WO2002088177A1

WO2002088177A1 - Erav diagnostics and vaccines

Info

Publication number: WO2002088177A1
Application number: PCT/AU2002/000540
Authority: WO
Inventors: Brendan Scott Crabb; Simone Warner-Haddad
Original assignee: The Council Of The Queensland Institute Of Medical Research
Priority date: 2001-05-02
Filing date: 2002-05-02
Publication date: 2002-11-07
Also published as: AUPR472501A0

Abstract

The present invention provides an isolated polypeptide comprising at least one antigenic determinant of Equine Rhinitis A virus (ERAV) VP1. The polypeptide consists of at least 17 and less than 240 amino acids and preferably comprises at least one sequence selected from the group consisting of amino acids 1 to 23, 172 to 188 and 230 to 246 of the amino acid sequence shown as SEQ ID. No. 1.

Description

EQUINE RHINITIS A VIRUS DIAGNOSTICS AND VACCINES

Field of the invention

The present invention relates to Equine rhinitis A virus (ERAV) VPl polypeptides and antigenic fragments thereof and their use in viral diagnostics and vaccines.

Background to the invention

Equine rhinitis A virus (ERAV), formerly known as equine rhinovirus 1, is a member of the Aphthovirus genus in the family Picornaviήdae. This genus is otherwise comprised of the different serotypes of Foot-and-mouth disease virus (FMDN). ERAV and FMDN share a range of physicochemical and biological properties. ERAV infection of horses results in an acute febrile respiratory disease that is accompanied by viremia and persistent virus shedding in urine and faeces. It has been shown to be responsible for relatively large outbreaks of acute respiratory illness in adult horse populations although much remains to be learned about the epidemiology and pathogenesis of this pathogen. Such studies are complicated by the likelihood that many isolates are not cytopathic for in vitro cultured cells. Despite being primarily an infection of horses, ERAN is also pathogenic for a broad range of other animal species including humans. We have shown previously that ERAN is rarely isolated from clinical samples and that this has probably led to a significant under diagnosis of ERAN infections. Despite this difficulty, ERAV has been isolated from thoroughbred horses with acute respiratory disease in Australia, Canada, USA, Japan and Europe and is emerging as an important problem in these regions. However, there is currently no vaccine to control ERAV infection and only limited diagnostic tools are available. Summary of the invention

We have expressed recombinant ERAV VPl protein and shown that it elicits a strong neutralizing antibody response. Furthermore, we have mapped a number of important epitopes within the polypeptide. We have also shown that the recombinant ERAV VPl participates directly in binding to a cellular receptor in a manner that mimics viral attachment. Our results firmly establish that recombinant ERAV VPl polypeptides may be used as diagnostic reagents and vaccines to control infections with ERAV.

Accordingly, the present invention provides an isolated polypeptide comprising at least one antigenic determinant of Equine Rhinitis A virus

(ERAV) VPl, wherein the polypeptide consists of at least 17 and less than 240 amino acids.

It is preferred that the polypeptide comprises at least one sequence selected from the group consisting of amino acids 1 to 23, 172 to 188 and 230 to 246 of the amino acid sequence shown as SEQ ID. No. 1. It is further preferred that the polypeptide consists of 150, more preferably 100, amino acids or less.

In another aspect the present invention provides an isolated polypeptide comprising an immunogenic fragment of ERAV VPl, or a variant or derivative thereof wherein the fragment comprises at least one sequence selected from the group consisting of amino acids 1 to 23, 172 to 188 and 230 to 246 of the amino acid sequence shown as SEQ ID. No. 1 or an immunogenic fragment, variant or derivative thereof and wherein the polypeptide is not identical to the amino acid sequence shown in SEQ ID No. 1.

The present invention also provides a polynucleotide encoding a polypeptide of the invention, a vector comprising said polynucleotide operably linked to a regulatory sequence permitting expression of the polynucleotide in a host cell and a host cell comprising said vector.

The present invention further provides a pharmaceutical composition comprising a polypeptide, a polynucleotide or vector of the invention together with a pharmaceutically acceptable carrier to diluent. Also provided is a vaccine composition comprising a polypeptide, a polynucleotide or vector of the invention together with a pharmaceutically acceptable carrier to diluent.

In another aspect, the present invention provides a method of treating or preventing or reducing the susceptibility to Equine Rhinitis A virus (ERAV) infection in a human or animal which comprises administering to the human or animal an effective amount of a polypeptide, a polynucleotide, a vector or composition of the invention.

The present invention also provides the use of a polypeptide, a polynucleotide or a vector of the invention in a method for producing antibodies which recognise one or more epitopes within an ERAV VPl polypeptide.

In a related aspect, the present invention provides a method for producing antibodies which recognise one or more epitopes within an ERAV VPl polypeptide which method comprises administering a polypeptide, a polynucleotide or a vector of the invention to a human or animal.

In another aspect, the present invention provides a method of producing anti-ERAV neutralizing antibodies which method comprises administering a VPl polypeptide, such as a polypeptide of the invention, or a polynucleotide encoding the same, to a human or animal.

The present invention also provides antibodies produced by said methods. Antibodies produced by these methods may be used in a method of treating, preventing or reducing susceptibility to Equine Rhinitis A virus (ERAV) infection in a human or animal by administering to the human or animal an effective amount of the antibody.

In a further aspect, the present invention provides a method for selecting a compound capable of disrupting binding of a VPl polypeptide to its cognate cell surface receptor which method comprises:

(i) providing a VPl polypeptide or a biologically active fragment, preferably a biologically active N-terminal fragment, thereof; (ii) contacting a cell permissive for ERAV infection with said polypeptide or fragment thereof in the presence or absence of a candidate compound; (iii) determining whether binding of the VPl polypeptide, or fragment thereof, to the cell is reduced or abolished in the presence of the compound; and (iv) selecting a candidate compound if the compound is determined in step (iii) to reduce or abolish binding of the VPl polypeptide, or fragment thereof, to the cell.

Preferably, wherein said fragment comprises amino acids 1 to 51 of the amino acid sequence shown in SEQ ID. No. 1 or a variant or derivative thereof.

Also provided is a compound identified by the above method and a method of treating, preventing or reducing susceptibility to Equine Rhinitis A virus (ERAV) infection in a human or animal which comprises administering to the human or animal an effective amount of said compound.

The present invention also provides a method of preventing ERAV binding to a target cell which method comprises contacting said cells with a polypeptide of the invention. In another aspect, the present invention provides a method of detecting the presence of ERAV in a biological sample which method comprises:

(a) providing an antibody which recognises specifically a polypeptide of the invention ;

(b) incubating a biological sample with said antibody under conditions which allow for the formation of an antibody-antigen complex; and

(c) determining whether an antibody-antigen complex comprising said antibody is formed. The present invention also provides a method of detecting the presence of anti-ERAV antibodies in a biological sample which method comprises:

(a) providing a polypeptide of the invention;

(b) incubating a biological sample with said polypeptide under conditions which allow for the formation of an antibody- polypeptide complex; and

(c) determining whether an antibody-polypepαde complex comprising said polypeptide is formed.

Also provided is a diagnostic kit comprising one or more polypeptides of the invention and /or antibodies capable of recognising specifically a polypeptide of the invention.

Detailed description of the invention Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art (e.g. in cell culture, molecular genetics, nucleic acid chemistry, hybridization techniques and biochemistry). Standard techniques are used for molecular, genetic and biochemical methods (see generally, Sambrook et al., Molecular Cloning: A Laboratory Manual, 2^nd ed. (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. and Ausubel etal., Short Protocols in Molecular Biology (1999) 4^th Ed, John Wiley & Sons, Inc. - and the full version entitled Current Protocols in Molecular Biology, which are incorporated herein by reference) and chemical methods.

A. Equine Rhinitis A Virus (ERAV) VPl Polypeptides

Equine rhinitis A virus (ERAV), formerly known as equine rhinovirus 1, is a member of the Aphthovirus genus in the family Picornaviήdae. The genome of all picornaviruses is single-stranded, positive-sense RNA containing a single, long open-reading frame that encodes the viral polyprotein. Processing of the polyprotein produces several non-structural proteins as well as four structural polypeptides termed VPl, VP2, VP3 and VP4 which together form the virus capsid. The complete nucleotide and amino acid sequence of the ERAV genome is given in Li et al, 1996, Proc. Natl. Acad. Sci. 93: 990-995 (and GenBank Accession No. L43052). The amino acid sequence of VPl, derived from GenBank Accession No. L43052 is provided herein for reference as SEQ ID. No. 1. It is to be understood that although the description below adopts the amino acid numbering based on the sequence of VPl described herein, the present invention is equally applicable to VPl variants found in other strains of ERAV (which may have slightly different amino acid numbering).

Polypeptides of the invention comprise immunogenic fragments of a ERAV VPl polypeptide. Typically, said fragments consist of at least 17 to less than 250 contiguous amino acids of a VPl polypeptide. Preferably the fragments consist of at least 30 to less than 200 contiguous amino acids of a VPl polypeptide. Most preferably the immunogenic fragments consist of less than 100 contiguous amino acids of a VPl polypeptide, for example less than 80, 70, 60 or 50 amino acids.

Highly preferred fragments include fragments consisting of amino acids 1 to 23, 172 to 188 and /or 230 to 246 of the amino acid sequence shown as SEQ ID. No. 1, or immunogenic fragments, variants or derivatives thereof.

Particularly preferred fragments are those which are capable of producing neutralising antibodies in an animal, such as a horse, or human, for example fragments consisting of amino acids 1 to 23 and /or 230 to 246 of the amino acid sequence shown as SEQ ID . No. 1, or immunogenic fragments, variants or derivatives thereof.

An "immunogenic fragment" is understood to be a fragment of the full- length protein, that is capable of inducing an immune response in the host. A variety of techniques are available to identify antigenic fragments (determinants). The method described by Gey sen et al. (Patent Application WO 84/03564, Patent Application WO 86/06487, U.S. Pat. No. 4,833,092, Proc. Natl Acad. Sci. 81: 3998-4002 (1984), J. Imm. Meth. 102, 259-274 (1987), the so- called PEPSCAN method is an easy to perform, quick and well-established method for the detection of epitopes; the immunologically important regions of the protein. This (empirical) method is especially suitable for the detection of B- cell epitopes. Computer algorithms may also be used to predict epitope regions based on a combination of the hydrophilicity criteria according to Hopp and Woods (Proc. Natl. Acad. Sci. 78: 38248-3828 (1981)), and the secondary structure aspects according to Chou and Fasman (Advances in Enzymology 47: 45-148 (1987) and U.S. Pat. No. 4,554,101). T-cell epitopes can likewise be predicted from the sequence by computer with the aid of Berzof sky's amphiphilicity criterion (Berzofsky et al., 1987, Science 235, 1059-1062). A condensed overview is found in Lu, 1991, Tibtech 9: 238-242 (1991),

Immunogenic polypeptides of the invention may comprise more than one of the above mentioned fragments, such as two or more. These fragments may be linked by heterologous amino acid sequences (i.e. sequences that do not occur in the wild-type VPl polypeptide), especially linking sequences that promote folding of the polypeptides of the invention to enhance surface presentation of antigenic sequences. Such linking sequences include diproline spacers which can increase the likelihood of interaction between sequences through induction of structural turns. Other linking sequences that may aid in the production of secondary structure include β-sheets, α-helices and coiled- coiled motifs (see for example W096/ 11944). This may assist in the presentation of conformational epitopes. A further technique for linking one or more immunogenic fragments is the use of polymers in which the peptides are covalently linked to polymer subunits (see for example W098/ 34968). The peptide-polymer may comprise multiple repeats of the same peptide and /or one or more repeats of different peptides. The terms "variant" or "derivative" in relation to the amino acid sequences of the present invention includes any substitution of, variation of, modification of, replacement of, deletion of or addition of one (or more) amino acids from or to the sequence providing the resultant amino acid sequence preferably is immunogenic and /or capable of binding to permissive cells, preferably having at least 25 to 50% of the activity as the VPl polypeptide presented in the sequence listing.

Thus, VPl immunogenic fragments may be modified for use in the present invention. Typically, modifications are made that maintain biological properties /activity such as the immunogenicity and /or cell binding properties of the sequence. Thus, in one embodiment, amino acid substitutions may be made, for example from 1, 2 or 3 to 10, 20 or 30 substitutions provided that the modified sequence retains at least about 25 to 50% of, or substantially the same activity.

In general, preferably less than 20%, 10% or 5% of the amino acid residues of a variant or derivative are altered as compared with the corresponding region depicted in the sequence listing.

Amino acid substitutions may include the use of non-naturally occurring analogues, for example to increase blood plasma half-life of a therapeutically administered polypeptide (see below for further details on the production of peptide derivatives for use in therapy).

Conservative substitutions may be made, for example according to the Table below. Amino acids in the same block in the second column and preferably in the same line in the third column may be substituted for each other:

Fragments of VPl that contain epitopes may be used in the polypeptides of the invention. These fragments will comprise at least 5 or 6 amino acids, preferably at least 10 amino acids, more preferably at least 15, 20, 50 or 100 amino acids.

It is preferred that ERAV VPl polypeptides of the present invention have more than 50% permissive cell binding activity compared with wild type ERAV VPl, more preferably more than 60, 70, 80 or 90%. Permissive cell binding activity may, for example, be determined as described in the experimental section, e.g. using flow cytometry.

In addition, it is preferred that mutant polypeptides of the invention retain at least 50% of the immunogenicity of the wild type sequence from which they are derived (i.e. the full length fragment VPl sequence or immunogenic fragments thereof), more preferably at least 70, 80 or 90%.

Immunogenicity may be determined typically by the use of in vitro techniques such as ELISA or Western blotting. Alternatively, or in addition, immunogenicity may be determined in vivoby, for example, immunising animals with a polypeptide of the invention and then either testing sera by ELISA or Western blotting, or by subsequently challenging immunised individuals with VPl protein or ERAV. Polypeptides of the invention may further comprise heterologous amino acid sequences, typically at the N-terminus or C-terminus, preferably the N-terminus. Heterologous sequences may include sequences that affect intra or extracellular protein targeting (such as leader sequences). Heterologous sequences may also include sequences that increase the immunogenicity of the polypeptide of the invention and /or which facilitate identification, extraction and /or purification of the polypeptides. Other heterologous amino acid sequences includes immunogenic sequences from other pathogenic organisms such as bacteria or viruses. Polypeptides of the invention are typically made by recombinant means, for example as described below. However they may also be made by synthetic means using techniques well known to skilled persons such as solid phase synthesis. Various techniques for chemically synthesising peptides are reviewed by Borgia and Fields, 2000, TibTech 18: 243-251 and described in detail in the references contained therein.

Polypeptides of the invention may also be produced as fusion proteins, for example to aid in extraction and purification. Examples of fusion protein partners include glutathione-S-transferase (GST), 6xHis, GAL4 (DNA binding and /or transcriptional activation domains) and β-galactosidase. It may also be convenient to include a proteolytic cleavage site between the fusion protein partner and the protein sequence of interest to allow removal of fusion protein sequences, such as a thrombin cleavage site. Preferably the fusion protein will not hinder the function of the VPl immunogenic fragment.

Alternatively, instead of fusion partners, cysteine residues may be placed at or near each terminus of the polypeptide to aid polymerisation. Other sequences that may be added to the N- or C-terminus which aid in the production of secondary structure include sequence which form 0-sheets, I-helices and/ or coiled-coiled motifs (see for example W096/ 11944). This may assist in the presentation of conformational epitopes. Polypeptides of the invention may be in a substantially isolated form. It will be understood that the protein may be mixed with carriers or diluents which will not interfere with the intended purpose of the protein and still be regarded as substantially isolated. A polypeptide of the invention may also be in a substantially purified form, in which case it will generally comprise the protein in a preparation in which more than 90%, e.g. 95%, 98% or 99% of the protein in the preparation is a polypeptide of the invention.

Polypeptides of the present invention may be administered therapeutically to human or animal patients. It is preferred to use polypeptides /peptides that do not consist solely of naturally-occurring amino acids but which have been modified, for example to reduce immunogenicity, to increase circulatory half-life in the body of the patient, to enhance bioavailability and /or to enhance efficacy and /or specificity.

A number of approaches have been used to modify peptides for therapeutic application. One approach is to link the peptides or proteins to a variety of polymers, such as polyethylene glycol (PEG) and polypropylene glycol (PPG) - see for example U.S. Patent Nos. 5,091,176, 5,214,131 and US 5,264,209

Replacement of naturally-occurring amino acids with a variety of uncoded or modified amino acids such as D-amino acids and N-methyl amino acids may also be used to modify peptides

Another approach is to use bifunctional crosslinkers, such as N- succinimidyl 3-(2 pyridyldithio) propionate, succinimidyl 6-[3-(2 pyridyldithio) propionamido] hexanoate, and sulfosuccinimidyl 6-[3-(2 pyridyldithio) propionamido]hexanoate (see US Patent 5,580,853). It may be desirable to use derivatives of the polypeptides of the invention which are conformationally constrained. Conformational constraint refers to the stability and preferred conformation of the three-dimensional shape assumed by a peptide. Conformational constraints include local constraints, involving restricting the conformational mobility of a single residue in a peptide; regional constraints, involving restricting the conformational mobility of a group of residues, which residues may form some secondary structural unit; and global constraints, involving the entire peptide structure.

The active conformation of the peptide may be stabilized by a covalent modification, such as cyclization or by incorporation of gamma-lactam or other types of bridges. For example, side chains can be cyclized to the backbone so as create a L-gamma-lactam moiety on each side of the interaction site. See, generally, Hruby et al., "Applications of Synthetic Peptides," in Synthetic Peptides: A User's Guide: 259-345 (W. H. Freeman & Co. 1992). Cyclization also can be achieved, for example, by formation of cystine bridges, coupling of amino and carboxy terminal groups of respective terminal amino acids, or coupling of the amino group of a Lys residue or a related homolog with a carboxy group of Asp, Glu or a related homolog. Coupling of the .alpha-amino group of a polypeptide with the epsilon-amino group of a lysine residue, using iodoacetic anhydride, can be also undertaken. See Wood and Wetzel, 1992, Int'l J. Peptide Protein Res. 39: 533-39.

Another approach described in US 5,891,418 is to include a metal-ion complexing backbone in the peptide structure. Typically, the preferred metal- peptide backbone is based on the requisite number of particular coordinating groups required by the coordination sphere of a given complexing metal ion. In general, most of the metal ions that may prove useful have a coordination number of four to six. The nature of the coordinating groups in the peptide chain includes nitrogen atoms with amine, amide, imidazole, or guanidino functionalities; sulfur atoms of thiols or disulfides; and oxygen atoms of hydroxy, phenolic, carbonyl, or carboxyl functionalities. In addition, the peptide chain or individual amino acids can be chemically altered to include a coordinating group, such as for example oxime, hydrazino, sulfhydryl, phosphate, cyano, pyridino, piperidino, or morpholino. The peptide construct can be either linear or cyclic, however a linear construct is typically preferred. One example of a small linear peptide is Gly-Gly-Gly-Gly which has four nitrogens (an N₄ complexation system) in the back bone that can complex to a metal ion with a coordination number of four.

A further technique for improving the properties of therapeutic peptides is to use non-peptide peptidomimetics. A wide variety of useful techniques may be used to elucidating the precise structure of a peptide. These techniques include amino acid sequencing, x-ray crystallography, mass spectroscopy, nuclear magnetic resonance spectroscopy, computer-assisted molecular modeling, peptide mapping, and combinations thereof. Structural analysis of a peptide generally provides a large body of data which comprise the amino acid sequence of the peptide as well as the three-dimensional positioning of its atomic components. From this information, non-peptide peptidomimetics may be designed that have the required chemical functionalities for therapeutic activity but are more stable, for example less susceptible to biological degradation. An example of this approach is provided in US 5,811,512. Techniques for chemically synthesising therapeutic peptides of the invention are described in the above references and also reviewed by Borgia and Fields, 2000, TibTech 18: 243-251 and described in detail in the references contained therein.

B. Polynucleotides and vectors.

Polynucleotides of the invention comprise nucleic acid sequences encoding the polypeptides of the invention. Polynucleotides of the invention may comprise DNA or RNA. They may also be polynucleotides which include within them synthetic or modified nucleotides. A number of different types of modification to oligonucleotides are known in the art. These include methylphosphonate and phosphorothioate backbones, addition of acridine or polylysine chains at the 3' and /or 5' ends of the molecule. For the purposes of the present invention, it is to be understood that the polynucleotides described herein may be modified by any method available in the art. Such modifications may be carried out in order to enhance the in vivo activity or life span of polynucleotides of the invention.

It will be understood by a skilled person that numerous different polynucleotides can encode the same polypeptide as a result of the degeneracy of the genetic code.

Polynucleotides of the invention can be incorporated into a recombinant replicable vector. The vector may be used to replicate the nucleic acid in a compatible host cell. Thus, in a further embodiment, the invention provides a method of making polynucleotides of the invention by introducing a polynucleotide of the invention into a replicable vector, introducing the vector into a compatible host cell, and growing the host cell under conditions which bring about replication of the vector. The vector may be recovered from the host cell. Suitable host cells include bacteria such as E. coli, yeast, mammalian cell lines and other eukaryotic cell lines, for example insect Sf9 cells. Preferably, a polynucleotide of the invention in a vector is operably linked to a regulatory sequence that is capable of providing for the expression of the coding sequence by the host cell, i.e. the vector is an expression vector. The term "operably linked" refers to a juxtaposition wherein the components described are in a relationship permitting them to function in their intended manner. A regulatory sequence "operably linked" to a coding sequence is ligated in such a way that expression of the coding sequence is achieved under conditions compatible with the control sequences.

Such vectors may be transformed or transfected into a suitable host cell as described above to provide for expression of a polypeptide of the invention. This process may comprise culturing a host cell transformed with an expression vector as described above under conditions to provide for expression by the vector of a coding sequence encoding the polypeptides, and optionally recovering the expressed polypeptides.

The vectors may be, for example, plasmid or virus vectors provided with an origin of replication, optionally a promoter for the expression of the said polynucleotide and optionally a regulator of the promoter. The vectors may contain one or more selectable marker genes, for example an ampicillin resistance gene in the case of a bacterial plasmid or a neomycin resistance gene for a mammalian vector. Vectors may be used in vitro, for example for the production of RNA or used to transfect or transform a host cell. The vector may also be adapted to be used in vivo, for example in a method of gene therapy. Promoters/ enhancers and other expression regulation signals may be selected to be compatible with the host cell for which the expression vector is designed. For example, prokaryotic promoters may be used, in particular those suitable for use in E. coli strains (such as E. coli HB101). When expression of the polypeptides of the invention is carried out in mammalian cells, either in vitro or in vivo, mammalian promoters may be used. Tissue-specific promoters may also be used. Viral promoters may also be used, for example the Moloney murine leukaemia virus long terminal repeat (MMLV LTR), the promoter rous sarcoma virus (RSV) LTR promoter, the SV40 promoter, the human cytomegalovirus (CMV) IE promoter, herpes simplex virus promoters or adenovirus promoters. All these promoters are readily available in the art.

C Host cells Vectors and polynucleotides of the invention may be introduced into host cells for the purpose of replicating the vectors /polynucleotides and /or expressing the polypeptides of the invention encoded by the polynucleotides of the invention. Suitable host cells include prokaryotes such as eubacteria, for example E. coli and B. subtilis and eukaryotes such as yeast, insect or mammalian cells.

Vectors /polynucleotides of the invention may be introduced into suitable host cells using a variety of techniques known in the art, such as transfection, transformation and electroporation. Where vectors /polynucleotides of the invention are to be administered to animals, several techniques are known in the art, for example infection with recombinant viral vectors such as retroviruses, herpes simplex viruses and adenoviruses, direct injection of nucleic acids and biolistic transformation.

L Protein Expression and Purification Host cells comprising polynucleotides of the invention may be used to express polypeptides of the invention. Host cells may be cultured under suitable conditions which allow expression of the proteins of the invention. Expression of the polypeptides of the invention may be constitutive such that they are continually produced, or inducible, requiring a stimulus to initiate expression. In the case of inducible expression, protein production can be initiated when required by, for example, addition of an inducer substance to the culture medium, for example dexamethasone or IPTG.

Polypeptides of the invention can be extracted from host cells by a variety of techniques known in the art, including enzymatic, chemical and /or osmotic lysis and physical disruption.

Purification of polypeptides may optionally be performed using well known techniques such as affinity chromatography, including immunoaffinity chromatography, ion-exchange chromatography and the like. A particularly preferred technique is to express the polypeptide of the invention as a fusion protein with polyhistidine tag (for example 6xHis) and purify cell extracts using Ni-NTA agarose (Qiagen). A variety of other similar affinity chromatography systems based on fusion protein sequences are known in the art.

Polypeptides of the invention may also be produced recombinantly in an in vitro cell-free system, such as the TnT™ (Promega) rabbit reticulocyte system. E. Administration

The polypeptides of the invention may be administered by direct injection. Preferably the polypeptides are combined with a pharmaceutically acceptable carrier or diluent to produce a pharmaceutical composition, which may be for human or veterinary use. Suitable carriers and diluents include isotonic saline solutions, for example phosphate-buffered saline. The composition may be formulated for parenteral, intramuscular, intravenous, subcutaneous, intraocular, oral or transdermal administration. Typically, each polypeptide is administered at a dose of from 0.01 to 30 μg/kg body weight, preferably from 0.1 to 10 μg/kg, more preferably from 0.1 to 1 μg/kg body weight. It is also possible to use antibodies prepared using the polypeptides of the invention, as described below, in treating or preventing ERAV infection. Neutralising antibodies, or fragments thereof which retain specificity for ERAV VPl antigens, can be administered in a similar manner to the polypeptides of the invention.

The polynucleotides of the invention may be administered directly as a naked nucleic acid construct. They may further comprise flanking sequences homologous to the host cell genome. When the expression cassette is administered as a naked nucleic acid, the amount of nucleic acid administered is typically in the range of from 1 μg to 10 mg, preferably from 100 μg to 1 mg. Uptake of naked nucleic acid constructs by mammalian cells is enhanced by several known transfection techniques for example those including the use of transfection agents. Example of these agents include cationic agents (for example calcium phosphate and DEAE-dextran) and lipofectants (for example lipofectam™ and transfectam™). Typically, nucleic acid constructs are mixed with the transfection agent to produce a composition.

Preferably the polynucleotide or vector of the invention is combined with a pharmaceutically acceptable carrier or diluent to produce a pharmaceutical composition. Suitable carriers and diluents include isotonic saline solutions, for example phosphate-buffered saline. The composition may be formulated for parenteral, intramuscular, intravenous, subcutaneous, intraocular, oral or transdermal administration.

The routes of administration and dosages described are intended only as a guide since a skilled practitioner will be able to determine readily the optimum route of administration and dosage for any particular patient and condition.

F. Preparation of Vaccines

Vaccines may be prepared from one or more polypeptides, polynucleotides or vectors of the invention. The preparation of vaccines which contain an immunogenic polypeptide(s) as active ingredient(s), is known to one skilled in the art. Typically, such vaccines are prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid prior to injection may also be prepared. The preparation may also be emulsified, or the protein encapsulated in liposomes. The active immunogenic ingredients are often mixed with excipients which are pharmaceutically acceptable and compatible with the active ingredient. Suitable excipients are, for example, water, saline, dextrose, glycerol, ethanol, or the like and combinations thereof. In addition, if desired, the vaccine may contain suitable amounts of auxiliary substances such as wetting or emulsifying agents, pH buffering agents, and /or adjuvants which enhance the effectiveness of the vaccine. Examples of adjuvants which may be effective include but are not limited to: aluminum hydroxide, N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr- MDP), N-acetyl-nor-muramyl-L-alanyl-D-isoglutamine (CGP 11637, referred to as nor-MDP), N-acetylmuramyl-L-alanyl-D-isoglutaminyl-L-alanine-2-(l '-2'- dipalmit-oyl-sn-gly cero-3-hydroxyphosphoryloxy )-ethylamine (CGP 19835 A, referred to as MTP-PE), and RIBI, which contains three components extracted from bacteria, monophosphoryl lipid A, trehalose dimycolate and cell wall skeleton (MPL+TDM+CWS) in a 2% squalene/ Tween 80 emulsion. Further examples of adjuvants and other agents include aluminum hydroxide, aluminum phosphate, aluminum potassium sulfate (alum), beryllium sulfate, silica, kaolin, carbon, water-in-oil emulsions, oil-in-water emulsions, muramyl dipeptide, bacterial endotoxin, lipid X, Corynebacteήum parvum (Propionobacteήum acnes), Bordetella pertussis, polyribonucleotides, sodium alginate, lanolin, lysolecithin, vitamin A, saponin, liposomes, levamisole, DEAE-dextran, blocked copolymers or other synthetic adjuvants. Such adjuvants are available commercially from various sources, for example, Merck Adjuvant 65 (Merck and Company, Inc., Rahway, N.J.) or Freund's Incomplete Adjuvant and Complete Adjuvant (Difco Laboratories, Detroit, Michigan). It is particularly preferred to include adjuvants which promote helper T cell responses, such as diphtheria, pertussis and tetanus toxins and ovalalbumin. Other preferred adjuvants include immune stimulatory complexes (ISCOMs) which are small micelles of detergent such as Quil A. The immunogens of the invention are present within the micelles which can fuse with antigen-presenting cells, allowing the immunogen to enter the cytosol.

Polypeptides of the present invention, especially peptides, may also be prepared as self-adjuvanting peptides by conjugation to fatty acids, for example as described in W093/ 02706. Typically, adjuvants such as Amphigen (oil-in-water), Alhydrogel

(aluminum hydroxide), or a mixture of Amphigen and Alhydrogel are used. Only aluminum hydroxide is approved for human use.

The proportion of immunogen (or nucleotide/ vector directing expression of the immunogen) and adjuvant can be varied over a broad range so long as both are present in effective amounts. For example, aluminum hydroxide can be present in an amount of about 0.5% of the vaccine mixture (A1₂0₃ basis). Conveniently, the vaccines are formulated to contain a final concentration of immunogen in the range of from 0.2 to 200 μg/ml, preferably 5 to 50 μg/ml, most preferably 15 μg/ml. After formulation, the vaccine may be incorporated into a sterile container which is then sealed and stored at a low temperature, for example 4°C, or it may be freeze-dried. Lyophilisation permits long-term storage in a stabilised form. The effectiveness of an adjuvant may be determined by measuring the amount of antibodies directed against an immunogenic polypeptide containing a ERAV VPl antigenic sequence resulting from administration of this polypeptide in vaccines which are also comprised of the various adjuvants.

The vaccines are conventionally administered parenterally, by injection, for example, either subcutaneously or intramuscularly. Additional formulations which are suitable for other modes of administration include suppositories and, in some cases, oral formulations. For suppositories, traditional binders and carriers may include, for example, polyalkylene glycols or triglycerides; such suppositories may be formed from mixtures containing the active ingredient in the range of 0.5% to 10%, preferably 1% to 2%. Oral formulations include such normally employed excipients as, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, and the like. These compositions take the form of solutions, suspensions, tablets, pills, capsules, sustained release formulations or powders and contain 10% to 95% of active ingredient, preferably 25% to 70%. Where the vaccine composition is lyophilised, the lyophilised material may be reconstituted prior to administration, e.g. as a suspension. Reconstitution is preferably effected in buffer. Capsules, tablets and pills for oral administration to a patient may be provided with an enteric coating comprising, for example, Eudragit "S", Eudragit "L", cellulose acetate, cellulose acetate phthalate or hydroxypropylmethyl cellulose.

The polypeptides of the invention may be formulated into the vaccine as neutral or salt forms. Pharmaceutically acceptable salts include the acid addition salts (formed with free amino groups of the peptide) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids such as acetic, oxalic, tartaric and maleic. Salts formed with the free carboxyl groups may also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, 2-ethylamino ethanol, histidine and procaine.

G. Dosage and Administration of Vaccines The vaccines are administered in a manner compatible with the dosage formulation, and in such amount as will be prophylactically and /or therapeutically effective. The quantity to be administered, which is generally in the range of 5 μg to 250 μg of antigen per dose, depends on the subject to be treated, capacity of the subject's immune system to synthesize antibodies, and the degree of protection desired. A preferable range is from about 20 μg to about 40 μg per dose. These dosage ranges can also be applied to amounts of polynucleotide required to synthesise the required antigen dose.

A suitable dose size is about 0.5 ml. Accordingly, a dose for intramuscular injection, for example, would comprise 0.5 ml containing 20 μg of immunogen in admixture with 0.5% aluminum hydroxide.

Precise amounts of active ingredient required to be administered may depend on the judgement of the practitioner and may be peculiar to each subject. Typically, the patient is a horse or other animal susceptible to ERAV infection. The vaccine may be given in a single dose schedule, or preferably in a multiple dose schedule. A multiple dose schedule is one in which a primary course of vaccination may be with 1-10 separate doses, followed by other doses given at subsequent time intervals required to maintain and or reinforce the immune response, for example, at 1 to 4 months for a second dose, and if needed, a subsequent dose(s) after several months. The dosage regimen will also, at least in part, be determined by the need of the individual and be dependent upon the judgement of the practitioner.

In addition, the vaccine containing the immunogenic ERAV VPl antigen(s) may be administered in conjunction with other immunoregulatory agents, for example, immunoglobulins and/ or cytokines.

H. Preparation of antibodies against the polypeptides of the invention The immunogenic polypeptides prepared as described above can be used to produce antibodies, both polyclonal and monoclonal. In addition, full length VPl polypeptides may also be used to produce neutralizing antibodies. If polyclonal antibodies are desired, a selected mammal (e.g. mouse, rabbit, goat, horse, etc.) is immunised with an immunogenic polypeptide bearing a ERAV VPl epitope(s). Serum from the immunised animal is collected and treated according to known procedures. If serum containing polyclonal antibodies to a ERAV VPl epitope contains antibodies to other antigens, the polyclonal antibodies can be purified by immunoaffinity chromatography. Techniques for producing and processing polyclonal antisera are known in the art.

Monoclonal antibodies directed against ERAV VPl epitopes in the polypeptides of the invention can also be readily produced by one skilled in the art. The general methodology for making monoclonal antibodies by hybridomas is well known. Immortal antibody-producing cell lines can be created by cell fusion, and also by other techniques such as direct transformation of B lymphocytes with oncogenic DNA, or transfection with Epstein-Barr virus. Panels of monoclonal antibodies produced against ERAV VPl epitopes can be screened for various properties; i.e., for isotype and epitope affinity.

An alternative technique involves screening phage display libraries where, for example the phage express scFv fragments on the surface of their coat with a large variety of complementarity determining regions (CDRs). This technique is well known in the art.

Antibodies, both monoclonal and polyclonal, which are directed against ERAV VPl epitopes are particularly useful in diagnosis, and those which are neutralising are useful in passive immunotherapy. Monoclonal antibodies, in particular, may be used to raise anti-idiotype antibodies. Anti-idiotype antibodies are immunoglobulins which carry an "internal image" of the antigen of the infectious agent against which protection is desired.

Techniques for raising anti-idiotype antibodies are known in the art. These anti-idiotype antibodies may also be useful for treatment of ERAV infections, as well as for an elucidation of the immunogenic regions of ERAV VPl antigens.

For the purposes of this invention, the term "antibody", unless specified to the contrary, includes fragments of whole antibodies which retain their binding activity for a target antigen. Such fragments include Fv, F(ab') and F(ab')₂ fragments, as well as single chain antibodies (scFv). Furthermore, the antibodies and fragments thereof may be humanised antibodies, for example as described in EP-A-239400.

L Diagnostic methods and kits

Polypeptides and antibodies according to the invention may also be used in diagnostic methods for detecting the presence of ERAV polypeptides or antibodies against ERAV polypeptides in a biological sample. Suitable samples include blood samples and samples taken from the respiratory tract of an animal or human.

Both the polypeptides of the invention, and antibodies produced using the polypeptides of the inventions may be used in immunoassay methods, for example which react immunologically with serum containing ERAV antibodies, for example to detect presence of ERAV antibodies, or the presence of viral antigens, in biological samples, including for example, blood or serum samples. The design of immunoassays is subject to a great deal of variation, and a variety of these immunoassays are known in the art. For example, the immunoassay may utilise one viral antigen, for example, a polypeptide of the invention; or alternatively, the immunoassay may use a combination of viral antigens including a polypeptide of the invention. It may also use, for example, an antibody obtained using a method of the invention or a combination of these antibodies directed towards one viral antigen or several viral antigens. Protocols may be based, for example, upon competition, or direct reaction, or sandwich type assays. The immunoassay protocols used may also, for example, use solid supports, or may be by immunoprecipitation. Most assays involve the use of labelled antibody or polypeptide; the labels may be, for example, fluorescent, chemiluminescent, radioactive, or dye molecules. Assays which amplify the signals from the probe are also known; examples of which are assays which utilise biotin and avidin, and enzyme-labelled and mediated immunoassays, such as ELISA assays.

Assay formats already used in the art for related viruses such as FMDV may conveniently be applied to assays for ERAV.

Antibodies and polypeptides of the invention may be bound to a solid support, for example the surface of an immunoassay well or dipstick, and /or packaged into kits in a suitable container along with suitable reagents, controls, instructions and the like.

J. Assays for compounds that disrupt binding of ERAV viruses to permissive cells. The results presented herein show that ERAV VPl binds to permissive cells, and is likely to participate directly in receptor binding to such cells. Disruption of this interaction may provide a means of preventing viral infection of cells. Thus, in a further aspect, the present invention provides a method for selecting a compound capable of disrupting binding of a VPl polypeptide to its cognate cell surface receptor which method comprises: (i) providing a VPl polypeptide or a biologically active fragment thereof; (ii) contacting a cell permissive for ERAV infection with said polypeptide or fragment thereof in the presence or absence of a candidate compound;

(iii) determining whether binding of the VPl polypeptide, or fragment thereof, to the cell is reduced or abolished in the presence of the compound; and (iv) selecting a candidate compound if the compound is determined in step (iii) to reduce or abolish binding of the VPl polypeptide, or fragment thereof, to the cell.

The VPl polypeptide may be a polypeptide of the invention or full length VPl. Where the polypeptide is a biologically active N-terminal fragment of full length VPl, it will comprise the N-terminal sequences required for binding to permissive cells, for example the fragment may comprise amino acids 1 to 51 of the amino acid sequence shown in SEQ ID. No. 1 or a variant or derivative thereof. The VPl polypeptide may be present in ERAV viral particles. Biologically active in the present context means that the fragment is capable of binding to permissive cells.

Candidate substances /compounds

Suitable candidate substances include peptides, especially of from about 5 to 30 or 10 to 25 amino acids in size, based on the VPl polypeptides sequences described in section A, or variants of such peptides in which one or more residues have been substituted. Peptides from panels of peptides comprising random sequences or sequences which have been varied consistently to provide a maximally diverse panel of peptides may be used. Suitable candidate substances also include antibody products (for example, monoclonal and polyclonal antibodies, single chain antibodies, chimeric antibodies and CDR-grafted antibodies) which are specific for VPl, especially the N-terminal 51 amino acids of VPl. Furthermore, combinatorial libraries, peptide and peptide mimetics, defined chemical entities, and natural product libraries may be screened for activity as inhibitors of binding of VPl to permissive cells. The candidate substances may be used in an initial screen in batches of, for example 10 substances per reaction, and the substances of those batches which show inhibition tested individually.

Binding of the VPl polypeptide to a permissive cells may be determined by methods such as flow cytometry (see experimental section in Example 1). Permissive cells are cells that can be productively infected by ERAV and include Vero cells and equine fetal kidney cells. Such cells will contain a cognate receptor which binds ERAV via VPl.

Candidate substances are typically added to a final concentration of from 1 to 1000 nmol/ml, more preferably from 1 to 100 nmol/ml. In the case of antibodies, the final concentration used is typically from 100 to 500 μg/ml, more preferably from 200 to 300 μg/ml.

Preferably, suitable compounds reduce binding of VPl to permissive cells by at least 50%, more preferably 60, 70 or 80% as compared with the control where candidate compounds are absent. Also provided is a compound identified by the above method and a method of treating, preventing or reducing susceptibility to Equine Rhinitis A virus (ERAV) infection in a human or animal which comprises administering to the human or animal an effective amount of said compound. Administration of compounds will typically be similar to that described above for polypeptides.

Examples of compounds that disrupt binding of ERAV to a permissive cells include VPl and fragments thereof that bind to permissive cells. These polypeptides (and nucleic acids that express such polypeptides) may be used in a method of preventing ERAV binding to a target cell which method comprises contacting said cell with VPl or fragments therefore that can bind to permissive cells. Administration of such polypeptides (and nucleic acids encoding the same) will typically be similar to that described above.. Disruption of binding of ERAV to a cell via disruption of VPl binding may be used to treat, prevent or reduce susceptibility to ERAV infection.

The invention will be described with reference to the following Examples which are intended to be illustrative only and not limiting. The Examples refer to the Figures. Referring to the Figures in more details:

Detailed description of the figures

Figure 1. Schematic diagram of the ERAV genome and design of recombinant ERAV GST- VPl fusion protein. The location of the encoded polypeptides and the internal ribosomal entry site (IRES) are indicated. For the amplification of ERAV VPl a SaK restriction site included in the sense primer and a stop codon followed by a No& site included in the antisense primer. The VPl PCR product was ligated into the pGEX4T-3 vector downstream of the GST gene and the N-terminal and C-terminal amino acids of VPl included in the clone are shown.

Figure 2. SDS-PAGE and Western blot analysis of GST and GST-VP1 recombinant proteins. (A) Purified proteins separated on a 12% SDS-PAGE gel under reducing conditions and stained with Coomassie Blue. (B) Duplicate samples separated on the same SDS-PAGE gel were transferred to PVDF membrane and either stained with Coomassie Blue or probed with anti-GST monoclonal antibody (IGST) diluted 1/750.

Figure 3. Reactivity of polyclonal rabbit and horse sera with GST- VPl. (A) Western blot showing reactivity of a rabbit anti-ERAV (whole virion) serum (RIERAV) diluted 1/10000. Prior to Western blot, samples were separated by SDS-PAGE run under either non-reducing or reducing conditions as indicated under each panel. (B) Western blot showing reactivity of sera from two horses (Horse 1 and Horse 2) following experimental infection with ERAV - see materials and methods. SDS-PAGE was performed under reducing conditions. Sera were tested at a 1/250 dilution. The position of the Mr standards is shown to the left of each membrane.

Figure 4. Reactivity of polyclonal antisera with ERAV viral proteins. Viral proteins prepared from purified virions were separated on a 10-15% gradient polyacrylamide gel and transferred to PVDF membrane. Membrane strips were probed with pre-immune serum (Rabbit-pre or Mouse-pre), rabbit and mouse anti-GST-VPl (RIGST-VP1 or MIGST-VP1) and rabbit anti-ERAV hyperimmune serum (RIERAV). Note that Mouse-pre and MIGST-VP1 represent a pool of sera from two mice.

Figure 5. Binding and inhibition of GST- VPl to Vero cells. The binding of GST fusion proteins to cells was detected by FACS analysis following staining with a rabbit anti-GST antibody. The fusion protein and amount of purified ERAV virions are shown. The relative linear median fluorescence intensity (RLMFI) values (comparing fluorescence intensity of GST-VPl-labelled cells to GST- labelled cells) are not shown on this figure but were as follows; GST- VPl: RLMFI = 14.07, GST-VP1 (+ lOμg virus); RLMFI = 9.38 and GST-VP1(+ 20μg virus); RLMFI = 4.13.

Figure 6. Binding of GST-VP1 to different cell lines. Full-length GST-VP1 fusion protein (unfilled) and GST control (filled) were incubated with 5X10⁵ Vero, COS-7, BHK-21, CHO, MDCK and L929 cells. The cells were then stained with rabbit polyclonal anti-GST antibodies and analyzed by FACS as described in the Materials and methods. The relative linear median fluorescence intensity (RLMFI) values (comparing fluorescence intensity of GST-VPl-labelled cells to GST-labelled cells) are shown. Figure 7. Specific absorption of GST-VP1 by Vero cells. GST-VP1 and GST fusion proteins were combined and sequentially absorbed with Vero cells. Aliquots of the mixture were removed prior to absorption (Absorption step 0) and following each absorption (Absorption steps 1, 2 and 3) and analyzed by reducing SDS-PAGE and Western blotting with an anti-GST MAb. Prior to absorption, an equal aliquot of the GST- VPl / GST starting mixture was absorbed with glutathione-sepharose beads (Glut) prior to loading. The intensity of the GST- VPl and GST bands were determined by densitometric analysis and is expressed as ratio below the figure. GST- VPl breakdown products are highlighted by the small arrows. The position of the M standards is shown to the left.

Figure 8: Linear representation of the ERAV VPl (not to scale). Boxes represent predicted α-helices and β-sheeting, regions between depict surface loops (determined from Wutz et al., 1996). The full-length VPl and four overlapping subfragments were expressed as GST-fusion proteins. Each fusion protein contained one or more of the predicted epitopes including the relatively unstructured N-terminus containing the DGE motif, the βD-βE loop, the βG-βH loop or the highly basic C-terminal residues. 5' and 3' VPl amino acid numbers of tile clones are indicated. A further two GST-fusion proteins were made corresponding to 17 amino acids of the βG-βH loop (GST-GH) and a stretch of 17 amino acids at the C-terminus (GST-CT).

Figure 9: SDS-PAGE and Western blot analysis of GST, GST-VP1 and subfragment GST-fusion proteins. Approximately equal amounts of each purified fusion protein. GST-NT, GST-VP1.2, GST-VP1.3, GST-VP1.4 and GST- VP1 (abbreviated to NT, 2, 34 and VPl respectively in each panel) were separated on a 12% SDS-PAGE gel under reducing conditions and (A) stained with Coomassie blue. (B) Western blot showing reactivity of a RαERAV serum diluted 1 / 10000. (C and D) Western blots showing reactivity of sera from two individual horses (panel C, Horse 1; panel D, Horse 2) following experimental infection with ERAV (Hartley et al., 2001). Horse sera were tested at a 1/250 dilution.

Figure 10: SDS-PAGE and Western blot analysis of smaller ERAV GST-fusion proteins. Approximately equal amounts of GST and each purified fusion protein GST-NT, GST-GH and GST-CT (abbreviated to NT, GH and CT in each panel) were separated on a 15% PAGE gel under reducing conditions and (A) stained with Coomassie blue. (B) Western blot showing reactivity of RαERAV serum diluted 1/ 10000. (C) Western blot showing reactivity of H^poolocERAV depleted of αGST antibodies and diluted 1/250.

Figure 11: Western blot analysis of GST-fusion proteins probed with depleted horse sera. Four affinity chromatography columns were prepared by binding GST, GST-NT, GST-GH or GST-CT fusion proteins to CNBr-activated

Sepharose 4B. The H^poolαERAV was added to the GST column and the serum flow-through collected. The GST column flow through was then applied to either the GST-NT, GST-GH or GST-CT column to further deplete the sera of the appropriate antigen. A multiply-depleted serum was produced by taking a serum sample down three or four of the columns in series. The depleted sera were then used to probe GST-NT, GST-GH or GST-CT proteins separated on a 15% SDS-PAGE gel and transferred to PVDF membrane. Membrane straps were probed with original pooled horse sera diluted 1/200 (Lane 1), or various depleted sera (lanes 2-7) at differing dilutions to correspond to a final dilution of 1 / 200 of original horse sera.

Figure 12: Reactivity of GST-fusion proteins with affinity purified antibodies. Western blot showing GST, GST-NT, GST-GH and GST-CT separated on a 15% SDS-PAGE gel under reducing conditions and transferred to PVDF membrane. Membranes were probed with (A) GST (B) GST-NT (C) GST-GH or (D) GST-CT affinity purified antibodies diluted 1 / 150. The affinity purified antibodies were produced by incubating membrane-bound fusion proteins with H^poolαERAV. Bound antibodies were eluted from the membrane with a low pH gly cine buffer and concentrated as described in the Material and methods.

EXAMPLES

Example 1 - Recombinant VPl elicits strong neutralizing antibody responses and binds to cells in a manner that appears to mimic viral attachment.

Materials and methods

Cells and virus.

Vero cells were grown in minimal essential medium containing 2 mM glutamine (Gibco), 2 mM pyruvate, 30 μg/ml gentamicin (Roussel), 100 IU/ml penicillin and 100 μg/ml streptomycin (MEM) and supplemented with 5%

(v/v) heat-inactivated fetal calf serum (FCS; CSL Pty. Ltd., Parkville, Australia). The ERAV isolate used in this study 393/76 has been described previously (Li et al., 1996. Proc. Νatl. Acad. Sci. USA. 93: 990-995; Studdert and Gleeson. 1978. Zbl Vet. Med. 25: 225-237; GenBank Accession Number L43052). Infected cell culture supernatant was prepared by adding virus to cells and allowing adsorption before the addition of MEM containing 1% (v/v) FCS. The supernatant was collected at 24 hrs post-infection, clarified at 2500 x gioτ 10 mins, filtered and stored at -70°C for further use. Purified virus for binding inhibition assays was concentrated from clarified (10 000 x g, 15 min at 4°C) cell culture supernatant of ERAV-infected Vero cells by centrifugation at 100000 x gioτ 2 hrs at 4°C. The pellet was resuspended in TNE containing 1% sarcosyl/ 1% SDS and pelleted through a 10% sucrose cushion at 100, 000 x g for 2 hrs at 4°C. The resuspended virus was then purified through a 15-45% (w/v) sucrose gradient at 80,000 x giox 4 hrs at 4°C and the gradient collected in lmL fractions. Virus containing fractions (determined by SDS-PAGE) were pooled before pelleting at 100000 x ^for 2 hrs at 4°C and re-suspended in TNE.

Cloning and expression of ERA V VPl. The full-length VPl was amplified from the purified RNA of

ERAV.393/76 by RT-PCR using synthetic oligonucleotide primers. The positive sense primer 5'-ggcgtcgacgttaccaatgtgggcgaggat-3' contains a SaK cleavage site followed by nucleotides 3088 to 3108 of ERAV and the negative sense primer 5'- tcactgtttgttgatgttag -3' bearing a stop codon followed by nucleotides 3831 to 3809 of ERAV (17). A single band corresponding to the expected molecular weight of the full-length VPl was obtained. The PCR DNA was purified and ligated into pGEM T-Easy (Promega, Madison, Wis). DNA from a positive clone was then subcloned by digestion with SaR and No& and ligated into the SaΛ and Notl digested pGEX-4T3 expression vector (Amersham Pharmacia, Uppsala, Sweden). Ligated products were transformed into E. coli XL10 Gold (Stratagene, CA, USA) by electroporation (Gene Pulser II; Biorad). DNA from a positive clone was then electroporated into Ecoli BL21 DE3 (Amersham Pharmacia) for protein expression. Large-scale fusion protein preparations were prepared as recommended by the supplier. Briefly, overnight cultures were used to seed 1.6 L Luria broth cultures at 1:100, and incubated at 37°C for 2.5 hrs. Cultures were then induced with 0.02 mM isopropyl-D-galactoside (IPTG; Boehringer Mannheim, Germany) and incubated at 30°C for 1.5 hrs. The cells were then lysed using lysozyme (Boehringer Mannheim), sonicated prior to the addition of Triton X-100 (USB, Ohio, USA) to a final concentration of 1%. The soluble fusion protein was affinity purified using Glutathione-Sepharose (Amersham Pharmacia), and eluted using 20 mM reduced glutathione (Sigma, St Louis USA). Imm unoblotting.

Purified fusion protein was subjected to electrophoresis in 12% polyacrylamide gels, electrotransferred to Immobilon-polyvinylidene fluoride (PVDF) membrane (Millipore, Bedford, MA) and blocked overnight at 4°C with either 5% skim milk or 10% goat serum in phosphate buffered saline (PBS). The membranes were incubated for 2 hrs at RT with either rabbit anti-ERAV diluted 1/10000 in PBS containing 0.05% Tween 20 (PBST) and 2.5% skim milk, or the convalescent horse sera diluted 1 / 250 in PBST containing 5% goat serum. After extensive washing in PBST, the antibodies were detected with either a 1/4000 dilution of sheep anti -rabbit IgG (Silenus, Australia), or a 1/4000 dilution of goat anti-horse IgG (Southern Biotechnology Associates, Birmingham, AL), both conjugated with horseradish peroxidase. Reactions were detected using ECL Chemilluminescence Reagent Plus (NEN Life Sciences Products Inc, Boston, MA). For detection of GST fusion proteins the primary antibody diluent contained 5 μg/ml GST to absorb GST reactive antibodies.

Sera

To obtain ERAV.393/76-specific antisera, four horses (B, C, G and S) were inoculated intranasally with this virus. Horses B and C received 10 mL of fifth passage equine foetal kidney (EFK) monolayer cell culture lysate (10⁶⁵ TCID₅₀/ml) intranasally, while horses G and S received 10 mL of 22 passage infected cell lysate (10⁷⁹TCID50/ml) (four times in EFK cells and 18 times in Vero cells) that had been clarified at 10 OOOg for 20 minutes at 4°C. Serums collected from these horses over a 105-day period were tested for the presence of ERAV.393/76 neutralising antibodies (Studdert & Gleeson, 1978, supra). Neutralising antibody titres peaked approximately three weeks post infection for each horse and the antibody titres of horses S and G decreased with time thereafter. These titres were comparable to serum taken from naturally infected horses, where titres of between 800 and 8 900 were attained 20 days after infection (Li etal., 1997, supra). Acute and convalescent sera from horses C and G, herein termed horse 1 and 2 respectively, were used below.

Rabbit immune sera to full-length recombinant GST- VPl was prepared by the subcutaneous immunization of an outbred New Zealand White rabbit with 70 μg GST- VPl emulsified in Freund's complete adjuvant (Sigma-Aldrich, Castle Hill, Australia). This rabbit was boosted twice at four week intervals with 25 μg GST- VPl in Freund's incomplete adjuvant (Sigma). Mouse immune sera to full-length recombinant GST- VPl was prepared by the intraperitoneal immunization of two BALB/c mice with 10 μg GST- VPl emulsified in Freund's complete adjuvant which were subsequently boosted 3 times at 3 week intervals with 8-10 μg GST- VPl in Freund's incomplete adjuvant.

Serum Neutralization (SN) Assays.

Dilutions of test sera were made in Linbro sterile flat-bottomed microtitre plates (ICN Biomedicals) and incubated with an equal volume of pre-titrated virus (100 TCID50) at 37°C for one hour. A suspension of Vero cells (50 μl, 1X104 cells /ml) in MEM containing 2% FCS was then added to each well and the plates incubated for a further 72-96 hrs at 37°C in a humidified incubator with 5% Cθ2- SN titers are expressed as the reciprocal of the highest dilution of serum that neutralized 100 TCID₅₀ of virus.

Cell binding assay using Bow cytometry.

The binding of GST- VPl to cells was detected by flow cytometric analysis based on a modification of the technique used by Londrigan et al., 2000 (J. Gen. Virol. 81: 2203-2213). Briefly, an approximately equimolar amount of purified GST- VPl (~12 μg of the 54 kDa species) or a GST control (5μg) were added to 5xl0⁵ Vero, COS-7, BHK-21, L929, MDCK or CHO cells in suspension in round bottom tubes. To derive the suspension culture, confluent cell monolayers were washed twice with PBS, cells detached by incubation for 3 mins with a solution containing 0.01% (w/v) trypsin (Difco) and 0.02% (w/v) EDTA, and resuspended in approximately 10 ml MEM containing 1% (v/v) FCS. The cell suspension was then incubated for 30 mins at 37°C to allow trypsin-sensitive molecules to regenerate, and the cells counted. All further volumes were 50 μl and all incubations were on ice for 45 minutes. Cells were washed with FACS wash buffer (PBS containing 1% (v/v) FCS and 0.1% (w/v) sodium azide) before incubation with rabbit anti-GST serum at 1/500, washing with FACS wash buffer, followed by incubation with FITC-conjugated swine anti-rabbit immunoglobulins diluted 1/50. Cells were fixed with 500 μl of 1% ultrapure formaldehyde (Polysciences) in PBS and analysed using a FACSort flow cytometer (Becton Dickinson) set for detection of FITC. Populations of viable cells were selected by gating dot plots and fluorescence intensity histograms of the gated populations were constructed. Binding to cells was considered positive when the relative linear median fluorescence intensity (RLMFI) value was greater than 1.2 (median fluorescence intensity with GST- VPl-bound cells/ median fluorescence intensity with GST-bound cells

(Wasserman et al., 1994. Chest. 105: 1324-1334). For virus inhibition, 1 to 20 μg of purified ERAV virions (which was considered approximately equimolar to the amount of the 54 kDa GST- VPl fusion protein) was added to cells before the addition of fusion protein. Cells were incubated for 15 mins on ice before proceeding with the assay as described above.

Depletion ofGST-VPl using Vero cells (cell absorption assay).

Approximately 0.5 μg GST- VPl and 0.6 μg GST were combined in PBS to a total volume of lOOμl. An aliquot of 20μl was removed from the mix and absorbed with excess Glutathione-Sepharose beads. Another aliquot of 20μl was removed from the mix and stored on ice as a pre-binding control sample. The remaining solution was used to resuspend a pellet of 4X10⁵ Vero cells and incubated at 4°C for 45 minutes. After incubation, the cell-fusion protein mix was centrifuged at 1,500 x giox 5 mins and a 20 μl aliquot of the supernatant removed for analysis. The procedure was repeated for a total of three adsorption steps. The collected supernatants were subjected to on SDS-PAGE, transferred to PVDF membranes and probed with a mouse anti-GST monoclonal antibody diluted 1 / 750 and rabbit anti-mouse HRP-conjugate diluted 1/4000. Densitometry was performed using Kodak ID analysis software (Eastman Kodak, New Haven, CT).

Results

Expression and antibody reactivity of the ERA V GST- VPl fusion protein

Full-length ERAV VPl was expressed as a GST fusion protein in E. coli. For this, a PCR product encoding ERAV VPl was ligated into the ρGEX4T-3 expression vector to derive the plasmid pGST-VPl (Figure 1). The N-terminus of the expressed VPl was chosen as that predicted previously and which has now been confirmed by N-terminal protein sequencing. The C-terminus of the expressed VPl was chosen as two amino acids upstream of that originally predicted by others. The expressed fusion protein, termed GST- VPl, was only partially soluble with most of the expressed protein (~80%) forming inclusion bodies. GST- VPl purified on glutathione-sepharose beads consistently migrated as a doublet most commonly with a Mr of 54/59 kDa (Figure 2 A) although in some gels the doublet migrated slightly more rapidly (Figure 2B). The predicted size of the full-length fusion protein is 56 kDa (comprised of 26 kDa GST plus 30 kDa VPl). Only the more rapidly migrating species reacted with an anti-GST monoclonal antibody (Figure 2B).

GST- VPl was examined by immunoblotting for reactivity to various anti-ERAV sera. Serum from a rabbit hyperimmunized with purified ERAV virions reacted strongly to the 54 kDa species under both reducing and non- reducing conditions (Figure 3A). Smaller reactive species (30-42 kDa) which presumably represent minor breakdown products were also seen in the GST- VP1 lanes. Convalescent sera from two different horses that had been experimentally infected with ERAV also reacted specifically with the 54 kDa species (Figure 3B). Pre-immune horse sera showed no reactivity (data not shown). These results highlight the presence of authentic VPl B cell epitopes in the recombinant protein. The larger 59 kDa species showed no reactivity with either the rabbit anti-ERAV serum or the Horse 2 serum and relatively weak reactivity with antibodies from Horse 1 (Figs. 3A and B). The lack of reactivity of the 59 kDa species was confirmed by Coomassie blue staining of parallel Western blot strips (data not shown). Given that the 59 kDa species also does not react with anti-GST antibody, it is likely that this band represents a nonspecific E coli protein that co-purifies with the 54 kDa GST- VPl fusion protein.

ERA V GST- VPl elicits a strong neutralizing antibody response.

To test if GST- VPl is capable of eliciting a VPl-specific neutralizing antibody response, two BALB/c mice and one White New Zealand outbred rabbit were immunized with the fusion protein. Sera from both the hyperimmunized mice and rabbit reacted strongly with a 25 kDa protein present in purified virions (Figure 4). This species is the lower band of a doublet present at this molecular weight detected by the rabbit anti-ERAV serum. The result is consistent with N-terminal sequence analysis of purified virion proteins which had previously suggested that the upper band in the 25 kDa doublet represented VP2, the lower band VPl and that the 21 kDa species represents VP3.

Sera from the GST- VPl immunized mice (and sera from control BALB/c mice) were found to be cytotoxic for Vero cells over a broad dilution range so that a SN antibody titer could not be determined (data not shown). This was not the case for sera from the GST- VPl immunized rabbit. A SN titer of 320-400 was obtained following 2 immunizations in this rabbit which rose to 400-526 after a further boost (Table 1). A SN titer of 200-320 was determined for the rabbit anti-ERAV serum. Hence, neutralizing antibodies may be elicited in rabbits by the GST- VPl fusion protein to a titer comparable to that produced by immunization with inactivated whole virus. TABLE 1. Immunization with GST- VPl generates neutralizing antibodies

SN liters ^a

Immunogen⁰ Pre-immune Post-2o immunization Post-3o immunization

GST-NP1 <107<10 320/400 400/562

ERAN virions ΝD^C ND 200/320

^a Serum neutralization (SN) titers were determined from two independent assays and the values shown are the titers obtained in Assay 1 and Assay 2 respectively. ^b Represents the proteins used to immunize rabbits ^cNot determined

Evidence for a receptor-binding site in VPl To investigate if ERAN VPl possesses a receptor-binding site, GST- VPl was tested for its ability to bind to Vero cells, a line permissive for infection by ERAV. Binding was detected by flow cytometry after incubations with rabbit anti-GST and FITC-labeled anti-rabbit immunoglobulins. Cells incubated with GST- VPl showed strong fluorescence relative to those incubated with GST alone (Figure 5). This was a consistent result that was observed in numerous repeat experiments and also when a mouse anti-GST monoclonal antibody was used to detect binding (data not shown). Furthermore, three other GST fusion proteins were tested and each showed a complete absence of binding in this assay (data not shown). To further test the specificity of the GST- VPl binding, different amounts of purified ERAV virions (1, 10 and 20 μg) were added to the Vero cell suspensions and allowed to bind prior to the addition of GST- VPl. This treatment inhibited GST- VPl binding in a dose dependent manner (Figure 5; note that 1 μg of virus had no effect on GST- VPl binding and hence is not shown on this figure). A repeat experiment gave an identical result (data not shown). This data is consistent with the binding of GST- VPl to the same cell surface receptor as ERAV virions. Since ERAV has a broad host range we tested if GST-VP1 could bind to different cell types. In addition to Vero cells, GST-VP1 binding, as measured by increased cellular fluorescence over the GST control, was detected in COS-7, CHO, BHK-21, MDCK and L929 cells (Figure 6). Taken together, these data are consistent with the presence of a receptor-binding site on ERAV VPl.

An alternate assay was also performed to independently test the ability of GST- VPl to bind Vero cells. In this assay, a mixture of GST- VPl and GST proteins was absorbed with Vero cells. The binding of GST- VPl was monitored by immunoblot analysis of aliquots of the GST- VPl / GST mixture, sampled before and after each absorption step, with an anti-GST monoclonal antibody. The ratio of GST- VPl to GST decreased incrementally from 0.78 prior to incubation with Vero cells to 0.50 after 3 absorption steps indicating a specific depletion of GST- VPl (Figure 7. bottom). Note that the sequential decrease in the intensity of the GST band is attributed to the small increase in volume, and hence dilution of sample, during each absorption step. Interestingly, smaller breakdown products of GST- VPl were rapidly removed by Vero cell absorption (indicated by the small arrows in Figure 7). These proteins were also removed by incubation with glutathione-sepharose beads confirming the presence of an active, presumably full-length, GST-fusion partner in these species (Figure 7). These data suggest that the receptor-binding site in GST- VPl is located in the N-terminal region of VPl.

Discussion

The emerging significance of ERAV as a pathogen for horses as well as its close relationship to FMDV, a virus of major worldwide importance, highlights a need to better understand the pathogenic processes adopted by ERAV. In this study, we show that ERAV VPl is a target of protective antibodies and provide evidence that this molecule is involved directly in viral attachment to host cells. To investigate the B cell responses to ERAV VPl, recombinant full- length ERAV VPl protein fused to the C-terminus of GST was produced. In SDS-PAGE, GST-VP1 consistently migrated as doublet at 54 kDa/ 59 kDa. Both species are close to the theoretical Mr of GST- VPl but, by several analyses, it appeared that the faster migrating 54 kDa species represented GST- VPl. We show that antibodies raised against ERAV virions, both in immunized rabbit and in experimentally infected horses, react specifically against this species. This indicates that ERAV VPl is immunogenic in the context of the wild-type virus and also that the GST- VPl fusion contains B cell epitopes that resemble those present in native VPl. Furthermore, immunization of laboratory animals with GST- VPl resulted in the production of antibodies that reacted specifically with viral VPl, confirming the presence of authentic VPl epitopes in the fusion protein. Importantly, sera from a rabbit immunized with GST- VPl strongly neutralized ERAV infection in in vitro assays. Although, the relatively poor yields of fusion protein limited the number of animals that were immunized in this study, this finding establishes the potential of mounting a protective response with recombinant ERAV VPl protein.

The identification of ERAV VPl as a target of protective antibodies raised the possibility that this protein may be responsible for attachment to host receptors. To address this we developed an assay that employed anti-GST antibodies to detect GST- VPl binding to cells by flow cytometry. By this approach we demonstrated that GST- VPl binds to Vero cells and that this binding is reversible with the addition of purified ERAV virions. The data implies that native ERAV VPl participates directly in binding to a cellular receptor and that this interaction is mimicked by the GST- VPl fusion protein. In another approach, we showed that incubation of Vero cells with a mixture of GST- VPl and GST proteins resulted in the specific depletion of GST- VPl, including of smaller breakdown products that contain only the N-terminal residues of VPl. We believe that this motif may be involved in cell attachment. Example 2 - Mapping the antigenic sites on ERAV NP1.

Introduction

In Example 1, it was shown that full length ERAN NP1 contains B cell epitopes and possesses receptor binding site activity. To map the location of ERAV VPl B cell epitopes that are targeted by neutralising antibodies and/ or involved receptor binding, four overlapping subfragments encompassing the complete protein were expressed as GST-fusion proteins. Each subfragment was designed to contain one or more surface loops. Results of initial antigenicity studies led to the construction of two additional GST-fusion proteins corresponding to the 17 amino acid βG-βH loop and a stretch of 17 amino acids at the VPl C-terminus.

Results Identification of linear B cell epitopes using Western blot analysis of GST fusion proteins

In addition to GST- VPl, a series of overlapping subfragments (GST-ΝT, GST-VP1.2, GST-VP1.3 and GST-VP1.4 - see Figure 8: amino acid numbering corresponds to SEQ ID No. 1) encompassing the complete VPl protein were expressed in E.coli as fusion proteins ligated to the C-terminus of GST (cloned into the multiple cloning site of pGEX 4T-1). The subfragment fusion proteins were designed to contain one or more surface loops, the regions found between the α-helices and the β-sheets (Figure 8).

GST control and GST-NT recombinant proteins proved to be highly soluble proteins over a range of conditions. GST- VPl has a low to medium solubility, whereas GST-VP1.2, GST-VP1.3 and GST-VP1.4 were highly insoluble even when induced at very low levels of IPTG and/ or at reduced temperatures (data not shown). The full-length GST-VP1, GST-NT, GST-VP1.2, GST- VPl .3, GST- VPl .4 and a GST control were loaded approximately equally, separated by reducing SDS-PAGE and stained with Coomassie blue (Figure 9A). The same panel of fusion proteins loaded at half the concentration shown in Figure 9 A were probed with antisera depleted of anti-GST antibodies. When probed with the rabbit hyperimmune serum to whole inactivated ERAV (RαERAV), the N-terminal GST-NT and full-length GST-VPl reacted strongly, whereas subfragments GST-VPl .2, GST-VPl .3 and GST-VPl .4 showed no reactivity (Figure 9B). This pattern of reactivity maps this strong B cell epitope to the N-terminal 23 amino acids of VPl (Figure 8), as these residues do not overlap with GST- VPl.2. When the same antigens were probed with individual convalescent horse sera (H(C)αERAV and H(G)αERAV), GST-NT and GST-VPl .4 showed some reactivity, whereas GST-VPl .2 and GST-VPl .3 showed some but generally lower reactivity (Figure 9C+9D). The pattern of reactivity obtained with both the RαERAV and individual HαERAV sera indicates the presence of a B cell epitope at the N-terminal region of VPl. The reactivity observed when the same proteins were probed with sera from the natural host, indicated that there is a further epitope toward the C-terminus of VPl, as evident by the increased reactivity of C-terminal subfragment GST- VPl.4. This pattern of reactivity shown in Figure 9C+9D was achieved consistently in many repeats of the Western blots.

[Note that horse sera were depleted of GST-reactive antibodies prior to use in a Western blot to eliminate false-positive reactions background problems due to binding of αGST antibodies to the GST fusion partner].

The epitopes present in GST-VPl .4 were mapped further. Two regions of this fragment, the βG-βH loop and the C-terminal region, are not predicted to be involved in structure and were considered likely to be exposed to antibodies (Figure 8) They correspond to 17 amino acids of the βG-βH loop (GST-GH; VPl aa residues 172 to 188) and a stretch of 17 amino acids at the extreme C-terminus of VPl (GST-CT; VPl aa residues 230 to 246). Each of these fusion proteins proved to be highly soluble, and bulk preparations of each were produced for further testing. The RαERAV and H^poolαERAV (two convalescent horse serum pooled and depleted of GST reactive antibodies) were used to probe GST-NT, GST-GH and GST-CT fusion proteins following separation by SDS-PAGE and Western blotting (Figure 10). Only GST-NT reacted when probed with RαERAV serum. The GST-GH and GST-CT fusion proteins were not expected to show reactivity since the original subfragment GST-VPl .4 that contained these regions was also non-reactive with this serum (Figure 9B). Like GST-NT, fusion proteins GST- GH and GST-CT both reacted with antibodies in H^poolαERAV, with GST-GH showing the strongest reactivity. Very weak reactivity was also observed for GST alone in the blot shown in Figure IOC, however this low level GST-specific reactivity was not always observed in other Western blots.

The reactivity of the small fusion proteins with these same sera was also tested in an ELISA assay. GST-NT, GST-GH, GST-CT and a GST control were used to coat ELISA plates and then screened with titrations of individual horse, rabbit or mice sera. The titres obtained for the various sera with the GST antigen were subtracted from the titres obtained with all other antigens to control for GST reactive antibodies, particularly in the horse sera. The titres of the various sera were consistently elevated when titrated on GST-NT or GST- CT coating antigen, interestingly, in contrast to the Western blot results, GST- GH gives the least reactivity when used as an antigen in an ELISA (data not shown). To test that GST-GH was actually binding in the ELISA plate wells, all antigens were coated and probed with titrated anti-GST serum. In this assay, GST, GST-NT, GST-GH and GST-CT all gave identical titres (data not shown), indicating that all of the fusion proteins were binding in the ELISA plate wells. It would seem that when used to coat ELISA plates the βG-βH loop is either not accessible to antibodies or not folded correctly. These results also indicate that GST-NT and GST-CT could be useful reagents in a diagnostic ELISA.

To confirm the presence of particular antibody specificities in horse sera fusion proteins, individual affinity chromatography columns were made by binding different fusion proteins to CnBr-activated Sepharose 4B. Firstly, GST- reactive antibodies were removed by adding a pool of convalescent horse sera (H^poolαERAV) to the GST-bound column, allowing binding and collecting the serum flow through. A portion of this αGST-depleted serum was then separately run down GST-NT, GST-GH or GST-CT columns to deplete the serum of reactive antibodies to these fusion proteins. To deplete the serum of multiple antibody specificities, the flow through was loaded onto each of the columns in series and the final flow through collected. These depleted sera were then used to probe all of the individual fusion proteins in a Western blot assay (Figure 11). Non-depleted and GST depleted sera reacted strongly with each of the three antigens (Figure HA, B+C lanes 1+2). In all instances, the depleted sera showed markedly reduced reactivity against the homologous antigen (that is, that used for depletion) (Figure 11 Panel A lanes 3, 6, 7; Panel B lanes 4, 6, 7; Panel C lanes 5, 6). Reactivity with non-homologous antigens, however, remained largely unaffected. For example, GST-GH depleted sera reacted most strongly with GST-NT or GST-CT (Figure 11A+C , lane 4), but showed little reactivity with GST-GH (Figure 11B, lane 4). Serum that was sequentially depleted by being adding to multiple columns, had reduced reactivity with multiple antigens corresponding to the affinity columns that had been used. For example, serum depleted of both GST-NT and GST-GH reactive antibodies reacted strongly with GST-CT but showed little reactivity with both GST-NT and GST-GH (Figure 11A,B+C, lane 7). This analysis indicates that the affinity columns removed fusion protein-specific antibodies from the serum and confirms that the VPl fragments present in each of the three fusion proteins contained B cell epitopes recognised by convalescent horse sera.

In an alternate assay, fusion protein-specific antibodies were affinity purified by the addition of H^poolαERAV to membrane-bound fusion protein, followed by elution with a low pH glycine buffer and concentration using a Centricon ultrafiltration unit. In a Western blot assay affinity -purified GST antibodies reacted with GST and the three GST-fusion proteins as expected (Figure 12A), whereas affinity purified αGST-NT, αGST-GH and αGST-CT antibodies reacted most strongly, if not completely, with the homologous antigen (Figure 12B, C and D). Together, these results confirm the presence of antibodies in convalescent horse sera that are specific for the ERAV VPl residues present in GST-NT, GST-GH and GST-CT fusion proteins.

Several approaches were adopted to determine if antibodies that specifically recognise the smaller fusion proteins were neutralising. A serum neutralisation (SN) assay was used to determine the presence of neutralising antibodies in variously depleted serum samples. Firstly, a SN assay was performed where H^poolαERAV was pre-incubated with equal amounts of either soluble GST-NT, GST-GH, GST-CT or GST immediately prior to the addition of pre-titrated virus (Table 2). This process was chosen since a single dilution of serum can be used for all samples whether they are to be depleted of antibodies or not, and the addition of different fusion proteins does not lead to any loss in potency of the serum since all samples are diluted equally. The horse serum with no added fusion protein repeatedly gave a titre in the range of 1568-2521, as did the same sera incubated in the presence of GST (titre range 1568-2000). When the serum was incubated with GST-NT or GST-CT however, the serum titre was consistently reduced (61%/ 49% and 49%/ 70% of GST-depleted titre respectively), suggesting that a significant proportion of the total neutralising antibodies within the pooled convalescent horse sera recognise these fusion proteins. When the same sera was incubated with GST-GH, no reduction in titre was observed (100%/ 121% of the GST-depleted titre). These results indicate that horse sera contains neutralising antibodies to the N-terminal and C-terminal regions of the ERAV VPl. From these results, the ERAV βG-βH loop does not appear to be a neutralising epitope in horses, suggesting that unlike FMDV which elicits a strong neutralising response to the βG-βH loop, the ERAV βG-βH loop may not be a neutralising epitope. Table 2. Convalescent horse sera contains neutralising antibodies that recognise GST-NT and GST-CT.

^a serum neutralisation (SN) titres were determined for a pool of two convalescent horse sera that were depleted for antibodies reactive to the various GST fusion proteins and tested in triplicate ^b Represents two independent assays ^c % of GST-depleted titre

Example 3 - A receptor-binding site in the N-terminal region of VPl.

Results in Example 1 showed that a GST fusion protein of the full-length ERAV VPl binds to permissive cells and that binding was inhibited in a dose- dependant manner by the addition of purified ERAV virions. No such binding was observed with the smaller fusion proteins GST-NT, GST-GH or GST-CT when screened by FACS (data not shown). This suggests that the receptor binding site of ERAV VPl may be outside these regions, that the fusion proteins may be incorrectly folded, or that the fusion proteins are too short to fold correctly. However an alternate assay that was used to determine if GST- VPl was binding to Vero cells, indicated that breakdown products of GST-VPl - which presumably contain the VPl N-terminal amino acids - were binding well. Hence, it was not clear why the GST-NT fusion protein does not bind.

Re-sequencing of the GST-NT clone detected a single nucleotide difference that led to an amino acid change in the fusion protein. Several differences to published sequence of 393/76 were found throughout the genome and most of the differences were due to sequencing errors in the original sequence. However, the sequence of another PCR product of this region confirmed that the error was within the GST-NT clone. The error was a change at VPl amino acid 14 which led to a non-conservative amino acid change from an E to a G, a change that could be expected to have a substantial effect on the folding of that region of the protein. Any change in folding is likely to have a dramatic effect on the ability of the protein to bind cellular receptors. Therefore, a new GST-NT clone was produced termed GST-NT2. Sequencing of this clone revealed that amino acid 14 was indeed an E residue, matching the ERAV reference sequence.

To determine if the corrected NT fusion GST-NT2 could bind to cells, soluble NT and NT2 were added separately to Vero cells and binding detected using the FACS assay used previously. GST-NT again did not bind Vero cells (data not shown). In contrast, GST-NT2 did bind Vero cells (data not shown) albeit at a lower level than the full-length VPl control (data not shown) also evident by the reduced RLMFI (6.7, 6.9 and 4.8, average of 6.1, for full length versus 3.5, 5.0 and 1.9, average 3.5, for GST-NT2). This result indicates that the amino acid change at position 14 from an E to a G in the GST-NT clone did affect the ability of that protein to bind cells. A reversion to authentic sequence improved the binding capability of GST-NT2, but not to a level comparable to the full-length VPl. There are several reasons why the binding of this fusion protein is reduced. Firstly, there may be multimeric species of GST-NT2 within the preparation, and secondly there may still be improvements that could be made to the GST-NT2 protein, such as an increase in length, that may further improve its ability to bind cells. However, the binding of this protein was broadly consistent over three independent assays including using two different protein preparations, indicating that this binding is authentic. Preliminary experiments to test the specificity of the GST-NT2 binding by allowing purified ERAV virions (15μg) to bind to Vero cells prior to the addition of GST-NT2, suggested that GST-NT2 binding can be inhibited.

Discussion of Examples 2 and 3 Our results in Example 1 demonstrated that ERAV VPl is a target of protective antibodies and is involved directly in viral attachment to host cells. In this study, we map the B cell epitopes to small N-terminal and C-terminal regions as well as providing evidence that the N-terminal region may be involved in binding to cells. To investigate which regions of VPl are important in B cell responses and receptor binding, four overlapping subfragments encompassing the entire ERAV VPl were expressed as GST-fusion proteins. The four subfragments had varying reactivities in a Western blot when probed with rabbit or horse antibodies raised against ERAV virions. The sera from a rabbit immunised with whole, inactivated ERAV reacted specifically against the N-terminal GST- NT fusion protein only. The convalescent sera from experimentally infected horses reacted primarily with the N-terminal and C-terminal (GST-VPl .4) fusion proteins. The pattern of reactivity obtained with RαERAV and individual HαERAV sera indicates the presence of a B cell epitope at the N-terminal region of VPl, whereas the HαERAV also indicates the presence of a further epitope toward the C-terminus of VPl.

To further map the B cell epitopes present in GST-VPl .4, two regions not predicted to be involved in structure, and therefore likely to be exposed to antibodies, were expressed as GST fusion-proteins. These corresponded to the βG-βH loop and a stretch of amino acids at the extreme C-terminus. The results show that in addition to the epitope located in the N-terminal region, the pooled horse sera also reacted with GST-GH and GST-CT. Of the three fusion proteins, GST-GH had the strongest reactivity in a Western blot assay, which was interesting since GST-GH showed the least reactivity in an ELISA and implicates an importance in the folding of this loop protein. These results suggest the fusion proteins contain B cell epitopes that resemble those present in native VPl, and like FMDV, the βG-βH loop and the C-terminus possess epitopes in the natural host.

The specificity of these reactions was confirmed using different forms of affinity chromatography. Affinity chromatography columns were used to deplete pooled horse sera of fusion protein-reactive antibodies where the depleted sera was shown to have markedly reduced reactivity for the homologous antigen. Secondly, horse antibodies were affinity purified by incubation with individual membrane-bound fusion proteins and eluting bound antibodies from the membrane. These antibodies were found to react most strongly, if not completely, with the homologous antigen. Taken together, these results confirm the presence of antibodies in convalescent horse sera specific for each of the GST-NT, GST-GH and GST-CT fusion proteins.

Immunisation of laboratory animals with each of GST-NT, GST-GH and GST-CT fusion proteins resulted in the production of antibodies that reacted specifically with viral VPl, again confirming the presence of authentic VPl epitopes within the small fusion proteins. As with GST-VPl, immunisation of mice did not produce neutralising antibodies to the small fusion proteins. The fact that horse sera depleted of GST-NT and GST-CT reactive antibodies showed a reduction in neutralising antibody titre in a SN assay, indicating these regions are involved to some extent in eliciting neutralising antibodies in the natural host.

An enhanced response may result from combining the epitopes from the small fusion proteins into a single peptide or fusion protein. A whole virion would be folded in such a way that various regions of the capsid would lie in close proximity to one another, despite appearing distant in a linear representation of the sequence. For example, some of the residues from the GST-NT, GST-GH and GST-CT proteins may be combined and separated by a diproline spacer to increase the likelihood of interaction between the sites through the presumed induction of a secondary structural turn. To dispense with the need of a carrier protein or fusion partner, cysteine residues could be placed at or near each terminus to aid polymerisation.

Many of the experiments performed above used the original GST-NT protein. Re-sequencing of this clone clearly showed a nucleotide error present where original sequence was ambiguous. The consequent amino acid change from a glutamic acid to a glycine at VPl position 14 appeared to disrupt the binding capability of the GST-NT fusion protein indicating that this residue is either important in the folding of this protein, or that this residue is directly involved in the receptor binding site. The mutation does not appear to affect the B cell epitope in this region since Western blot analysis shows similar reactivity for the GST-NT and GST-NT2 proteins.

Using the same flow cytometry approach used for GST-VPl, we attempted to reverse GST-NT2 binding by the addition of purified ERAV virions. We found that binding of GST-NT2 is inhibited to the level of the GST control by the addition of virus. This suggests that ERAV virions are binding to the same receptor on Vero cells that the GST-NT2 binds, thereby effectively blocking attachment of GST-NT2. In support of the ERAV N-terminal region being involved in binding to cell surface receptors on Vero cells, an alternate assay was used (cell absorption assay) to verify GST-VPl binding. This assay demonstrated that smaller breakdown products of GST-VPl were effectively removed from solution after a single absorption on Vero cells. These breakdown proteins contain an active GST fusion partner since the addition of Glutathione-Sepharose beads removes them from solution, and consequently the ERAV sequence within them must be N-terminal. The lower MW protein appears to be of a similar size to the GST-NT fusion protein which contains the N-terminal 51 amino acids of VPl. The effect of a mutation at position 14 suggests that this fusion protein can probably be truncated significantly as at least part of the receptor binding site appears to be at the extreme N-terminus of VPl. All publications mentioned in the above specification are herein incoφorated by reference. Various modifications and variations of the described methods and system of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention which are apparent to those skilled in molecular biology or related fields are intended to be within the scope of the invention.

Any discussion of documents, acts, materials, devices, articles or the like which has been included in the present specification is solely for the purpose of providing a context for the present invention. It is not to be taken as an admission that any or all of these matters form part of the prior art base or were common general knowledge in Australia in the field relevant to the present invention

Throughout this specification the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.

Sequence Listing

SEQ ID No. 1 - Amino acid sequence of VPl - from GenBank Accession No. L43052.

1 VTNVGEDGEPGETEPRHALS 20 21 PVDMHVHTDVSFLLDRFFDV 40 41 ETLELSNLTGSPATHVLDPF 60 61 GSTAQLAWARLLNTCTYFFS 80 81 DLELSIQFKFTTTPSSVGEG 100

101 FVWVKWLPVGAPTKTTDAWQ 120

121 LEGGGNSVRIQKLAVAGMCP 140

141 TWFKIAGSRSQACASALPY 160

161 TSMWRWPVFYNGWGAPTKE 180 181 KATYNWLPGAHFGSILLTSD 200

201 AHDKGGCYLRYAFRAPAMYC 221

221 PRPIPPAFTRPADKTRHKFP 241 i

241 TNINKQ 246

Claims

1. An isolated polypeptide comprising at least one antigenic determinant of Equine Rhinitis A virus (ERAV) VPl, wherein the polypeptide consists of at least 17 and less than 240 amino acids.

2. A polypeptide according to claim 1 wherein the polypeptide comprises at least one sequence selected from the group consisting of amino acids 1 to 23, 172 to 188 and 230 to 246 of the amino acid sequence shown as SEQ ID. No. 1.

3. A polypeptide according to claim 1 or claim 2 wherein the polypeptide consists of 150 amino acids or less.

4. A polypeptide according to claim 1 or claim 2 wherein the polypeptide consists of 100 amino acids or less.

5. An isolated polypeptide comprising an immunogenic fragment of ERAV VPl, or a variant or derivative thereof wherein the fragment comprises at least one sequence selected from the group consisting of amino acids 1 to 23, 172 to 188 and 230 to 246 of the amino acid sequence shown as SEQ ID. No. 1 or an immunogenic fragment, variant or derivative thereof and wherein the polypeptide is not identical to the amino acid sequence shown in SEQ ID No. 1.

6. A polynucleotide encoding a polypeptide according to any one of claims I to 5.

7. A vector comprising a polynucleotide according to claim 6 operably linked to a regulatory sequence permitting expression of the polynucleotide in a host cell.

8. A host cell comprising a vector according to claim 7.

9. A host cell according to claim 8 wherein the host cell is a bacterium.

10. A pharmaceutical composition comprising a polypeptide according to any one of claims 1 to 5, a polynucleotide according to claim 6 or a vector according to claim 7 together with a pharmaceutically acceptable carrier to diluent.

11. A vaccine composition comprising a polypeptide according to any one of claims 1 to 5, a polynucleotide according to claim 6 or a vector according to claim 7 together with a pharmaceutically acceptable carrier to diluent.

12. A method of treating or preventing or reducing the susceptibility to Equine Rhinitis A virus (ERAV) infection in a human or animal which comprises administering to the human or animal an effective amount of a polypeptide according to any one of claims 1 to 5, a polynucleotide according to claim 6 or a composition according to any one of claims 10 or 11.

13. A method for producing antibodies which recognise one or more epitopes within an ERAV VPl polypeptide which method comprises administering a polypeptide according to any one of claims 1 to 5, a polynucleotide according to claim 6 or a vector according to claim 7 to a human or animal.

14. A method for producing anti-ERAV neutralizing antibodies which method comprises administering a VPl polypeptide or immunogenic fragment thereof, or polynucleotide encoding said polypeptide, to a human or animal.

15. A method for selecting a compound capable of disrupting binding of a VPl polypeptide to its cognate cell surface receptor which method comprises: (i) providing a VPl polypeptide or a biologically active fragment, preferably a biologically active N-terminal fragment, thereof;

(ii) contacting a cell permissive for ERAV infection with the VPl fragment thereof in the presence or absence of a candidate compound;

(iii) determining whether binding of the VPl fragment to the cell is reduced or abolished in the presence of the compound; and (iv) selecting a candidate compound if the compound is determined in step

(iii) to reduce or abolish binding of the VPl fragment to the cell.

16. A method according to claim 15 wherein said fragment comprises amino acids 1 to 51 of the amino acid sequence shown in SEQ ID. No. 1 or a variant or derivative thereof.

17. A method of detecting the presence of anti-ERAV antibodies in a biological sample which method comprises:

(a) providing a polypeptide according to any one of claims 1 to 5;

(b) incubating a biological sample with the polypeptide under conditions which allow for the formation of an antibody-antigen complex; and

(c) determining whether an antibody-antigen complex comprising the polypeptide is formed.

18. A method of detecting the presence of ERAV in a biological sample which method comprises: (a) providing an antibody which reacts specifically with a polypeptide according to any one of claims 1 to 5 ;

(b) incubating a biological sample with the polypeptide under conditions which allow for the formation of an antibody-polypeptide complex; and

(c) determining whether an antibody-polypeptide complex comprising the antibody is formed.