WO2003004524A2 - Apicomplexa parasites secreted proteins - Google Patents

Abstract

The present invention provides secreted proteins from Apicomplexa parasites, and their use in medicine, particularly in the preparation of vaccines and in diagnosis.

Description

Substances

The present invention relates to novel proteins from malarial parasites, and their use in medicine, particularly in the preparation of vaccines and in diagnosis.

The pathogenesis of malaria is primarily one of tissue and cell specific infectivity; hepatocytes and erythrocytes in humans, gut epithelial and salivary gland cells in the mosquito. There is clear evidence that the first-line of defence in mosquito and human host is a common ancestral innate immune system (Hoffmann, et al, Science 284, 1313-8 (1999); Salzet, Trends Immunol 22, 285-8 (2001); Cohn, et al Curr Opin

Immunol 13, 55-62 (2001)). Invertebrates and humans develop an acute response to infection through similar complement effector and receptor molecules containing LCCL and SRCR domains (Trexler, et al, Eur J Biochem 267, 5751-7 (2000)). Complement-like aTEP proteins were recently reported in Anopheles gambiae, adding to growing evidence of common immune processes. In the vertebrate, pro- inflammatory cytokines such as TNF, IL-1 and IL-6, induce toxic radicals and acute phase proteins such as C-reactive protein (CRP) and serum amyloid P component (SAP) protein that mediate killing of pathogens and parasites (Kwiatkowski, Res.Immunol. 142, 707-712 (1991); Bharadwaj, et al J Immunol 166(11), 6735-6741. (2001)). Although sl^w to develop, recurrent infection and antigenic challenge results in protective immunity. Arguably, with reoccurring malaria the adaptive immune response replaces the innate response.

The present inventors have found a novel modular secreted protein (PfSR) from Plasmodiumfalciparum,conta mg: Limulus clotting factor C (LCCL) (Iwanaga, et αl Thromb Res 68, 1-32 (1992)); lipid binding (LH2) (Gillmor, et αl Nat Struct Biol 4, 1003-9 (1997)); scavenger receptor cysteine rich (SRCR) (Resnick, et αl, Trends Biochem Sci 19, 5-8 (1994)); and pentraxin (Gewurz, et αl Curr Opin Immunol 7, 54- 64 (1995)) (PTX) domains. They have identified the corresponding proteins in the mouse malaria parasites, P.berghei (PbSR), and in P. yoelii (PySR). The protein is post-translationally modified in sporozoites. Conserved sequences from three species show that the genes encoding the proteins are from a unique and previously unrecognised Plasmodium gene family containing domains associated with binding and modulating host proteins involved in immunity. They have shown that transgenic PbSR null, mutants have attenuated growth in immunocompetent mice, and fail to produce sporozoites in Anopheles Stephens! mosquitoes and consequently are deadend parasites in the midgut of the mosquito Anopheles Stephens!. Furthermore, they have shown that the transgenic PbSR null mutants do not have attenuated growth in T- and B-cell deficient mice, and that there are higher levels of T cell activation in immunocompetent mice infected with the null mutants compared to wild type parasite. These data suggest that PbSR has an immunomodulating role.

The proteins find use in the diagnosis of malaria. In particular, they find use in the prophylaxis and/or treatment of malaria because of the observed results that disruption of the normal expression of the proteins causes the malaria parasite to die at an early stage in its life cycle. Malaria disease symptoms, morbidity and mortality are a consequence of parasite load. That is to say, when numbers of parasites increase, they cause significant disturbance to host metabolism (release of toxins), immune activation and haemolysis of infected erythrocytes. Many other vascular and tissue- related problems accrue with increased parasitaemia. Successive rounds of parasite proliferation occur during shizogony in the vertebrate and development of the ooyst in mosquito. Parasite disruption via drugs or vaccines is therefore more likely to be effective when parasite numbers are low, i.e. at the early infective stages: sporozoites in human and ookinete in mosquito. The proteins of the present invention are the first proteins from Plasmodium which are secreted and which show a gene disruption phenotype in both vertebrate and mosquito; this makes them highly useful for the production of vaccines against malaria. According to the present invention, there is provided an isolated protein comprising one of the amino acid sequences shown in Figure la, or a homologue of said protein, or a fragment of said protein or homologue.

Certain proteins of the present invention are isolatable from Plasmodium falciparum, Plasmodium berghei or Plasmodium yoelii and may be provided in recombinant and/or substantially pure form. For example, they may be provided in a form which is substantially free of other proteins.

As discussed herein, the proteins (which term includes the homologues and fragments mentioned above) of the invention are useful as antigenic material. Such material can be "antigenic" and/or "immunogenic". Generally, "antigenic" is taken to mean that the protein is capable of being used to raise antibodies or indeed is capable of inducing an antibody response in a subject. "Immunogenic" is taken to mean that the protein is capable of eliciting a protective immune response in a subject. Thus, in the latter case, the protein may be capable of not only generating an antibody response but, in addition, non-antibody based immune responses.

The skilled person will appreciate that homologues or derivatives of the proteins of the invention will also find use in the context of the present invention, e.g. as antigenic/immunogenic material. Thus, for instance, after identifying PfSR from the human malaria parasite, P. falciparum, the present inventors were able to identify the corresponding homologous proteins in the mouse malaria parasites, P. berghei and P. yoelii. Given that the mouse parasites are more distant in evolutionary terms, the present invention enables the skilled person to find equivalent proteins in the other human malaria parasites, P. vivax, P. ovale, and P. malariae. It follows that the PxSR proteins of these organisms are likely to have a higher homology to the PfSR protein than that of PbSR and PySR. These proteins, and any other proteins which have a higher homology to PfSR than PbSR, including homologous proteins from primate malarial parasites, are included within the scope of the present invention. In addition, the inventors have identified homologues in Plasmodium knowlesi (PkSR), Plasmodium chabaudi (PcSR), Cryptospridium parvum (CpSR), Toxoplasma gondii (TgSR) and Theϊleria parva (TpSR). These homologues are also included in the present invention. Hereinafter, certain aspects of the invention refer to the treatment, diagnosis, prophylaxis, etc, of malaria. It is to be understood that, for those proteins of the present invention which are not associated with Apicomplexa parasites which cause malaria, these aspects apply equally to the treatment, diagnosis, prophylaxis, etc of the condition which is caused by the Apicomplexa parasite with which the particular protein is associated.

In addition, proteins which include one or more additions, deletions, substitutions or the like are encompassed by the present invention, hi addition, it may be possible to replace one amino acid with another of similar "type". For instance, replacing one hydrophobic amino acid with another.

In the case of homologues and derivatives, the degree of identity with a protein as described herein is less important than that the homologue or derivative should retain its antigenicity and/or immunogenicity to P. falciparum, P. vivax, P. ovale, P. malariae, P. berghei and/or P. yoelii. However, suitably, homologues or derivatives having at least 60% identity with the proteins or polypeptides described herein are provided. Preferably, homologues or derivatives having at least 70% identity, more preferably at least 80% identity are provided. Most preferably, homologues or derivatives having at least 90%, 95%, 96, 97, 98 or even 99% or greater identity are provided.

The percent identity of two amino acid sequences, or of two nucleic acid sequences, is preferably determined by aligning the sequences for optimal comparison purposes (e.g., gaps can be introduced in the first sequence for best alignment with the sequence) and comparing the amino acid residues or nucleotides at corresponding positions. The "best alignment" is an alignment of two sequences which results in the highest percent identity. The percent identity is determined by the number of identical amino acid residues or nucleotides in the sequences being compared (i.e., % identity = # of identical positions/total # of positions x 100).

The determination of percent identity between two sequences can be accomplished using a mathematical algorithm known to those of skill in the art. An example of a mathematical algorithm for comparing two sequences is the algorithm of Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA 87:2264-2268, modified as in Karlin and Altschul (1993) Proc. Natl Acad. Sci. USA 90:5873-5877. The NBLAST and XBLAST programs of Altschul, et al. (1990) J. Mol. Biol. 215:403-410 have incorporated such an algorithm. BLAST nucleotide searches can be performed with the NBLAST program, score = 100, wordlength = 12 to obtain nucleotide sequences homologous to nucleic acid molecules of the invention. BLAST protein searches can be performed with the XBLAST program, score = 50, wordlength = 3 to obtain amino acid sequences homologous to protein molecules of the invention. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilised as described in Altschul et al. (1997) Nucleic Acids Res. 25:3389-3402. Alternatively, PSI-Blast can be used to perform an iterated search which detects distant relationships between molecules (Id.). When utilising BLAST, Gapped BLAST, and PSI-Blast programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used. See http://www.ncbi.nlm.nih.gov.

Another example of a mathematical algorithm utilised for the comparison of sequences is the algorithm of Myers and Miller, CABIOS (1989). The ALIGN program (version 2.0) which is part of the GCG sequence alignment software package has incorporated such an algorithm. Other algorithms for sequence analysis known in the art include ADVANCE and ADAM as described in Torellis and Robotti (1994) Comput. Appl. Biosci., 10 :3-5; and FASTA described in Pearson and Lipman (1988) Proc. Natl. Acad. Sci. 85:2444-8. Within FASTA, ktup is a control option that sets the sensitivity and speed of the search. Alternatively or additionally, the homologues could be fusion proteins, incorporating moieties which render purification easier, for example by effectively tagging the desired protein or polypeptide. It may be necessary to remove the "tag" or it may be the case that the fusion protein itself retains sufficient antigenicity to be useful.

It is well known that is possible to screen an antigenic or immunogenic protein or polypeptide to identify epitopic regions, i.e. those regions which are responsible for the protein or polypeptide 's antigenicity or immunogenicity. Methods well known to the skilled person can be used to test fragments and/or homologues and/or derivatives for antigenicity. Thus, the fragments of the present invention should preferably include one or more such epitopic regions or be sufficiently similar to such regions to retain their antigenic/immunogenic properties. Thus, for fragments according to the present invention, the degree of identity is perhaps irrelevant, since they may be 100% identical to a particular part of a protein or homologue as described herein. The key issue, once again, is that the fragment retains the antigenic/immunogenic properties of the protein from which it is derived.

Fragments of the present invention may have the amino acid sequences of Figure 1 without the first 22 amino acids thereof, or the following sequences:

KAKFEYGMSDYAEC and CNKFIGTKRNNIES. Fragments of the invention may be 5, 10, 15, 20, 25, 30, 40, 50, 60 or more amino acids long.

The proteins of the present invention can be provided alone, as a purified or isolated preparation. They may be provided as part of a mixture with one or more other proteins of the invention, or one or more other Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, Plasmodium malariae, Plasmodium berghei and/or Plasmodium yoelii proteins or fragments thereof. It is known in the art that effective anti-malarial vaccines may comprise provide multiple antigens (Stanley, Lancet. 1998 Oct 10;352(9135):1163-4; Ockenhouse et al J Infect Dis 1998 Jun; 177(6): 1664-73; Tine et al, Infect Immun 1996 Sep; 64(9):3833-44; Wang et al, Infect Immun 1998 Sep;66(9):4193-202; Gozar et al, Infect Immun 1998 Jan; 66(l):59-64; Gilbert et al. Nat Biotechnol 1997 Nov;15(12):1280-4). The proteins of the present invention may be provided together with one or more of the antigens mentioned in the above literature.

In a second aspect, therefore, the invention provides an antigen composition comprising one or more proteins, homologues and/or fragments of the invention. Such a composition can be used for the detection and/or diagnosis of Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, Plasmodium malariae, Plasmodium berghei and/or Plasmodium yoelii. In one embodiment, the composition comprises one or more additional Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, Plasmodium malariae, Plasmodium berghei and/or Plasmodium yoelii antigens/immunogens .

In a third aspect, the present invention provides a method of detecting and/or diagnosing malaria, which comprises:

(a) bringing into contact with a sample to be tested a protein, homologue and/or fragment of the invention; and (b) detecting the presence of antibodies to malaria parasite.

The method is particularly useful for detecting and/or diagnosing Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, Plasmodium malariae, Plasmodium berghei and/or Plasmodium yoelii. The protein, homologue and/or fragment of the present invention can be used to detect IgA, IgM or IgG antibodies. Suitably, the sample to be tested will be a biological sample, e.g. a sample of blood or saliva.

In a fourth aspect, the invention provides the use of a protein, homologue and/or fragment of the present invention in detecting and/or diagnosing malaria, particularly Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, Plasmodium malariae, Plasmodium berghei and/or Plasmodium yoelii. Preferably, the detecting and/or diagnosing is carried out in vitro.

The proteins, homologues and/or fragments of the present invention can be provided as a kit for use in the in vitro detection and/or diagnosis of malaria. Thus, in a further aspect, the present invention provides a kit for use in the detection and/or diagnosis of malaria, which kit comprises a protein, homologue and/or fragment of the present invention. Such a kit may include suitable instructions for use.

For such diagnostic uses, it is preferred if the protein, homologue and/or fragment is labelled so that antibodies which bind to the protein, homologue and/or fragment can be easily detected. Such labels are well known to those skilled in the art.

In addition, the protein, homologue and/or fragment of the invention can be used to induce an immune response against Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, Plasmodium malariae, Plasmodium berghei and/or Plasmodium yoelii. Indeed, the localisation and structure of PxSR suggests that it has a role in regulating host parasite interactions in the pre-erythrocytic stage of the life cycle, and thus that targeting it will provide an effective treatment for malaria. Although the proteins of the present invention may suppress the immune system, the whole proteins, but more likely fragments of the proteins, find use as antigens. It is well established in the art that secretory proteins, such as the thrombospondin related adhesive protein (TRAP) or the circumsporozoite protein (CS), expressed in the malarial sporozoite are carried by the parasite into the ensuing stage of the life cycle (the pre-erythrocytic schizont) inside the liver of the host. Here, these proteins can be effectively targeted by the host immune system and are therefore prime targets for immune intervention (e.g. TRAP - Aidoo, et al Lancet. 1995; 3451003-1007). In the case of the CS protein, it has been further shown that the protein interacts with the organelles of the host cell and down-regulates the processing of intracellular proteins and thus the potential presentation of parasite peptides to the immune system (Frevert, et al, The EMBO Journal. 1998; 173816-3826.).

Thus, in a further aspect, the invention provides a protein, homologue and/or fragment of the invention for use in medicine. The invention also provides the use of a protein, homologue and/or fragment of the invention in the manufacture of a medicament for the treatment and/or prophylaxis of malaria, especially that caused by Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, Plasmodium malariae, Plasmodium berghei and/or Plasmodium yoelii.

In a further aspect, the present invention provides a composition capable of eliciting an immune response in a subject, which composition comprises a protein, homologue and/or fragment of the invention. Suitably, the composition will be a vaccine composition, optionally comprising one or more suitable adjuvants. It is preferred if the composition comprises one or more of the anti-malarial antigens mentioned above. Such a vaccine composition may be either a prophylactic or therapeutic vaccine composition. Because the proteins of the present invention are expressed in the sporozoite, they can be used as an anti-malarial prophylactic vaccine i.e. kill the parasite early in infection before clinical symptoms arise. In addition, because the proteins may be expressed in the blood stages of the parasite (trophozoites and schizonts), they can be used as a therapeutic vaccine, i.e. once clinical symptoms are present.

The vaccine compositions of the invention can include one or more adjuvants. Examples well-known in the art include inorganic gels, such as aluminium hydroxide, and water-in-oil emulsions, such as incomplete Freund's adjuvant. Other useful adjuvants are well known to the skilled person.

In yet further aspects, the present invention provides: (a) the use of a protein, homologue and/or fragment of the invention in the preparation of an immunogenic composition, preferably a vaccine;

(b) the use of such an immunogenic composition in inducing an immune response in a subject; and (c) a method for the treatment or prophylaxis of malaria, especially that caused by Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, Plasmodium malariae, Plasmodium berghei and/or Plasmodium yoelii infection in a subject, or of vaccinating a subject against malaria, especially Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, Plasmodium malariae, Plasmodium berghei and/or Plasmodium yoelii which comprises the step of administering to the subject an effective amount of a protein, homologue and/or fragment of the invention, preferably as a vaccine.

In an alternative approach, the proteins, homologues and/or fragments described herein can be used to raise antibodies, which in turn can be used to detect the antigens, and hence malaria. Alternatively, such antibodies may be used in the treatment of malaria, especially Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, Plasmodium malariae, Plasmodium berghei and/or Plasmodium yoelii infection. Such antibodies form another aspect of the invention, as do such antibodies for use in medicine, in particular in the manufacture of a medicament for the treatment and/or prophylaxis of malaria. Antibodies within the scope of the present invention may be monoclonal or polyclonal.

Polyclonal antibodies can be raised by stimulating their production in a suitable animal host (e.g. a mouse, rat, guinea pig, rabbit, sheep, goat or monkey) when a protein as described herein, or a homologue, derivative or fragment thereof, is injected into the animal. If desired, an adjuvant may be administered together with the protein. Well- known adjuvants include Freund's adjuvant (complete and incomplete) and aluminium hydroxide. The antibodies can then be purified by virtue of their binding to a protein as described herein. The inventors have raised polyclonal antibodies against fragments of PbSR (see Figure 1).

Monoclonal antibodies can be produced from hybridomas. These can be formed by fusing myeloma cells and spleen cells which produce the desired antibody in order to form an immortal cell line. Thus the well-known Kohler & Milstein technique (Nature 256 (1975)) or subsequent variations upon this technique can be used.

Techniques for producing monoclonal and polyclonal antibodies that bind to a particular polypeptide/protein are now well developed in the art. They are discussed in standard immunology textbooks, for example in Roitt et al, Immunology second edition (1989), Churchill Livingstone, London.

In addition to whole antibodies, the present invention includes derivatives thereof which are capable of binding to proteins, etc. as described herein. Thus the present invention includes antibody fragments and synthetic constructs, and the term "antibody" as used herein is intended to include these. Examples of antibody fragments and synthetic constructs are given by Dougall et al in Tϊbtech 12372-379 (September 1994).

Antibody fragments include, for example, Fab, F(ab')₂ and Fv fragments. Fab fragments (These are discussed in Roitt et al [supra]). Fv fragments can be modified to produce a synthetic construct known as a single chain Fv (scFv) molecule. This includes a peptide linker covalently joining V and V_\ regions, which contributes to the stability of the molecule. Other synthetic constructs that can be used include CDR peptides. These are synthetic peptides comprising antigen-binding determinants. Peptide mimetics may also be used. These molecules are usually conformationally restricted organic rings that mimic the structure of a CDR loop and that include antigen-interactive side chains.

Synthetic constructs include chimaeric molecules. Thus, for example, humanised (or primatised) antibodies or derivatives thereof are within the scope of the present invention. An example of a humanised antibody is an antibody having human framework regions, but rodent hypervariable regions. Ways of producing chimaeric antibodies are discussed for example by Morrison et al in PNAS, 81, 6851-6855 (1984) and by Takeda et al in Nature. 314, 452-454 (1985).

Synthetic constructs also include molecules comprising an additional moiety that provides the molecule with some desirable property in addition to antigen binding. For example the moiety may be a label (e.g. a fluorescent or radioactive label, or latex or an equivalent solid physical label such as an erythrocyte). Alternatively, it may be a pharmaceutically active agent.

In addition, so-called "Affibodies" may be utilised. These are binding proteins selected from combinatorial libraries of an alpha-helical bacterial receptor domain (Nord et al,). Thus, small protein domains, capable of specific binding to different target proteins can be selected using combinatorial approaches.

Antibodies of the present invention find use in detection/diagnosis of malaria, especially Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, Plasmodium malariae, Plasmodium berghei and/or Plasmodium yoelii. Thus, in another aspect, the present invention provides a method for the detection/diagnosis of malaria which comprises the step of bringing into contact with a sample to be tested an antibody of the present invention.

Gene cloning techniques may be used to provide a protein, homologue and/or fragment of the invention in substantially pure form. These techniques are disclosed, for example, in J. Sambrook et al Molecular Cloning 2nd Edition, Cold Spring Harbor Laboratory Press (1989).

It is also possible to utilise the nucleic acid sequences encoding the protein, homologue and/or fragment of the present invention in the preparation of so-called DNA vaccines. Thus, the invention also provides a nucleic acid molecule comprising or consisting of a sequence which encodes a protein, homologue and/or fragment of the present invention for use in medicine, as well as a vaccine composition comprising one or more nucleic acid molecules comprising or consisting of a sequence which encodes a protein, homologue and/or fragment of the present invention. The invention also provides the use of such a nucleic acid molecule in the manufacture of a medicament for the treatment and/or prophylaxis of malaria. The use of such DNA vaccines is described in the art. See for instance, Donnelly et al, Ann. Rev. Immunol, 15:617-648 (1997). Figure 5 shows the nucleic acid sequence for PbSR cDNA, and Figures 6 and 7 show the nucleic acid sequences for PfSR and PySR, respectively

Identification of the nucleic acid sequences encoding PbSR, PySR and particularly PfSR enables the skilled person to identify homologous nucleic acid sequences in other malaria parasite organisms. Such nucleic acid sequences are included within the present invention. Thus, in a further aspect, the present invention provides a nucleic acid comprising or consisting of a sequence whose identity to the nucleic acid encoding PfSR is in the range 75-99%. It is preferred if the identity of such nucleic acid molecules is in the range 80-99%, more preferred are identities of 90, 91, 92, 93, 94, 95, 96 or 98%.

Nucleic acid molecules of the present invention may hybridise, preferably under moderately stringent conditions, more strongly to PfSR that either PbSR and PySR.

It will also be clear that the nucleic acid molecules described herein may be used to detect/diagnose malaria, especially Plasmodium falciparum, Plasmodium vivax,

Plasmodium ovale, Plasmodium malariae, Plasmodium berghei and/or Plasmodium yoelii. Thus, in yet a further aspect, the present invention provides a method for the detection/diagnosis of malaria, which comprises the step of bringing into contact a sample to be tested with at least one nucleic acid molecule as described herein. Suitably, the sample is a biological sample, such as a tissue sample or a sample of blood obtained from a subject to be tested. Such samples may be pre-treated before being used in the methods of the invention. Thus, for example, a sample may be treated to extract DNA. Then, DNA probes based on the nucleic acid sequences described herein (i.e. usually fragments of such sequences) may be used to detect nucleic acid from malaria parasites, especially Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, Plasmodium n lariae, Plasmodium berghei and/or Plasmodium yoelii.

The present invention also provides a method of vaccinating a subject against malaria which comprises the step of administering to a subject a nucleic acid molecule as defined herein; a method for the prophylaxis and/or treatment of malaria, which comprises the step of administering to a subject a nucleic acid molecule as defined herein; and a kit for use in detecting/diagnosing malaria infection comprising one or more nucleic acid molecules as defined herein. In each of the above cases, malaria may be caused by Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, Plasmodium malariae, Plasmodium berghei and/or Plasmodium yoelii.

A nucleic acid molecule used in the present invention may be in isolated or recombinant form. It may be incorporated into a vector and the vector may be incorporated into a host. Nucleic acid molecules used in the present invention may be obtained from Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, Plasmodium malariae, Plasmodium berghei and/or Plasmodium yoelii by the use of appropriate probes complementary to part of the sequences of the nucleic acid molecules. Restriction enzymes or sonication techniques can be used to obtain appropriately sized fragments for probing. Alternatively, PCR techniques may be used to amplify a desired nucleic acid sequence. Thus, two primers for use in PCR can be designed so that a desired sequence, including whole genes or fragments thereof, can be targeted and then amplified to a high degree. One primer will normally show a high degree of specificity for a first sequence located on one strand of a DNA molecule, and the other primer will normally show a high degree of specificity for a second sequence located on the complementary strand of the DNA sequence and being spaced from the complementary sequence to the first sequence. Typically primers will be at least 15-25 nucleotides long.

As a further alternative, chemical synthesis may be used. This may be automated. Relatively short sequences may be chemically synthesised and ligated together to provide a longer sequence.

It appears that the proteins of the present invention may function to suppress the immune system of their host, i.e. the mosquito. Accordingly, the proteins, homologues and fragments of the present invention find use as biopesticides.

According to a further aspect of the present invention, there is provided the use of a protein, homologue and/or fragment of the invention in the manufacture of a pesticide, as well as a method for killing insects comprising administering to the insects a protein, homologue and/or fragment of the invention. Particular fragments that are useful in this aspect of the present invention comprise one or more of the SRCR, LCCL, PTX and/or LH2 domains identified in Figure 1.

As is described in more detail below, the proteins of the present invention have one or more discrete SRCR, LCCL, PTX and LH2 domains. These domains are implicated in , the suppression of immune reactions. Accordingly, in a still further aspect of the present invention, there is provided the use of a protein, homologue and/or fragment of the invention in the manufacture of a medicament for immunomodulation. In particular, the medicament may be used as an anti-inflammatory or in the treatment of auto-immune diseases, such as arthritis and multiple sclerosis, as well as graft rejection and graft- versus-host disease. Particular fragments that are useful in this aspect of the present invention comprise one or more of the SRCR, LCCL, PTX and/or LH2 domains identified in Figure 1.

In a final aspect, the present invention provides the use of an agent capable of antagonising, inhibiting or otherwise interfering with the function or expression of a protein or polypeptide of the invention in the manufacture of a medicament for use in the treatment and/or prophylaxis of malaria.

Preferred features of each aspect of the invention are as for each of the other aspects mutatis mutandis. The prior art documents mentioned herein are incorporated to the fullest extent permitted by law.

Examples

The present invention will now be described in more detail with reference to the following non-limiting examples. Reference is made to the accompanying drawings in which:

Figure 1 is a protein sequence analysis of PxSR. a, ClustalW alignment of PbSR (deposited in Genbank under accession number AY034780), PySR (chrPyl 453), PfSR (chrl4_cl4m33), PkSR (Sanger_PKN.0.008677) and CpSR (cparvum_contig 1948). Identical residues to PbSR are represented by (.) and insertion/deletion gaps by (-). A quantitative consensus of PxSR sequences, interpreted using a 66% identity threshold, is shown below alignment. Conserved domain homology patterns were identified from PSI-BLAST protein searches (BLOSUM 80 matrix) and SMART and Pfam database searches. Shaded domains constitute (as they appear) signal peptide; LH2/PLAT; LCCL; SRCR; PTX. Cysteine motifs of LCCL and SRCR domains are also shaded. Grey boxes mark conserved peptide sequences used for polyclonal antibody production in rabbits (Eurogentec). b, Schematic diagram of PxSR proteins showing the modular structure, shaded as in a. c Molecular modelling using PDB Brookhaven (MMDB) was used to construct homology models based on PDB:1BU8_A (pancreatic lipase); PDB:1JBI (inner ear protein; Coch-5b2); PDB:1BY2 (Mac-2 binding protein; M2BP) and PDB:1SAC_A (serum amyloid protein; SAP). MMDB alignments were interpreted using the RasWin program. Shown are regions of high confidence mapping (>85% of primary sequence aligns to known 3D-structure) that functionally annotate PxSR domains to the colipase binding domain of pancreatic lipase, the interaction site of the SAP homopentamer, confirm the disulphide bridge structure of LCCL and intradomain cysteine pattern of SCSR domains.

Figure 2 shows the construction and molecular analysis of PbSR disrupted parasites. a, Schematic diagram of the transfection plasmid pPbSR and the integration of the DHFR/TS cassette into PbSR (grey) by double homologous recombination. Recombination sequences (dark grey), crossover sites (crossed lines), crossover positions (small arrows), and probes used in Southern blot analyses (thick lines) are shown, b, Southern blot analysis of HwidUI-digested genomic DNA from wt and PbSR ko parasite clones 5 and 6 with probes indicated in a.

Figure 3 shows PxSR expression and knockout phenotype in mouse, a, Patent parasitaemia time course in BALB/c mice infected i.p. with lxlO³ wt (squares) or PbSR ko (circles) parasites on day 0. Each time point shows mean ± s.e.m. parasitaemia of five mice.

Figure 4 shows PxSR expression and knockout phenotype in mosquito, a, Twenty-day old oocysts in An.stephensi show the presence of mature sporozoites (s) budding off sporoblast (sb) in wt oocysts, and the absence of sporozoite formation in PbSR ko oocysts. b, Oocyst development time course in An.stephensi infected with wt (squares) or PbSR ko (circles) parasites. Each time point shows mean oocyst size of 100 oocysts, s.e.m. were negligible, c, FITC immunofluorescent antibody staining of P.berghei day 23 salivary gland sporozoite, arrow indicates apical end. d, Field of P. falciparum day 23 salivary gland sporozoites similarly stained as in c;

Figure 5 shows the sequence of PbSR cDNA; Figure 6 shows the sequence of PfiR;

Figure 7 shows the sequence of PySR;

Figure 8 is an alignment between the PbSR and PfSR nucleic acid sequences constructed using the GCG GAP program (Devereux et al, (1984) Nucleic Acids Res. 12: 387-95);

Figure 9 is an alignment between the PbSR and PfSR nucleic acid sequences constructed in the same manner as the alignment of Figure 8;

Figure 10 is an alignment between the PbSR and PySR amino acid sequences constructed in the same manner as the alignment of Figure 8;

Figure 11 is an alignment between the PbSR and PySR nucleic acid sequences constructed in the same manner as the alignment of Figure 8;

Figure 12 is an alignment between the PySR and PfSR amino acid sequences constructed in the same manner as the alignment of Figure 8;

Figure 13 is an alignment between the PySR and PfSR nucleic acid sequences constructed in the same manner as the alignment of Figure 8; and

Figures 14a-d are graphs showing wild type and knockout parasite proliferation in immunocompetent (Figure 14a) and T- and B-cell deficient mice (Figure 14b), and levels of CD25 (Figure 14c) and CDl 1 (Figure 14d) in immunocompetent and T- and B-cell deficient mice infected with wild type and knockout parasites.

Methods Parasite maintenance and purification, RNA extraction, mosquito infections, Southern blotting and immunodetection were as described (Butcher et al., Annals of Tropical Medicine and Parasitology 85: 271-273 (1991); Dessens, et al. The EMBO Journal 18, 6221-6227 (1999)).

Example 1 - Identification of PbSR

A single putative gene containing two tandem SRCR domains was found (PfSR) from the P. falciparum genome database. In more detail, NCBI malaria genomics database searches with SRCR Pfam 00530 consensus sequence yielded a single hit

(gnl|pf 14|TIGR_cl4m33 length=99544nts). Analysis of this P.fάlciparum sequence contig revealed a single open reading frame nts 84340-88155. Primers from this sequence were constructed and verified the cDNA via RT-RCR.

The PCR product was used as a heterologous probe to screen a P.berghei 24hr ookinete cDNA library, and an orthologue was subsequently identified in the rodent malaria species P.berghei.

In more detail, a λTriplEX2 cDNA library was constructed from total P.berghei RNA using the cDNA Library Construction Kit (Clontech Laboratories), Superscript TJ (Life Sciences) and Gigapack HI gold packaging (Stratagene), according to manufacturer's instructions. Escherichia coli strain XLl-Blue was used for all library screens and strain BM25.8 for plasmid conversion. The library was screened using a [ -³²P]dATP random primer labelled PfSR sequence. The 3' end of PbSR was amplified using SMART™ RACE with primer (CCCAAATTTGAGCACCCTTGTCATCTTGTT). Cloned cDNAs were analysed by automated sequencing and primer walking.

PbSR contains a single open reading frame encoding a 1304 amino acid protein with a calculated M_τ of 148,247 (Fig. la). It contains a predicted 22 amino acid signal peptide, but no identifiable transmembrane or GPI-anchor domains, indicating that the protein is soluble and secreted.

The corresponding sequence in P. yoelii was subsequently detected by searching NCBI malaria P. yoelii database with the full-length PbSR peptide sequence (tblastn). A single high homology hit (gnl|py|TIGR_453 length=8653) confirmed a single open reading frame nts 4944-1048 in length. The translated product of is the orthologous PySR molecule.

Protein comparisons show that PbSR is 95% identical to PySR (see Figure 10), reflecting their close ancestry, while PbSR is 64% identical to PfSR (see Figure 8). PySR is 64% identical to PfSR (see Figure 12).

Nucleic acid comparisons show that PbSR is 95% identical to PySR (see Figure 11), while PbSR is 74% identical to PβR (see Figure 9). PySR is 74% identical to PfSR (see Figure 13).

The PxSR proteins are made up of eight modules corresponding to four different protein families, namely PLAT/LH2, LCCL, SRCR and PTX (Fig. 1) (Bateman et al Nucleic Acids Res, 28: 263-6 (2000).

Homology searches failed to detect complete genes with similar modular composition to PxSR in non-Plasmodium species. The closest hit (>gnl|pbgss|UFL_244PbA10 Plasmodium berghei ANKA clone Genome Survey Sequence (GSS); Score = 47.8 bits. (112), Expect = le-05 Identities = 33/117 (28%), Positives = 61/117 (51%), Gaps = 5/117 (4%)) was quite obviously not the PbSR gene.

NCBI tblastn and PSI-blast (PAM 70 & BLOSUM 80) searches of non-redundant nucleotide and protein databases did not detect any homologies to the whole the full- length PxSR predicted protein. More distant homologies to SRCR, LH2, LCCL, PTX domains, confirm the existence of these protein modules in other metazoan genes. NCBI DART (domain architecture similarities) did not detect any other recorded sequence to contain a similar combination of domains. PxSR has a unique modular combination thus far unique in the protein databases.

Subsequently, a putative orthologue was identified from data made available by the Cryptosporidium parvum genome project, and homologous sequences from other Apicomplexa parasite genome projects, including Toxoplasma gondii and Theileria parva have been identified, although these partial sequences cannot confirm a complete gene. Protein comparisons show that PbSR is 95% identical to PySR, consistent with their close ancestry, while identities with PfSr, PkSR and CpSR are 64%, 58% and 33% respectively.

PxSR proteins were also examined using Clusters of Orthologous Groups of proteins (COGs). Comparing protein sequences encoded in 44 complete protist genomes, representing 30 major phylogenetic lineages. Each COG consists of individual proteins or groups of paralogs from at least 3 lineages and thus corresponds to an ancient conserved domain. Proteins from two eukaryotic genomes were assigned to COGs and can be reached from each individual COG page. No significant obvious homology was detected. Closest homology was to E.coli, CDa7767; Similar bits=36 e value=0.63. Analysis further confirms the unique nature of the PxSR protein and confirms its novel composition among protozoan organisms.

In Plasmodium falciparum, the LH2, SRCR and PTX domains appear to be unique to PxSR, although there are three other sequences that encode putative LCCL-like domains (data not shown). Thus, PbSR, PfSR and PySR appear to be conserved single copy genes which constitute a novel Plasmodium gene family.

SRCR domains are closely related to metazoan family of proteins (Pfam 00530) that is implicated in development and regulation of the immune system in vertebrates. Members include T cell surface glycoprotein receptors CD5 and CD6 (Freeman, Curr. Opin. Lipidol. 5: 143-8(1994)). An SRCR domain is also present in human complement factor I (Catteral et al, Biochem J. 242:849-56(1987)). PxSR contains two duplicated Group B type SRCR domains, which are characterised by an eight cysteine motif that forms intradmonain disulphide bonds thought to mediate protein- protein interactions (Resnick, et al, Trends Biochem Sci 19, 5-8 (1994)). Molecular modelling of the PxSR SRCR domains on the cell-adhesive Mac-2 binding protein (M2BP) (Hohenester, et al Nat Struct Biol 6, 228-32 (1999)) (Fig. lc) indicates the PxSR and M2BP SRCR domains may have a similar structure and therefore may share function. This is the first report of SRCR domains in protozoa, an observation indicating that they have moved into the parasite via horizontal genetic exchange. Their presence in a parasitic protozoan suggests that they may play a role in host molecule interaction. Based on this evidence, it is expected that the SRCR domains of PxSR will be useful in modulating development and regulation of the immune system preferably via binding and modulation of lymphocyte receptors, or in targeting immuno-modulating activities contained within PxSR to sites of action (e.g. lymphocytes), or in modulating complement-based immune responses.

LCCL domains are characterised by a four cysteine residue motif pattern (Trexler, et al, Eur J Biochem 267, 5751-7 (2000)). The LCCL domains of Limulus clotting factor C and late gestation lung protein are implicated in innate host defence mechanisms by recognising cell-surface carbohydrates of invading pathogens (Trexler, et al, Eur J Biochem 267, 5751-7 (2000)). PxSR contains four duplicated LLCL domains (Fig. 1). Based on this evidence, it is expected that the LCCL domains of PxSR will be useful in modulating immune responses or in targeting modulating activities contained within PxSR to sites of action (e.g. cell surfaces).

PTX (pentaxin or pentraxin) domains belong to a family of proteins (Pfam 00354) that are involved in acute immunological responses. Members typically contain one PTX domain. The individual monomers are organised in a discoid arrangement of five or eight non-covalently bound subunits. Members of this family of serum proteins include the oposins C-reactive protein (CRP) and serum amyloid P component protein (SAP) (Bharadwaj, et al J Immunol 166(11), 6735-6741. 2000). Structural similarities also exist with proteins such as Limulus SAP (Shrive, et al, J Mol Biol 290, 997-1008 (1999)) and the predicted Drosophila melanogaster b6 pentraxin like gene (FlyBase; FBgn0024897). Molecular modelling of the PxSR PTX domain on human SAP (Emsley et al, Nature 367:338-45(1994)) (Fig. lc) indicates these domains may have similar structure, further implicating PxSR in a potential immune modulating role. Based on this evidence, it is expected that the PTX domain of PxSR will be useful in modulating immune responses like opsonisation, or in targeting immuno-modulating activities contained within PxSR to sites of action (e.g. leukocytes).

The LH2 (Lipoxygenase Homology) or PLAT (Polycystine-1, Lipoxygenase, Alpha- Toxin) domains are typically found in a variety of membrane or lipid associated proteins of plants, metazoans and some pathogenic bacteria (Pfam 01477). These domains are implicated in protein-lipid interactions (Bateman & Standford, Curr. Biol. 9:R588-90(1999)). The N-terminal domain of lipoxygenase enzymes has structural homology to the C-terminal domain in bacterial alpha-toxin and mammalian pancreatic lipases. In lipoxygenase, this domain binds to procolipase that mediates binding to membranes (van Tilbeurgh, et al, Biochim Biophys Acta 1441, 173-84 (1999)). Modular modelling the PxSR LH2 domain on the atomic structure of rat pancreatic lipase (Roussel, et al. J Biol Chem 273, 32121-8 (1998)) (Fig. lc) indicates these domains may have similar structuires and may potentially share function. Based on this evidence, it is expected that the LH2/PLAT domain of PxSR will be useful in targeting immuno modulating activities contained within PxSR to sites of action (e.g.cell membranes, lipids). Example 2 - Effect of PbSR in P. berghei

To investigate possible functions of PbSR, we generated transgenic PMR-disrupted P. berghli parasites by insertion of a modified Toxoplasma gondii dihydrofolate reductase-thymidylate synthase gene cassette (DHFR/TS) (van Dijk, et al, Science 268, 1358-1362 (1995); Waters, etal, Transfection of malaria parasites. Methods 13: 134-147 (1997)) into the PbSR gene by double homologous recombination (Fig 2a). The DHFR/TS cassette, which confers resistance to the antimalarial drug pyrimethamine, was inserted between nucleotide positions 880 and 2776 of PbSR, thereby removing 1.9 kb of the PbSR central coding sequence.

A 606 bp sequence was PCR-amplified using the primers PbSRl Notl (GCGGCCGCGAGAATCTATAACTGGGTCAG) and PbSRl BamHI (GGATCCAGATATGAACCCTTCATGTAACAT), digested with Notl and BamHl and hgated into a Nσtl/tfαmHI-digested pBS-DHFR (Dessens, et al. The EMBO Journal 18, 6221-6227 (1999)), to give pPbSR-ΝB. A 481 bp fragment was PCR amplified using the primers and PbSRl/Kpnl

(GGTACCTCTCCTATAAAATAATCAGTTGC) and PbSRl/HindUI (AAGCTTAGAATCTATAACTGGGTCAG), digested with H dIII and Kpnl and ligated into H cliπ/iζtml-digested pPbSR-ΝB, to give transfection plasmid pPbSR (Fig. 2a). Parasite transfection, pyrimethamine selection and dilution cloning were as described (Waters, et al, Transfection of malaria parasites. Methods 13:134-147 (1997)).

Two independent clonal pyrimethamine-resistant parasite populations (named PbSR ko, clones 5 and 6) were assessed by Southern blot analysis of Hindϋl-digested genomic DΝA. A PbSR probe corresponding to nucleotide position 1090 to 1629 (no H dUI sites present) gave rise to a single band in parental (wt) parasites and no bands in the PbSR ko parasites (Fig 2b), indicating the successful deletion of the central PbSR sequence via insertion of the DHFR/TS cassette. Conversely, a DHFR/TS probe (no HmdIII sites present) gave rise to a single band in the PbSR ko parasites and no signal in wt parasites, confirming successful integration (Fig 2b).

Although PbSR disruption was not lethal to parasite infection of mice, proliferation was attenuated (Fig. 3a). The doubling rate of wt parasites was approximately three times higher than that of PbSR ko parasites during patent parasitaemia, and at 10-day s post-infection mean parasitaemia in the PbSR ko parasite-infected mice was less than half that observed in wt parasite-infected animals (Fig. 3a).

To evaluate effects of PbSR disruption on P.berghei development in mosquito, wt and PbSR ko parasites were fed to An.stephensi. Both parasites formed comparable numbers of oocysts as examined at 10-days post-infection (Table 1).

Table 1. Effect of PbSR disruption on P. berghei infectivity to An. stephensi

Expt. Type of feed Mean number of oocytes ± SEM from % of wt

(clone)^a mosquito infected midguts ^b (number of midguts dissected) wt PbSR ko

1 get (5) 18.0 ± 2.2 (149) 39.2 ± 2.7^C (135) 217

2 gct(6) 111 ± 6.8 (97) 143 ± 8.6 (98) 129

3 ook (5) 38.7 ± 3.3 (106) 43.7 ± 3.1 (120) 113

4 ook (6) 46.6 ± 3.2 (105) 41.7 ± 2.8 (106) 89

Gametocyte (get) or ookinete (ook) feed, and clone used.

Each experiment is based on pooled data from three mice (get) and three membrane feeders (ook). ^c Significantly different (P < 0.001) from value for wt-infected control group as calculated by Mann Witney U test. However, in contrast to wt oocysts, PbSR ko oocysts did not produce any sporozoites in either of the clones examined (Fig. 4a). Oocyst growth curves significantly diverged near 10-days post-infection, approximately the time when sporozoites normally start to appear in P.berghei (Sinden, Transactions of the Royal Society of Tropical Medicine and Hygiene 75, 171-172 (1981)), and mean oocysts size ended up some 35% greater in PbSR ko parasite-infected mosquitoes (Fig. 4b). No further oocyst growth was observed from 15-days post-infection for either parasite (Fig. 4b). Sporozoites of both P.berghei and P. falciparum stained positive for PxSR (Figs. 4c,d). This staining was polarised towards the apical end of the sporozoite (Fig. 4c), an observation indicative of micronemal targeting and hence secretion by the parasite.

The PbSR knockout phenotype in the mosquito is reminiscent of that resulting from disruption of the circumsporozoite protein (CS) gene, which also affects sporozoite formation in the oocyst (Menard, et al. Nature 385, 336-340 (1997)). There are, however, notable differences between the two scenarios. CS-disrupted oocysts did produce some sporozoites and oocysts were of comparable size between wt and CS- disrupted parasites (Menard, etal. Nature 385, 336-340 (1997)), suggesting that the mechanisms that cause the reduction of sporozoite formation are distinct in the CS- and PbSR-disrupted parasites. A mechanism of potential innate immune evasion by CS in the sporozoite-infected liver cells has previously been described (Frevert, et al. The EMBO Journal 17, 3816-3826 (1998)) and it is conceivable that other evasion mechanisms may exist in the parasite against antibody-independent immunity in the vertebrate or insect host. Clearly, the unique modular structure of PxSR, its predicted extracellular nature, its knockout phenotypes and its expression pattern thus far established are supportive of such a role.

Example 3 - PbSR knockout phenotypes in mouse

Parasitaemia time courses of PbSR-positive (wt) and PbSR-negative (ko) Plasmodium berghei parasites in immunocompetent B ALB/c mice were studied. As shown in Figure 14a, attenuated proliferation was see with ko parasites. In contrast, in T- and B-lymphocyte deficient Ragl-/- mice, the attenuated growth of the ko parasites is not observed (see Figure 14b). These results are consistent with a role for PbSR in immunity; if the attenuated growth of ko parasites in BALB/c were not mediated through effects on the immune system, but through other factors (e.g. a reduced ability of the parasites to replicate or invade), these parasites would also have attenuated growth in immunodeficient animals. This is clearly not the case. Mice were infected by intraperitoneal injection of 1,000 intraerythrocytic parasites on day 0. Note that the experiments of Figures 14a and b were internally controlled, the same parasite samples being used to infect BALB/c and Ragl-/- animals. The overall differences in the levels of infection between BALB/c and Ragl-/- mice is caused by their differing genetic backgrounds.

Spleen lymphocyte populations from the BALB/c mice in the experiment of Figure 14a were also analysed for T lymphocyte activation at days 8 (n = 3) and 10 (n = 5) post-infection. Both wt- and ko-infected animals contained comparable numbers as well as ratios of CD4+, CD8+ and B lymphocytes on days 8 and 10 (not shown). The number of CD8αβ+ CD3+ lymphocytes (cytotoxic T lymphocytes) expressing the activation marker CD25 was higher in the ko parasite-infected animals than in the wt parasite-infected animals on days 8 and 10 post-infection (see Figure 14c). Spleens of ko parasite-infected animals also contained markedly higher numbers of activated cytotoxic T lymphocytes than those of wt parasite-infected animals on day 10 post- infection, as assessed by expression of the late activation marker CDllc (see Figure 14d). These data suggest that PbSR may be involved in modulating T lymphocyte activation. Significant differences (paired t-test, P<0.05) are indicated by *.

Claims

Claims

1. A protein comprising one of the amino acid sequences shown in Figure la, or a homologue of said protein, or a fragment of said protein or homologue.

2. A protein as claimed in claim 1, wherein said fragment has one of the amino acid sequences of Figure 1 without the first 22 amino acids thereof, or the following sequences: KAKFEYGMSDYAEC and CNKFIGTKRNNIES.

3. A method of detecting and/or diagnosing malaria, which comprises:

(a) bringing into contact with a sample to be tested a protein as claimed in claim 1 or claim 2; and

(b) detecting the presence of antibodies to malaria parasite.

4. The use of a protein as claimed in claim 1 or claim 2 in detecting and/or diagnosing malaria.

5. A kit for use in the detection and/or diagnosis of malaria, which kit comprises a protein as claimed in claim 1 or claim 2.

6. A protein as claimed in claim 1 or claim 2 for use in medicine.

7. The use of a protein as claimed in claim 1 or claim 2 in the manufacture of a medicament for the treatment and/or prophylaxis of malaria.

8. A composition capable of eliciting an immune response in a subject, which composition comprises a protein as claimed in claim 1 or claim 2.

9. A composition as claimed in claim 8, which is a vaccine composition, optionally comprising one or more suitable adjuvants.

10. An antibody which binds to a protein as claimed in claim 1 or claim 2.

11. An antibody as claimed in claim 10 which is polyclonal or monoclonal.

12. The use of an antibody as claimed in claim 10 or claim 11 in medicine,

13. The use of an antibody as claimed in claim 10 or claim 11 in the manufacture of a medicament for the treatment and/or prophylaxis of malaria.

14. A method for the detection/diagnosis of malaria which comprises the step of bringing into contact with a sample to be tested an antibody as claimed in claim 10 or claim 11.

15. The use of a nucleic acid molecule comprising or consisting of a sequence which encodes a protein as claimed in claim 1 or claim 2 in medicine.

16. A vaccine composition comprising a nucleic acid molecule as defined in claim

15. optionally comprising one or more suitable adjuvants.

17. The use of a nucleic acid molecule as defined in claim 15 in the manufacture of a medicament for the treatment and/or prophylaxis of malaria.

18. A method for the detection/diagnosis of malaria which comprises the step of bringing into contact a sample to be tested with at least one nucleic acid molecule as defined in claim 15.

19. The use of an agent capable of antagonising, inhibiting or otherwise interfering with the function or expression of a protein as claimed in claim 1 or claim 2 in the manufacture of a medicament for use in the treatment and/or prophylaxis of malaria.