WO2002103010A1 - Methods and materials for targeted gene disruption in actinomycete bacteria - Google Patents

Abstract

A method is provided for generating a targeted nucleic acid disruption in an actinomycete, the method comprising:(1) providing a first nucleic acid construct comprising:(a) a nucleic acid sequence (the 'marker sequence') encoding a marker;(b) a nucleic acid sequence (the 'origin sequence') comprising an origin of transfer;(c) a pair of nucleic acid sequences (the 'recombining sequences') which are capable of undergoing recombination with each other, thereby to eliminate nucleic acid lying between them and leave only a single recombining sequence; and(d) a pair of nucleic acid sequences (the 'targeting sequences') capable of undergoing homologous recombination with a nucleic acid of interest of said actinomycete,wherein parts (a) and (b) lie between the pair (c) of recombining sequences and parts (a), (b) and (c) lie between the pair of targeting sequences;(2) recombining the first nucleic acid construct with a first plasmid bearing at least part of the actinomycete target nucleic acid of interest to form a 'recombined plasmid';(3) transferring the recombined plasmid by conjugation from a first bacterial cell into an actinomycete bacterial cell; (4) integrating nucleic acid of the first nucleic acid construct from the transferred plasmid into the target actinomycete nucleic acid by homologous recombination; and(5) eliminating the origin sequence and marker sequence from the integrated nucleic acid, to leave an insertion in the actinomycete nucleic acid, the insertion having a single recombining sequence of the original pair of recombining sequences.Also provided are related materials, methods for producing them, and libraries of cells having such targeted nucleic acid disruptions.

Description

Methods and Materials for Targeted Gene Disruption in

Actinomycete Bacteria

The present invention relates to methods and materials for generating targeted gene disruptions, especially multiple targeted gene disruptions, in actinomycete bacteria, especially Streptomyces spp..

The generation of gene disruptions in actinomycetes poses several problems. For example, like most bacteria, actinomycetes are not readily transformable with linear DNA because of the presence of intracellular exonucleases that degrade linear DNA.

Because of this, to inactivate chromosomal genes of

S. coelicolor, a gene disruption is usually created on a suitable plasmid in E. coli before introducing the construct into S. coelicolor for recombination with the chromosome. Alternatively single crossover integration of a phage vector or suicide plasmids has been used (Kieser et al . , 2000) .

Moreover, the generation of multiple knock-out mutants tends to require the use of a corresponding number of different selectable markers, leading to undesirable complication, e.g. in the preparation of suitable culturing media.

These problems have, however, been addressed to some extent in E. coli . The λ RED { gam, bet, exo) functions promote a greatly enhanced rate of recombination when using linear DNA. By exploiting this, Datsenko and Wanner made 13 different disruptions on the E. coli chromosome by replacing a chromosomal sequence with a selectable marker generated by PCR using primers with 36nt homology extensions. After selection, the resistance gene can also be eliminated by using a helper plasmid expressing the FLP recombinase, which acts on directly repeated FRT (FLP recognition target) sites flanking the resistance gene leaving a remaining FRT site (Datsenko and Wanner, 2000) .

It would be desirable to apply a similar approach to actinomycetes such as S . coelicolor.

The present invention is intended to address this and other problems associated with the generation of targeted gene disruptions in actinomycete bacteria.

Accordingly, in a first general aspect, the present invention provides a nucleic acid construct comprising:

(a) a nucleic acid sequence (the "marker sequence") encoding a marker, preferably a selectable marker; (b) a nucleic acid sequence (the "origin sequence") comprising an origin of transfer;

(c) a pair of nucleic acid sequences (the "recombining sequences") which are capable of undergoing recombination with each other, thereby to eliminate nucleic acid lying between them and leave only a single recombining sequence; and

(d) a pair of nucleic acid sequences (the "targeting sequences") capable of undergoing homologous recombination with a gene of interest, wherein parts (a) and (b) lie between the pair (c) of recombining sequences and parts (a) , (b) and (c) lie between the pair of targeting sequences, such that following homologous recombination of the targeting sequences with a target gene and recombination of the recombining sequences, a single recombining sequence is left as an insertion in the target gene, and the marker sequence and origin sequence are eliminated.

Preferably the construct further comprises (e) a pair of nucleic acid sequences (the "intervening sequences") which flank the recombining sequences and which are flanked by the targeting sequences. It is however contemplated that in some embodiments only one intervening sequence may be present (i.e. one end of the construct has an intervening sequence between a recombining sequence and a targeting sequence, but the other has only adjacent targeting and recombining sequences) . Following the above-mentioned recombination events, the intervening sequence (s) (where present) will also form part of the insertion in the target gene.

The term "flank" as used herein is not intended to imply that the sequences concerned are immediately adjacent, though this is generally preferred.

In certain preferred embodiments, the insertion comprises a stop codon in at least one reading frame in a forward or backward direction. More preferably, it comprises a stop codon in each of the three forward or in each of the three backward reading frames. Still more preferably it comprises a stop codon in each of the six forward and backward reading frames. It is however contemplated that in some embodiments it may be desirable to encode an in- frame amino acid insertion without terminating the encoded polypeptide. Preferably the insertion consists of a multiple of three nucleotides, especially where it is desirable to encode an in-frame amino acid insertion without terminating the encoded polypeptide.

As will be evident from the foregoing, an intervening sequence may be used to provide an insertion into a gene of interest, e.g. to modify the upstream, non-coding regions of the gene, or to create a gene encoding a fusion protein.

In particular, an intervening sequence placed downstream of the recombining sequences may be targeted to the upstream non-coding region of a gene, e.g. to insert a promoter sequence upstream of the coding sequence. In this case, the targeting sequences of the construct would be based on the sequence of the upstream non-coding region of the gene (e.g. the existing promoter sequence of the gene) and optionally (for the downstream targeting sequence) the start of the coding sequence of the gene. After recombination with the target gene and elimination of the marker sequence and origin sequence, the intervening sequence will form part of the insertion in the target gene, downstream of the single remaining recombining sequence, but upstream of the coding region of the gene. This is particularly suited to inserting exogenous control sequences upstream of the coding region, e.g. promoter and/or enhancer or repressor sequences .

Alternatively, an intervening sequence placed upstream of the recombining sequences may be targeted to the 3' end of the coding region of a gene, e.g. to alter the 3' coding sequence of the gene, particularly to encode a fusion protein. In this case, the targeting sequences of the construct would be based on the sequence of the 3' end of the coding region of the gene and (for the downstream targeting sequence) the start of the 3' non- coding sequence of the gene. After recombination with the target gene and elimination of the marker sequence and origin sequence, the intervening sequence will form part of an insertion in the 3' end of the target gene, upstream of the single remaining recombining sequence. Preferably such an insertion will replace the normal stop codon of the target gene with a codon for an amino acid, allowing translation to continue into the intervening sequence. Preferably the intervening sequence and/or the recombining sequence provides a stop codon, however, after the desired insertion.

Accordingly, the term "gene" as used herein is not to be interpreted as limited to a coding sequence, but also includes upstream and downstream non-coding regions. Also, the term "disruption" is not to be interpreted as limited to the prevention of functional expression of a gene, but also includes for example the inclusion of exogenous control sequences and/or exogenous coding sequences into the coding or non-coding regions of the target gene.

A sequence encoding any suitable marker (preferably a selective marker) may be used; antibiotic resistance markers are preferred.

The origin sequence is discussed further below.

The recombining sequences are preferably FRT (FLP recognition target) sequences, which may be recombined by FLP recombinase activity In trans (e.g. provided by a helper plasmid, e.g. as described in the Examples) . The FLP recombinase system is well known per se to those skilled in the art, e.g. from Hoang et al. (1998) . Preferably each FRT sequence comprises a palindrome (preferably an interrupted palindrome) , having the palindromic half site GAAGTTCCTAT. Preferably the interruption is by a sequence of about 12 nucleotides (e.g. 8-16 nucleotides). Preferably each FRT sequence comprises the double stranded core sequence: 5' -GAAGTTCCTATACTTTCTAGAGAATAGGAACTTC-3' 3' -CTTCAAGGATATGAAAGATCTCTTATCCTTGAAG-5'

However, any other suitable recombination system may also find use in the present invention.

The targeting sequences are also discussed further below.

Such a nucleic acid construct finds use in generating targeted gene disruptions in actinomycete bacteria, e.g. using the methods of the invention.

In a second aspect, the invention provides a method for generating targeted gene disruptions in an actinomycete, the method comprising:

(1) providing a nucleic acid construct according to the first aspect;

(2) recombining the nucleic acid construct with a plasmid bearing at least part of an actinomycete target gene of interest to form a "recombined plasmid";

(3) transferring the recombined plasmid by conjugation from a first bacterial cell into an actinomycete bacterial cell; (4) integrating nucleic acid of the nucleic acid construct from the transferred plasmid into the target chromosomal actinomycete gene by homologous recombination; and (5) eliminating the origin sequence and marker sequence from the integrated nucleic acid, to leave an insertion in the actinomycete gene, the insertion having a single recombining sequence of the original pair of recombining sequences.

Step (1) may comprise providing the nucleic acid construct by homology extension PCR from a plasmid containing parts (a), (b) , (c) and preferably (e) of the nucleic acid construct of the first aspect, the PCR primer (or its complementary strand) providing part (d) and optionally (e) . A nucleic acid construct comprising parts (a) , (b) , (c) and preferably (e) as defined in the first aspect is a further aspect of the invention, as is the above method of producing a construct according to the first aspect.

The 3' end of each primer will be designed to hybridise with a respective recombining sequence and/or, where present, intervening sequence, and the 5' end will be designed to provide a sequence which, when double stranded, is capable of homologous recombination with the target gene. The 5' ends of the primers -therefore generate the targeting sequences of the resultant construct. The primers may also generate the intervening sequence (s), where present. The generation of the necessary sequences may occur in multiple PCR steps, in which case, the primers may individually provide incomplete parts of the sequences identified. The skilled person will be able to determine an appropriate size for the 5' ends of the homology extension PCR primers (i.e. for the targeting sequences of the nucleic acid construct) . Preferably the size of the 5' end of each homology extension primer will be at least 20 nucleotides, more preferably at least 25, 30 or 35 nucleotides, still more preferably at least 40 nucleotides .

Preferably step (2) comprises recombining the nucleic acid construct with nucleic acid from an actinomycete cosmid or BAC library, though recombination with actinomycete nucleic acid cloned on any suitable plasmid is contemplated. Most preferred is the S. coelicolor cosmid of Redenbach et al . , 1996.

Preferably the first bacterial cell is an E. coli cell. Where it is intended later to conjugate the plasmid into an actinomycete cell possessing a potent methyl-specific restriction system { S . coelicolor has such a system, although the related strain S. llvldans does not, MacNeil et al . , 1992), the first bacterial cell is preferably methylation deficient, e.g. E. coli strain ET12567 (MacNeil et al . _r 1992).

The nucleic acid construct is preferably linear. Especially when that is the case, step (2) preferably occurs in a bacterial cell (preferably an E. coli cell) having λ RED { gam, bet , exo) function, to enhance the rate of recombination by reducing degradation of linear nucleic acid by bacterial intracellular exonucleases .

The nucleic acid construct preferably does not share sufficient sequence homology for homologous recombination with the plasmid, except in the targeting sequences (which share homology with the target actinomycete gene) . This assists in preventing erroneous recombination, i.e. recombination into the plasmid, but outside the target gene.

Prior to step (3) , the plasmid may be pre-existing in the first bacterial cell or may be introduced into the first bacterial cell following purification from another source.

The provision of the origin sequence in the nucleic acid construct allows the introduction of the recombined plasmid into the actinomycete cell by conjugation. The main advantages in using conjugation (especially from

E. coli) as a means of introducing DNA into actinomycetes are the simplicity of the procedure because it does not rely on protoplast formation and regeneration, and its broad applicability in introducing DNA into actinomycetes other than specifically S. coelicolor (Matsushima et al . , 1994) .

Preferably the origin sequence is an oriT sequence which can be mobilised by the helper (or "transfer") plasmids pUZ8002 and pϋB307, such as an oriT sequence from an

IncP-group plasmid, such as RP4 (also designated RP1/RK2; Pansegrau et al . , 1994), preferably having the nucleic acid sequence shown in Fig. IB, residues 1450-1558, or a variant thereof. However, the use of any other suitable origin of transfer is also contemplated.

For transfer of (in particular) plasmids bearing an RP4 oriT to occur by conjugation, a transfer function should be supplied in trans, e.g. by an E. coli donor strain -such as ET12567 carrying the self-transmissible pUB307 (Bennett et al . , 1977, Flett et al . , 1997) or ET12567 carrying the non-transmissible pUZ8002 (Kieser et al . , 2000) .

Thus step (3) preferably includes such provision in trans of transfer function. This step may involve transforming the recombined plasmid into a donor strain carrying a non-transmissible transfer plasmid (e.g. ET12567/pUZ8002) , followed by incubation under suitable conditions with the actinomycete cell (e.g. a pre- germinated actinomycete spore) .

Alternatively, in a modified version of the conjugation procedure described by Kieser et al . , 2000, step (3) may involve a "triparental"-like conjugation in which the first bacterial cell (which may be a cosmid cell in which recombination of the plasmid and construct has previously occurred) , a donor strain carrying a non-transmissible transfer plasmid (e.g. ET12567/pϋZ8002) , a donor strain carrying a self-transmissible transfer plasmid (e.g. ET12567/pUB307) and the actinomycete cell (e.g. a pre- germinated actinomycete spore) are all incubated together under suitable conditions (for which see Kieser et al . , 2000 and the examples) . In this "triparental" procedure the recombined plasmid is firstly mobilised by the donor strain carrying the self-transmissible transfer plasmid (e.g. ET12567/pϋB307) into the donor strain carrying the non-transmissible transfer plasmid (e.g. ET12567/pUZ8002) and then is subsequently mobilised by the latter into the actinomycete cell.

It is thought that direct mobilisation of the plasmid by pUB307 may occur to a small extent, but that this method of conjugation is inefficient (estimated at less than 1%), owing to the absence of selection in the actinomycete cell.

The steps of the method need not occur in the order shown above. In particular, step (5) may precede steps (3) and (4). However, it is preferred that step (5) follows steps (3) and (4) , as the presence of the marker sequence (from the nucleic acid construct) in the actinomycete cell aids confirmation that the transferring and integrating steps have successfully occurred. Elimination of the marker sequence (and also the origin sequence) may be confirmed by replica plating of exconjugants, elimination being reflected by lack of marker function (e.g. antibiotic susceptibility).

Where step (5) follows steps (3) and (4), the elimination of the origin and marker sequences may occur by FLP recombinase-mediated recombination, leaving a single FRT sequence (and, where present, the intervening sequence (s) ) as an insertion in the target gene.

FLP recombinase activity is preferably provided in trans using a plasmid that shows inducible (e.g. temperature sensitive) replication and induction of FLP synthesis under conditions in which replication will not occur (e.g. at high temperature). Such a plasmid allows for simultaneous induction of FLP synthesis and loss of the plasmid. Preferred plasmids are BT340, as described in the Examples, and pFLPl from Hoang et al. (1998).

Loss of FLP recombinase activity allows the process to be repeated to target disruptions in another gene of the same actinomycete cell. However, an alternative method has been developed for eliminating the origin sequence and marker sequence following steps (3) and (4) . The method may also make use of the FLP recombinase system, though in a different way from that described above.

This method makes use of a helper plasmid which contains a nucleic acid construct comprising targeting sequences for the same actinomycete gene as the first plasmid, optionally the intervening sequence (s), a single recombining sequence (since the elimination step (5) has already occurred) , and no origin sequence between the targeting sequences. Nucleic acid from such a helper plasmid may be integrated into the actinomycete gene, following previous integration of nucleic acid from the first plasmid. Integration from the first plasmid results in an insert in the actinomycete chromosomal gene, the insert comprising the entire nucleic acid construct as defined in the first aspect. Subsequent integration from the helper plasmid into the same gene replaces that insert with an insert having only a single recombining sequence and (optionally) intervening sequence (s). The two plasmids must therefore be capable of homologous recombination with the actinomycete gene at the same site.

In part, the helper plasmid is preferably constructed by a method comprising steps (1), (2) and (5) as shown above. To allow efficient introduction into the actinomycete cell, however, the helper plasmid also comprises a second origin sequence outside the construct defined above, which therefore neither forms part of the insertion into the actinomycete chromosomal gene, following the integration step, nor is eliminated if and when the first origin sequence and marker sequence are eliminated in the construction of the helper plasmid. The second origin sequence may be introduced into the helper plasmid following elimination of the first origin sequence. Preferably the helper plasmid also comprises a second marker sequence (preferably encoding a selectable marker) .

The second origin sequence and second marker sequence are preferably introduced by recombination between a helper nucleic acid construct and the helper plasmid, the helper construct comprising the second origin sequence and second marker sequence in between two sequences (the "helper construct targeting sequences") which share homology with sequences of the helper plasmid. The helper construct targeting sequences will be chosen so that introduction of the helper construct into the helper plasmid does not interfere with the targeting sequences of the helper plasmid (which allow integration of the helper plasmid into the actinomycete gene) .

In a particularly preferred embodiment, the first plasmid and helper plasmid are derived from the same basic plasmid (preferably a plasmid of an actinomycete library or cosmid) . This will allow convenient selection of helper construct targeting sequences. Preferably the first plasmid and helper plasmid are derived from the same basic plasmid with which the same nucleic acid construct of the first aspect of the invention has been recombined. This allows convenient integration of nucleic acid from the helper plasmid into the same site in the chromosomal actinomycete gene as the earlier integration of nucleic acid from the first plasmid. As will be appreciated, the helper nucleic acid construct and helper plasmid, as well as methods for their production, all as defined above, form further aspects of the invention.

As will be further appreciated, the use of the helper plasmid to eliminate the origin and marker sequences from the actinomycete chromosomal gene falls within the definition of step (5) above.

An alternative nucleic acid construct (the "additional disruption construct") is also provided for the generation of additional disruptions, after a first disruption has been generated using a construct according to the first aspect of the invention. Such a construct has component features as defined for the construct of the first aspect, with the exception of an origin of transfer. The reason for this is that a plasmid which is to be conjugated into the actinomycete cell needs only one origin of transfer, which will be provided by recombination with a construct of the first aspect; further origins are unnecessary.

The additional disruption construct will comprise different marker and targeting sequences from the origin- containing construct with which it is intended to be used. Preferably, it will comprise the same recombining sequences (e.g. FLT sequences) as the origin-containing sequence, to allow elimination of the marker sequence of the additional disruption construct at the same time as the marker sequence and origin sequence of the construct of the first aspect are eliminated. Accordingly, such constructs may be used in the method of the second aspect of the invention to introduce further disruptions into the actinomycete nucleic acid, by recombination with the "recombined plasmid" of step (2), preferably before step (3) occurs.

The invention also provides vectors containing the nucleic acid constructs of the invention, flanked by suitable restriction sites for excising nucleic acid constructs from the remainder of the vectors.

The invention also provides cells comprising the plasmids and vectors of the invention, and cells comprising gene disruptions as obtainable according to the methods of the invention. Furthermore, the invention provides a method of determining the effect of a gene disruption, the method comprising culturing such a cell and determining the effect of the gene disruption on the cell.

The skilled person is well aware of suitable techniques for the preparation of such vectors and cells, e.g. from Sambrook et al. 1989, and Kieser et al, 2000.

In a further aspect, the present invention provides a method for producing a library of actinomycete host cells having respective different gene disruptions, the method comprising: repeating the methods of the previous aspects to generate different gene disruptions in different respective host cells.

In this aspect, there is also provided such a library of actinomycete host cells having different respective gene disruptions as produced or as producible according to the method of this aspect. In particular, the invention provides a library of actinomycete host cells respectively having insertions in different chromosomal genes. Preferably the insertions each comprise a single FRT site, optionally with intervening sequence (s) also.

Such a library may be screened for phenotypic characteristics or changes resulting from the gene disruptions. Screening may be followed by the step of identifying the disrupted gene. This may be followed by the step of cloning the undisrupted gene, e.g. from a cosmid used in the generation of the host cells bearing disruptions.

In a further aspect, the present invention provides a kit comprising a nucleic acid construct according to the first aspect of the invention (preferably without targeting sequences) and a helper nucleic acid construct or an additional disruption construct as defined above, optionally with one or more other plasmids used in the methods described herein, e.g. a plasmid providing λ RED function, a self-transmissible plasmid providing transfer function, a non-transmissible plasmid providing transfer function and/or a plasmid providing FRP recombinase function.

The actinomycete gene is preferably a native gene, though it is also contemplated that the materials and methods of the invention may be used for targeted disruption of exogeneous genes in an actinomycete cell. As mentioned above, the term "gene" includes not only the coding region, but also upstream and downstream non-coding regions. Moreover, it will be evident that the present invention can also be applied to the generation of disruptions in any actinomycete nucleic acid of interest, especially chromosomal nucleic acid. References herein to "gene" may therefore be replaced with "nucleic acid" within the scope of the invention.

Preferably the actinomycete cell is a streptomycete cell, more preferably a cell of the genus Streptomyces , still more preferably of the species S. coelicolor or S . ambofaciens, most preferably a cell of the strain S . coelicolor A3 (2) .

For the avoidance of doubt, the term "plasmid" is herein defined as a genetic element containing nucleic acid and able to replicate independently of its host's chromosome. Generally, the plasmids of the invention will be circular, not linear, plasmids.

Variants

References herein to genes and nucleic acids are not to be interpreted as being restricted to genes and nucleic acids having the specific nucleic acid sequences disclosed herein. Rather, genes and nucleic acids having variants of those sequences are also included, provided that the functional interactions of the various components used in the methods and materials of the invention are maintained. Genes and nucleic acids having the specific sequences disclosed are preferred embodiments .

The term "variant" as used herein in relation to a particular nucleic acid (the reference nucleic acid) may denote: any nucleic acid having a sequence which is different from that of the reference nucleic acid, but which is its complement or which shows significant nucleic acid sequence identity with, or hybridisation under stringent conditions to, the reference nucleic acid or its complement or a fragment of the reference nucleic acid or its complement.

Significant nucleic acid sequence identity is preferably at least 50%, more preferably 60%, 70%, 80% or 90%, still more preferably 95%, 98% or 99%.

Significant nucleic acid sequence identity is preferably shown between the variant nucleic acid (or a portion thereof) and a fragment of at least 30 residues of the reference nucleic acid, more preferably a fragment of a least 60, 90 or 120 residues, still more preferably the entire reference nucleic acid.

"Percent (%) nucleic acid sequence identity" is defined as the percentage of nucleotide residues in a candidate sequence that are identical with the nucleotide residues in the sequence under comparison, as determined by the BLASTN module of WU BLAST-2 (Altschul et al. (1996); http: //blast. wustl/edu/blast/README. html) , set to the default parameters, with overlap span and overlap fraction set to 1 and 0.125, respectively.

"Stringent conditions" or "high stringency conditions", as defined herein, may be identified by those that: (1) employ low ionic strength and high temperature for washing, for example 0.015 M sodium chloride/0.0015 M sodium citrate/ 0.1% sodium dodecyl sulfate at 50°C; (2) employ during hybridization a denaturing agent, such as formamide, for example, 50% (v/v) formamide with 0.1% bovine serum albumin/0.1% Ficoll/0.1% polyvinylpyrrolidone/50mM sodium phosphate buffer at pH 6.5 with 750 mM sodium chloride, 75 mM sodium citrate at 42°C; or (3) employ 50% formamide, 5 x SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 x Denhardt ' s solution, sonicated salmon sperm DNA (50 μg/ml) , 0.1% SDS, and 10% dextran sulfate at 42°C, with washes at 42°C in 0.2 x SSC (sodium chloride/sodium citrate) and 50% formamide at 55°C, followed by a high-stringency wash consisting of 0.1 x SSC containing EDTA at 55°C.

Embodiments of the invention will now be described, by way of example only.

Summary of Knock-Out Experiments

The basic strategy for PCR-targeting for mutagenesis of Streptomyces coelicolor is to replace a chromosomal sequence within a S. coelicolor cosmid (Redenbach et al . , 1996) by a knock-out cassette containing a selectable marker. The knock-out cassette is generated by PCR using primers with 40nt homology extensions. Recombination occurs in E. coli containing the λ RED system, to enhance recombination efficiency.

An oriT from the IncP-group plasmid RP4 (also designated RP1/RK2; Pansegrau et al . , 1994) within the knock-out cassette allows the introduction of the PCR targeted cosmid DNA into S. coelicolor by conjugation. The main advantages in using conjugation from E. coli as a means of introducing DNA into Streptomyces are the simplicity of the procedure (because it does not rely on the generation of protoplast formation and regeneration) and its broader applicability in introducing DNA into other actinomycetes (Matsushima et al . , 1994).

The potent methyl-specific restriction system of S . coelicolor A3 (2) is circumvented by passaging DNA through the methylation-deficient E. coli host ET12567 (MacNeil et al . , 1992).

To enable transfer of plasmids by conjugation, a transfer function is supplied in trans by the E. coli donor strain ET12567 carrying the self-transmissible pUB307 (Bennett et al . , 1977, Flett et al . , 1997) or ET12567 carrying the non-transmissible pUZ8002 (Kieser et al . , 2000).

To avoid having to transform mutagenised cosmid DNA

(recombinant cosmid containing the knock-out cassette including oriT) into ET12567/pUZ8002, a "triparental" like conjugation has been developed in which the mutagenised cosmid strain, ET12567/pUZ8002, ET12567/pϋB307 and pre-germinated S. coelicolor spores are incubated together in a modified version of the conjugation procedure described by Kieser et al . , 2000. In this "triparental" procedure the cosmid is firstly mobilised by ET1256/pUB307 into strain ET1256/pUZ8002 and then is subsequently mobilised by ET1256/pUZ8002 into S. coelicolor.

In order to allow in-frame deletions within a specific gene or site of interest, different knock-out cassettes have been constructed. pIJ771 and pIJ772 as template plasmids leave behind an 84 bp "scar" sequence with stop codons in all six reading frames after FLP-mediated excision of the knock-out cassette (where the knock-out cassette has previously been integrated into the specific gene or site of interest) . In contrast, the pIJ773 "scar" (81 bp) has stop codons in all three forward but in only one reverse frame. pIJ773 might be useful for creating in-frame deletions in which the scar encodes a new 27-residue internal peptide(s).

Both the inclusion of an oriT within the knock-out cassette and the "triparental" like conjugation allow the development of a high throughput knock-out system in S . coelicolor and potentially in other actinomycetes as well.

As will be evident from the foregoing summary and the following more detailed description, the scar sequences correspond to the "insertions" defined above, including a single FRT site and the A and B or C primers.

The FRT sites are examples of "recombining sequences"; the homology extensions (provided by the PCR primers) are examples of "targeting sequences"; the oriT site is an example of an "origin sequence"; the A, B and C primer sites are examples of "intervening sequences"; the aac(3)IV gene is an example of a selectable marker sequence; the oriT and hyg of the nucleic acid construct which is carried in pIJ774 (and introduced into cosmid A in step a in Fig. 7) are examples of a "second origin sequence" and "second marker sequence", respectively; the Supercos 1 sequences used to target oriT and hyg into cosmid A in Fig. 7 are examples of "helper construct targeting sequences".

Summary of Knock-In Experiments The same technique may be used, not only to make knockout mutants by inserting one or more stop codons into a target gene, but also to insert other nucleic acid sequences of interest into a target gene, e.g. to insert a control sequences (e.g. exogenous promoter) upstream of the coding sequence of the gene or to insert additional coding sequence at the 3' end of the normal coding sequence of the gene, to generate a gene encoding a fusion protein.

The following more detailed description makes reference to the accompanying drawings, in which:

Fig.lA shows the construction of plasmid pIJ771, which contains a nucleic acid construct according to the first aspect of the invention (also referred to as a "knock-out cassette") ;

Fig. IB shows the sequence of the knock-out cassette from pIJ771: the arrows indicate the primer sites A and B (which correspond to intervening sequences as defined previously) , the bold arrows the FRT sites (FLP recognition targets, i.e. recombining sequences) and the broken arrows the primers Apraforw and oriTrev to generate the PCR product of pOJ436, used in the construction of plasmid pIJ771; the upper case underlined sequences (312 bp - 1097 bp and 1450 bp - 1558 bp) represent an apramycin resistance gene aac (3) IV and an ori T, respectively; the lower case sequences (78 bp - 303 bp and 1561 bp - 1612 bp) are homologous to sequences in the vector Supercos 1; the bold upper case sequences at 1106 bp - 1110 bp, at 1130 bp - 1136 bp and at 1154 bp - 1160 bp indicate the ribosomal binding site, the -10 promoter region and the -35 promoter region respectively; Fig. 2 shows a scheme for the construction of plasmids pIJ772 and pIJ773, which also contain knock-out cassettes according to the first aspect of the invention: aac (3) IV = Apramycin resistance gene; FRT = FLP recognition targets; primers: Apraforw (1,5), oriTrev (2), FRTApra (3), FRToriT or oriT773 (4), AoriTrev or AoriT773 (6), AoriTforw (7), Aprarev (8), FRTforw (9), FRTrev or FRT773 (10), left primer site (A) and right primer site (B) ; explanation appears in the text;

Fig. 3A shows the structure of pI 772;

Fig. 3B shows the sequence of the knock-out cassette from pIJ772: the arrows indicate the primer sites A and B and the bold arrows the FRT sites; the underlined sequences (67 bp - 851 bp and 1204 bp - 1313 bp) represent the apramycin resistance gene aac (3) IV and the oriT, respectively; the bold sequences at 860 bp - 864 bp, at 884 bp - 890 bp and at 908 bp - 914 bp indicate the ribosomal binding site, the -10 promoter region and the - 35 promoter region, respectively.

Fig. 4A shows the structure of plasmid pIJ773;

Fig. 4B shows the sequence of the knock-out cassette from pIJ773: the arrows indicate the primer si.te A and C and the bold arrows the FRT sites; the underlined sequences (67 bp - 851 bp and 1204 bp - 1313 bp) represent the apramycin resistance gene aac (3) IV and the oriT, respectively; the bold sequences at 860 bp - 864 bp, at 884 bp - 890 bp and at 908 bp - 914 bp indicate the ribosomal binding site, the -10 promoter region and the - 35 promoter region, respectively. Fig. 5 shows the structure of plasmid pIJ774, which carries a helper nucleic acid construct according to the invention. The hygromycin resistance gene hyg fused with an oriT was cloned into the Smal/Bglll sites of the vector Supercosl to generate pIJ774. After digestion of pIJ774 with Hpal/Ncol , a 3270 bp fragment can be isolated which contains the hygromycin resistance gene hyg and an oriT, flanked by 889 bp and 431 bp stretches of Supercos 1 DNA respectively, which allow integration of this fragment into a mutagenised cosmid by λ RED mediated recombination;

Fig. 6 shows the sequence remaining from each of the knock-out cassettes after FLP-mediated excision of the antibiotic resistance gene and oriT. In pIJ771 and pIJ772, this forms an 84 bp scar, with stop codons in both directions and in all three reading frames. In pIJ773, it forms an 81 bp scar, with stop codons in all three forward reading frames, but only in one reverse reading frame;

Fig. 7 shows a scheme for generating multiple knock-outs. A mutagenised cosmid such as SC1C3 : : whillll , SC1C3: : whillll or SC1C3 :: whi II 13 (as described in the text; these cosmids contain a S . coelicolor whil gene into which a nucleic acid construct of the invention has been introduced) is subjected to FLP mediated recombination to excise the apramycin oriT cassette leaving the predicted "scar" sequence at the site of the original PCR cassette insertion (shown at A as a single FLT site) . To subsequently add a new resistance marker with an ori T to the mutagenised cosmid, pIJ774 was utilised (constructed as described previously and in the text) . The hygromycin- oriT cassette of pIJ774 is used to replace the kanamycin resistance gene of the mutagenised cosmid as follows. The 3270 bp Hpal/Ncol fragment of pIJ774 containing the hygromycin resistance gene hyg combined with an oriT and flanked by 889 bp and 431 bp sequences corresponding to sequences in Supercos 1 is used to replace the kanamycin resistance gene in Supercos 1 by λ RED mediated recombination (a) . In this way, a new oriT is introduced in the mutagenised cosmid (generating a helper plasmid according to the invention) allowing conjugation with a S . coelicolor mutant (B) which already contains the apramycin resistance gene fused with an ori T, generated as described previously. Exconjugants can be selected (b) for single cross-over resulting in hygromycin and apramycin resistant colonies and can be further screened (c) by replica-plating on DNA medium with and without apramycin and hygromycin to select for double cross-over, which leaves colonies lacking both resistance markers. This results in a S. coelicolor mutant (C) which is marker free and therefore can be conjugated with another mutagenised cosmid (D) containing the apramycin resistance gene fused with an oriT to generate a double mutant. The procedure can be repeated following steps (a) , (b) and (c) ;

Fig. 8A shows the structure of an alternative form of plasmid pIJ773 to that shown in Fig. 4, containing the ampicillin resistance gene amp, in place of the bla gene. As with the plasmid of Fig. 4, the plasmid contains the apramycin resistance gene aac (3) IV (AC=X99313) and the oriT of plasmid RP4 (=RK2) (AC=L27758), flanked by FRT sites (FLP recognition targets, see Datsenko and Wanner, 2000) . The disruption cassette was cloned into the EcoRV site of pBluescript SK (+) (rather than pBluescript KS (+) , as in Fig. 4), allowing its isolation as a 1398 bp EcoRI / Hindlll fragment.

* indicates suitable restriction sites for verification of mutagenised cosmid DNA by restriction analysis (for example: SstI generates a 751 bp internal fragment within the disruption cassette) ;

Fig. 8B shows the sequence of the plasmid pIJ773 shown in Fig. 8A. Sequence annotations are provided in Annex 1;

Fig. 9 shows a scheme for the construction of disruption cassettes containing alternative antibiotic resistance markers, with oriT (pIJ778 and pIJ780) and without oriT (pIJ779 and pIJ781) . The genes for alternative antibiotic resistance were amplified by PCR (description in the text) and targeted against pIJ773 using λred recombination. To generate cassettes with an oriT, the primer design was carried out in such a way to allow replacing the apramycin resistance gene aac (3) IV on pIJ773 by the spectinomycin / strepto ycing resistance gene aadA and the viomycin resistance gene vph to generate pIJ779 and pIJ780 respectively. For the generation of disruption cassettes without ori T, the primers for amplification of alternative resistance genes were designed to generate a PCR product which contains the resistance gene with its own promoter. This PCR product is flanked by 40 bp of ori -sequence and 40 bp of aac (3) IV - sequence to allow replacement of the apramycin resistance gene and the oriT by λred recombination;

Fig. 10A shows the structure of template plasmid pIJ778, which contains the streptomycin and spectinomycin resistance gene aadA (AC=M60473) and the ori T of plasmid RP4 (=RK2) (AC=L27758), flanked by FRT sites. The disruption cassette was cloned into the EcoRV site of pBluescript SK (+) allowing its isolation as a 1438 bp EcoRI / Hindlll fragment.

* indicates suitable restriction sites for verification of mutagenised cosmid DNA by restriction analysis (for example: Nael generates a 782 bp internal fragment within the disruption cassette) ;

Fig. 10B shows the sequence of plasmid pIJ778. Sequence annotations are provided in Annex 2;

Fig. 11A shows the structure of template plasmid pIJ780 containing the viomycin resistance gene vph (AC=X99314) and the oriT of plasmid RP4 (=RK2) (AC=L27758), flanked by FRT sites (FLP recognition targets, see Datsenko and Wanner, 2000) . The disruption cassette was cloned into the iScoRV site of pBluescript SK (+) allowing its isolation as a 1510 bp EcoRI/iϊindlll fragment.

* indicates suitable restriction sites for verification of mutagenised cosmid DΝA by restriction analysis (for example: Hindi generates a 1137 bp internal fragment within the disruption cassette) ;

Fig. 11B shows the sequence of plasmid pI.J780. Sequence annotations are provided in Annex 3; and

Fig. 12 shows a scheme for the insertion of an exogenous promoter, tipAp, into the upstream non-coding sequence of the glgE gene of S . coelicolor. Bacteria

Escherichia coli strain BW25113 containing the recombination plasmid pKD46, E. coli BW25141 containing the template plasmid pKD4 and E. coli DH5α containing the yeast Flp recombinase genes were acquired from the E. coli Genetic Stock Centre, Yale University, New Haven, USA (strain numbers CGSC7630, CGSC7632 and CGSC6729 respectively) .

Plasmids

Recombination plasmids : pKD46, pKD20 and pIJ790

The recombination vector pKD46 described by Datsenko and Wanner, 2000 contains the λ RED gam, bet and exo DNA fragments under the control of the araC-P_araB promotor which allows the induction of the λ RED genes by 1 mM L- arabinose in SOB media (Hanahan, 1983) .

The recombination plasmid pKD20 is very similar to pKD46, and may be used interchangeably with pKD46. pKD20 is, however, slightly preferred, as it is a more efficient recombination vector.

The λ Red recombination plasmid pKD20 (E.coli Genetic stock center CGSC Strain#: 7637) was modified by replacing the ampicillin resistance gene bla by the chloramphenicol resistance gene cat by PCR targeting, generating pIJ790, to permit selection for both the cosmid (ampicillin and kanamycin resistance) and the λ Red recombination plasmid pIJ790 (chloramphenicol resistance) . The plasmid pIJ790 was constructed as follows:

The chloramphenicol resistance gene cat was amplified from plasmid pIJ666 (Kieser and Melton., 1988) using primers catforw: (5'-

ATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTCGGCACGTAAGAGGTTC C-3') and catrev: (5'- TTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATTAAGGGCACCAATAACTG C-3') . Underlined is the 3" end of the primer homologous to the cat gene of pIJ666. The 5' end of the primers are homologous to the first (catforw) and the last (catrev) 40 bp of the bla gene for ampicillin resistance of pKD20. Amplification was performed in a 50 μl reaction using the Expand High Fidelity PCR System (Roche) , 100 pg template DNA, 200 μM dNTPs, 50 pmol each primer, 5% DMSO and following protocol: a denaturation step at 94°C for 2 min followed by 25 cycles with denaturation at 94°C for 45s, annealing at 55°C for 45 s and extension at 72°C for 1 min 30 s. A last elongation step was done at 72°C for 5 min. The generated 866 bp fragment was purified using the PCR purification kit (Qiagen) according to the manufacturer's instructions.

E.coli BW25113 containing the recombination plasmid pKD20 was grown in 10 ml SOB (Hanahan, 1983) with carbenicillin (100 μg/ml) and L-arabinose (final concentration of lO M) at 30°C to an OD₆₀o of ~ 0.6 and then made electro- competent by washing twice with 10 ml ice-cold 10 % glycerol and resuspended in 100 μl 10 % glycerol. Cells were electroporated with ~ 100 ng of the purified PCR product. Electroporation was carried out in 0.2 cm ice- cold electroporation chambers using a BioRad GenePulser II set to the following parameters: 200 Ω, 25 μF and 2,5 kV. Shocked cells were added to 1 ml LB (Luria-Bertani medium; Sambrook et al., 1998), incubated 1 h at 30°C and then spread onto LB agar to select for chloramphenicol^R (25 μg/ml) o/n at 30 °C. Chloramphenicol resistant colonies were checked by replica-plating for carbenicillin^s on LB agar plates containing carbenicillin (100 μg/ml) for the successful replacement of the bla gene by the PCR product containing the cat gene.

Template plasmids

The template plasmids pIJ771, pIJ772 and pIJ773 were used to generate the whil-specific knock-out cassette by PCR (see following description) . These plasmids are derived from pBluescript SK (+) (Stratagene, USA) and contain the apramycin resistance gene aac (3) IV and the origin of transfer ori T, flanked by FRT sites (FLP recognition targets) and primer sites.

Construction of these template plasmids was as follows:

PIJ771 (Fig. 1)

The apramycin resistance gene aac (3) IV and the origin of transfer oriT from RK2 were jointly amplified from pOJ436 (Bierman et al . , 1992) using primers Apraforw (5'- TCATGAGCTCAGCCAATC-3' ) and oriTrev (5'- CGCCAGCCTCGCAGAGCAG-3' ) (oligo sequences are underlined in Fig. IB) .

Amplification was performed in a 50 μl reaction using the Expand High Fidelity PCR System (Roche, Germany), 100 pg template DNA, 200 μM dNTPs, 50 pmol each primer, 5% DMSO and following protocol: a denaturation step at 94°C for 2 min followed by 25 cycles with denaturation at 94°C for 45 s, annealing at 55°C for 45 s and extension at 72°C for 1 min 30 s. A last elongation step was done at 72°C for 5 min.

The generated 1246 bp fragment was ligated (using standard methods from Sambrook et al . , 1998) to the 2227 bp Pvull/Nael fragment of pKD4 that contains the FRT sites and bla gene, to generate pIJ771, and was subsequently verified by sequencing.

PIJ772 (Figs. 2 and 3)

Bracketed numbers refer to the primers shown in Fig. 2.

The apramycin resistance gene aac (3) IV and the origin of transfer oriT from RK2 were amplified from pOJ436 using primers Apraforw (1) and oriTrev (2) (see above for primer sequences) which generate a 1246 bp fragment. A second PCR was performed using the 1246 bp fragment as template and the primers FRTApra (3) (5'-

CCTATACTTTCTAGAGAATAGGAACTTCGGAATAGGAACTTCATGAGCTCAGCCAAT

CG-3') and FRToriT (4) (5'- TATTCCGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTGCCAGCCTCGCAGAGCAG

-3' ) to generate a 1325 bp PCR product flanked by partial

FRT (FLP recognition target) sites.

Amplification was performed in a 50 μl reaction using the Expand High Fidelity PCR System (Roche, Germany) , 100 pg template DNA, 200 μM dNTPs, 50 pmol each primer, 5% DMSO and following protocol: a denaturation step at 94°C for 2 min followed by 10 cycles with denaturation at 94°C for 45 s, annealing at 50°C for 45 s and extension at 72°C for 1 min 30 s followed by 15 cycles with denaturation at 94°C for 45 s, annealing at 55°C for 45 s and extension at 72°C for 1 min 30 s. A last elongation step was done at 72°C for 5 min.

To construct the complete FRT sites, two PCR reactions were done under the same conditions as the FRTApra/FRToriT PCR detailed above to generate the left and right FRT sites separately. The left FRT site was generated by PCR using primers AoriTforw (7) (5'- GTGTAGGCTGGAGCTGCTTCGAAGTTCCTATACTTTCTAGAG-3' ) and Aprarev (8) (5' -GTGCAATACGAATGGCGA-3' ) and the right FRT site using primers Apraforw (5) and AoriTrev (6) (5'- CATATGAATATCCTCCTTAGTTCCTATTCCGAAGTTCCTATT-3' ) .

A 851 bp fragment (containing the left FRT site) and a 1309 bp fragment (containing the right FRT site) were gel purified using a QIAquick Kit (Qiagen, Hilden, Germany) according to manufacturers recommendations and digested with Xhol (the apramycin resistance gene aac (3) IV contains an internal Xhol site) . Both digests were purified by phenol/chloroform extraction and ligated together using standard conditions (Sambrook et al . , 1998).

The final knock-out construct was amplified by PCR (for conditions see FRTApra/FRToriT PCR above) using the ligation mix as template (lμl of the 50μl total ligation volume) with primers FRTforw (9) (5'-

GTGTAGGCTGGAGCTGCTTC-3' ) and FRTrev (10) (5'- CATATGAATATCCTCCTTAGT-3' ) , generating a 1375 bp fragment which was further cloned into the EcoRV site of pBluescript SK (+) (Stratagene, USA) to generate pIJ772 (Fig. 3) .

pIJ773 (Figs. 2 and 4)

This plasmid was constructed in the same manner as pIJ772 (Fig. 2) using pOJ436 as template for the first PCR with primers Apraforw (1) and oriTrev (2) . The generated 1246 bp fragment was then used as template for a second PCR with primers FRTApra (3) and oriT773 (4) (5'-

AGTTCCTATTCTCTAGAAAGTATAGGAACTTCGAAGTTGCCGCCAGCCTCGCAGAGC AG-3' ; note that this differs from primer FRToriT used at 4 in the construction of pIJ772) using the same conditions as stated previously for primers FRTApra/FRToriT (3,4) in the construction of pIJ772.

The complete FRT sites were added by two PCRs separately using primers AoriTforw (7) with Aprarev (8) and Apraforw (5) with AoriT773 (6) (5'- ATTCCGGGGATCCGTCGACCTGCAGTTCGAAGTTCCTATTCTCTAGAAAG-3' ; note that this differs from primer Aprarev used at 6 in the construction of pIJ772), generating 851 bp and 1304 bp fragments respectively, which were gel purified (using a QIAquick purification kit (Qiagen, Hilden, Germany) according to manufacturers recommendations) , digested with Xhol , purified by phenol/chloroform extraction, and ligated together using standard conditions (Sambrook et al . , 1998). The ligation mix was then used as template (lμl of the 50μl total ligation volume) to amplify a 1371 bp fragment with primers FRTforw (9) and FRT773 (10) (5'- ATTCCGGGGATCCGTCGACC-3' ; note that this differs from primer FRTrev used at 10 in the construction of pIJ772) . The same conditions were used as described previously for primers FRTApra/FRToriT (3,4) in the construction of pIJ772.

The 1317 bp fragment was subsequently cloned into the EcoRV site of pBluescript SK (+) (Stratagene, USA) to generate pIJ773 (Fig. 4) .

Note that Fig. 2 shows primer B on the right hand side of the knock-out cassette. This is correct for pIJ772, but the knock-out cassette of pIJ773 differs from that of pIJ772 at the right hand side, having instead primer C. See Fig. 4. Both knock-out cassettes have primer A on the left hand side, as shown in Fig. 2.

pIJ774 (Fig. 5)

This template helper plasmid was generated to help in creating multiple knock-outs. The 1843 bp Clal/BamEl fragment of the Omega fragment (Blondelet-Rouault et al . , 1997) carrying the hygromycin resistance gene was subcloned into the Clal/BamEl sites of the 2929 bp Clal/BamRI restriction fragment of pBluescript SK (+) , yielding pBSKyg.

The ori T of RK2 was amplified from pOJ436 using primer oriTrev (5' -CGCCAGCCTCGCAGAGCAG-3' ) and OriTB (5'- GAGTGGATCCTGCCAGCCTCGCAGAGCAG-3' ) introducing a new BamHI site at one end of the generated PCR product.

Amplification was performed in a 50 μl reaction using the Expand High Fidelity PCR System (Roche, Germany) , 100 pg template DNA, 200 μM dNTPs, 50 pmol each primer, 5% DMSO and following protocol: a denaturation step at 94°C for 2 min followed by 25 cycles with denaturation at 94°C for 45 s, annealing at 55°C for 45 s and extension at 72°C for 'l min 30 s. A last elongation step was done at 72°C for 5 min.

The resulting 120 bp fragment was digested with BamHI and ligated (using standard conditions, Sambrook et al . , 1998) to a 4749 bp BamHI /HindiII fragment from BamHI /Hindi11 digested pBSKyg to generate a linear fragment that is blunt at one end and possesses a Hindlll site at the other end. This linear fragment was then rendered blunt at both ends by using the DNA polymerase activity of the Klenow enzyme and pBSKhyg-oriT was then subsequently obtained by ligation of the two ends of the 4864 bp blunt ended fragment. Following this a 1951 bp fragment containing the hygromycin resistance gene and the ori T was removed from pBSKhyg-oriT by XhoI/BamHI digestion and ligated (using standard conditions Sambrook et al . , 1998) to the 6934 bp fragment from a Smal/Bglll digest of Supercosl DNA (Stratagene, USA) to generate a linear fragment that was then blunt ended with Klenow enzyme and religated to generate pIJ774.

Alternative form of pIJ773 (Fig. 8)

Fig. 8 shows an alternative form of plasmid pIJ773, containing the ampicillin resistance gene amp, in place of the jla gene.

This form of pIJ773 was used for the production (see below) of plasmids pIJ778-781.

To allow multiple double or triple mutants without need for the FLP-mediated excision system, different knock-out cassettes in template plasmids for gene disruptions were constructed allowing selection in E. coli and Streptomyces . In addition to the disruption cassettes present in pIJ772 and pIJ773 (containing the apramycin resistance gene aac (3) IV with ori T) , pIJ778 containing the spectinomycin-streptomycin resistance gene aadA with ori T and pIJ780 containing the viomycin resistance gene vph with ori T were constructed using pIJ773 as target for PCR targeting.

After a single disruption with an oriT-containing cassette, further disruptions can be performed on the same cosmid with oriT-free cassettes (pIJ779 contains aadA without oriT and pIJ780 contains vph without oriT) .

The PCR products to generate pIJ778-781 were constructed as follows (see Figs. 9-11):

The spectinomycin-streptomycin resistance gene aadA was amplified from the omega fragment from pHP45Ω (Prentki et al . , 1991; Prentki and Krisch, 1984) using primers pIJ778F (5'-

GAACTTCATGAGCTCAGCCAATCGACTGGCGAGCGGCATCTTATTTGCCGACTACCT TGG -3') and pIJ778R (5'- CTATGATCGACTGATGTCATCAGCGGTGGAGTGCAATGTCATGAGGGAAGCGGTGAT CGC -3') or pIJ778F and pIJ779R (5'-

AAGTTCCCGCCAGCCTCGCAGAGCAGCATTCCCGTTGAGCGTACAGTCTATGCCTGC GGC -3"), respectively. Underlined is the 3' end of the primer homologous to the aadA gene of the omega fragment (primer pIJ779R includes the promoter sequence of aadA) . The 5' end of the primer pIJ778F is homologous to the last 40 bp of the aac (3) IV gene of pIJ773. The 5' ends of the primers pIJ778R and pIJ779R are homologous to the first 40 bp of the aac (3) IV gene or to the first 40 bp of the oriT of pIJ773 respectively. The PCR products to generate pIJ780 and pIJ781 were constructed in the same manner as pIJ778 and pIJ779. The viomycin resistance gene vph was amplified from the omega fragment (Blondelet-Rouault et al . , 1997) using primer pIJ780F (5'-

GAACTTCATGAGCTCAGCCAATCGACTGGCGAGCGGCATCCTACCGGTAGCCGCTGA GGC-3 ' ) and pIJ780R (5'- CTATGATCGACTGATGTCATCAGCGGTGGAGTGCAATGTCATGAGAATCATTGAGAC GCA-3') or pIJ780F and pIJ781R (5'-

AAGTTCCCGCCAGCCTCGCAGAGCAGGAATCCCGTTGAGCGATGAAGGCAGGAACCC AGT-3') respectively. Underlined is the 3' end of the primer homologous to the vph gene of the omega fragment (primer pIJ781R includes the promoter sequence of vph) . The 5" end of the primer pIJ780F is homologous to the last 40 bp of the aac (3) IV gene of pIJ773. The 5' ends of the primers pIJ780R and pIJ78lR are homologous to the first 40 bp of the aac (3) IV gene or to the first 40 bp of the oriT of pIJ773 respectively.

Amplification was performed in a 50 μl reaction using the Expand High Fidelity PCR System (Roche) , 100 pg template DNA, 200 μM dNTPs, 50 p ol each primer, 5% DMSO and the following protocol: a denaturation step at 94°C for 2 min followed by 25 cycles with denaturation at 94°C for 45 s, annealing at 55°C for 45 s and extension at 72°C for 1 min 30 s. A last elongation step was done at 72°C for 5 min. The generated PCR products were purified using the PCR purification kit (Qiagen) according to the manufacturer's instructions.

RESULTS A preliminary gene disruption experiment was carried out using the whil gene of S . coelicolor. This gene is known to be involved in sporulation and its deletion results in a white non-sporulating phenotype (Ainsa et al . , 1999). In the gene disruption experiments described here, deletion of the whil gene resulted (as expected) in a visible phenotype that lacked sporulation and appeared as white colonies on SFM (Kieser et al . , 2000) agar plates. In three knock-out experiments using template plasmids pIJ771, pIJ772 and pIJ773 respectively, the gene disruption was done in the S . coelicolor cosmid SC1C3 (Redenbach et al . , 1996) followed by conjugation of the mutagenised cosmid into S. coelicolor (strain M145) .

Experiment 1

This experiment was performed with the template plasmid pIJ771 which should, following double cross-over in S. coelicolor, result in an 84 bp scar sequence that possesses stop codons in all 6 reading frames.

Gene disruption in the S. coelicolor cosmid SC1C3

Using a 1860 bp Hindlll fragment of pIJ771 containing the aac (3) IV gene and the oriT flanked by FRT sites as template a wniI-specific knock-out PCR product was generated by using primers whilFRTforw (5'-

CAGTGTGTCCGAATTGCTCGGATTGTTACTCACCAGATCGGTGTAGGCTGGAGCTGC TTC-3' ) and whilFRTrev (5'- GAGCGGGGAGCGGAGATCGGGGAATCGGGGATCGGAGCGGCATATGAATATCCTCCT TAGT -3') (underlined is the 3' end of the primer with homology to the primer site of the knock-out cassette) . Amplification was performed in a 50 μl reaction 'using the Expand High Fidelity PCR System (Roche, Germany) , using 100 pg template DNA, 200 μM dNTPs, 50 pmol each primer, 5% DMSO and following protocol: a denaturation step at 94°C for 2 min followed by 10 cycles with denaturation at 94°C for 45 s, annealing at 45°C for 45 s and extension at 72°C for 1 min 30 s followed by 15 cycles with denaturation at 94°C for 45 s, annealing at 50°C for 45 s and extension at 72°C for 1 min 30 s. A last elongation step was done at 72°C for 5 min.

E. coli BW25113 containing the recombination plasmid pKD46 was grown in 10 ml SOB (Hanahan, 1983) with carbenicillin (100 μg/ml) at 30°C to an OD₆oo of « 0.6 and then made electro-competent by washing twice with 10 ml ice-cold 10 % glycerol and resuspending in 100 μl 10 % glycerol. Cells were electroporated with « 100 ng of cosmid SC1C3 DNA. Electroporation was carried out in 0.2 cm ice-cold electroporation chambers using a BioRad GenePulser II set to the following parameters: 200 Ω, 25 μF and 2.5 kV.

Shocked cells were added to 1 ml LB (Luria-Bertani medium; Sambrook et al . , 1998), incubated 1 h at 30°C and then spread onto LB agar to select for carbenicillin^E (100 μg/ml) , and kanamycin^R (50 μg/ml) .

Transformants containing the recombination plasmid pKD46 and the S . coelicolor cosmid SC1C3 were grown in 10 ml SOB cultures with carbenicillin (100 μg/ml) kanamycin (50 μg/ml) and L-arabinose (ImM final) in order to induce the expression of the λ RED genes, at 30°C to an OD₆₀o of « 0.6 and then made electro-competent by concentrating 100-fold and washing twice with 10 ml ice-cold 10 % glycerol and finally resuspending in 100 μl 10 % glycerol. Cells were electroporated with « lOOng of purified (QIAquick Purification Kit, Qiagen, Hilden, Germany) knock-out cassette PCR product using the same parameters and conditions as during electroporation (see above) .

Shocked cells were added to 1 ml LB, incubated 1 h at 37°C and then spread onto LB agar to select for carbenicillin¹¹ (100 μg/ml) apramycin (50 μg/ml) and kanamycin^R (50 μg/ml) .

Recombinant cosmid DNA (designated SC1C3 : : whill 11 ) from antibiotic resistant transformants was further characterized by restriction enzyme digestion with

Xhol/Sacl (the knock-out cassette contains one internal Xhol and two internal Sad site(s)) and PCR using primer Aprarev (5' -GTGCAATACGAATGGCGA-3' ) with primer whiI2 (5'- CTATTTCGGAGGGCTCTC-3' ) and primer oriTforw (5'- GCCAGCCTCGCAGAGCAG-3' ) with primer whill (5'-

GAGAGATCGGGACAGGCC-3' ) to verify left and right novel joints.

The restriction enzyme digests and PCR products generated fragments of the size expected (as determined by agarose gel electrophoresis) and as predicted. The PCR fragments generated were approximately 1487 bp and 715 bp from the Aprarev/whi12 and oriTforw/ whill primer combinations respectively.

On average, ~ 1500 transformants were obtained by transforming the E. coli strain containing the recombination plasmid pKD46 and the cosmid SC1C3 with 100 ng of PCR product. Restriction digestion and PCR verification showed that less than 2% of all resulting transformants have the PCR knock-out cassette fragment integrated within the expected location in the cosmid SC1C3. Most of the transformants have the knock-out cassette integrated in the Supercos 1 sequence within the cosmid. The reason for this is the presence of a 226 bp sequence upstream of the aac (3) IV gene and a 52 bp sequence between oriT and the right FRT site within the knock-out cassette that show 100% homology to the vector Supercos 1 (Fig. IB) , which is the vector used for the construction of the ordered S. coelicolor cosmid library used in this experiment (Redenbach et al., 1996).

To avoid this problem of false positives (transformants which are apramycin^R, but show an integration of the whil- specific knock-out cassette within the vector of the cosmid SC1C3) , a new template plasmid pIJ772 was constructed as described above lacking the sequence homology to Supercos 1. See Experiment 2.

Conjugation of S. coelicolor M145 with mutagenised cosmid SC1C3: -. whillll

In order to test the functionality of the oriT in

SC1C3: : whillll, a conventional conjugation was carried out following the protocol described by Kieser et al . , 2000 p249. The methylation-deficient E. coli host ET12567 (MacNeil et al . , 1992) carrying the non-transmissible pUZ8002 (Kieser et al . , 2000) was grown in 10 ml LB containing kanamycin (25 μg/ml) and chloramphenicol (25 μg/ml) to maintain selection for pUZ8002 and the dam mutation, respectively, and made electro-competent as described above. Electro-competent cells of ET12567/pUZ8002 were transformed with ~ 100 ng of SC1C3: : whill l l DNA and selected for apramycin^R (50 μg/ml) on LB agar plates.

A single colony of ET12567/pUZ8002/SClC3 : : whillll was inoculated into 10 ml LB containing kanamycin (25 μg/ml) , chloramphenicol (25 μg/ml) and apramycin (50 μg/ml) and grown overnight at 37°C. The overnight culture was diluted 1:100 in fresh LB with antibiotic selection (see above) and grown at 37°C to an OD₆₀o of « 0.4 - 0.6. The cells were washed twice with an equal volume of LB to remove antibiotics and resuspended in 1 ml of LB.

For each conjugation, approximately 10⁸ Streptomyces spores were added to 500 μl 2 x YT broth, heat shocked at 50°C for 10 min, allowed to cool and then mixed with 500 μl ETl2567/pUZ8002/SClC3: -. whillll cells, spun briefly and most of the supernatant was poured off. The pellet was resuspended in the residual liquid and plated out on SFM agar + 10 mM MgCl₂ (Kieser et al . , 2000) and incubated at 30°C for 16-20 h.

Plates were overlaid with 1 ml water containing 0.5 mg nalidixic acid (which kills E. coli, thereby selecting for the Streptomyces cells) and 1 mg apramycin and incubated at 30°C for 3 - 6 days. Exconjugants were replica-plated on DNA medium (Kieser et al . , 2000) containing kanamycin (50 μg/ml) and apramycin (50 μg/ml) and onto another plate containing kanamycin (50 μg/ml) only, to screen for double cross-over exconjugants which are kanamycin^s and apramycin^R. On average, 1000 - 1500 exconjugants were obtained by conjugating pregerminated S. coelicolor M145 spores with the E. coli strain ETl2567/pUZ8002/SClC3: : w iJ771. The rate of double cross-over was above 25 % as determined by the ratio of the number of colonies which were kanamycin^s and apramycin^R to the number which were kanamycin^R and apramycin^R.

Ten positive double cross-over mutants showing the expected white colony phenotype were verified by PCR using primers whill and whil2 following the protocol described by Kieser et al . , 2000 p402-403. A fragment of about 2566 bp should be generated as predicted. A fragment of approximately 2566 bp (as determined by agarose gel electrophoresis) was observed in all ten cases .

Experiment 2

This experiment was performed with the template plasmid pIJ772 which has had the region of homology to SC1C3 in the PCR knock-out cassette removed and should, following double cross-over in S. coelicolor, result in an 84 bp scar sequence that possesses stop codons in all 6 reading frames.

Gene disruption in the S. coelicolor cosmid SC1C3.

Using an internal 1399 bp BcoRI/Hindlll fragment of pIJ772 containing the apramycin resistance and the oriT flanked by FRT and primer sites, a whil-specific knockout cassette was generated by PCR and E. coli BW25113 containing the recombination plasmid pKD46 was made electro-competent and transformed with S. coelicolor cosmid SC1C3 following the procedure described in Experiment 1.

E. coli BW25113 containing the recombination plasmid pKD46 and the cosmid SC1C3 was made chemical-competent with TSS (85% LB, 5% DMSO, 10% PEG, 50 mM MgCl₂: pH 6.5) following the protocol of Chung et al . , 1989. Competent cells were transformed with ~ 100 ng unpurified knock out cassette PCR product, heat shocked at 42°C for 90 s and added to 1 ml LB, incubated 90 min at 37°C and then spread onto LB agar to select for carbenicillin^R (100 μg/ml) , kanamycin^R (50 μg/ml) and apramycin^R (50 μg/ml) .

On average, 70 antibiotic resistant transformants were obtained for each transformation of E. coli

BW25113/pKD46/SClC3 with ~ 100 ng knock out cassette PCR product.

Recombinant cosmid DNA (designated SC1C3 : : whi 1112 ) for 48 of the resulting 70 transformants was further characterized by restriction enzyme digestion with Xhol/SacI and PCR using primer Aprarev with primer whil2 and primer oriTforw with primer whiI2 . In recombinant cosmids from all 48 transformants the restriction enzyme digests and PCR products generated fragments of the size expected (as determined by agarose gel electrophoresis) and predicted. The PCR fragments generated were approximately 1242 bp and 600 bp for the Aprarev/whi12 and oriTforw/ whiI2 primer combinations respectively.

Conjugation of S. coelicolor M145 with mutagenised cosmid SC1C3: : whim 2 To avoid the transformation step of ET12567/pUZ8002 with DNA of SC1C3: : whill 12 a "triparental" like conjugation was carried out between an E. coli strain harbouring SC1C3: : whiI112 , ET12567/pUZ8002 and ET124567/pUB307 together with pre-germinated S . coelicolor spores following the conjugation procedure described by Kieser et al . , 2000 and in Experiment 1.

120 exconjugants were obtained per conjugation in comparison with 1000 - 1500 exconjugants obtained using a conventional conjugation method (including the additional step oftransforming ETl2567/pUZ8002 with SC1C3 : : whi II 12 ) which represents a sufficient yield of exconjugants, considering a double-cross-over rate of at least 25%. Ten positive double cross-over mutants showing the expected white colony phenotype were verified by PCR using primers whill and whil2 following the protocol described by Kieser et al . , 2000. These PCR reactions generated a fragment of approximately 2267 bp (as determined by agarose gel electrophoresis) in all ten cases as expected and predicted.

Experiment 3

This experiment was performed with the template plasmid pIJ773 which has had the region of homology to SC1C3 in the PCR knock out cassette removed and should, following double cross-over in S. coelicolor, result in an 81 bp scar sequence that possesses stop codons in all 3 forward and one reverse reading frames.

Gene disruption in the S. coelicolor cosmid SC1C3 Using an internal 1396 bp EcoRI/Hindlll fragment of pIJ773 containing the apramycin resistance and the oriT flanked by FRT and primer sites, a whiJ-specific knockout cassette was generated by PCR using primers whiJFRTforw and whi II 13 (5'~

GAGCGGGGAGCGGAGATCGGGGAATCGGGGATCGGAGCGGTTCCGGGGATCCGTCGA CC-3' ; underlined is the 3' end of the primer that possesses homology to the primer site of the knock-out cassette pIJ773) . Conditions of the PCR are described in Experiment 1.

E. coli BW25113 containing the recombination plasmid pKD46 was made electro-competent and transformed with S . coelicolor cosmid SC1C3 following the procedure described in Experiment 1.

E. coli BW25113 containing the recombination plasmid pKD46 and the cosmid SC1C3 were made chemical-competent and transformed with the whil knock-out cassette PCR product as described in Experiment 2.

Recombinant cosmid DNA (designated SC1C3 : : whi II 13 ) from 48 of the resulting transformants was further characterized by restriction enzyme digestion with Xhol / Sad and PCR using primer Aprarev with primer whil2 and primer oriTforw with primer whi 12 . In all 48 selected transformants the restriction enzyme digests and PCR products generated fragments of the size expected (as determined by agarose gel electrophoresis) and predicted. The PCR fragments generated were approximately 1242 bp and 586 bp for the Aprarev/whi12 and oriTforw/whiI2 primer combinations respectively. Conjugation of S. coelicolor M145 with mutagenised cosmid SC1C3: : whiI773

The conjugation procedure followed the description in Experiment 2. 90 exconjugants were obtained with a double cross-over rate of at least 25%. Ten positive double cross-over mutants showing the expected phenotype were verified by PCR using primers whill and whiI2 following the protocol described by Kieser et al . , 2000. These PCR generated a fragment of approximately 2253 bp fragment

(as determined by agarose gel electrophoresis) in all ten cases as expected and predicted.

Experiment 4 : Elimination of the knock-out cassette by FLP-mediated recombination

BT340 [CGSC7629] is an ampicillin and chloramphenicol resistant plasmid that shows temperature-sensitive replication (only replicates at 30°C) and allows the thermal induction of FLP synthesis at 42°C (Cherepanov and Wackernagel, 1995) .

E. coli strains harbouring SC1C3 : : whillll, SC1C3 :: whill 12 or SC1C3: : whi 1113 cosmids and resistant to all three apramycin, kanamycin and carbenicillin antibiotics were transformed with the BT340 plasmid, and apramycin^R and chloramphenicol^R transformants were selected at 30°C.

For each recombinant cosmid strain (i.e. SC1C3 : : whilll l , SC1C3: \ whiI112 or SC1C3 :: whill 13 derivatives), 50 colonies were streaked on a single LB agar plate (masterplate) with no antibiotics and were grown non- selectively at 43°C for 6 h to allow the expression and synthesis of the FLP recombinase and the loss of the plasmid BT340 simultaneously. The masterplate was then replica-plated on LB agar containing apramycin (50 μg/ml) to test for loss of the knock-out cassette.

After 6 h of non-selective growth at 43°C more than 50% of the colonies were apramycin^s indicating that recombinant cosmids had lost the apramycin resistance gene and the oriT simultaneously resulting in the predicted 84 bp or 81 bp "scar". Using primers whill and whi 12 , the remaining "scar" of five apramycin^s derivatives for each of SC1C3: : whilll l , SC1C3: : whiI112 and SC1C3 : : hiI773 was amplified by PCR and sequenced (Fig. 6) .

For each recombinant SC1C3:: whil cosmid the five sequences obtained were all identical and confirmed that the FLP mediated excision of the knock out cassette had occurred as expected and resulted in the predicted scar sequence. After excision of the knock-out cassette from SC1C3:. - whillll and SC1C3: : whi!772 a 84 bp "scar" sequence was left in place of the disrupted gene(s) with stop codons in all six reading frames. In contrast, the remaining "scar" from SC1C3: : whi 1113 (81 bp) has stop codons in all three forward but in only one reverse frame .

It is believed that this procedure may also work in actinomycete cells, to remove the origin sequence and marker sequence following an integration step into the chromosomal gene, thereby to leave a single FRT site (and optionally any intervening sequence, such as the primer sites A and B or C) as a scar sequence.

Experiment 5 : Development to generate multiple knock-outs The helper plasmid pIJ774 was constructed to allow multiple knock-outs in S. coelicolor by repeated use of the knock-out cassette containing apramycin resistance and oriT.

After FLP-mediated excision of the apramycin resistance and the oriT in the mutagenised cosmid (Fig. 7, at A) , the 3270 bp Hpal/Ncol fragment of pIJ774 (hygromycin resistance with oriT) , whose ends correspond to 889 bp and 431 bp sequences in Supercos 1, is introduced by λ RED mediated targeting following the same protocol described in Experiment 2 (Fig. 7, at A) . (This procedure is comparable to the disruption of the cosmid gene in earlier experiments.) In this way, the Supercos 1 kanamycin resistance marker is replaced by the hygromycin resistance marker fused with an oriT.

The use of a different selectable marker in the helper plasmid allows confirmation that the new oriT sequence has been introduced into the helper plasmid.

After conjugation with a S. coelicolor mutant containing the apramycin resistance gene/oriT knock out cassette inserted into the chromosome (generated as described in Experiments 1, 2 and 3) , exconjugants can be selected on hygromycin (50 μg/ml; Fig. 7, at B) and screened by replica-plating on DNA-medium with and wrthout apramycin (50 μg/ml) and hygromycin (50 μg/ml; Fig. 7, at C) for the loss of both resistance markers.

This S. coelicolor mutant (containing one "scar" within the first disrupted gene; Fig. 7, at C) can then be conjugated with another mutagenised cosmid containing an apramycin resistance cassette derived from pIJ77l, pIJ772 or pIJ773 generating a double mutant (containing one "scar" within the first disrupted gene and the knock-out cassette at a second location; Fig. 7, at D) .

This procedure can be repeated to generate multiple knock-outs in S. coelicolor without necessarily using more than two different resistance markers.

Experiment 6: Use of recombination plasmid pIJ790 instead of pKD46, along with template plasmid pIJ773 and optionally pIJ778-781

E. coli BW25113 containing the recombination plasmid pIJ790 and the template plasmid pIJ773 was grown in 10 ml SOB (Hanahan, 1983) with carbenicillin (100 μg/ml) and L- arabinose (final concentration of lOmM) at 30°C to an OD₆oo of ~ 0.6 and then made electro-competent by washing twice with 10 ml ice-cold 10 % glycerol and resuspended in 100 μl 10 % glycerol. Cells were electroporated with ~ 100 ng of the purified PCR product, respectively and electroporated in a 0.2 cm ice-cold electroporation chambers using a BioRad GenePulser II set to the following parameters: 200 Ω, 25 μF and 2,5 kV. Shocked cells were added to 1 ml LB (Luria-Bertani medium; Sambrook et al . , 1998), incubated 1 h at 37°C and then spread onto LB agar plates to select for carbenicillin^R (100 μg/ml) , spectinomycin^R (50 μg/ml) and streptomycin^R (50 μg/ml) for transformants where the pIJ778 and pIJ779 PCR product was used and DNA agar plates to select for carbenicillin^R (100 μg/ml) and viomycin^R (30 μg/ml) for transformants where the pIJ780 and pIJ781 PCR product was used. The insert of each template plasmid was confirmed by sequencing with T3 and T7 primers in a standard sequencing reaction.

In more than 25 further knock-out experiments, pIJ790 was used successfully instead of pKD46 for gene disruption experiments .

Summary of Disruption Experiment Results

In the above experiments, and continuations thereof, the following gene disruptions have so far successfully been performed.

Cosmid SC1C3, gene whil, template plasmid pIJ771, recombination plasmid pKD46, primers used: whilFRTforw

CAGTGTGTCCGAATTGCTCGGATTGTTACTCACCAGATCGGTGTAGGCTGGAGCTGC

TTC whiIFRTrev

GAGCGGGGAGCGGAGATCGGGGAATCGGGGATCGGAGCGGCATATGAATATCCTCCT

TAGT

Cosmid SC1C3, gene whil, template plasmid pIJ772, recombination plasmid pKD46, primers used: whilFRTforw

CAGTGTGTCCGAATTGCTCGGATTGTTACTCACCAGATCGGTGTAGGCTGGAGCTGC

TTC whiIFRTrev GAGCGGGGAGCGGAGATCGGGGAATCGGGGATCGGAGCGGCATATGAATATCCTCCT

TAGT

Cosmid SC1C3, gene whil, template plasmid pIJ773, recombination plasmid pKD46, primers used: whilFRTforw

CAGTGTGTCCGAATTGCTCGGATTGTTACTCACCAGATCGGTGTAGGCTGGAGCTGC TTC whiI773 GAGCGGGGAGCGGAGATCGGGGAATCGGGGATCGGAGCGGTTCCGGGGATCCGTCGA CC

Cosmid SC1C3, gene whil, template plasmid pIJ778, recombination plasmid pIJ790, primers used: whilFRTforw

CAGTGTGTCCGAATTGCTCGGATTGTTACTCACCAGATCGGTGTAGGCTGGAGCTGC

TTC whiI773

GAGCGGGGAGCGGAGATCGGGGAATCGGGGATCGGAGCGGTTCCGGGGATCCGTCGA CC

Cosmid SC1C3, gene whil, template plasmid pIJ779, recombination plasmid pIJ790, primers used: whilFRTforw CAGTGTGTCCGAATTGCTCGGATTGTTACTCACCAGATCGGTGTAGGCTGGAGCTGC

TTC whil773

GAGCGGGGAGCGGAGATCGGGGAATCGGGGATCGGAGCGGTTCCGGGGATCCGTCGA

CC

Cosmid SCH24, gene 18, template plasmid pIJ773, recombination plasmid pIJ790, primers used:

H24.18 forw

GGGCGCCCGTCTCCGCCAAGGCCACGTACCCTGTTTTGTTATTCCGGGGATCCGTCG ACC

H24.18 rev

TCATGCGTTGTCCGGGTGCTGAGCCCACCATTCCTTCAGTTGTAGGCTGGAGCTGCT

TC Cosmid SC3C3, gene gsp, template plasmid plJ773, recombination plasmid pIJ790, primers used: 3C3.gsp forw

GGCGTGGGACAAAAGACGACAAGCATCGGAGAAACCACTAATTCCGGGGATCCGTCG ACC

3C3.gsp rev

GTGGCGCTACGGGACGTCATCTGTCGGGGTCGTCCTTCTTTGTAGGCTGGAGCTGCT

TC

Cosmid SC7G11, gene wblE, template plasmid pIJ773, recombination plasmid pIJ790, primers used:

7Gll.wblE forw

AAGCATCCCAGCATGTAATACCAAGGAGAGGTAGCAGCCATTCCGGGGATCCGTCGA

CC 7Gll.wblE rev

ACGCGCCGCCAAGCTGAGGCTGTCAGTAGGGGTGGGTTGTGTAGGCTGGAGCTGCTC

Cosmid SC3B6, gene 14, template plasmid pIJ773, recombination plasmid pIJ790, primers used: 3B6.14 forw

GTCAAGCGGCCGGAACGAACAGACGAGGAAGACCACCCCATTCCGGGGATCCGTCGA

CC

3B6.14 rev

ACGTCAGGGGGCGGTCGATCGTTCCTGCGGTGTTCATGCTGTAGGCTGGAGCTGCTT C

Cosmid SC1B2, gene 28c, template plasmid .pIJ773,. recombination plasmid pIJ790, primers used: lB2.28c forw CCTAGCCCGACCGGTGCGGCAGCACATCGGAGACCCGCCATTCCGGGGATCCGTCGA CC

1B2.28C rev

AGGTGGCACCGAAGGCGAGGACGGGGTGGGTCATGCTGCTGTAGGCTGGAGCTGCTT C Cosmid SC5F8, gene 16c, template plasmid pIJ773, recombination plasmid pIJ790, primers used:

5F8.16c forw

TGGACGAGGCGCGAACGATACCGATCGCAGGTGACTTTGATTCCGGGGATCCGTCGA

CC

5F8.16c rev

GTGCCCGCGCCGGGCTGCCTCCGGCGTGGGCGGCGAGGGTGTAGGCTGGAGCTGCTT

C

Cosmid SC4B10, gene 07, template plasmid pIJ773, recombination plasmid pIJ790, primers used: 4B10.07 forw

CCCCGAACCGGTATCCGTTTCTCATACAGGAGACAATTCATTCCGGGGATCCGTCGA CC

4B10.07 rev

CCAGATCCCCTCGACCGGCCCGACATCGACGGCCCAGGCTGTAGGCTGGAGCTGCTT

C

Cosmid SCP1/17, gene 95, template plasmid pIJ773, recombination plasmid pIJ790, primers used:

SCP117.95 forw

CGGAGCTGTCTCCTGCACTGGACCTTCTGGGAGGCCCTGATTCCGGGGATCCGTCGA

CC SCP117.95 rev

GGGGCGGGCCCGAACTTGCCCGCCGGTCCCGGACAGCGGTGTAGGCTGGAGCTGCTT

C

Cosmid SCP1/32, gene 115, template plasmid pIJ773, recombination plasmid pIJ790, primers used: SCP132.115 forw

CGAGTTGCACGCAATGCTCCCGGAGATCGCGTCAGTACTATTCCGGGGATCCGTCGA CC SCP132.115 rev

CTTCAACGGACCCCGCCGGTCACGTGCAGGGCCCAGCGCTGTAGGCTGGAGCTGCTT

C

Cosmid SCH17, gene 13c, template plasmid pIJ773, recombination plasmid pIJ790, primers used: Hl7.13c forw

CCGTGGGGGAGCCTCGATTCGGGAGAGGACGGCGCCGGTATTCCGGGGATCCGTCGA CC H17.13C rev

GCCGGGCGCCTGATCCGGGCCCCTGGTCCGGCCTCGGGGTGTAGGCTGGAGCTGCTT C

Cosmid SC9B1, gene 20, template plasmid pIJ773, recombination plasmid pIJ790, primers used:

9B1.20 forw

CGGCGGATGCGGTCGAAGAGCCCTGGGTAGGGCCGGGCCATTCCGGGGATCCGTCGA

CC

9B1.20 rev CGAGCCACGAAAGAGTGAGACTGAACGTCCGTCAGCGCGTGTAGGCTGGAGCTGCTT

C

Cosmid SC4G10, gene 13c, template plasmid pIJ773, recombination plasmid pIJ790, primers used: 4Gl0.13c forw

CGCGCCGCAGAACGGAGGGTCAGGAGCCTCATGACCGTCATTCCGGGGATCCGTCGA

CC

4G10.13c rev

GTCTTCGGCATGGTGACGCGTCCTTTCCTCGGCCCACGCTGTAGGCTGGAGCTGCTT C

Cosmid SC4G10, gene glgPII, template plasmid pIJ773, recombination plasmid pIJ790, primers used: 4Gl0.glgPII forw ATCGTCCGTACCCCCGGACCGTCCGGAAGGTGACCGGCCATTCCGGGGATCCGTCGA CC

4G10.glgPII rev

ACCGACTGCCCCGGACAGCCGGTCGGACACCTGGCAGGCTGTAGGCTGGAGCTGCTT C

Cosmid SC7H1, gene 32, template plasmid pIJ773, recombination plasmid pIJ790, primers used:

7H1.32 forw TCTAGCCTCGGTCGCAGACCCAGGAGGAACCCCATGACGATTCCGGGGATCCGTCGA

CC

7H1.32 rev

CCGGTCGTAGTAGCGCAGGGTGCGGATGCTCAGCCCGGTTGTAGGCTGGAGCTGCTT

C

Cosmid SCE39, gene 25, template plasmid pIJ773, recombination plasmid pIJ790, primers used:

E39.25 forw

GACGGACTGACGCGAAGAGCCAGGAGAACAACGGTGGACATTCCGGGGATCCGTCGA CC

E39.25 rev

GACCAGGCCGGTCGTCTCGTAGTGCCGGATGGTGCGCAGTGTAGGCTGGAGCTGCTT

C

Cosmid SC6A11, gene 13, template plasmid pIJ773, recombination plasmid pIJ790, primers used:

6A11.13 forw

TTGACGTCCGCGTCAAGGCTTACGTTCGTCCCCAGTCGAATTCCGGGGATCCGTCGA

CC 6A11.13 rev

GCCCCGCCGCGCGGGCAGCAGACCCCGCGACTCGTAGTATGTAGGCTGGAGCTGCTT

C Cosmid SC5F1, gene 39, template plasmid pIJ773, recombination plasmid pIJ790, primers used: 5F1.39 forw

CGCTAGACCCTGACACTGACGTCAGAGGCAAGTATGTGTATTCCGGGGATCCGTCGA CC

5F1.39 rev

CTCGTAGTAGCGCACCGACCGGACGCTGACTCCGGCCCGTGTAGGCTGGAGCTGCTT

C

Cosmid SC5H1, gene sigL, template plasmid pIJ773, recombination plasmid pIJ790, primers used:

5Hl.sigL forw

AGCCGTGACTTTCGTGGGAGAGGCAATGCAGACCGCCGTGATTCCGGGGATCCGTCT

ACC 5Hl.sigL rev

CTCAGGCGCAGCCGAGTTCGCCCAGCATGCCCTCGCGCAGTGTAGGCTGGAGCTGCT

TC

Cosmid SC5F8, gene sigM, template plasmid pIJ773, recombination plasmid pIJ790, primers used:

5F8.sigM forw

GCGGATCCGCATGCTCATAGAAACGCCCACCATCCGTCCCATTCCGGGGATCCGTCG

ACC

5F8.sigM rev CTCCCTGTCACCTGCTGTGTCCCCTGTGATCCTTGTGTCCTGTAGGCTGGAGCTGCT

TC

Cosmid SCF55, gene sigJ, template plasmid pIJ773, recombination plasmid pIJ790, primers used: F55.sigJ forw

CTTCGAGCAGCTCACCGTGCTGGAGGAGGGCACGCCCGAGATTCCGGGGATCCGTCG ACC F55.sigJ rev

ACCCGAGCCCCGCTCAGGTGGTGCTGAGCATGCCTTCCCGTGTAGGCTGGAGCTGCT TC

Cosmid SCF55, gene dps, template plasmid pIJ773, recombination plasmid pIJ790, primers used: F55.dps forw

CGAAACGCATGAGGAGCTGAGGTCCGCCATGACGCACGACATTCCGGGGATCCGTCG ACC F55.dps rev

CGGCGCTCTCGAGATGCGCCCGCACGAACCACTGGAACTGTGTAGGCTGGAGCTGCT TC

Cosmid SC5C7, gene sigK, template plasmid pIJ773, recombination plasmid pIJ790, primers used:

5C7.sigK forw

GCGACGCACCATGCCGATCCACGCCAGCGTGAAGCACCCGATTCCGGGGATCCGTCG

ACC

5C7. sigK rev TTCACGCCTGCGGACCCGGATCCCGCAGGACCTGTTCCCGTGTAGGCTGGAGCTGCT

TC

Cosmid SCD13, gene sigN, template plasmid pIJ773, recombination plasmid pIJ790, primers used: Dl3.sigN forw

CATGTCCGCAGAACAGGGCAGCTCGAAGGTGCTCGCGCTCATTCCGGGGATCCGTCG

ACC

Dl3.sigN rev

CGGCGCGGGCTCAGTCGGAGATGAGACCCTCGCGCAGCTGTGTAGGCTGGAGCTGCT TC

Cosmid SC7C7, gene dps, template plasmid pIJ773, recombination plasmid pIJ790, primers used: 7C7.dps forw ACCGACGGAGGCGTGGATGTACGTCGTGAAGAGCCCGTTGATTCCGGGGATCCGTCG ACC

7C7.dps rev

CCGTCCGCGCCGAGACCATCCCGCGTCATCCGTTTTCGGCTGTAGGCTGGAGCTGCT TC

Cosmid SC9B1, gene 20, resulting in an N-terminal protein deletion, template plasmid pIJ773, recombination plasmid pIJ790, primers used: 9B1.20NF

AGCCCTGGGTAGGGCCGGGCCATGACGCAACAGCCCTTCATTCCGGGGATCCGTCGA

CC

9B1.20NR

GAGCAGTGCTCCCACGTCCGCCGCGGAGGTGCCGGGCCCTGTAGGCTGGAGCTGCTT C

Cosmid SC9B1, gene 20, resulting in a C-terminal protein deletion, template plasmid pIJ773, recombination plasmid pIJ790, primers used: 9B1.20CF

GTGCCCTTCCAGAAGGTCGGCCCGTCCGTCATCCCCGACATTCCGGGGATCCGTCGA

CC

9B1.20CR

CAGTGAACGTCCGTCAGCGCGTCAGTGCGTCAGTGCGGGTGTAGGCTGGAGCTGCTT C

All disruptions in the S . coelicolor cosmids have been successfully been proved by restriction- and PCR analysis. Disruptions in S . coelicolor have also been verified by PCR and southern blot analysis.

The disruption of the gene number 20 on cosmid SC9B1 codes for a possible cyclase, which was predicted to be involved in the production of the volatile secondary metabolite geosmin ( trans-1 , 10-dimethyl-trans-9-decalol) in S . coelicolor. A common tool for compound identification is mass spectrometry (MS) . After separation of the analytes by gas chromatography (GS) the mass spectrometer converts the sample into gaseous ions, normally by the exposure to a beam of electrons under vacuum. After separation and detection the resulting fragmentation pattern of different positive ions with different mass-to-charge ratios {m/z) enables the identification of compounds by comparison to libraries (Silverstein et al . , 1981). Such an GS-MS was performed with the S . coelicolor SC9B1.20 mutant and confirmed the prediction of the involvement in geosmin production. The mutant in comparison to the wildtype did not produce any geosmin.

Experiment 7: Gene Disruption by Insertion ("Knock-In" Experiment)

The nucleic acid constructs ("disruption cassettes") of the invention also allow the insertion of new DNA sequences into any position within a target nucleic acid (e.g. S. coelicolor cosmid), with or without deleting original sequences during replacement with the disruption cassette ("knock-in") . As an example, shown in Fig. 12, the promotor of the gene glgE in cosmid 6A11 was replaced by the thiostreptone inducible promotor tipAp (Kataoka et al . , 1996).

Shown in Fig. 12A, in a 3-step PCR, the inducible promotor was amplified together with the disruption cassette pIJ773 to allow targeting of upstream regions (shown as 1 and 2 in Fig. 12) by λ RED mediated recombination . The first PCR was performed in a final volume of 50 μl with 50 pmol primer PI (5'-

GCTCCGCGGAGGTGGCTGACGAGTGGTGCGTGGCGGGCATTTCCGCTCCCTTCTCTG ACG-3') and 50 pmol primer P2 (5'- GGTCGACGGATCCCCGGAATCACCAATAAAAAACGCCCGG-3' ) , 200μM dNTPs, 5% DMSO, 1 x buffer, 2.5 U High Fidelity Taq polymerase (Roche) and 50 ng pIJ6021, which contains the inducible promotor tipAp (Takano et al . , 1995). The conditions were: a denaturation step at 94°C for 2 min followed by 10 cycles with denaturation at 94°C for 45 s, annealing at 50°C for 45 s and extension at 72°C for 30 s followed by another 10 cyles with denaturation at 94°C for 45 s, annealing at 55°C for 45 s and extension at 72°C for 30 s. A last elongation step was done at 72°C for 5 min.

The generated first PCR product (~ 250 bp) is flanked by two different extensions, 40 bp homologous to upstream regions of the S. coelicolor sequence of glgE (2) and 20 bp homologous to the priming sequence of the template plasmid pIJ773.

In a second PCR, pIJ773 and the first PCR product are added together to allow annealing and extension of the complete cassette, containing the promotor tipAp with the apramycin- oriT cassette.

The second PCR was performed in a final volume of 50 μl with 50 ng pIJ773 template (1384 bp EcoRl/Hindlll fragment) , 1 μl first PCR product (purified with Qiagen PCR purification kit), 200μM dNTPs, 5% DMSO, 1 x buffer and 2.5 U High Fidelity Taq polymerase (Roche). The conditions were: a denaturation step at 94°C for 2 min followed by 5 cycles with denaturation at 94°C for 15 s, annealing at 45°C for 30 s and extension at 72°C for 2 min. A last elongation step was done at 72°C for 5 min.

The complete "knock-in" cassette was generated in a third PCR with primer PI and primer P3 (5'-

GAACTGACGCGCACGGCGTGTCGATATGGCCGGATCTTTCTGTAGGCTGGAGCTGCT YCG-3' ) , which contains a 40 nt extension homologous to chromosomal S. coelicolor DNA (1) in a final volume of 50 μl with 50 pmol primer PI and 50 pmol primer P3, 200μM dNTPs, 5% DMSO, 1 x buffer, 2.5 U High Fidelity Taq polymerase (Roche) , lOμl second PCR product (unpurified) , 2μl first PCR product and 50 ng pIJ773 (1384 bp .EcoRI/Rindlll fragment) . The conditions were: a denaturation step at 94°C for 2 min followed by 10 cycles with denaturation at 94°C for 45 s, annealing at 50°C for 45 s and extension at 72°C for 1 min 30 s followed by another 10 cyles with denaturation at 94°C for 45 s, annealing at 55°C for 45 s and extension at 72°C for 1 min 30 s . A last elongation step was done at 72°C for 5 min.

Shown in Fig. 12B, the third PCR product was purified (Qiagen PCR purification kit) and used for λ RED mediated PCR-targeting of the S. coelicolor cosmid 6A11. After conjugal transfer of the mutagenised cosmid into

S . coelicolor M145, the marked (apramycin^R) mutant was verified by PCR and Southern blot analysis.

Shown in Fig. 12 C, to replace the marked insertion of the promotor tipAp by the unmarked version, a FLP- mediated excision of the disruption cassette was performed as described in the section "FLP-mediated excision of the disruption cassette". The only divergence between the wanted insertion of the promotor tipAp upstream of glgE and the resulting mutation after FLP- ediated excision of the disruption cassette is a FRT "scar" sequence 81 bp upstream of the promotor tipAp.

Annex 1: Sequence annotation for pIJ773 (Fig. 8B)

LOCUS pIJ773 4336 bp DNA CIRCULAR SYN 17-OCT-2001 DEFINITION Ligation of Apra-oriT disruption cassette into the EcoRV site of pBluescript SK(+) ACCESSION pIJ773 REFERENCE 1 (bases 1 to 4336) AUTHORS Self JOURNAL Unpublished. FEATURES Location/Qualifiers

CDS 699..717

/marker="Primer site reverse" /product="TGT AGG CTG GAG CTG CTT C" CDS complement (718..751)

/region="FRT"

/product="Natural FRT site" CDS complement (764..1549)

/gene="aac(3)IV" /product="aminoglycoside acetyltransferase inactivating apramycin" CDS 1890..1999

/region="oriT"

/product="origin of transfer from plasmid RP4 (also designated RP1/RK2)" CDS 2008..2041

/region="FRT"

/product="Natural FRT site" CDS complement (2050..2069)

/marker="Primer site forward" /product="ATT CCG GGG ATC CGT CGA CC" CDS complement (3345..4205)

/gene="amp"

/product="b-lactamase" BASE COUNT 1048 a 1121 c 1143 g 1024 t Annex 2: Sequence annotation for pIJ778 (Fig. 10B)

LOCUS pIJ778 4376 bp DNA CIRCULAR SYN 17-OCT-2001 DEFINITION Ligation of Spec-Strep-oriT disruption cassette into the EcoRV site of pBluescript SK(+) ACCESSION pIJ778 REFERENCE 1 (bases 1 to 4376) AUTHORS Self JOURNAL Unpublished. FEATURES Location/Qualifiers

CDS 699..717

/marker="Primer site reverse" /product="TGT AGG CTG GAG CTG CTT C" CDS complement (718..751)

/region="FRT"

/product="Natural FRT site" CDS complement (798..1589)

/gene="aadA"

/product=" spectinomycin-streptomycin adenyltransf erase gene from R100 . 1" CDS 1930 . .2039

/region="oriT"

/product="origin of transfer from plasmid RP4 (also designated RP1/RK2)"

CDS 2048..2081 /region="FRT"

/product="Natural FRT site"

CDS complement (2090..2109) /marker="Primer site forward" /product="ATT CCG GGG ATC CGT CGA CC"

CDS complement (3385..4245) /gene="amp"

/product="b-lactamase"

BASE COUNT 1065 a 1120 c 1108 g 1083 t Annex 3: Sequence annotation for pIJ780 (Fig. 11B)

LOCUS pIJ780 4448 bp DNA CIRCULAR SYN 17-OCT-2001 DEFINITION Ligation of Vio-oriT disruption cassette into the EcoRV site of pBluescript SK(+) ACCESSION pIJ780 REFERENCE 1 (bases 1 to 4448) AUTHORS Self JOURNAL Unpublished. FEATURES Location/Qualifiers

CDS 699..717

/marker="Primer site reverse" /product="TGT AGG CTG GAG CTG CTT C" CDS complement (718..751)

/region="FRT"

/product="Natural FRT site" CDS complement (798..1661)

/gene="vph"

/product="viomycin phosphotransferase gene from S.vinaceus"

CDS 2002..2111

/region="oriT"

/product="origin of transfer from plasmid RP4 (also designated RP1/RK2)" CDS 2120..2153

/region="FRT"

/product="Natural FRT site" CDS complement (2162..2181)

/marker="Primer site forward" /product="ATT CCG GGG ATC CGT CGA CC" CDS complement (3457..4317)

/gene="amp"

/product="b-lactamase" BASE COUNT 1002 a 1223 c 1211 g 1012 t References :

Ainsa, J.A. , Parry, H.D. and Chater, K.F. (1999) Mol . Microbiol . , 34, 607-619.

Bennett, P.M., Grinsted, J. and Richmond, M.H. (1977) Mol . Gen . Genet . , 154, 205-211.

Bierman, M. , Logan, R. , O'Brien, K. , Seno, E.T., Rao, R.N. and Schoner, B.E. (1992) Gene, 116, 43-49.

Blondelet-Rouault, M.H., Weiser, J. , Lebrihi, A., Branny, P. and Pernodet, J.L. (1997) Gene, 190, 315-317. Cherepanov , P.P and Wackernagel, W. (1995) Gene, 158, 9-14. Chung, C.T., Nie ela, S.L. and Miller, R.H. et al . , (1989) Proc. Natl . Acad. Sci, 86, 2172-2175.

Datsenko, K.A. and Wanner, B.L. (2000) Proc. Natl . Acad. Sci . USA 97, 6640-6645.

Flett, F., Mersinias, V. and Smith, C.P. (1997) FEMS Microbiol . Lett. , 155, 223-229. Hanahan, D. (1983) J.Mol . Biol . , 166, 557-580. Hoang, T.T., Karkhoff-Schweizer, R.R., Kutchma, A.J., Schweizer, H.P. (1998) Gene 212, 77-86.

Kataoka M, Tatsuta T, Suzuki I, Seki T, and Yoshida T (1996) J. Bacteriol . , 178, 5540-5542

Kieser, T., Bibb, M.J., Buttner, M.J., Chater, K.F. and Hopwood, D.A. (2000) Practical Streptomyces Genetics; John Innes Centre, Norwich Research Park, Colney, Norwich NR4 7UH, UK.

Kieser T and Melton RE (1988) Gene, 65, 83-91

MacNeil, D.J., Gewain, K.M., Ruby, C.L., Dezeny, G., Gibbons, P.H. and MacNeil, T. (1992) Gene, 111, 61-68.

Matsushima ,P., Broughton, M.C., Turner, J.R. and Baltz, R.H. (1994) Gene, 146, 39-45.

Pansegrau, W., Lanka, E., Barth, P.T., Figurski, D.H., Guiney, D.G., Haas, D., Helinski, D.R., Stanisich, V.A. and Thomas, CM. (1994) J.Mol . Biol . , 239, 623-663. Prentki P, Binda A and Epstein A (1991) Gene, 103, 17-23

Prentki P and Krisch HM (1984) Gene, 29, 303-313

Redenbach, M., Kieser, H.M., Denapaite, D. , Eichner, A.,

Cullum, J., Kinashi, H. and Hopwood, D.A. (1996) Mol .

Microbiol . , 21, 77-96.

Sambrook, J. , Fritsch, E.F. and Maniatis, T. (1989) Molecular

Cloning: A Labora tory Manual . Cold Spring Harbor Laboratory

Press, Cold Spring Habor, NY.

Silverstein RM, Bassler, GC and Morrill, TC (1981)

Spectrometric Identification of Organic Compounds. New York,

John Wiley & Sons, Inc.

Takano E, White J, Thompson CJ and Bibb MJ (1995) Gene, 166,

133-137

Claims

Claims :

1. A method for generating a targeted nucleic acid disruption in an actinomycete, the method comprising:

(1) providing a first nucleic acid construct comprising:

(a) a nucleic acid sequence (the "marker sequence") encoding a marker;

(b) a nucleic acid sequence (the "origin sequence") comprising an origin of transfer;

(c) a pair of nucleic acid sequences (the "recombining sequences") which are capable of undergoing recombination with each other, thereby to eliminate nucleic acid lying between them and leave only a single recombining sequence; and

(d) a pair of nucleic acid sequences (the "targeting sequences") capable of undergoing homologous recombination with a nucleic acid of interest of said actinomycete, wherein parts (a) and (b) lie between the pair (c) of recombining sequences and parts (a) , (b) and (c) lie between the pair of targeting sequences;

(2) recombining the first nucleic acid construct with a first plasmid bearing at least part of the actinomycete target nucleic acid of interest to form a "recombined plasmid";

(3) transferring the recombined plasmid by conjugation from a first bacterial cell into an actinomycete bacterial cell;

(4) integrating nucleic acid of the first nucleic acid construct from the transferred plasmid into the target actinomycete nucleic acid by homologous recombination; and

(5) eliminating the origin sequence and marker sequence from the integrated nucleic acid, to leave an insertion in the actinomycete nucleic acid, the insertion having a single recombining sequence of the original pair of recombining sequences.

2. The method of claim 1, wherein the first nucleic acid construct further comprises:

(e) a pair of nucleic acid sequences (the "intervening sequences") which flank the recombining sequences and which are flanked by the targeting sequences.

3. The method of claim 1, wherein the first nucleic acid construct further comprises:

(e) an intervening sequence between the recombining sequence and the targeting sequence at one end only of the construct .

4. The method of any preceding claim, wherein the insertion comprises a stop codon in at least one reading frame in a forward or backward direction.

5. The method of claim 4, wherein the insertion comprises a stop codon in each of the three forward or in each of the three backward reading frames .

6. The method of claim 5, wherein the insertion comprises a stop codon in each of the six forward and backward reading frames .

7. The method of any preceding claim, wherein the nucleic acid sequence of interest is a gene.

8. The method of any preceding claim, wherein the targeting sequences are capable of undergoing homologous recombination with the upstream, non-coding region of a gene of interest or the coding region of a gene of interest.

9. The method of any preceding claim, wherein the marker is an antibiotic resistance marker.

10. The method of any preceding claim, wherein the recombining sequences are FRT (FLP recognition target) sequences, capable of being recombined by FLP recombinase activity in trans .

11. The method of claim 10, wherein each FRT sequence comprises a palindrome having the palindromic half site GAAGTTCCTAT .

12. The method of claim 11, wherein each FRT sequence comprises the double stranded core sequence:

5' -GAAGTTCCTATACTTTCTAGAGAATAGGAACTTC-3' 3 ' -CTTCAAGGATATGAAAGATCTCTTATCCTTGAAG-5'

13. The method of any preceding claim, wherein the origin sequence is an ori T sequence which can be mobilised by the transfer plasmids pUZ8002 and pUB307.

14. The method of claim 13, wherein the oriT sequence has the nucleic acid sequence shown in Fig. IB, residues 1450-1558.

15. The method of any preceding claim, wherein the nucleic acid construct is linear.

16. The method of any preceding claim, wherein step (1) comprises providing the nucleic acid construct by homology extension PCR from a plasmid containing parts (a) , (b) , (c) and preferably (e) , the PCR primers (or their complementary strands) providing parts (d) and optionally (e) .

17. The method of claim 16, wherein the generation of parts- (d) and optionally (e) occurs in multiple PCR steps.

18. The method of any preceding claim, wherein step (2) comprises recombining the nucleic acid construct with nucleic acid from an actinomycete cosmid or BAG library.

19. The method of any preceding claim, wherein the first bacterial cell is methylation deficient.

20. The method of any preceding claim, wherein the first bacterial cell is an E. coli cell.

21. The method of any preceding claim, wherein step (2) occurs in a bacterial cell having λ RED { gam, bet , exo) function.

22. The method of claim 21, wherein the bacterial cell is an E. coli cell.

23. The method of any preceding claim, wherein step (2) also occurs in the first bacterial cell.

24. The method of any preceding claim, wherein step (3) includes the provision in trans of transfer function.

25. The method of claim 24, wherein the recombined plasmid is transformed into a donor strain carrying a non-transmissible transfer plasmid, followed by incubation with the actinomycete cell .

26. The method of claim 24, wherein the first bacterial cell, a donor strain carrying a non-transmissible transfer plasmid, a donor strain carrying a self-transmissible transfer plasmid and the actinomycete cell are all incubated together.

27. The method of claim 24 or claim 25, wherein the donor strain carrying a non-transmissible transfer plasmid is ET12567/pUZ8002.

28. The method of claim 26 or claim 27 wherein the donor strain carrying a self-transmissible transfer plasmid is ET12567/pUB307.

29. The method of any one of claims 25 to 28, wherein the actinomycete cell is a pre-germinated actinomycete spore.

30. The method of any preceding claim, further comprising the step of confirming the elimination of the marker sequence and origin sequence by replica plating of exconj gants, elimination being reflected by lack of marker function.

31. The method of any preceding claim wherein step (5) follows steps (3) and (4) .

32. The method of claim 31, wherein step (5) occurs by FLP recombinase-mediated recombination .

33. The method of claim 32, wherein FLP recombinase activity is provided in trans using a plasmid that shows inducible replication and induction of FLP synthesis under conditions in which replication will not occur, thereby allowing simultaneous induction of FLP synthesis and loss of the plasmid.

34. The method of claim 33, wherein the plasmid is temperature-inducible .

35. The method of claim 31, wherein step (5) comprises homologous recombination between the actinomycete nucleic acid of interest into which the nucleic acid construct has been integrated and a helper plasmid, which helper plasmid contains : a helper nucleic acid construct that: comprises targeting sequences capable of undergoing homologous recombination with the same actinomycete nucleic acid of interest as the nucleic acid construct, comprises a single recombining sequence between the targeting sequences, and lacks an origin sequence between the targeting sequences, and a second origin sequence outside the nucleic acid construct.

36. The method of claim 35, wherein the helper nucleic acid construct further comprises an intervening sequence or a pair of intervening sequences.

37. The method of claim 35 or claim 36, wherein the helper nucleic acid construct lacks a marker sequence between the targeting sequences.

38. The method of any one of claims 35 to 37, wherein the helper plasmid further comprises a second marker sequence.

39. The method of any one of claims 35 to 38, wherein the helper plasmid is constructed by a method comprising steps

(1), (2) and (5) as defined in claim 1.

40. The method of claim 39, wherein the construction method further comprises the subsequent step of introducing the second origin sequence and second marker sequence by homologous recombination between the helper plasmid and a helper nucleic acid construct, the helper nucleic acid construct comprising the second origin sequence and second marker sequence in between two sequences (the "helper construct targeting sequences") which share homology with sequences of the helper plasmid.

41. The method claim 39 or 40, wherein the recombination step (2) as defined in claim 1 and the recombination step as defined in claim 39 involve recombination with identical plasmids .

42. The method of any preceding claim wherein the first plasmid and/or the helper plasmid are circular.

43. The method of any preceding claim which is repeated to generate a disruption in another target nucleic acid sequence of the actinomycete.

44. The method of any one of claims 1 to 42, further comprising a step between steps (2) and (3) of generating an additional disruption, the step comprising recombining an additional disruption construct with the recombined plasmid, wherein the additional disruption construct comprises the same component parts as the first nucleic acid construct, with the exception that it lacks an origin sequence; the marker sequence of the additional disruption construct is different from that of the first nucleic acid construct; and the targeting sequences of the additional disruption construct are different from those of the first nucleic acid construct.

45. The method of claim 44, wherein the recombining sequences of the additional disruption construct are the same as those of the first nucleic acid construct.

46. A method for producing a library of actinomycete host cells having respective different gene disruptions, the method comprising: repeating the method of any preceding claim to generate different gene disruptions in different respective host cells.

47. A library of actinomycete host cells having different respective gene disruptions as produced or as producible according to the method of claim 46.

48. The library of claim 47, wherein different host cells respectively have insertions in different chromosomal genes.

49. The library of claim 48, wherein the insertions each comprise a single FRT site, and optionally an intervening sequence or pair of intervening sequences.

50. A method comprising screening the library of any one of claims 47 to 49 for phenotypic characteristics or changes resulting from the gene disruptions.

51. The method of claim 50, wherein the screening is. followed by the step of identifying the disrupted gene.

52. The method of any preceding claim, wherein the actinomycete cell is a cell of the genus Streptomyces .

53. The method of claim 52, wherein the species is S. coelicolor or S . ambofaciens .

54. A first nucleic acid construct as defined in any one of claims 1 to 15, with the optional exception of lacking targeting sequences.

55. A helper nucleic acid construct as defined in any one of claims 35 to 37.

56. An additional disruption construct as defined in claim 44 or claim 45.

57. A helper plasmid as defined in any one of claims 35 to 38.

58. A vector comprising the nucleic acid construct of any one of claims 54 to 56, flanked by restriction sites for excising the nucleic acid construct from the remainder of the vector.

59. A cell comprising a vector or plasmid as defined in claim 57 or claim 58.

60. A kit comprising a first nucleic acid construct as defined in claim 54; and a helper nucleic acid construct as defined in claim 55 or an additional disruption construct as defined in claim 56.