WO2002103060A2 - Enterovirus nucleic acids and methods for detecting enterovirus - Google Patents

Abstract

The nucleotide sequence of coxsackie virus strain VD2921 is disclosed, as are nucleic acids having sequence similarity to VD 2921. Also disclosed are methods and materials for detecting and typing enterovirus infections, in particular, viruses associated with insulin dependent diabetes mellitus.

Description

ENTEROVIRUS NUCLEIC ACIDS

PRIORITY This application claims priority to Swedish Patent Application Serial Number

0102198-9, filed June 20, 2001, which is herein incorporated by reference in its entirety.

TECHNICAL FIELD

The invention relates to methods and materials involved in detecting and typing enteroviruses.

BACKGROUND

Diabetes is one of the most common chronic diseases worldwide. There are two main types of diabetes, type 1 (also known as Insulin Dependent Diabetes Mellitus (IDDM) or Juvenile diabetes mellitus) and type 2 (also known as Non Insulin Dependent Diabetes Mellitus (NIDDM)). Type 1 diabetes is common in children and young adults up to about 35 years of age while type 2 diabetes is common in elderly people.

Type 1 diabetes is an autoimmune process, involving T lymphocytes and autoantibodies, such as GAD65 and insulin autoantibodies, that leads to destruction of the insulin-producing β cells of the Islets of Langerhans in the pancreas. As a result, there is a lack of secretion of insulin to the blood, which, in turn, leads to high blood glucose levels. Increased blood glucose can be manifested as a state of glucose intolerance or prediabetes, or in other cases, blood glucose increases until clinical symptoms of diabetes, including thirst and increased urine amounts, are evident. In Type 2 diabetes, insulin secretion is not reduced and the β cells are not destroyed, as there is no autoimmune process. Rather, increased blood glucose is a result of insulin insensitivity, i.e., a reduced response to a normal, or even increased, amount of insulin.

Type 1 diabetes often starts in childhood with a peak incidence around puberty, although in the last two decades, an increased incidence has been observed in young children. In childhood, the incidence is similar in males and females, while in young adults, new cases are more frequent in males. Around 10% of all new cases have a close relative with the disease. In the vast majority of new cases (about 90 %), there is no close relative and no foregoing symptoms, and the disease is diagnosed when obvious clinical symptoms have occurred. Late diagnosis is associated with an increased risk of mortality at that time, mainly because of brain edema. Options for diagnosing type 1 diabetes before appearance of clinical symptoms are limited. While some autoimmune antibodies can be found in blood before clinical diagnosis, this information has so far not been of practical use for preventive measures. Detecting autoimmune antibodies may be useful for high-risk children, i.e., 10 % of future cases.

The etiology behind type 1 diabetes is unclear. There is a genetic predisposition connected with the HLA antigens on the sixth chromosome, but it has been proposed that some external agent is involved in the autoimmune process.

SUMMARY

The invention is based on the discovery of a diabetogenic strain of coxsackie virus ("VD2921") and the sequence of its genome. A comparison of the genomic sequence of VD2921 with the genomic sequence of other coxsackie B viruses (CBV) revealed mutations in both coding and noncoding regions of the VD2921 genome. As a result, the invention provides probes and primers for detecting, typing, and/or diagnosing diabetogenic enterovirus infections. For example, diabetogenic enterovirus RNA can be detected in peripheral blood mononuclear cells. Early detection of diabetes can improve prognosis by allowing treatment, e.g., with antiviral drugs, to prevent further loss of β cells and preventing severe long-term consequences of diabetes such as blindness, renal failure, and leg amputations.

The invention features a method for detecting enterovirus in a mammal. The method comprises providing a sample of nucleic acid from the mammal, and subjecting the nucleic acid to an amplification reaction that is capable of amplifying an enterovirus nucleic acid using a first oligonucleotide primer and a second oligonucleotide primer. The presence or absence of enterovirus is determined by the presence or absence of amplification product from the amplification reaction. The enterovirus can be a coxsackie B enterovirus. The mammal can be, e.g., a human, a pig, a rat or a mouse. The first primer can be the primer EBV-1, SEQ ID NO:4, and the second primer can be the primer EBV-5, SEQ ID NO:7. The subjecting step can include a first and a second amplification reaction, in which case, the first amplification reaction can use the EBV- 1 /EBV-5 primer pair, and the second amplification reaction can use the EBV-/EBV-4 primer pair. The amplification product can comprise nucleic acid from the VPl region of VD2921. The method can further comprise correlating the presence or absence of enterovirus with the presence or absence of a diabetic condition in the mammal. In some embodiments, the method further comprises the step of typing detected enterovirus using phylogenetic analysis. The sample can comprise peripheral blood mononuclear cells.

The invention also features a composition comprising a first oligonucleotide primer and a second oligonucleotide primer, wherein the first oligonucleotide primer has a sequence set forth in SEQ ID NO:4, and the second oligonucleotide primer has a sequence set forth in SEQ ID NO: 7.

The invention also features a composition comprising a first oligonucleotide primer and a second oligonucleotide primer, wherein the first oligonucleotide primer has a sequence set forth in SEQ ID NO:4, and the second oligonucleotide primer has a sequence set forth in SEQ ID NO:6.

The invention also features a composition comprising a first oligonucleotide primer and a second oligonucleotide primer, wherein the first oligonucleotide primer has a sequence set forth in SEQ ID NO:5, and the second oligonucleotide primer has a sequence set forth in SEQ ID NO:6.

In another aspect, the invention features an isolated nucleic acid 10 to 88 nucleotides in length, that has at least 92% sequence identity to nucleotides 1 to 87 of SEQ ID NO:l. The invention also features an isolated nucleic acid 10 to 425 nucleotides in length, that has at least 92% sequence identity to nucleotides 88 to 512 of SEQ ID NO: 1. The invention also features an isolated nucleic acid 10 to 231 nucleotides in length, that has at least 92% sequence identity to nucleotides 513 to 743 of SEQ ID NO : 1. The invention also features an isolated nucleic acid 30 to 744 nucleotides in length, that has 100% sequence identity to nucleotides 1 to 743 of SEQ ID NO:l.

In another aspect, the invention features an isolated nucleic acid 10 to 209 nucleotides in length, that has at least 77% sequence identity to nucleotides 744 to 952 of SEQ ID NO: 1. The invention features an isolated nucleic acid 10 to 774 nucleotides in length, that has at least 87% sequence identity to nucleotides 953 to 1726 of SEQ ID NO:l.

The invention also features an isolated nucleic acid 10 to 715 nucleotides in length, that has at least 87% sequence identity to nucleotides 1727 to 2441 of SEQ ID NO:l.

The invention features an isolated nucleic acid 10 to 855 nucleotides in length, that has at least 85% sequence identity to nucleotides 2442 to 3296 of SEQ ID NO: 1. The invention features an isolated nucleic acid 10 to 441 nucleotides in length, the nucleic acid having at least 85% sequence identity to nucleotides 3297 to 3737 of SEQ ID NO:l The invention features an isolated nucleic acid 10 to 296 nucleotides in length, that has at least 80% sequence identity to nucleotides 3738 to 4033 of SEQ ID NO:l.

The invention features an isolated nucleic acid 10 to 996 nucleotides in length, that has at least 83% sequence identity to nucleotides 4034 to 5029 of SEQ ID NO: 1.

The invention features an isolated nucleic acid 10 to 263 nucleotides in length, that has at least 75% sequence identity to nucleotides 5030 to 5292 of SEQ ID NO : 1.

The invention also features an isolated nucleic acid 10 to 56 nucleotides in length, that has at least 80% sequence identity to nucleotides 5293 to 5348 of SEQ ID NO:l.

The invention also features an isolated nucleic acid 10 to 560 nucleotides in length, that has at least 80% sequence identity to nucleotides 5349 to 5908 of SEQ ID NO:l.

The invention also features an isolated nucleic acid 10 to 1381 nucleotides in length, that has at least 95% sequence identity to nucleotides 5909 to 7289 of SEQ ID NO:l.

The invention also features an isolated nucleic acid 10 to 103 nucleotides in length, that has at least 83% sequence identity to nucleotides 7290 to 7392 of SEQ ID NO:l.

The invention also features an isolated nucleic acid comprising a nucleotide sequence encoding a polypeptide. The encoded polypeptide can be one of the following polypeptides of strain VD2921 : a polypeptide having at least 61% sequence identity to the VP4 polypeptide, a polypeptide having at least 92% sequence identity to the VP2 polypeptide, a polypeptide having at least 96% sequence identity to the VP3 polypeptide, a polypeptide having at least 92%) sequence identity to the VPl polypeptide. a polypeptide having at least 92% sequence identity to the P2A polypeptide, a polypeptide having at least 83% sequence identity to the P2B polypeptide, a polypeptide having at least 97% sequence identity to the P2C polypeptide, a polypeptide having at least 82% sequence identity to the P3A polypeptide, a polypeptide having at least 96% sequence identity to the P3B polypeptide, a polypeptide having at least 97% sequence identity to the P3C polypeptide, or a polypeptide having at least 93% sequence identity to the P3D polypeptide.

The invention also features an article of manufacture comprising packaging material, and first and second oligonucleotide primers associated with the packaging material. The primers are effective for amplifying nucleic acid of a coxsackie B virus strain, e.g., VD2921. The first primer can be the EBV-1 primer, SEQ ID NO:4. The second primer can be the EBV-5 primer, SEQ ID NO:7, or the EBV-4 primer, SEQ ID NO:6. Alternatively, the first primer can be the EBV-2 primer, SEQ ID NO:5, and the second primer can be the EBV-2 primer, SEQ ID NO:6.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. Other features and advantages of the invention will be apparent from the following detailed description, and from the claims.

DESCRIPTION OF DRAWINGS

Figure 1 shows the percent sequence identity the 5' non-translated regions (NTR) of VD2921 and other enteroviruses. Figure 2 is an amino acid sequence alignment of the VPl region of VD2921 and type strains of CVB serotypes 1-6. Figure 3 is an alignment of a portion of the 3' NTR of VD2921 and other enteroviruses.

DETAILED DESCRIPTION In general, the invention provides methods and materials (e.g., probes and primers) for detecting and/or typing enteroviruses. Enteroviruses are a genus of small, non-enveloped, positive-strand RNA viruses in the picomavirus family. Over 60 distinct enterovirus serotypes have been identified and grouped into the following main types: polio viruses, coxsackie A viruses, coxsackie B viruses (CBV), and echo viruses. The invention also provides methods for detecting and typing diabetogenic enteroviruses. The term "diabetogenic enterovirus" refers to an enterovirus that is associated with the development, or presence, of IDDM in patients. In other embodiments, the invention provides probes and primers that can be used to detect enteroviruses associated with a diabetic condition such as IDDM. The invention also relates to enterovirus strain VD2921 , which was isolated from a patient suffering from aseptic meningitis. Analysis of the VD2921 genome indicates sequence differences, both at the nucleotide and amino acid level, between this strain and other strains of CBV-serotype 4 viruses as well as other enteroviruses. Thus, in some embodiments, the invention provides probes and primers that have sequence similarity to VD2921, and as such, can be used to determine whether a subject is infected with

VD2921 or a strain related to VD2921. Furthermore, nucleic acids based on VD2921 sequences can be used to produce antibodies having specific binding affinity for VD2921 or VD2921 polypeptides.

Nucleic Acids

Isolated nucleic acid molecules of the invention are at least 10 nucleotides in length (e.g., 10, 15, 17, 20, 50, 100, 200, 300, 400, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, or more nucleotides in length). Such nucleic acid molecules have sequence similarity to the nucleotide sequence of the CBV-4 strain VD2921. As described below, the genome of VD2921 is 7392 bases in length, excluding the poly A-tract. The 5' NTR is 742 bases in length, followed by a PI region 2952 bases in length, a P2 region 1732 bases in length, a P3 region 2366 bases in length, and a 3' NTR 104 bases in length. A nucleic acid molecule is not required to contain each of the above regions; in fact, such a nucleic acid molecule can contain a single region (e.g., 5' NTR or PI region) or a portion of a single region (e.g., 10 contiguous nucleotides from the 5' NTR or VPl). Nucleic acid molecules that are less than full-length can be useful, for example, for diagnostic purposes (e.g., probes or primers).

The term "nucleic acid" as used herein encompasses both RNA and DNA, including cDNA, genomic DNA, synthetic (e.g., chemically synthesized) DNA, and nucleic acid analogs. The nucleic acid molecule can be double or single-stranded. Where single-stranded, the nucleic acid can be the sense strand or the antisense strand. In addition, nucleic acid can be circular or linear. Nucleic acid analogs can be modified at the base moiety, sugar moiety, or phosphate backbone to improve, for example, stability, hybridization, or solubility of the nucleic acid. Modifications at the base moiety include deoxyuridine for deoxythymidine, and 5-methyl-2'-deoxycytidine and 5-bromo-2'- doxycytidine for deoxycytidine. Modifications of the sugar moiety include modification of the 2' hydroxyl of the ribose sugar to form 2'-O-methyl or 2'-O-allyl sugars. The deoxyribose phosphate backbone can be modified to produce morpholino nucleic acids, in which each base moiety is linked to a six membered, morpholino ring, or peptide nucleic acids, in which the deoxyphosphate backbone is replaced by a pseudopeptide backbone and the four bases are retained. See, for example, Summerton and Weller, Antisense Nucleic Acid Drug Dev. (1997) 7(3): 187-195; and Hyrup et al. (1996) Bioorgan. Med. Chem. 4(1): 5-23. In addition, the deoxyphosphate backbone can be replaced with, for example, a phosphorothioate or phosphorodithioate backbone, a phosphoroamidite, or an alkyl phosphotriester backbone. The term "isolated" as used herein with reference to nucleic acid refers to a naturally-occurring nucleic acid that is not immediately contiguous with both of the sequences with which it is immediately contiguous (one on the 5' end and one on the 3' end) in the naturally-occurring genome of the organism from which it is derived. For example, an isolated nucleic acid can be, without limitation, a recombinant nucleic acid molecule of any length, provided one of the nucleic acid sequences normally found immediately flanking that recombinant nucleic acid molecule in a naturally-occurring genome is removed or absent. Thus, an isolated nucleic acid includes, without limitation, a recombinant nucleic acid that exists as a separate molecule (e.g., a cDNA or a genomic DNA fragment produced by PCR or restriction endonuclease treatment) independent of other sequences as well as recombinant nucleic acid that is incorporated into a vector, an autonomously replicating plasmid, a virus (e.g., a retro virus, adeno virus, or herpes virus), or into the genome of a prokaryote or eukaryote. In addition, an isolated nucleic acid can include a recombinant nucleic acid molecule that is part of a hybrid or fusion nucleic acid sequence.

The term "isolated" as used herein with reference to nucleic acid also includes any non-naturally-occurring nucleic acid since non-naturally-occurring nucleic acid sequences are not found in nature and do not have immediately contiguous sequences in a naturally occurring genome. For example, non-naturally-occurring nucleic acid such as an engineered nucleic acid is considered to be isolated nucleic acid. Engineered nucleic acid can be made using common molecular cloning or chemical nucleic acid synthesis techniques. Isolated non-naturally-occurring nucleic acid can be independent of other sequences, or incorporated into a vector, an autonomously replicating plasmid, a virus (e.g., a retrovirus, adenovirus, or herpes virus), or the genomic DNA of a prokaryote or eukaryote. In addition, a non-naturally-occurring nucleic acid can include a nucleic acid molecule that is part of a hybrid or fusion nucleic acid sequence. A nucleic acid existing among hundreds to millions of other nucleic acid molecules within, for example, cDNA or genomic libraries, or gel slices containing a genomic DNA restriction digest is not to be considered an isolated nucleic acid.

The invention provides isolated nucleic acid molecules that contain a nucleic acid sequence having (1) a length, and (2) a percent identity to an identified nucleic acid sequence over that length. For example, a nucleic acid molecule can be at least 10 nucleotides in length and have at least 70% (e.g., 75, 80, 85, 90, 92, 95, or 99%) sequence identity to nucleotides 1 to 742, 1 to 87, 86 to 599, 100 to 120, 121 to 141, 142 to 162, 230 to 250, 235 to 265, 300 to 320, 315 to 335, 320 to 340, 330 to 350, 340 to 360, 370 to 390, 380 to 400, 470 to 490, 490 to 500, 513 to 561, or 655 to 742 of the 5' NTR of VD2921. Nucleic acid molecules having at least 70% sequence identity to nucleotides 655 to 742 (i.e., the hypervariable region in the 5' NTR of VD2921) or at least 91% sequence identity to nucleotides 1 to 742 are particularly useful.

The invention provides an isolated nucleic acid molecule that contains the entire VD2921 nucleic acid sequence set forth in SEQ ID NO:l. In addition, the invention provides isolated nucleic acid molecules that contain a portion of the VD2921 nucleic acid sequence set forth in SEQ ID NO: 1. For example, the invention provides an isolated nucleic acid molecule that contains a 15 nucleotide sequence identical to any 15 nucleotide sequence set forth in the VD2921 sequence of SEQ ID NO:l including, without limitation, the sequence starting at nucleotide number 1 and ending at nucleotide number 15, the sequence starting at nucleotide number 2 and ending at nucleotide number 16, the sequence starting at nucleotide number 3 and ending at nucleotide number 17, and so forth. It will be appreciated that the invention also provides isolated nucleic acid molecules that contain a nucleotide sequence that is greater than 15 nucleotides (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more nucleotides) in length and identical to any portion of the VD2921 sequence set forth in SEQ ID NO: 1. For example, the invention provides an isolated nucleic acid molecule that contains a 25 nucleotide sequence identical to any 25 nucleotide sequence set forth in the VD2921 sequence of SEQ ID NO:l including, without limitation, the sequence starting at nucleotide number 1 and ending at nucleotide number 25, the sequence starting at nucleotide number 2 and ending at nucleotide number 26, the sequence starting at nucleotide number 3 and ending at nucleotide number 27, and so forth. Additional examples include, without limitation, isolated nucleic acid molecules that contain a nucleotide sequence that is 50 or more nucleotides (e.g., 100, 150, 200, 250, 300, 350, or more nucleotides) in length and identical to any portion of the sequence set forth in SEQ ID NO: 1.

In addition, the invention provides isolated nucleic acid molecules that contain a variation of the nucleic acid sequence set forth in SEQ ID NO: 1. For example, the invention provides an isolated nucleic acid molecule containing a nucleic acid sequence set forth in SEQ ID NO:l that contains a single insertion, a single deletion, a single substitution, multiple insertions, multiple deletions, multiple substitutions, or any combination thereof (e.g., single deletion together with multiple insertions). The invention also provides isolated nucleic acid molecules that contain a variant of a portion of the VD2921 nucleic acid sequence set forth in SEQ ID NO:l as described herein. In some embodiments, an isolated nucleic acid has sequence similarity to the PI region of the VD2921 genome. Such nucleic acids have a length and sequence identity as described herein, e.g., a length from 10 to 210 nucleotides, and at least 77% sequence identity to nucleotides 743 to 952 of SEQ ID NO: 1. Other such nucleic acids can have a length from 10 to 773 nucleotides and at least 87% sequence identity to nucleotides 953 to 1726 of SEQ ID NO:l. Other nucleic acids of these embodiments can have a length of 10 to 715 nucleotides in length, and at least 87% sequence identity to nucleotides 1727 to 2441 of SEQ ID NO:l. Other such nucleic acids have a length from 10 to 855 nucleotides, and at least 85% sequence identity to nucleotides 2442 to 3296 of SEQ ID NO:l.

In some embodiments, an isolated nucleic acid has sequence similarity to the P2 region of the VD2921 genome. Such nucleic acids have a length and sequence identity as described herein, e.g., a length of from 10 to 441 nucleotides, and at least 85% sequence identity to nucleotides 3297 to 3737 of SEQ ID NO: 1. Other such nucleic acids have a length of from 10 to 296 nucleotides, and at least 80% sequence identity to nucleotides 3738 to 4033 of SEQ ID NO:l. Other such nucleic acids of these embodiments have a length of from 10 to996 nucleotides in length, and at least 83% sequence identity to nucleotides 4034 to 5029 of SEQ ID NO:l.

In some embodiments, an isolated nucleic acid has sequence similarity to the P3 region of the VD2921 genome. Such nucleic acids have a length and sequence identity as described herein, e.g., a length of from 10 to 263 nucleotides in length, and at least 75% sequence identity to nucleotides 5030 to 5292 of SEQ ID NO: 1. Other such nucleic acids have a length of from 10 to 56 nucleotides, and at least 80% sequence identity to nucleotides 5293 to 5348 of SEQ ID NO:l. Other such nucleic acids of these embodiments have a length of from 10 to 560 nucleotides, and at least 80% sequence identity to nucleotides 5349 to 5908 of SEQ ID NO: 1. Other such nucleic acids of these embodiments have a length of from 10-1390 nucleotides and at least 95% sequence identity to nucleotides 5909 to 7289 of SEQ ID NO.T .

In some embodiments, an isolated nucleic acid has sequence similarity to the 3' NTR region of the VD2921 genome. Such nucleic acids have a length and sequence identity as described herein, e.g., a length of from 10 to 103 nucleotides, and at least 83% sequence identity to nucleotides 7290 to 7392 of SEQ ID NO:l.

The invention also provides isolated nucleic acid molecules that contain the entire nucleic acid sequence set forth in one of the following SEQ ID NOs:8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19.

Nucleic Acids Encoding Polypeptides

The invention also provides isolated nucleic acid molecules that encode a polypeptide that contains an amino acid sequence having (1) a length, and (2) a percent identity to an identified amino acid sequence over that length. As used herein, the term "polypeptide" refers to a chain of at least 10 amino acid residues (e.g., 10, 20, 50, 75, 100, 200, or more than 200 residues), regardless of post-translational modification (e.g., phosphorylation or glycosylation).

The invention provides isolated nucleic acid molecules that encode the entire VD2921 polyprotein amino acid sequence set forth in SEQ ID NO:2. In addition, the invention provides isolated nucleic acid molecules that contain a nucleic acid sequence that encodes a portion of the amino acid sequence set forth in SEQ ID NO:2. For example, the invention provides isolated nucleic acid molecules that contain a nucleic acid sequence that encodes a 5 amino acid sequence identical to any 5 amino acid sequence set forth in SEQ ID NO:2 including, without limitation, the sequence starting at amino acid residue number 1 and ending at amino acid residue number 5, the sequence starting at amino acid residue number 2 and ending at amino acid residue number 6, the sequence starting at amino acid residue number 3 and ending at amino acid residue number 7, and so forth. It will be appreciated that the invention also provides isolated nucleic acid molecules that contain a nucleic acid sequence that encodes an amino acid sequence that is greater than 5 amino acid residues (e.g., 6, 7, 8, 9, 10, 15, 20, 50, 100, 200, or more amino acid residues) in length and identical to any portion of the sequence set forth in SEQ ID NO:2. For example, the invention provides isolated nucleic acid molecules that contain a nucleic acid sequence that encodes a 15 amino acid sequence identical to any 15 amino acid sequence set forth in SEQ ID NO:2 including, without limitation, the sequence starting at amino acid residue number 1 and ending at amino acid residue number 15, the sequence starting at amino acid residue number 2 and ending at amino acid residue number 16, the sequence starting at amino acid residue number 3 and ending at amino acid residue number 17, and so forth.

In addition, the invention provides an isolated nucleic acid molecule that encodes an amino acid sequence having a variation of the amino acid sequence set forth in SEQ ID NO:2. For example, the invention provides isolated nucleic acid molecules encoding an amino acid sequence set forth in SEQ ID NO:2 that contains a single insertion, a single deletion, a single substitution, multiple insertions, multiple deletions, multiple substitutions, or any combination thereof (e.g., single deletion together with multiple insertions). The invention also provides isolated nucleic acid molecules encoding an amino acid sequence that contains a variant of a portion of the amino acid sequence set forth in SEQ ID NO:2 as described herein.

In some embodiments, an isolated nucleic acid encoding a polypeptide has sequence similarity to the PI region of the VD2921 genome. Such nucleic acids have a length and sequence identity as described herein. For example, such a nucleic acid molecules can encode a polypeptide having at least 61% (e.g., 70, 80, 90, 95, or 99%) sequence identity with the VP4 region of VD2921. In some embodiments, such a polypeptide comprises the amino acid sequence LPALNSPT (SEQ ID NO:20), e.g., the amino acid sequence VMIKSLPALNSPTVEECG (SEQ ID NO:21). In some instances, a nucleic acid of such embodiments encodes a polypeptide having at least 92% sequence identity to the VP2 polypeptide of VD2921. A nucleic acid of such embodiments can encode a polypeptide having at least 96% sequence identity to the VP3 polypeptide of BD2921, e.g., a polypeptide having the amino acid sequence at positions 57-82, or 181- 238 of the VP3 polypeptide. A nucleic acid of such embodiments can encode a polypeptide having at least 92% sequence identity to the VP 1 polypeptide of VD2921. In some embodiments, an isolated nucleic acid encoding a polypeptide has sequence similarity to the P2 region of the VD2921 genome. Such nucleic acids have a length and sequence identity as described herein. For example, such a nucleic acid molecules can encode a polypeptide having at least 92% sequence identity to the P2A polypeptide. A nucleic acid of such embodiments can encode a polypeptide having at least 83% sequence identity to the P2B polypeptide, e.g., a polypeptide having the amino acid sequence at positions 87-98 of the P2B polypeptide. Alternatively, a nucleic acid of such embodiments can encode a polypeptide having at least 97% sequence identity to the P2C polypeptide.

In some embodiments, an isolated nucleic acid encoding a polypeptide has sequence similarity to the P3 region of the VD2921 genome. Such nucleic acids have a length and sequence identity as described herein. For example, such a nucleic acid molecule can encode a polypeptide having at least 82% sequence identity to the P3 A polypeptide, or at least 96% sequence identity to the P3B polypeptide, or at least 97% sequence identity to the P3C polypeptide. Alternatively, such a nucleic acid can encode a polypeptide having at least 93% sequence identity to the P3D polypeptide, e.g., a polypeptide having the amino acid sequence GXXSGXXXTXXXNS (SEQ ID NO:22) or the amino acid sequence YGDD (SEQ ID NO:23).

Length and Sequence Identity Typically, a identified nucleic acid or amino acid sequence is a sequence referenced by a particular sequence identification number, and the nucleic acid or amino acid sequence being compared to the identified sequence is referred to as the target sequence. For example, an identified sequence can be nucleotides 744-952 of the sequence set forth in SEQ ID NO: 1. A length, and percent identity over that length, for any nucleic acid or amino acid sequence is determined as follows. First, a nucleic acid or amino acid sequence is compared to the identified nucleic acid or amino acid sequence using the BLAST 2 Sequences (B12seq) program from the stand-alone version of BLASTZ containing BLASTN version 2.0.14 and BLASTP version 2.0.14. A standalone version of BLASTZ can be obtained at www.fr.com/blast or at www.ncbi.nlm.nih.gov. Instructions explaining how to use the B12seq program can be found in the readme file accompanying BLASTZ. B12seq performs a comparison between two sequences using either the BLASTN or BLASTP algorithm. BLASTN is used to compare nucleic acid sequences, while BLASTP is used to compare amino acid sequences. To compare two nucleic acid sequences, the options are set as follows: -i is set to a file containing the first nucleic acid sequence to be compared (e.g., C:\seql.txt); -j is set to a file containing the second nucleic acid sequence to be compared (e.g., C:\seq2.txt); -p is set to blastn; -o is set to any desired file name (e.g., C:\output.txt); -q is set to -1 ; -r is set to 2; and all other options are left at their default setting. For example, the following command can be used to generate an output file containing a comparison between two nucleic acid sequences: C:\B12seq -i c:\seql .txt -j c:\seq2.txt -p blastn -o c:\output.txt -q -1 -r 2. To compare two amino acid sequences, the options of B12seq are set as follows: -i is set to a file containing the first amino acid sequence to be compared (e.g., C:\seql.txt); -j is set to a file containing the second amino acid sequence to be compared (e.g., C:\seq2.txt); -p is set to blastp; -o is set to any desired file name (e.g., C:\outputtxt); and all other options are left at their default setting. For example, the following command can be used to generate an output file containing a comparison between two amino acid sequences: C:\B12seq -i c:\seql .txt -j c:\seq2.txt -p blastp -o c:\output.txt. If the target sequence shares homology with any portion of the identified sequence, then the designated output file will present those regions of homology as aligned sequences. If the target sequence does not share homology with any portion of the identified sequence, then the designated output file will not present aligned sequences. Once aligned, a length is determined by counting the number of consecutive nucleotides or amino acid residues from the target sequence presented in alignment with sequence from the identified sequence starting with any matched position and ending with any other matched position. A matched position is any position where an identical nucleotide or amino acid residue is presented in both the target and identified sequence. Gaps presented in the target sequence are not counted since gaps are not nucleotides or amino acid residues. Likewise, gaps presented in the identified sequence are not counted since target sequence nucleotides or amino acid residues are counted, not nucleotides or amino acid residues from the identified sequence. The percent identity over a given length is determined by counting the number of matched positions over that length and dividing that number by the length followed by multiplying the resulting value by 100. For example, if (1) a 1000 nucleotide target sequence is compared to the VD2921 sequence set forth in SEQ ID NO:l, (2) the B12seq program presents 200 nucleotides from the target sequence aligned with a region of the VD2921 sequence set forth in SEQ ID NO: 1 where the first and last nucleotides of that 200 nucleotide region are matches, and (3) the number of matches over those 200 aligned nucleotides is 180, then the 1000 nucleotide target sequence contains a length of 200 and a percent identity over that length of 90 (i.e., 180 ÷ 200 * 100 = 90).

It will be appreciated that a single nucleic acid or amino acid target sequence that aligns with an identified sequence can have many different lengths with each length having its own percent identity. For example, a target sequence containing a 20 nucleotide region that aligns with an identified sequence as shown below has many different lengths including those listed in Table 1.

1 20 Target Sequence: AGGTCGTGTACTGTCAGTCA

Identified Sequence: ACGTGGTGAACTGCCAGTGA

Table 1

It is noted that the percent identity value is rounded to the nearest tenth. For example, 78.11, 78.12, 78.13, and 78.14 is rounded down to 78.1, while 78.15, 78.16, 78.17, 78.18, and 78.19 is rounded up to 78.2. It is also noted that the length value will always be an integer.

In some embodiments, nucleic acid molecule of the invention hybridize, under hybridization conditions, to a sense or antisense strand of a nucleic acid having the VD2921 sequence set forth in SEQ ID NO:l. The hybridization conditions can be moderately or highly stringent hybridization conditions.

For the purpose of this invention, moderately stringent hybridization conditions mean the hybridization is performed at about 42°C in a hybridization solution containing 25 mM KPO₄ (pH 7.4), 5X SSC, 5X Denhart's solution, 50 μg/mL denatured, sonicated salmon sperm DNA, 50% formamide, 10% Dextran sulfate, and 1-15 ng/mL probe (about 5 l0⁷ cpm/μg), while the washes are performed at about 50°C with a wash solution containing 2X SSC and 0.1% sodium dodecyl sulfate.

Highly stringent hybridization conditions mean the hybridization is performed at about 42°C in a hybridization solution containing 25 mM KPO₄ (pH 7.4), 5X SSC, 5X Denhart's solution, 50 μg/mL denatured, sonicated salmon sperm DNA, 50% formamide, 10% Dextran sulfate, and 1-15 ng/mL probe (about 5x10⁷ cpm/μg), while the washes are performed at about 65°C with a wash solution containing 0.2X SSC and 0.1% sodium dodecyl sulfate.

Production of isolated nucleic acid molecules

Isolated nucleic acid molecules of the invention can be produced by any method, including, without limitation, common molecular cloning and chemical nucleic acid synthesis techniques. For example, polymerase chain reaction (PCR) techniques can be used to obtain an isolated VD2921 nucleic acid molecule. PCR refers to a procedure or technique in which target nucleic acids are enzymatically amplified. Sequence information from the ends of the region of interest or beyond typically is employed to design oligonucleotide primers that are identical in sequence to opposite strands of the template to be amplified. A primer need not reflect the exact sequence of the template but must be sufficiently complementary to specifically hybridize with a template. It is understood that the term "primer," when directed to a sequence that encodes a defined . peptide sequence, specifically encompasses degenerate primers. PCR can be used to amplify specific sequences from DNA as well as RNA, including sequences from total genomic DNA or total cellular RNA. Primers are typically 10 to 50 nucleotides in length, but can range from 10 nucleotides to hundreds of nucleotides in length. General PCR techniques are described, for example in PCR Primer: A Laboratory Manual Ed. by Dieffenbach, C. and Dveksler, G, Cold Spring Harbor Laboratory Press, 1995. When using RNA as a source of template, reverse transcriptase can be used to synthesize complementary DNA (cDNA) strands. Ligase chain reaction, strand displacement amplification, self-sustained sequence replication or nucleic acid sequence-based amplification also can be used to obtain isolated nucleic acids. See, for example, Lewis (1992) Genetic Engineering News 12(9):1; Guatelli et al. (1990) Proc. Natl. Acad. Sci. USA 87:1874-1878; and Weiss (1991) Science 254:1292- 1293.

In some embodiments, a primer is a single-stranded or double-stranded oligonucleotide that, and when combined with DNA (e.g., cDNA) and subjected to PCR conditions, is capable of being extended to produce a nucleic acid product corresponding to a region of a VD2921 nucleic acid molecule. Typically, a VD2921 PCR product is 25 to 3000 nucleotides in length (e.g., 30, 35, 50, 100, 250, 500, 600, 1000, 1500, 1600, or more nucleotides in length). Primers such as those listed in Table 2 are particularly useful for producing PCR products.

Specific regions of DNA can be amplified (i.e., replicated such that multiple exact copies are produced) when a pair of oligonucleotide primers is used. For example, to detect VD2921 nucleic acid, a sample suspected of containing viral RNA can be reverse- transcribed using an antisense primer (e.g., a primer that anneals to positions 622 to 640 of the 5' -NTR) and the resulting cDNA amplified using one primer containing a nucleotide sequence from the sense strand of a VD2921 nucleic acid and the other primer containing a nucleotide sequence from the antisense strand. In some embodiments, a second pair of oligonucleotide primers can be used to amplify a region within the amplified product. The second pair of oligonucleotide primers may or may not have a primer in common with the first pair of primers. PCR reaction mixtures may contain a plurality of oligonucleotide primer pairs, in which case multiple PCR products can be generated. Each primer pair can amplify, for example, one region or a portion of one region.

Specific PCR conditions typically are defined by the concentration of salts (e.g., MgCl₂) in the reaction buffer, and by the temperatures utilized for melting, annealing, and extension. Specific concentrations or amounts of primers, templates, deoxynucleotides (dNTPs), and DNA polymerase also may be set out. For example, PCR conditions with a buffer containing 2.5 mM MgCl₂, and melting, annealing, and extension temperatures of 94°C, 45-65°C, and 72°C, respectively, are particularly useful. Under such conditions, a PCR sample can include, for example, 50 to 100 ng of each primer, 0.2 mmol/L dNTPs, 2 to 4 U DNA polymerase (e.g., Taq DNA polymerase), and the appropriate amount of buffer as specified by the manufacturer of the polymerase (e.g., IX Taq polymerase buffer). Denaturation, annealing, and extension each may be carried out for 30 seconds per cycle, with, for example, a total of 30 to 40 cycles. An initial denaturation step (e.g., 94°C for 4 minutes) and a final elongation step (e.g., 72°C for 5 minutes) also may be useful.

The size of the amplified products can be determined by electrophoresis (e.g., through an agarose gel) and staining with a DNA intercalating agenfsuch as ethidium bromide. Amplified products also can be sequenced.

Isolated nucleic acids of the invention also can be chemically synthesized, either as a single nucleic acid molecule (e.g., using automated DNA synthesis in the 3' to 5' direction using phosphoramidite technology) or as a series of oligonucleotides. For example, one or more pairs of long oligonucleotides (e.g., > 100 nucleotides) can be synthesized that contain the desired sequence, with each pair containing a short segment of complementarity (e.g., about 15 nucleotides) such that a duplex is formed when the oligonucleotide pair is annealed. DNA polymerase is used to extend the oligonucleotides, resulting in a single, double-stranded nucleic acid molecule per oligonucleotide pair, which then can be ligated into a vector. Isolated nucleic acids of the invention also can be obtained by mutagenesis. For example, VD291 sequence can be mutated using standard techniques including oligonucleotide-directed mutagenesis and site-directed mutagenesis through PCR. See, . Short Protocols in Molecular Biology, Chapter 8, Green Publishing Associates and John Wiley & Sons, Edited by Ausubel et al., 1992. Examples of positions that can be modified are described above and in Example 5, as well as in the alignments of Figures 2- 4. Possible mutations include, without limitation, deletions, insertions, and substitutions, as well as combinations of deletions, insertions, and substitutions.

In addition, nucleic acid and amino acid databases (e.g., GenBank^®) can be used to obtain an isolated nucleic acid molecule within the scope of the invention. For example, any nucleic acid having some sequence homology to the VD2921 sequence set forth in SEQ ID NO: 1 can be used as a query to search GenBank^®. Further, any polypeptide having some amino acid sequence homology to a polypeptide in any region of the VD2921 polyprotein sequence set forth in SEQ ID NO:2 can be used as a query to search GenBank^®.

Further, nucleic acid hybridization techniques can be used to obtain an isolated nucleic acid molecule within the scope of the invention. Briefly, any nucleic acid molecule having some homology to a sequence set forth in SEQ ID NO:l can be used as a probe to identify a similar nucleic acid by hybridization under conditions of moderate to high stringency. Once identified, the nucleic acid molecule then can be purified, sequenced, and analyzed to determine whether it is within the scope of the invention as described herein. The term "probe" as used herein refers to an oligonucleotide that binds through complementary base pairing to a subsequence of a target nucleic acid. A primer may be a probe. It will be understood by one of skill in the art that probes typically substantially bind target sequences lacking complete complementarity with the probe sequence depending upon the stringency of the hybridization conditions. By assaying for the presence or absence of the probe, one can detect the presence or absence of the target. Hybridization can be done by Southern or Northern analysis to identify a DNA or RNA sequence, respectively, that hybridizes to a probe. Suitable hybridization conditions are set out above. The probe can be labeled with a biotin, digoxygenin, an enzyme, or a radioisotope such as ³²P. The DNA or RNA to be analyzed can be electrophoretically separated on an agarose or polyacrylamide gel, transferred to nitrocellulose, nylon, or other suitable membrane, and hybridized with the probe using standard techniques well known in the art such as those described in sections 7.39-7.52 of Sambrook et al, (1989) Molecular Cloning, second edition, Cold Spring harbor Laboratory, Plainview, NY. Typically, a probe is at least about 20 nucleotides in length.

Methods of Using Nucleic Acid Molecules

Nucleic acid molecules of the invention can be used to detect an enterovirus. In general, enteroviruses can be detected in RNA samples (e.g., from peripheral blood cells, plasma cells, or serum) from mammals (e.g., human subjects, including adults and children) by amplifying entero viral nucleic acid sequences (as discussed above).

Nucleic acid molecules also can be used to type an enterovirus (i.e., determine the specific serotype of the enterovirus). While nucleic acid molecules useful for typing enteroviruses can be from any part of the enteroviral genome, the most variable regions of the enteroviral genome are within the genes encoding the capsid proteins VPl, VP2, and VP3, which are partially exposed on the virus surface. In particular, VPl encodes major antigenic sites and most type-specific neutralization determinants. For example, the NH₂- terminal part of VPl, encompassing the B-C loop, is a major antigenic region. Thus, in some embodiments, the VP1-P2C region can be amplified and used to type an enterovirus. As described herein, the amino acid sequence of the VPl polypeptide from ^• VD2921 contains 17 amino acid substitutions (see Example 5) relative to other enteroviral sequences, which are located on the surface near the icosahedral five-fold axis. The substitutions are located very near to the canyon and may affect interactions with cellular receptors. Amino acid sequence variations also are present in non-structural proteins, involving protease 2 A, proteins 2B, 2C and 3 A and viral polymerase 3D. Such sequence variations can affect virulence and ability to establish persistent infections.

VD2921 polypeptides

The invention provides purified VD2921 polypeptides that are encoded by the nucleic acid molecules of the invention. A VD2921 polypeptide may have an amino acid sequence that is identical to that of SEQ ID NO:2. Alternatively, a VD2921 polypeptide can include an amino acid sequence variant. As used herein, an amino acid sequence variant refers to a deletion, insertion, or substitution at one or more amino acid positions - (e.g., 1, 2, 3, 10, or more than 10 positions), provided that the polypeptide has an amino acid sequence that is at least 60% identical (e.g., 60%, 70%, 80%, 85%, 90%, 95%, or 99% identical) over its length to the corresponding region of the sequences set forth in SEQ ID NO:2. Percent sequence identity is determined as set forth herein.

Amino acid substitutions may be conservative or non-conservative. Conservative amino acid substitutions replace an amino acid with an amino acid of the same class, whereas non-conservative amino acid substitutions replace an amino acid with an amino acid of a different class. Conservative amino acid substitutions typically have little effect on the structure or function of a polypeptide. Examples of conservative substitutions include amino acid substitutions within the following groups: glycine and alanine; valine, isoleucine, and leucine; aspartic acid and glutamic acid; asparagine, glutamine, serine, and threonine; lysine, histidine, and arginine; and phenylalanine and tyrosine.

Non-conservative substitutions may result in a substantial change in the hydrophobicity of the polypeptide or in the bulk of a residue side chain. In addition, non- conservative substitutions may make a substantial change in the charge of the polypeptide, such as reducing electropositive charges or introducing electronegative charges. Examples of non-conservative substitutions include a basic amino acid for a non-polar amino acid, or a polar amino acid for an acidic amino acid.

The term "purified" as used herein with reference to a polypeptide refers to a polypeptide that either has no naturally occurring counterpart (e.g., a peptidomimetic), has been chemically synthesized and is thus uncontaminated by other polypeptides, or has been separated or purified from other components by which it is naturally accompanied (e.g., other viral proteins or polynucleotides). Typically, the polypeptide is considered "purified" when it is at least 70% (e.g., 70%, 80%, 90%, 95%, or 99%), by dry weight, free from the proteins and naturally occurring organic molecules with which it naturally associates.

Production ofVD2921 polypeptides

VD2921 polypeptides can be produced by a number of methods, many of which are well known in the art. For example, VD2921 polypeptides can be produced by standard recombinant technology, using expression vectors encoding VD2921 polypeptides. The resulting VD2921 polypeptides then can be purified. Expression systems that can be used for small or large scale production of VD2921 polypeptides include, without limitation, microorganisms such as bacteria (e.g., E. coli and B. subtilis) transformed with recombinant bacteriophage DNA, plasmid DNA, or cosmid DNA expression vectors containing the nucleic acid molecules of the invention; yeast (e.g., S. cerevisiae) transformed with recombinant yeast expression vectors containing the nucleic acid molecules of the invention; insect cell systems infected with recombinant virus expression vectors (e.g., baculovirus) containing the nucleic acid molecules of the invention; plant cell systems infected with recombinant virus expression vectors (e.g., tobacco mosaic virus) or transformed with recombinant plasmid expression vectors (e.g., Ti plasmid) containing the nucleic acid molecules of the invention; or mammalian cell systems (e.g., primary cells or immortalized cell lines such as COS cells, Chinese hamster ovary cells, HeLa cells, human embryonic kidney 293 cells, and 3T3 LI cells) harboring recombinant expression constructs containing promoters derived from the genome of mammalian cells (e.g., the metallothionein promoter) or from mammalian viruses (e.g., the adenovirus late promoter and the cytomegalovirus promoter), along with the nucleic acids of the invention.

Suitable methods for purifying the polypeptides of the invention can include, for example, affinity chromatography, immunoprecipitation, size exclusion chromatography, and ion exchange chromatography. The extent of purification can be measured by any appropriate method, including but not limited to: column chromatography, polyacrylamide gel electrophoresis, or high-performance liquid chromatography. VD2921 polypeptides also can be "engineered" to contain a tag sequence described herein that allows the polypeptide to be purified (e.g., captured onto an affinity matrix). Immunoaffmity chromatography also can be used to purify VD2921 polypeptides.

Anti-VD2921 Antibodies

The invention also provides antibodies having specific binding activity for

VD2921 and VD2921 polypeptides. Such antibodies can be useful for diagnostic purposes (e.g., an antibody that specifically recognizes a VD2921 polypeptide, could be used to diagnose a diabetogenic enteroviral infection). Antibodies that are able to neutralize virus are particularly useful. Such antibodies typically are considered to be of high affinity, and are usually type-specific.

"Antibody" or "antibodies" includes intact molecules as well as fragments thereof that are capable of binding to an epitope of VD2921 or a VD2921 polypeptide. The term

"epitope" refers to an antigenic determinant on an antigen to which an antibody binds.

Epitopes usually consist of chemically active surface groupings of molecules such as amino acids or sugar side chains, and typically have specific three-dimensional structural characteristics, as well as specific charge characteristics. Epitopes generally have at least five contiguous amino acids. The terms "antibody" and "antibodies" include polyclonal antibodies, monoclonal antibodies, humanized or chimeric antibodies, single chain Fv antibody fragments, Fab fragments, and F(ab)₂ fragments. Polyclonal antibodies are heterogeneous populations of antibody molecules that are specific for a particular antigen, while monoclonal antibodies are homogeneous populations of antibodies to a particular epitope contained within an antigen. Monoclonal antibodies are particularly useful. In general, a VD2921 polypeptide is produced as described above, i.e., recombinantly, by chemical synthesis, or by purification of the native protein, and then used to immunize animals. For example, a VPl polypeptide can be used to immunize an animal. Various host animals including, for example, rabbits, chickens, mice, guinea pigs, and rats, can be immunized by injection of the protein of interest. Depending on the host species, adjuvants can be used to increase the immunological response and include Freund's adjuvant (complete and/or incomplete), mineral gels such as aluminum hydroxide, surface-active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, and dinitrophenol. Polyclonal antibodies are contained in the sera of the immunized animals. Monoclonal antibodies can be prepared using standard hybridoma technology. In particular, monoclonal antibodies can be obtained by any technique that provides for the production of antibody molecules by continuous cell lines in culture as described, for example, by Kohler et al. (1975) Nature 256:495-497, the human B-cell hybridoma technique of Kosbor et al. (1983) Immunology Today 4:72, and Cote et al. (1983) Proc. Natl. Acad. Sci. USA 80:2026-2030, and the EBV-hybridoma technique of Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc. pp. 77-96 (1983). Such antibodies can be of any immunoglobulin class including IgM, IgG, IgE, IgA, IgD, and any subclass thereof. The hybridoma producing the monoclonal antibodies of the invention can be cultivated in vitro or in vivo. A chimeric antibody is a molecule in which different portions are derived from different animal species, such as those having a variable region derived from a mouse monoclonal antibody and a human immunoglobulin constant region. Chimeric antibodies can be produced through standard techniques.

Antibody fragments that have specific binding affinity for VD2921 or VD2921 polypeptides can be generated by known techniques. Such antibody fragments include, but are not limited to, F(ab') fragments that can be produced by pepsin digestion of an antibody molecule, and Fab fragments that can be generated by deducing the disulfide bridges of F(ab')₂ fragments. Alternatively, Fab expression libraries can be constructed. See, for example, Huse et al. (1989) Science 246:1275-1281. Single chain Fv antibody fragments are formed by linking the heavy and light chain fragments of the Fv region via an amino acid bridge (e.g., 15 to 18 amino acids), resulting in a single chain polypeptide. Single chain Fv antibody fragments can be produced through standard techniques, such as those disclosed in U.S. Patent No. 4,946,778.

Once produced, antibodies or fragments thereof can be tested for recognition of VD2921 or a VD2921 polypeptide by standard immunoassay methods including, for example, enzyme-linked immunosorbent assay (ELISA) or radioimmuno assay (RIA). See, Short Protocols in Molecular Biology, eds. Ausubel et al., Green Publishing Associates and John Wiley & Sons (1992). Suitable antibodies typically have equal binding affinities for recombinant and native proteins.

Detecting Diabetogenic Enteroviruses

Nucleic acid molecules of the invention also can be used to detect enteroviruses associated with a diabetic condition (e.g., IDDM) in a mammal. In general, diabetogenic enteroviruses can be detected in samples (e.g., from peripheral blood cells, plasma cells, or serum) from mammals (e.g., human subjects, including adults and children) by amplifying enteroviral nucleic acid sequences (as discussed above).

Nucleic acid molecules of the invention can be used to design oligonucleotide primers that, when used in an amplification reaction, can detect enteroviruses present in a patient who has been diagnosed with diabetes. Such oligonucleotide primers can be designed to hybridize and amplify particular regions of enteroviruses. Non-limiting examples of such primers include primers having sequences as set forth in SEQ ID

NOs: 3, 4, 5, 6, and 7. Primers can be used in a variety of combinations depending on the particular desired outcome. For example, a first oligonucleotide primer having a sequence set forth in SEQ ID NO:4 and a second oligonucleotide primer having a sequence as set forth in SEQ ID NO: 7 can be used to amplify a region of the 5' NTR of a diabetogenic virus in a sample from a mammal.

The presence of a diabetogenic enterovirus infection in a patient sample before or at onset of diabetes permits earlier detection and treatment of the diabetic condition. The detection of diabetogenic enterovirus can be correlated with the presence or absence of diabetic symptoms or conditions in that patient. Such detection also permits treatment of the viral infection.

Articles of Manufacture

Probes and primers described herein can be combined with packaging materials and sold as articles of manufacture or kits. Components and methods for producing articles of manufactures are well known. The articles of manufacture may combine one or more probes and primers described herein. For example, an article of manufacture can include a first oligonucleotide primer and a second oligonucleotide primer, each 10 to 50 nucleotides in length, which can be combined with nucleic acid from a mammal and subjected to PCR conditions as described herein, to determine if the mammal is infected with an enterovirus. Furthermore, a composition may contain one or more additional pairs of oligonucleotide primers (e.g., 2, 3, or 4 primer pairs), such that multiple nucleic acid products can be generated. In addition, the articles of manufacture may further include sterile water, pharmaceutical carriers, buffers, antibodies, indicator molecules, and/or other useful reagents for performing PCR (e.g., DNA polymerase, reverse- transcriptase, or nucleotides) or for detecting or typing enteroviruses. Instructions describing how probes and primers can be used for detecting or typing enteroviruses (e.g., diabetogenic enteroviruses) can be included in such kits.

The invention will be further described in the following examples, which do not limit the scope of the invention described in the claims.

EXAMPLES

Example 1 - Detection of RNA in blood cells from IDDM patients: The occurrence of enterovirus infections were examined in a 1-year cohort of recently diagnosed type I diabetic children and their matched control subjects. All 24 children below the age of 16.0 years with newly diagnosed diabetes during 1 year in Uppsala county (population slightly less than 300,000) were used as subjects. Six of the children were female and 18 male, with a mean age of 8.4 years (range 1.6-15.7). The children had a mean history of polydipsia and polyuria of 18 days, with a wide variation (1-60 days). Mean HbA_lc was 9.8% (range 6.5-16.5; upper reference limit 5.0), and the first blood glucose was between 15.5 and 40.7 mmol/1 (mean 25.0). They were all in relatively good condition, all were conscious, and only three had a pH <7.30. The first blood sample was taken within 1 week in all cases, except for one boy who fell ill in another part of the country (day 26). The second blood sample was taken 2-6 months after the diagnosis.

The control group consisted of 24 age and sex-matched control subjects from the same county or neighboring counties, with the exception of two control subjects who were from the north of Sweden. Control subjects were recruited within 2 months after the proband from among patients without evidence of ongoing infection. Samples were also taken from 20 siblings of the type 1 diabetic children who were willing to participate (mean age at the first sample 12.4 ± 6.0 years). The first blood sample from each sibling was obtained at or close (within 6 weeks) to the diagnosis of the index case. The study was approved by the ethics committee of the Medical Faculty at Uppsala University.

Viruses and cells: Three strains of CBV-4 were used, V89-4557 and VD2921 (two plaque-purified strains isolated from patients suffering from aseptic meningitis), and the E2-Yoon strain (shown to be diabetogenic in mice). All three strains are readily neutralized with a standard polyclonal neutralizing anti-CBV-4 serum (American Type Culture Collection). The sequence of VD2921 is provided herein. Green monkey kidney (GMK) cells were used for the neutralization test and were cultured in Eagle's minimum essential medium (EMEM) supplemented with 10% newborn bovine serum.

Measurements of neutralizing antibodies, antibodies against GAD65, and EV- IgM: For analyses of neutralizing antibodies, 5 μL of serum specimens were serially diluted with EMEM in twofold steps from 1 :20 to 1 :2,560. The diluted sera and EMEM containing 100 of the 50% tissue culture infective dose (TCID₅₀) of the virus/0.1 mL were mixed and incubated for 90 min at 37°C. The mixtures were then transferred to GMK cells cultured in 96-well plates. The titers were recorded after 4-8 days. Antibodies against GAD65 in serum samples from the type 1 diabetic group, the siblings, and the control group were measured with Diamyd's Anti-GAD65 RIA (Mercodia, Uppsala, Sweden). Using a cutoff of 9.5 units/L, the specificity was 99% and the sensitivity was 74%. IgM antibodies against EV were measured at the Karolinska Institute, Stockholm as described by Glimaker et al.. J. Med. Virol. 36:193-201 (1992). .

RNA and DNA preparation: PBMCs were isolated from type 1 diabetic children, their siblings, and healthy control subjects by centrifugation of blood samples with Lymphoprep (Nycomed Pharma, Oslo) and stored at -70°C until the DNA/RNA extraction. Total RNA was extracted from PMBCs using a QIAamp Viral RNA Mini Kit (QIAGEN, Germany) and stored at -70°C. DNA from patients and control subjects was extracted from PMBCs using a QIAamp DNA Mini Blood Kit (QIAGEN, Germany). HLA typing: HLA typing of DRB1 and DQB1 genes was achieved with Dynal Classic SSP (Norway), a PCR-based method using sequence-specific primers for each HLA allele and visualization of the PCR products on a 1.2% agarose gel. All of the type 1 diabetic children, 23 of the 24 control subjects, and 11 of the 12 EV-PCR-positive siblings were HLA typed.

Primers for EV-PCR: A series of primers were synthesized based on conserved 5 'NTR sequence information identified from a sequence alignment of multiple, known enteroviruses. Primer pairs ECBV-1 to -5 correspond to highly conserved regions within the 5 '-NCR of the enteroviral genome (Table 2). External primers ECBV5 and ECBVl generate a 600-bp fragment, whereas a 539-bp product is generated with the internal primer ECBV4 (downstream primer) and ECBVl (upstream primer). The external primers used in group B were ECBV4 and ECBVl. The internal primers for the PCR group B ECBV4 (downstream primer) and ECBV2 (upstream primer) generated a 436-bp PCR product.

Sequence analysis of the PCR products amplified from biological tissue samples confirmed that the primers had primed specific amplification of the targeted nucleotide interval.

Table 2 CBV primer sequences

Primer Sequence Polarity Location*

El CACCGGATGGCCAATCA (SEQ ID NO:3) Antisense 640

ECBVl GGTACCTTTGTGCGCCTGTT (SEQ ID NO:4) Sense 65

ECBV2 CAAGCACTTCTGTTTCCCCGG (SEQ ID NO:5) Sense 160

ECBV4 ATTGTCACCATAAGCAGCCA (SEQ ID NO:6) Antisense 603

ECBV5 GATGGCCAATCCAATAGCT (SEQ ID NO:7) Antisense 640

*Positions refer to the CBV4/E2 strain (GenBank accession no: S76772) and the CBV4/JVB strain (GenBank accession no: D00149).

Reverse transcription: Reverse transcription (RT) was performed by mixing 11 μL extracted RNA and 1 μL of negative-strand primer (El) (Table 2). The mixture (12 μL) was heated for 10 min at 70°C and put on ice before adding 7 μL of a master mix containing 4 μL of 5X first-strand buffer (250 mmol/L Tris-HCI, 375 mmol/L KC1, and 15 mmol/L MgCl₂), 2 μL of 0.1 mol/L dithiothreitol, and 1 μL of each dNTP (Life

Technologies, 10 mmol/L). After incubating for 2 min at 42°C, 200 units of Superscript II (Life Technologies) was added and the reaction incubated for 60 min at 42°C. The reverse-transcribed samples were then denatured for 15 min at 70°C before storage on ice. PCR: PCR was performed in two steps. In the first step, PCR was carried out by using two primer pairs: ECBV5 and ECBVl (group A) and ECBV4 and ECBVl (group B). cDNA (2 μL) was amplified in a 50 μL reaction containing 50 mmol/L KC1, 20 mmol/L Tris-HCI (pH 8.4), 2.5 mmol/L MgCl₂, 0.1 mg/mL BSA, 0.2 mmol/L of each dNTP, 50 ng of each primer, and 2 units of Taq DNA polymerase (Amersham Pharmacia Biotech, Piscataway, NJ) with a DNA thermal cycler-Touchgen (Techn, U.K.). The theπnal cycler held the reactions at 94°C for 4 min, followed by 40 cycles of 94°C for 30 s, 45°C for 30 s, and 72°C for 1 min, and a final extension at 72°C for 5 min. In the second step, PCR was performed using primer pairs ECBV4 and ECBVl for group A amplification products and ECBV4 and ECBV2 for group B reaction products. PCR was performed by adding 2 μL of the amplified products to a PCR mixture containing 10 μL of 10 x PCR buffer, 4 units Taq DNA polymerase, and 100 ng of each primer. The mixture was adjusted to a volume of 100 μL with water. PCR was performed as in the first PCR, but using 50°C instead of 45°C for the annealing temperature. Precautions were taken to avoid any kind of contamination with extraneous nucleic acid. A negative control (no RNA) was used in each PCR. RT and the first and second PCRs were performed in separate locations in the laboratory. Sequence analysis: PCR products from the second PCR were identified by electrophoresis through a 1.5% agarose gel. The positive PCR products with correct size (539 bp with the primers ECBV4/ECBV1 and 436 bp with the primers ECBV4/ECBV2) were purified using QIAquick PCR Purification Kit (QIAGEN). Both strands of the DNA fragments were sequenced using an automatic ABI Prism 310 sequencer by the Big Dye-labeled terminator method using Amplitaq DNA polymerase FS (Perkin-Elmer). The sequencing primers were the same as those used in the second run of PCR amplification (ECBV4, ECBVl, and ECBV2). The nucleotide sequences of viral 5' NTR amplification products from twelve patients are shown in SEQ ID NOs: 8 through 19. These sequences correspond to patients 1, 3, 4, 5, 6, 9, 10, 12, 14, 15, 18 and 22, respectively, in Table 3 below.

To estimate genetic relationship, the nucleotide sequences from enterovirus (EV) positive siblings of patients, control subjects, and from known sequences of other EV serotypes (deposited in GenBank) were aligned using the CLUSTAL W (1.5) multiple sequence alignment program. The analyses were performed using the programs DNADIST and NEIGHBOR-joining included in the PHYLIP package (PHYLIP Phylogeny Inference Package, version 3.5p; Department of Genetics, University of Washington, Seattle, WA). To check the reliability of the branches defined by the phylogenetic tree, SEQBOOT (100 replicates), which was also included in the PHYLIP package, was used. Boot-strapping of 1,000 replicates was performed. Statistical analysis: Statistical analyses of four field tables were performed using

Fisher's exact two-tailed test. A P value <0.05 was considered to indicate a statistical significance. The statistical package SPSS for Windows, version 10.0, was used in statistical analyses.

Results: EV-RNA was found in PBMCs from 12 (50%) of the 24 newly diagnosed type 1 diabetic patients and 5 (26%) of 19 siblings (Table 3), but in none of the control subjects (Table 4) with the group A primers (ECBV4/ECBV1). With the group B primers (ECBV4/ECBV2), EV-RNA was detected in PBMCs from 11 (46%) of the 24 type 1 diabetic children, 11 (58%) of 19 siblings, and 7 (29%) of the 24 control subjects (Tables 3 and 4). In Tables 3 and 4, EV-IgM refers to measurements of antibodies against EV; NT titer refers to neutralization antibodies against the CBV-4 strains E2- Yoon, V89-4557 and VD2921 ; anti-GAD65 refers to antibodies against GAD65 in serum. One of the EV-PCR-positive siblings (P20S) belonged to an EV-PCR-negative family. The total number of EV-RNA-positive patients was 18 (75%). Among the siblings, the corresponding figure was 12 (63%) of 19, and in the control group, the figure was 7 (29%) of 24. With the use of group A primers, 50% of the type 1 diabetic children were positive for EV, compared with none (0%) of the 24 control subjects, a statistically significant difference (P < 0.001). The difference in group A EV-PCR positivity between the siblings (5 of 19) and the type 1 diabetic children (12 of 24) was not significant, but siblings had a higher frequency of EV-PCR positivity compared with the control subjects (P < 0.05). PCR data from a second cohort of subjects, different from those described above and consisting of 23 IDDM patients, 18 matched siblings, and 21 control subjects, confirmed the findings from the first cohort. Using Group A primers, EV-RNA was found in 10 of the 23 IDDM patients (43.5%), none of the siblings, and in one of the 21 control subjects (4.7%). With the Group B primers, EV-RNA was detected in 4 of the 23 IDDM patients (17.4%), 9 of the 18 siblings (50%), and 5 of the 21 control subjects (23.8%).

Docket No: 12389-005WO1

Table 3

EV-PCR results from PBMC from IDDM children at onset and degree of homology to EV genotypes.

RT-PCR NTtiter

EV genotype Strains Anti-

Age Primer Primer Homology EV- GAD65 HLA- HLA-

Patient Sex (years) GrpA GrpB (identity) IgM E2 V89-4557 VD2921 (units) DRBI* DQB1*

PI F 8 + + 92.4 (CBV-5) -- 80 — 40 300 04,08 04,04

P2 M 7 - + 92.3 (echo-V-5) — 640 — >2560 — 01,13 05,06

P3 M 11 + + 92.5 (CBV-4/E2) — — — 20 50 01,13 03,03

P4 M 4 + - 92.3 (CBV-4) 200 160 ~ 20 — 04,11 02,04

P5 M 13 + - 91.5(CBV-4VD2921) — — — — 90 03,08 02,03

P6 M 8 + - 92.8 (CBV-4/VD2921) 200 — 160 — 180 04,13 03,04

P7 M 7 - + 93.4(CBV-4/E2) — 320 — 160 250 03,09 02,03

P8 M 13 - - -- 320 — — — 04,04 03,03

P9 M 13 + - 99.8 (CBV-5 — — 40 20 — 03,01 02,05

P10 M 4 + - 98.2 (CBV-5) — — — 20 — 04,07 02,03

Pll M 8 - - ND 20 20 — 100 04,13 06,06

P12 M 4 + - 96.6 (CBV-4/VD2921) 200 20 — __ — 01,04 05,05

P13 F 9 - + 95.4(CBV-4/VD2921) ~ 40 — — 13 04,11 05,05

P14 M 3 + + 97.0 (CBV-4/VD2921) — — 20 20 100 03,14 06,06

P15 M 11 + - 96.8 (CBV-4/VD2921) — — 20 20 — 01,03 02,05

P16 F 14 - + 93.6 (CBV-4/E2) — 160 — 20 250 01,04 03,05

P17 F 6 - - — 20 — — 11 03,13 02,06

P18 M 1 + + 97.8 (CBV/4VD2921) — — — — 40 03,04 02,02

P19 M 16 - - ND — — 40 190 03,04 02,02 ^'

P20 M 8 - - ND 80 320 160 26 03,04 02,03

P21 F 6 - + 93.6 (CBV-4/E2) ND ~ 80 160 — 03,04 02,03

P22 F 10 + + 98.2 (CBV-4/VD2921) — 80 80 40 10 04,04 03,03

P23 M 10 - - -- — 20 40 24 01,04 03,05

P24 M 13 + 98.7 (CBV-5) 200 160 80 20 12 01,04 03,05

Docket No: 12389-005WO1

Table 4

EV-PCR results from EV positive siblings and control children and degree of homology to EV genotypes

RT-PCR NT-titer

Strains Anti-

Sib Sex Age Primer Primer EV genotype EV- E2 V89-4557 VD2921 GAD65 HLA- HLA-

(yrs) GrpA GrpB Homology IgM (units/L) DRB1* DQB1*

PIS F 8 - - ND 320 -# 20 50 03, X 02,02

P2B M 9 + - 92.7 (CBV-4/E2) ND 640# 160 320 — 07,11 02,02

P5B M 26 + + 96.6 (CBV- ND 1,280 — 160 — 04,14 03,03

4/VD2921)

P7S F 5 - + 93.9 (CBV-4/E2) ND 320 40 160 — 03,07 02,02

P9S F 18 - + 97.7 (CBV- ND — — 20 — ND ND 4/VD2921)

P10B M 6 - + 92.9 (CBV-4/E2) ND — — — — 07,09 02,03

P13S F 7 + + 87.9 (SVDV) ND. 80 160 2,560 — 11,X ND

P16B1 M 11 + + 99.8 (CBV-5) ND 160 — — 80 01,04 05,03

P16B2 M 10 - + 93.9 (CBV-4/E2) ND. 160 20 — — 01,13 05,06

P20S F 7 - + 93.6 (CBV-4/E2) ND 160# 160 160 — 13, X 06,06

P21S F 10 - + 93.1 (CBV-4/E2) ND — 320 20 — 03,04 02,03

P22B M 13 - + 90.5 (CBV- ND >1,280 320 20 — 01,04 05,03 4/VD2921)

P23S F 9 + + 89.2 CBV-4/E2 40 — ND ND

C9 M 13 - + N.D. ND — — — — 04,13 06,03

C18 M 1 - + N.D. ND — — 20 — ND ND

C19 M 16 - + N.D. ND 80 20 20 10 15,13 06,06

C20 M 8 - + N.D. ND — 160 80 — 16,03 02,

C21 M 6 - + N.D. ND 320 80 40 — 04,08 03,04

C22 M 10 - + N.D. ND 1,280 — — — 04,15 03,06

C23 M 10 - + N.D. ND 40 80 40 — 07,15 03,06

D= Not Done, P = Patient, B = = Brother, S = Sister, C= = Control, # = significant : rise in NT titre, x = an ' HLA-DRB1 allele except ^: *04. The figure for EV genotype imology belongs to primer group A if it is positive, otherwise to group B.

IgM antibodies against EV were found in 4 of 24 patients (subject P4, P6, PI 2, and P24). All of these were EV-PCR- positive. Two of the EV-IgM-positive patients (subjects P6 and P24) also revealed antibodies against GAD65. No analyses of EV-IgM antibodies were performed in serum samples from siblings or control subjects. The neutralizing antibody (NT) titers against CBV-4 differed somewhat, depending on which strain was used in the tests (Tables 3-5). The NT titer in sera from one patient could be negative against one of the CBV-4 strains and as high as 2,560 against one of the other strains. The number of NT-positive samples against the CBV-4 strains did not vary significantly between the patients, siblings, and control subjects. No significant difference in titer levels against the three CBV-4 strains was obtained when the three groups were compared. In 15 of the patients (subjects Pl-3, P5, P8-10, P13, P16, PIT, and P19-23), a convalescent serum sample was taken 2-3 months after the onset of type 1 diabetes and, as can be seen in Table 6, 7 of the type 1 diabetic children (subjects P2, P5, P9, P13, and P21— 23) had a significant rise in NT titer between the acute and convalescent sera against V89^-557. In total, 7 (41%) of 17 revealed a significant rise in NT titer, and 1 of these children was EV-PCR-negative (subject P23). Five of the type 1 diabetic children were too young (age 5 years) for a second serum sample to be obtained (they were all EVPCR- positive), and a second sample was not available from three of the patients for other reasons. Among the siblings, three revealed significant NT titer rises against CBV- 4/CBV-2 against the E2-Yoon strain and one revealed a rise against the V89-4557 strain. All but one of these siblings (subject PIS) were EV-PCR-positive. In total, 10 children revealed significant rises in NT titer against CBV-4, and in' 8 of them, the finding could be confirmed by a positive EV-PCR.

TABLE 5

Neutralization antibody titers against three strains of CBV-4 in acute sera from type

1 diabetic children, their siblings, and control subjects

TABLE 6

Significant rises in neutralization antibody titers (bold) and titers against GAD65 in samples from type 1 diabetic children and in samples from siblings obtained at onset and 2 months later

Comparison of sequencing results with the presence of NT titer against the different CBV-4 strains revealed that of the 13 patients with CBV-4-like sequences, two showed a significant rise in NT titer against the V89-4557 strain and one had a rise in titer against the E2-Yoon strain. Convalescent serum samples were not available from five of these patients. In the remaining five type 1 diabetic children, no confirmation of the observed sequence homology with CBV-4 could be obtained with the use of NT; however, some of these patients showed high NT titers against one or more of the CBV-4 strains already in the acute serum. No NT tests were performed against other serotypes of CBV or against other EVs.

Antibodies against GAD65 were found in 16 (67%) of the 24 acute sera from the type 1 diabetic children, compared with in 2 (10%) of the 20 siblings (P < 0.01) and 1 (4%) of the 23 control subjects (P < 0.001) (Tables 3 and 4). These antibodies were also detected in 13 of the 17 convalescent sera (subjects PI, P3, P5, P7, P8, P10, PI 1, P13, P16, P17, P19, P21, and P 23). In total, 18 (75%) of the 24 type 1 diabetic children revealed these antibodies at the onset or 2 months later. Among the siblings 2 (10%) of 20 had these antibodies in the acute sera, and both of them were negative when the convalescent sera (taken 2-3 months later) were analyzed. One of the control subjects (subj ects C 19) had a low level of antibodies against this autoantigen. Of the two anti- GAD65-positive siblings, one was EVPCR-positive and one had a significant rise in NT titer against V89^4557. Group B-positive individuals (type 1 diabetic children, siblings, and control subjects) more often than group B-negative individuals revealed antibodiesto GAD65 (P < 0.03). Group A positivity however, was not significantly associated with antibodies against this autoantigen. Individuals positive in both group A and group B EV-PCR also had a higher frequency of antibodies against GAD65 than individuals positive in just group A or group B or those who were EV-PCR-negative (P < 0.004).

HLA-DRB1 and -DQB1 alleles for each patient are presented together with EV- PCR results in Table 3. The allele HLA-DRB1 *04, which has been linked to increased risk for type 1 diabetes in earlier studies, was overrepresented in the type 1 diabetic group, being present in 71% of the type 1 diabetic children compared with in 30% of the control subjects (P < 0.01), whereas the alleles DR and HLADQB1* 06 were more common among control subjects. None of the type 1 diabetic children, compared with 39% of the control subjects, carried the DRB1*15 allele (P < 0.01), and 17% of the patients, compared with 70% of the control subjects, carried the DQB1*06 (P < 0.01) allele. Example 2 - Investigation of serum from IDDM patient: Serum from diabetes children which had been collected since 1980 were analysed in accordance with the method described in Example 1. Sixty serum and thirty plasma samples from 60 patients were studied by using this method. Overall, 31% of the samples were positive for enterovirus.

Example 3 - Phylo genetic analysis

Two phylogenetic trees were constructed by comparing the sequences from EV- PCR amplicons obtained from type 1 diabetic children, siblings, and control subjects and previously published human EVs. Phylogenetic trees depicting genetic relationships were constructed using the neighbor-joining method.

The sequences collected in Example 1 were used for type 1 diabetic children, siblings, and control subjects, specifically, the sequences of the 496 nucleotide amplicons from group A primers and the sequences of the 394 nucleotide amplicons from group B primers. Human EV sequences used in the analysis were CBV-4 strain VD2921; CBV-1

(accession no. M16560); CBV-2 Ohio-1 reference strain (accession no. AF081485);

CBV-3 (accession no. Ml 6572); CBV-4 (accession no. S76772); CBV-5 (accession no.

AF114383); CBV-6 (accession no. AF225478); CAV-9 (accession no. D00627); CAV-16 (accession no. NC001612); echovirus 5 (echo- V-5; accession no. AF083069); echo-V-6

(accession no. NC001657); echo-V-9 (accession no. X84981); echo-V-11 (accession no.

X80059); echo-V-30 (accession no. NC000873); EV-71 (accession no. NC001769);

SVDV (accession no. X54521); and poliovirus type 1 (PV-1; accession no. V01149).

Phylogenetic analysis of the 5' -NTR sequences obtained with the group A primers revealed clustering of the sequences into five major branches. CBV-1, CBV-3, and the other EV formed their own cluster (bootstrap 99%). Six of the patients and one of the type 1 diabetic children's siblings (subject P5B) clustered with the CBV-4 strain VD2921

(VD2921-like), and one patient (subject P5) formed a sub-branch in the VD2921- like cluster. P2B, P23S, P3, P4, and P6 were found in the same cluster as the CBV-4/E2 (CBV-4-like). The sequence from P13S was clustered with CBV-2, echovirus-6, and swine vesicular disease virus (SVDV; EV-like). P9, P10, and P16B1 sequences were more closely related to CBV-5 and -6 (CBV-5/CBV-6-like, respectively). The sequence of one patient (subject PI) formed a separate cluster with polio virus, although this patient was clearly in the same branch as P9, P10, and P16B1 (PV-like). The sequence alignment showed that the nucleotide sequence of patient 1 was 79.1% similar to poliovirus type 1. The CBV-4/E2-like, CBV-4/VD2921-like, and CBV-5/CBV- 6-like groups were strongly supported by bootstrap values of 94-100%, whereas the bootstrap score for the echovirus-like group was 61%.

Phylogenetic analyses of the 5' -NTR sequences obtained with the group B. _r primers indicated that they segregated into three major clusters: CBV-5/CBV-6-like, echovirus-like, and CBV-4/E2-like. In this tree, unlike the tree obtained with the group A primers, VD2921 was clustered together with CBV-4/E2. Eight positive amplifications (subject P7, P16, P21, P7S, P10B, P16B2, P20S, and P21S) were closely grouped together in one of the sub-branches formed with the CBV-4/E2 strain and VD2921 with 100% bootstrap support. Subjects P13, P9S, and P22B were clustered with VD2921 with 95.4-97.7% nucleotide identity. Six of the control children formed the other sub-branch of the CBV- 4/E2-like cluster. One patient and one control subject (subjects P24 and C9) clustered with CBV-5/CBV-6-like, and the sequence of one patient (subject P2) was related to echovirus (EV-like cluster).

Comparison of these two trees revealed some variation in the branching order of some subgroups, some variation in bootstrap values for certain nodes, and also a variation in branch lengths. In addition, the branching order of the CBV-5/CBV-6-like and echovirus-like clusters differed between the two trees.

The analysis indicated that amplicons from the infected siblings shared a high degree of homology with that of the respective type 1 diabetic children. Six of seven control subjects were clustered on a separate sub-branch of CBV-4, compared with the sequences of the type 1 diabetic children and their siblings. In addition, with the use of these primers, the VD2921 and the CBV-4/E2 strain had branches that clustered together. The high degree of similarity between the sequences from the type 1 diabetic children and their brothers or sisters indicates that both were infected with the same or a closely related strain of a serotype of EV. Example 4 - Identification of CBV-4 strain VD2921 : This series of experiments describes the ability of strain VD2921 to establish a persistent infection of human β cells, and the effects of the infection on insulin secretion, insulin content, and proinsulin synthesis, as well as genomic determinants for virulence and persistence. When CBA/j mice were infected with VD2921, glucose tolerance test performed 115 days post infection (after viral clearance) were significantly affected indicating that the mice infected with this viral strain were pre-diabetic.

Cells and virus: Green Monkey Kidney (GMK) cells (American Type Culture Collection, Manassas, Va) were maintained as monolayers in EMEM supplemented with 10% newborn bovine serum. CBV-4 strain VD2921 was plaque purified after isolation from a patient suffering from aseptic meningitis. The prototype strain of CBV-4 (JVB) was included as a positive control since it induces cytopathic effects (CPE) in human islet cells (Frisk and Diderholm, Virus Res. 74:8953-8965 (2000)). The cell culture supernatant was freeze-thawed three times and then used for further analysis. Neutralization tests were used to confirm the serotype of the viruses before the inoculation of the islet cells.

Preparation and culture of isolated human islets: Human pancreata were excised from ten heart beating organ donors and transported to the Central Unit of Beta-Cell Transplant, Brussels, where islet isolation was performed as previously described (see, for example, Keymeulen et al, Diabetologia 41:452-459 (1998)). Samples of the isolated islets were examined by electron microscopy and by light microscopy after immunocytochemical staining for insulin and glucagon. Less than 7% of the cells were dead (6.2±0.7%) and virtually no exocrine cells were present. The prevalence of insulin positive cells in the isolated islets was 55±2% and that of glucagon positive cells 15±3%. The insulin content was 1.51±0.14 μg/μg islet DNA. The islets were cultured in Brussels for 13±1 days (range 2-32) before being sent by air to Uppsala, Sweden. After arrival in Uppsala, the islets were cultured in RPMI 1640 containing 5.5 mM glucose and supplemented with 10% fetal bovine calf serum, benzyl penicillin (100 U/mL) and streptomycin (0.1 mg/mL). Islet viability: Islet degeneration was determined in a double-blind manner by phase-contrast microscopic analysis. Islet degeneration is characterized by the loss of islet integrity, disintegration, and partial dispersion of islets.

Virus replication and CPE: Studies of replication of VD2921 strain in isolated islets were performed before changes of culture medium at 24-h intervals. Islets were inoculated at 37°C with 103-104 TCID₅₀ per well. After allowing the virus to attach for 30-60 min at 37°C, the islets were washed and resuspended in fresh RPMI 1640 supplemented as described above. The islets were examined each day in a light microscope for virus-induced morphological changes indicating a CPE. There was no CPE in the infected islets that could be detected under a light microscope during 15-17 days of culture.

Assays of virus replication were performed by TCID₅0 titrations on GMK cells. Virus replication was assessed every day during culture and before changes of the culture medium at 72 and 96 h and after 7, 8, 14 and 15 days. At 7 days post infection (pi) the TCID₅₀ titers were consistently increased above those at 2 h pi. Viral replication was still detected after another 7-9 days of culture. Viral replication was detected in human islet cells as long as 28 days pi.

Strain VD2921 replicated well in human pancreatic islet cells in vitro, although this was not associated with lysis of the islet cells. The absence of signs of ongoing pyknosis in cells continuously carrying a replicating virus compared to control cells indicates a persistent infection.

Electron microscopy: Infected and uninfected islets were fixed in 2% glutaraldehyde and 1% formaldehyde followed by 1% osmium tetroxide, dehydrated in graded ethanol and embedded in TAAB-812-resin. Ultrathin sections (50θA) were counterstained with uranyl acetate and lead citrate before examination under the electron microscope.

Measurement of islet proinsulin content: Proinsulin content was determined with a proinsulin ELISA (Mercodia AB, Uppsala, Sweden). Islets were collected in glycine buffer with albumin (50 mM glycine, 6 mMNaOH, 0.125 g albumin, pH 8.8 (200 μL)). After freeze-thawing and vortexing, the samples were diluted 1:50 in standard solution. Proinsulin standards (0, 3.2, 12, 46, and 142 pmol/L) were used. Fifty μL of sample or standard solution were mixed with 50 μL assay buffer and incubated on a shaker, at room temperature, for one hour. After washing six times with washing solution, the plates were incubated with lOOμL/well conjugate solution on a shaker, at room temperature, for one hour. The wash step was repeated and 200 μL/well peroxidase substrate was added. After 15 minutes, reactions were stopped by adding 50 μl/well stop solution and the absorbance measured at 450 nm. The pro-insulin content was calculated from the standard curve in pmol/L per islet for each sample.

Measurement of insulin content in islets and in the culture medium in response to high glucose: Insulin release in response to high glucose was determined using a high range insulin ELISA (Mercodia AB, Uppsala, Sweden). Human insulin standards (0,

100, 300, 750, 1500, and 3500 mU/L) were included. Samples were diluted 1 :10 or 1 :50 depending on the number of islets present during culture. All 1:10 dilutions were done by mixing 1 μL of sample with 9 μL of 0 mU/L insulin standard (Std 0). The 1:50 dilutions were achieved either by first diluting samples 1 :5 in culture medium (RPMI 1640) and then mixing 1 μL of the 1 :5 dilution with 9 μL of Std 0 to a final dilution of 1 :50 or by first diluting samples 1:10 in glycine buffer with albumin pH 8.8 (50 mM glycine, 6 mM NaOH, 0.125 g albumin, pH 8.8) and then mixing 2 μL of the 1:10 dilution with 8 μL Std 0 to a final dilution of 1 :50. Ten μl of diluted sample or standard solution were incubated with 50 μL of conjugate solution on a shaker, for two hours, at room temperature. The plates were washed six times with washing solution (350 μL/well) and then incubated for 15 minutes at room temperature with peroxidase substrate (200 μL/well). After stopping the reaction with stop solution (50 μL/well), the absorbance was measured at 450 nm. Insulin content was calculated from the standard curve in mU/L per islet for each sample. The insulin response per islet for each treatment was then calculated by subtracting the insulin content in the culture medium at 0 h pi from the content at 24 h.

Statistical analyses: Data presented are mean ± SEM. All results were based on observations from at least three donors. A P-value of<0.05 was considered significant. Rates of insulin release mU/islet/24h) from infected and control islets including calculated differences have been computed using descriptive statistics. Differences in islets pro-insulin and insulin content were tested with the Student 's t-test for comparing paired samples. The comparisons were between virus infected and control samples for each time point. For pro-insulin and insulin content no comparisons were made between different time points because of too few samples. In addition, differences in insulin release between islets cultured in 5.5 mM and islets cultured in 16.5 mM glucose at different time points pi were calculated. Results: Insulin release in response to high glucose

The data on the rates of insulin release in some groups showed rather large variations between individual observations as evidenced by the large standard errors of the means (Table 7). This was, however, also seen in the uninfected control group and might reflect the condition of the islets when they were infected. The differences in insulin release between control islets cultured in 5.5 mM compared to those cultured in 16.5 mM at 3-4 days as well as 7-8 days pi was significant (p< 0.05). The same results were obtained with the infected islets. Insulin release in response to high glucose 3-4 days and 7-8 days pi was the same in the infected islets (350±100 mU/1/islet; n=13, 320±140 mU/1/islet; n= 8, respectively) as in the control islets (320±66 mU/1/islet; n=13, 300±80 mU/1/islet; n= 8 respectively). In the 11-17 days pi period, the infected islets did not respond to high glucose with insulin release at all when compared to the infected islets cultured at 5.5 mM. Response of uninfected islets did not differ significantly from that of control islets cultured at 5.5 mM glucose. The failure of control islets to respond significantly to high glucose lead to no significant difference between the infected and the infected islet despite that the infected islets did not respond at all.

TABLE 7

Insulin release in response to high glucose, insulin content and pro-insulin content in human pancreatic islets infected with VD2921 and in uninfected control islets.

Proinsulin and insulin content

As indicated in Table 7, proinsulin content in islets 3-4 days or 7-17 days pi did not differ significantly between the infected and the uninfected islets. Proinsulin content after the first 3-4 day period in islets infected with VD2921 was 70±50 pg/islet (n=4) and the amount in the uninfected controls was 330±290 pg/islet (n=4). After an additional 7- 17 days of culture the proinsulin content in the infected islets was 260±90 pg/islet (n=6) compared to 170±50pg/islet (n=6) in the controls, which was not a statistically significant difference. Insulin content in infected islets 3-4 days pi was 2600±1600 pg/islet (n=4) and the figure for the control islets was 9000±8000 pg/islet (n=4). After an additional 3-4 days of culture the figure for the infected islets was 6900±3400 pg/islet (n=3) compared to 4000±1900 pg/islet (n=3) for the controls. Eleven to 17 days pi the insulin content in the infected islets was 10200±7400 pg/islet (n-3) and the corresponding figure for the controls was 2500±1000 pg/islet (n=3). Electron microscopy

Ultrastructural studies of infected islets revealed crystalline inclusions in cells from islets infected with the VD2921 strain and the prototype strain of CBV-4 (JVB). The subunits of the inclusions had a size of about 25nm and were considered to be virus. Most crystalline inclusions were found in β-cells, whereas in islets infected with strain JVB, the inclusions were present both in β-cells and in alpha cells. Numerous particles in the same size and electron density as the subunits of the crystalline inclusions were found in different cells of the islets containing crystalline inclusions. Vesicular structures, which are assumed to be CBV-4-induced (Suhy et al., J. Virol. 74:8953-8965 (2000)), were found in islets infected with the prototype strain, and in islets from one control

(donor HI 200). Some of the vesicles appeared to be composed of particles of about the same size as the crystalline inclusions described before. Normal β-cells and alpha-cells were rather frequent in both infected and in uninfected islets.

Example 5 - Genomic structure of VD2921: In order to determine the complete nucleotide sequence of the VD2921 strain, RNA was purified from virus and amplified with RT-PCR as described below. The amplification products were sequenced and assembled into a complete genome sequence.

Viral RNA extraction and reverse transcription: Total RNA from VD2921 was extracted from 500 μL of virus stock using RNeasy Mini Kit (QIAGEN, QIAGEN Gmbh, Germany) and stored at - 70°C. Viral RNA was reverse transcribed in a total volume of 19 μL. Total RNA (11 μL) was mixed with 1 μL primer (dT26) and the mixture heated for 10 min at 70°C then put on ice before adding 7 μL of a master mix (4 μL of 5X First Strand Buffer (250 mM Tris-HC, 375 mM KCl, 15 mM MgCl₂ ), 2 μL of 0.1 M DTT, and 1 μL of each dNTP (10 mM, Life Technologies)). After incubating the mixture for 2 min at 42°C, 200 units of Superscript II (Life Technologies) were added and the reaction was incubated for 120 min at 44°C. Reverse-transcribed samples were denatured for 15 min at 70°C before storage on ice.

PCR: Reverse-transcribed RNA (2 μL) was amplified in a volume of 50 μL containing 50 mM KCl, 20 mM Tris-HCI (pH 8.4), 2.5 mM MgCl₂, BSA (0.1 mg/ml), 250 ng of each primer, and 2 units of Amplitaq (Perkin-Elmer Cetus, Branchburg, NJ) using a DNA thermal cycler-Touchgen (Techn Limited, England). Primer dT26V was used as downstream primer in the RT reaction (see Table 8). The samples were denatured at 94°C for 4 min followed by 35 cycles of 94°C for 30 sec, 50°C for 30 sec, and 72°C for 6 min with a final extension at 72°C for 5 min. To generate templates for cycle sequencing, several fragments were amplified with PCR from cDNA: (i) a 2.9 kb fragment at the 5'-end generated with primers T75nc/2874; (ii) a 2.7 kb fragment amplified with primer pair 2413/CB14; (iii) a 1 kb fragment generated with the primers CB6/4394; (iv) a 3 kb fragment at the 3 '-end amplified with the primers 4388/dT26V; and (v) several smaller fragments obtained with the primers walking between the different fragments. The sequences of each of these primers are presented in Table 8. The products were analyzed on 1 % Tris-borate-EDTA agarose gels containing 0.1 μg ethidium bromide/milliliter and purified with QIAquick PCR Purification Kit (QIAGEN GmbH) according to the manufacturer's protocol.

TABLE 8 Primer sequences

Determination of 5 ' end and poly A: One primer (T7nc) from the 5' end and three primers (NotdT25, dT26V and 3ncdT25cb3) in the 3' end were used in PCR to determine 5' and 3' ends. The nucleotide sequence of the 5 '-end was obtained using the primers T7nc, CB19 and CB30. Poly A was demonstrated by using primer 7145. Sequence analysis: Amplification fragments of VD 2921 strain were sequenced with an automatic ABI Prism 310 sequencer by the Big-dye labeled terminator method using Amplitaq DNA polymerase FS (Perkin-Elmer). The VD 2921 genome was sequenced using a primer walking strategy from the amplification fragment and primer walking to bridge a few gaps not covered by the fragment sequence. The true 3 '-end was determined by multiple sequencing in one direction. After sequencing in both directions was carried out, a translation in all three reading frames was done with BCM Search Launcher: Sequence Utilities (BCM, The Baylor College of Medicine Search Launcher, Human Genome Sequencing Center, One Baylor Plaza, Houston, TX). Alignments of amino acid and nucleic acid sequences were performed using the Clustal W (1.5) multiple sequence alignment program.

The DNA sequence of the VD2921 genome is shown in SEQ ID NO: 1. Sequence analysis indicated that the genome of the VD2921 strain is 7392 bp long, excluding the poly A-tract. The genome contains a 5 ' NTR (742 bp), a 3 ' NTR, a PI region (2952 bp), a P2 region (1732 bp), and a P3 region (2366 bp). The sequences of the 5' NTR and 3' NTR of VD2921 had 90.4% and 82% sequence identity, respectively, to the sequences of other CBV serotypes. See Table 9. The 5 ' NTR is followed by an open reading frame from nucleotides 743-7303. The polyprotein coding sequence is flanked by a 104 nucleotide long 3 ' NTR and polyA tract with a GC-content of 51%. The amino acid sequence of the VD2921 polyprotein is given in SEQ ID NO: 2.

Docket No: 12389-005WO1

Table 9 Nucleotide and amino acid identity (%) between VD2921 and six serotypes of group B coxsackieviruses

5' NTR VP4 VP2 VP3 VPl 2A 2B 2C 3A 3B 3C 3D 3 "NTR nn nn aa nn aa nn aa nn aa nn aa nn aa nn aa nn aa nn aa nn aa aa nn

CVB1 85.2 73.4 59.4 72.3 74.4 70.9 76.9 64.0 70.1 78.6 90.7 76.0 86.7 81.9 97.0 73.8 83.9 80.0 100 78.5 95.1 94.1 82.9

CVB2 82.9 71.5 58.0 73.6 78.2 74.0 81.9 64.6 67.7 77.6 88.7 74.7 84.7 82.3 96.0 72.2 85.1 83.1 100 78.5 95.6 94.1 82.5

CVB3 85.0 72.9 60.9 72.3 74.7 69.4 76.5 62.2 66.9 77.1 82.7 76.4 87.8 82.8 95.0 70.0 83.9 84.6 90.0 78.9 93.4 93.5 77.9

CVB4 90.4 76.3 60.9 86.8 91.2 86.2 96.2 84.5 91.9 84.9 91.3 79.7 82.7 82.5 96.7 74.1 81.6 80.0 95.5 79.8 96.2 92.6 82.2

CVB5 83.6 71.5 58.0 70.1 75.1 71.0 79.0 62.0 66.1 75.1 88.7 77.0 84.7 81.6 95.1 78.7 82.8 80.0 100 80.0 96.2 95.2 83.2

CVB6 82.1 73.4 59.4 73.7 77.8 70.6 81.1 64.7 66.3 78.0 90.0 78.7 85.7 81.4 95.7 71.1 86.2 83.1 100 80.0 95.1 94.8 84.0

Nucleotide Sequences of the 5 'NTR

A comparison of the nucleotide sequence of the 5 'NTR (742 bp) of VD2921 strain with other enteroviruses revealed intertypic nucleic acid sequence identities of 85.2% to CBV-1, 82.9% to CVB-2, 84.0% to CBV-3, 90.4% to CBV-4, 83.6% to CBV-5, 82.1% to CBV-6, 82-83%) to some echoviruses and enteroviruses, and 69% to poliovirus 1 (Figure 1). Nucleotides 1 to 88 and 513 to 561 of VD2921 5 'NTR displayed a higher nucleotide sequence identity to other enteroviruses than did nucleotides 89 to 512 and nucleotides 562 to 742.

The 5 'NTR of VD2921 contains five AUG codons located between nucleotide 86 and 599. No AUG codons were found in the region from nucleotides 655 to 742, which is similar to other enterovirus sequences characterized to date having multiple AUG codons in the 5 'NTR. Four of the AUG codons were conserved among compared enteroviruses. One unconserved AUG codon was found at nucleotides 87 to 88 of the VD2921 5'NTR. This AUG codon was found in coxsackie virus A-16 (CAV-16) as well. The length of the short open reading frames following the conserved AUGs within the 5'NTR were not conserved in the VD2921 strain.

PI Region

VP4 region: A protein sequence alignment of the VD2921 strain with the corresponding sequences of other CBVs (CVB-1 to CVB-6) showed a sequence identity of 58% to 61% compared to other enteroviruses. At the VP4-VP2 junction of VD2921, (VMIKSLPALNSPTVEECG; SEQ ID NO:21), there is a region where amino acid similarities have been found between some enteroviruses and HSP60/65 (ALLRCIPALDSLTPANED; SEQ IDNO:36). VP2 region: The nucleotide length of the VP2 region varied among the six serotypes of CBV and the VD2921 strain. This region was eleven nucleotides shorter in VD2921 than in the CBV-4 (E2) strain, CBV-5 and CBV-6, and seventeen nucleotides shorter in VD2921 than in CBV-1 and CBV-3 (strain Nancy). This region was twenty nucleotides in VD2921 than in CBV-2. The open reading-frame of the VP2 region of the VD2921 strain is comprised of 780 nucleotides that encode 261 amino acids. At the amino acid level, VP2 is 91.2% identical to CVB-4 (E2-strain) and 75-78% identical to other serotypes of CBV.

VP3 region: The open reading frame of the VP3 of VD2921 strain was comprised of 716 nucleotides, which encodes 238 amino acids. The amino acid identities were 76.9 to 96.2% to other CBVs. Identities at the nucleotide level ranged from 68.4-86.2%. The major variable regions of the VD29291 VP3 were at amino acid positions 57-82 and 181- 238. Sequence analysis revealed that VD2921 had 95.4% amino acid sequence identity to other CBV4 strains and 86.2% nucleotide sequence identity to other CBV4 strains. VPl region: The amino acid length of the VPl region varies among the six serotypes of CBV (see Figure 2). The highest amino acid sequence identity was 91.9% to CBV-4. Variable regions of VD2921 strain were located at amino acid positions 74-97, 123-144, 153-163 and 248-286 (carboxyl-terminus). Structural motifs in the VPl coding region of VD2921 were identified based on the known positions within VPl of other serotypes of CBV. Three of six loops of VPl are identical in size (EF, EG and HI). The BC and DE loops of VD2921 and CBV-4 (E2) are the same length. The length of the CH loop of VD2921 differs by one amino acid compared to the E2 strain. The EF, FG and CH loops appear to have a higher percent sequence identity compared to the DE, HI and BC loops. Amino acid 129 of VPl of the VD2921 strain is predicted to lie within the DE loop. Seventeen amino acid variations were found in the loops, relative to CBV-4 (E2). These variations are: BC loop (T124S), DE loop (W162M, T164P, N176T and F185E), EF puff (T155P, S156L, N158S, D159Y, Y160A, V161M, V162M, T164P, N176T and F185E), HI loop (R252E, P254T and R256A).

An immunogenic amino acid motif (PALTAVETGHT; SEQ ID NO:37) was found within the VPl region of the VD2921 strain. This region displays amino acid sequence similarity to the human HSP60 protein. HSP60 is an islet cell autoantigen that is reported to be involved in the development of diabetes in a nonobese diabetic mouse model. The 3D structure of the VPl protein was mapped by a computer program. Mapping suggested that these substitutions might affect virus-receptor interactions. The positions of the amino acid substitutions at positions 142-144 and 158-162 in the three dimensional protein and whole capsid have been analysed based on the structure of CBV- 3, strain Nancy. The substitutions are adjacently located, despite being separated by 14 amino acids. In addition, the three-dimensional structural mapping suggested that the location of these substitutions is beside the icosahedral five-fold axis. Ions located at these positions are believed to contribute to the pH stability of the CBVs.

P2 Region

P2A region: The P2A region of enterovirus encodes the 2A proteinase. Biochemical and genetic evidence suggests that the viral proteinase 2A induces cleavage of the eukaryotic initiation factor (elF) 4 gamma (p220) component of eIF-4. Sequence analysis showed that the nucleotide length of the P2A region of VD2921 strain differed by only one nucleotide from other CBVs but with no differences in the amino acid length. The single mismatch could have been generated during PCR by Taq polymerase. The P2A region has 150 amino acids.

P2B region: The amino acid identities of the P2B protein of VD2921 range from 82.7 (CBV-4), 84.7% (CBV-2 and CBV-5), to 86.7% (CBV-1), 87.8% (CBV-3) and 85.7% (CBV-6). The major variable region is at position 87-98.

P2C region: The P2C region is the most conserved region among enterovirus sequences. The amino acid sequence of the P2C protein of VD2921 has 95.0% to 97% identity to other CVBs while highest identity is to CBV-1 (97% identity). The motif PEVKEK (SEQ ID NO:38), which is also present in human GAD65 expressed in pancreatic islet cells, was found in the P2C region of the VD2921 genome.

PS Region

P3 A region: The sequence of the P3A region is variable among CBVs. This region in the CBV-4 strain VD2921 shows 70 to 78.7% identity to other CBVs at the amino acid level.

P3B region (VPs : The sequence of the P3B region of VD2921 strain is identical to that of CBV-1, CBV-2, CBV-5 and CBV-6 (100% identity) at the amino acid level, whereas it has 3 amino acid differences to CBV-3 (90.0% identity) and one amino acid difference to CBV-4 (95.5% identity). P3C region: An amino acid motif conserved among enteroviruses is present in the VD2921 genome corresponding to part of the active site of the 3C protease (GXCGG; SEQ ID NO:39).

P3D region: The P3D region of the VD2921 contains 461 amino acids. The length of this region does not differ between CBVs. The major variable region is at amino acid positions 403-440 where VD2921 exhibits sequence differences when compared to other CBVs. Four conserved amino acid motifs were found in the P3D region of VD2921: KDE, GXXSGXXXTXXXNS (SEQ ID NO:22), YGDD (SEQ ID NO:23), and FLKR (SEQ ID NO:40).

3 ' NTR

Enteroviral 3 ' NTR contains two (poliovirus-like subgroup) or three

(coxsackievirus B-like subgroup) hairpin structures, designated as domains "X" and "Y".

A tertiary kissing interaction ("K") is formed by base pairing of complementary sequences within the predominant hairpin-loop structures of the enteroviral 3 ' untranslated region. The kissing interaction appeared to consist of 6 bp. The kissing reactions UUCGGU and AAGCCA were conserved in the 3 ' NTR of the VD2921 strain.

A G nucleotide is used to gap the major groove ii VD2921, whereas an A is found in other enteroviruses A (Figure 3).

OTHER EMBODIMENTS It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

WHAT IS CLAIMED IS:

1. A method for detecting enterovirus in a mammal, said method comprising: a) providing a sample of nucleic acid from said mammal; b) subjecting said nucleic acid to an amplification reaction that is capable of amplifying an enterovirus sequence using a first oligonucleotide primer and a second oligonucleotide primer, wherein the presence or absence of said enterovirus is determined by the presence or absence of amplification product from said amplification reaction.

2. The method of claim 1, wherein said enterovirus is a coxsackie B enterovirus.

3. The method of claim 1, wherein said mammal is selected from the group consisting of a human, a pig, and a mouse.

4. The method of claim 3 , wherein said mammal is a human.

5. The method of claim 4, wherein said human is between the ages of 8 and 16.

6. The method of claim 1 , wherein said first oligonucleotide primer has the sequence set forth in SEQ ID NO:4, and said second oligonucleotide primer has the sequence set forth in SEQ ID NO:7.

7. The method of claim 1 , wherein said subjecting step comprises a first and a second amplification reaction.

8. The method of claim 7, wherein said first amplification reaction includes a first oligonucleotide primer having the sequence set forth in SEQ ID NO:4 and the second oligonucleotide primer having a sequence set forth in SEQ ID NO: 7, and wherein said second amplification reaction includes a first oligonucleotide primer having the sequence set forth in SEQ ID NO:4 and a second oligonucleotide primer having the sequence set forth in SEQ ID NO:6.

9. The method of claim 1, wherein amplification product comprises a nucleic acid encoding VPl.

10. The method of claim 1 , further comprising correlating the presence or absence of said enterovirus with the presence or absence of a diabetic condition in said mammal.

11. The method of claim 1 , further comprising the step of typing detected enterovirus using phylogenetic analysis.

12. The method of claim 1, wherein said sample comprises peripheral blood mononuclear cells.

13. A composition comprising a first oligonucleotide primer and a second oligonucleotide primer, wherein said first oligonucleotide primer has a sequence set forth in SEQ ID NO:4, and said second oligonucleotide primer has a sequence set forth in SEQ ID NO:7.

14. A composition comprising a first oligonucleotide primer and a second oligonucleotide primer, wherein said first oligonucleotide primer has a sequence set forth in SEQ ID NO:4, and said second oligonucleotide primer has a sequence set forth in SEQ ID NO:6.

15. A composition comprising a first oligonucleotide primer and a second oligonucleotide primer, wherein said first oligonucleotide primer has a sequence set forth in SEQ ID NO: 5, and said second oligonucleotide primer has a sequence set forth in SEQ ID NO:6.

16. An isolated nucleic acid 10 to 88 nucleotides in length, said nucleic acid having at least 92% sequence identity to nucleotides 1 to 87 of SEQ ID NO: 1.

17. The isolated nucleic acid of claim 16, wherein said nucleic acid has 95% sequence identity.

18. The isolated nucleic acid of claim 16, wherein said nucleic acid is from 17 to 30 nucleotides in length.

19. An isolated nucleic acid 10 to 425 nucleotides in length, said nucleic acid having at least 92% sequence identity to nucleotides 88 to 512 of SEQ ID NO:l.

20. The isolated nucleic acid of claim 19, wherein said nucleic acid has 95% sequence identity.

21. The isolated nucleic acid of claim 19, wherein said nucleic acid is from 17 to 30 nucleotides in length.

22. An isolated nucleic acid 10 to 230 nucleotides in length, said nucleic acid having at least 92% sequence identity to nucleotides 513 to 742 of SEQ ID NO:l.

23. The isolated nucleic acid of claim 22, wherein said nucleic acid has 95% sequence identity.

24. The isolated nucleic acid of claim 22, wherein said nucleic acid is from 17 to 30 nucleotides in length.

25. An isolated nucleic acid 30 to 742 nucleotides in length, said nucleic acid having 100% sequence identity to nucleotides 1 to 742 of SEQ ID NO:l.

26. An isolated nucleic acid 10 to 210 nucleotides in length, said nucleic acid having at least 77% sequence identity to nucleotides 743 to 952 of SEQ ID NO:l.

27. The isolated nucleic acid of claim 26, wherein said nucleic acid has 85% sequence identity.

28. The isolated nucleic acid-of claim 26, wherein said nucleic acid is from 17 to 30 nucleotides in length.

29. An isolated nucleic acid 10 to 774 nucleotides in length, said nucleic acid having at least 87% sequence identity to nucleotides 953 to 1726 of SEQ ID NO:l.

30. The isolated nucleic acid of claim 29, wherein said nucleic acid has 95%> sequence identity.

31. The isolated nucleic acid of claim 29, wherein said nucleic acid is from 17 to 30 nucleotides in length.

32. An isolated nucleic acid 10 to 715 nucleotides in length, said nucleic acid having at least 87% sequence identity to nucleotides 1727 to 2441 of SEQ ID NO:l.

33. The isolated nucleic acid of claim 32, wherein said nucleic acid has 95% sequence identity.

34. The isolated nucleic acid of claim 32, wherein said nucleic acid is from 17 to 30 nucleotides in length.

35. An isolated nucleic acid 10 to 855 nucleotides in length, said nucleic acid having at least 85% sequence identity to nucleotides 2442 to 3296 of SEQ ID NO:l.

36. The isolated nucleic acid of claim 35, wherein said nucleic acid has 90% sequence identity.

37. The isolated nucleic acid of claim 35, wherein said nucleic acid is from 17 to 30 nucleotides in length.

38. An isolated nucleic acid 10 to 441 nucleotides in length, said nucleic acid having at least 85% sequence identity to nucleotides 3297 to 3737 of SEQ ID NO:l.

39. The isolated nucleic acid of claim 38, wherein said nucleic acid has 90% sequence identity.

40. The isolated nucleic acid of claim 38, wherein said nucleic acid is from 17 to 30 nucleotides in len th.

41. An isolated nucleic acid 10 to 296 nucleotides in length, said nucleic acid having at least 80% sequence identity to nucleotides 3738 to 4033 of SEQ ID NO:l.

42. The isolated nucleic acid of claim 41, wherein said nucleic acid has 85% sequence identity.

43. The isolated nucleic acid of claim 41 , wherein said nucleic acid is from 17 to 30 nucleotides in length.

44. An isolated nucleic acid 10 to 996 nucleotides in length, said nucleic acid having at least 83% sequence identity to nucleotides 4034 to 5029 of SEQ ID NO:l.

45. The isolated nucleic acid of claim 44, wherein said nucleic acid has 90% sequence identity.

46. The isolated nucleic acid of claim 44, wherein said nucleic acid is from 17 to 30 nucleotides in length.

56

57

67. An isolated nucleic acid comprising a nucleotide sequence encoding a polypeptide having at least 92% sequence identity to the VPl polypeptide of CBV-4 strain VD2921.

68. An isolated nucleic acid comprising a nucleotide sequence encoding a polypeptide having at least 92% sequence identity to the P2A polypeptide of CBV-4 strain VD2921.

69. An isolated nucleic acid comprising a nucleotide sequence encoding a polypeptide having at least 83% sequence identity to the P2B polypeptide of CBV-4 strain VD2921.

70. An isolated nucleic acid comprising a nucleotide sequence encoding a polypeptide having at least 97% sequence identity to the P2C polypeptide of CBV-4 strain VD2921.

71. An isolated nucleic acid comprising a nucleotide sequence encoding a polypeptide having at least 82% sequence identity to the P3A polypeptide of CBV-4 strain VD2921.

72. An isolated nucleic acid comprising a nucleotide sequence encoding a polypeptide having at least 96% sequence identity to the P3B polypeptide of CBV-4 strain VD2921.

73. An isolated nucleic acid comprising a nucleotide sequence encoding a polypeptide having at least 97% sequence identity to the P3 C polypeptide of CBV-4 strain VD2921.

74. An isolated nucleic acid comprising a nucleotide sequence encoding a polypeptide having at least 93% sequence identity to the P3D polypeptide of CBV-4 strain VD2921.

75. The isolated nucleic acid of claim 74, wherein said polypeptide comprises the amino acid sequence GXXSGXXXTXXXNS (SEQ ID NO:22).

76. The isolated nucleic acid of claim 74, wherein said polypeptide comprises the amino acid sequence YGDD (SEQ ID NO:23).

77. An article of manufacture comprising: a) packaging material; and b) first and second oligonucleotide primers associated with said packaging material, said primers effective for amplifying coxsackie B virus strain VD2921 nucleic acid.

78. The article of claim 77, wherein said first primer has the nucleotide sequence of SEQ ID NO:4.

79. The article of claim 78, wherein said second primer has the nucleotide sequence of SEQ ID NO:7.

80. The article of claim 78, wherein said second primer has the nucleotide sequence of SEQ ID NO:6.

81. The article of claim 77, wherein said first primer has the nucleotide sequence of SEQ ID NO:5.

82. The article of claim 81, wherein said second primer has the nucleotide sequence of SEQ ID NO:6.