WO2002098457A2 - Recombinant rhabdoviruses as live-viral vaccines for immunodeficiency viruses - Google Patents
Recombinant rhabdoviruses as live-viral vaccines for immunodeficiency viruses Download PDFInfo
- Publication number
- WO2002098457A2 WO2002098457A2 PCT/US2002/000295 US0200295W WO02098457A2 WO 2002098457 A2 WO2002098457 A2 WO 2002098457A2 US 0200295 W US0200295 W US 0200295W WO 02098457 A2 WO02098457 A2 WO 02098457A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- recombinant
- hiv
- htv
- envelope protein
- virus
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/525—Virus
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/16011—Human Immunodeficiency Virus, HIV
- C12N2740/16111—Human Immunodeficiency Virus, HIV concerning HIV env
- C12N2740/16122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
- C12N2760/00011—Details
- C12N2760/20011—Rhabdoviridae
- C12N2760/20022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
- C12N2760/00011—Details
- C12N2760/20011—Rhabdoviridae
- C12N2760/20041—Use of virus, viral particle or viral elements as a vector
- C12N2760/20043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
- C12N2760/00011—Details
- C12N2760/20011—Rhabdoviridae
- C12N2760/20041—Use of virus, viral particle or viral elements as a vector
- C12N2760/20045—Special targeting system for viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2810/00—Vectors comprising a targeting moiety
- C12N2810/50—Vectors comprising as targeting moiety peptide derived from defined protein
- C12N2810/60—Vectors comprising as targeting moiety peptide derived from defined protein from viruses
- C12N2810/6072—Vectors comprising as targeting moiety peptide derived from defined protein from viruses negative strand RNA viruses
- C12N2810/6081—Vectors comprising as targeting moiety peptide derived from defined protein from viruses negative strand RNA viruses rhabdoviridae, e.g. VSV
Definitions
- the present invention relates to the fields of molecular biology and virology, and to a method of treating an HTV-l infection and, more particularly, to the induction of both humoral and cellular immunity against HTV-l.
- HTV-l pandemic New anti-retroviral strategies against human HTV-l result in a dramatic decrease in mortality among infected humans in developed countries, but the development of a successful vaccine to prevent infection is still the major goal to halt the HTV-l pandemic.
- a human being is infected with HIV-1 every 10 seconds on average, and in the heavily affected countries in Africa, such as Zambia and Kenya, nearly 40% of young adults are HJV-1-seropositive. (1).
- HIV vaccine strategies including recombinant proteins (Goebel, F.D., et al., European Multinational 1MMUNO AIDS Vaccine Study Group Aids, 5:643-50, 1999; Quinnan, G.V., Jr., et al., AIDS Research & Human Retroviruses, 15:561-70, 1999; VanCott, T.C., et al., J. Virol, 73:4640-50, 1999), peptides (Bekyakov, I.M., et al, Journal of Clinical Investigation, 102:2072- 81, 1998; Berzofsky, J.A., et al, Immunological Reviews, 170:151-72.
- the ability of recombinant non-segmented negative- stranded RNA viruses expressing an immunodeficiency virus gene(s) as an immunodeficiency virus vaccine is disclosed.
- an immunodeficiency virus vaccine e.g., HIV-1 vaccine
- the HIV-1 envelope protein is stably and functionally expressed and induces a strong humoral response directed against the HIV-1 envelope protein after a single boost with recombinant HIV-1 protein boost (gpl20) in mice.
- high neutralization titers against HIV-1 are detected in the mouse sera. (Schnell, M. J., et al., Proc. Natl. Acad. Sci. USA, 97:3544-3549, 2000.).
- the present invention fulfills this long sought need and further relates to recombinant RV vaccines expressing HTV-l envelope proteins to induce HTV-l -specific CTLs. Specifically, a single inoculation of the HIV-1 virus vaccines of the present invention induce a solid and long-lasting memory CTL response specific for HTV-l proteins. These recombinant viruses are non-pathogenic for a wide range of animal species when administered orally or intramuscularly.
- the coding region of the HIV-1 gpl60 (strains NL4-3 and 89.6) is cloned between the RV glycoprotein (G) and polymerase (L) proteins under the control of a RV transcription Stop/Start signal, the resulting recombinant RVs expressed HIV-1 g ⁇ l60 along with the other RV proteins.
- boost vaccine vector is “boost virus”
- boost virus is “boost vaccine vector” SUMMARY OF THE INVENTION
- the present invention is directed to recombinant non-segmented negative- stranded RNA virus vectors expressing an immunodeficiency virus genes as a live- viral vaccine (e.g., HTV-l vaccine) and methods of malcing and using the same. More in particular the invention relates to recombinant Rhabdoviruses which express gene products of a human immunodeficiency virus and to immunogenic compositions which induce an immunological response against immunodeficiency virus infections when administered to a host.
- a live- viral vaccine e.g., HTV-l vaccine
- live-viral vaccines are non- pathogenic for a wide range of animal species when administrated orally or intramuscularly and induce protective immune responses such as neutralizing antibody response and long lasting cellular (such as cytotoxic T lymphocyte (CTL)) responses against the immunodeficiency viruses.
- protective immune responses such as neutralizing antibody response and long lasting cellular (such as cytotoxic T lymphocyte (CTL)) responses against the immunodeficiency viruses.
- CTL cytotoxic T lymphocyte
- the invention is a recombinant non-segmented negative- stranded RNA virus vector having: (a) a modified negative-stranded RNA virus genome that is modified to have one or more new restriction sites, or not to have one or more genes otherwise present in the genome; (b) a new transcription unit that is inserted into the modified negative-stranded RNA virus genome to express heterologous nucleic acid sequences; and (c) a heterologous viral nucleic acid sequence that is inserted into the new transcription unit, where the recombinant non- segmented negative-stranded RNA virus vector is replication competent, and the heterologous viral nucleic acid sequence encodes an antigenic polypeptide.
- the recombinant non- segmented negative-stranded RNA virus vector that is used as a live- viral vaccine is a recombinant Rhabdovirus vector.
- This vector includes (a) a modified Rhabdovirus genome; (b) a new transcription unit inserted into the Rhabdovirus genome to express heterologous nucleic acid sequences; and (c) a heterologous viral nucleic acid sequence that is inserted into the new transcription unit, where the recombinant Rhabdovirus vector is replication competent, and the heterologous viral nucleic acid sequence encodes an antigenic polypeptide.
- the modified Rhabdovirus genome is, for example, modified rabies virus genome or a modified vesicular stomatitis virus genome.
- the modifications in the Rhabdovirus genome include creation of new restriction sites and/or deletion of one or more genes such as the native G (glycoprotein) gene of the Rhabdovirus, ⁇ gene of rabies virus, etc.
- the modified Rhabdovirus genome has a further modification to have a glycoprotein from another class of virus in place of the native glycoprotein.
- the glycoprotein from another class of virus is vesicular stomatitis virus glycoprotein.
- the modified rabies virus genome has a third modification to have contiguity of structural genes different from that in the rhabodvirus genome after the second modification.
- heterologous viral nucleic acid refers to the viral nucleic acid that encodes the antigenic polypeptide that induces immune response.
- a full-length HTV envelope protein, HIV gpl60, HIV gag, HIV gpl20, and full-length SIV envelope protein are some of the antigenic polypeptides that are expressed in the recombinant viral vectors of the present invention.
- heterologous viral nucleic acid as used herein does not include the native gene sequences of the one or more classes of Rhabdoviruses in a recombinant Rhabdovirus such as, for example, VS V G gene in the recombinant RV.
- the sequence of the cytoplasmic domain of Rhabdovirus G gene is fused to other sequences before cloning into the modified Rhabdovirus genome.
- One such example is a chimeric VSV/RV glycoprotein where the fusion protein has VSV ectodomain and transmembrane domain, and RV cytoplasmic domain.
- Another such example is a chimeric HTV-l/RV glycoprotein where the fusion protein has HIV-1 gpl60 ectodomain and transmembrane domain, and RV cytoplasmic domain.
- the heterologous viral nucleic acid is fused to the sequence of the cytoplasmic domain of the G gene of the modified Rhabdovirus genome to produce a chimeric protein such that the resulting chimeric protein has a fusion between the transmembrane domain of the heterologous protein and cytoplasmic domain of the glycoprotein.
- the glycoprotein gene of the recombinant Rhabdovirus is deleted and the heterologous viral nucleic acid is fused to the sequence of the cytoplasmic domain of the G gene of the modified Rhabdovirus genome to produce a chimeric protein which functionally substitutes for the recombinant Rhabdoviruses glycoprotein gene.
- a recombinant Rhabdovirus that expresses a functional HTV envelope protein is provided.
- the recombinant Rhabdovirus is replication-competent.
- the Rhabdovirus can be a recombinant rabies virus or a recombinant vesicular stomatitis virus.
- the HTV envelope protein expressed from the recombinant Rhabdovirus is from any HTV-l isolate.
- Rhabdovirus having a heterologous nucleic acid segment encoding an immunodeficiency virus envelope protein or a subunit thereof is provided.
- the recombinant ⁇ gene deficient Rhabdovirus is a rabies virus and the immunodeficiency virus envelope protein, or a subunit thereof, is from a human immunodeficiency virus or from a simian immunodeficiency virus.
- the subunit or a fragment of the immunodeficiency envelope protein includes fragments having only a part of the contiguous amino acids of the envelope protein.
- subunits or fragments include, for example, HIV g ⁇ l20, HIV gp41, HIV gp40, the envelop proteins expressed by HTV N - 3 and HTV 89 . 6 , and the subunits of other immunodeficiency viruses.
- a method of inducing an immunological response in a mammal includes the steps of: (a) delivering to a tissue of the mammal a recombinant Rhabdovirus vector that expresses a functional immunodeficiency virus envelope protein, or a subunit thereof, effective to induce an immunological response to the envelope protein; (b) expressing the envelope protein, or the subunit thereof, in vivo; (c) boosting the animal by delivering an effective dose of an isolated immunodeficiency virus envelope protein, or a subunit thereof, in an adjuvant or by delivering an effective dose of a boost vaccine vector; and (d) inducing a neutralizing antibody response and/or long lasting cellular immune response thereto to protect the mammal from an immunodeficiency virus.
- the recombinant Rhabdovirus has a rabies virus genome.
- it is deficient in ⁇ gene.
- rabies virus genome is also deficient in a rabies virus glycoprotein gene or rabies virus genome has glycoprotein gene from another class of Rhabdovirus in place of the rabies virus glycoprotein.
- Boosting the animal can be done by delivering an effective dose of a boost vaccine vector instead of the isolated immunodeficiency virus envelope protein.
- an immunogenic composition having any of the above mentioned recombinant Rabdoviruses along with an adjuvant is provided.
- a method of inducing an immunological response in a mammal which includes the steps of: (a) delivering to a tissue of the mammal a non-segmented negative-stranded RNA virus that expresses a functional immunodeficiency virus envelope protein, or a subunit thereof, effective to induce an immunological response to the envelope protein; (b) expressing the envelope protein, or the subunit thereof, in vivo; (c) boosting the animal by delivering an effective dose of an isolated immunodeficiency virus envelope protein, or a subunit thereof, in an adjuvant or by delivering an effective dose of a boost vaccine vector; and (d) inducing a neutralizing antibody response and/or long lasting cellular immune response thereto to protect the mammal from an immunodeficiency virus.
- the method where the non-segmented negative-stranded RNA virus is used includes a Rabies virus or a Vesicular Stomatitis virus.
- a non-segmented negative-stranded RNA virus that expresses a functional immunodeficiency virus envelope protein, or subunit thereof is administered to the mammal.
- This RNA virus will express the functional immunodeficiency virus envelope protein, or subunit thereof.
- An effective dose of an isolated immunodeficiency virus envelope protein, or subunit thereof, in an adjuvant or an effective dose of a boost vaccine vector is delivered to the mammal, thereby inducing a neutralizing antibody response and/or long lasting cellular immune response to the functional immunodeficiency virus envelope protein, or subunit thereof.
- the immunodeficiency virus is any HIV-1 virus.
- the non-segmented negative-stranded RNA virus is a Rhabdovirus.
- the long-lasting cellular response is a cross-reactive CTL response wherein the cross-reactive CTLs are directed against envelope proteins, or subunits thereof, from different immunodeficiency virus strains.
- a non-segmented negative- stranded RNA virus that expresses a functional immunodeficiency virus envelope protein, or subunit thereof is administered to the mammal.
- This RNA virus will express the functional immunodeficiency virus envelope protein, or subunit thereof, thereby thereby inducing a neutralizing antibody response and or long lasting cellular immune response to the functional immunodeficiency virus envelope protein, or subunit thereof.
- the immunodeficiency virus is any HIV-1 virus.
- the non-segmented negative-stranded RNA virus is a Rhabdovirus.
- the long-lasting CTL response is a cross-reactive CTL response wherein the cross-reactive CTLs are directed against envelope proteins, or subunits thereof, from different immunodeficiency virus strains.
- Figure 1 Schematically shows a method for the construction of recombinant RV genomes.
- Figure 2. A graph showing One-step growth curves of BSR cells that were infected with the recombinant RVs (SBN, SBN-89.6, and SBN-NL4-3)
- FIG. 1 Western blot analysis of recombinant rabies viruses (RVs) expressing HTV-l g ⁇ l60.
- Figure 4 A composite photograph showing Sup-Tl cells after these cells were infected (using a MOI of 1) with SBN, SBN-89.6, or SBN-NL4-3.
- Figure 5 A graph showing ELISA reactivity of mouse sera against HTV-l gpl20.
- FIG. 1 Western blot analysis of mice serum antibody response to HIV- 1 antigens.
- Figure 7. Schematic representation of a method for the construction of RV- based expression vectors with foreign viral glycoproteins.
- FIG 8. Schematic representation of a method for the construction of full- length and RV-glycoprotein deleted RVs expressing HTV-l gpl60.
- Figure 9. CTLs from HTV-l gpl60 immunized mice induce long-lasting HTV- 1 gpl60-specif ⁇ c CTLs.
- Groups of three 6- to 8-week-old female BALB/c mice (Harlan Sprague) are inoculated i.p. with 2x10 foci-forming units of recombinant RV expressing HTV-1N L4 - 3 envelope protein.
- 105 to 135 days after the single inoculation spleens are aseptically removed and single cells suspensions are prepared (infra). Stimulator cells are prepared (infra), then added back to the effector cell population at a ratio of 3:1. Cytolytic activity of cultured CTLs is determined by measurement of the percent 51 Cr released (infra).
- FIG. 10 CTLs from HTV-l gpl60 immunized mice cross-kill target cells expressing heterologous HIV-1 envelope proteins.
- Groups of six 6- to 8-week-old female BALB/c mice are inoculated i.p. with 2xl0 7 foci-forming units recombinant RV expressing HTV-l envelope protein from strains NL4-3 (A) or 89.6 (B).
- Target cells are prepared by infection with vaccinia virus expressing HTV-l envelope proteins from strains NL4-3 (vCB41), 89.6 (vBD3), JR-FL (vCB28), or Ba-L (vCB43). Chromium release assays are completed (infra). The results are shown from two different, independent experiments.
- Cytolytic activity is mediated by CD8 + T-cells.
- Groups of three 6- to 8-week-old female BALB/c mice are inoculated i.p. with 2xl0 7 foci-forming units recombinant RV expressing HTV-l envelope protein from the NL4-3 strain.
- Eighteen weeks after the single inoculation spleens are aseptically removed and splenocytes are stimulated in vitro with vaccinia virus expressing HTV-I NU - 3 envelope protein (infra).
- CD8 + T-cells are depleted from the cell culture (CD8 " ) and enriched (CD8 + ) using Dynabeads Mouse CD8 (Lyt2), as described by the manufacturer. Chromium release assays are completed (infra) on cultures depleted (CD8 " ) or enriched (CD8 + ) of CD8 T-cells, or unprocessed cultures (CD8 + /CD8 " ). Target cells are prepared (infra) by infection with vaccinia virus expressing HTV-l envelope proteins from NL4-3 (vCB41). Background levels were equal to, or below, 6% specific lysis. DETAILED DESCRIPTION OF THE INVENTION
- Rhabdoviruses such as Rabies virus and Vesicular Stomatitis virus are members of the family Rhabdoviridae.
- Rabies virus possesses a negative stranded RNA genome of approximately 12kb. The genome is modularly organized and similar to that of vesicular stomatitis virus (VSV).
- VSV vesicular stomatitis virus
- These Rhabdoviruses encode five structural proteins.
- the five open reading frames coding for the viral structural proteins are nucleoprotein (N), phosphoprotein (P), matrix protein (M), glycoprotein (G), and polymerase (L).
- N nucleoprotein
- P phosphoprotein
- M matrix protein
- G glycoprotein
- L polymerase
- the nucleoprotein (N), the phosphoprotein (P), the viral polymerase (L), and the genomic RNA form a helical ribonucleoprotein complex (RNP).
- the RNP is surrounded by a host cell-derived envelope membrane which contains the matric protein (M) on the inner side of the membrane, and the transmembrane glycoprotein (G) which mediates binding of the virus to specific receptors on the cell membrane.
- a number of recombinant Rhabdovirus vectors are generated and are used to express functional genes, including full-length HTV-l envelope proteins. From the recombinant Rhabdovirus vectors of the invention all the dominant epitopes for neutralizing antibodies, cytotoxic T-lymphocytes (CTL), and antibody-dependent cell cytotoxicity are expressed at one time.
- CTL cytotoxic T-lymphocytes
- the construction of different recombinant Rhabdovirus vectors expressing HTV or STV or other viral genes is described in the following paragraphs. Recombinant Rhabdovirus expression vectors
- RNA vectors that express heterologous genes or gene sequences are constructed.
- an expression vector with its own glycoprotein is constructed.
- X can be cloned at different genome sites to regulate expression levels.
- an expression vector with a glycoprotein from another virus or another viral serotype is constructed (see Fig. 7 as an example for the RV vector with VSV glycoprotein).
- This vector is used as boost virus to induce a stronger immune response.
- X can be cloned at different genome sites to regulate expression levels.
- the present invention relates to constructs of recombinant RVs (rabies viruses) expressing HTV-l gpl60, where the RV glycoprotein (G) is replaced with that of a chimeric vesicular stomatitis virus (VSV) G /RV-cytoplasmic domain (serotype Indiana or New Jersey).
- RVs chimeric vesicular stomatitis virus
- RV-cytoplasmic domain serotype Indiana or New Jersey
- RV/VSV recombinant chimeric RV/VSV
- RV nucleoprotein which was previously shown to be an exogenous superantigen (Lafon, et al., Nature, 358, 507-10, 1992; Lafon, M. Research in Immunology, 144:209-13, 1993)
- Rabies Virus the cytoplasmic domain of the RV glycoprotein is fused to the foreign glycoproteins.
- a recombinant RV with rearranged genome, VSV glycoprotein, and HTV-l gpl60 (X) can be constructed to have: 3'-X-N-P-G(VSV serotype NJ)-M-L-5'.
- a recombinant expression vector (either RVs or VSVs) having a foreign glycoprotein instead of their own is constructed for entry into specific host cells, i.e., to mimic the tropism of another virus (e.g., HIV-1, Hepatitis C) in order to induce a stronger immune response (Fig. 8).
- This construct can be represented as 3 -N-P-M-HTV-l-gpi60-L.
- these constructs can have, in addition, their own glycoproteins (e.g., 3'-N-P-M-HTV-l-gpl60-G-L).
- Transgenic mice expressing human CD4 and CXCR4 are generated to analyze the in vivo induction of an immune response of the G-related RVs expressing HTV-l gpl60/RVG.
- a recombinant expression vector (either RV or VSV) having a multiple antigens and multiple transcription stop/start signals is constructed.
- This construct is represented as 3 -N-P-M-G-X-Y-L-5' where X and Y are heterologous genes.
- X can be HTV-l gpl60 and Y can be HIV-1 gag.
- An alternative construct can be 3 -N-Z-P-M-G-X-Y-L-5' where, for example, X can be HIV-1 gpl60, Y can be HTV-l gag and Z can be HTV-l tat.
- Rabies virus is a negative- stranded RNA virus of the Rhabdovirus family and it possesses a relatively simple, modular genome organization coding for five structural proteins (supra and Conzelmann, et al., Virology, 175:485-99, 1990).
- the present invention relates to an RV vaccine strain-based vector, which is non-pathogenic for a wide range of animal species when administrated orally or intramuscularly. This vector shows advantages over other viral vectors, for several reasons. First, its modular genome organization makes genetic modification easier than for the majority of more complex genomes of DNA and plus-stranded RNA viruses.
- Rhabdoviruses have a cytoplasmic replication cycle and there is no evidence for recombination and/or integration into the host cell genome.
- Rose, et al. Rhabdovirus genomes and their products, Plenum Publishing Corp., New York, 1997.
- RV In contrast to most other viral vectors only a negligible seropositivity exists in the human population to RV and immunization with a RV-based vector against HTV-l will not interfere with immunity against the vector itself.
- RV grows to high titers 10 foci forming units (FFU) in various cell-lines without killing the cells, which probably results in longer expression of HTV-l genes compared to a cytopathogenic vector.
- FFU foci forming units
- rabies virus vectors The following different recombinant rabies virus vectors are constructed.
- This vector also contains a Smal site upstream of the RV glycoprotein, which is used to delete the RV glycoprotein gene (G).
- the vector is called RV-SBN.
- RVs expressing HTV-lgp-160 ecto- and transmembrane domain fused to the RV G cytoplasmic domain are also constructed.
- the chimeric gpl60/RVG protein is expressed by RV and incorporated into RV virions.
- a recombinant virus displaying a foreign envelope protein on its surface will induce a strong immune response against this antigen.
- Another RV vector is also generated which is identical to RV-SBN but has, in addition, a single Pad site downstream of RV G protein. This vector is used to functionally replace RV G with VSV G or other viral glycoproteins. This vector is called RV-SPBN and is used as a boost vaccine vector or a boost virus.
- a recombinant rabies virus based expression vector with foreign viral glycoproteins is constructed and the recombinant virus is recovered.
- a Smal restriction enzyme site is introduced downstream of the M/G transcription Stop/Start sequence and a Pad site upstream of the synthetic transcription Stop/Start sequence, which is used to express foreign genes from the RV vector. These two sites (Smal/Pac) can be used to replace the RV glycoprotein with that from other viruses.
- a chimeric VSV/RV glycoprotein VSV ectodomain and transmembrane domain, RV cytoplasmic domain
- this method can be applied to every glycoprotein and foreign antigen in different Rhabdoviruses, as shown in the same figure (glycoprotein X, foreign protein Y).
- recombinant RVs expressing chimeric gpl60/RV G without expressing RV G are generated. These G-deleted RVs have a different tropism as compared to wild-type RV (which infects most cells) and specifically infect only cells expressing HIV-1 receptor human CD4 and one of the
- HIV-1 coreceptors eg, CXCR4 or CCR5
- Both the full-length and RV-glycoprotein deleted recombinant rabies RVs are constructed and recovered (Fig. 8).
- the Smal and BsiWI restriction enzyme sites are used to delete RV glycoprotein and fuse the M/G transcription Stop/Start sequence to the HTV-l/RV chimeric glycoprotein (HIV-1 g ⁇ l60 ectodomain and transmembrane domain, RV cytoplasmic domain).
- the recovered RV-vector is, analogous to the HTV-l virus, specific for cells expressing human CD4 and the appropriate HIV-1 co- receptor. It should be noted that this method can be applied to every glycoprotein which supports infection of certain cell types by rhabdoviruses. It can also be used to express additional foreign antigens (HTV-l Gag, HIV protease, SIV proteins , Hepatitis A, B or C proteins, and other viral and non-viral proteins).
- a recombinant replication-competent rabies virus expression vector having all of the above combinations can be constructed.
- a recombinant rabies virus vector having other glycoproteins (especially to construct boost viruses) without or with their own G, having genome rearrangements, and expressing multiple viral antigens from the same or different viruses e.g. HTV-l gpl60 and Hepatitis B.
- Products, methods and compositions There are provided by the invention, products, compositions and methods for assessing treating viral diseases, particularly HTV (AIDS) and administering a recombinant Rhadovirus of the invention to an organism to raise an immunological response against invading viruses, especially against immunodeficiency virus infections.
- HTV HIV
- Rhadovirus of the invention to an organism to raise an immunological response against invading viruses, especially against immunodeficiency virus infections.
- Another aspect of the invention relates to a method for inducing an immunological response in an individual, particularly a mammal, which involves inoculating the individual with a recombinant virus of the invention followed by the appropriate recombinant protein boost, adequate to produce antibody and/ or T cell immune response to protect the individual from infection, particularly immunodeficiency infection and most particularly HIV-1 and 2 infections. Also provided are methods whereby such immunological response slows the HIV replication.
- Yet another aspect of the invention relates to a method of inducing immunological responses in an individual which comprises delivering to such individual a nucleic acid vector, sequence or ribozyme to direct the expression of HIV envelope polypeptides, or a fragment or a variant thereof, for expressing the HTV envelope polypeptide, or a fragment or a variant thereof, in vivo in order to induce an immunological response, such as, to produce antibody and/ or T cell immune response.
- Antibody and/or T cell responses include, for example, cytokine-producing T cells or cytotoxic T cells, to protect the individual, preferably a human, from the viral disease, whether that disease is already established within the individual or not.
- nucleic acid vector may comprise DNA, RNA, a ribozyme, a modified nucleic acid, a DNA/RNA hybrid, a DNA-protein complex or an RNA-protein complex.
- compositions that induce an immunological response
- a further aspect of the invention relates to an immunological composition that when introduced into an individual, preferably a human, capable of having induced within it an immunological response.
- the immunological response that is induced is to a polynucleotide and/or polypeptide encoded therefrom, wherein the composition comprises a recombinant Rhabdoviruses of the invention which encodes and expresses an antigen of an exogeneous viral protein, such as HIV envelope protein or polypeptide.
- the exogeneous polypeptides include antigenic or immunologic polypeptides.
- the immunological response is used therapeutically or prophylactically and takes the form of antibody immunity and/or cellular immunity, such as cellular immunity arising from CTL or CD4+ T cells.
- compositions comprising a Rhabdovirus vector of the present invention for administration to a cell or to a multicellular organism.
- the Rhabdovirus vectors of the invention may be employed in combination with a non-sterile or sterile carrier or carriers for use with cells, tissues or organisms, such as a pharmaceutical carrier suitable for administration to an individual.
- a pharmaceutical carrier suitable for administration to an individual Such compositions comprise, for instance, a media additive or a therapeutically effective amount of a recombinant virus of the invention and a pharmaceutically acceptable carrier or excipient.
- Such carriers may include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol and combinations thereof.
- the formulation should suit the mode of administration.
- the invention further relates to diagnostic and pharmaceutical packs and kits comprising one or more containers filled with one or more of the ingredients of the aforementioned compositions of the invention.
- the recombinant vectors of the invention may be employed alone or in conjunction with other compounds, such as therapeutic compounds.
- compositions may be administered in any effective, convenient manner including, for instance, administration by intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal routes among others.
- the active agent may be administered to an individual as an injectable composition, for example as a sterile aqueous dispersion, preferably isotonic.
- the pharmaceutical compositions of the invention are preferably administered by injection to achieve a systematic effect against relevant viral pathogens.
- the daily dosage level of the active composition of the invention will be from 10 ⁇ FFU to 10 8 FFU of virus in the composition or 10 ⁇ g/kg tolO mg/kg of body weight of recombinant protein.
- the physician in any event will determine the actual dosage and duration of treatment which will be most suitable for an individual and can vary with the age, weight and response of the particular individual.
- the above dosages are exemplary of the average case. There can, of course, be individual instances where higher or lower dosage ranges are merited, and such are within the scope of this invention.
- a vaccine composition is conveniently in injectable form. Conventional adjuvants may be employed to enhance the immune response.
- a suitable unit dose for vaccination is preferably administered daily and with or without an interval of at least lweek. With the indicated dose range, no adverse toxicological effects are observed with the compounds of the invention which would preclude their administration to suitable individuals.
- Recombinant RV vectors expressing an HIV-1 envelope protein In a preferred emodiment recombinant RVs expressing FfTV-1 envelope protein is explained.
- a new vector is constructed based on the previously described infectious RV cDNA clone pSAD-L16. (Schnell, et al., EMBO Journal, 13:4195-4203, 1994).
- site directed mutagenesis and a PCR strategy the ⁇ gene is deleted from the RV genome and a new transcription unit, containing a RV Stop/Start signal and two single sites (BsiWI and Nhel), is introduced into the RV genome (see also Generation of recombinant vectors, supra).
- the resulting plasmid is designated pSBN (Fig. 1).
- the SBN RV-vector is recovered by the reported methods and displayed the same growth characteristics and similar viral titers as SAD-L16, indicating that neither the deletion of the ⁇ gene nor the new transcription unit affected the RV vector (deleted).
- the HTV-l envelope genes (NL4-3 and 89.6) to be expressed from SBN are generated by PCR and cloned between the BsiWI and Nhel sites, resulting in the plasmids pSBN- NL4-3 and pSBN-89.6 (Fig.l). All constructs are checked via DNA sequencing. It should be noted that foreign genes up to at least 4kb are stable within the RV genome and a full length HTV-l envelope protein is expressed from the recombinant RVs.
- a positive signal for gpl60 in cells infected with recombinant SBN-NL4-3 and SBN-89.6 confirmed the successful recovery of recombinant RVs expressing HTV-l envelope protein.
- the recombinant RVs expressing HTV-l gag are also constructed and recovered with the same procedure used for the recombinant RVs expressing HTV-l envelope protein.
- recombinant RVs expressing HIV-1 envelope protein are examined. A three-fold lower liter for SBN-NL4-3 and a 10-fold tiler reduction for SBN-89.6 is noticed, as compared to wild-type SBN.
- a one-step growth curve of the recombinant RVs is performed. BSR cells are infected with a MOI of ten to allow synchronous infection of all cells. After replacing the virus inoculum with fresh medium, viral titers are determined at the indicated time-points (Fig. 2).
- HIV-1 gpl60 by recombinant RVs is also examined.
- cell lysates from recombinant RV infected cells are analyzed by Western immunoblotting with an antibody directed against RV (Fig. 3, -rabies) or HTV-l gpl20 (Fig. 3, ⁇ -gpl20).
- Two bands of the expected size for HTV-l gpl60 and gpl20 are detected in lysates from cells infected with SBN-89.6 or SBN-NL4-3 (lanes 3 and 4), but are not observed in cell lysates of mock-infected or SBN infected cells (lanes 1 and 2).
- the Western blot probed with an ⁇ RV antibody confirmed that all viruses (lanes 2, 3, and 4) infected the target cells.
- Envelope proteins expressed in recombinant RVs are functional
- the recombinant RVs are analyzed in a fusion assay in a human T cell-line (Sup-Tl). This experiment confirmed that wild-type RV is able to infect and replicate in human T cell-lines. Because wild-type RV infects cells by receptor- mediated endocytosis, the RV glycoprotein (G) can only cause fusion of infected cells at a low pH. (Whitt, et al., Virology, 185:681-8, 1991).
- Envelope protein from the dual-tropic HIV-1 strain (89.6) will induce cell fusion if coexpressed with CD4 and CCR5, whereas NL4-3 gpl60 will only induce fusion on cells expressing CD4 and the HTV-l coreceptor CXCR4.
- Infection of 3T3 murine cells expressing human CD4 does not result in cell fusion regardless of the recombinant RV used, whereas syncytium-formation is detected in 3T3 cells expressing CD4 and CXCR4 after infection with SBN-NL4-3 or SBN-89.6.
- SBN-NL4-3 or SBN-89.6 As expected, only expression of HTV-1 89 . 6 envelope protein in 3T3 cells, expressing CD4 and CCR5, caused fusion of these cells.
- Anti-gpl20 antibody response in mice infected with RV expressing HIV-1 gpl60 is also analyzed.
- One likely requirement for a successful HIV-1 vaccine is the ability to induce a strong humoral response against the HIV-1 protein gpl60.
- groups of five BALB/c mice are inoculated subcutaneously in both rear footpads with 10 6 FFU of SBN, SBN-89.6, or 10 5 FFU SBN-NL4-3. Mice are bled 11, 24, and 90 days after the initial infection with RV and the sera are analyzed by ELISA.
- mice Twelve days after the subunit boost, the mice are bled and the immune response is analyzed by an HTV-l gpl20 ELISA.
- the results demonstrate that an HTV-envelope subunit boost elicits a strong immune response against HTV-l gpl20 only in mice previously infected with SBN-89.6 or SBN-NL4-3 (Fig. 5). Wild-type RV (SBN) infected mice reacted only in the lowest serum dilution (1:160) after the boost.
- An ELISA specific for HIV-1 gp41 is negative for all mouse sera, even after the boost with recombinant HIV-1 gpl20/gp41. These data are confirmed by Western blot analysis (Fig. 6).
- HTV-l neutralizing antibody (NA) titers are determined in MT-2 cells by a vital dye staining assay using HTV-I NL ⁇ .
- the mouse serum is able to neutralize a tissue culture laboratory adapted (TCLA) HTV-1 NL4 .- 3 strain at a 1:800 serum dilution after immunization with SBN-NL4-3 and an envelope subunit booster injection of recombinant gpl20 (ITD3 strain), whereas immunization with SBN-NL4-3 did not induce detectable neutralizing antibody,
- mice with recombinant RV expressing HTV-l gpl60 results in a strong priming of the immune system, as indicated by vigorous humoral responses after a single boost with HIV-1 gpl20 protein or g ⁇ 41.
- boosting with another recombinant RV using a different viral glycoprotein for infection of the mice, or recombinant VSV expressing HIV-1 gpl60 can be tested for an even stronger response.
- mice were immunized with 2 x 10 7 foci forming units (FFU) of the recombinant RV expressing HIV- 1, ⁇ . envelope protein (SBN-NL4-3) (supra and infra). Three mice are sacrificed 105 or 135 days after infection and the spleens are removed. One third of the splenocyte cultures are infected with a multiplicity of infection (moi) of 1 with a recombinant vaccinia virus expressing T ⁇ V-l NM 3 gpl60 for 16 hours, deactivated using Psoralen and UV treatment, and added back to the culture as presenter cells.
- moi multiplicity of infection
- Stimulated effector cells are analyzed 7 days after activation for their ability to kill P815 target cells infected with vaccinia wild-type virus, a recombinant vaccinia virus expressing HTV-l NL43 gpl60 or HIV-1 Gag.
- a strong cytotoxic response is detected only against P815 target cells infected with the recombinant vaccinia virus expressing HIV-1 envelope protein. Only a low percentage of lysis is observed for P815 cells infected with the other two vaccinia viruses.
- these responses are achieved after a single inoculation with recombinant RV expressing HIV-1 envelope protein, which indicates that RV-based vectors are able to induce long-lasting CTLs after a single vaccination.
- CTLs from HIV-1 gpl ⁇ O immunized mice cross-kill target cells expressing a heterologous HIV-1 envelope protein
- HTV-l envelope amino acid sequences There is a significant difference in HTV-l envelope amino acid sequences but cross-protection between divergent viruses will be a likely requirement for a protective HTV-l vaccine.
- splenocytes from mice immunized with a recombinant RV expressing HIV-1 gpl60 are screened against P815 target cells expressing homologous and heterologous HTV-l envelope proteins.
- mice are immunized intraperitoneally (i.p) either with 2 x 10 7 recombinant RV expressing HTV-l g ⁇ l60 from a laboratory- adapted, CXCR4-tropic (NL4-3) or a dual-tropic (CXCR4 and CCR5) isolate (89.6).
- mice from each group are sacrificed, the spleens are removed, and the pooled splenocytes are stimulated with a recombinant vaccinia virus expressing the homologous HIV-1 envelope protein (NL4-3 or 89.6).
- effector cells are analyzed for their ability to lyse P815 cells infected with recombinant vaccinia viruses expressing HTV-l envelope protein from the laboratory- adapted, CXCR4-trapic HTV-l strain (NL4-3), the dual-tropic strain (89.6), and two primary, CCR5-tropic HTV-l strains (Ba-L and JR-FL).
- Activated splenocytes from SBN- NL4-3 immunized mice achieved a specific lysis of P815 cells expressing gpl60 JR- FL or 89.6 in the 40% range at an effector: target (E:T) ratio of 50:1 and are also able to cross-kiH target cells expressing HTV-lB - gpl60.
- Cross-killing is also observed with effector cells from SBN-89.6 primed mice.
- P815 target cells are lysed in the same range as observed for activated splenocytes from mice immunized with SBN- NL4-3, but lysed only about 20% P815 cells expressing HTV-l NL4-3 .
- HIV-1 -specific CTL activity is mediated by CD8 + T-cells
- the phenotype of the T-cell subpopulation mediating cytolytic activity is assessed by selective depletion.
- Three mice are immunized with 2 x 10 7 FFU of recombinant RV expressing HTV-1 NL 4- 3 envelope protein, eighteen weeks later the spleens are removed.
- Splenocytes are re-stimulated with a recombinant vaccinia virus expressing the homologous HTV-l envelope protein for 7 days.
- Immuno-magnetic bead cell separation is completed to both deplete and positively isolate CD8 + T-cells from the activated splenocyte culture.
- Chromium release assays are completed using cultures depleted of CD8 + T-cells (CDS ' ), cultures of isolated CD8 cells (CD8 + ) or unprocessed cultures (CD8 + /CD8 " ).
- P815 target cells are infected with vaccinia virus expressing HTV-l NL _ 3 gpl60 or HIV-1 gag.
- the CD8 + T-cell depleted cultures show no activity while the CD8 + T-cell enriched and unprocessed cultures show high specific lysis at E:T ratios of 25:1 and 12.5:1, respectively.
- the CD8 + T-cell enriched population is also enriched in lytic units, as the CTL activity is still on a plateau at 12.5:1, in contrast to the unselected population.
- the present invention relates to RV-based vectors expressing HIV-1 envelope proteins. These vectors are able to induce a humoral response against HTV-l gpl60 after a single immunization followed by a boost injection with recombinant HTV-l gpl20. (Schnell, M. J., et al., Proc. Natl. Acad. Sci. USA, 97:3544-3549, 2000.). Expanding evidence suggests that CTL responses play a major role in the an ti -viral immune response against HTV-l. (Brander, C. and B. D. Walker, Current Opinion in Immunology, 11:451-9, 1999.). The development of an effective prophylactic HTV-l vaccine therefore requires the selection of HTV-l antigen(s) capable of inducing long- lasting and broadly reactive CTL responses.
- the present invention further relates to RV-based vectors to induce such responses.
- RV nucleoprotein which was previously shown to be an exogenous superantigen (Lafon, M., Research in Immunology, 144:209-13, 1993; Lafon, M., et al, Nature, 358:507-10, 1992), might help to enhance a general immune response against the HTV-l envelope after a single immunization.
- the recombinant RVs of the present invention are able to induce cross-reactive CTLs against a variety of different HTV-l envelope prote s.
- Previous studies showed that single amino acid exchanges can abrogate CTL cross-reactivity, whereas other examinations indicated that single or even double amino acid substitutions frequently did not abrogate cross-killing. (Cao, H., et al., J. Virol, 71:8615-23, 1997; Johnson, R. P., et al., Journal of Experimental Medicine, 175:961-71, 1992; Johnson, R. P., et al., Journal of Immunology, 147:1512-21, 1991.).
- the inventors of the present invention are currently analyzing if CTLs against HIV-1 gpl60 induced by recombinant RV are also cross-reactive against HIV-1 envelope protein from clades other than B.
- the present invention demonstrates the ability of the murine sera to neutralize HTV-l strain.
- recombinant RVs are excellent vectors for B cell priming.
- the present invention also shows that a single vaccination with recombinant RV expressing HIV-1 envelope protein elicits a strong, long-lasting CTL response specific against HIV-1 proteins, such as the envelope protein of different HIV-1 strains.
- RVs of the present invention Using the recombinant RVs of the present invention, all of the dominant epitopes for neutralizing antibodies, cytotoxic lymphocytes, and antibody dependent cell cytotoxicity are expressed at one time, thereby eliciting both humoral and cell-mediated immunity against HTV-l. Examples
- Example I Plasmid construction. Shown in Fig. 1 is a schematic representation of a method for the construction of recombinant RV genomes. At the top, the wild-type RV genome with its five open reading frames is shown (SAD L16). Using a PCR strategy and site directed mutagenesis the entire ⁇ gene is removed and a new minimal RV transcription unit containing two single sites is introduced between the G and L genes (SBN). The cDNA sequence encoding HTV-1 89 . 6 or HTV-l N 4 .- 3 gpl60 is inserted using the BsiWI and Nhel sites resulting in the plasmids, pSBN-89.6 or pSBN-NL4-3 (bottom).
- pSN is the target used to introduce a new transcription Stop/Start sequence, as well as a single BsiWI site using a polymerase chain reaction (PCR) strategy.
- two fragments are amplified by PCR from pSN using Vent polymerase (New England Biolabs Inc.) and the forward primers RPl 5 - TTTTGCTAGCTTATAAAGTGCTGGGTCATCTAAGC-3' (SEQ TD NO: 3) or RP10 5 -CACTACAAGTCAGTCGAGACTTGGAATGAGATC-3' (SEQ TD NO: 4).
- the reverse primers were RPl 8 5 -TCTCGAGTGTTCTCTCTCCAACAA-3' (SEQ TD NO: 5) and RP17 5'- AAGC ⁇ AGCAAAACG ⁇ ACGGGAGGGGTGTTAGTTTTTTTCATGGACTTGGAT
- RP17 contains a RV transcription
- Stop/Start sequence (underlined) and a BsiWI and Nhel site (shown in italics).
- PCR products are digested with Nhel, li gated, and the 3.5 kb band eluted from an agarose gel. After gel elution the band is digested with ClaT/MluI and ligated to the previously ClaT/MluI digested pSN.
- the plasmid is designated pSBN.
- the HTV-l g ⁇ l60 genes encoding the envelope protein of the HIV-1 strains 89.6 and NL4-3, are amplified by PCR using Vent polymerase, the forward primer 5 - GGGC ⁇ GCAGC ⁇ CGAGCG ⁇ ACGAAAATGAGAGTGAAGGAGATCAGG-3' (SEQ ID NO: 1).
- Example 2 Recovery of infectious RV from cDNA.
- the previously described vaccinia virus-free RV recovery system is used (see Finke, et al., Journal of Virology, 73:3818-25, 1999).
- BSR-T7 cells which stably express T7 RNA polymerase (a generous gift of Drs. S. Finke and K.-K.
- Conzelmann are transfected with 5 ⁇ g of full-length RV cDNA in addition to plasmids coding for the RV N-, P-, and L-proteins (2.5 ⁇ g, 1.25 ⁇ g, and 1.25 ⁇ g) respectively, using a Ca j PO,, transfection kit (Stratagene) as indicated by the vendor.
- tissue culture supematants are transferred onto fresh BSR cells and infectious RV is detected three days later by immunostaining against RV the N protein (Centocor).
- FIG. 2 Shown in Fig. 2 is a graph showing One-step growth curves of recombinant RV BSR cells that are infected with the recombinant RVs (SBN, SBN-89.6, and SBN- NL4-3). The viral titers are determined in duplicate at the indicated time-points.
- BSR cells a BHK-21 clone
- MOI multiplicity of infection
- FIG. 3 the Western blot analysis of recombinant RVs expressing HTV-l gpl60 is shown.
- Sup-Tl cells are infected with a MOI of 2 with SBN, SBN-89.6, or SBN-NL4-3 and lysed 24 h later. Proteins are separated by SDS-PAGE and analyzed by Western blotting.
- An antibody directed against gpl20 detected two bands at the expected size for HTV-l gpl60 and gpl20 in cell-lysates infected with SBN-89.6 or SBN-NL4-3 ( -gpl20, lanes 3 and 4).
- Shown in Fig. 4. are Sup-Tl cells which are infected using a MOI of 1 with SBN, SBN-89.6, or SBN-NL4-3. Twenty-four hours after infection, syncytia- formation is detected in cell cultures infected with recombinant RV expressing HTV-l gpl60 (panel SBN-89.6 and SBN-NL4-3), indicating expression of functional HIV-1 envelope protein. No cell fusion is detected in cultures infected with wild-type RV (panel SBN).
- Example 4 Immunization. Groups of five 4-6 week old female BALB/c mice obtained from Jackson
- mice are inoculated subcutaneously in both rear footpads with 10 6 foci forming units (FFU) SBN, SBN-89.6, or 10 5 NL4-3 in DMEM + 10% FBS.
- FFU foci forming units
- mice in each group Three out of five mice in each group are boost immunized intraperitonealy three months after infection with 10 ⁇ g recombinant gp41 (IITB, Intracel Inc.) and 10 ⁇ g recombinant gpl20 (DIB, Intracel Inc.) in 100 ⁇ l complete Freunds adjuvant.
- Example 5 Enzyme-linked Immunosorbent Assay (ELISA ).
- Recombinant HTV-l gpl20 (TUB strain, Intracel) is resuspended in coating buffer (50 mM Na 2 CO 3 , pH 9.6) at a concentration of 200 ng/ml and plated in 96 well ELISA MaxiSorp plates (Nunc) at 100 ⁇ l in each well. After overnight incubation al 4°C, plates are washed three times (PBS pH 7.4, 0.1% Tween-20), blocked with blocking buffer (PBS, pH 7.4, 5% dry milk powder) for 30 minutes at room temperature, and incubated with serial dilutions of sera for 1 hour.
- HEP horseradish peroxidase-conjugated
- H+L horseradish peroxidase-conjugated
- plates are washed three times and 200 ⁇ l OPD-substrate (o-phenylenediamine dihydrochloride, Sigma) is added to each well.
- OPD-substrate o-phenylenediamine dihydrochloride, Sigma
- Optical density is determined at 490 nm.
- Shown in Fig. 5 is a graph depicting ELISA reactivity of mouse sera against HIV-1 gpl20.
- mice Five mice each are immunized with recombinant RVs (SBN, SBN-89.6, or SBN-NL4-3) and 3 months after the initial infection three mice from each group are boosted with recombinant HTV-l gpl20 and gp41 (SBN*, SBN-89.6*, or SBN-NL4-3*).
- Each data point on the graph indicates the average of mice from each group in three independent experiments.
- One mouse of the SBN-89.6 group did not react to the boost injection and is not included in the graph.
- the error bars indicate the standard deviations.
- Human T-lymphocytic cells (Sup-Tl) cells are infected with a MOI of 2 for 24 hours and resuspended in ' lysis buffer 50mM Tris, pH 7.4; 150 mM NaCl, 1% NP-40, 0.1% SDS, and lx protease inhibitor cocktail (Sigma) for 5 minutes. The protein suspension is transferred to a microfuge tube and spun for 1 minute at 10,000 x g to remove cell debris. Proteins are separated by 10% SDS-PAGE and transferred to a PVDF-Plus membrane (Osmonics).
- blots are incubated with sheep -gpl20 antibody (ARRRP) (1:1000) or human ⁇ -rabies sera (1:500) in blocking buffer for 1 hour.
- RRRRP sheep -gpl20 antibody
- HRP horseradish peroxidase-conjugated antibodies
- Western blot analysis to detect anti-HTV-1 antibody is performed using a commercial Western Blot kit (QualiCode HTV- 1/2 Kit, Immunetics) according to the manufacturer's instructions, except for the mouse sera in which ⁇ -human IgG conjugate is substituted with a 1:5000 dilution of an alkaline phosphatase-conjugated goat anti-mouse IgG (H+L) (Jackson ImmunoResearch Laboratories). Shown in Fig. 6 is the Western blot analysis of mice serum antibody response to HIV-1 antigens.
- Sera from one mouse of each group (SBN, SBN-89.6, or SBN-NL4-3), which are immunized by the RVs ( ⁇ -SBN, ⁇ -SBN-89.6 or ⁇ -SBN-NL4-3), or immunized and boost injected with recombinant gpl20 and gp41 ( ⁇ -SBN*, ⁇ -SBN- 89.6* or ⁇ -SBN-NL4-3*), are tested at 1:100 dilutions.
- a highly positive and weakly positive human control serum is used to detect the position of the HTV-l proteins.
- SC indicates the serum control.
- Example 7 Virus Neutralization Assays. HTV-l strains are recovered on 293T cells and virus stocks are expanded on
- MT-2 cells HTV-l NL4-3
- MT-2 cells frozen at -75° C and titered on MT-2 cells.
- Neutralization assays are performed according to Montefiori et al., (Journal of Clinical Microbiology, 26, 231-5, 1998). Briefly, -5000 TCTD 5 o of HIV-1 NL4 . 3 are incubated with serial dilutions of mouse sera for 1 hour. MT-2 cells are added and incubated at 37°C, 5% CO for 4-5 days. 100 ⁇ l of cells are transferred to a poly-L-lysine plate and stained with neutral red dye (Neutral Red, ICN) for 75 minutes. Cells are washed with PBS, lysed with acid alcohol and analyzed using a colorimeter at 550 nm. Protection is estimated to be at least 50% virus inhibition.
- LL-2 interleukin
- the virus is inactivated using psoralen (Sigma). Psoralen is added to cells to achieve a final concentration of 5 ⁇ g/ml. Following a ten minute incubation at 37°C the cells were treated with long-wave UV (365 nm) for 4 minutes and washed twice with PBS.
- Target cells are prepared by infection with vaccinia virus expressing the HTV-l protein (see specific figure legend for specific protein) for one hour at a moi of 10, washed to remove excess virus, and incubated for 16 hours at 37°C.
- target cells are infected with vaccinia virus expressing HIV-1 Gag (vP1287) or wild-type vaccinia (vP1170).
- Target cells are washed once in PBS, incubated with 100 ⁇ Ci 51 Cr for one hour to label the cells, washed two times in PBS and added to effector cells at various E:T ratios (see figures) for four hours at 37°C.
- the percent specific 5l Cr release is calculated as 100 x (experimental release - spontaneous release)/(maximum release - spontaneous release). Maximum release was determined from supematants of cells that were lysed by the addition of 5% Triton X-100. Spontaneous release was determined from target cells incubated without added effector cells.
- CD8 + T-cells are depleted from the cell culture (CD8 " ) and enriched (CD8 + ) using Dynabeads Mouse CD8 (Lyt2), as described by the manufacturer.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Virology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Biomedical Technology (AREA)
- General Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
This invention provides recombinant, replication-competent Rhabdovirus vaccine strain-based expression vectors for expressing heterologous viral antigenic polypeptides such as immunodeficiency virus envelope proteins or subparts thereof. An additional transcription stop/start unit within the Rhabdovirus genome is inserted to express the heterologouos antigenic polypeptides. The HIV-1 gp 160 protein is stably and functionally expressed, as indicated by fusion of human T cell-lines after infection with the recombinant RVs. Inoculation of mice with the recombinant Rabies viruses expressing HIV-1 gp160 induces a strong humoral response directed against the HIV-1 envelope protein after a single boost with an isolated recombinant HIV-1 gp120 protein. Moreover, high neutralization titers, Up to 1:800, against HIV-1 are detected in the mouse sera. The present invention also shows that a single vaccination with recombinant RV expressing HIV-1 envelope protein elicits a strong, long-lasting CTL response specific against HIV-1 proteins, such as the envelope protein of different HIV-1 strains. These recombinant viral vectors expressing viral antigenic polypeptides provide useful and effective pharmaceutical compositions for the generation of viral specific immune responses.
Description
RECOMBINANT RHABDOVIRUSES AS LIVE-VIRAL VACCINES FOR IMMUNODEFICIENCY VIRUSES
GOVERNMENT RIGHTS TO THE INVENTION
This invention was made in part with government support under grant AI44340 awarded by the National Institute of Health. The government has certain rights to the invention.
CROSS REFERENCE TO RELATED APPLICATIONS
This application claims priority to U.S. Application No. 09/761,312, filed January 17, 2001, which claims priority, in part, to U.S. Non-Provisional Application No. 09/494,262, filed January 28, 2000.
FIELD OF THE INVENTION
The present invention relates to the fields of molecular biology and virology, and to a method of treating an HTV-l infection and, more particularly, to the induction of both humoral and cellular immunity against HTV-l.
BACKGROUND OF THE INVENTION
Great success has been made in the therapy of HTV-l infection during the last several years. (Holtzer, et al., Annals of Pharmacotherapy 33:198-209, 1999; Bonfanti, et al., Biomedicine & Pharmacotherapy, 53:93-105, 1999). However, the development of a protective immunodeficiency virus vaccine (e.g., HTV-l vaccine) still remains a major goal in halting immunodeficiency virus pandemics. Most successful vaccines against viral diseases have been composed of killed or attenuated viruses. (Hilleman, M. R., Nature Medicine, 4:507-14, 1998). This
approach does not seem to be suitable for immunodeficiency viruses, particularly HTV-l because killed HTV-l virus induces only a poor neutralizing antibody response and no cytotoxic T lymphocyte (CTL) response.
New anti-retroviral strategies against human HTV-l result in a dramatic decrease in mortality among infected humans in developed countries, but the development of a successful vaccine to prevent infection is still the major goal to halt the HTV-l pandemic. A human being is infected with HIV-1 every 10 seconds on average, and in the heavily affected countries in Africa, such as Zambia and Uganda, nearly 40% of young adults are HJV-1-seropositive. (1). Currently, a variety of HIV vaccine strategies are being investigated, including recombinant proteins (Goebel, F.D., et al., European Multinational 1MMUNO AIDS Vaccine Study Group Aids, 5:643-50, 1999; Quinnan, G.V., Jr., et al., AIDS Research & Human Retroviruses, 15:561-70, 1999; VanCott, T.C., et al., J. Virol, 73:4640-50, 1999), peptides (Bekyakov, I.M., et al, Journal of Clinical Investigation, 102:2072- 81, 1998; Berzofsky, J.A., et al, Immunological Reviews, 170:151-72. 1999; Pinto, L.A., et al, AIDS, 13:2003-12, 1999), naked DNA (Bagarazzi, M. L., et al., 1999, Journal of Infectious Diseases, 180:1351-5, 1999; Barouch, D. H., et al., Science, 290:486-492, 2000; Cafaro, A., et al., Nature Medicine, 5:643-50, 1999; Lu, S., et al., AIDS Research & Human Retroviruses, 14:151-5, 1998; Putkonen, P., et al., Virology, 250:293-301, 1998; Robinson, H. L., Aids, 11:S109-19, 1997; Weiner, D. B., and R. C. Kennedy, Scientific American, 281:50-7, 1999.), replication-competent and incompetent (replicon) live viral vectors (Berglund, P., et al., AIDS Research & Human Retroviruses, 13:1487-95, 1997; Mossman, S. P., et al., J. Virol, 70:1953-60, 1996; Natuk, R. J., et al., Proc. Natl. Acad. Set USA, 89:7777-81, 1992; Ourmanov, I., et al., J. Virol, 74:2740-2751, 2000; Schnell, M. J., et al., Proc. Natl. Acad. Sci. USA, 97:3544-3549, 2000.), and prime-boost combinations, [for review see (5)]. A large number of these vaccine strategies have been tested in the simian immunodeficiency virus (SIV) macaque model system, but to date no potent protective immunity has been obtained, although some amelioration of disease course has been seen. (Barouch, D. H., et al., Science, 290:486-492, 2000; Davis, N. L., et al., /. Virol, 74:371-8, 2000; Ourmanov, I., et al., /. Virol., 74:2740-2751, 2000.). So far, the only effective method to protect macaques from SIV infection is the use of live, attenuated SIV. Desrosiers and colleagues showed that a genetically modified, nef-
deleted SIV strain that does not cause disease in rhesus monkeys induced high anti- SIV titers of antibodies and cytotoxic T lymphocyte (CTL) activity. (Daniel, M. D., et al., Science, 258, 1938-1941, 1992; Kestler, H. W„ et al, Cell, 65:651-662, 1991.). Subsequent challenge of the immunized animals with infectious doses of a pathogenic SIV strain yielded protection from infection. (Daniel, M. D., et al., Science, 258: 1938- 1941, 1992). A major drawback in the use of attenuated lentiviral vaccine approaches is the finding that even πe/-deleted SIV can give rise to an AIDS-like disease in both neonatal and adult macaques. (Baba, T. W., et al., Science, 267:1820-5, 1995; Baba, T. W., et al., Nature Medicine, 5:194-203, 1999; Desrosiers, R. C, AIDS Research & Human Retroviruses, 10:331-2, 1994.). Additional concerns regarding the use of attenuated lentiviruses arise from the recent finding that recombination of live, attenuated SIV with challenge virus in some cases results in an even more virulent strain. (Gundlach, B. R., et al., J. Virol, 74:3537-3542, 2000.). However, the results indicated that live- viral vectors may be excellent vaccine candidates for an HIV-1 vaccine.
For the foregoing reasons, there is a great need for. the development of a protective immunodeficiency virus vaccine that is non-pathogenic for a wide range of animal species when administered orally or intramuscularly, as well as being able to induce the required neutralizing antibody and CTL responses. The immune response(s) required to protect against HIV-1 infection is currently unknown, but a protective immune response against HIV-1 might require both major arms of the immune systems. Recent reports on vaccine approaches using recombinant HIV-1 envelope protein suggests that an exclusively humoral response is not sufficient to protect against an HIV-1 infection, but the passive transfer of three monoclonal antibodies directed against HIV-1 envelope protein resulted in protection of macaques against subsequent challenge with pathogenic HTV-1/STV chimeric virus. (Mascola, J. R., et al., Nature Medicine, 6:207-10, 2000.). Other studies indicate that a cell-mediated response plays an important role in controlling an HIV-1 infection. (Brander, C. and B. D. Walker, Current Opinion in Immunology, 11:451-9 1999; Goulder, P. J., et al., Anti-HIV cellular immunity: recent advances towards vaccine design Aids, 13:S121-36, 1999.). Exposed but uninfected individuals often have HTV- 1-specific CTLs but no detectable antibodies against HIV-1 (Pinto, L. A., et al., Journal of Clinical Investigation, 96:867- 76, 1995; Rowland- Jones, S. L., et al.,
Journal of Clinical Investigation, 102:1758-65, 1998.).
In the present invention, the ability of recombinant non-segmented negative- stranded RNA viruses expressing an immunodeficiency virus gene(s) as an immunodeficiency virus vaccine (e.g., HIV-1 vaccine) is disclosed. Specifically, the ability of a Rhabdovirus-based recombinant viruses to induce an immune response against HIV is demonstrated. The HIV-1 envelope protein is stably and functionally expressed and induces a strong humoral response directed against the HIV-1 envelope protein after a single boost with recombinant HIV-1 protein boost (gpl20) in mice. Moreover, high neutralization titers against HIV-1 are detected in the mouse sera. (Schnell, M. J., et al., Proc. Natl. Acad. Sci. USA, 97:3544-3549, 2000.).
Little information is available regarding the induction of CTL responses against foreign proteins expressed by rhabdovirus-based vectors. The present invention fulfills this long sought need and further relates to recombinant RV vaccines expressing HTV-l envelope proteins to induce HTV-l -specific CTLs. Specifically, a single inoculation of the HIV-1 virus vaccines of the present invention induce a solid and long-lasting memory CTL response specific for HTV-l proteins. These recombinant viruses are non-pathogenic for a wide range of animal species when administered orally or intramuscularly. In a specific embodiment when the coding region of the HIV-1 gpl60 (strains NL4-3 and 89.6) is cloned between the RV glycoprotein (G) and polymerase (L) proteins under the control of a RV transcription Stop/Start signal, the resulting recombinant RVs expressed HIV-1 gρl60 along with the other RV proteins.
DEFINITIONS
"boost vaccine vector" is "boost virus" "boost virus" is "boost vaccine vector"
SUMMARY OF THE INVENTION
The present invention is directed to recombinant non-segmented negative- stranded RNA virus vectors expressing an immunodeficiency virus genes as a live- viral vaccine (e.g., HTV-l vaccine) and methods of malcing and using the same. More in particular the invention relates to recombinant Rhabdoviruses which express gene products of a human immunodeficiency virus and to immunogenic compositions which induce an immunological response against immunodeficiency virus infections when administered to a host. These recombinant live-viral vaccines are non- pathogenic for a wide range of animal species when administrated orally or intramuscularly and induce protective immune responses such as neutralizing antibody response and long lasting cellular (such as cytotoxic T lymphocyte (CTL)) responses against the immunodeficiency viruses.
In general aspects, the invention is a recombinant non-segmented negative- stranded RNA virus vector having: (a) a modified negative-stranded RNA virus genome that is modified to have one or more new restriction sites, or not to have one or more genes otherwise present in the genome; (b) a new transcription unit that is inserted into the modified negative-stranded RNA virus genome to express heterologous nucleic acid sequences; and (c) a heterologous viral nucleic acid sequence that is inserted into the new transcription unit, where the recombinant non- segmented negative-stranded RNA virus vector is replication competent, and the heterologous viral nucleic acid sequence encodes an antigenic polypeptide.
Specifically, in one embodiment of the invention, the recombinant non- segmented negative-stranded RNA virus vector that is used as a live- viral vaccine is a recombinant Rhabdovirus vector. This vector includes (a) a modified Rhabdovirus genome; (b) a new transcription unit inserted into the Rhabdovirus genome to express heterologous nucleic acid sequences; and (c) a heterologous viral nucleic acid sequence that is inserted into the new transcription unit, where the recombinant Rhabdovirus vector is replication competent, and the heterologous viral nucleic acid sequence encodes an antigenic polypeptide. The modified Rhabdovirus genome is, for example, modified rabies virus genome or a modified vesicular stomatitis virus genome. The modifications in the Rhabdovirus genome include creation of new restriction sites and/or deletion of one or more genes such as the native G
(glycoprotein) gene of the Rhabdovirus, ψ gene of rabies virus, etc. In some instances, the modified Rhabdovirus genome has a further modification to have a glycoprotein from another class of virus in place of the native glycoprotein. The glycoprotein from another class of virus is vesicular stomatitis virus glycoprotein. In some other instances, the modified rabies virus genome has a third modification to have contiguity of structural genes different from that in the rhabodvirus genome after the second modification.
The term heterologous viral nucleic acid as used herein refers to the viral nucleic acid that encodes the antigenic polypeptide that induces immune response. For example, a full-length HTV envelope protein, HIV gpl60, HIV gag, HIV gpl20, and full-length SIV envelope protein are some of the antigenic polypeptides that are expressed in the recombinant viral vectors of the present invention. The term heterologous viral nucleic acid as used herein does not include the native gene sequences of the one or more classes of Rhabdoviruses in a recombinant Rhabdovirus such as, for example, VS V G gene in the recombinant RV.
In the case of a modified Rhabdovirus genome where G gene is deleted, the sequence of the cytoplasmic domain of Rhabdovirus G gene is fused to other sequences before cloning into the modified Rhabdovirus genome. One such example is a chimeric VSV/RV glycoprotein where the fusion protein has VSV ectodomain and transmembrane domain, and RV cytoplasmic domain. Another such example is a chimeric HTV-l/RV glycoprotein where the fusion protein has HIV-1 gpl60 ectodomain and transmembrane domain, and RV cytoplasmic domain. Thus, in some cases, the heterologous viral nucleic acid is fused to the sequence of the cytoplasmic domain of the G gene of the modified Rhabdovirus genome to produce a chimeric protein such that the resulting chimeric protein has a fusion between the transmembrane domain of the heterologous protein and cytoplasmic domain of the glycoprotein. In some cases, the glycoprotein gene of the recombinant Rhabdovirus is deleted and the heterologous viral nucleic acid is fused to the sequence of the cytoplasmic domain of the G gene of the modified Rhabdovirus genome to produce a chimeric protein which functionally substitutes for the recombinant Rhabdoviruses glycoprotein gene.
In another embodiment of the invention a recombinant Rhabdovirus that expresses a functional HTV envelope protein is provided. The recombinant
Rhabdovirus is replication-competent. The Rhabdovirus can be a recombinant rabies virus or a recombinant vesicular stomatitis virus.
The HTV envelope protein expressed from the recombinant Rhabdovirus is from any HTV-l isolate. In still another embodiment of the invention, a recombinant Ψ gene deficient
Rhabdovirus having a heterologous nucleic acid segment encoding an immunodeficiency virus envelope protein or a subunit thereof is provided. In such cases, the recombinant Ψ gene deficient Rhabdovirus is a rabies virus and the immunodeficiency virus envelope protein, or a subunit thereof, is from a human immunodeficiency virus or from a simian immunodeficiency virus. The subunit or a fragment of the immunodeficiency envelope protein includes fragments having only a part of the contiguous amino acids of the envelope protein. These subunits or fragments include, for example, HIV gρl20, HIV gp41, HIV gp40, the envelop proteins expressed by HTV N -3 and HTV 89.6, and the subunits of other immunodeficiency viruses.
In yet another embodiment of the invention, a method of inducing an immunological response in a mammal is provided. This method includes the steps of: (a) delivering to a tissue of the mammal a recombinant Rhabdovirus vector that expresses a functional immunodeficiency virus envelope protein, or a subunit thereof, effective to induce an immunological response to the envelope protein; (b) expressing the envelope protein, or the subunit thereof, in vivo; (c) boosting the animal by delivering an effective dose of an isolated immunodeficiency virus envelope protein, or a subunit thereof, in an adjuvant or by delivering an effective dose of a boost vaccine vector; and (d) inducing a neutralizing antibody response and/or long lasting cellular immune response thereto to protect the mammal from an immunodeficiency virus.
The recombinant Rhabdovirus has a rabies virus genome. In the method where the rabies virus genome is used, it is deficient in Ψ gene. In some cases, rabies virus genome is also deficient in a rabies virus glycoprotein gene or rabies virus genome has glycoprotein gene from another class of Rhabdovirus in place of the rabies virus glycoprotein. Boosting the animal can be done by delivering an effective dose of a boost vaccine vector instead of the isolated immunodeficiency virus envelope protein.
In another embodiment of the invention an immunogenic composition having any of the above mentioned recombinant Rabdoviruses along with an adjuvant is provided.
In yet another embodiment of the invention a method of inducing an immunological response in a mammal is provided which includes the steps of: (a) delivering to a tissue of the mammal a non-segmented negative-stranded RNA virus that expresses a functional immunodeficiency virus envelope protein, or a subunit thereof, effective to induce an immunological response to the envelope protein; (b) expressing the envelope protein, or the subunit thereof, in vivo; (c) boosting the animal by delivering an effective dose of an isolated immunodeficiency virus envelope protein, or a subunit thereof, in an adjuvant or by delivering an effective dose of a boost vaccine vector; and (d) inducing a neutralizing antibody response and/or long lasting cellular immune response thereto to protect the mammal from an immunodeficiency virus. The method where the non-segmented negative-stranded RNA virus is used includes a Rabies virus or a Vesicular Stomatitis virus.
It is a further object of the invention to present a method of treating a mammal infected with an immunodeficiency virus. A non-segmented negative-stranded RNA virus that expresses a functional immunodeficiency virus envelope protein, or subunit thereof is administered to the mammal. This RNA virus will express the functional immunodeficiency virus envelope protein, or subunit thereof. An effective dose of an isolated immunodeficiency virus envelope protein, or subunit thereof, in an adjuvant or an effective dose of a boost vaccine vector is delivered to the mammal, thereby inducing a neutralizing antibody response and/or long lasting cellular immune response to the functional immunodeficiency virus envelope protein, or subunit thereof. In one embodiment the immunodeficiency virus is any HIV-1 virus. In another embodiment the non-segmented negative-stranded RNA virus is a Rhabdovirus. In a further embodiment there is an induction of mucosal immunity to the functional immunodeficiency virus envelope protein, or subunit thereof. In another embodiment the long-lasting cellular response is a cross-reactive CTL response wherein the cross-reactive CTLs are directed against envelope proteins, or subunits thereof, from different immunodeficiency virus strains.
It is another object of the invention to present a method of protecting a
mammal from an immunodeficiency virus infection. A non-segmented negative- stranded RNA virus that expresses a functional immunodeficiency virus envelope protein, or subunit thereof is administered to the mammal. This RNA virus will express the functional immunodeficiency virus envelope protein, or subunit thereof, thereby thereby inducing a neutralizing antibody response and or long lasting cellular immune response to the functional immunodeficiency virus envelope protein, or subunit thereof. In one embodiment the immunodeficiency virus is any HIV-1 virus. In another embodiment the non-segmented negative-stranded RNA virus is a Rhabdovirus. In a further embodiment there is an induction of mucosal immunity to the functional immunodeficiency virus envelope protein, or subunit thereof. In another embodiment the long-lasting CTL response is a cross-reactive CTL response wherein the cross-reactive CTLs are directed against envelope proteins, or subunits thereof, from different immunodeficiency virus strains.
BRIEF DESCRIPTION OF THE FIGURES
Figure 1. Schematically shows a method for the construction of recombinant RV genomes. Figure 2. A graph showing One-step growth curves of BSR cells that were infected with the recombinant RVs (SBN, SBN-89.6, and SBN-NL4-3)
Figure 3. Western blot analysis of recombinant rabies viruses (RVs) expressing HTV-l gρl60.
Figure 4. A composite photograph showing Sup-Tl cells after these cells were infected (using a MOI of 1) with SBN, SBN-89.6, or SBN-NL4-3.
Figure 5. A graph showing ELISA reactivity of mouse sera against HTV-l gpl20.
Figure 6. Western blot analysis of mice serum antibody response to HIV- 1 antigens. Figure 7. Schematic representation of a method for the construction of RV- based expression vectors with foreign viral glycoproteins.
Figure 8. Schematic representation of a method for the construction of full- length and RV-glycoprotein deleted RVs expressing HTV-l gpl60.
Figure 9. CTLs from HTV-l gpl60 immunized mice induce long-lasting HTV- 1 gpl60-specifϊc CTLs. Groups of three 6- to 8-week-old female BALB/c mice (Harlan Sprague) are inoculated i.p. with 2x10 foci-forming units of recombinant RV expressing HTV-1NL4-3 envelope protein. 105 to 135 days after the single inoculation, spleens are aseptically removed and single cells suspensions are prepared (infra). Stimulator cells are prepared (infra), then added back to the effector cell population at a ratio of 3:1. Cytolytic activity of cultured CTLs is determined by measurement of the percent 51Cr released (infra).
Figure 10. CTLs from HTV-l gpl60 immunized mice cross-kill target cells expressing heterologous HIV-1 envelope proteins. Groups of six 6- to 8-week-old female BALB/c mice are inoculated i.p. with 2xl07 foci-forming units recombinant RV expressing HTV-l envelope protein from strains NL4-3 (A) or 89.6 (B). Three and four weeks after the single inoculation, spleens were aseptically removed and splenocytes were stimulated in-vitro with vaccinia virus expressing the homologous HTV-l envelope protein (infra). Target cells are prepared by infection with vaccinia virus expressing HTV-l envelope proteins from strains NL4-3 (vCB41), 89.6 (vBD3), JR-FL (vCB28), or Ba-L (vCB43). Chromium release assays are completed (infra). The results are shown from two different, independent experiments.
Figure 11. Cytolytic activity is mediated by CD8+ T-cells. Groups of three 6- to 8-week-old female BALB/c mice are inoculated i.p. with 2xl07 foci-forming units recombinant RV expressing HTV-l envelope protein from the NL4-3 strain. Eighteen weeks after the single inoculation, spleens are aseptically removed and splenocytes are stimulated in vitro with vaccinia virus expressing HTV-INU-3 envelope protein (infra). Seven days post in vitro stimulation, CD8+ T-cells are depleted from the cell culture (CD8") and enriched (CD8+) using Dynabeads Mouse CD8 (Lyt2), as described by the manufacturer. Chromium release assays are completed (infra) on cultures depleted (CD8") or enriched (CD8+) of CD8 T-cells, or unprocessed cultures (CD8+/CD8"). Target cells are prepared (infra) by infection with vaccinia virus expressing HTV-l envelope proteins from NL4-3 (vCB41). Background levels were equal to, or below, 6% specific lysis.
DETAILED DESCRIPTION OF THE INVENTION
Rhabdoviruses such as Rabies virus and Vesicular Stomatitis virus are members of the family Rhabdoviridae. Rabies virus possesses a negative stranded RNA genome of approximately 12kb. The genome is modularly organized and similar to that of vesicular stomatitis virus (VSV). These Rhabdoviruses encode five structural proteins. The five open reading frames coding for the viral structural proteins are nucleoprotein (N), phosphoprotein (P), matrix protein (M), glycoprotein (G), and polymerase (L). After infection, the viral polymerase-complex (P and L) begins transcription at the 3 'end of the encapsidated genome to generate a short leader RNA followed by sequential synthesis of five viral RNAs. The nucleoprotein (N), the phosphoprotein (P), the viral polymerase (L), and the genomic RNA form a helical ribonucleoprotein complex (RNP). The RNP is surrounded by a host cell-derived envelope membrane which contains the matric protein (M) on the inner side of the membrane, and the transmembrane glycoprotein (G) which mediates binding of the virus to specific receptors on the cell membrane.
The generation of non-segmented negative-strand RNA viruses entirely from cDNA has been reported by the inventors. (Schnell et. al., EMBO, 13:4195-4203, 1994). The approach involved intracellular expression of anti-genomic RNA in cells also expressing the viral proteins required for formation of an active RNP complex, namely, the nucleoprotein (N), the phosphoprotein (P), and the viral polymerase (L). This method avoids problems of antisense that are encountered when expressing the non-encapsidated negative-strand genomic RNAs, and positive strand mRNAs, and the same method was later also successful in the recovery of another Rhabdovirus, VSV. (Lawson et al., PNAS, USA, 92:4477-81, 1995).
In the present invention a number of recombinant Rhabdovirus vectors are generated and are used to express functional genes, including full-length HTV-l envelope proteins. From the recombinant Rhabdovirus vectors of the invention all the dominant epitopes for neutralizing antibodies, cytotoxic T-lymphocytes (CTL), and antibody-dependent cell cytotoxicity are expressed at one time. The construction of different recombinant Rhabdovirus vectors expressing HTV or STV or other viral genes is described in the following paragraphs.
Recombinant Rhabdovirus expression vectors
Several different recombinant Rhabdovirus-based and replication-competent expression vectors that express heterologous genes or gene sequences are constructed. In one aspect of the invention an expression vector with its own glycoprotein is constructed. The genome of this recombinant expression vector can be represented as: 3 -N-P-M-G-X-L-5' where X=foreign gene (e.g. HIV-1 gpl60, HIV-1 gag, or any other HTV-l gene; any SIV , HTV-2, Hepatitis C gene, or any other viral antigen) (see Fig. 1). X can be cloned at different genome sites to regulate expression levels. In another aspect of the invention an expression vector with a glycoprotein from another virus or another viral serotype is constructed (see Fig. 7 as an example for the RV vector with VSV glycoprotein). This vector is used as boost virus to induce a stronger immune response. The genome of this recombinant expression vector is represented as: 3'-N-P-M-G (from another virus or viral serotype)-X-L-5' (for example, 3 -N-P-M-G from VSV serotype Indiana)-X-L-57) where X=foreign gene specific (e.g. HIV-1 gpl60, HIV-1 gag, or any other HIV-1 gene; any SIV or HTV-2 gene or any other viral antigen). X can be cloned at different genome sites to regulate expression levels. The present invention relates to constructs of recombinant RVs (rabies viruses) expressing HTV-l gpl60, where the RV glycoprotein (G) is replaced with that of a chimeric vesicular stomatitis virus (VSV) G /RV-cytoplasmic domain (serotype Indiana or New Jersey). Of note, this method is not restricted to VSV glycoprotein. Because Rhabdoviruses have only a single surface protein on their virions, chimeric RV/VSV viruses are not neutralized by the humoral response against the RV G and therefore allow a second productive infection. The use of a recombinant chimeric RV/VSV can be used to display the properly folded HIV-1 envelope protein on the surface of the infected cell. In addition, repeated expression of the RV nucleoprotein, which was previously shown to be an exogenous superantigen (Lafon, et al., Nature, 358, 507-10, 1992; Lafon, M. Research in Immunology, 144:209-13, 1993), might help to enhance the immune response against the HTV-l envelope. In case of Rabies Virus (RV) the cytoplasmic domain of the RV glycoprotein is fused to the foreign glycoproteins.
It should be noted that all genes within the recombinant genome can be rearranged to attenuate the virus or to enhance transcription of the foreign gene.
For example, a recombinant RV with rearranged genome, VSV glycoprotein, and HTV-l gpl60 (X) can be constructed to have: 3'-X-N-P-G(VSV serotype NJ)-M-L-5'.
In still another aspect of the invention a recombinant expression vector (either RVs or VSVs) having a foreign glycoprotein instead of their own is constructed for entry into specific host cells, i.e., to mimic the tropism of another virus (e.g., HIV-1, Hepatitis C) in order to induce a stronger immune response (Fig. 8). This construct can be represented as 3 -N-P-M-HTV-l-gpi60-L. Alternatively these constructs can have, in addition, their own glycoproteins (e.g., 3'-N-P-M-HTV-l-gpl60-G-L). Again, it should be noted that all genes within the recombinant genome can be rearranged to attenuate the virus or to enhance transcription of the foreign gene. Transgenic mice expressing human CD4 and CXCR4 are generated to analyze the in vivo induction of an immune response of the G-related RVs expressing HTV-l gpl60/RVG.
In still another aspect of the invention a recombinant expression vector (either RV or VSV) having a multiple antigens and multiple transcription stop/start signals is constructed. This construct is represented as 3 -N-P-M-G-X-Y-L-5' where X and Y are heterologous genes. For example, X can be HTV-l gpl60 and Y can be HIV-1 gag. An alternative construct can be 3 -N-Z-P-M-G-X-Y-L-5' where, for example, X can be HIV-1 gpl60, Y can be HTV-l gag and Z can be HTV-l tat.
An HIV-1 virus vaccine
In a preferred embodiment, an immunodeficiency virus vaccine based on recombinant rabies virus vectors is described. Rabies virus (RV) is a negative- stranded RNA virus of the Rhabdovirus family and it possesses a relatively simple, modular genome organization coding for five structural proteins (supra and Conzelmann, et al., Virology, 175:485-99, 1990). The present invention relates to an RV vaccine strain-based vector, which is non-pathogenic for a wide range of animal species when administrated orally or intramuscularly. This vector shows advantages over other viral vectors, for several reasons. First, its modular genome organization makes genetic modification easier than for the majority of more complex genomes of DNA and plus-stranded RNA viruses. Second, Rhabdoviruses have a cytoplasmic replication cycle and there is no evidence for recombination and/or integration into the host cell genome. (Rose, et al., Rhabdovirus genomes and their products, Plenum Publishing Corp., New York, 1997). In contrast to most other viral vectors only a
negligible seropositivity exists in the human population to RV and immunization with a RV-based vector against HTV-l will not interfere with immunity against the vector itself. In addition, RV grows to high titers 10 foci forming units (FFU) in various cell-lines without killing the cells, which probably results in longer expression of HTV-l genes compared to a cytopathogenic vector.
Generation of recombinant vectors
The following different recombinant rabies virus vectors are constructed. A new infectious Rabies Virus (RV) vector with a deletion of the ψ-gene (a ~ 400 bases long non-coding sequence fused to the G RNA) and new transcription unit containing a short transcription Stop/Start signal (to express foreign genes) and two single sites (BsiWI and Nhel) to introduce foreign genes is constructed. This vector also contains a Smal site upstream of the RV glycoprotein, which is used to delete the RV glycoprotein gene (G). The vector is called RV-SBN. RVs expressing HTV-lgp-160 ecto- and transmembrane domain fused to the RV G cytoplasmic domain (HIV- Igpl60-RVG) are also constructed. The chimeric gpl60/RVG protein is expressed by RV and incorporated into RV virions. A recombinant virus displaying a foreign envelope protein on its surface will induce a strong immune response against this antigen. Another RV vector is also generated which is identical to RV-SBN but has, in addition, a single Pad site downstream of RV G protein. This vector is used to functionally replace RV G with VSV G or other viral glycoproteins. This vector is called RV-SPBN and is used as a boost vaccine vector or a boost virus.
As shown in Fig. 7, a recombinant rabies virus based expression vector with foreign viral glycoproteins is constructed and the recombinant virus is recovered. For this construct a Smal restriction enzyme site is introduced downstream of the M/G transcription Stop/Start sequence and a Pad site upstream of the synthetic transcription Stop/Start sequence, which is used to express foreign genes from the RV vector. These two sites (Smal/Pac) can be used to replace the RV glycoprotein with that from other viruses. In Fig. 7 a chimeric VSV/RV glycoprotein (VSV ectodomain and transmembrane domain, RV cytoplasmic domain), in combination with HTV-l is shown as an example. However, it should be noted that this method can be applied to every glycoprotein and foreign antigen in different Rhabdoviruses, as shown in the
same figure (glycoprotein X, foreign protein Y).
In another experiment, recombinant RVs expressing chimeric gpl60/RV G without expressing RV G (G-deleted RVs) are generated. These G-deleted RVs have a different tropism as compared to wild-type RV (which infects most cells) and specifically infect only cells expressing HIV-1 receptor human CD4 and one of the
HIV-1 coreceptors (eg, CXCR4 or CCR5).
Both the full-length and RV-glycoprotein deleted recombinant rabies RVs are constructed and recovered (Fig. 8). The Smal and BsiWI restriction enzyme sites are used to delete RV glycoprotein and fuse the M/G transcription Stop/Start sequence to the HTV-l/RV chimeric glycoprotein (HIV-1 gρl60 ectodomain and transmembrane domain, RV cytoplasmic domain). The recovered RV-vector is, analogous to the HTV-l virus, specific for cells expressing human CD4 and the appropriate HIV-1 co- receptor. It should be noted that this method can be applied to every glycoprotein which supports infection of certain cell types by rhabdoviruses. It can also be used to express additional foreign antigens (HTV-l Gag, HIV protease, SIV proteins , Hepatitis A, B or C proteins, and other viral and non-viral proteins).
In still another aspect of the invention a recombinant replication-competent rabies virus expression vector having all of the above combinations can be constructed. For example, a recombinant rabies virus vector having other glycoproteins (especially to construct boost viruses) without or with their own G, having genome rearrangements, and expressing multiple viral antigens from the same or different viruses (e.g. HTV-l gpl60 and Hepatitis B).
Products, methods and compositions There are provided by the invention, products, compositions and methods for assessing treating viral diseases, particularly HTV (AIDS) and administering a recombinant Rhadovirus of the invention to an organism to raise an immunological response against invading viruses, especially against immunodeficiency virus infections.
Methods for induction of an immune response
Another aspect of the invention relates to a method for inducing an immunological response in an individual, particularly a mammal, which involves
inoculating the individual with a recombinant virus of the invention followed by the appropriate recombinant protein boost, adequate to produce antibody and/ or T cell immune response to protect the individual from infection, particularly immunodeficiency infection and most particularly HIV-1 and 2 infections. Also provided are methods whereby such immunological response slows the HIV replication.
Yet another aspect of the invention relates to a method of inducing immunological responses in an individual which comprises delivering to such individual a nucleic acid vector, sequence or ribozyme to direct the expression of HIV envelope polypeptides, or a fragment or a variant thereof, for expressing the HTV envelope polypeptide, or a fragment or a variant thereof, in vivo in order to induce an immunological response, such as, to produce antibody and/ or T cell immune response. Antibody and/or T cell responses include, for example, cytokine-producing T cells or cytotoxic T cells, to protect the individual, preferably a human, from the viral disease, whether that disease is already established within the individual or not. One example of administering the gene is by accelerating it into the desired cells as a coating on particles or otherwise. Such nucleic acid vector may comprise DNA, RNA, a ribozyme, a modified nucleic acid, a DNA/RNA hybrid, a DNA-protein complex or an RNA-protein complex.
Compositions that induce an immunological response
A further aspect of the invention relates to an immunological composition that when introduced into an individual, preferably a human, capable of having induced within it an immunological response. The immunological response that is induced is to a polynucleotide and/or polypeptide encoded therefrom, wherein the composition comprises a recombinant Rhabdoviruses of the invention which encodes and expresses an antigen of an exogeneous viral protein, such as HIV envelope protein or polypeptide. Specifically, the exogeneous polypeptides include antigenic or immunologic polypeptides. The immunological response is used therapeutically or prophylactically and takes the form of antibody immunity and/or cellular immunity, such as cellular immunity arising from CTL or CD4+ T cells.
In a further aspect of the invention there are provided compositions comprising a Rhabdovirus vector of the present invention for administration to a cell or to
a multicellular organism.
Pharmaceutical compositions
The Rhabdovirus vectors of the invention may be employed in combination with a non-sterile or sterile carrier or carriers for use with cells, tissues or organisms, such as a pharmaceutical carrier suitable for administration to an individual. Such compositions comprise, for instance, a media additive or a therapeutically effective amount of a recombinant virus of the invention and a pharmaceutically acceptable carrier or excipient. Such carriers may include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol and combinations thereof. The formulation should suit the mode of administration. The invention further relates to diagnostic and pharmaceutical packs and kits comprising one or more containers filled with one or more of the ingredients of the aforementioned compositions of the invention.
The recombinant vectors of the invention may be employed alone or in conjunction with other compounds, such as therapeutic compounds.
Methods of administration
The pharmaceutical compositions may be administered in any effective, convenient manner including, for instance, administration by intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal routes among others. In therapy or as a prophylactic, the active agent may be administered to an individual as an injectable composition, for example as a sterile aqueous dispersion, preferably isotonic. The pharmaceutical compositions of the invention are preferably administered by injection to achieve a systematic effect against relevant viral pathogens.
For administration to mammals, and particularly humans, it is expected that the daily dosage level of the active composition of the invention will be from 10~FFU to 108 FFU of virus in the composition or 10 μg/kg tolO mg/kg of body weight of recombinant protein. The physician in any event will determine the actual dosage and duration of treatment which will be most suitable for an individual and can vary with the age, weight and response of the particular individual. The above dosages are exemplary of the average case. There can, of course, be individual instances
where higher or lower dosage ranges are merited, and such are within the scope of this invention.
A vaccine composition is conveniently in injectable form. Conventional adjuvants may be employed to enhance the immune response. A suitable unit dose for vaccination is preferably administered daily and with or without an interval of at least lweek. With the indicated dose range, no adverse toxicological effects are observed with the compounds of the invention which would preclude their administration to suitable individuals.
Recombinant RV vectors expressing an HIV-1 envelope protein In a preferred emodiment recombinant RVs expressing FfTV-1 envelope protein is explained. To generate RV recombinant viruses expressing HIV-1 gpl60, a new vector is constructed based on the previously described infectious RV cDNA clone pSAD-L16. (Schnell, et al., EMBO Journal, 13:4195-4203, 1994). Using site directed mutagenesis and a PCR strategy, the Ψ gene is deleted from the RV genome and a new transcription unit, containing a RV Stop/Start signal and two single sites (BsiWI and Nhel), is introduced into the RV genome (see also Generation of recombinant vectors, supra). The resulting plasmid is designated pSBN (Fig. 1). The SBN RV-vector is recovered by the reported methods and displayed the same growth characteristics and similar viral titers as SAD-L16, indicating that neither the deletion of the Ψ gene nor the new transcription unit affected the RV vector (deleted). The HTV-l envelope genes (NL4-3 and 89.6) to be expressed from SBN are generated by PCR and cloned between the BsiWI and Nhel sites, resulting in the plasmids pSBN- NL4-3 and pSBN-89.6 (Fig.l). All constructs are checked via DNA sequencing. It should be noted that foreign genes up to at least 4kb are stable within the RV genome and a full length HTV-l envelope protein is expressed from the recombinant RVs.
Recombinant RVs expressing either HIV-INI -3 or TπV-l89.6 envelope proteins are recovered by transfection of cells stably expressing the T7-RNA-polymerase with plasmids encoding the RV N, P, and L proteins along with a plasmid coding for the respective RV full-length anti-genomic RNA. Three days after transfection, supernatants of transfected cells are transferred to fresh cells and three days
later analyzed by indirect immunofluorescence microscopy for expression of HIV-1 gpl60. A positive signal for gpl60 in cells infected with recombinant SBN-NL4-3 and SBN-89.6 confirmed the successful recovery of recombinant RVs expressing HTV-l envelope protein. The recombinant RVs expressing HTV-l gag are also constructed and recovered with the same procedure used for the recombinant RVs expressing HTV-l envelope protein.
Growth characteristics of recombinant RVs
Growth characteristics of recombinant RVs expressing HIV-1 envelope protein are examined. A three-fold lower liter for SBN-NL4-3 and a 10-fold tiler reduction for SBN-89.6 is noticed, as compared to wild-type SBN. To examine the differences in virus replication in detail, a one-step growth curve of the recombinant RVs is performed. BSR cells are infected with a MOI of ten to allow synchronous infection of all cells. After replacing the virus inoculum with fresh medium, viral titers are determined at the indicated time-points (Fig. 2). Both recombinant RVs expressing HTV-l gpl60 replicated at only a slightly reduced rate compared to wild- type RV, with the final titers being 2.3- (SBN-NL4-3) or 8-fold (SBN-89.6) reduced. The 20% longer genome size of the recombinant RVs cannot explain the slower growth of these viruses. A recombinant RV expressing a 1.9 kb gene (firefly luciferase) grew to wild-type RV titers. (Mebatsion, et al, Proceedings of the National Academy of Sciences of the United States of America, 93:7310-4, 1996).
Expression of foreign glycoprotein by recombinant RVs
Expression of HIV-1 gpl60 by recombinant RVs is also examined. To ensure the expression of HTV-l gpl60 by the recombinant viruses, cell lysates from recombinant RV infected cells are analyzed by Western immunoblotting with an antibody directed against RV (Fig. 3, -rabies) or HTV-l gpl20 (Fig. 3, α-gpl20). Two bands of the expected size for HTV-l gpl60 and gpl20 are detected in lysates from cells infected with SBN-89.6 or SBN-NL4-3 (lanes 3 and 4), but are not observed in cell lysates of mock-infected or SBN infected cells (lanes 1 and 2). The Western blot probed with an αRV antibody confirmed that all viruses (lanes 2, 3, and 4) infected the target cells.
Envelope proteins expressed in recombinant RVs are functional To determine whether the expressed HTV-l envelope protein is functionally expressed from RV, the recombinant RVs are analyzed in a fusion assay in a human T cell-line (Sup-Tl). This experiment confirmed that wild-type RV is able to infect and replicate in human T cell-lines. Because wild-type RV infects cells by receptor- mediated endocytosis, the RV glycoprotein (G) can only cause fusion of infected cells at a low pH. (Whitt, et al., Virology, 185:681-8, 1991). In contrast to wild-lype RV, large syncytium-formation is detected in Sup-Tl cells 24 hours after infection with SBN-89.6 or SBN-NL4-3 (Fig. 4). These results indicate that the expressed HTV-l envelope proteins are properly folded, transported to the cell surface, * and are recognized by the HTV-l receptor and coreceptor, CD4 and CXCR4.
Envelope protein from the dual-tropic HIV-1 strain (89.6) will induce cell fusion if coexpressed with CD4 and CCR5, whereas NL4-3 gpl60 will only induce fusion on cells expressing CD4 and the HTV-l coreceptor CXCR4. Infection of 3T3 murine cells expressing human CD4 does not result in cell fusion regardless of the recombinant RV used, whereas syncytium-formation is detected in 3T3 cells expressing CD4 and CXCR4 after infection with SBN-NL4-3 or SBN-89.6. As expected, only expression of HTV-189.6 envelope protein in 3T3 cells, expressing CD4 and CCR5, caused fusion of these cells.
Induction of a humoral immune response in mice
Anti-gpl20 antibody response in mice infected with RV expressing HIV-1 gpl60 is also analyzed. One likely requirement for a successful HIV-1 vaccine is the ability to induce a strong humoral response against the HIV-1 protein gpl60. To determine whether the recombinant gplδO proteins expressed by recombinant RV are able to induce an anti-HTV-1 immune response, groups of five BALB/c mice are inoculated subcutaneously in both rear footpads with 106 FFU of SBN, SBN-89.6, or 105 FFU SBN-NL4-3. Mice are bled 11, 24, and 90 days after the initial infection with RV and the sera are analyzed by ELISA. No response to the HTV-l envelope is detected in the sera of immunized animals, but an ELISA using RV glycoprotein, instead of HTV-l gpl20, as an antigen confirmed the RV infection and detected high level of antibodies against RV as early as 11 days after infection. Several studies on viral vectors expressing HIV-1 gpl60
indicated that a booster infection or a boost with a recombinant protein is necessary "to induce detectable serum antibody response against HIV-1 envelope protein. The high antibody titer detected in the RV ELISA indicated that an additional infection with the recombinant RV would not be promising, therefore 3 out of 5 mice from every group were boosted with lOμg of recombinant gρl20 and gp41 in complete Freund adjuvant. Twelve days after the subunit boost, the mice are bled and the immune response is analyzed by an HTV-l gpl20 ELISA. The results demonstrate that an HTV-envelope subunit boost elicits a strong immune response against HTV-l gpl20 only in mice previously infected with SBN-89.6 or SBN-NL4-3 (Fig. 5). Wild-type RV (SBN) infected mice reacted only in the lowest serum dilution (1:160) after the boost. An ELISA specific for HIV-1 gp41 is negative for all mouse sera, even after the boost with recombinant HIV-1 gpl20/gp41. These data are confirmed by Western blot analysis (Fig. 6). Only sera from mice infected with SBN-89.6 or SBN-NL4-3 and subsequently boosted with recombinant protein are able to react with gpl20, whereas all other sera failed to detect any HTV-l protein. None of the sera had gp41-specific bands, even with a gp41 subunit immunization.
Induction of neutralizing antibodies
An experiment is also earned out to see whether primary virus infection followed by recombinant protein boost induces neutralizing antibodies against HIV-1. In this experiment, HTV-l neutralizing antibody (NA) titers are determined in MT-2 cells by a vital dye staining assay using HTV-INL^. The mouse serum is able to neutralize a tissue culture laboratory adapted (TCLA) HTV-1NL4.-3 strain at a 1:800 serum dilution after immunization with SBN-NL4-3 and an envelope subunit booster injection of recombinant gpl20 (ITD3 strain), whereas immunization with SBN-NL4-3 did not induce detectable neutralizing antibody, These results are confirmed in two independent experiments. The sera from wild-type RV (SBN) infected mice which received a recombinant gρl20 boost displayed only a very low NA titer of 1:50 (Table 1). These results indicate that a boost injection with recombinant gpl20 following the priming with recombinant RV expressing HTV-l gpl60 elicits high titers of NA.
Table 1. Neutralizing antibody totres of sera from mice infected with different RVs followed by boost injection of recombinant HIV-1 gpl20/gp41.
The results presented herein demonstrate that a recombinant RV expressing a full-length HTV-l envelope protein is generated. The foreign gene is stably expressed by replication competent RV and induces a strong humoral response in mice against HTV-l envelope protein after infection with recombinant RV and a single subsequent boost of HTV-l gpl20 protein. Infection of mice with recombinant RV expressing HTV-l gpl60 results in a strong priming of the immune system, as indicated by vigorous humoral responses after a single boost with HIV-1 gpl20 protein or gρ41. Thus, boosting with another recombinant RV using a different viral glycoprotein for infection of the mice, or recombinant VSV expressing HIV-1 gpl60 can be tested for an even stronger response.
Induction of long-lasting HIV-1 gp 160 -specific CTL. Recombinant RV expressing HIV-1 envelope protein from a laboratory- adapted HTV-l strain (NL4-3) and a primary HIV-1 isolate (89.6) show that RV-based vectors are excellent for B cell priming (supra). (Schnell, M. J., et al., Proc. Natl. Acad. Sci. USA, 97:3544-3549, 2000.). The present invention further relates to the memory CTL response against HTV-l envelope protein expressed by the
attenuated RV-based vectors. As noted, increasing evidence suggests that the induction of a vigorous, long-lasting CTL response is an important feature for a successful HTV-l vaccine.
To analyze the potency of RV-based vectors to induce a cytotoxic response against HTV-l, six mice were immunized with 2 x 107 foci forming units (FFU) of the recombinant RV expressing HIV- 1,^. envelope protein (SBN-NL4-3) (supra and infra). Three mice are sacrificed 105 or 135 days after infection and the spleens are removed. One third of the splenocyte cultures are infected with a multiplicity of infection (moi) of 1 with a recombinant vaccinia virus expressing TπV-lNM 3 gpl60 for 16 hours, deactivated using Psoralen and UV treatment, and added back to the culture as presenter cells. Stimulated effector cells are analyzed 7 days after activation for their ability to kill P815 target cells infected with vaccinia wild-type virus, a recombinant vaccinia virus expressing HTV-l NL43 gpl60 or HIV-1 Gag. As can be observed in Figure 9, a strong cytotoxic response is detected only against P815 target cells infected with the recombinant vaccinia virus expressing HIV-1 envelope protein. Only a low percentage of lysis is observed for P815 cells infected with the other two vaccinia viruses. Of note, these responses are achieved after a single inoculation with recombinant RV expressing HIV-1 envelope protein, which indicates that RV-based vectors are able to induce long-lasting CTLs after a single vaccination.
CTLs from HIV-1 gplόO immunized mice cross-kill target cells expressing a heterologous HIV-1 envelope protein
There is a significant difference in HTV-l envelope amino acid sequences but cross-protection between divergent viruses will be a likely requirement for a protective HTV-l vaccine. To analyze the potency of the vaccine candidate to induce cross-reactive CTLs against gpl60 from different HTV-l strains, splenocytes from mice immunized with a recombinant RV expressing HIV-1 gpl60 are screened against P815 target cells expressing homologous and heterologous HTV-l envelope proteins. For this approach, two groups of six mice are immunized intraperitoneally (i.p) either with 2 x 107 recombinant RV expressing HTV-l gρl60 from a laboratory- adapted, CXCR4-tropic (NL4-3) or a dual-tropic (CXCR4 and CCR5) isolate (89.6).
Three and five weeks after the immunization, three mice from each group are sacrificed, the spleens are removed, and the pooled splenocytes are stimulated
with a recombinant vaccinia virus expressing the homologous HIV-1 envelope protein (NL4-3 or 89.6). Seven days after the stimulation, effector cells are analyzed for their ability to lyse P815 cells infected with recombinant vaccinia viruses expressing HTV-l envelope protein from the laboratory- adapted, CXCR4-trapic HTV-l strain (NL4-3), the dual-tropic strain (89.6), and two primary, CCR5-tropic HTV-l strains (Ba-L and JR-FL). The results from two different, independent experiments are shown in Figure 10A for mice immunized with a RV expressing HTV-l NM-3 Env and in Figure 10B for mice immunized with RV expressing HTV-l89.6 Env. As expected, a strong, specific lysis of P815 cells expressing the homologous antigen is observed for both groups. More strildng, these effector cells are able to cross-kill P815 target cells expressing heterologous HIV-1 envelope proteins. Activated splenocytes from SBN- NL4-3 immunized mice achieved a specific lysis of P815 cells expressing gpl60 JR- FL or 89.6 in the 40% range at an effector: target (E:T) ratio of 50:1 and are also able to cross-kiH target cells expressing HTV-lB - gpl60. Cross-killing is also observed with effector cells from SBN-89.6 primed mice. P815 target cells are lysed in the same range as observed for activated splenocytes from mice immunized with SBN- NL4-3, but lysed only about 20% P815 cells expressing HTV-l NL4-3. These data indicate that CTLs against HTV-l gpl60 induced by RV-based vectors may be directed against different epitopes within the HIV-1 envelope protein.
HIV-1 -specific CTL activity is mediated by CD8+ T-cells
The phenotype of the T-cell subpopulation mediating cytolytic activity is assessed by selective depletion. Three mice are immunized with 2 x 107 FFU of recombinant RV expressing HTV-1NL4-3 envelope protein, eighteen weeks later the spleens are removed. Splenocytes are re-stimulated with a recombinant vaccinia virus expressing the homologous HTV-l envelope protein for 7 days. Immuno-magnetic bead cell separation is completed to both deplete and positively isolate CD8+ T-cells from the activated splenocyte culture. Chromium release assays are completed using cultures depleted of CD8+ T-cells (CDS'), cultures of isolated CD8 cells (CD8+) or unprocessed cultures (CD8+/CD8").
P815 target cells are infected with vaccinia virus expressing HTV-lNL _3 gpl60 or HIV-1 gag. As illustrated in Figure 11, the CD8+ T-cell depleted cultures show no activity while the CD8+ T-cell enriched and unprocessed cultures show high specific
lysis at E:T ratios of 25:1 and 12.5:1, respectively. Indeed, the CD8+ T-cell enriched population is also enriched in lytic units, as the CTL activity is still on a plateau at 12.5:1, in contrast to the unselected population. These data indicate that the cytolytic activity is mediated by the CD8+ T-cell sub-population. Furthermore, these results imply that in addition to antibodies, recombinant RV vectors also generate long-lived anti-HTV-l CD8+ T-cell responses.
Discussion
The present invention relates to RV-based vectors expressing HIV-1 envelope proteins. These vectors are able to induce a humoral response against HTV-l gpl60 after a single immunization followed by a boost injection with recombinant HTV-l gpl20. (Schnell, M. J., et al., Proc. Natl. Acad. Sci. USA, 97:3544-3549, 2000.). Expanding evidence suggests that CTL responses play a major role in the an ti -viral immune response against HTV-l. (Brander, C. and B. D. Walker, Current Opinion in Immunology, 11:451-9, 1999.). The development of an effective prophylactic HTV-l vaccine therefore requires the selection of HTV-l antigen(s) capable of inducing long- lasting and broadly reactive CTL responses. The present invention further relates to RV-based vectors to induce such responses.
In contrast to the observed humoral response, a single inoculation of mice with a recombinant RV expressing HTV-l envelope protein results in a vigorous CTL response against HTV-l Env. In addition, these responses are stable for at least 135 days after immunization. One explanation for these strong responses is that RV grows in various cell-lines without killing the cells, which results in longer expression of HTV-l genes compared to a cytopathogenic viral vector. In addition, the expression of the RV nucleoprotein, which was previously shown to be an exogenous superantigen (Lafon, M., Research in Immunology, 144:209-13, 1993; Lafon, M., et al, Nature, 358:507-10, 1992), might help to enhance a general immune response against the HTV-l envelope after a single immunization.
The recombinant RVs of the present invention are able to induce cross-reactive CTLs against a variety of different HTV-l envelope prote s. Previous studies showed that single amino acid exchanges can abrogate CTL cross-reactivity, whereas other examinations indicated that single or even double amino acid substitutions frequently did not abrogate cross-killing. (Cao, H., et al., J. Virol, 71:8615-23, 1997;
Johnson, R. P., et al., Journal of Experimental Medicine, 175:961-71, 1992; Johnson, R. P., et al., Journal of Immunology, 147:1512-21, 1991.). Therefore, the question remains if CTLs induced by recombinant RVs are directed against different epitopes. However, several studies indicating that CTLs from HIV-1 infected individuals show cross-reactivity even with different clades of HIV-1, indicating a broad cross- reactivity, is an important requirement for an HTV-l vaccine. ( Cao, H., et al., J. Virol, 71:8615-23, 1997; Rowland- Jones, S. L., et al., Journal of Clinical Investigation, 102:1758-65, 1998.). There is currently only one study showing cross- clade CTLs reactivities induced with a canarypox-based HTV-l vaccine in uninfected volunteers. (Feixari, G., et al., Proc. Natl. Acad. Sci. USA, 94:1396-401, 1997.). The inventors of the present invention are currently analyzing if CTLs against HIV-1 gpl60 induced by recombinant RV are also cross-reactive against HIV-1 envelope protein from clades other than B.
In summery, the present invention demonstrates the ability of the murine sera to neutralize HTV-l strain. Thus the present invention shows that recombinant RVs are excellent vectors for B cell priming. The present invention also shows that a single vaccination with recombinant RV expressing HIV-1 envelope protein elicits a strong, long-lasting CTL response specific against HIV-1 proteins, such as the envelope protein of different HIV-1 strains. These results further emphasize the use of RV as an HTV-l vaccine.
In contrast to most other viral vectors, only a negligible sero-positivity exists in the human population to RV and immunization with a RV-based vector against HIV-1 will not interfere with immunity against the vector itself. Because oral immunization against RV with a RV vaccine strain is successful and apathogenic in chimpanzees (Report of the forth WHO Consultion on oral immunization of dogs against rabies, unpublished document WHO/Rab.Res./93.42, 1993.), a RV-based vector will also be promising in inducing mucosal immunity against HIV-1. Therefore, the present invention fulfills a long felt, yet unfulfilled need, for a method of treating HTV-l infections. Using the recombinant RVs of the present invention, all of the dominant epitopes for neutralizing antibodies, cytotoxic lymphocytes, and antibody dependent cell cytotoxicity are expressed at one time, thereby eliciting both humoral and cell-mediated immunity against HTV-l.
Examples
The following examples further illustrate the present invention, but of course are not in any way limiting its scope. The examples below are earned out using standard techniques, that are well known and routine to those of skill in the art, except where otherwise described in detail. The examples are illustrative, but do not limit the invention. All animal methods of treatment or prevention described herein are preferably applied to mammals, most preferably to humans.
Example I : Plasmid construction. Shown in Fig. 1 is a schematic representation of a method for the construction of recombinant RV genomes. At the top, the wild-type RV genome with its five open reading frames is shown (SAD L16). Using a PCR strategy and site directed mutagenesis the entire Ψ gene is removed and a new minimal RV transcription unit containing two single sites is introduced between the G and L genes (SBN). The cDNA sequence encoding HTV-189.6 or HTV-lN 4.-3 gpl60 is inserted using the BsiWI and Nhel sites resulting in the plasmids, pSBN-89.6 or pSBN-NL4-3 (bottom).
Two single sites are introduced in the previously described RV cDNA pSAD L16 upstream of the G (Smal) and Ψ gene (Nhel) by site directed mutagenesis (GeneEditor™ Promega Inc.) using the primers RP11 5 - CCTCAAAAGACCCCGGGAAAGATGGTTCCTCAG-3' (SEQ TD NO: 1) and RP12 5 -GACTGTAAGGACYGGCTAGCCTTTCAACGATCCAAG-3' (SEQ TD NO: 2) resulting in the plasmid pSN. pSN is the target used to introduce a new transcription Stop/Start sequence, as well as a single BsiWI site using a polymerase chain reaction (PCR) strategy. First, two fragments are amplified by PCR from pSN using Vent polymerase (New England Biolabs Inc.) and the forward primers RPl 5 - TTTTGCTAGCTTATAAAGTGCTGGGTCATCTAAGC-3' (SEQ TD NO: 3) or RP10 5 -CACTACAAGTCAGTCGAGACTTGGAATGAGATC-3' (SEQ TD NO: 4). The reverse primers were RPl 8 5 -TCTCGAGTGTTCTCTCTCCAACAA-3' (SEQ TD NO: 5) and RP17 5'- AAGCΓAGCAAAACGΓACGGGAGGGGTGTTAGTTTTTTTCATGGACTTGGAT
CGTTGAAAGGACG-3' (SEQ ID NO: 6). RP17 contains a RV transcription
Stop/Start sequence (underlined) and a BsiWI and Nhel site (shown in italics). PCR products are digested with Nhel, li gated, and the 3.5 kb band eluted from an
agarose gel. After gel elution the band is digested with ClaT/MluI and ligated to the previously ClaT/MluI digested pSN. The plasmid is designated pSBN.
The HTV-l gρl60 genes, encoding the envelope protein of the HIV-1 strains 89.6 and NL4-3, are amplified by PCR using Vent polymerase, the forward primer 5 - GGGCΓGCAGCΓCGAGCGΓACGAAAATGAGAGTGAAGGAGATCAGG-3' (SEQ
ID NO: 7) containing Pstl/XhoT/BsiWI sites (italics), and the reverse primer 5 - CCΓCΓAGATTATAGCAAAGCCCTTTCCAAG-3' (SEQ ID NO: 8) containing a Xbal (italics) site. The PCR products are digested with Pstl and Xbal and cloned to pBluescript II SK + (Stratagene). After conformation of the sequence, the HIV-1 gpl60 genes are excised with BsiWI and Xbal and ligated to pSBN, which had been digested with BsiWI and Nhel. The resulting plasmids are entitled pSBN-89.6 and pSBN-NL4-3.
Example 2: Recovery of infectious RV from cDNA. For rescue experiments of the recombinant RVs, the previously described vaccinia virus-free RV recovery system is used (see Finke, et al., Journal of Virology, 73:3818-25, 1999). In brief, BSR-T7 cells, which stably express T7 RNA polymerase (a generous gift of Drs. S. Finke and K.-K. Conzelmann) are transfected with 5 μg of full-length RV cDNA in addition to plasmids coding for the RV N-, P-, and L-proteins (2.5 μg, 1.25 μg, and 1.25 μg) respectively, using a CajPO,, transfection kit (Stratagene) as indicated by the vendor. Three days after transfection, tissue culture supematants are transferred onto fresh BSR cells and infectious RV is detected three days later by immunostaining against RV the N protein (Centocor).
Example 3: One-Step Growth Curve
Shown in Fig. 2 is a graph showing One-step growth curves of recombinant RV BSR cells that are infected with the recombinant RVs (SBN, SBN-89.6, and SBN- NL4-3). The viral titers are determined in duplicate at the indicated time-points. BSR cells (a BHK-21 clone) are plated in 60 mm dishes and 16 hours later infected (7xl06 cells) with a multiplicity of infection (MOI) of 5 with SBN, SBN- 89.6, or SBN-NL4-3 in a total volume of 2 ml. After incubation at 37°C for 1 hour, inocula are removed and cells are washed four times with phosphate-buffered saline
(PBS) to remove any unabsorbed virus. Three milliliters of complete medium is
added back and 100 μl of tissue culture supematants are removed at 4,16, 24 and 48 hours after infection. Virus aliquots are titered in duplicate on BSR cells.
In Fig. 3 the Western blot analysis of recombinant RVs expressing HTV-l gpl60 is shown. Sup-Tl cells are infected with a MOI of 2 with SBN, SBN-89.6, or SBN-NL4-3 and lysed 24 h later. Proteins are separated by SDS-PAGE and analyzed by Western blotting. An antibody directed against gpl20 detected two bands at the expected size for HTV-l gpl60 and gpl20 in cell-lysates infected with SBN-89.6 or SBN-NL4-3 ( -gpl20, lanes 3 and 4). No signal is detected either in the mock or SBN infected cells (α-gpl20, lanes 1 and 2). Successful infection of the cells by the recombinant RVs is confirmed with a polyclonal antibody directed against RV (α- rabies, lanes 2, 3, and 4).
Shown in Fig. 4. are Sup-Tl cells which are infected using a MOI of 1 with SBN, SBN-89.6, or SBN-NL4-3. Twenty-four hours after infection, syncytia- formation is detected in cell cultures infected with recombinant RV expressing HTV-l gpl60 (panel SBN-89.6 and SBN-NL4-3), indicating expression of functional HIV-1 envelope protein. No cell fusion is detected in cultures infected with wild-type RV (panel SBN).
Example 4: Immunization. Groups of five 4-6 week old female BALB/c mice obtained from Jackson
Laboratories are inoculated subcutaneously in both rear footpads with 106 foci forming units (FFU) SBN, SBN-89.6, or 105 NL4-3 in DMEM + 10% FBS. Three out of five mice in each group are boost immunized intraperitonealy three months after infection with 10 μg recombinant gp41 (IITB, Intracel Inc.) and 10 μg recombinant gpl20 (DIB, Intracel Inc.) in 100 μl complete Freunds adjuvant.
Example 5: Enzyme-linked Immunosorbent Assay (ELISA ).
Recombinant HTV-l gpl20 (TUB strain, Intracel) is resuspended in coating buffer (50 mM Na2CO3, pH 9.6) at a concentration of 200 ng/ml and plated in 96 well ELISA MaxiSorp plates (Nunc) at 100 μl in each well. After overnight incubation al 4°C, plates are washed three times (PBS pH 7.4, 0.1% Tween-20), blocked with blocking buffer (PBS, pH 7.4, 5% dry milk powder) for 30 minutes at room temperature, and incubated with serial dilutions of sera for 1 hour. Plates are
washed three times followed by the addition of horseradish peroxidase-conjugated (HEP) goat anti-mouse-IgG (H+L) secondary antibody (1:5000, Jackson ImmunoResearch Laboratories). After a 30 minute incubation at 37°C, plates are washed three times and 200 μl OPD-substrate (o-phenylenediamine dihydrochloride, Sigma) is added to each well. The reaction is stopped by the addition of 50 μl of 3 M H2SO per well. Optical density is determined at 490 nm. Shown in Fig. 5 is a graph depicting ELISA reactivity of mouse sera against HIV-1 gpl20. Five mice each are immunized with recombinant RVs (SBN, SBN-89.6, or SBN-NL4-3) and 3 months after the initial infection three mice from each group are boosted with recombinant HTV-l gpl20 and gp41 (SBN*, SBN-89.6*, or SBN-NL4-3*). Each data point on the graph indicates the average of mice from each group in three independent experiments. One mouse of the SBN-89.6 group did not react to the boost injection and is not included in the graph. The error bars indicate the standard deviations.
Example 6: Western Blotting.
Human T-lymphocytic cells (Sup-Tl) cells are infected with a MOI of 2 for 24 hours and resuspended in'lysis buffer 50mM Tris, pH 7.4; 150 mM NaCl, 1% NP-40, 0.1% SDS, and lx protease inhibitor cocktail (Sigma) for 5 minutes. The protein suspension is transferred to a microfuge tube and spun for 1 minute at 10,000 x g to remove cell debris. Proteins are separated by 10% SDS-PAGE and transferred to a PVDF-Plus membrane (Osmonics). After blocking for 1 hour (5% dry milk powder in PBS pH 7.4), blots are incubated with sheep -gpl20 antibody (ARRRP) (1:1000) or human α-rabies sera (1:500) in blocking buffer for 1 hour. Secondary antibodies of goat α-human or donkey α- sheep horseradish peroxidase-conjugated (HRP) antibodies (1:5000) (Jackson ImmunoResearch Laboratories) are added and blots incubated for one hour. Each antibody incubation is followed by three washes with WB-wash buffer (PBS pH 7.4, 0.1% Tween-20). Chemiluminescence (NEN) is performed, as directed by the manufacturer.
Western blot analysis to detect anti-HTV-1 antibody is performed using a commercial Western Blot kit (QualiCode HTV- 1/2 Kit, Immunetics) according to the manufacturer's instructions, except for the mouse sera in which α-human IgG conjugate is substituted with a 1:5000 dilution of an alkaline phosphatase-conjugated goat anti-mouse IgG (H+L) (Jackson ImmunoResearch Laboratories). Shown
in Fig. 6 is the Western blot analysis of mice serum antibody response to HIV-1 antigens. Sera from one mouse of each group (SBN, SBN-89.6, or SBN-NL4-3), which are immunized by the RVs (α-SBN, α-SBN-89.6 or α-SBN-NL4-3), or immunized and boost injected with recombinant gpl20 and gp41 (α-SBN*, α-SBN- 89.6* or α-SBN-NL4-3*), are tested at 1:100 dilutions. A highly positive and weakly positive human control serum is used to detect the position of the HTV-l proteins. SC indicates the serum control.
Example 7: Virus Neutralization Assays. HTV-l strains are recovered on 293T cells and virus stocks are expanded on
MT-2 cells (HTV-l NL4-3), frozen at -75° C and titered on MT-2 cells. Neutralization assays are performed according to Montefiori et al., (Journal of Clinical Microbiology, 26, 231-5, 1998). Briefly, -5000 TCTD5o of HIV-1NL4.3 are incubated with serial dilutions of mouse sera for 1 hour. MT-2 cells are added and incubated at 37°C, 5% CO for 4-5 days. 100 μl of cells are transferred to a poly-L-lysine plate and stained with neutral red dye (Neutral Red, ICN) for 75 minutes. Cells are washed with PBS, lysed with acid alcohol and analyzed using a colorimeter at 550 nm. Protection is estimated to be at least 50% virus inhibition.
All publications and references, including but not limited to patent applications, cited in this specification, are herein incorporated by reference in their entirety as if each individiual publication or reference were specifically and individually indicated to be incorporated by reference herein as being fully set forth.
While this invention has been described with a reference to specific embodiments, it will be obvious to those of ordinary skill in the art that variations in these methods and compositions may be used and that it is intended that the invention may be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications encompassed within the spirit and scope of the invention as defined by the claims.
Example 8: Preparation of splenocytes
Spleens are aseptically removed and single cells suspensions are prepared. Red blood cells are lysed with ACK lysing buffer (BioWhitaker) and the remaining splenocytes are washed twice in RPMI- 10 media containing 10% fetal bovine
serum. Splenocytes are divided into effector and stimulator cells. Stimulator cells are prepared by infection with recombinant vaccinia virus (moi = 10) expressing an envelope protein from HIV-1 at a multiplicity of infection (moi) of 1 for two hours. Cells are washed with PBS once to remove excess virus and incubated for 16 hours at 37°C. After incubation, the vaccinia virus is inactivated using Psoralen (Sigma) (infra). Stimulator cells are added back to the effector cell population at a ratio of 3: 1 and 10% T-STIM (Collaborative Biomedical Products) is added as a source of interleukin-II (LL-2).
Inactivation of virus with Psoralen
Following incubation of splenocytes with the vaccinia virus, the virus is inactivated using psoralen (Sigma). Psoralen is added to cells to achieve a final concentration of 5 μg/ml. Following a ten minute incubation at 37°C the cells were treated with long-wave UV (365 nm) for 4 minutes and washed twice with PBS.
Preparation of chromium labeled target cells.
Target cells (P815) are prepared by infection with vaccinia virus expressing the HTV-l protein (see specific figure legend for specific protein) for one hour at a moi of 10, washed to remove excess virus, and incubated for 16 hours at 37°C. To measure background, target cells are infected with vaccinia virus expressing HIV-1 Gag (vP1287) or wild-type vaccinia (vP1170). Target cells are washed once in PBS, incubated with 100 μCi 51Cr for one hour to label the cells, washed two times in PBS and added to effector cells at various E:T ratios (see figures) for four hours at 37°C. The percent specific 5lCr release is calculated as 100 x (experimental release - spontaneous release)/(maximum release - spontaneous release). Maximum release was determined from supematants of cells that were lysed by the addition of 5% Triton X-100. Spontaneous release was determined from target cells incubated without added effector cells.
Preparation of CD8+ depleted T cells.
Seven days post in-vitro stimulation, CD8+ T-cells are depleted from the cell culture (CD8") and enriched (CD8+) using Dynabeads Mouse CD8 (Lyt2), as described by the manufacturer.
Claims
1. A method of treating a mammal infected with an immunodeficiency virus, comprising: a) administering to said mammal a non-segmented negative- stranded RNA virus that expresses a functional immunodeficiency virus envelope protein, or subunit thereof; b) expressing said functional immunodeficiency virus envelope protein, or subunit thereof; c) boosting said mammal by delivering an effective dose of an isolated immunodeficiency virus envelope protein, or a subunit thereof, in an adjuvant or by delivering an effective dose of a boost vaccine vector; and d) inducing a neutralizing antibody response and/or long lasting cellular immune response to said functional immunodeficiency virus envelope protein, or subunit thereof.
2. The method of Claim 1, wherein said immunodeficiency virus is any HIV-1 virus.
3. The method of Claim 1, wherein said non-segmented negative-stranded RNA virus is a Rhabdovirus.
4. The method of Claim 1, further comprising an induction of mucosal immunity to said functional immunodeficiency virus envelope protein, or subunit thereof.
5. The method of Claim 1, wherein said long-lasting cellular response further comprises a cross-reactive CTL response wherein said cross-reactive CTLs are directed against envelope proteins, or subunits thereof, from different immunodeficiency virus strains.
6. A method of protecting a mammal from an immunodeficiency virus infection, comprising: a) administering to said mammal a non-segmented negative-stranded RNA virus that expresses a functional immunodeficiency virus envelope protein, or subunit thereof; b) expressing said functional immunodeficiency virus envelope protein, or subunit thereof; c) boosting said mammal by delivering an effective dose of an isolated immunodeficiency virus envelope protein, or a subunit thereof, in an adjuvant or by delivering an effective dose of a boost vaccine vector; and d) inducing a neutralizing antibody response and/or long lasting cellular immune response to said functional immunodeficiency virus envelope protein, or subunit thereof.
7. The method of Claim 6, wherein said immunodeficiency virus is any HIV-
1 virus.
8. The method of Claim 6, wherein said non-segmented negative-stranded RNA virus is a Rhabdovirus.
9. The method of Claim 6, further comprising an induction of mucosal immunity to said functional immunodeficiency virus envelope protein, or subunit thereof.
10. The method of Claim 6, wherein said long-lasting cellular response further comprises a cross-reactive CTL response wherein said cross-reactive CTLs are directed against envelope proteins, or subunits thereof, from different immunodeficiency virus strains.
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US76131201A | 2001-01-17 | 2001-01-17 | |
US09/761,312 | 2001-01-17 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2002098457A2 true WO2002098457A2 (en) | 2002-12-12 |
WO2002098457A3 WO2002098457A3 (en) | 2003-04-24 |
Family
ID=25061854
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US2002/000295 WO2002098457A2 (en) | 2001-01-17 | 2002-01-08 | Recombinant rhabdoviruses as live-viral vaccines for immunodeficiency viruses |
Country Status (1)
Country | Link |
---|---|
WO (1) | WO2002098457A2 (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US8486420B2 (en) | 2005-02-15 | 2013-07-16 | The University Of North Carolina At Chapel Hill | Live virus vaccines |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0440219A1 (en) * | 1990-02-02 | 1991-08-07 | SCHWEIZERISCHES SERUM- & IMPFINSTITUT BERN | cDNA corresponding to the genome of negative-strand RNA viruses, and process for the production of infectious negative-strand RNA viruses |
US5166057A (en) * | 1989-08-28 | 1992-11-24 | The Mount Sinai School Of Medicine Of The City University Of New York | Recombinant negative strand rna virus expression-systems |
WO1994008022A1 (en) * | 1992-09-28 | 1994-04-14 | Commonwealth Scientific And Industrial Research Organisation | Vector to deliver and express foreign gene |
EP0702085A1 (en) * | 1994-07-18 | 1996-03-20 | Akzo Nobel N.V. | Recombinant infectious non-segmented negative strand RNA virus |
-
2002
- 2002-01-08 WO PCT/US2002/000295 patent/WO2002098457A2/en not_active Application Discontinuation
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5166057A (en) * | 1989-08-28 | 1992-11-24 | The Mount Sinai School Of Medicine Of The City University Of New York | Recombinant negative strand rna virus expression-systems |
EP0440219A1 (en) * | 1990-02-02 | 1991-08-07 | SCHWEIZERISCHES SERUM- & IMPFINSTITUT BERN | cDNA corresponding to the genome of negative-strand RNA viruses, and process for the production of infectious negative-strand RNA viruses |
WO1994008022A1 (en) * | 1992-09-28 | 1994-04-14 | Commonwealth Scientific And Industrial Research Organisation | Vector to deliver and express foreign gene |
EP0702085A1 (en) * | 1994-07-18 | 1996-03-20 | Akzo Nobel N.V. | Recombinant infectious non-segmented negative strand RNA virus |
Non-Patent Citations (6)
Title |
---|
CONZELMANN K K: "NONSEGMENTED NEGATIVE-STRAND RNA VIRUSES: GENETICS AND MANIPULATION OF VIRAL GENOMES" ANNUAL REVIEW OF GENETICS, ANNUAL REVIEWS INC., PALO ALTO, CA, US, vol. 32, no. 32, 1998, pages 123-162, XP008005872 ISSN: 0066-4197 * |
CONZELMANN K-K ET AL: "RESCUE OF SYNTHETIC GENOMIC RNA ANALOGS OF RABIES VIRUS BY PLASMID-ENCODED PROTEINS" JOURNAL OF VIROLOGY, THE AMERICAN SOCIETY FOR MICROBIOLOGY, US, vol. 68, no. 2, February 1994 (1994-02), pages 713-719, XP001034147 ISSN: 0022-538X * |
CONZELMANN K-K: "GENETIC MANIPULATION OF NON-SEGMENTED NEGATIVE-STRAND RNA VIRUSES" JOURNAL OF GENERAL VIROLOGY, SOCIETY FOR GENERAL MICROBIOLOGY, READING, GB, vol. 77, 1996, pages 381-389, XP002911692 ISSN: 0022-1317 * |
LUYTJES W ET AL: "AMPLIFICATION, EXPRESSION, AND PACKAGING OF A FOREIGN GENE BY INFLUENZA VIRUS" CELL, CELL PRESS, CAMBRIDGE, NA, US, vol. 59, no. 6, 22 December 1989 (1989-12-22), pages 1107-1113, XP000083570 ISSN: 0092-8674 * |
PATTNAIK A K ET AL: "REPLICATION AND AMPLIFICATION OF DEFECTIVE INTERFERING PARTICLE RNAS OF VESICULAR STOMATITIS VIRUS IN CELLS EXPRESSING VIRAL PROTEINS FROM VECTORS CONTAINING CLONED CDNAS" JOURNAL OF VIROLOGY, THE AMERICAN SOCIETY FOR MICROBIOLOGY, US, vol. 64, no. 6, June 1990 (1990-06), pages 2948-2957, XP001069625 ISSN: 0022-538X * |
SCHNELL M J ET AL: "INFECTIOUS RABIES VIRUSES FROM CLONED CDNA" EMBO JOURNAL, OXFORD UNIVERSITY PRESS, SURREY, GB, vol. 13, no. 18, 1 September 1994 (1994-09-01), pages 4195-4203, XP000612065 ISSN: 0261-4189 * |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US8486420B2 (en) | 2005-02-15 | 2013-07-16 | The University Of North Carolina At Chapel Hill | Live virus vaccines |
Also Published As
Publication number | Publication date |
---|---|
WO2002098457A3 (en) | 2003-04-24 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US10946090B2 (en) | Consensus/ancestral immunogens | |
Mossman et al. | Protection against lethal simian immunodeficiency virus SIVsmmPBj14 disease by a recombinant Semliki Forest virus gp160 vaccine and by a gp120 subunit vaccine | |
US5714374A (en) | Chimeric rhinoviruses | |
Girard et al. | Vaccine-induced protection of chimpanzees against infection by a heterologous human immunodeficiency virus type 1 | |
Giavedoni et al. | Immune response of rhesus macaques to recombinant simian immunodeficiency virus gp130 does not protect from challenge infection | |
Rovinski et al. | Expression and characterization of genetically engineered human immunodeficiency virus-like particles containing modified envelope glycoproteins: implications for development of a cross-protective AIDS vaccine | |
Ahmad et al. | Reduced virus load in rhesus macaques immunized with recombinant gp160 and challenged with simian immunodeficiency virus | |
KR19990087126A (en) | Synthetic Human Immunodeficiency Virus Gene | |
US8048431B2 (en) | Modified HIV-1 clade C envelope glycoprotein immunogens comprising deletions in the gp120/gp41 cleavage site and gp41 fusion domain | |
Khattar et al. | Newcastle disease virus expressing human immunodeficiency virus type 1 envelope glycoprotein induces strong mucosal and serum antibody responses in Guinea pigs | |
CZ2003784A3 (en) | Enhanced conditionally replicating vectors, processes of their preparation and their use | |
VAN EENDENBURG et al. | Cell-mediated immune proliferative responses to HIV-1 of chimpanzees vaccinated with different vaccinia recombinant viruses | |
ES2634144T3 (en) | Defective lentiviral transfer vectors that are not integrated for vaccines | |
Sheppard | Inactivated-or killed-virus HIV/AIDS vaccines | |
Nakaya et al. | Enhanced cellular immune responses to SIV Gag by immunization with influenza and vaccinia virus recombinants | |
Mills et al. | Vaccine-induced CD4+ T cells against the simian immunodeficiency virus gag protein. Epitope specificity and relevance to protective immunity. | |
WO2001055330A2 (en) | Recombinant rhabdoviruses as live-viral vaccines for immunodeficiency viruses | |
Schlienger et al. | Vaccine-induced neutralizing antibodies directed in part to the simian immunodeficiency virus (SIV) V2 domain were unable to protect rhesus monkeys from SIV experimental challenge | |
Stott | Towards a vaccine against AIDS: lessons from simian immunodeficiency virus vaccines | |
US20030124146A1 (en) | Recombinant Rhabdoviruses as live-viral vaccines | |
AU766264B2 (en) | Viral chimeras comprised of caev and hiv-1 genetic elements | |
WO2002098457A2 (en) | Recombinant rhabdoviruses as live-viral vaccines for immunodeficiency viruses | |
US20130164316A1 (en) | Genetic signatures in hiv-1 subtype c envelope glycoproteins | |
Rubinstein et al. | Immunologic responses of HIV-1-infected study subjects to immunization with a mixture of peptide protein derivative-V3 loop peptide conjugates | |
US20240181040A1 (en) | Clade c hiv-1 envelope (env) trimer immunogens, compositions including the clade c hiv-1 envelope (env) trimer immunogens, and uses thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): CA JP US |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR |
|
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase in: |
Ref country code: JP |
|
WWW | Wipo information: withdrawn in national office |
Country of ref document: JP |