular thymidine kinase) to their corresponding active nucleotide triphosphate

-13- forms (see, for example, Schaeffer et al., Nature 272:583, 1978). Acyclovir and FIAU triphosphates inhibit cellular polymerases in general, leading to the specific destruction of cells expressing HSVTK in transgenic mice (see Borrelli et al., Proc. Natl. Acad. Sci. USA 85:7572, 1988). In accordance with one embodiment of the present invention, a method is provided for treating a patient that has a tumor. The method comprises the steps of delivering a nucleic acid construct to the patient, wherein the nucleic acid construct comprises a therapeutic agent under the control of the osteocalcin promoter. In one embodiment the Super hOC promoter of SEQ ID NO: 1 is used to deliver therapeutic genes to treat localized benign and malignant tumors and metastatic cancers that have the capacity to undergo calcification and mineralization. For example, OC expression has been detected in both primary and bone metastatic prostate tumor specimens. Based on the knowledge of hOC expression in tumor tissues, such a promoter will be highly efficient for delivering therapeutic genes to prostate, breast, brain, osteosarcoma, ovarian, lung, and thyroid tumors.

Accordingly, the present invention provides a method for treating a tumor comprising the step of delivering to the tumor a therapeutic agent comprising the osteocalcin promoter of SEQ ID NO: 1 driving the expression of thymidine kinase (TK). In one embodiment the therapeutic agent is delivered through the use of a recombinant adenovirus (Ad) vector that comprises the osteocalcin (OC) promoter of SEQ ID NO: 1 operably linked to thymidine kinase. In one embodiment the method of treating a tumor further comprises delivering acyclovir (ACV , a pro-drug substrate) to said tumor either simultaneously or after administration of the therapeutic agent. Acyclovir, or suitable analog of acyclovir, is administered using standard techniques in a dose of from about 1 mg/day/kg to about 100 mg/day/kg body weight. The use of thymidine kinase/acyclovir therapy has been described previously, see US Patent Nos. 6,217,860, 6,159,467 and 5,772,993, the disclosures of which are incorporated herein.

It has been previously reported that mouse OC-mediated hsv-TK (OC- TK), plus the pro-drug ganciclovir (GCV) or acyclovir (ACV), efficiently blocks the growth of localized prostate tumors and their skeletal xenografts (Chung et al, (1997) Hinyokika Kiyo, 43: 815-820). Furthermore a single i.v. administrated dose of Ad-

-14- OC-Ela was shown to markedly inhibit previously established prostate tumor grown in the skeleton (Matsubara et al., (2001) Cancer Res., 61: 6012-6019. A Phase I OC dose escalation trial has demonstrated the safety of intratumoral delivery of Ad-OC- TK followed by an oral ACV analogue, valacyclovir (Koeneman et al., (2000) World J. UroL, 18: 102-110). Accordingly, administration of a recombinant adenovirus that expresses the thymidine kinase (TK) under the control of the osteocalcin promoter in combination with ACV treatment is anticipated to be highly selective in blocking the growth of human osteosarcoma cells, as well as human brain tumor cells and prostate carcinoma cell growth. The present invention provides a method for treating a tumor selected from the group consisting of osteosarcoma, breast cancer, prostate cancer, melanoma or a brain tumor.

Because of the exclusive hOC expression in normal bone, super hOC promoter can also be used to deliver therapeutic genes for the repair of bone tissues in conditions of bone fracture, osteoporosis, and congenital abnormality of bone growth and formation. In addition, the super hOC promoter can also be used to deliver therapeutic genes to benign tumors and tissues in such conditions as benign prostatic hyperplasia, (BPH) or hypertensive conditions resulting from over-growth of the smooth muscle components surrounding the blood vessels (plaques surrounding the arterior blood vessels). In one embodiment the nucleic acid construct is delivered using a viral vector such as an adenovirus, and more particularly, a recombinant adenovirus (Ad) vector is used that contains the osteocalcin promoter of SEQ ID NO: 1 driving the expression of thymidine kinase (TK).

Further, the present invention provides a method of treating neoplastic cells by intravenous, intratumoral or isolated regional perfusion of organs injection with the recombinant adenovirus, wherein the adenovirus comprises the osteocalcin promoter of SEQ ID NO: 1 operably linked to the thymidine kinase (TK). This treatment can also be coupled with ACV treatment. In addition the present invention provides a method for treating osseous metastatic tumors such as melanoma, breast cancer and prostate cancer, the treatment of tumors (e.g. osteosarcoma and prostate cancer) that metastasized to the lung, and inhibiting human brain tumor cell growth. As used herein the term "treating" means administering therapy to prevent, alleviate, or cure a malady, disorder, affliction, disease or injury in a patient. For example

-15- treatment of cancer includes alleviating symptoms, reducing the growth rate or size of a tumor, inducing remission or eliminating cancer cells.

Applicants have also discovered that ECM-integrin signaling and soluble growth factors produced by prostate cancer and bone cells could co-signal prostate cancer cells to induce osteocalcin promoter activity. In particular, Collagen 1 and Vitronectin have been identified as inducers for OC promoter activity in prostate cancer cells. This induction of OC promoter activity can be blocked by anti-integrin antibodies (alpha 2 beta 1 and alpha v beta 3, respectively, see Fig. 3 A), suggesting that pathways leading to OC promoter activation may be mediated by ECM-integrin signaling. In addition, conditioned media isolated from prostate cancer and bone cell lines can activate remarkable OC promoter activity in a concentration-dependent manner (see Fig. 2). This conditioned media activated hOC promoter activity can be blocked only partially by anti-integrin antibodies such as alpha 2 beta 1 and alpha v beta 3, suggesting other regions of hOC cis-DNA-elements may be responsible also for the induction of hOC promoter activity by prostate cancer and bone stromal cell conditioned media (Fig. 3A).

In accordance with one embodiment, nucleic acid constructs comprising the osteocalcin promoter operably linked to a reporter gene are used in screening assays to detect the presence of neoplastic cells in a warm blooded vertebrate species. In one preferred embodiment the Super OC promoter of SEQ ID NO: 1 is used for detecting the presence of cancer cells because the multiple cis elements responsive to ECM and soluble growth factors result in enhanced promoter activation. One aspect of the present invention is directed to a method of diagnosing a patient for neoplastic disease. The method comprises the steps of obtaining a biological sample from said patient, and measuring the amount of expression from an osteocalcin/reporter gene construct in the presence of the biological sample. More particularly, the osteocalcin/reporter gene construct comprises an osteocalcin promoter sequence operably linked to a reporter gene.

In one embodiment, expression of the marker is conducted using cells transfected with the osteocalcin/reporter gene construct. In this embodiment, the transfected cells are cultured in the presence of the biological sample or a purified fraction of the biological sample. Preferred host cells for transfection are eukaryotic

-16- cells, more preferably human cell lines, and in one embodiment are human cancer cell lines (including for example, prostate cancer cells: LN-CaP, C4-2, PC3, DU145, C4- 2B, ARCaP or human osteosarcoma cell line MG63) or human bone stomal cell lines (such as KeesII). Alternatively, the marker can be expressed using standard cell free in vitro reactions in the presence of the biological sample. In one embodiment an in vitro cell free transcription reaction is used to measure the activity of the osteocalcin promoter in the presence and absence of the biological sample.

In one embodiment the promoter used in the osteocalcin/reporter gene construct comprises the 800bp human osteocalcin promoter, previously described in Morrison et al., Science, 246, 1158-1161 (1989). In an alternative embodiment the osteocalcin promoter is selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2 and more preferably the promoter consists of SEQ ID NO: 1.

The marker encoded by the reporter gene is not critical and can be selected from any of the known detectable markers including visible (colorimetric) markers, enzymatic markers (e.g., easily assayed enzymes such as beta-galactosidase, luciferase, beta-glucuronidase, chloramphenicol acetyl transferase (CAT) and secreted embryonic alkaline phosphatase (SEAP)), fluorescent proteins (such as green fluorescent protein (GFP), enhanced blue fluorescent protein (EBFP), enhanced yellow fluorescent protein (EYFP) and enhanced cyan fluorescent protein (ECFP)); and proteins for which immunoassays are readily available such as hormones and cytokines. The expression of these reporter genes can also be monitored by measuring levels of mRNA transcribed from these genes. One preferred marker is luciferase, and in one preferred embodiment the osteocalcin/reporter gene construct comprises a promoter consisting of the sequence of SEQ ID NO: 1 operably linked to the luciferase gene.

The biological sample may comprise tissue, cells or extracellular matrix recovered directly from a patient or recovered from cells obtained from the patient and cultured in vitro for varying lengths of time or a purified fraction of such recovered material. The biological sample may also comprise one or more bodily fluids obtained from the patient and containing soluble factors secreted or produced by neoplastic tissue or cells. Bodily fluids suitable for use in the present invention include blood, plasma, serum, lymph, urine and cerebrospinal fluid, or a purified

-17- fraction of such fluids. The biological sample in one embodiment includes both insoluble components (i.e. cells, cell fragments, cell matrix components, etc..) as well as soluble factors recovered from a patient being screened for neoplastic cells. In accordance with one embodiment the biological sample is blood, or a component of blood.

The presence of neoplastic cells is detected by observing an increased in expression of the osteocalcin/reporter gene construct (as measured by the strength of the marker signal) induced by the presence of the biological sample. The increased level of expression is relative to normal or basal expression of the osteocalcin/reporter gene construct marker. In accordance with one embodiment the detection of a predetermined level of marker expression is indicative of the presence of a tumor. This threshold level can be established based on the levels of expression obtained from normal patients (i.e. non-tumor bearing patients). Alternatively, two separate transcription translation reactions can be run simultaneously and under similar conditions, wherein one reaction is run in the presence of the biological sample and the other reaction is run in the absence of the biological sample. A significant increase in the expression of the marker when the reporter gene is being transcribed and translated in the presence of the biological sample relative to that transcribed and translated in the absence of the biological sample is indicative of the presence of a tumor. As used herein a "transcription/translation reaction" and "expressing the reporter gene construct" includes the expression of genes in intact transfected cells wherein the cells are cultured in the presence or absence of the biological sample. Applicants have also discovered that there is a positive relationship between the induction of OC promoter activity and the invasiveness of the prostate cancer cells from which conditioned media were obtained. For example, ARCaP conditioned media induced markedly enhanced OC promoter activity (see Fig. 2), and ARCaP cells are considered to be one of the most invasive prostate cancer cell lines. Conversely, LNCaP is one of the least invasive prostate cancer cell lines, and this cell line secretes conditioned media which exert low OC promoter inductive activity. Applicants have also discovered that the compounds responsible for OC promoter induction are non-dialyzable and ammonium sulfate precipitable and thus are likely proteins.

-18- In accordance with one embodiment of the invention osteocalcin promoter activity is used as an indicator of the invasiveness and aggressiveness of a detected tumor and can help determine the prognosis and therapeutic options for the patient. More particularly, the present invention provides a method for detecting cancer and determining the prognosis and therapeutic strategy. The method comprises obtaining a biological sample from a warm-blooded patient, including humans, and expressing a reporter gene construct in the presence of the biological sample (or a purified fraction or derivative thereof) and determining if expression of the marker is enhanced by the presence of the biological sample. In one embodiment the marker gene construct comprises the osteocalcin promoter of SEQ ID NO: 1 or SEQ ID NO: 2 operably linked to a reporter gene.

As shown in Fig. 3, in addition to the cis-element identified herein, there are other yet unidentified DNA elements within OC promoter that are sensitive to ECMs and conditioned media up regulation of OC promoter activity in prostate cancer cells.

Based on the presently described combination of specific transcription factors (e.g. OSEl binding factors, Sp-2, and Sp-3 proteins, OSE-2 binding factor Runx-2, and AP-1 /VDRE binding proteins, Fra2/JunD/Vit D receptor) that may be required to activate hOC promoter activity during androgen-independent prostate cancer progression, such combination of transcription factors may be responsible for "switching on" other identified or yet to be identified down-stream target genes in cancer cells. These gene products, identified by their promoter sequences (similar cis- elements as hOC promoter), and combination of transcription factors may be unique markers to differentiate tumor from normal tissues, or tumor cells of different hormonal dependency. In accordance with one embodiment the nucleic acid sequences of AV (GGTGACTCACCGGGTGAA; SEQ ID NO: 3), OSEl (CAGGCATGCCCCTCCTCATCGCTGGGCAC; SEQ ID NO: 4) and OSE2 (GCTCCCAACCACATATCC; SEQ ID NO: 5) are used as probes to identify other genes that are involved in tumorigenesis or whose upregulated expression may serve as a diagnostic of a neoplastic disease.

The transcription factors and their interactive cis-elements may be novel therapeutic targets for the treatment of cancers. For example, one could design

-19- decoy cis-elements or antisense oligos of SEQ ID NOs: 3-5 to target these identified regions and to control cancer growth and gene expression.

The present invention is also directed to the transgenic host cells and non-human transgenic organisms produced using DNA constructs of the present invention. Host cells are selected from eukaryotic cells including plant and animal cells. Preferably the host cell is a vertebrate species host cell, and more preferably the cell is from a warm-blooded vertebrate species. In one embodiment, the host cells are selected from human, primate or mouse cells. Methods for transforming host cells are well known to those skilled in the art and vary with the type of cell to be transformed. In one embodiment of the present invention, a recombinant host cell is provided wherein the cell contains a heterologous DNA construct comprising a promoter, wherein the promoter consists of the nucleic acid sequence of SEQ ID NO: 1.

Example I Prostate Cancer Induced Expression from the Ostecalcin Promoter Materials and Methods

Cell culture and Transfection.

Prostate cancer cells (PC3, DU145, LNCaP) and MG63 (human osteosarcoma cell) were cultured in T-medium (Gleave, et al. (1991) Cancer Res 51(14), 3753-61) supplemented with 5% fetal bovine serum (FBS). ^"Rat osteosarcoma cells (ROS) were cultured in DMEM (Life Technologies, Inc.) with 10% FBS. For transfections, cells were plated at a density of 1.0 x 10⁵ (PC3, DU145 & ROS) cells/well in 12-well plates 24 hours or 3 x 10⁵ cells/well (LNCaP) in 6-well plates 48 hours before transfection. Plasmid DNAs were introduced into cells either by complexing with DOTAP (Roche Molecular Biochemicals) or Clonfectm (Clontech, Palo Alto, CA). Briefly 1 to 3.5 ug of tested DNA constructs were used in the experiments. DNA-lipid complexes were allowed to form for 5-15 minutes at room temperature prior to their addition to each well containing 0.5 ml or 1 ml of serum- free and phenol red-free RPMI 1640 medium or serum free DMEM. The cells were incubated with the complexes for 4-5 hours at 5% CO₂, 37°C. DNA-lipid containing medium was then replaced with fresh medium with FBS. Cells were collected after 36-48 hours of additional incubation.

-20- Luciferase assay.

Cells were washed with 0.5 ml/well of PBS and lysed in 100 ul IX lysis buffer (Promega, Madison, WI). Cell lysates were vortexed for a few seconds and spun for 2 minutes. For luciferase activity detection, 20 ul of the supernatant was mixed with 100 ul of luciferase substrate (Promega) and measured by a luminometer (Monolight 2010, Analytical Luminescence Laboratory, Sparks, MD). For β- galactosidase activity detection, 50 or 100 ul of the supernatant was mixed with an equal volume of 2X β-gal substrate (Promega) and incubated at 37°C for 15-30 minutes. The β-gal activity was determined by plate reader at 405 nm wavelength. For protein assay, 10 ul of cell extract were mixed with 200 ul of Coomassie plus protein reagent (Pierce, Rockford, IL) and measured at 590 nm. Data are expressed as relative luciferase activity (RLA), which is obtained by normalizing the luciferase activity with either CMV- β-gal activity or the protein concentrations of the cell lysates. Each experiment was carried out either in duplicate or triplicate, and RLA was expressed as the mean SD ± of 2-3 independent experiments. Plasmids.

Genomic DNA was used in the PCR amplification of the 800 bp human osteocalcin promoter (Morrison, et al., (1989) Science 246(4934), 1158-61), subsequently cloned into luciferase reporter vector, pGL3/Basic (Promega). The deletion constructs were generated by recombinant PCR method (Carey, M., and Smale, S. T. (2000) Transcriptional Regulation in Eukaryotes: concepts, strategies, and techniques, 1st Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, New York). Complementary oligomers (the detailed oligos sequences were listed in the EMS A section) containing Kpn I and Nhe I sites were annealed and ligated to Kpn I- and Nhe I -digested pGL3/TATA vector to generate OSEl 2-, OSE22-, and AV2- TATA. Different combinations of the OSEI2-, OSE22-, and AV2-TATA were generated by ligating respective constructs digested with either BamH I and Avr II or BamH I and Nhe I.

Western Blot Analyses. Immunoblotting was performed using the NOVEX (Invitrogen,

Carlsbad, CA) system. Briefly, proteins were separated on 4-12% Tris-glycine PAGE gels and transferred onto a 0.2 micron nitrocellulose membrane. Non-specific binding

-21- was blocked with 5% non-fat milk in TBS-T for 1 hour at 37 °C. Primary antibody was used at a 1 :500-Runx2 or 1 :200-Fra-2 (Santa Cruz Biotechnology, Santa Cruz, CA) dilution. Secondary antibody (HRP-anti-rabbit-Ab) (Amersham, Piscataway, NJ) was used in a 1 :4000 dilution. The incubation of both primary and secondary antibodies was done at 37 °C for 1 hour with 30 minutes washing (TBS-T) in between. ECL plus (Amersham) reagent was used for detection. Electrophoretic Mobility Shift Assay (EMSA).

PAGE purified oligos (Sigma-Genosys, Woodlands, TX) were annealed by heating up to 95 °C and slowly cooled down to room temperature. The oligo sequences used as probes or competitors were as follows: ARE-HI TCGACGAGGAACATATTGTATCGAGTCGA (SEQ ID NO: 6), SP-1 ATTCGATCGGGGCGGGGCGAGC (SEQ ID NO: 7; Santa Cruz Biotechnology), AP-1 CGCTTGATGACTCAGCCGGAA (SEQ ID NO: 8), VDRE AGGTCAAGGAGGTCA (SEQ ID NO: 11; Santa Cruz Biotechnology), OSEl CAGGCATGCCCCTCCTCATCGCTGGGCAC (SEQ ID NO: 5), OSE2 GCTCCCAACCACATATCC (SEQ ID NO: 4), AP-1/VDRE TGGTGACTCACCGGGTGAA (SEQ ID NO: 3). The double-stranded probes were end-labeled with -32pATP by using T4 polynucleotide kinase (NEB, Beverly, MA). Nuclear extracts were prepared as describe in Current Protocols (Ausubel et al., (1999) Current Protocols in Molecular Biology, three vols., John Wiley & Sons, Inc., Massachusetts General hospital, Harvard Medical school). 40,000 cpm of labeled probe and 5 ug-10 ug of nuclear extracts were incubated with binding buffer containing 10 mM Tris-HCl (pH 7.5), 50 mM NaCl, 0.5 mM EDTA, 0.5 mM dithiothreitol, 4% glycerol, 1 ug of polydl-dC (Amersham), and 1 mM KC1 at room temperature for 30 minutes. The samples were subjected to electrophoresis at room temperature on a 4% non-denaturing polyacrylamide gel in 0.5X TBE at 35 mA for 2 hours. For experiments using Runx2 antibody, 2 ug antibody was added to the reaction mixture for 30 minutes after the incubation period of the probe and nuclear extracts; for experiments using Sp-1, Sp-2, Sp-3, VDR, Fra-2, Jun-D and AR antibodies (Santa Cruz Biotechnology), nuclear extracts and 2 ug antibody were pre- incubated at room temperature for 30 minutes before the addition of probe. In

-22- competition experiments, competitor oligos were incubated with nuclear extracts for 30 minutes at room temperature before the addition of the probe. RT-PCR

RNA was extracted using RNAzolB (Teltest, Friendswood, TX). Reverse transcription was performed using Superscript II reverse transcriptase (Life Technologies Inc), according to the manufacturer's protocol. Each RT reaction contained 5 ug of total RNA, 0.5 ug of oligo dT (Amersham) and 0.5 ug of random hexamer (Amersham) in a total volume of 20 ul which were then incubated at 42 C for 1.5 hours. Subsequently, 3 ul of the fresh RT reaction was used for PCR purpose. The primers used for hOC PCR are: CACTCCTCGCCCTATTGGCC (OC 1 FW; SEQ ID NO: 9) and GCCAACTCGTCACAGTCCGG (OC1RV; SEQ ID NO: 10). The primers used for human runx2 PCR are: ACCATGGTGGAGATCATCGC (SEQ ID NO: 12) and CATCAAGCTTCTGTCTGTGC (SEQ ID NO: 13). The cycle for both PCR reactions is 94°C 30 second, 60°C 30 second, and 72°C 30 second for 35 cycles.

Results

Androgen-independent metastatic human prostate cancer cell lines have high and inducible hOC mRNA and promoter activity.

OC protein is not detectable in normal human prostate tissue, yet is prevalently expressed in primary prostate cancer (85%) and in prostate cancer lymph node (100%) and bone metastasis specimens (100%). To understand the molecular mechanism of hOC expression in prostate cancer cells, the expression pattern of hOC mRNA in different cancer cell lines was examined. RNA from four cell lines in two different conditions were extracted and used as templates for RT-PCR. Ethanol (the control groups) or 5 nM of vi D3 was added to the medium when the cells reached 60% confluence. Cells were collected after an additional 48 hours incubation. A human osteosarcoma cell line (MG63), shown previously to express endogenous OC, was used as a positive control. hOC mRNA was detected in both PC3 bone metastatic Al prostate cancer cells and the positive control MG63. Upon addition of vitD3, all the Al prostate cancer cell lines (DU145, PC3) and MG63 showed an elevated level of hOC mRNA. However, the androgen-dependent/sensitive non-tumorigenic prostate

-23- cancer cell-LNCaP did not have any detecteable hOC expression in either the presence or absence of vitD3>

To investigate whether the expression of hOC mRNA is controlled at the transcriptional level, the 800bp hOC promoter was cloned and inserted upstream to a luciferase reporter gene (hOC/luc) for transient expression analysis. In parallel with the RT-PCR data, PC3 exhibited the highest basal hOC/luc activity (34,850 ± 7,434 RLA) among the three prostate cancer cell lines; and the activity (2,311 ± 312 RLA) observed in LNCaP cells was similar to the empty vector, and was considered to be background. The rat osteosarcoma cells (ROS) served as positive control in the transient transfection experiments because of the high transfection efficiency obtained with ROS cells. In accordance with previous studies, the hOC promoter was inducible by the addition of vitD3 in all the cell lines tested. Thus the promoter is tissue-specific and regulated by vitD3.

OSE 1 and AP-1/VDRE are critical for regulating basal hOC promoter activity in PC3 cells.

OSEl and OSE2 of mOC promoter were reported to be responsible for its restrictive activity in bone cells, while AP-1 /VDRE (AV) is required for the vhT>3 inductive response in hOC promoter. However, the roles of OSEl, OSE2 and AP- 1/VDRE have never been examined in the regulation of basal hOC promoter activity in prostate cancer cells. To define the functional hierarchy of these cis-elements in the control of hOC promoter activity in PC3 cells, the recombinant PCR method was used to generate single, double or triple deletions of these elements. Among the single deletion mutants, OSEl suffered the greatest activity drop, followed by AV. Deletion of OSE2 did not seem to affect the promoter activity to a great extent. Moreover, when OSE2 was removed together with either OSEl or AV in double deletion, no additional decrease of activity was observed compared to the single deletion mutants (AV or OSEl). Thus, the OSE2 element may not be required for the maintenance of basal hOC promoter activity. On the other hand, OSEl and AV single or double deletions have caused dramatic loss of activity in the hOC promoter indicating that these two cis-elements are crucial in conferring basal activity to the promoter in prostate cancer cells (see Fig. 1 A). It is conceivable that the OSEl element exerts its effect by being in close proximity to the TATA box, which would allow the OSEl

-24- binding factor(s) to act as a mediator between the binding factors of the other two cis- elements and the TATA binding complex.

To determine if these cis-elements can function independently in gene transcription, constructs were generated with two copies of each of the cis-elements inserted upstream to an artificial TATA box (pGL3/TATA). Both AV and OSEl could function independently in PC3 cells, with OSEI2/TATA having the highest increase above the pGL3/TATA activity (28.1 fold) among the single cis-element constructs and OSE22/TATA the least activity (2 fold). These results are in agreement with the deletion data, indicating that OSEl and AV are strong regulatory elements in the hOC promoter in PC3 cells. Interactions among the three elements were investigated by juxtaposing dimers of the elements in different combinations in the pGL3/TATA vector. The results indicated that OSEl could interact with AV and activate the simple TATA promoter in a synergistic manner (181.3 fold, see Fig. IB). Addition of OSE22 could not further increase the activity of either OSEI2 /TATA or AV2 /TATA. However, when OSE22 was inserted between AV2 and OSEl 2 in the AV₂-OSE2₂-OSEl2/TATA construct, increased activity (299 fold, see Fig. IB) was observed. These surprising results suggest that the OSE2-binding factor is not sufficient to induce transcriptional activation, but it can cooperate with OSEl and AV-binding factors and collectively activate hOC promoter. Based on the above data, a chimeric promoter, AV2-OSE22-

OSEI2/TATA was generated, which not only retained the tissue-specific characteristic of hOC promoter, but was also 8.1 fold more active than wild type hOC promoter in the OC- positive PC3 cells, but not in the OC-negative LNCaP cells (see Fig. IC). Thus, tissue-specific transcription factor(s), which are only present in OC positive cells, may be involved in regulating the chimeric AV2-OSE22-OSEI2/TATA promoter.

Runx2 is expressed in PC3 cells and active in associating with OSE2. Even though OSE2 in mOC promoter was shown to associate with the osteoblast-specific factor-Runx2, it is not clear whether the same transcription factor binds to the OSE2 on hOC promoter in PC3 cells. To address this question, the expression of Runx2 in PC3 cells was first determined by both RT-PCR and immunoblot analysis. Runx2 mRNA was expressed in all the OC positive cell lines

-25- tested both in the presence and absence of vitD3, with PC3 having the highest level of expression. VitU3 does not seem to regulate the mRNA level of runx2. On the protein level, Runx2 is highly expressed only in the OC positive PC3 cells, but was not detected in the OC negative LNCaP cells. Although the OSE2 site was not necessary for transcriptional activation of hOC promoter, its binding factor Runx2 was expressed at a high level in PC3 cells. To determine if Runx2 in PC3 cells was capable of binding DNA, EMS A profiles were compared between PC3 and LNCaP nuclear extracts. PC3 nuclear extracts gave a specific DNA-protein complex which could only be competed away by a specific competitor, OSE2, but not by a non-specific competitor, ARE-III. With LNCaP nuclear extracts, no specific DNA-protein complex was observed. By adding Runx2 antibody or control AR antibody to the EMS A reactions, the protein factor which associates with OSE2 in PC3 cells is indeed Runx2. In lanes 10 and 11, Runx2, but not AR antibody, could supershift the DNA-protein complex, suggesting that transcriptionally active Runx2 may play a significant role in the regulation of hOC promoter activity in PC3 cells as these cells acquire Al and skeletal metastatic potentials.

AP-1 proteins, Fra-2 and Jun-D, bind to AP-1/VDRE sites on the hOC promoter. Different AP-1 binding are known to operate at the AP-1/VDRE (AV) site in rat OC (rOC) promoter during different stages of osteoblast development. In proliferating osteoblasts, c-Fos and c-Jun are involved in phenotypic suppression of the OC promoter while in the post-proliferative stage, Jun-D and Fra-2 are responsible for enhancing the expression of OC. The hOC AP-1/VDRE is believed to be occupied by AP-1 protein factors and not by VDR, because the VDRE consensus site could not compete away the protein-DNA complex observed while AP-1 competitor could successfully compete away the complex. Furthermore, the LNCaP nuclear extract yielded a lower level of the specific protein-DNA complex than the OC- positive PC3 and MG63. This result is further confirmed at the transcriptional level, where AV2 T ATA showed lower activity in LNCaP than in PC3 cells.

The AP-1 protein factors, which regulate AP-1/VDRE in hOC promoter were then defined, by the use of AP-1 antibodies in EMS A. Neither c-Fos

-26- nor c-Jun antibodies could supershift the DNA-protein complex observed; however, with Jun-D antibody, the DNA-protein complex was clearly super-shifted, while Fra-2 antibody acted more like a blocking antibody, which prevented the protein-DNA complex formation and diminished the intensity of the original band. Furthermore, neither the control AR antibody nor VDR antibody could affect the complex. This complements the previous observations that VDR does not associate with the AV site at the hOC promoter in the absence of vitD3 stimulation. Therefore, the action of VDR on AV site may be strictly dependent upon the activation of the receptor through its ligand binding activity. Furthermore, less Fra-2 protein, but not less Jun-D was present in the nuclear extracts of LNCaP compared to MG63 or PC3 cells. Therefore, PC3 cells behave like mature, post-proliferate osteoblasts, in which Fra-2 and Jun-D regulate the AV site and enhanced the expression of hOC in PC3 cells. OSEl is a weak Sp-1 binding site.

Osfl was shown previously to be the osteoblast-specific transcription factor that associates with OSEl in the mOC promoter. By sequence alignment, OSEl is mapped to a similar location in hOC promoter with about 40% identity. Because no study has been done on the OSEl in hOC promoter, little is known about the regulation of OSEl in this promoter. The mobility pattern of the protein factors that bind OSEl was observed to be very similar to the Sp-1 site except OSEl-protein complexes were weaker in intensity. Both the OSEl and Sp-1 sites gave three distinctive bands and their levels were similar among the three different nuclear extracts used. Based on published Sp-1 studies, these bands were presumed to represent Sp-1, 2 & 3 protein complexes. These specific protein-DNA complexes could be easily competed away with either unlabeled specific OSEl competitor or SP- 1 consensus competitor. Moreover, antibody supershift experiments showed that the OSEl binding factors could be super-shifted by Sp-2 and Sp-3 antibodies; whereas Sp-1 antibody blocked the Sp-1 protein factor from binding to OSEl, hence the disappearance of the top band. Together these results proved that OSEl is a weak Sp- 1 site, which is regulated by the members of the Sp-1 universal transcription factor family. Since Sp-1 transcription factors have been known for their association with the general transcription complex TFIID, the binding of Sp-1 factors at the OSEl site

-27- could facilitate and/or stabilize the interactions between the Runx2 and Ap-1 factors with the general transcription machinery.

Over-expression of Fra-2 andRunx2 activates hOC promoter activity in LNCaP cells. The high level of Fra-2 and Runx2 in PC3 cells but not in LNCaP cells suggested that these factors might be important in regulating hOC promoter activity in Al prostate cancer cells. To determine whether increased levels of Runx2 and Fra-2 are sufficient to confer hOC promoter activity in the OC negative LNCaP cells, Runx2 and Fra-2 expression vectors were co-transfected with hOC/luc into LNCaP cells. The introduction of Fra-2 alone or Runx2 alone was insufficient to significantly increase hOC promoter activity in LNCaP cells. The activity of hOC/luc could only be enhanced (~6 fold) when both Runx2 and Fra-2 were overexpressed in LNCaP cells. Therefore, differential level of Runx2 and Fra-2 could contribute to the tissue- specific activity of hOC promoter in cells.

Discussion

With increased in life expectancy, prostate cancer has become a serious health concern in American men. Prostate cancer most commonly metastasizes to lymph node and bone and causes significant mortality and morbidity in men with advanced disease. The pathology of bone often involves the proliferation of cancer cells with woven bone to replace corticolaminin bone causing symptoms like bone pain, fracture, and inflammation in cancer patients.

However, little progress has been made in understanding the molecular mechanisms responsible for bone metastasis in prostate cancer. Non-collagenous bone matrix proteins such as osteopontin (OPN), osteocalcin (OC), and bone sialoprotein (BSP) have been reported to be expressed at high levels in advanced bone metastatic prostate tumor specimens. The expression of these bone matrix proteins in Al bone metastatic prostate cancer cell lines has also been identified. There seems to be a remarkable parallelism of the temporal expression of bone matrix proteins between prostate cancer cells and mature osteoblasts. This observation led to the theory that as prostate cancer progresses, prostate cancer cells can acquire the ability to become "bone-like" or express osteomimetic properties. Since normal prostate

-28- epithelium does not express noncollagenous bone matrix proteins, during the malignant transformation of prostate epithelium a switch of gene transcription toward an osteoblast phenotype must occur. The increased expression of these bone matrix proteins may play an important role in prostate cancer bone metastasis and its osteoblastic responses.

It is conceivable that OPN expression in prostate cancer cells could facilitate their adhesion to osteoclasts and participate in subsequent bone "pitting' and in osteoid mineralization. Overexpression of BSP by metastatic prostate cancer cells could enhance their attachment to osteoblasts and osteoclasts and stimulate osteoblast differentiation. OC secreted by prostate cancer cells can complex with ECM and calcium and serve as a chemoattractant for recruiting osteoblast for bone remodeling. Therefore, the osteomimetic properties of prostate cancer cells in theory could allow them to metastasize, adhere, survive and grow better in the bone microenvironment. In an effort to better understand the osteomimetic properties of prostate cancer cells, PC3 cells were used as an in-vitro model system to investigate the regulation of OC, a tissue-specific non-collagenous bone matrix protein. PC3 cells are Al, bone metastatic prostate cancer cells, which share the unique feature with mature osteoblasts in synthesizing and depositing a large amount of hOC. The 800- bp hOC promoter was shown to have high and inducible activity in PC3 cells. By focusing on three well-studied regulatory cis-elements (OSEl, OSE2, & AP-1/VDRE) of the hOC promoter, the molecular mechanism by which hOC promoter is turned on in PC3 cells was demonstrated to be similar to that in osteoblasts. As reported herein hOC promoter activity in both PC3 and bone cells is regulated by the interactions among three different sets of transcription factors: Jun-D/Fra-2 heterodimers, Runx2 and Sp- 1. When compared to the OC-negative prostate cancer cell line LNCaP, PC3 has the ability to express the osteoblast-specific factor Runx2. Since over-expression of Runx2 in cells that normally express neither Runx2 nor osteoblast-specific genes leads to OC and 1 -collagen expression, the turning on of funx2 expression in prostate cancer cells is one of the critical steps in making prostate cells bone-like. The up-regulation of Fra-2 is another feature shared by osteoblasts and

PC3 cells. It has been established that in proliferating osteoblasts, c-Fos and c-Jun heterodimers are the predominant species at the AP-1 sites, while Fra-2 and Jun-D are

-29- the abundant AP-1 factors in differentiated osteoblasts. The connection between Fra- 2 translation and matrix mineralization in rat calvarial cells has further suggested the functional significance of relatively high levels of Fra-2 compared to other AP-1 proteins for osteoblasts differentiation and maturation. With similar levels of Jun-D in OC-negative and OC-positive cells, the high level of Fra-2 in OC-positive cells could allow the cells to selectively and specifically push the equilibrium toward the formation of Fra-2/Jun-D heterodimer, activating hOC promoter in PC3 cells and mature osteoblasts.

A major finding of this study is the discovery of Sp-1 universal transcription factors in the regulation of hOC promoter activity. Despite sharing homology (>40%) and similar location with mouse OSEl, human OSEl does not bind any bone-specific transcription factor. In light of the fact that OSEl is indispensable for hOC promoter activity, Sp-1 factors might be serving as a bridge to facilitate or stabilize the interaction between Runx2, Fra-2/Jun-D and the general transcription machinery. Therefore, the delicate interplay and co-ordination of Sp-1 , Runx2 and Fra-2/Jun-D protein factors could specifically turn on hOC promoter in Al prostate cancer cells and confer "bone-like" phenotypes on them.

Example 2 Creation of a Super hOC promoter

Interaction exists between OSEl and AV sites. To evaluate the activities and interactions of the cis-elements, dimers of the cis-elements were inserted upstream to an artificial TATA box in different combinations. The promoter constructs were operably linked to the luciferase gene and the constructs were used to transfect PC3 cells. The normalized activities (RLA) of various constructs were divided by the normalized activity of the control (pGL3/TATA) in PC3 cells and expressed as fold of control. Juxtaposing OSEl, OSE2 and AP-1/VDRE reconstituted hOC promoter activity (see Fig. IB). The activities of the control (hOC/luc) in PC3 (34,850 ± 7,434 RLA) and LNCaP (2,311 ± 311.7 RLA) were set to be 1 respectively, and the activities of the various constructs were were expressed as fold of control.

-30- Methods and Methods:

Cell culture and transfection:

C4-2B4 (or PC3) cells were cultured in T-medium supplemented with 5% FBS (fetal bovine serum) and 100 U/ml of penicillin and 100 μg/ml of streptomycin (1 % P/S). For transfection, C4-2B4 cells were seeded at a density of 1.5 x 10⁵ (PC3 cells were 1.0 x 10⁵) cells/well in 12-well plates for 24 h before transfection. Plasmid DNAs were introduced into cells by complexing with DOTAP- liposomal method (Roche Molecular Biochemicals). For transfection, 1.25 μg of tested DNA constructs (hOCO.8 promoter-Luc [800 bp of human OC promoter- directed luciferase expression] and other constructs of deletion of hOC0.8 promoter- Luc, see Fig.l), respectively, and 0.25 μg of CMV/β-Gal were co-transfected into cells. DNAs-lipid complexes were allowed to form for 15 min at room temperature prior to their addition to each well containing 1 ml of T-medium (containing 5% FBS and 1% P/S). The cells were incubated with the complexes for 6 h at 5% CO₂, 37°C. After transfection, DNA-DOTAP mixtures were replaced with fresh medium.

To investigate the concentration-dependent effect of different CM (conditioned medium with 5% FBS) harvested from either prostate cancer (LNCaP, PC-3, DU-145, or ARCaP) or bone stroma (MG-63, Kees) cell lines, CM isolated from those cell cultures (Volume/Volume) at 0%, 25%, 50%, 75% and 100% (i.e. 0 ml, 0.25 ml, 0.5 ml, 0.75 ml and 1.0 ml) in T-medium (containing 5% FBS) (1.0 ml, 0.75 ml, 0.5 ml, 0.25ml and 0 ml), respectively were conducted. Note that OC promoter activity was induced in a concentration dependent manner until CM became 100% due to nutrition limitation by the CM.

The effect of bone matrix associated ECMs such as vitronectin (VN) or collagen 1 (Coll), in the presence or absence of anti-integrin antibodies, on OC promoter activity in transfected cells was also investigated. In the ECM-integrin experiment, after tansfection and changing to new medium, VN and/or Coll was added at lOμg/ml, and anti-αvβ3 or -α2βl antibodies were added (lOμg/ml), at same time. VN-¹ or Coil-mediated OC expression and such expression was blocked effectively by integrin isotype specific antibodies, however, the integrin antibodies (anti-α_vβ₃ and -α₂β, Ab) can only partially block the conditioned media-activated hOC promoter activity (See Fig. 3 A).

-31- To evaluate DNA cis-elements responsible for conferring OC promoter activity, a promoter deletion study was performed (see Fig. 3B). Prostate cancer cells transfected with different OC constructs (i.e., intact 800bp OC or different deletions as indicated ) were added with 75% ARCaP CM (0.75 ml of ARCaP CM and 0.25 ml of T-medium containing 5% FBS). Cells were harvested after 36 h of additional incubation and OC promoter activity was assayed. Note the importance of having AV, OSEl and OSE2 cis-DNA element within the OC promoter is crucial for mediating Coil-mediated OC promoter activity in prostate cancer cell lines.

For collection of conditioned media (LNCaP, DU145, PC3, ARCaP, KeesII and MG63), different cells were incubated in T-medium supplemented with 5% FBS and 1 % P/S, respectively. Once the cells reached 60-70% confluence, the media was exchanged for new fresh media, and after 3 -days incubation, the cells were collected by centrifugation of the media, and the resulting supematants were recovered as the conditioned media. Enzyme activity assay:

For luciferase assay, cells were lysed in 170 μl of 1 x lysis buffer (Promega, Madison, WT). Cell lysates were votexed for 20 seconds and centrifuged 5 min and removed cell pellets. For luciferase activity assay, 20 μl of the supernatant was mixed with 100 μl of luciferase substrate (Promega) and measured by a luminometer (Monolight 2010, Analytical Luminescence Laboratory, Sparks, MD). For β-galactosidase activity detection, 100 μl of cells extracts were mixed with 100 μl of 2 x β-galactosidase substrate in 96-well plate incubated at 37°C for 5-15 min. the β- galactosidase activity was determined by ELISA reader at 405 nm wave-length. Data were normalizing the luciferase activity with β-galactosidase activity of the cell lysates. All transfection experiments were carried out in duplicate (for different concentration and different CM experiment, ECM-integrin experiment and promoter deletion study), and data were presented as the mean ±S.D. of two independent experiments.

The super hOC promoter (SEQ ID NO: 1) having the structure of two AV elements (GGTGACTCACCGGGTGAA; SEQ ID NO: 3), linked to two OSE2 elements (GCTCCCAACCACATATCC; SEQ ID NO: 5) linked to two OSEl elements (CAGGCATGCCCCTCCTCATCGCTGGGCAC; SEQ ID NO: 4) linked to

-32- a TATA box, is referred to herein as the AV₂-OSE2₂-OSEl₂/TATA construct. This construct is expected to be more efficient than current hOC promoters in that this promoter will provide a higher (8 to 20-fold) activity than the foil-length hOC and mOC promoters and mouse OC (mOC), respectively (see Fig. IC). Consequently super hOC promoter is expected to be more effective in delivering therapeutic genes to diseased, tumorous and normal tissues.

To apply this technology to the treatment of cancer, the tumor will be co-targeted by delivering therapeutic genes to tumor epithelium, smooth muscle/fibroblast surrounding the tumor epithelium as well as to the tumor endothehal cells. All three of these cell compartments over-express hOC activity in the diseased state. For the treatment of normal tissues, hOC promoter can deliver therapeutic genes to BPH and arteriosclerosis. For the treatment of bone, super AOC promoter could have an advantage over hOC promoter by providing stronger activity in delivering therapeutic genes to target sites for efficient bone repair

Example 3

Use of Osteocalcin Promoter to Target Adenoviral Replication to Tumor Cells A novel replication-competent adenoviral vector, Ad-hOC-El, was developed containing a single bidirectional human osteocalcin (hOC) promoter to drive both the early viral El A and EIB gene. This vector selectively replicated in OC-expressing but not non-OC-expressing cells, with viral replication enhanced at least 10-fold on vitamin D(3) exposure. Both the artificial TATA-box and hOC promoter element in this bidirectional promoter construct were controlled by a common OC regulatory element which selectively activated OC expression in cells. The expression of El A and EIB gene by Ad-hOC-El can be markedly induced by vitamin D(3).

Unlike Ad-sPSA-El, an adenoviral vector with viral replication controlled by a strong super prostate-specific antigen (sPSA) promoter which only replicates in PSA-expressing cells with androgen receptor (AR), Ad-hOC-El retarded the growth of both androgen-dependent and androgen-independent prostate cancer cells irrespective of their basal level of AR and PSA expression. A single i.v. administration of 2 x 10(9) plaque-forming units of Ad-hOC-El inhibited the growth

-33- of previously established s.c. DU145 tumors (an AR- and PSA-negative cell line). Viral replication is highly enhanced by i.p. administration of vitamin D(3).

Material and Methods RT-PCR Analysis.

Cells were treated with 5 nM vitamin D₃ analogue (Ro 25-9022; Roche, Nutley, NJ) or ethanol as the control group for 48 h. RNA was extracted using RNAzolB (Teltest, Friendswood, TX) and RT-PCR was performed according to the manufacturer" s protocol with Moloney Murine Leukemia Virus reverse transcriptase (Life Technologies, Inc., Rockville, MD). Plasmid and Virus Construction.

A 3.9-kb hOC promoter was cloned from genomic DNA of DU145, using Genome Walker kits (Clontech, Palo Alto, CA). A short version (800-bp) of hOC promoter was subsequently generated by PCR. A 600-bp PSA promoter (sPSA) was created by our laboratory as described previously (Yeung et al., (2000) J. Biol. Chem., 275: 40846-40855). Ad5 E1A and EIB cDNAwere amplified from pXC548c by PCR. An artificial 33-bpTATA-box containing fragment was obtained from the original pGL3 /TATA. These fragments were subcloned to generate the bidirectional hOC or sPSA promoter-driving El A and EIB expression cassette (Hsieh et al., (2002) Cancer Res 62(11):3084-92) using standard cloning methods. Ad-hOC-El and Ad- sPSA-El were generated in 293 cells by cotransfecting these cells with both the expression shuttle plasmid and a circular Ad genome plasmid (pJM17). After transfection, cells were cultured in agarose medium for up to 10 — 12 days to allow plaque formation. Individual plaques were picked up and screened by the PCR method. Viral DNA of recombinant Ad vectors obtained from the selected plaques was extracted and digested with Hindlll. Ad vectors were amplified in 911 cells to avoid recombinant Ad virus generation and purified according to the method of Graham and Prevec. Wild-type Ad5 (Ad-w.t), dl309, was a gift from Dr. Frank Graham (McMaster University, Ontario, Canada). A replication-defective Ad vector, Ad-CMV-pA, was constructed by our laboratory as described previously (Cheon et al, (1997) Cancer Gene Ther., 4: 359-365). All of the Ad vectors were evaluated by

-34- particle count as determined by absorbance measurement of DNA and titered by plaque assay.

Results El A and EIB genes Are Expressed in OC-expressing Cells by Ad-hOC-El.

To control both El A and EIB genes with a single promoter, bidirectional hOC and strong sPSA promoters were generated by inverting an artificial TATA box lined in the opposite direction to hOC or sPSA enhancer/promoter. The El A cDNA was cloned downstream of an artificial TATA box promoter, and EIB cDNA was cloned downstream of the hOC or sPS A enhancer/promoter region. Replication-competent Ad-hOC-El and Ad-sPSA-El vectors were constructed by inserting these bidirectional E1A/E1B expression cassettes at the deleted El region of the replication-defective Ad5 virus. In parallel, a replication defective Ad vector, Ad- CMV-pA, was also constructed by inserting the polyadenylated[poly(A)] signal-linked CMV promoter fragment at the same region as E 1 A/E 1 B expression cassette. The bidirectional hOC promoter, shown to be functional for driving both El A and EIB gene expression, can be induced by vitamin D₃ in both directions. OC-expressing prostate cancer cell lines, C4-2, PC3, and DU145, and a non-OC-expressing cell line, RCC52, were infected with Ad-hOC-El and the transcription of El A and EIB mRNA was assessed by Northern blot analysis. The basal level of two major EIB transcripts, 12S and 22S mRNAs transcribed from hOC-enhancer/promoter, was detected only as trace in C4-2, PC3, and DU145, and was nondetectable in RCC52 cells. After vitamin D₃ induction, however, these transcripts were enhanced 10- to 50-fold above the basal level of gene expression in these cell lines. These results suggest that both the artificial TATA-box and the hOC promoter element can be controlled by a common OC regulatory element in a bidirectional manner. OC transcription in cells can be markedly induced by vitamin D₃.

To test whether El A transcript driven by artificial promoter element can be successfully translated into El A protein, an immunoblotting analysis of El A protein from Ad-hOC-El- or Ad-CMV-pA-infected C4-2, PC3, DU145, and RCC52 was performed. Cell lysate prepared from 293 cells expressing endogenous El gene was used as a positive control. With the exception of DU 145 cells, the induction of

-35- El A mRNA by vitamin D₃ is consistent with both basal and vitamin D₃-induced El A protein accumulation in cells. A trace amount of El A protein accumulated in Ad- hOC-El -infected RCC52 cells, and this level was greatly enhanced by vitamin D₃. El A was undetectable in cells infected with Ad-CMV-pA, either with or without vitamin D₃.

Ad-hOC-El Selectively Replicates in OC-expressing Cells.

To examine Ad-hOC-El viral DNA replication in C4-2, PC3, DU145, and RCC52 cells, Southern blot were performed to detect the viral DNA accumulated in the cells. With vitamin D₃ induction, Ad-hOC-El DNA was detected in C4-2 and DU145 cells 24 h earlier than without vitamin D₃. Similarly, vitamin D₃ induced a 3- to 10-fold increase over the basal level of Ad-hOC-El DNA replication. The induction of viral replication in C4-2, PC3 and DU145 correlated with hOC mRNA expression. In RCC52 cells, Ad-hOC DNA was strongly detected at 48 h p.i. with vitamin D₃ induction but was barely detectable without induction. This result is consistent with the expression of hOC mRNA. Because RCC52 cells expressed a high level of CAR on the cell surface, the failed Ad-hOC-El replication in non-hOC- expressing cells is obviously attributable to the stringent specificity of hOC promoter and is not related to the efficiency of viral entry.

To further assess whether the amplified viral DNA can be packed to form the infectious particle, culture medium was harvested and a plaque assay was performed. The differential titer of Ad vectors in various human cell lines is shown in Table 1 and demonstrates that Ad-hOC-El grew well in OC-expressing prostate cancer cell lines, such as C4-2, PC3, and DU145, and that vitamin D₃ can induce a 5- to 25-fold increase in viral replication. This induced viral titer is equal to Ad-w.t. in PC3. However, Ad-OC-El cannot grow in non-OC-expressing RCC52 cells. The titer of Ad-hOC-El in these cells is as low as that of Ad-CMV-pA, a replication- defective Ad vector.

Replication-competent Ad Vectors Induce Al Prostate Cancer Cell Death. To test whether replication-competent Ad vectors can grow andlyse prostate cancer cells, an in vitro cytotoxicity assay comparing Ad-hOC-El and Ad- sPSA-El was performed. As controls, Ad-w.t. (positive control) and Ad-CMV-pA (negative control) either effectively lysed or were completely ineffective in all of the

-36- tested cell lines. In response to Ad-hOC-El, marked cell lysis was observed in C4-2 cells (AR- and PSA-positive) at a dose level of 1 MOI (P < 0.05 versus mock-infected group) at 7 days posttreatment and day 5 by vitamin D₃ induction. The 10-fold- enhanced cell kill of Ad-hOC-El by vitamin D₃ also occurred in PC3 and DU145 cells, whereas there was no vitamin D-induced kinetic change of cytotoxicity observed in Ad-sPSA-El, Ad-CMV-pA, and Ad-w.t.-treated groups in any of the tested cell lines. With vitamin D₃ treatment, in C4-2 cells, Ad-sPSA-El showed higher cell killing activity than did Ad-hOC-El . These data correlate with the endogenous PSA and OC promoter activity. In contrast, however, when Ad-hOC-El or Ad-sPSA-El was added to PC-3 cells (AR- and PSA-negative), a differential inhibition of cell growth by Ad-hOC-El but not by Ad-sPSA-El was observed. Because of the lower level of CAR associated with PC-3 cells, a higher dose of Ad vector (e.g., 1 — 5 MOI) was necessary to lyse these cells in vitro. This is supported by DU145 experimental data (AR- and PSA-negative cells), which have a higher level of CAR and were inhibited by Ad-w.t. and Ad-hOC-El at a dose of 0.1—1.0 MOI 5—7 days after viral exposure. Ad-sPSA-El and Ad-CMV-pA were ineffective against the growth of DU145 cells in vitro. As expected, the growth of RCC52 cells (completely deficient in OC expression) was sensitive only to Ad-w.t. and completely insensitive to growth inhibition by Ad-OC-El, Ad-sPSA-El, or Ad-CMV-pA. Ad-hOC-El Combined with Vitamin D₃ Is Highly Effective against the

Growth of DU145 Tumors in Vivo.

To determine the therapeutic efficacy of Ad-hOC-El in Al prostate cancer in vivo, the therapeutic effect of Ad-hOC-El in a DU145 xenograft model in nude mice was evaluated. DU145 xenograft was shown to be a very aggressive tumor that grew to 40-fold of its initial volume at 5 weeks. A single tail vein injection of replication-defective Ad-CMV-pA barely inhibited tumor growth, but the identical protocol of Ad-hOC-El administration suppressed tumor growth significantly (P < 0.05). Similarly, vitamin D₃ administration alone also inhibited DU145 tumor growth (P < 0.05) in vivo. The growth of DU145 tumors was markedly repressed when animals were treated with Ad-hOC-El plus vitaminD₃ (P < 0.005). In controls, Ad- CMV-pA plus vitamin D₃ did not further enhance tumor volume reduction when compared with vitamin D treatment alone. These results demonstrated that Ad-hOC-

-37- El and vitamin D₃ combination therapy achieved additive antitumor efficacy (P < 0.05 versus Ad-hOC-El alone or vitamin D₃ alone).

To assess viral distribution after a single i.v. Ad-hOC-El administration, PCR analysis was used to detect the Ad viral DNA sequences in the prostate, liver, lung, brain, and tumor tissues. Liver and lung were the major organs trafficking viruses. Only a few viruses were found at the s.c. tumor site at week 1. Viral DNA accumulated significantly thereafter and markedly increased in weeks 3 and 5. Vitamin D₃ administration enhanced viral replication/accumulation consistently in tumor tissues, but not liver, during the entire course of the treatment period (week 1 to 5). Toxicology studies with Ad vectors were hampered because human adeno viruses replicate only in human cells. Immunohistochemistry data are consistent with the characteristics of Ad type 5 virus in which the El A viral protein was expressed only in human tumortissue but not in mouse liver, although a steady accumulation of Ad-DNA was observed in mouse liver over 5 weeks. Tumor xenografts maintained in mice treated with Ad-hOC-El plus vitamin D₃ together underwent a strong necrotic reaction within the tumor region without affecting the normal hepatocellular architecture. These results provide preclinical evidence of the specificity, efficacy, and safety of Ad-hOC-El and vitamin D₃ for prostate cancer gene therapy.

-38-

Claims

1. A nucleic acid sequence comprising the sequence of SEQ ID NO: 1.

2. An expression vector comprising a promoter, wherein the promoter consists of the nucleic acid sequence of SEQ ID NO : 1.

3. The expression vector of claim 2 further comprising a polylinker operably linked to said promoter.

4. The expression vector of claim 2 further comprising a heterologous gene operably linked to said promoter.

5. The expression vector of claim 3 wherein the heterologous gene encodes a product that is directly or indirectly toxic to mammalian cells.

6. The expression vector of claim 5 further comprising a recombinant adenovirus (Ad) vector sequences.

7. The expression vector of claim 5 wherein the vector is in the form of a plasmid.

8. A host cell comprising the nucleic acid construct of claim 2.

9. The host cell of claim 8 wherein the cell is a eukaryotic cell.

10. The cell of claim 9 wherein said construct is inserted into the genome of the cell.

11. A method of screening a patient for neoplastic cells, said method comprising the steps of obtaining a biological sample from said patient;

-39- contacting said biological sample with an expression vector to form an expression mixture, wherein said expression vector comprises an osteocalcin promoter sequence operably linked to a marker gene; incubating the expression mixture for a predetermined length of time under conditions conducive to the transcription of the marker gene; and measuring the amount of marker gene product produced after said predetermined length of time, wherein an enhanced level of expression of the marker gene product over basal levels indicates the presence of neoplastic cells.

12. The method of claim 11 wherein the osteocalcin promoter is selected form the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2.

13. The method of claim 11 wherein the osteocalcin promoter consists of SEQ ID NO: l.

14. The method of claim 13 wherein the step of contacting said biological sample with an expression vector comprises culturing a tranfected host cell in the presence of the biological sample, wherein the host cell is transfected with said expression vector.

15. The method of claim 14 wherein the biological sample is blood or urine.

16. The method of claim 14 wherein the biological sample comprises cells, cellular products or cellular components.

17. The method of claim 11 wherein the enhanced level of expression of the marker gene is detected by comparing the level of marker gene expression that occurs in the presence of the biological sample to that occurring in the absence of the biological sample.

18. A method for determining the prognosis of a patient having cancer, said method comprising the steps of

-40- obtaining a biological sample from said patient; contacting said biological sample with an expression vector to form an expression mixture, wherein said expression vector comprises an osteocalcin promoter sequence operably linked to a marker gene; incubating the expression mixture for a predetermined length of time under conditions conducive to the transcription of the marker gene; and measuring the amount of marker gene product produced after said predetermined length of time, wherein the amount of marker produced is directly proportional to the invasiveness of the cancer cells and thus indicative of the patient's prognosis.

19. The method of claim 18 wherein the osteocalcin promoter consists of SEQ ID NO: 1.

20. The method of claim 19 wherein the step of contacting said biological sample with an expression vector comprises culturing a tranfected host cell in the presence of the biological sample, wherein the host cell is transfected with said expression vector.

21. The method of claim 18 wherein the biological sample is blood or urine.

22. The method of claim 18 wherein the biological sample comprises cells, cellular products or cellular components.

23. A kit for regulating the expression of a gene, said kit comprising an expression vector comprising a promoter, wherein the promoter consists of the nucleic acid sequence of SEQ ID NO: 1; and a polylinker operably linked to said promoter.

24. The kit of claim 23 wherein the expression vector is formed as a plasmid.

25. The kit of claim 23, further comprising acyclovir.

-41-

26. A therapeutic agent, comprising a recombinant adenovirus vector said vector comprising a promoter operably linked to a thymidine (TK) kinase coding sequence, wherein the promoter consists of the nucleic acid sequence of SEQ ID NO: 1.

-42-