REGULATION OF HUMAN CITRON RHO/RAC-INTERACTING KINASE
This application incorporates by reference and claims the benefit of co-pending provisional applications Serial No. 60/301,841 filed July 2, 2001, Serial No. 60/338,651 filed December 11, 2001 and Serial No. 60/375,014 filed April 25, 2002
TECHNICAL FIELD OF THE INVENTION
The invention relates to the regulation of human citron rho/rac-interacting kinase (CRIK).
BACKGROUND OF THE INVENTION
Kinases are involved in a variety of disease processes. There is a need in the art to identify related enzymes, which can be regulated for therapeutic effects.
SUMMARY OF THE INVENTION
It is an object of the invention to provide reagents and methods of regulating a human CRIK. This and other objects of the invention are provided by one or more of the embodiments described below.
One embodiment of the invention is a human citron rho/rac-interacting kinase polypeptide comprising an amino acid sequence selected from the group consisting of:
amino acid sequences which are at least about 97% identical to the amino acid sequence shown in SEQ ID NO: 2; and
the amino acid sequence shown in SEQ ID NO: 2.
Yet another embodiment of the invention is a method of screening for agents which decrease extracellular matrix degradation. A test compound is contacted with a human citron rho/rac-interacting kinase polypeptide comprising an amino acid sequence selected from the group consisting of:
amino acid sequences which are at least about 97% identical to the amino acid sequence shown in SEQ ID NO: 2; and
the amino acid sequence shown in SEQ ID NO: 2.
Binding between the test compound and the human citron rho/rac-interacting kinase polypeptide is detected. A test compound which binds to the human citron rho/rac- interacting kinase polypeptide is thereby identified as a potential agent for decreasing extracellular matrix degradation. The agent can work by decreasing the activity of the human citron rho/rac-interacting kinase.
Another embodiment of the invention is a method of screening for agents which decrease extracellular matrix degradation. A test compound is contacted with a polynucleotide encoding a human citron rho/rac-interacting kinase polypeptide, wherein the polynucleotide comprises a nucleotide sequence selected from the group consisting of:
nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ LD NO: 1;
the nucleotide sequence shown in SEQ ID NO: 1;
nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO: 24; and
the nucleotide sequence shown in SEQ ID NO: 24.
Binding of the test compound to the polynucleotide is detected. A test compound which binds to the polynucleotide is identified as a potential agent for decreasing extracellular matrix degradation. The agent can work by decreasing the amount of the human citron rho/rac-interacting kinase through interacting with the human citron rho/rac-interacting kinase mRNA.
Another embodiment of the invention is a method of screening for agents which regulate extracellular matrix degradation. A test compound is contacted with a human citron rho/rac-interacting kinase polypeptide comprising an amino acid sequence selected from the group consisting of:
amino acid sequences which are at least about 97% identical to the amino acid sequence shown in SEQ ID NO: 2; and
the amino acid sequence shown in SEQ ID NO: 2.
A human citron rho/rac-interacting kinase activity of the polypeptide is detected. A test compound which increases human citron rho/rac-interacting kinase activity of the polypeptide relative to human citron rho/rac-interacting kinase activity in the absence of the test compound is thereby identified as a potential agent for increasing extracellular matrix degradation. A test compound which decreases human citron rho/rac-interacting kinase activity of the polypeptide relative to human citron rho/rac- interacting kinase activity in the absence of the test compound is thereby identified as a potential agent for decreasing extracellular matrix degradation.
Even another embodiment of the invention is a method of screening for agents which decrease extracellular matrix degradation. A test compound is contacted with a human citron rho/rac-interacting kinase product of a polynucleotide which comprises a nucleotide sequence selected from the group consisting of:
nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO: 1;
the nucleotide sequence shown in SEQ ID NO: 1;
nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO: 24; and
the nucleotide sequence shown in SEQ ID NO: 24.
Binding of the test compound to the human citron rho/rac-interacting kinase product is detected. A test compound which binds to the human citron rho/rac-interacting kinase product is thereby identified as a potential agent for decreasing extracellular matrix degradation.
Still another embodiment of the invention is a method of reducing extracellular matrix degradation. A cell is contacted with a reagent which specifically binds to a polynucleotide encoding a human citron rho/rac-interacting kinase polypeptide or the product encoded by the polynucleotide, wherein the polynucleotide comprises a nucleotide sequence selected from the group consisting of:
nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO: 1;
the nucleotide sequence shown in SEQ ID NO: 1;
nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO: 24; and
the nucleotide sequence shown in SEQ LO NO: 24.
Human citron rho/rac-interacting kinase activity in the cell is thereby decreased.
The invention thus provides a human CRIK that can be used to identify test compounds that may act, for example, as activators or inhibitors at the enzyme's active site. Human CRIK and fragments thereof also are useful in raising specific antibodies that can block the enzyme and effectively reduce its activity.
BRIEF DESCRIPTION OF THE DRAWINGS
Fig. 1 shows the DNA-sequence encoding a citron rho/rac- interacting kinase Polypeptide (SEQ ID NO:l). Fig. 2 shows the amino acid sequence deduced from the DNA- sequence of Fig.1 (SEQ ID NO:2). Fig. 3 shows the amino acid sequence of the protein identified by trembl|AF086824|AF086824__l (SEQ ID NO:3).
Fig. 4 shows the DNA-sequence encoding a citron rho/rac- interacting kinase Polypeptide (SEQ ID NO:4). Fig. 5 shows the amino acid sequence of the protein identified by swiss|O14578|CTRO_HUMAN (SEQ ID NO:5). Fig. 6 shows the DNA-sequence of a protein identified by trembl|AB023166|AB023166_l (SEQ ID NO:6). Fig. 7 shows the amino acid sequence of the protein identified by swissnew|P54265|DMK_MOUSE (SEQ ID NO:7). Fig. 8 shows the BLASTP - alignment of 543_Protein (SEQ ID NO:2) against trembl|AF086824|AF086824_l (SEQ
ID NO:3). Fig. 9 shows the BLASTP - alignment of 543_Protein (SEQ . ID NO:2) against swiss|O14578|CTROJTϋMAN (SEQ ID NO:5). Fig. 10 shows the BLASTP - alignment of 543_Protein (SEQ
ID NO:2) against aageneseq|AAB43359|AAB43359.
Fig. 11 shows the BLASTP - alignment of 543_Protein (SEQ
ID NO:2) against trembl|AB023166|AB023166_l (SEQ
ID NO:6). Fig. 12 shows the BLASTP - alignment of 543_Protein (SEQ ID NO:2) against swissnew|P54265|DMK_MOUSE
(SEQ ID NO:7). Fig. 13 shows the BLASTP - alignment of 543_Protein (SEQ
ID NO:2) against pdb|lCDK|lCDK-A. Fig. 14 shows the HMMPFAM - alignment of 543_Protein (SEQ ID NO:2) against pfam|hmm]pkinase.
Fig. 15 shows the HMMPFAM - alignment of 543_Protein
(SEQ ID NO:2) against pfam|hmm|PH. Fig. 16 shows the HMMPFAM - alignment of 543_Protein
(SEQ ID NO:2) against pfam|hmm|CNH. Fig. 17 shows the HMMPFAM - alignment of 543_Protein
(SEQ ID NO:2) against ρfam|hmm|DAG_PE-bind. Fig. 18 shows the HMMPFAM - alignment of 543_Protein
(SEQ ID NO: 2) against pfam|hmm|pkinase_C. Fig. 19 shows the Prosite search results. Fig. 20 shows the Genewise output.
Fig. 21 shows the Relative expression of human citron rho/rac- interacting kinase. Fig. 22 shows the TBLASTN - alignment of 543_Protein against emnew|AX166510|AX166510 Sequence 1 from Patent WO0138503.//:gbnew|AX166510|AX166510
Sequence Patent WO0138503. Fig. 23 shows the TBLASTN - alignment of 543_ Protein against BAYER_LLB_DNA|wu_37300600 Bayer Corp
Pharma Proprietary OP Library: Fat Rat Hypofhalamus Linda Oct 15 15:45:51 EDT 1999
Fig. 24 shows the DNA-sequence encoding a citron rho/rac- interacting kinase Polypeptide.
DETAILED DESCRIPTION OF THE INVENTION
The invention relates to an isolated polynucleotide from the group consisting of: a) a polynucleotide encoding a human citron rho/rac-interacting kinase polypeptide comprising an amino acid sequence selected from the group consisting of: amino acid sequences which are at least about 97% identical to the amino acid sequence shown in SEQ ID NO: 2; and the amino acid sequence shown in SEQ ID NO: 2. b) a polynucleotide comprising the sequence of SEQ LO NOS: 1 or 24; c) a polynucleotide which hybridizes under stringent conditions to a polynucleotide specified in (a) and (b) and encodes a human citron rho/rac-interacting kinase polypeptide; d) a polynucleotide the sequence of which deviates from the polynucleotide sequences specified in (a) to (c) due to the degeneration of the genetic code and encodes a human citron rho/rac- interacting kinase polypeptide; and e) a polynucleotide which represents a fragment, derivative or allelic variation of a polynucleotide sequence specified in (a) to (d) and encodes a human citron rho/rac-interacting kinase polypeptide.
Furthermore, it has been discovered by the present applicant that a novel CRJK, particularly a human CRIK, can be used in therapeutic methods to treat obesity, a CNS disorder, diabetes or COPD. Human CRIK comprises the amino acid sequence shown in SEQ ID NO:2. A coding sequence for human CRIK is shown in SEQ ID NO:l. This sequence is contained within the longer sequence shown in SEQ ID NO:4, which is located on chromosome 12q24.2. Related ESTs are expressed in bone marrow, denis_drash (pediatric kidney tumors), epithehoid carcinoma
(pancreas), colon ns (colon cancer cell line), uterus_tumor, glioblastoma with EGFR amplification, colon, nervous, nervous tumor, and bladder_tumor.
Human CRIK is 96% identical over 2056 amino acids to trembl]AF086824|AF086824_l (SEQ ID NO:3) (FIG. 1), 100% identical over 1286 amino acids to swiss|O14578]CTRO_HUMAN (SEQ ID NO:5) (FIG. 2), 100% identical over 1286 amino acids to SEQ LD NO:6246 of aageneseq|AAB43359|AAB43359 (FIG. 3), 100% over 940 amino acids to trembl|AB023166|AB023166_l (SEQ ID NO:6) (FIG. 4), and 38% identical over 522 amino acids to swissnew|P54265|DMK_MOUSE (SEQ LD NO:7) (FIG. 5).
Human CRIK of the invention is expected to be useful for the same purposes as previously identified CRIK enzymes. Human CRIK is believed to be useful in therapeutic methods to treat disorders such as CNS disorders, obesity ,y and COPD. Human CRIK also can be used to screen for human CRIK activators and inhibitors.
Polypeptides
Human CRIK polypeptides according to the invention comprise at least 6, 10, 15, 20, 25, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450,
475, 500, 525, 550, 575, 600, 625, 650, 675, 700, 725, 750, 775, 800, 825, 850, 875,
900, 925, 950, 975, 1000, 1025, 1050, 1075, 1100, 1125, 1150, 1175, 1200, 1225,
1250, 1275, 1300, 1325, 1350, 1375, 1400, 1425, 1450, 1475, 1500, 1525, 1550,
1575, 1600, 1625, 1650, 1675, 1700, 1725, 1750, 1775, 1800, 1825, 1850, 1875, 1900, 1925, 1950, 1975, 2000, 2025, 2050, or 2054 contiguous amino acids selected from the amino acid sequence shown in SEQ ID NO:2 or a biologically active variant thereof, as defined below. A CRIK polypeptide of the invention therefore can be a portion of a CRIK protein, a full-length CRIK protein, or a fusion protein comprising all or a portion of a CRIK protein.
Biologically Active Variants
Human CRIK polypeptide variants which are biologically active, e.g., retain enzymatic activity, also are human CRIK polypeptides. Preferably, naturally or non-naturally occurring human CRIK polypeptide variants have amino acid sequences which are at least about 97, 98, of 99% identical to the amino acid sequence shown in SEQ ID NO:2 or a fragment thereof. Percent identity between a putative human CRIK polypeptide variant and an amino acid sequence of SEQ ID NO:2 is determined by conventional methods. See, for example, Altschul et al., Bull. Math. Bio. 48:603 (1986), and Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA
5.9:10915 (1992). Briefly, two amino acid sequences are aligned to optimize the alignment scores using a gap opening penalty of 10, a gap extension penalty of 1, and the "BLOSUM62" scoring matrix of Henikoff & Henikoff, 1992.
Those skilled in the art appreciate that there are many established algorithms available to align two amino acid sequences. The "FASTA" similarity search algorithm of Pearson & Lipman is a suitable protein alignment method for examining the level of identity shared by an amino acid sequence disclosed herein and the amino acid sequence of a putative variant. The FASTA algorithm is described by Pearson & Lipman, Proc. Nat'l Acad. Sci. USA 55:2444(1988), and by Pearson,
Meth. Enzymol. 183:63 (1990). Briefly, FASTA first characterizes sequence similarity by identifying regions shared by the query sequence (e.g., SEQ LD NO: 2) and a test sequence that have either the highest density of identities (if the ktup variable is 1) or pairs of identities (if ktup=2), without considering conservative amino acid substitutions, insertions, or deletions. The ten regions with the highest density of identities are then rescored by comparing the similarity of all paired amino acids using an amino acid substitution matrix, and the ends of the regions are "trimmed" to include only those residues that contribute to the highest score. If there are several regions with scores greater than the "cutoff value (calculated by a predetermined formula based upon the length of the sequence the ktup value), then the trimmed initial regions are examined to determine whether the regions can be
joined to form an approximate alignment with gaps. Finally, the highest scoring regions of the two amino acid sequences are aligned using a modification of the Needleman-Wunsch- Sellers algorithm (Needleman & Wunsch, J. Mol. Biol.48:444 (1970); Sellers, SUM J. Appl. Math.26:l l (1974)), which allows for amino acid insertions and deletions. Preferred parameters for FASTA analysis are: ktup=l, gap opening penalty=10, gap extension penalty=l, and substitution matrix=BLOSUM62. These parameters can be introduced into a FASTA program by modifying the scoring matrix file ("SMATRIX"), as explained in Appendix 2 of Pearson, Meth. Enzymol. 183:63 (1990).
FASTA can also be used to determine the sequence identity of nucleic acid molecules using a ratio as disclosed above. For nucleotide sequence comparisons, the ktup value can range between one to six, preferably from three to six, most preferably three, with other parameters set as default.
Variations in percent identity can be due, for example, to amino acid substitutions, insertions, or deletions. Amino acid substitutions are defined as one for one amino acid replacements. They are conservative in nature when the substituted amino acid has similar structural and/or chemical properties. Examples of conservative replacements are substitution of a leucine with an isoleucine or valine, an aspartate with a glutamate, or a fhreonine with a serine.
Amino acid insertions or deletions are changes to or within an amino acid sequence. They typically fall in the range of about 1 to 5 amino acids. Guidance in determining which amino acid residues can be substituted, inserted, or deleted without abolishing biological or immunological activity of a human CRIK polypeptide can be found using computer programs well known in the art, such as DNASTAR software.
The invention additionally, encompasses CRLK polypeptides that are differentially modified during or after translation, e.g., by glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting/blocking groups,
proteolytic cleavage, linkage to an antibody molecule or other cellular ligand, etc. Any of numerous chemical modifications can be carried out by known techniques including, but not limited, to specific chemical cleavage by cyanogen bromide, trypsin, chymotrypsin, papain, V8 protease, NaBH4, acetylation, formylation, oxidation, reduction, metabolic synthesis in the presence of tunicamycin, etc.
Additional post-translational modifications encompassed by the invention include, for example, e.g., N-linked or O-linked carbohydrate chains, processing of N- terminal or C-terminal ends), attachment of chemical moieties to the amino acid backbone, chemical modifications of N-linked or O-linked carbohydrate chains, and addition or deletion of an N-terminal methionine residue as a result of prokaryotic host cell expression. The CRIK polypeptides may also be modified with a detectable label, such as an enzymatic, fluorescent, isotopic or affinity label to allow for detection and isolation of the protein.
The invention also provides chemically modified derivatives of CRIK polypeptides that may provide additional advantages such as increased solubility, stability and circulating time of the polypeptide, or decreased immunogenicity (see U.S. Patent No. 4,179,337). The chemical moieties for derivitization can be selected from water soluble polymers such as polyethylene glycol, ethylene glycol/propylene glycol copofymers, carboxymethylcellulose, dextran, polyvinyl alcohol, and the like. The polypeptides can be modified at random or predetermined positions within the molecule and can include one, two, three, or more attached chemical moieties.
Whether an amino acid change or a polypeptide modification results in a biologically active CRIK polypeptide can readily be determined by assaying for enzymatic activity, as described for example, in Di Cunto F. et al, J Biol Chem. 1998 Nov 6;273(45):29706-l l.
Fusion Proteins
Fusion proteins are useful for generating antibodies against CRIK polypeptide amino acid sequences and for use in various assay systems. For example, fusion proteins can be used to identify proteins that interact with portions of a CRIK polypeptide.
Protein affinity chromatography or library-based assays for protein-protein interactions, such as the yeast two-hybrid or phage display systems, can be used for this purpose. Such methods are well known in the art and also can be used as drug screens.
A CRIK polypeptide fusion protein comprises two polypeptide segments fused together by means of a peptide bond. The first polypeptide segment comprises at least 6, 10, 15, 20, 25, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, 600, 625, 650, 675, 700, 725, 750, 775, 800, 825, 850, 875, 900, 925, 950, 975, 1000, 1025, 1050, 1075, 1100, 1125, 1150,
1175, 1200, 1225, 1250, 1275, 1300, 1325, 1350, 1375, 1400, 1425, 1450, 1475, 1500, 1525, 1550, 1575, 1600, 1625, 1650, 1675, 1700, 1725, 1750, 1775, 1800, 1825, 1850, 1875, 1900, 1925, 1950, 1975, 2000, 2025, 2050, or 2054 contiguous amino acids of SEQ ID NO:2 or of a biologically active variant, such as those described above. The first polypeptide segment also can comprise full-length CRIK protein.
The second polypeptide segment can be a full-length protein or a protein fragment.
Proteins commonly used in fusion protein construction include β-galactosidase, β- glucuronidase, green fluorescent protein (GFP), autofluorescent proteins, including blue fluorescent protein (BFP), glutafhione-S-transferase (GST), luciferase, horseradish peroxidase (HRP), and chloramphenicol acetyltransferase (CAT).
Additionally, epitope tags are used in fusion protein constructions, including histidine (His) tags, FLAG tags, influenza hemagglutinin (HA) tags, Myc tags, VSV- G tags, and thioredoxin (Trx) tags. Other fusion constructions can include maltose binding protein (MBP), S-tag, Lex a DNA binding domain (DBD) fusions, GAL4
DNA binding domain fusions, and herpes simplex virus (HSV) BP16 protein fusions. A fusion protein also can be engineered to contain a cleavage site located between the CRIK polypeptide-encoding sequence and the heterologous protein sequence, so that the CRIK polypeptide can be cleaved and purified away from the heterologous moiety.
A fusion protein can be synthesized chemically, as is known in the art. Preferably, a fusion protein is produced by covalently linking two polypeptide segments or by standard procedures in the art of molecular biology. Recombinant DNA methods can be used to prepare fusion proteins, for example, by making a DNA construct which comprises coding sequences selected from SEQ ID NO:l in proper reading frame with nucleotides encoding the second polypeptide segment and expressing the DNA construct in a host cell, as is known in the art. Many kits for constructing fusion proteins are available from companies such as Promega Corporation (Madison, WI), Stratagene (La Jolla, CA), CLONTECH (Mountain View, CA),
Santa Cruz Biotechnology (Santa Cruz, CA), MBL International Corporation (MIC; Watertown, MA), and Quantum Biotechnologies (Montreal, Canada; 1-888-DNA- KITS).
Identification of Species Homologs
Species homologs of human CRIK polypeptide can be obtained using CRLK polypeptide polynucleotides (described below) to make suitable probes or primers for screening cDNA expression libraries from other species, such as mice, monkeys, or yeast, identifying cDNAs which encode homologs of CRIK polypeptide, and expressing the cDNAs as is known in the art.
Polynucleotides
A CRIK polynucleotide can be single- or double-stranded and comprises a coding sequence or the complement of a coding sequence for a CRIK polypeptide. A coding sequence for human CRIK is shown in SEQ ID NO: 1.
Degenerate nucleotide sequences encoding human CRIK polypeptides, as well as homologous nucleotide sequences which are at least about 50, 55, 60, 65, 70, preferably about 75, 90, 96, 98, or 99% identical to the nucleotide sequence shown in SEQ ID NO:l or its complement also are CRIK polynucleotides. Percent sequence identity between the sequences of two polynucleotides is determined using computer programs such as ALIGN which employ the FASTA algorithm, using an affine gap search with a gap open penalty of -12 and a gap extension penalty of -2. Complementary DNA (cDNA) molecules, species homologs, and variants of CP K polynucleotides that encode biologically active CRIK polypeptides also are CRIK polynucleotides. Polynucleotide fragments comprising at least 8, 9, 10, 11, 12, 15, 20, or 25 contiguous nucleotides of SEQ ID NO:l or its complement also are CRIK polynucleotides. These fragments can be used, for example, as hybridization probes or as antisense oligonucleotides.
Identification of Polynucleotide Variants and Homologs
Variants and homologs of the CRJK polynucleotides described above also are CRIK polynucleotides. Typically, homologous CRIK polynucleotide sequences can be identified by hybridization of candidate polynucleotides to known CRIK polynucleotides under stringent conditions, as is known in the art. For example, using the following wash conditions~2X SSC (0.3 M NaCl, 0.03 M sodium citrate, pH 7.0), 0.1% SDS, room temperature twice, 30 minutes each; then 2X SSC, 0.1% SDS, 50 °C once, 30 minutes; then 2X SSC, room temperature twice, 10 minutes each—homologous sequences can be identified which contain at most about 25-30%
basepair mismatches. More preferably, homologous nucleic acid strands contain 15-25% basepair mismatches, even more preferably 5-15% basepair mismatches.
Species homologs of the CRIK polynucleotides disclosed herein also can be identified by making suitable probes or primers and screening cDNA expression libraries from other species, such as mice, monkeys, or yeast. Human variants of CRIK polynucleotides can be identified, for example, by screening human cDNA expression libraries. It is well known that the Tm of a double-stranded DNA decreases by 1-1.5 °C with every 1% decrease in homology (Bonner et ah, J. Mol. Biol. 81, 123 (1973). Variants of human CRIK polynucleotides or CRIK polynucleotides of other species can therefore be identified by hybridizing a putative homologous CRIK polynucleotide with a polynucleotide having a nucleotide sequence of SEQ ID NO:l or the complement thereof to form a test hybrid. The melting temperature of the test hybrid is compared with the melting temperature of a hybrid comprising polynucleotides having perfectly complementary nucleotide sequences, and the number or percent of basepair mismatches within the test hybrid is calculated.
Nucleotide sequences which hybridize to CRIK polynucleotides or their complements following stringent hybridization and/or wash conditions also are
CRIK polynucleotides. Stringent wash conditions are well known and understood in the art and are disclosed, for example, in Sambrook et al, MOLECULAR CLO ΓNG: A LABORATORY MANUAL, 2d ed., 1989, at pages 9.50-9.51.
Typically, for stringent hybridization conditions a combination of temperature and salt concentration should be chosen that is approximately 12-20 °C below the calculated Tm of the hybrid under study. The Tm of a hybrid between a CRIK polynucleotide having a nucleotide sequence shown in SEQ ID NO:l or the complement thereof and a polynucleotide sequence which is at least about 50, preferably about 75, 90, 96, or 98% identical to one of those nucleotide sequences
can be calculated, for example, using the equation of Bolton and McCarthy, Proc. Natl Acad. Sci. U.S.A. 48, 1390 (1962):
Tm = 81.5 °C - 16.6(log10[Na+]) + 0.41(%G + C) - 0.63(%formamide) - 600//), where = the length of the hybrid in basepairs.
Stringent wash conditions include, for example, 4X SSC at 65 °C, or 50% formamide, 4X SSC at 42 °C, or 0.5X SSC, 0.1% SDS at 65 °C. Highly stringent wash conditions include, for example, 0.2X SSC at 65 °C.
Preparation of Polynucleotides
A CRIK polynucleotide can be isolated free of other cellular components such as membrane components, proteins, and lipids. Polynucleotides can be made by a cell and isolated using standard nucleic acid purification techniques, or synthesized using an amplification technique, such as the polymerase chain reaction (PCR), or by using an automatic synthesizer. Methods for isolating polynucleotides are routine and are known in the art. Any such technique for obtaining a polynucleotide can be used to obtain isolated CRIK polynucleotides. For example, restriction enzymes and probes can be used to isolate polynucleotide fragments, which comprise CRIK nucleotide sequences. Isolated polynucleotides are in preparations that are free or at least 70, 80, or 90% free of other molecules.
Human CRIK cDNA molecules can be made with standard molecular biology techniques, using CRIK mRNA as a template. Human CRIK cDNA molecules can thereafter be replicated using molecular biology techniques known in the art and disclosed in manuals such as Sambrook et al. (1989). An amplification technique, such as PCR, can be used to obtain additional copies of polynucleotides of the invention, using either human genomic DNA or cDNA as a template.
Alternatively, synthetic chemistry techniques can be used to synthesize CRIK polynucleotides. The degeneracy of the genetic code allows alternate nucleotide sequences to be synthesized which will encode a CRIK polypeptide having, for example, an amino acid sequence shown in SEQ ID NO:2 or a biologically active variant thereof.
Extending Polynucleotides
Various PCR-based methods can be used to extend the nucleic acid sequences disclosed herein to detect upstream sequences such as promoters and regulatory elements. For example, restriction-site PCR uses universal primers to retrieve unknown sequence adjacent to a known locus (Sarkar, PCR Methods Applic. 2, 318-322, 1993). Genomic DNA is first amplified in the presence of a primer to a linker sequence and a primer specific to the known region. The amplified sequences are then subjected to a second round of PCR with the same linker primer and another specific primer internal to the first one. Products of each round of PCR are transcribed with an appropriate RNA polymerase and sequenced using reverse transcriptase.
Inverse PCR also can be used to amplify or extend sequences using divergent primers based on a known region (Triglia et al, Nucleic Acids Res. 16, 8186, 1988). Primers can be designed using commercially available software, such as OLIGO 4.06 Primer Analysis software (National Biosciences Inc., Plymouth, Minn.), to be 22-30 nucleotides in length, to have a GC content of 50% or more, and to anneal to the target sequence at temperatures about 68-72 °C. The method uses several restriction enzymes to generate a suitable fragment in the known region of a gene. The fragment is then circularized by intramolecular ligation and used as a PCR template.
Another method which can be used is capture PCR, which involves PCR amplification of DNA fragments adjacent to a known sequence in human and yeast artificial chromosome DNA (Lagerstrom et al, PCR Methods AppHc. 1, 111-119,
1991). In this method, multiple restriction enzyme digestions and ligations also can be used to place an engineered double-stranded sequence into an unknown fragment of the DNA molecule before performing PCR.
Another method which can be used to retrieve unknown sequences is that of Parker et al., Nucleic Acids Res. 19, 3055-3060, 1991). Additionally, PCR, nested primers, and PROMOTERFINDER libraries (CLONTECH, Palo Alto, Calif.) can be used to walk genomic DNA (CLONTECH, Palo Alto, Calif). This process avoids the need to screen libraries and is useful in finding intron exon junctions.
When screening for full-length cDNAs, it is preferable to use libraries that have been size-selected to include larger cDNAs. Randomly-primed libraries are preferable, in that they will contain more sequences which contain the 5' regions of genes. Use of a randomly primed library may be especially preferable for situations in which an oligo d(T) library does not yield a full-length cDNA. Genomic libraries can be useful for extension of sequence into 5' non-transcribed regulatory regions.
Commercially available capillary electrophoresis systems can be used to analyze the size or confirm the nucleotide sequence of PCR or sequencing products. For example, capillary sequencing can employ flowable polymers for electrophoretic separation, four different fluorescent dyes (one for each nucleotide) that are laser activated, and detection of the emitted wavelengths by a charge coupled device camera. Output/light intensity can be converted to electrical signal using appropriate software (e.g. GENOTYPER and Sequence NAVIGATOR, Perkin Elmer), and the entire process from loading of samples to computer analysis and electronic data display can be computer controlled. Capillary electrophoresis is especially preferable for the sequencing of small pieces of DNA that might be present in limited amounts in a particular sample.
Obtaining Polypeptides
Human CRIK polypeptides can be obtained, for example, by purification from human cells, by expression of CRIK polynucleotides, or by direct chemical synthesis.
Protein Purification
Human CRIK polypeptides can be purified from any cell that expresses the polypeptide, including host cells that have been transfected with CRIK expression constructs. A purified CRIK polypeptide is separated from other compounds that normally associate with the CRIK polypeptide in the cell, such as certain proteins, carbohydrates, or lipids, using methods well-known in the art. Such methods include, but are not limited to, size exclusion chromatography, ammonium sulfate fractionation, ion exchange chromatography, affinity chromatography, and preparative gel electrophoresis. A preparation of purified CRLK polypeptides is at least 80%» pure; preferably, the preparations are 90%, 95%, or 99% pure. Purity of the preparations can be assessed by any means known in the art, such as SDS- polyacrylamide gel electrophoresis.
Expression of Polynucleotides
To express a CRIK polynucleotide, the polynucleotide can be inserted into an expression vector that contains the necessary elements for the transcription and translation of the inserted coding sequence. Methods that are well known to those skilled in the art can be used to construct expression vectors containing sequences encoding CRIK polypeptides and appropriate transcriptional and translational control elements. These methods include in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. Such techniques are described, for example, in Sambrook et al. (1989) and in Ausubel et al, CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, N. Y., 1989.
A variety of expression vector/host systems can be utilized to contain and express sequences encoding a CRIK polypeptide. These include, but are not limited to, microorganisms, such as bacteria transformed with recombinant bacteriophage, plasmid, or cosmid DNA expression vectors; yeast transformed with yeast expression vectors, insect cell systems infected with virus expression vectors (e.g., baculovirus), plant cell systems transformed with virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or with bacterial expression vectors (e.g., Ti or pBR322 plasmids), or animal cell systems.
The control elements or regulatory sequences are those non-translated regions of the vector ~ enhancers, promoters, 5' and 3' untranslated regions ~ which interact with host cellular proteins to carry out transcription and translation. Such elements can vary in their strength and specificity. Depending on the vector system and host utilized, any number of suitable transcription and translation elements, including constitutive and inducible promoters, can be used. For example, when cloning in bacterial systems, inducible promoters such as the hybrid lacZ promoter of the BLUESCRLPT phagemid (Stratagene, LaJolla, Calif.) or pSPORTl plasmid (Life Technologies) and the like can be used. The baculovirus polyhedrin promoter can be used in insect cells. Promoters or enhancers derived from the genomes of plant cells (e.g., heat shock, RUBISCO, and storage protein genes) or from plant viruses
(e.g., viral promoters or leader sequences) can be cloned into the vector. In mammalian cell systems, promoters from mammalian genes or from mammalian viruses are preferable. If it is necessary to generate a cell line that contains multiple copies of a nucleotide sequence encoding a CRIK polypeptide, vectors based on SV40 or EBV can be used with an appropriate selectable marker.
Bacterial and Yeast Expression Systems
In bacterial systems, a number of expression vectors can be selected depending upon the use intended for the CRIK polypeptide. For example, when a large quantity of a
CRIK polypeptide is needed for the induction of antibodies, vectors which direct
high level expression of fusion proteins that are readily purified can be used. Such vectors include, but are not limited to, multifunctional E. coli cloning and expression vectors such as BLUESCRIPT (Stratagene). In a BLUESCRIPT vector, a sequence encoding the CRIK polypeptide can be ligated into the vector in frame with sequences for the amino-terminal Met and the subsequent 7 residues of β-galactosidase so that a hybrid protein is produced. pIN vectors (Van Heeke & Schuster, J Biol Chem. 264, 5503-5509, 1989) or pGEX vectors (Promega, Madison, Wis.) also can be used to express foreign polypeptides as fusion proteins with glutathione S-transferase (GST). In general, such fusion proteins are soluble and can easily be purified from lysed cells by adsorption to glutathione-agarose beads followed by elution in the presence of free glutathione. Proteins made in such systems can be designed to include heparin, thrombin, or factor Xa protease cleavage sites so that the cloned polypeptide of interest can be released from the GST moiety at will.
In the yeast Saccharomyces cerevisiae, a number of vectors containing constitutive or inducible promoters such as alpha factor, alcohol oxidase, and PGH can be used. For reviews, see Ausubel et al. (1989) and Grant et al, Methods Enzymol. 153, 516-544, 1987.
Plant and Insect Expression Systems
If plant expression vectors are used, the expression of sequences encoding CRIK polypeptides can be driven by any of a number of promoters. For example, viral promoters such as the 35S and 19S promoters of CaMV can be used alone or in combination with the omega leader sequence from TMV (Takamatsu, EMBO J. 6, 307-311, 1987). Alternatively, plant promoters such as the small subunit of RUBISCO or heat shock promoters can be used (Coruzzi et al, EMBO J. 3, 1671-1680, 1984; Broglie et al, Science 224, 838-843, 1984; Winter et al, Results Probl. Cell Differ. 17, 85-105, 1991). These constructs can be introduced into plant cells by direct DNA transformation or by pathogen-mediated transfection. Such
techniques are described in a number of generally available reviews (e.g., Hobbs or Murray, in MCGRAW HILL YEARBOOK OF SCIENCE AND TECHNOLOGY, McGraw Hill, Ne York, N.Y., pp. 191-196, 1992).
An insect system also can be used to express a CRIK polypeptide. For example, in one such system Autographa californica nuclear polyhedrosis virus (AcNPV) is used as a vector to express foreign genes in Spodoptera frugiperda cells or in Trichoplusia larvae. Sequences encoding CRIK polypeptides can be cloned into a non-essential region of the virus, such as the polyhedrin gene, and placed under control of the polyhedrin promoter. Successful insertion of CRIK polypeptides will render the polyhedrin gene inactive and produce recombinant virus lacking coat protein. The recombinant viruses can then be used to infect S. frugiperda cells or Trichoplusia larvae in which CRIK polypeptides can be expressed (Engelhard et al, Proc. Nat. Acad. Sci. 91, 3224-3227, 1994).
Mammalian Expression Systems
A number of viral-based expression systems can be used to express CRIK polypeptides in mammalian host cells. For example, if an adenovirus is used as an expression vector, sequences encoding CRIK polypeptides can be ligated into an adenovirus transcription translation complex comprising the late promoter and tripartite leader sequence. Insertion in a non-essential El or E3 region of the viral genome can be used to obtain a viable virus that is capable of expressing a CRIK polypeptide in infected host cells (Logan & Shenk, Proc. Natl. Acad. Sci. 81, 3655-3659, 1984). If desired, transcription enhancers, such as the Rous sarcoma virus (RSV) enhancer, can be used to increase expression in mammalian host cells.
Human artificial chromosomes (HACs) also can be used to deliver larger fragments of DNA than can be contained and expressed in a plasmid. HACs of 6M to 10M are constructed and delivered to cells via conventional delivery methods (e.g. , liposomes, polycationic amino polymers, or vesicles).
Specific initiation signals also can be used to achieve more efficient translation of sequences encoding CRIK polypeptides. Such signals include the ATG initiation codon and adjacent sequences. In cases where sequences encoding a CRIK polypeptide, its initiation codon, and upstream sequences are inserted into the appropriate expression vector, no additional transcriptional or translational control signals may be needed. However, in cases where only coding sequence, or a fragment thereof, is inserted, exogenous translational control signals (including the ATG initiation codon) should be provided. The initiation codon should be in the correct reading frame to ensure translation of the entire insert. Exogenous translational elements and initiation codons can be of various origins, both natural and synthetic. The efficiency of expression can be enhanced by the inclusion of enhancers which are appropriate for the particular cell system which is used (see Scharf et al, Results Probl Cell Differ. 20, 125-162, 1994).
Host Cells
A host cell strain can be chosen for its ability to modulate the expression of the inserted sequences or to process the expressed CRIK polypeptide in the desired fashion. Such modifications of the polypeptide include, but are not limited to, acetylation, carboxylation, glycosylation, phosphorylation, lipidation, and acylation. Post-translational processing which cleaves a "prepro" form of the polypeptide also can be used to facilitate correct insertion, folding and/or function. Different host cells that have specific cellular machinery and characteristic mechanisms for post-translational activities (e.g., CHO, HeLa, MDCK, HEK293, and WI38), are available from the American Type Culture Collection (ATCC; 10801 University Boulevard, Manassas, VA 20110-2209) and can be chosen to ensure the correct modification and processing of the foreign protein.
Stable expression is preferred for long-term, high-yield production of recombinant proteins. For example, cell lines which stably express CRIK polypeptides can be
transformed using expression vectors which can contain viral origins of replication and/or endogenous expression elements and a selectable marker gene on the same or on a separate vector. Following the introduction of the vector, cells can be allowed to grow for 1-2 days in an enriched medium before they are switched to a selective medium. The purpose of the selectable marker is to confer resistance to selection, and its presence allows growth and recovery of cells which successfully express the introduced CRLK sequences. Resistant clones of stably transformed cells can be proliferated using tissue culture techniques appropriate to the cell type. See, for example, ANIMAL CELL CULTURE, R.I. Freshney, ed., 1986.
Any number of selection systems can be used to recover transformed cell lines.
These include, but are not limited to, the herpes simplex virus thymidine kinase (Wigler et al, Cell 11, 223-32, 1977) and adenine phosphoribosyltransferase (Lowy et al, Cell 22, 817-23, 1980) genes which can be employed in tk~ or aprf cells, respectively. Also, antimetabolite, antibiotic, or herbicide resistance can be used as the basis for selection. For example, dhfr confers resistance to mefhotrexate (Wigler et al, Proc. Natl. Acad. Sci. 77, 3567-70, 1980), npt confers resistance to the aminoglycosides, neomycin and G-418 (Colbere-Garapin et al, J. Mol. Biol. 150, 1-14, 1981), and als and pat confer resistance to chlorsulfuron and phosphinotricin acetyltransferase, respectively (Murray, 1992, supra). Additional selectable genes have been described. For example, trpB allows cells to utilize indole in place of tryptophan, or hisD, which allows cells to utilize histinol in place of histidine (Hartman & Mulligan, Proc. Natl. Acad. Sci. 85, 8047-51, 1988). Visible markers such as anthocyanins, β-glucuronidase and its substrate GUS, and luciferase and its substrate luciferin, can be used to identify transformants and to quantify the amount of transient or stable protein expression attributable to a specific vector system (Rhodes et al, Methods Mol. Biol 55, 121-131, 1995).
Detecting Expression
Although the presence of marker gene expression suggests that the CRIK polynucleotide is also present, its presence and expression may need to be confirmed. For example, if a sequence encoding a CRIK polypeptide is inserted within a marker gene sequence, transformed cells containing sequences that encode a CRIK polypeptide can be identified by the absence of marker gene function. Alternatively, a marker gene can be placed in tandem with a sequence encoding a CRLK polypeptide under the control of a single promoter. Expression of the marker gene in response to induction or selection usually indicates expression of the CRIK polynucleotide.
Alternatively, host cells which contain a CRIK polynucleotide and which express a CRLK polypeptide can be identified by a variety of procedures known to those of skill in the art. These procedures include, but are not limited to, DNA-DNA or
DNA-RNA hybridizations and protein bioassay or immunoassay techniques that include membrane, solution, or chip-based technologies for the detection and/or quantification of nucleic acid or protein. For example, the presence of a polynucleotide sequence encoding a CRIK polypeptide can be detected by DNA-DNA or DNA-RNA hybridization or amplification using probes or fragments or fragments of polynucleotides encoding a CRIK polypeptide. Nucleic acid amplification-based assays involve the use of oligonucleotides selected from sequences encoding a CRIK polypeptide to detect transformants that contain a CRIK polynucleotide.
A variety of protocols for detecting and measuring the expression of a CRIK polypeptide, using either polyclonal or monoclonal antibodies specific for the polypeptide, are known in the art. Examples include enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), and fluorescence activated cell sorting (FACS). A two-site, monoclonal-based immunoassay using monoclonal antibodies reactive to two non-interfering epitopes on a CRIK polypeptide can be used, or a competitive binding assay can be employed. These and other assays are described in Hampton et
al., SEROLOGICAL METHODS: A LABORATORY MANUAL, APS Press, St. Paul, Minn., 1990) and Maddox et α/., J Exp. Med. 158, 1211-1216, 1983).
A wide variety of labels and conjugation techniques are known by those skilled in the art and can be used in various nucleic acid and amino acid assays. Means for producing labeled hybridization or PCR probes for detecting sequences related to polynucleotides encoding CRIK polypeptides include oligolabeling, nick translation, end-labeling, or PCR amplification using a labeled nucleotide. Alternatively, sequences encoding a CRIK polypeptide can be cloned into a vector for the production of an mRNA probe. Such vectors are known in the art, are commercially available, and can be used to synthesize RNA probes in vitro by addition of labeled nucleotides and an appropriate RNA polymerase such as T7, T3, or SP6. These procedures can be conducted using a variety of commercially available kits (Amersham Pharmacia Biotech, Promega, and US Biochemical). Suitable reporter molecules or labels which can be used for ease of detection include radionuclides, enzymes, and fluorescent, chemiluminescent, or chromogenic agents, as well as substrates, co- factors, inhibitors, magnetic particles, and the like.
Expression and Purification of Polypeptides
Host cells transformed with nucleotide sequences encoding a CRIK polypeptide can be cultured under conditions suitable for the expression and recovery of the protein from cell culture. The polypeptide produced by a transformed cell can be secreted or contained intracellularly depending on the sequence and/or the vector used. As will be understood by those of skill in the art, expression vectors containing polynucleotides which encode CRIK polypeptides can be designed to contain signal sequences which direct secretion of soluble CRIK polypeptides through a prokaryotic or eukaryotic cell membrane or which direct the membrane insertion of membrane- bound CRLK polypeptide.
As discussed above, other constructions can be used to join a sequence encoding a CRIK polypeptide to a nucleotide sequence encoding a polypeptide domain which will facilitate purification of soluble proteins. Such purification facilitating domains include, but are not limited to, metal chelating peptides such as histidine-tryptophan modules that allow purification on immobilized metals, protein A domains that allow purification on immobilized immunoglobulin, and the domain utilized in the FLAGS extension/affinity purification system (Immunex Corp., Seattle, Wash.). Inclusion of cleavable linker sequences such as those specific for Factor Xa or enterokinase (Invitrogen, San Diego, CA) between the purification domain and the CRIK polypeptide also can be used to facilitate purification. One such expression vector provides for expression of a fusion protein containing a CRIK polypeptide and 6 histidine residues preceding a thioredoxin or an enterokinase cleavage site. The histidine residues facilitate purification by TMAC (immobilized metal ion affinity chromatography, as described in Porath et al, Prot. Exp. Purif 3, 263-281, 1992), while the enterokinase cleavage site provides a means for purifying the CRIK polypeptide from the fusion protein. Vectors that contain fusion proteins are disclosed in Kroll et al, DNA Cell Biol. 12, 441-453, 1993.
Chemical Synthesis
Sequences encoding a CRIK polypeptide can be synthesized, in whole or in part, using chemical methods well known in the art (see Carufhers et al, Nucl Acids Res. Symp. Ser. 215-223, 1980; Horn et al. Nucl. Acids Res. Symp. Ser. 225-232, 1980). Alternatively, a CRIK polypeptide itself can be produced using chemical methods to synthesize its amino acid sequence, such as by direct peptide synthesis using solid-phase techniques (Merrifield, J Am. Chem. Soc. 85, 2149-2154, 1963; Roberge et al, Science 269, 202-204, 1995). Protein synthesis can be performed using manual techniques or by automation. Automated synthesis can be achieved, for example, using Applied Biosystems 431 A Peptide Synthesizer (Perkin Elmer). Optionally, fragments of CRIK polypeptides can be separately synthesized and combined using chemical methods to produce a full-length molecule.
The newly synthesized peptide can be substantially purified by preparative high performance liquid chromatography (e.g., Creighton, PROTEINS: STRUCTURES AND MOLECULAR PRINCIPLES, WH Freeman and Co., New York, N.Y., 1983). The composition of a synthetic CRIK polypeptide can be confirmed by amino acid analysis or sequencing (e.g., the Edman degradation procedure; see Creighton, supra). Additionally, any portion of the amino acid sequence of the CRIK polypeptide can be altered during direct synthesis and/or combined using chemical methods with sequences from other proteins to produce a variant polypeptide or a fusion protein.
Production of Altered Polypeptides
As will be understood by those of skill in the art, it may be advantageous to produce CRIK polypeptide-encoding nucleotide sequences possessing non-naturally occurring codons. For example, codons preferred by a particular prokaryotic or eukaryotic host can be selected to increase the rate of protein expression or to produce an RNA transcript having desirable properties, such as a half-life that is longer than that of a transcript generated from the naturally occurring sequence.
The nucleotide sequences disclosed herein can be engineered using methods generally known in the art to alter CRIK polypeptide-encoding sequences for a variety of reasons, including but not limited to, alterations which modify the cloning, processing, and/or expression of the polypeptide or mRNA product. DNA shuffling by random fragmentation and PCR reassembly of gene fragments and synthetic oligonucleotides can be used to engineer the nucleotide sequences. For example, site-directed mutagenesis can be used to insert new restriction sites, alter glycosylation patterns, change codon preference, produce splice variants, introduce mutations, and so forth.
Antibodies
Any type of antibody known in the art can be generated to bind specifically to an epitope of a CRIK polypeptide. "Antibody" as used herein includes intact immuno- globulin molecules, as well as fragments thereof, such as Fab, F(ab')2, and Fv, which are capable of binding an epitope of a CRLK polypeptide. Typically, at least 6, 8, 10, or 12 contiguous amino acids are required to form an epitope. However, epitopes which involve non-contiguous amino acids may require more, e.g., at least 15, 25, or 50 amino acids.
An antibody which specifically binds to an epitope of a CRIK polypeptide can be used therapeutically, as well as in immunochemical assays, such as Western blots, ELISAs, radioimmunoassays, immunohistochemical assays, immunoprecipitations, or other immunochemical assays known in the art. Various immunoassays can be used to identify antibodies having the desired specificity. Numerous protocols for competitive binding or immunoradiometric assays are well known in the art. Such immunoassays typically involve the measurement of complex formation between an immunogen and an antibody that specifically binds to the immunogen.
Typically, an antibody which specifically binds to a CRIK polypeptide provides a detection signal at least 5-, 10-, or 20-fold higher than a detection signal provided with other proteins when used in an immunochemical assay. Preferably, antibodies which specifically bind to CRLK polypeptides do not detect other proteins in immunochemical assays and can immunoprecipitate a CRIK polypeptide from solution.
Human CRIK polypeptides can be used to immunize a mammal, such as a mouse, rat, rabbit, guinea pig, monkey, or human, to produce polyclonal antibodies. If desired, a CRIK polypeptide can be conjugated to a carrier protein, such as bovine serum albumin, thyroglobulin, and keyhole limpet hemocyanin. Depending on the host species, various adjuvants can be used to increase the immunological response.
Such adjuvants include, but are not limited to, Freund's adjuvant, mineral gels (e.g., aluminum hydroxide), and surface active substances (e.g. lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, and dinitrophenol). Among adjuvants used in humans, BCG (bacilli Calmette-Gueriή) and Corynebαcterium pαrvum are especially useful.
Monoclonal antibodies that specifically bind to a CRIK polypeptide can be prepared using any technique which provides for the production of antibody molecules by continuous cell lines in culture. These techniques include, but are not limited to, the hybridoma technique, the human B-cell hybridoma technique, and the
EBV-hybridoma technique (Kohler et αl, Nature 256, 495-497, 1985; Kozbor et al, J. Immunol. Methods 81, 31-42, 1985; Cote et al, Proc. Natl. Acad. Sci. 80, 2026-2030, 1983; Cole et al, Mol. Cell Biol. 62, 109-120, 1984).
In addition, techniques developed for the production of "chimeric antibodies," the splicing of mouse antibody genes to human antibody genes to obtain a molecule with appropriate antigen specificity and biological activity, can be used (Morrison et al, Proc. Natl. Acad. Sci. 81, 6851-6855, 1984; Neuberger et al, Nature 312, 604-608, 1984; Takeda et al, Nature 314, 452-454, 1985). Monoclonal and other antibodies also can be "humanized" to prevent a patient from mounting an immune response against the antibody when it is used therapeutically. Such antibodies may be sufficiently similar in sequence to human antibodies to be used directly in therapy or may require alteration of a few key residues. Sequence differences between rodent antibodies and human sequences can be minimized by replacing residues which differ from those in the human sequences by site directed mutagenesis of individual residues or by grating of entire complementarity determining regions. Alternatively, humanized antibodies can be produced using recombinant methods, as described in GB2188638B. Antibodies that specifically bind to a CRLK polypeptide can contain antigen binding sites which are either partially or fully humanized, as disclosed in U.S. 5,565,332.
Alternatively, techniques described for the production of single chain antibodies can be adapted using methods known in the art to produce single chain antibodies that specifically bind to CRIK polypeptides. Antibodies with related specificity, but of distinct idiotypic composition, can be generated by chain shuffling from random combinatorial immunoglobin libraries (Burton, Proc. Natl Acad. Sci. 88, 11120-23,
1991).
Single-chain antibodies also can be constructed using a DNA amplification method, such as PCR, using hybridoma cDNA as a template (Thirion et al, 1996, Eur. J. Cancer Prev. 5, 507-11). Single-chain antibodies can be mono- or bispecific, and can be bivalent or tetravalent. Construction of tetravalent, bispecific single-chain antibodies is taught, for example, in Coloma & Morrison, 1997, Nat. Biotechnol 15, 159-63. Construction of bivalent, bispecific single-chain antibodies is taught in Mallender & Voss, 1994, J Biol Chem. 269, 199-206.
A nucleotide sequence encoding a single-chain antibody can be constructed using manual or automated nucleotide synthesis, cloned into an expression construct using standard recombinant DNA methods, and introduced into a cell to express the coding sequence, as described below. Alternatively, single-chain antibodies can be produced directly using, for example, filamentous phage technology (Verhaar et al,
1995, Int. J. Cancer 61, 497-501; Nicholls et al, 1993, J Immunol. Meth. 165, 81- 91).
Antibodies which specifically bind to CRIK polypeptides also can be produced by inducing in vivo production in the lymphocyte population or by screening immunoglobulin libraries or panels of highly specific binding reagents as disclosed in the literature (Orlandi et al, Proc. Natl. Acad. Sci. 86, 3833-3837, 1989; Winter et al, Nature 349, 293-299, 1991).
Other types of antibodies can be constructed and used therapeutically in methods of the invention. For example, chimeric antibodies can be constructed as disclosed in
WO 93/03151. Binding proteins which are derived from immunoglobulins and which are multivalent and multispecific, such as the "diabodies" described in WO 94/13804, also can be prepared.
Antibodies according to the invention can be purified by methods well known in the art. For example, antibodies can be affinity purified by passage over a column to which a CRIK polypeptide is bound. The bound antibodies can then be eluted from the column using a buffer with a high salt concentration.
Antisense Oligonucleotides
Antisense oligonucleotides are nucleotide sequences that are complementary to a specific DNA or RNA sequence. Once introduced into a cell, the complementary nucleotides combine with natural sequences produced by the cell to form complexes and block either transcription or translation. Preferably, an antisense oligonucleotide is at least 11 nucleotides in length, but can be at least 12, 15, 20, 25, 30, 35, 40, 45, or 50 or more nucleotides long. Longer sequences also can be used. Antisense oligonucleotide molecules can be provided in a DNA construct and introduced into a cell as described above to decrease the level of CRIK gene products in the cell.
Antisense oligonucleotides can be deoxyribonucleotides, ribonucleotides, or a combination of both. Oligonucleotides can be synthesized manually or by an automated synthesizer, by covalently linking the 5' end of one nucleotide with the 3' end of another nucleotide with non-phosphodiester internucleotide linkages such alkylphosphonates, phosphorothioates, phosphorodithioates, alkylphosphonothioates, alkylphosphonates, phosphoramidates, phosphate esters, carbamates, acetamidate, carboxymethyl esters, carbonates, and phosphate triesters. See Brown, Meth. Mol Biol. 20, 1-8, 1994; Sonveaux, Meth. Mol. Biol. 26, 1-72, 1994; Uhlmann et al, Chem. Rev. 90, 543-583, 1990.
Modifications of CRIK gene expression can be obtained by designing antisense oligonucleotides that will form duplexes to the control, 5', or regulatory regions of the CRLK gene. Oligonucleotides derived from the transcription initiation site, e.g., between positions -10 and +10 from the start site, are preferred. Similarly, inhibition can be achieved using "triple helix" base-pairing methodology. Triple helix pairing is useful because it causes inhibition of the ability of the double helix to open sufficiently for the binding of polymerases, transcription factors, or chaperons. Therapeutic advances using triplex DNA have been described in the literature (e.g., Gee et al., in Huber & Carr, MOLECULAR AND IMMUNOLOGIC APPROACHES, Futura Publishing Co., Mt. Kisco, N.Y., 1994). An antisense oligonucleotide also can be designed to block translation of mRNA by preventing the transcript from binding to ribosomes.
Precise complementarity is not required for successful complex formation between an antisense oligonucleotide and the complementary sequence of a CRIK polynucleotide. Antisense oligonucleotides which comprise, for example, 2, 3, 4, or 5 or more stretches of contiguous nucleotides which are precisely complementary to a CRIK polynucleotide, each separated by a stretch of contiguous nucleotides which are not complementary to adjacent CRIK nucleotides, can provide sufficient targeting specificity for CRIK mRNA. Preferably, each stretch of complementary contiguous nucleotides is at least 4, 5, 6, 7, or 8 or more nucleotides in length. Non- complementary intervening sequences are preferably 1, 2, 3, or 4 nucleotides in length. One skilled in the art can easily use the calculated melting point of an antisense-sense pair to determine the degree of mismatching which will be tolerated between a particular antisense oligonucleotide and a particular CRIK polynucleotide sequence.
Antisense oligonucleotides can be modified without affecting their ability to hybridize to a CRIK polynucleotide. These modifications can be internal or at one or both ends of the antisense molecule. For example, internucleoside phosphate linkages can be modified by adding cholesteryl or diamine moieties with varying
numbers of carbon residues between the amino groups and terminal ribose. Modified bases and/or sugars, such as arabinose instead of ribose, or a 3', 5 '-substituted oligonucleotide in which the 3' hydroxyl group or the 5' phosphate group are substituted, also can be employed in a modified antisense oligonucleotide. These modified oligonucleotides can be prepared by methods well known in the art. See, e.g., Agrawal et al, Trends Biotechnol. 10, 152-158, 1992; Uhlmann et al, Chem. Rev. 90, 543-584, 1990; Uhlmann et al, Tetrahedron. Lett. 215, 3539-3542, 1987.
Ribozymes
Ribozymes are RNA molecules with catalytic activity. See, e.g., Cech, Science 236, 1532-1539; 1987; Cech, Ann. Rev. Biochem. 59, 543-568; 1990, Cech, Curr. Opin. Struct. Biol. 2, 605-609; 1992, Couture & Stinchcomb, Trends Genet. 12, 510-515, 1996. Ribozymes can be used to inhibit gene function by cleaving an RNA sequence, as is known in the art (e.g., Haseloff et al, U.S. Patent 5,641,673). The mechanism of ribozyme action involves sequence-specific hybridization of the ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage. Examples include engineered hammerhead motif ribozyme molecules that can specifically and efficiently catalyze endonucleolytic cleavage of specific nucleotide sequences.
The coding sequence of a CRIK polynucleotide can be used to generate ribozymes that will specifically bind to mRNA transcribed from the CRIK polynucleotide. Methods of designing and constructing ribozymes which can cleave other RNA molecules in trans in a highly sequence specific manner have been developed and described in the art (see Haseloff et al. Nature 334, 585-591, 1988). For example, the cleavage activity of ribozymes can be targeted to specific RNAs by engineering a discrete "hybridization" region into the ribozyme. The hybridization region contains a sequence complementary to the target RNA and thus specifically hybridizes with the target (see, for example, Gerlach et al, EP 321,201).
Specific ribozyme cleavage sites within a CRLK RNA target can be identified by scanning the target molecule for ribozyme cleavage sites which include the following sequences: GUA, GUU, and GUC. Once identified, short RNA sequences of between 15 and 20 ribonucleotides corresponding to the region of the target RNA containing the cleavage site can be evaluated for secondary structural features which may render the target inoperable. Suitability of candidate CRIK RNA targets also can be evaluated by testing accessibility to hybridization with complementary oligonucleotides using ribonuclease protection assays. Longer complementary sequences can be used to increase the affinity of the hybridization sequence for the target. The hybridizing and cleavage regions of the ribozyme can be integrally related such that upon hybridizing to the target RNA through the complementary regions, the catalytic region of the ribozyme can cleave the target.
Ribozymes can be introduced into cells as part of a DNA construct. Mechanical methods, such as microinjection, liposome-mediated transfection, electroporation, or calcium phosphate precipitation, can be used to introduce a ribozyme-containing DNA construct into cells in which it is desired to decrease CRIK expression. Alternatively, if it is desired that the cells stably retain the DNA construct, the construct can be supplied on a plasmid and maintained as a separate element or integrated into the genome of the cells, as is known in the art. A ribozyme-encoding
DNA construct can include transcriptional regulatory elements, such as a promoter element, an enhancer or UAS element, and a transcriptional terminator signal, for controlling transcription of ribozymes in the cells.
As taught in Haseloff et al, U.S. Patent 5,641,673, ribozymes can be engineered so that ribozyme expression will occur in response to factors that induce expression of a target gene. Ribozymes also can be engineered to provide an additional level of regulation, so that destruction of mRNA occurs only when both a ribozyme and a target gene are induced in the cells.
Differentially Expressed Genes
Described herein are methods for the identification of genes whose products interact with human CRIK. Such genes may represent genes that are differentially expressed in disorders including, but not limited to, obesity, CNS disorders, and COPD.
Further, such genes may represent genes that are differentially regulated in response to manipulations relevant to the progression or treatment of such diseases. Additionally, such genes may have a temporally modulated expression, increased or decreased at different stages of tissue or organism development. A differentially expressed gene may also have its expression modulated under control versus experimental conditions. In addition, the human CRIK gene or gene product may itself be tested for differential expression.
The degree to which expression differs in a normal versus a diseased state need only be large enough to be visualized via standard characterization techniques such as differential display techniques. Other such standard characterization techniques by which expression differences may be visualized include but are not limited to, quantitative RT (reverse transcriptase), PCR, and Northern analysis.
Identification of Differentially Expressed Genes
To identify differentially expressed genes total RNA or, preferably, mRNA is isolated from tissues of interest. For example, RNA samples are obtained from tissues of experimental subjects and from corresponding tissues of control subjects. Any RNA isolation technique that does not select against the isolation of mRNA may be utilized for the purification of such RNA samples. See, for example, Ausubel et al., ed., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, Inc. New York, 1987-1993. Large numbers of tissue samples may readily be processed using techniques well known to those of skill in the art, such as, for example, the single-step RNA isolation process of Chomczynski, U.S. Patent 4,843,155.
Transcripts within the collected RNA samples that represent RNA produced by differentially expressed genes are identified by methods well known to those of skill in the art. They include, for example, differential screening (Tedder et al., Proc. Natl. Acad. Sci. U.S.A. 85, 208-12, 1988), subtractive hybridization (Hedrick et al, Nature 308, 149-53; Lee et al, Proc. Natl. Acad. Sci. U.S.A. 88, 2825, 1984), and, preferably, differential display (Liang & Pardee, Science 257, 967-71, 1992; U.S. Patent 5,262,311).
The differential expression information may itself suggest relevant methods for the treatment of disorders involving the human CRIK. For example, treatment may include a modulation of expression of the differentially expressed genes and/or the gene encoding the human CROC. The differential expression information may indicate whether the expression or activity of the differentially expressed gene or gene product or the human CRIK gene or gene product are up-regulated or down- regulated.
Screening Methods
The invention provides assays for screening test compounds that bind to or modulate the activity of a CRIK polypeptide or a CRIK polynucleotide. A test compound preferably binds to a CRTK polypeptide or polynucleotide. More preferably, a test compound decreases or increases enzymatic activity by at least about 10, preferably about 50, more preferably about 75, 90, or 100% relative to the absence of the test compound.
Test Compounds
Test compounds can be pharmacologic agents already known in the art or can be compounds previously unknown to have any pharmacological activity. The compounds can be naturally occurring or designed in the laboratory. They can be isolated from microorganisms, animals, or plants, and can be produced
recombinantly, or synthesized by chemical methods known in the art. If desired, test compounds can be obtained using any of the numerous combinatorial library methods known in the art, including but not limited to, biological libraries, spatially addressable parallel solid phase or solution phase libraries, synthetic library methods requiring deconvolution, the "one-bead one-compound" library method, and synthetic library methods using affinity chromatography selection. The biological library approach is limited to polypeptide libraries, while the other four approaches are applicable to polypeptide, non-peptide oligomer, or small molecule libraries of compounds. See Lam, Anticancer Drug Des. 12, 145, 1997.
Methods for the synthesis of molecular libraries are well known in the art (see, for example, DeWitt et al, Proc. Natl. Acad. Sci. U.S.A. 90, 6909, 1993; Erb et al. Proc. Natl. Acad. Sci. U.S.A. 91, 11422, 1994; Zuckermann et al, J. Med. Chem. 37, 2618, 1994; Cho et al, Science 261, 1303, 1993; Carell et al, Angew. Chem. Int. Ed. Engl. 33, 2059, 1994; Carell et al, Angew. Chem. Int. Ed. Engl. 33, 2061; Gallop et al, J.
Med. Chem. 37, 1233, 1994). Libraries of compounds can be presented in solution (see, e.g., Houghten, BioTechniques 13, 412-421, 1992), or on beads (Lam, Nature 354, 82-84, 1991), chips (Fodor, Nature 364, 555-556, 1993), bacteria or spores (Ladner, U.S. Patent 5,223,409), plasmids (Cull et al, Proc. Natl Acad. Sci. U.S.A. 89, 1865-1869, 1992), or phage (Scott & Smith, Science 249, 386-390, 1990; Devlin,
Science 249, 404-406, 1990); Cwirla et al, Proc. Natl. Acad. Sci. 97, 6378-6382, 1990; Felici, J Mol. Biol. 222, 301-310, 1991; and Ladner, U.S. Patent 5,223,409).
High Throughput Screening
Test compounds can be screened for the ability to bind to CRIK polypeptides or polynucleotides or to affect CRIK activity or CRIK gene expression using high throughput screening. Using high throughput screening, many discrete compounds can be tested in parallel so that large numbers of test compounds can be quickly screened. The most widely established techniques utilize 96-well microtiter plates.
The wells of the microtiter plates typically require assay volumes that range from 50
to 500 μl. In addition to the plates, many instruments, materials, pipettors, robotics, plate washers, and plate readers are commercially available to fit the 96-well format.
Alternatively, "free format assays," or assays that have no physical barrier between samples, can be used. For example, an assay using pigment cells (melanocytes) in a simple homogeneous assay for combinatorial peptide libraries is described by Jayawickreme et al, Proc. Natl. Acad. Sci. U.S.A. 19, 1614-18 (1994). The cells are placed under agarose in petri dishes, then beads that carry combinatorial compounds are placed on the surface of the agarose. The combinatorial compounds are partially released the compounds from the beads. Active compounds can be visualized as dark pigment areas because, as the compounds diffuse locally into the gel matrix, the active compounds cause the cells to change colors.
Another example of a free format assay is described by Chelsky, "Strategies for Screening Combinatorial Libraries: Novel and Traditional Approaches," reported at the First Annual Conference of The Society for Biomolecular Screening in Philadelphia, Pa. (Nov. 7-10, 1995). Chelsky placed a simple homogenous enzyme assay for carbonic anhydrase inside an agarose gel such that the enzyme in the gel would cause a color change throughout the gel. Thereafter, beads carrying combinatorial compounds via a photolinker were placed inside the gel and the compounds were partially released by UV-light. Compounds that inhibited the enzyme were observed as local zones of inhibition having less color change.
Yet another example is described by Salmon et al, Molecular Diversity 2, 57-63 (1996). In this example, combinatorial libraries were screened for compounds that had cytotoxic effects on cancer cells growing in agar.
Another high throughput screening method is described in Beutel et al, U.S. Patent
5,976,813. In this method, test samples are placed in a porous matrix. One or more assay components are then placed within, on top of, or at the bottom of a matrix such as a gel, a plastic sheet, a filter, or other form of easily manipulated solid support.
When samples are introduced to the porous matrix they diffuse sufficiently slowly, such that the assays can be performed without the test samples running together.
Binding Assays
For binding assays, the test compound is preferably a small molecule that binds to and occupies, for example, the active site of the CRIK polypeptide, such that normal biological activity is prevented. Examples of such small molecules include, but are not limited to, small peptides or peptide-like molecules.
In binding assays, either the test compound or the CRIK polypeptide can comprise a detectable label, such as a fluorescent, radioisotopic, chemiluminescent, or enzymatic label, such as horseradish peroxidase, alkaline phosphatase, or luciferase. Detection of a test compound that is bound to the CRIK polypeptide can then be accomplished, for example, by direct counting of radioemmission, by scintillation counting, or by determining conversion of an appropriate substrate to a detectable product.
Alternatively, binding of a test compound to a CRIK polypeptide can be determined without labeling either of the interactants. For example, a microphysiometer can be used to detect binding of a test compound with a CRIK polypeptide. A microphysiometer (e.g., Cytosensor™) is an analytical instrument that measures the rate at which a cell acidifies its environment using a light-addressable potentiometric sensor (LAPS). Changes in this acidification rate can be used as an indicator of the interaction between a test compound and a CRIK polypeptide (McConnell et al, Science 257, 1906-1912, 1992).
Determining the ability of a test compound to bind to a CRIK polypeptide also can be accomplished using a technology such as real-time Bimolecular interaction Analysis (BIA) (Sjolander & Urbaniczky, Anal. Chem. 63, 2338-2345, 1991, and Szabo et al, Curr. Opin. Struct. Biol. 5, 699-705, 1995). BIA is a technology for studying biospecific interactions in real time, without labeling any of the interactants
(e.g., BIAcore™). Changes in the optical phenomenon surface plasmon resonance (SPR) can be used as an indication of real-time reactions between biological molecules.
In yet another aspect of the invention, a CRIK polypeptide can be used as a "bait protein" in a two-hybrid assay or three-hybrid assay (see, e.g., U.S. Patent 5,283,317; Zervos et al, Cell 72, 223-232, 1993; Madura et al, J. Biol. Chem. 268, 12046-12054, 1993; Barrel et al, BioTechniques 14, 920-924, 1993; Iwabuchi et al, Oncogene 8, 1693-1696, 1993; and Brent W094/10300), to identify other proteins which bind to or interact with the CRIK polypeptide and modulate its activity.
The two-hybrid system is based on the modular nature of most transcription factors, which consist of separable DNA-binding and activation domains. Briefly, the assay utilizes two different DNA constructs. For example, in one construct, polynucleotide encoding a CRIK polypeptide can be fused to a polynucleotide encoding the DNA binding domain of a known transcription factor (e.g., GAL-4). In the other construct a DNA sequence that encodes an unidentified protein ("prey" or "sample") can be fused to a polynucleotide that codes for the activation domain of the known transcription factor. If the "bait" and the "prey" proteins are able to interact in vivo to form an protein-dependent complex, the DNA-binding and activation domains of the transcription factor are brought into close proximity. This proximity allows transcription of a reporter gene (e.g., LacZ), which is operably linked to a transcriptional regulatory site responsive to the transcription factor. Expression of the reporter gene can be detected, and cell colonies containing the functional transcription factor can be isolated and used to obtain the DNA sequence encoding the protein that interacts with the CRIK polypeptide.
It may be desirable to immobilize either the CRLK polypeptide (or polynucleotide) or the test compound to facilitate separation of bound from unbound forms of one or both of the interactants, as well as to accommodate automation of the assay. Thus, either the CRIK polypeptide (or polynucleotide) or the test compound can be bound
to a solid support. Suitable solid supports include, but are not limited to, glass or plastic slides, tissue culture plates, microtiter wells, tubes, silicon chips, or particles such as beads (including, but not limited to, latex, polystyrene, or glass beads). Any method known in the art can be used to attach the enzyme polypeptide (or polynucleotide) or test compomid to a solid support, including use of covalent and non-covalent linkages, passive absorption, or pairs of binding moieties attached respectively to the polypeptide (or polynucleotide) or test compound and the solid support. Test compounds are preferably bound to the solid support in an array, so that the location of individual test compounds can be tracked. Binding of a test compound to a CRIK polypeptide (or polynucleotide) can be accomplished in any vessel suitable for containing the reactants. Examples of such vessels include microtiter plates, test tubes, and microcentrifuge tubes.
In one embodiment, the CRIK polypeptide is a fusion protein comprising a domain that allows the CRIK polypeptide to be bound to a solid support. For example, glutathione-S-transferase fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis, Mo.) or glutathione derivatized microtiter plates, which are then combined with the test compound or the test compound and the non-adsorbed CRIK polypeptide; the mixture is then incubated under conditions conducive to complex formation (e.g., at physiological conditions for salt and pH).
Following incubation, the beads or microtiter plate wells are washed to remove any unbound components. Binding of the interactants can be determined either directly or indirectly, as described above. Alternatively, the complexes can be dissociated from the solid support before binding is determined.
Other techniques for immobilizing proteins or polynucleotides on a solid support also can be used in the screening assays of the invention. For example, either a CRIK polypeptide (or polynucleotide) or a test compound can be immobilized utilizing conjugation of biotin and streptavidin. Biotinylated CRLK polypeptides (or poly- nucleotides) or test compounds can be prepared from biotin-NHS(N-hydroxy- succinimide) using techniques well known in the art (e.g., biotinylation kit, Pierce
Chemicals, Rockford, 111.) and immobilized in the wells of streptavidin-coated 96 well plates (Pierce Chemical). Alternatively, antibodies which specifically bind to a CRIK polypeptide, polynucleotide, or a test compound, but which do not interfere with a desired binding site, such as the active site of the CRIK polypeptide, can be derivatized to the wells of the plate. Unbound target or protein can be trapped in the wells by antibody conjugation.
Methods for detecting such complexes, in addition to those described above for the GST-immobilized complexes, include immunodetection of complexes using antibodies which specifically bind to the CRIK polypeptide or test compound, enzyme-linked assays which rely on detecting an activity of the CRIK polypeptide, and SDS gel electrophoresis under non-reducing conditions.
Screening for test compounds which bind to a CRIK polypeptide or polynucleotide also can be carried out in an intact cell. Any cell which comprises a CRIK polypeptide or polynucleotide can be used in a cell-based assay system. A CRIK polynucleotide can be naturally occurring in the cell or can be introduced using techniques such as those described above. Binding of the test compound to a CRIK polypeptide or polynucleotide is determined as described above.
Enzyme Assays
Test compounds can be tested for the ability to increase or decrease the enzymatic activity of a human CRIK polypeptide. Enzymatic activity can be measured, for example, as described in Di Cunto et al, J Biol Chem. 1998 Nov 6;273(45):29706-
11.
Enzyme assays can be carried out after contacting either a purified CRIK polypeptide, a cell membrane preparation, or an intact cell with a test compound. A test compound that decreases an enzymatic activity of a CRLK polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% is identified as
a potential therapeutic agent for decreasing CRIK activity. A test compound which increases an enzymatic activity of a human CRIK polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% is identified as a potential therapeutic agent for increasing human CRIK activity.
Gene Expression
In another embodiment, test compounds that increase or decrease CRIK gene expression are identified. A CRIK polynucleotide is contacted with a test compound, and the expression of an RNA or polypeptide product of the CRIK polynucleotide is determined. The level of expression of appropriate mRNA or polypeptide in the presence of the test compound is compared to the level of expression of mRNA or polypeptide in the absence of the test compound. The test compound can then be identified as a modulator of expression based on this comparison. For example, when expression of mRNA or polypeptide is greater in the presence of the test compound than in its absence, the test compound is identified as a stimulator or enhancer of the mRNA or polypeptide expression. Alternatively, when expression of the mRNA or polypeptide is less in the presence of the test compound than in its absence, the test compound is identified as an inhibitor of the mRNA or polypeptide expression.
The level of CRIK mRNA or polypeptide expression in the cells can be determined by methods well known in the art for detecting mRNA or polypeptide. Either qualitative or quantitative methods can be used. The presence of polypeptide products of a CRIK polynucleotide can be determined, for example, using a variety of techniques known in the art, including immunochemical methods such as radioimmunoassay, Western blotting, and immunohistochemistry. Alternatively, polypeptide synthesis can be determined in vivo, in a cell culture, or in an in vitro translation system by detecting incorporation of labeled amino acids into a CRIK polypeptide.
Such screening can be carried out either in a cell-free assay system or in an intact cell. Any cell that expresses a CRLK polynucleotide can be used in a cell-based assay system. The CRIK polynucleotide can be naturally occurring in the cell or can be introduced using techniques such as those described above. Either a primary culture or an established cell line, such as CHO or human embryonic kidney 293 cells, can be used.
Pharmaceutical Compositions
The invention also provides pharmaceutical compositions that can be administered to a patient to achieve a therapeutic effect. Pharmaceutical compositions of the invention can comprise, for example, a CRLK polypeptide, CRLK polynucleotide, ribozymes or antisense oligonucleotides, antibodies which specifically bind to a CRIK polypeptide, or mimetics, activators, or inhibitors of a CRIK polypeptide activity. The compositions can be administered alone or in combination with at least one other agent, such as stabilizing compound, which can be admimstered in any sterile, biocompatible pharmaceutical carrier, including, but not limited to, saline, buffered saline, dextrose, and water. The compositions can be administered to a patient alone, or in combination with other agents, drugs or hormones.
In addition to the active ingredients, these pharmaceutical compositions can contain suitable pharmaceutically-acceptable carriers comprising excipients and auxiliaries that facilitate processing of the active compounds into preparations which can be used pharmaceutically. Pharmaceutical compositions of the invention can be administered by any number of routes including, but not limited to, oral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, intraventricular, transdermal, subcutaneous, intraperitoneal, intranasal, parenteral, topical, sublingual, or rectal means. Pharmaceutical compositions for oral administration can be formulated using pharmaceutically acceptable carriers well known in the art in dosages suitable for oral administration. Such carriers enable the pharmaceutical compositions to be
formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for ingestion by the patient.
Pharmaceutical preparations for oral use can be obtained through combination of active compounds with solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores. Suitable excipients are carbohydrate or protein fillers, such as sugars, including lactose, sucrose, mannitol, or sorbitol; starch from corn, wheat, rice, potato, or other plants; cellulose, such as methyl cellulose, hydroxy- propylmethyl-cellulose, or sodium carboxymethylcellulose; gums including arabic and tragacanth; and proteins such as gelatin and collagen. If desired, disintegrating or solubilizing agents can be added, such as the cross-linked polyvinyl pyrrolidone, agar, alginic acid, or a salt thereof, such as sodium alginate.
Dragee cores can be used in conjunction with suitable coatings, such as concentrated sugar solutions, which also can contain gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures. Dyestuffs or pigments can be added to the tablets or dragee coatings for product identification or to characterize the quantity of active compound, i. e. , dosage.
Pharmaceutical preparations that can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a coating, such as glycerol or sorbitol. Push-fit capsules can contain active ingredients mixed with a filler or binders, such as lactose or starches, lubricants, such as talc or magnesium stearate, and, optionally, stabilizers. In soft capsules, the active compounds can be dissolved or suspended in suitable liquids, such as fatty oils, liquid, or liquid polyethylene glycol with or without stabilizers.
Pharmaceutical formulations suitable for parenteral administration can be formulated in aqueous solutions, preferably in physiologically compatible buffers such as
Hanks' solution, Ringer's solution, or physiologically buffered saline. Aqueous injection suspensions can contain substances that increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Additionally, suspensions of the active compounds can be prepared as appropriate oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes. Non-lipid polycationic amino polymers also can be used for delivery. Optionally, the suspension also can contain suitable stabilizers or agents that increase the solubility of the compounds to allow for the preparation of highly concentrated solutions. For topical or nasal administration, penetrants appropriate to the particular barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
The pharmaceutical compositions of the present invention can be manufactured in a manner that is known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping, or lyophilizing processes. The pharmaceutical composition can be provided as a salt and can be formed with many acids, including but not limited to, hydrochloric, sulfuric, acetic, lactic, tartaric, malic, succinic, etc. Salts tend to be more soluble in aqueous or other protonic solvents than are the corresponding free base forms. In other cases, the preferred preparation can be a lyophilized powder which can contain any or all of the following: 1-50 mM histidine, 0.1%-2% sucrose, and 2-7% mannitol, at a pH range of 4.5 to 5.5, that is combined with buffer prior to use.
Further details on techniques for formulation and administration can be found in the latest edition of REMINGTON'S PHARMACEUTICAL SCIENCES (Maack Publishing Co., Easton, Pa.). After pharmaceutical compositions have been prepared, they can be placed in an appropriate container and labeled for treatment of an indicated condition. Such labeling would include amount, frequency, and method of administration.
Therapeutic Indications and Methods
Human CRIK can be regulated to treat obesity, CNS disorders, and COPD.
Obesity. Obesity and overweight are defined as an excess of body fat relative to lean body mass. An increase in caloric intake or a decrease in energy expenditure or both can bring about this imbalance leading to surplus energy being stored as fat. Obesity is associated with important medical morbidities and an increase in mortality. The causes of obesity are poorly understood and may be due to genetic factors, environmental factors or a combination of the two to cause a positive energy balance.
In contrast, anorexia and cachexia are characterized by an imbalance in energy intake versus energy expenditure leading to a negative energy balance and weight loss. Agents that either increase energy expenditure and/or decrease energy intake, absorption or storage would be useful for treating obesity, overweight, and associated comorbidities. Agents that either increase energy intake and/or decrease energy expenditure or increase the amount of lean tissue would be useful for treating cachexia, anorexia and wasting disorders.
This gene, translated proteins and agents which modulate this gene or portions of the gene or its products are useful for treating obesity, overweight, anorexia, cachexia, wasting disorders, appetite suppression, appetite enhancement, increases or decreases in satiety, modulation of body weight, and/or other eating disorders such as bulimia.
Also this gene, translated proteins and agents which modulate this gene or portions of the gene or its products are useful for treating obesity/overweight-associated comorbidities including hypertension, type 2 diabetes, coronary artery disease, hyperhpidemia, stroke, gallbladder disease, gout, osteoarthritis, sleep apnea and respiratory problems, some types of cancer including endometrial, breast, prostate, and colon cancer, thrombolic disease, polycystic ovarian syndrome, reduced fertility, complications of pregnancy, menstrual irregularities, hirsutism, stress incontinence, and depression.
The hypothalamus has been considered as the feeding control center. Many neuro- peptides, hormones, neurotransmitters, etc. that play important roles in he control of energy homoeostasis have been identified in the hypothalamus. See J Lip. Res. 40, 1735-46, 1999; Pharm. Rev. 52, 35-61, 2000. Leptin signaling pathway, MC4, and 5-HT2C systems in the hypothalamus play critical roles in the control of body weight homeostasis. Therefore, a gene selectively expressed in the hypothalamus, such as the human CRIK of the invention, is a potential obesity target.
CNS disorders. Central and peripheral nervous system disorders also can be treated, such as primary and secondary disorders after brain injury, disorders of mood, anxiety disorders, disorders of thought and volition, disorders of sleep and wakefulness, diseases of the motor unit, such as neurogenic and myopathic disorders, neurodegenerative disorders such as Alzheimer's and Parkinson's disease, and processes of peripheral and chronic pain.PAR.Pain that is associated with CNS disorders also can be treated by regulating the activity of human CRIK. Pain which can be treated includes that associated with central nervous system disorders, such as multiple sclerosis, spinal cord injury, sciatica, failed back surgery syndrome, traumatic brain injury, epilepsy, Parkinson's disease, post-stroke, and vascular lesions in the brain and spinal cord (e.g., infarct, hemorrhage, vascular malformation). Non-central neuropathic pain includes that associated with post mastectomy pain, reflex sympathetic dystrophy (RSD), trigeminal neuralgia- radioculopathy, post-surgical pain, HIV/ AIDS related pain, cancer pain, metabolic neuropathies (e.g., diabetic neuropathy, vasculitic neuropathy secondary to connective tissue disease), paraneoplastic polyneuropathy associated, for example, with carcinoma of lung, or leukemia, or lymphoma, or carcinoma of prostate, colon or stomach, trigeminal neuralgia, cranial neuralgias, and post-herpetic neuralgia. Pain associated with cancer and cancer treatment also can be treated, as can headache pain (for example, migraine with aura, migraine without aura, and other migraine disorders), episodic and chronic tension-type headache, tension-type like headache, cluster headache, and chronic paroxysmal hemicrania.
COPD. Chronic obstructive pulmonary (or airways) disease (COPD) is a condition defined physiologically as airflow obstruction that generally results from a mixture of emphysema and peripheral airway obstruction due to chronic bronchitis (Senior & Shapiro, Pulmonary Diseases and Disorders, 3d ed., New York, McGraw-Hill, 1998, pp. 659-681, 1998; Barnes, Chest 117, 10S-14S, 2000). Emphysema is characterized by destruction of alveolar walls leading to abnormal enlargement of the air spaces of the lung. Chronic bronchitis is defined clinically as the presence of chronic productive cough for three months in each of two successive years. In COPD, airflow obstruction is usually progressive and is only partially reversible. By far the most important risk factor for development of COPD is cigarette smoking, although the disease does occur in non-smokers.
Chronic inflammation of the airways is a key pathological feature of COPD (Senior & Shapiro, 1998). The inflammatory cell population comprises increased numbers of macrophages, neutrophils, and CD8 lymphocytes. Inhaled irritants, such as cigarette smoke, activate macrophages which are resident in the respiratory tract, as well as epithelial cells leading to release of chemokines (e.g., interleukin-8) and other chemotactic factors. These chemotactic factors act to increase the neutro- phil/monocyte trafficking from the blood into the lung tissue and airways. Neutrophils and monocytes recruited into the airways can release a variety of potentially damaging mediators such as proteolytic enzymes and reactive oxygen species. Matrix degradation and emphysema, along with airway wall thickening, surfactant dysfunction, and mucus hypersecretion, all are potential sequelae of this inflammatory response that lead to impaired airflow and gas exchange.
Protein kinases are signal transducing enzymes that phosphorylate proteins, including other kinases, and, along with protein phosphatases, regulate the level and extent of protein phosphorylation and activation. Intracellular signalling pathways have important roles in inflammatory processes. These pathways may be activated by cytokines, oxidant stress and other inflammatory mediators (reviewed in Kyraikis and Avruch, 1996 and 2001). For example, the pro-inflammatory cytokines, tumor
necrosis factor α (TNFα) and interleukin-1 activate the protein ser/thr kinases c-Jun- NH2-terminal kinase (JNK) and p38 mitogen-activated protein (MAP) kinase, leading to activation of AP-1 and 1KB kinase (IKK), which, in turn, leads to activation of the transcription factor NFKB. Activation of NFKB is required for the transcription of several pro-inflammatory molecules, including interleukin-8 and
ICAM-1. Enzymes of the MAP kinase class may also act to increase cytokine production by stabilization of mRNA (Winzen et al, 1999).
Inhibition of specific protein kinases has been shown to elicit anti-inflammatory effects. For example, the accumulation of polymorphonuclear leukocytes in murine lung following intratracheal administration of bacterial lipopolysaccharide can be blocked by inhibition of p38 MAP kinase (Nick, et al. 2000). As a further example, aerosol delivery to rat lungs of antisense oligodeoxynucleotides to syk kinase mRNA, suppressed nitric oxide and TNFα production from alveolar macrophages stimulated with IgG-anti-IgG complexes (Stenton et al. 2000). Protein kinase subtypes are therefore attractive therapeutic targets for the attenuation of the inflammatory response in COPD. See Kyriakis, J.M. and Avrach J. Sounding the alarm: protein kinase cascades activated by stress and inflammation. J Biol Chem 1996, 271:24313-6; Kyriakis, J.M. and Avruch, J. Mammalian mitogen-activated protein kinase signal transduction pathways activated by stress and inflammation. J.
Physiol. Rev. 2001, 81:807-69; Winzen, R., Kracht, M., Ritter, B., Wilhelm, A, Chen C.A., Shyu, A., Muller, M., Gaestel, M., Resch, K., and Holtmann, H. The p38 MAP kinase pathway signals for cytokine-induced mRNA stabilization via MAP kinase-activated protein kinase 2 and an AU-rich region-targeted mechanism. EMBO J. 1999, 18: 4969-4980; Nick, J.A., Young, S.K., Brown, K.K., Avdi, NJ., Arndt,
P.G., Suratt, B.T., Janes, M.S., Henson, P.M., Worthen, G.S. Role of p38 mitogen- activated protein kinase in a murine model of pulmonary inflammation. J Immunol. 2000, 164:2151-9; and Stenton, G.R., Kim, M.K., Nohara, O., Chen, C.F., Hirji, N., Wills, F.L., Gilchrist, M., Hwang, P.H., Park, J.G., Finlay, W., Jones, R.L., Befus, A.D., Schreiber, A.D. Aerosolized Syk antisense suppresses Syk expression,
mediator release from macrophages, and pulmonary inflammation. J Immunol 2000, 164:3790-7.
This invention further pertains to the use of novel agents identified by the screening assays described above. Accordingly, it is within the scope of this invention to use a test compound identified as described herein in an appropriate animal model. For example, an agent identified as described herein (e.g., a modulating agent, an antisense nucleic acid molecule, a specific antibody, ribozyme, or a CRIK polypeptide binding molecule) can be used in an animal model to determine the efficacy, toxicity, or side effects of treatment with such an agent. Alternatively, an agent identified as described herein can be used in an animal model to determine the mechanism of action of such an agent. Furthermore, this invention pertains to uses of novel agents identified by the above-described screening assays for treatments as described herein.
A reagent which affects CRIK activity can be administered to a human cell, either in vitro or in vivo, to reduce CRIK activity. The reagent preferably binds to an expression product of a human CRIK gene. If the expression product is a protein, the reagent is preferably an antibody. For treatment of human cells ex vivo, an antibody can be added to a preparation of stem cells that have been removed from the body.
The cells can then be replaced in the same or another human body, with or without clonal propagation, as is known in the art.
In one embodiment, the reagent is delivered using a liposome. Preferably, the liposome is stable in the animal into which it has been administered for at least about
30 minutes, more preferably for at least about 1 hour, and even more preferably for at least about 24 hours. A liposome comprises a lipid composition that is capable of targeting a reagent, particularly a polynucleotide, to a particular site in an animal, such as a human. Preferably, the lipid composition of the liposome is capable of targeting to a specific organ of an animal, such as the lung, liver, spleen, heart brain, lymph nodes, and skin.
A liposome useful in the present invention comprises a lipid composition that is capable of fusing with the plasma membrane of the targeted cell to deliver its contents to the cell. Preferably, the transfection efficiency of a liposome is about 0.5 μg of DNA per 16 nmole of liposome delivered to about 106 cells, more preferably about 1.0 μg of DNA per 16 nmole of liposome delivered to about 106 cells, and even more preferably about 2.0 μg of DNA per 16 nmol of liposome delivered to about 106 cells. Preferably, a liposome is between about 100 and 500 nm, more preferably between about 150 and 450 nm, and even more preferably between about 200 and 400 nm in diameter.
Suitable liposomes for use in the present invention include those liposomes standardly used in, for example, gene delivery methods known to those of skill in the art. More preferred liposomes include liposomes having a polycationic lipid composition and/or liposomes having a cholesterol backbone conjugated to polyethylene glycol. Optionally, a liposome comprises a compound capable of targeting the liposome to a particular cell type, such as a cell-specific ligand exposed on the outer surface of the liposome.
Complexing a liposome with a reagent such as an antisense oligonucleotide or ribozyme can be achieved using methods that are standard in the art (see, for example, U.S. Patent 5,705,151). Preferably, from about 0.1 μg to about 10 μg of polynucleotide is combined with about 8 nmol of liposomes, more preferably from about 0.5 μg to about 5 μg of polynucleotides are combined with about 8 nmol lipo- somes, and even more preferably about 1.0 μg of polynucleotides is combined with about 8 nmol liposomes.
In another embodiment, antibodies can be delivered to specific tissues in vivo using receptor-mediated targeted delivery. Receptor-mediated DNA delivery techniques are taught in, for example, Findeis et al. Trends in Biotechnol 11, 202-05 (1993);
Chiou et al, GENE THERAPEUTICS: METHODS AND APPLICATIONS OF DIRECT GENE
TRANSFER (J.A. Wolff, ed.) (1994); Wu & Wu, J. Biol. Chem. 263, 621-24 (1988); Wu et al, J. Biol. Chem. 269, 542-46 (1994); Zenke et al, Proc. Natl. Acad. Sci. U.S.A. 87, 3655-59 (1990); Wu et al, J Biol Chem. 266, 338-42 (1991).
Determination of a Therapeutically Effective Dose
The determination of a therapeutically effective dose is well within the capability of those skilled in the art. A therapeutically effective dose refers to that amount of active ingredient which increases or decreases CRIK activity relative to the CRIK activity which occurs in the absence of the therapeutically effective dose.
For any compound, the therapeutically effective dose can be estimated initially either in cell culture assays or in animal models, usually mice, rabbits, dogs, or pigs. The animal model also can be used to determine the appropriate concentration range and route of administration. Such information can then be used to determine useful doses and routes for administration in humans.
Therapeutic efficacy and toxicity, e.g., ED50 (the dose therapeutically effective in 50% of the population) and LD50 (the dose lethal to 50% of the population), can be determined by standard pharmaceutical procedures in cell cultures or experimental animals. The dose ratio of toxic to therapeutic effects is the therapeutic index, and it can be expressed as the ratio, LD5o/ED50.
Pharmaceutical compositions that exhibit large therapeutic indices are preferred. The data obtained from cell culture assays and animal studies is used in formulating a range of dosage for human use. The dosage contained in such compositions is preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage varies within this range depending upon the dosage form employed, sensitivity of the patient, and the route of administration.
The exact dosage will be determined by the practitioner, in light of factors related to the subject that requires treatment. Dosage and administration are adjusted to provide sufficient levels of the active ingredient or to maintain the desired effect. Factors that can be taken into account include the severity of the disease state, general health of the subject, age, weight, and gender of the subject, diet, time and frequency of administration, drug combination(s), reaction sensitivities, and tolerance/response to therapy. Long-acting pharmaceutical compositions can be administered every 3 to 4 days, every week, or once every two weeks depending on the half-life and clearance rate of the particular formulation.
Normal dosage amounts can vary from 0.1 to 100,000 micrograms, up to a total dose of about 1 g, depending upon the route of administration. Guidance as to particular dosages and methods of delivery is provided in the literature and generally available to practitioners in the art. Those skilled in the art will employ different formulations for nucleotides than for proteins or their inhibitors. Similarly, delivery of polynucleotides or polypeptides will be specific to particular cells, conditions, locations, etc.
If the reagent is a single-chain antibody, polynucleotides encoding the antibody can be constructed and introduced into a cell either ex vivo or in vivo using well- established techniques including, but not limited to, transferrin-polycation-mediated DNA transfer, transfection with naked or encapsulated nucleic acids, liposome- mediated cellular fusion, intracellular transportation of DNA-coated latex beads, protoplast fusion, viral infection, elecfroporation, "gene gun," and DEAE- or calcium phosphate-mediated transfection.
Effective in vivo dosages of an antibody are in the range of about 5 μg to about 50 μg/kg, about 50 μg to about 5 mg/kg, about 100 μg to about 500 μg/kg of patient body weight, and about 200 to about 250 μg/kg of patient body weight. For administration of polynucleotides encoding single-chain antibodies, effective in vivo dosages are in the range of about 100 ng to about 200 ng, 500 ng to about 50 mg,
about 1 μg to about 2 mg, about 5 μg to about 500 μg, and about 20 μg to about 100 μg of DNA.
If the expression product is mRNA, the reagent is preferably an antisense oligo- nucleotide or a ribozyme. Polynucleotides that express antisense oligonucleotides or ribozymes can be introduced into cells by a variety of methods, as described above.
Preferably, a reagent reduces expression of a CRIK gene or the activity of a CRIK polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% relative to the absence of the reagent. The effectiveness of the mechanism chosen to decrease the level of expression of a CRIK gene or the activity of a CRIK polypeptide can be assessed using methods well known in the art, such as hybridization of nucleotide probes to CRTK-specific mRNA, quantitative RT-PCR, immunologic detection of a CRIK polypeptide, or measurement of CRLK activity.
In any of the embodiments described above, any of the pharmaceutical compositions of the invention can be administered in combination with other appropriate therapeutic agents. Selection of the appropriate agents for use in combination therapy can be made by one of ordinary skill in the art, according to conventional pharmaceutical principles. The combination of therapeutic agents can act synergistically to effect the treatment or prevention of the various disorders described above. Using this approach, one may be able to achieve therapeutic efficacy with lower dosages of each agent, thus reducing the potential for adverse side effects.
Any of the therapeutic methods described above can be applied to any subject in need of such therapy, including, for example, mammals such as dogs, cats, cows, horses, rabbits, monkeys, and most preferably, humans.
Diagnostic Methods
Human CRIK also can be used in diagnostic assays for detecting diseases and abnormalities or susceptibility to diseases and abnormalities related to the presence of mutations in the nucleic acid sequences that encode the enzyme. For example, differences can be determined between the cDNA or genomic sequence encoding CRLK in individuals afflicted with a disease and in normal individuals. If a mutation is observed in some or all of the afflicted individuals but not in normal individuals, then the mutation is likely to be the causative agent of the disease.
Sequence differences between a reference gene and a gene having mutations can be revealed by the direct DNA sequencing method. In addition, cloned DNA segments can be employed as probes to detect specific DNA segments. The sensitivity of this method is greatly enhanced when combined with PCR. For example, a sequencing primer can be used with a double-stranded PCR product or a single-stranded template molecule generated by a modified PCR. The sequence determination is performed by conventional procedures using radiolabeled nucleotides or by automatic sequencing procedures using fluorescent tags.
Genetic testing based on DNA sequence differences can be carried out by detection of alteration in electrophoretic mobility of DNA fragments in gels with or without denaturing agents. Small sequence deletions and insertions can be visualized, for example, by high resolution gel electrophoresis. DNA fragments of different sequences can be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific melting or partial melting temperatures (see, e.g., Myers et al, Science 230, 1242, 1985). Sequence changes at specific locations can also be revealed by nuclease protection assays, such as RNase and S 1 protection or the chemical cleavage method (e.g., Cotton et al, Proc. Natl. Acad. Sci. USA 85, 4397-4401, 1985). Thus, the detection of a specific DNA sequence can be performed by methods such as hybridization, RNase protection, chemical cleavage, direct DNA
sequencing or the use of restriction enzymes and Southern blotting of genomic DNA. In addition to direct methods such as gel-electrophoresis and DNA sequencing, mutations can also be detected by in situ analysis.
Altered levels of CRIK also can be detected in various tissues. Assays used to detect levels of the receptor polypeptides in a body sample, such as blood or a tissue biopsy, derived from a host are well known to those of skill in the art and include radioimmunoassays, competitive binding assays, Western blot analysis, and ELISA assays.
All patents and patent applications cited in this disclosure are expressly incorporated herein by reference. The above disclosure generally describes the present invention. A more complete understanding can be obtained by reference to the following specific examples, which are provided for purposes of illustration only and are not intended to limit the scope of the invention.
EXAMPLE 1
Detection of human citron rho/rac-interacting kinase activity
Subconfluent COS7 cells in 10-cm dishes are transiently transfected by the DEAE- dextran/chloroquine method with 10 μg of FLAG-SEQ ID NO: 1 vector. Cells are harvested 48 h after transfection. Immunoblotting is performed, and cells are probed with anti-FLAG M2 antibodies (Eastman Kodak Co.) Blots are developed using horseradish peroxidase-conjugated secondary antibodies and ECL detection system (Amersham Pharmacia Biotech). In vitro kinase assays are performed by incubating immune complexes in 50 ml of kinase buffer (50 mM HEPES, pH 7.4, 5 mM MgC12, 3 mM MnC12, lmM dithiothreitol), in the presence or absence of 5 mg of histone HI or myelin basic protein, plus 0.1 mM ATP and 10 mCi of [gamma-32P] ATP (6000 Ci/mM, NEN Life Science Products) for 30 min at 30 °C. The products are analyzed by 5% or 12.5% SDS-PAGE followed by autoradiography. For immunoprecipitation of metabolically labeled proteins, primary keratinocytes are
incubated with 0.1 mCi/ml [35S]methionine (Expre35S; NEN Life Science Products) for 4 h in methionine-free medium in the presence of serum. Immunoprecipitated proteins are separated on a 5% SDS-PAGE gel and visualized by autoradiography. It is shown that the polypeptide of SEQ ID NO: 2 has a human citron rho/rac- interacting kinase-short kinase activity.
EXAMPLE 2
Expression of recombinant human CRIK
The Pichia pas tor is expression vector pPICZB (Invitrogen, San Diego, CA) is used to produce large quantities of recombinant human CRIK polypeptides in yeast. The CRIK-encoding DNA sequence is derived from SEQ ID NO:l. Before insertion into vector pPICZB, the DNA sequence is modified by well known methods in such a way that it contains at its 5 '-end an initiation codon and at its 3 '-end an enterokinase cleavage site, a His6 reporter tag and a termination codon. Moreover, at both termini recognition sequences for restriction endonucleases are added and after digestion of the multiple cloning site of pPICZ B with the corresponding restriction enzymes the modified DNA sequence is ligated into pPICZB. This expression vector is designed for inducible expression in Pichia pastoris, driven by a yeast promoter. The resulting pPICZ/md-His6 vector is used to transform the yeast.
The yeast is cultivated under usual conditions in 5 liter shake flasks and the recombinantly produced protein isolated from the culture by affinity chromatography (Ni-NTA-Resin) in the presence of 8 M urea. The bound polypeptide is eluted with buffer, pH 3.5, and neutralized. Separation of the polypeptide from the His6 reporter tag is accomplished by site-specific proteolysis using enterokinase (Invitrogen, San Diego, CA) according to manufacturer's instructions. Purified human CRIK polypeptide is obtained.
EXAMPLE 3
Identification of test compounds that bind to CRIK polypeptides
Purified CRLK polypeptides comprising a glutathione-S-transferase protein and absorbed onto glutathione-derivatized wells of 96-well microtiter plates are contacted with test compounds from a small molecule library at pH 7.0 in a physiological buffer solution. Human CRIK polypeptides comprise the amino acid sequence shown in SEQ ID NO:2. The test compounds comprise a fluorescent tag. The samples are incubated for 5 minutes to one hour. Control samples are incubated in the absence of a test compound.
The buffer solution containing the test compounds is washed from the wells. Binding of a test compound to a CRIK polypeptide is detected by fluorescence measurements of the contents of the wells. A test compound that increases the fluorescence in a well by at least 15%o relative to fluorescence of a well in which a test compound is not incubated is identified as a compound which binds to a CP K polypeptide.
EXAMPLE 4 Identification of a test compound which decreases CRIK gene expression
A test compound is administered to a culture of human cells transfected with a CRIK expression construct and incubated at 37 °C for 10 to 45 minutes. A culture of the same type of cells that have not been transfected is incubated for the same time without the test compound to provide a negative control.
RNA is isolated from the two cultures as described in Chirgwin et al, Biochem. 18, 5294-99, 1979). Northern blots are prepared using 20 to 30 μg total RNA and hybridized with a 32P-labeled CPJK-specific probe at 65 ° C in Express-hyb (CLONTECH). The probe comprises at least 11 contiguous nucleotides selected from the complement of SEQ ID NO:l. A test compound that decreases the CRLK-
specific signal relative to the signal obtained in the absence of the test compound is identified as an inhibitor of CRIK gene expression.
EXAMPLE 5 Identification of a test compound which decreases CRIK activity
A test compound is administered to a culture of human cells transfected with a CRIK expression construct and incubated at 37 °C for 10 to 45 minutes. A culture of the same type of cells that have not been transfected is incubated for the same time without the test compound to provide a negative control. CRIK activity is measured using the method of Di Cunto et al, J Biol Chem. 1998 Nov 6;273(45):29706-ll.
A test compound which decreases the CRLK activity of the CRIK relative to the CRIK activity in the absence of the test compound is identified as an inhibitor of CRIK activity.
EXAMPLE 6
Tissue-specific expression of CRIK
The qualitative expression pattern of CRIK in various tissues is determined by
Reverse Transcription-Polymerase Chain Reaction (RT-PCR).
To demonstrate that CRLK is involved in the disease process of COPD, the initial expression panel consists of RNA samples from respiratory tissues and inflammatory cells relevant to COPD: lung (adult and fetal), trachea, freshly isolated alveolar type
II cells, cultured human bronchial epithelial cells, cultured small airway epithelial cells, cultured bronchial sooth muscle cells, cultured H441 cells (Clara-like), freshly isolated neutrophils and monocytes, and cultured monocytes (macrophage-like). Body map profiling also is carried out, using total RNA panels purchased from Clontech. The tissues are adrenal gland, bone marrow, brain, colon, heart, kidney,
liver, lung, mammary gland, pancreas, prostate, salivary gland, skeletal muscle, small intestine, spleen, stomach, testis, thymus, trachea, thyroid, and uterus.
To demonstrate that CRIK is involved in CNS disorders, the following tissues are screened: fetal and adult brain, muscle, heart, lung, kidney, liver, thymus, testis, colon, placenta, trachea, pancreas, kidney, gastric mucosa, colon, liver, cerebellum, skin, cortex (Alzheimer's and normal), hypothalamus, cortex, amygdala, cerebellum, hippocampus, choroid, plexus, thalamus, and spinal cord.
To demonstrate that CRIK is involved in the disease process of obesity, expression is determined in the following tissues: subcutaneous adipose tissue, mesenteric adipose tissue, adrenal gland, bone marrow, brain (cerebellum, spinal cord, cerebral cortex, caudate, medulla, substantia nigra, and putamen), colon, fetal brain, heart, kidney, liver, lung, mammary gland, pancreas, placenta, prostate, salivary gland, skeletal muscle small intestine, spleen, stomach, testes, thymus, thyroid trachea, and uterus.
Neuroblastoma cell lines SK-Nr-Be (2), Hr, Sk-N-As, HTB-10, IMR-32, SNSY-5Y, T3, SK-N-D2, D283, DAOY, CHP-2, U87MG, BE(2)C, T986, KANTS, MO59K, CHP234, C6 (rat), SK-N-F1, SK-PU-DW, PFSK-1, BE(2)M17, and MCIXC also are tested for CRIK expression. As a final step, the expression of CRIK in cells derived from normal individuals with the expression of cells derived from obese individuals is compared.
Quantitative expression profiling. Quantitative expression profiling is performed by the form of quantitative PCR analysis called "kinetic analysis" firstly described in Higuchi et al., BioTechnology 10, 413-17, 1992, and Higuchi et al, BioTechnology
11, 1026-30, 1993. The principle is that at any given cycle within the exponential phase of PCR, the amount of product is proportional to the initial number of template copies.
If the amplification is performed in the presence of an internally quenched fluorescent oligonucleotide (TaqMan probe) complementary to the target sequence,
the probe is cleaved by the 5 '-3' endonuclease activity of Taq DNA polymerase and a fluorescent dye released in the medium (Holland et al., Proc. Natl. Acad. Sci. U.S.A. 88, 7276-80, 1991). Because the fluorescence emission will increase in direct proportion to the amount of the specific amplified product, the exponential growth phase of PCR product can be detected and used to determine the initial template concentration (Heid et al, Genome Res. 6, 986-94, 1996, and Gibson et al, Genome Res. 6, 995-1001, 1996).
The amplification of an endogenous control can be performed to standardize the amount of sample RNA added to a reaction. In this kind of experiment, the control of choice is the 18S ribosomal RNA. Because reporter dyes with differing emission spectra are available, the target and the endogenous control can be independently quantified in the same tube if probes labeled with different dyes are used.
All "real time PCR" measurements of fluorescence are made in the ABI Prism 7700.
RNA extraction and cDNA preparation. Total RΝA from the tissues listed above are used for expression quantification. RΝAs labeled "from autopsy" were extracted from autoptic tissues with the TRIzol reagent (Life Technologies, MD) according to the manufacturer's protocol.
Fifty μg of each RΝA were treated with DΝase I for 1 hour at 37°C in the following reaction mix: 0.2 U/μl RΝase-free DΝase I (Roche Diagnostics, Germany); 0.4 U/μl RΝase inhibitor (PE Applied Biosystems, CA); 10 mM Tris-HCl pH 7.9; lOmM MgCl2; 50 mM ΝaCl; and 1 mM DTT.
After incubation, RΝA is extracted once with 1 volume of phenol hloro- formrisoamyl alcohol (24:24:1) and once with chloroform, and precipitated with 1/10 volume of 3 M ΝaAcetate, pH5.2, and 2 volumes of ethanol.
Fifty μg of each RNA from the autoptic tissues are DNase treated with the DNA-free kit purchased from Ambion (Ambion, TX). After resuspension and spectrophoto- metric quantification, each sample is reverse transcribed with the TaqMan Reverse Transcription Reagents (PE Applied Biosystems, CA) according to the manu- facturer's protocol. The final concentration of RNA in the reaction mix is 200ng/μL.
Reverse transcription is carried out with 2.5μM of random hexamer primers.
TaqMan quantitative analysis. Specific primers and probe are designed according to the recommendations of PE Applied Biosystems; the probe can be labeled at the 5' end FAM (6-carboxy-fluorescein) and at the 3' end with TAMRA (6-carboxy-tetra- methyl-rhodamine). Quantification experiments are performed on 10 ng of reverse transcribed RNA from each sample. Each determination is done in triplicate.
Total cDNA content is normalized with the simultaneous quantification (multiplex PCR) of the 18S ribosomal RNA using the Pre-Developed TaqMan Assay Reagents
(PDAR) Control Kit (PE Applied Biosystems, CA).
The assay reaction mix is as follows: IX final TaqMan Universal PCR Master Mix (from 2X stock) (PE Applied Biosystems, CA); IX PDAR control - 18S RNA (from 20X stock); 300 nM forward primer; 900 nM reverse primer; 200 nM probe; 10 ng cDNA; and water to 25 μl.
Each of the following steps are carried out once: pre PCR, 2 minutes at 50 °C, and 10 minutes at 95 °C. The following steps are carried out 40 times: denaturation, 15 seconds at 95 °C, annealing/extension, 1 minute at 60 °C.
The experiment is performed on an ABI Prism 7700 Sequence Detector (PE Applied Biosystems, CA). At the end of the run, fluorescence data acquired during PCR are processed as described in the ABI Prism 7700 user's manual in order to achieve better background subtraction as well as signal linearity with the starting target quantity.
EXAMPLE 7
Identification of test compound efficacy in a COPD animal model
Guinea pigs are exposed on a single occasion to tobacco smoke for 50 minutes.
Animals are sacrificed between 10 minutes and 24 hour following the end of the exposure and their lungs placed in RNAlater™. The lung tissue is homogenized, and total RNA was extracted using a Qiagens RNeasy™ Maxi kit. Molecular Probes RiboGreen™ RNA quantitation method is used to quantify the amount of RNA in each sample.
Total RNA is reverse transcribed, and the resultant cDNA is used in a real-time polymerase chain reaction (PCR). The cDNA is added to a solution containing the sense and anti-sense primers and the 6-carboxy-tetramethyl-rhodamine labelled probe of the CRIK gene. Cyclophilin is used as the housekeeping gene. The expression of the CRLK gene is measured using the TaqMan real-time PCR system that generates an amplification curve for each sample. From this curve a threshold cycle value is calculated: the fractional cycle number at which the amount of amplified target reaches a fixed threshold. A sample containing many copies of the CRIK gene will reach this threshold earlier than a sample containing fewer copies. The threshold is set at 0.2, and the threshold cycle Oχ is calculated from the amplification curve. The Cx value for the CRIK gene is normalized using the O value for the housekeeping gene.
Expression of the CRIK gene is increased by at least 3-fold between 10 minutes and
3 hours post tobacco smoke exposure compared to air exposed control animals.
Test compounds are evaluated as follows. Animals are pre-treated with a test compound between 5 minutes and 1 hour prior to the tobacco smoke exposure and they are then sacrificed up to 3 hours after the tobacco smoke exposure has been completed. Control animals are pre-treated with the vehicle of the test compound via
the route of administration chosen for the test compound. A test compound that reduces the tobacco smoke induced upregulation of CRIK gene relative to the expression seen in vehicle treated tobacco smoke exposed animals is identified as an inhibitor of CRIK gene expression.
EXAMPLE 8
Expression of human citron rho/rac-interacting kinase
Total RNA used for Taqman quantitative analysis were either purchased (Clontech,CA) or extracted from tissues using TRIzol reagent (Life Technologies,
MD) according to a modified vendor protocol which utilizes the Rneasy protocol (Qiagen, CA). One hundred μg of each RNA were treated with DNase I using RNase free- DNase (Qiagen, CA) for use with RNeasy or QiaAmp columns.
After elution and quantitation with Ribogreen (Molecular Probes Inc., OR), each sample was reverse transcribed using the GibcoBRL Superscript II First Strand Synthesis System for RT-PCR according to vendor protocol (Life Technologies, MD). The final concentration of RNA in the reaction mix was 50ng/μL. Reverse transcription was performed with 50 ng of random hexamers.
Specific primers and probe were designed according to PE Applied Biosystems' Primer Express program recommendations and are listed below:
forward primer: 5'-(TCCAATTTTGATGAACCAGAGAAG)-3' reverse primer: 5'-( AACCCCACAAACGGCAGTT)-3 ' probe: SYBR Green
Quantitation experiments were performed on 25 ng of reverse transcribed RNA from each sample. 18S ribosomal RNA was measured as a control using the Pre- Developed TaqMan Assay Reagents (PDAR)(PE Applied Biosystems, CA). The assay reaction mix was as follows:
final
TaqMan SYBR Green PCR Master Mix (2x) lx (PE Applied Biosystems, CA) Forward primer 300nM Reverse primer 300nM cDNA 25ng
Water to 25uL PCR conditions: Once: 2' minutes at 50° C 10 minutes at 95°C 40cycles: 15 sec.at 95°C 1 minute at 60°C
The experiment was performed on an ABI Prism 7700 Sequence Detector (PE
Applied Biosystems, CA). At the end of the run, fluorescence data acquired during PCR were processed as described in the ABI Prism 7700 user's manual. Fold change was calculated using the delta-delta CT method with normalization to the 18S values. Relative expression was calculated by normalizing to 18s (D Ct), then making the highest expressing tissue 100 and everything else relative to it. Copy number conversion was performed without normalization using the formula Cn=10(Ct- 40.007)/-3.623.
The results are shown in FIG. 21.
Human citron rho/rac-interacting kinase expressed in adipose and skeletal muscle could be regulated to increase insulin sensitivity.
EXAMPLE 9
In vivo testing of compounds/target validation 1. Pain: Acute Pain
Acute pain is measured on a hot plate mainly in rats. Two variants of hot plate testing are used: In the classical variant animals are put on a hot surface (52 to 56 °C) and the latency time is measured until the animals show nocifensive behavior, such as stepping or foot licking. The other variant is an increasing temperature hot plate where the experimental animals are put on a surface of neutral temperature.
Subsequently this surface is slowly but constantly heated until the animals begin to lick a hind paw. The temperature which is reached when hind paw licking begins is a measure for pain threshold.
Compounds are tested against a vehicle treated control group. Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t., i.c.v., s.c, intradermal, transdermal) prior to pain testing.
Persistent Pain
Persistent pain is measured with the formalin or capsaicin test, mainly in rats. A solution of 1 to 5% formalin or 10 to 100 μg capsaicin is injected into one hind paw of the experimental animal. After formalin or capsaicin application the animals show nocifensive reactions like flinching, licking and biting of the affected paw. The number of nocifensive reactions within a time frame of up to 90 minutes is a measure for intensity of pain.
Compounds are tested against a vehicle treated control group. Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t., i.c.v., s.c, intradermal, transdermal) prior to formalin or capsaicin administration.
Neuropathic Pain
Neuropathic pain is induced by different variants of unilateral sciatic nerve injury mainly in rats. The operation is performed under anesthesia. The first variant of sciatic nerve injury is produced by placing loosely constrictive ligatures around the common sciatic nerve. The second variant is the tight ligation of about the half of the diameter of the common sciatic nerve. In the next variant, a group of models is used in which tight ligations or transections are made of either the L5 and L6 spinal nerves, or the L% spinal nerve only. The fourth variant involves an axotomy of two of the three terminal branches of the sciatic nerve (tibial and common peroneal nerves) leaving the remaining sural nerve intact whereas the last variant comprises the axotomy of only the tibial branch leaving the sural and common nerves uninjured. Control animals are treated with a sham operation.
Postoperatively, the nerve injured animals develop a chronic mechanical allodynia, cold allodynioa, as well as a thermal hyperalgesia. Mechanical allodynia is measured by means of a pressure transducer (electronic von Frey Anesthesiometer, IITC Inc.-Life Science Instruments, Woodland Hills, SA, USA; Electronic von Frey System, Somedic Sales AB, Hδrby, Sweden). Thermal hyperalgesia is measured by means of a radiant heat source (Plantar Test, Ugo Basile, Comerio, Italy), or by means of a cold plate of 5 to 10 °C where the nocifensive reactions of the affected hind paw are counted as a measure of pain intensity. A further test for cold induced pain is the counting of nocifensive reactions, or duration of nocifensive responses after plantar administration of acetone to the affected hind limb. Chronic pain in general is assessed by registering the circadanian rhythms in activity (Surjo and
Arndt, Universitat zu Kδln, Cologne, Germany), and by scoring differences in gait (foot print patterns; FOOTPRINTS program, Klapdor et al., 1997. A low cost method to analyze footprint patterns. J. Neurosci. Methods 75, 49-54).
Compounds are tested against sham operated and vehicle treated control groups. Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t., i.c.v., s.c, intradermal, transdermal) prior to pain testing.
Inflammatory Pain
Inflammatory pain is induced mainly in rats by injection of 0.75 mg carrageenan or complete Freund's adjuvant into one hind paw. The animals develop an edema with mechanical allodynia as well as thermal hyperalgesia. Mechanical allodynia is measured by means of a pressure transducer (electronic von Frey Anesthesiometer,
IITC Inc. -Life Science Instruments, Woodland Hills, SA, USA). Thermal hyperalgesia is measured by means of a radiant heat source (Plantar Test, Ugo Basile, Comerio, Italy, Paw thermal stimulator, G. Ozaki, University of California, USA). For edema measurement two methods are being used. In the first method, the animals are sacrificed and the affected hindpaws sectioned and weighed. The second method comprises differences in paw volume by measuring water displacement in a plethysmometer (Ugo Basile, Comerio, Italy).
Compounds are tested against uninflamed as well as vehicle treated control groups. Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t., i.c.v., s.c, intradermal, transdermal) prior to pain testing.
Diabetic Neuropathic Pain
Rats treated with a single intraperitoneal injection of 50 to 80 mg/kg streptozotocin develop a profound hyperglycemia and mechanical allodynia within 1 to 3 weeks. Mechanical allodynia is measured by means of a pressure transducer (electronic von Frey Anesthesiometer, IITC Inc-Life Science Instruments, Woodland Hills, SA, USA).
Compounds are tested against diabetic and non-diabetic vehicle treated control groups. Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t., i.c.v., s.c, intradermal, transdermal) prior to pain testing.
2. Parkinson's disease 6-Hydroxydopamine (6-OH-DA) Lesion
Degeneration of the dopaminergic nigrostriatal and striatopallidal pathways is the central pathological event in Parkinson's disease. This disorder has been mimicked experimentally in rats using single/sequential unilateral stereotaxic injections of 6-OH-DA into the medium forebrain bundle (MFB).
Male Wistar rats (Harlan Winkelmann, Germany), weighing 200+250 g at the beginning of the experiment, are used. The rats are maintained in a temperature- and humidity-controlled environment under a 12 h light/dark cycle with free access to food and water when not in experimental sessions. The following in vivo protocols are approved by the governmental authorities. All efforts are made to minimize animal suffering, to reduce the number of animals used, and to utilize alternatives to in vivo techniques.
Animals are admimstered pargyline on the day of surgery (Sigma, St. Louis, MO, USA; 50 mg/kg i.p.) in order to inhibit metabolism of 6-OHDA by monoamine oxidase and desmethylimipramine HC1 (Sigma; 25 mg/kg i.p.) in order to prevent uptake of 6-OHDA by noradrenergic terminals. Thirty minutes later the rats are anesthetized with sodium pentobarbital (50 mg/kg) and placed in a stereotaxic frame. In order to lesion the DA nigrostriatal pathway 4 μl of 0.01% ascorbic acid-saline containing 8 μg of 6-OHDA HBr (Sigma) are injected into the left medial fore-brain bundle at a rate of 1 μl/min (2.4 mm anterior, 1.49 mm lateral, -2.7 mm ventral to Bregma and the skull surface). The needle is left in place an additional 5 min to allow diffusion to occur.
Stepping Test
Forelimb akinesia is assessed three weeks following lesion placement using a modified stepping test protocol. In brief, the animals are held by the experimenter with one hand fixing the hindlimbs and slightly raising the hind part above the surface. One paw is touching the table, and is then moved slowly sideways (5 s for 1 m), first in the forehand and then in the backhand direction. The number of adjusting steps is counted for both paws in the backhand and forehand direction of movement. The sequence of testing is right paw forehand and backhand adjusting stepping, followed by left paw forehand and backhand directions. The test is repeated three times on three consecutive days, after an initial training period of three days prior to the first testing. Forehand adjusted stepping reveals no consistent differences between lesioned and healthy control animals. Analysis is therefore restricted to backhand adjusted stepping.
Balance Test
Balance adjustments following postural challenge are also measured during the stepping test sessions. The rats are held in the same position as described in the stepping test and, instead of being moved sideways, tilted by the experimenter towards the side of the paw touching the table. This maneuver results in loss of balance and the ability of the rats to regain balance by forelimb movements is scored on a scale ranging from 0 to 3. Score 0 is given for a normal forelimb placement. When the forelimb movement is delayed but recovery of postural balance detected, score 1 is given. Score 2 represents a clear, yet insufficient, forelimb reaction, as evidenced by muscle contraction, but lack of success in recovering balance, and score
3 is given for no reaction of movement. The test is repeated three times a day on each side for three consecutive days after an initial training period of three days prior to the first testing.
Staircase Test (Paw Reaching)
A modified version of the staircase test is used for evaluation of paw reaching behavior three weeks following primary and secondary lesion placement. Plexiglass test boxes with a central platform and a removable staircase on each side are used.
The apparatus is designed such that only the paw on the same side at each staircase can be used, thus providing a measure of independent forelimb use. For each test the animals are left in the test boxes for 15 min. The double staircase is filled with 7 x 3 chow pellets (Precision food pellets, formula: P, purified rodent diet, size 45 mg; Sandown Scientific) on each side. After each test the number of pellets eaten
(successfully retrieved pellets) and the number of pellets taken (touched but dropped) for each paw and the success rate (pellets eaten/pellets taken) are counted separately. After three days of food deprivation (12 g per animal per day) the animals are tested for 11 days. Full analysis is conducted only for the last five days.
MPTP treatment
The neurotoxin l-methyl-4-phenyl-l,2,3,6-tetrahydro-pyridine (MPTP) causes degeneration of mesencephalic dopaminergic (DAergic) neurons in rodents, non-human primates, and humans and, in so doing, reproduces many of the symptoms of Parkinson's disease. MPTP leads to a marked decrease in the levels of dopamine and its metabolites, and in the number of dopaminergic terminals in the striatum as well as severe loss of the tyrosine hydroxylase (TH)-immunoreactive cell bodies in the substantia nigra, pars compacta.
In order to obtain severe and long-lasting lesions, and to reduce mortality, animals receive single injections of MPTP, and are then tested for severity of lesion 7-10 days later. Successive MPTP injections are administered on days 1, 2 and 3. Animals receive application of 4 mg/kg MPTP hydrochloride (Sigma) in saline once daily. All injections are intraperitoneal (i.p.) and the MPTP stock solution is frozen between injections. Animals are decapitated on day 11.
Immunohistology
At the completion of behavioral experiments, all animals are anaesthetized with 3 ml thiopental (1 g/40 ml i.p., Tyrol Pharma). The mice are perfused transcardially with
0.01 M PBS (pH 7.4) for 2 min, followed by 4% paraformaldehyde (Merck) in PBS for 15 min. The brains are removed and placed in 4% paraformaldehyde for 24 h at 4 °C. For dehydration they are then transferred to a 20% sucrose (Merck) solution in 0.1 M PBS at 4 °C until they sink. The brains are frozen in methylbutan at -20 °C for 2 min and stored at -70 °C. Using a sledge microtome (mod. 3800-Frigocut, Leica),
25 μm sections are taken from the genu of the corpus callosum (AP 1.7 mm) to the hippocampus (AP 21.8 mm) and from AP 24.16 to AP 26.72. Forty-six sections are cut and stored in assorters in 0.25 M Tris buffer (pH 7.4) for immunohistochemistry.
A series of sections is processed for free-floating tyrosine hydroxylase (TH) immunohistochemistry. Following three rinses in 0.1 M PBS, endogenous per- oxidase activity is quenched for 10 min in 0.3% H2O2 ±PBS. After rinsing in PBS, sections are preincubated in 10% normal bovine serum (Sigma) for 5 min as blocking agent and transferred to either primary anti-rat TH rabbit antiserum (dilution 1 :2000).
Following overnight incubation at room temperature, sections for TH immuno- reactivity are rinsed in PBS (2 xlO min) and incubated in biotinylated anti-rabbit immunoglobulin G raised in goat (dilution 1:200) (Vector) for 90 min, rinsed repeatedly and transferred to Vectastain ABC (Vector) solution for 1 h. 3,.3' -Diaminobenzidine tetrahydrochloride (DAB; Sigma) in 0.1 M PBS, supplemented with 0.005% H2O2 , serves as chromogen in the subsequent visualization reaction. Sections are mounted on to gelatin-coated slides, left to dry overnight, counter-stained with hematoxylin dehydrated in ascending alcohol concentrations and cleared in butylacetate. Coverslips are mounted on entellan.
Rotarod Test
We use a modification of the procedure described by Rozas and Labandeira-Garcia (1997), with a CR-1 Rotamex system (Columbus Instruments, Columbus, OH) comprising an IBM-compatible personal computer, a CIO-24 data acquisition card, a control unit, and a four-lane rotarod unit. The rotarod unit consists of a rotating spindle (diameter 7.3 cm) and individual compartments for each mouse. The system software allows preprogramming of session protocols with varying rotational speeds (0-80 rpm). Infrared beams are used to detect when a mouse has fallen onto the base grid beneath the rotarod. The system logs the fall as the end of the experiment for that mouse, and the total time on the rotarod, as well as the time of the fall and all the set-up parameters, are recorded. The system also allows a weak current to be passed through the base grid, to aid training.
3. Dementia
The object recosnition task
The object recognition task has been designed to assess the effects of experimental manipulations on the cognitive performance of rodents. A rat is placed in an open field, in which two identical objects are present. The rats inspects both objects during the first trial of the object recognition task. In a second trial, after a retention interval of for example 24 hours, one of the two objects used in the first trial, the 'familiar' object, and a novel object are placed in the open field. The inspection time at each of the objects is registered. The basic measures in the OR task is the time spent by a rat exploring the two object the second trial. Good retention is reflected by higher exploration times towards the novel than the 'familiar' object.
Administration of the putative cognition enhancer prior to the first trial predominantly allows assessment of the effects on acquisition, and eventually on consolidation processes. Administration of the testing compound after the first trial
allows to assess the effects on consolidation processes, whereas administration before the second trial allows to measure effects on retrieval processes.
The passive avoidance task
The passive avoidance task assesses memory performance in rats and mice. The inhibitory avoidance apparatus consists of a two-compartment box with a light compartment and a dark compartment. The two compartments are separated by a guillotine door that can be operated by the experimenter. A threshold of 2 cm separates the two compartments when the guillotine door is raised. When the door is open, the illumination in the dark compartment is about 2 lux. The light intensity is about 500 lux at the center of the floor of the light compartment.
Two habituation sessions, one shock session, and a retention session are given, separated by inter-session intervals of 24 hours. In the habituation sessions and the retention session the rat is allowed to explore the apparatus for 300 sec. The rat is placed in the light compartment, facing the wall opposite to the guillotine door. After an accommodation period of 15 sec. the guillotine door is opened so that all parts of the apparatus can be visited freely. Rats normally avoid brightly lit areas and will enter the dark compartment within a few seconds.
In the shock session the guillotine door between the compartments is lowered as soon as the rat has entered the dark compartment with its four paws, and a scrambled 1 mA footshock is admimstered for 2 sec. The rat is removed from the apparatus and put back into its home cage. The procedure during the retention session is identical to that of the habituation sessions.
The step-through latency, that is the first latency of entering the dark compartment
(in sec.) during the retention session is an index of the memory performance of the animal; the longer the latency to enter the dark compartment, the better the retention is. A testing compound in given half an hour before the shock session, together with
1 mg*kg_1 scopolamine. Scopolamine impairs the memory performance during the retention session 24 hours later. If the test compound increases the enter latency compared with the scopolamine-treated controls, is likely to possess cognition enhancing potential.
The Morris water escape task
The Morris water escape task measures spatial orientation learning in rodents. It is a test system that has extensively been used to investigate the effects of putative therapeutic on the cognitive functions of rats and mice. The performance of an animal is assessed in a circular water tank with an escape platform that is submerged about 1 cm below the surface of the water. The escape platform is not visible for an animal swimming in the water tank. Abundant extra-maze cues are provided by the furniture in the room, including desks, computer equipment, a second water tank, the presence of the experimenter, and by a radio on a shelf that is playing softly.
The animals receive four trials during five daily acquisition sessions. A trial is started by placing an animal into the pool, facing the wall of the tank. Each of four starting positions in the quadrants north, east, south, and west is used once in a series of four trials; their order is randomized. The escape platform is always in the same position.
A trial is terminated as soon as the animal had climbs onto the escape platform or when 90 seconds have elapsed, whichever event occurs first. The animal is allowed to stay on the platform for 30 seconds. Then it is taken from the platform and the next trial is started. If an animal did not find the platform within 90 seconds it is put on the platform by the experimenter and is allowed to stay there for 30 seconds. After the fourth trial of the fifth daily session, an additional trial is given as a probe trial: the platform is removed, and the time the animal spends in the four quadrants is measured for 30 or 60 seconds. In the probe trial, all animals start from the same start position, opposite to the quadrant where the escape platform had been positioned during acquisition.
Four different measures are taken to evaluate the performance of an animal during acquisition training: escape latency, traveled distance, distance to platform, and swimming speed. The following measures are evaluated for the probe trial: time (s) in quadrants and traveled distance (cm) in the four quadrants. The probe trial provides additional information about how well an animal learned the position of the escape platform. If an animal spends more time and swims a longer distance in the quadrant where the platform had been positioned during the acquisition sessions than in any other quadrant, one concludes that the platform position has been learned well.
In order to assess the effects of putative cognition enhancing compounds, rats or mice with specific brain lesions which impair cognitive functions, or animals treated with compounds such as scopolamine or MK-801, which interfere with normal learning, or aged animals which suffer from cognitive deficits, are used.
The T-maze spontaneous alternation task
The T-maze spontaneous alternation task (TeMCAT) assesses the spatial memory performance in mice. The start arm and the two goal arms of the T-maze are provided with guillotine doors which can be operated manually by the experimenter.
A mouse is put into the start arm at the beginning of training. The guillotine door is closed. In the first trial, the 'forced trial', either the left or right goal arm is blocked by lowering the guillotine door. After the mouse has been released from the start arm, it will negotiate the maze, eventually enter the open goal arm, and return to the start position, where it will be confined for 5 seconds, by lowering the guillotine door. Then, the animal can choose freely between the left and right goal arm (all guillotine-doors opened) during 14 'free choice' trials. As soon a the mouse has entered one goal arm, the other one is closed. The mouse eventually returns to the start arm and is free to visit whichever go alarm it wants after having been confined to the start arm for 5 seconds. After completion of 14 free choice trials in one session, the animal is removed from the maze. During training, the animal is never handled.
The percent alternations out of 14 trials is calculated. This percentage and the total time needed to complete the first forced trial and the subsequent 14 free choice trials
(in s) is analyzed. Cognitive deficits are usually induced by an injection of scopolamine, 30 min before the start of the training session. Scopolamine reduced the per-cent alternations to chance level, or below. A cognition enhancer, which is always administered before the training session, will at least partially, antagonize the scopolamine-induced reduction in the spontaneous alternation rate.
REFERENCES
1: Di Cunto F, Imarisio S, Hirsch E, Broccoli V, Bulfone A, Migheli A, Atzori C, Turco E, Triolo R, Dotto GP, Silengo L, Altruda F. Defective
neurogenesis in citron kinase knockout mice by altered cytokinesis and massive apoptosis. Neuron. 2000 Oct;28(l):l 15-27.
2: Di Cunto F, Calautti E, Hsiao J, Ong L, Topley G, Turco E, Dotto GP. Citron rho-interacting kinase, a novel tissue-specific ser/thr kinase encompassing the Rho-Rac-binding protein Citron. J Biol Chem. 1998 Nov 6;273(45):29706-l 1.
3: Madaule P, Furuyashiki T, Reid T, Ishizaki T, Watanabe G, Morii N, Narumiya S. A novel partner for the GTP-bound forms of rho and rac FEBS Lett. 1995 Dec 18;377(2):243-8.
4: Fujisawa K, Madaule P, Ishizaki T, Watanabe G, Bito H, Saito Y, Hall A, Narumiya S. Different regions of Rho determine Rho-selective binding of different classes of Rho target molecules. J Biol Chem. 1998 Jul 24;273(30): 18943-9.