WO2002083939A2

WO2002083939A2 - Controllable increase in the sensitivity of hybridisation detection

Info

Publication number: WO2002083939A2
Application number: PCT/DE2002/001319
Authority: WO
Inventors: Vladimir Mirsky
Original assignee: Vladimir Mirsky
Priority date: 2001-04-12
Filing date: 2002-04-10
Publication date: 2002-10-24
Also published as: WO2002083939A3; DE10164197A1

Abstract

The invention relates to a method for increasing the sensitivity of the detection of nucleic acid hybridisation, and for controlling said increase. To this end, at least one oligonucleotide is added to the solution, said oligonucleotide leading to the formation of long nucleic acid duplex structures as a result of hybridisation. The inventive method can be used not only with assays which are free of identifying marks but also with assays comprising identifying marks. Controlling the increase enables the dynamic region of the DNA or RNA chip to be enlarged.

Description

Controllable amplification of sensitivity in hybridization detection

It is of great importance to be able to detect certain nucleotide sequences for bioanalytical applications; some of these sequences are described in the following patents: EP 1 132398, EP1135510, US6287764, JP8191695, US6271444. US6271016, US627101 1, IL103766, IL98941, JP2001 128679, WO0155426, WO0155377. WO0155374, US6268549, EP1 123976, JP2001 103988, US20Ü101 1078, EP 1 1223 15. JP2001095581, JP2001078788, TW394776, WO0151631, WO0149828, EP 1 1 18670. TW420688, WO0146250, WO0146249, WO0146246, WO0146226. WO0146225, WO0146224, US6252140, US6252136, US6252046, US625 I 862, US6251664. US6251648, US6251634, US6251607, US6251586, US6251403. US6248589, US6248574. US6248554, US6248333, TW413702, TW402638, EP1 1 12358, CN 1300852, WO0144484. WO0144477, EP 1 1 10969, WOO 142481, WO0142452, WO0142448, WO0142447. US62455 I 5, US624222 I, US6242218, US6242193, RU2 I46705. RU2146292, RU2146290. EP1 108784, WO0140301, WO0139797, US6239331, US6238924, US6238918, US6238669. EP 1 106687, EP 1 105423, CN 1295081, CN1295126, CN1296015. US6235888, US6235514. US6235482, US6235290, US62321 10, US6232106, US6231863, CZ287715. CZ287619. WO0136457, WO0136456, WO0136455, WO0136442, US6229005, US6228609. US6225532, WO0132693, US6221849, US6221676, US6221640, IE62261 L, IE64966L. IE63126L, CZ20003421. CZ20001874, CZ20000867, CZ287810, AU731347, WOO 129200, WOO 129188, WOO 129082, US6218520, US6218508, US6218107, CZ9903146. CZ970049 I. CZ9700490, CZ9700488, CZ9005008, CZ286304, CZ286303, CZ286302, IE370289L. US6215048, US6215042, US621 1432, US6210943, US6197500, IE 174387L, IE 1572891. IE126185L, IE60488L, EP 1094069, WOO 125441, WO0125417, WO0125278, WO0124832. US619421 1, US6187548, US6172186, EP1092773, US6207810, US6207436, EP 1076720. NZ287563, JP 1 1290080, NZ314127, EP1043407, JP 1 1 192089. CA20633 16, EP0978570. US5370998, US5183737. US6054275, FR2768747, EP1 132398, NZ208282, AU7156100. EP1 132398, IE913456, GR3024963T, WO9206198, EP0551324, CA2091984, AU8656691. AU660945, JP9252787, FR2722509, EP0756006, CA2178526. US5656457, PL344145. CN 1291651, EP 10960 I 3, WO0100847, JP6046867, NZ229954, NZ260101, JP81 16998. JP6169779, FR2768747. US5215917, EP0391319, CA2013581, DK230890.

Various methods are known for the detection of nucleotide sequences or their genetic changes. This also includes nucleic acid hybridization. as described, for example, in the following patents: US5653939, EP0402917, WO9951778, US6087100, US6090933, US6071699, US6096273, DE 201 1 1754. DE201 1 1754, WO2001068913, JP2001299393, US2001046678, JP20001247 WO200, 1021072731, WO20020010107301, US63220001, WO2002001012, WO2002001010, WO2002001010, WO2002001010, WO2002001010, WO200101012, WO2002001010, WO20010107201 , WO2001025759, WO2001009388, WO9902730, WO9704129, EP286195, WO9102981, WO2001075166, WO2001021635, WO2001009378, JP2001033456, WO2000075276, WO2000062047. US6060237, JP2000125865, WO9606946, EP295965, WO8702066, US6054274, DE 19946296.

Hybridization is generally understood to mean the formation, under certain conditions, of base-pairing double-stranded nucleic acids from two completely separate, single-stranded nucleic acid molecules. A distinction is made between DNA-DNA hybridization, DNA-RNA hybridization, PNA-DNA

Hybridization, PNA-RNA hybridization and PNA-PNA hybridization distinguished. Various hybridization techniques, e.g. Saturation hybridization, plus-minus hybridization, sandwich hybridization,

Exhaustion hybridization, competition hybridization known. This

Hybridization methods are divided into liquid hybridization and hybridization on surfaces, e.g. B. Filter hybridization. In liquid hybridization (Fig. L a. B), both reactants are in one solution; in surface hybridization (Fig. 1c, d) one of the reactants is bound on one surface, which is then incubated in a solution that corresponds to the second Contains reactants. In order to suppress non-specific reactions between the nucleic acid in the solution and the surface, blocking reagents are usually added to the hybridization solution. Depending on the method used, the nucleic acid used as receptor can dev. consist of one (Fig. 1 a, c) or two (Fig. 1 b, d) nucleotides. To the nucleotide sequence

3'- a. a ₂ a ₃ ... a _n b ₁ b ₂ b ₃ ... b _m -5 '

To be able to detect either individual nucleotide sequences

5'- a ' ₁ a' ₂ a ' ₃ ... a ^, _n b' ₁ b ' ₂ b' ₃ ... b ' _m -3'

or separate partial sequences

5'- a'ι a ' ₂ a' ₃ ... a'n - and 5'-? '. b ' ₂ b' ₃ ... b ' _m -3' used. Here are a, and a ', (with / natural number from 1 to n) and b _s and b) (with j natural number from 1 to m) individual nucleotides of the nucleotide sequence, a, and a as well as h- and b', each complementary nucleotides.

The sequence 3'-a _? a ₂ a ₃ ... a _n bi b ₂ b ... b _m -5 'is the nucleotide sequence to be detected

Individual complementary nucleotides may be missing in the complementary sequences, e.g. B. the nucleotides a'i, a ' ₂ etc. at the 5' end of the sequence or the nucleotides b ' _m b' _m -ι tc. at the 3 'end of the sequence.

When using two nucleotide sequences, some nucleotides may be missing at either end of either sequence, e.g. B. in addition to the nucleotides mentioned also nucleotides a '"a' _n -ι etc. at the 3'-end of the first sequence and b ',, b' ₂ etc. at the 5'-endc of the second sequence, the first sequence a 'i a' ₂ a '... a' _n and the second sequence

b'i b ' ₂ b' ₃ ... b'm is.

The disadvantage of these methods is their often insufficient sensitivity.

In addition, when using this method for quantitative measurements (important for the measurement of RNA for the study of gene expression), there are often difficulties with the dynamic range, especially for applications in biochips (DNA array). Direct measurements of the hybridization on a DNA chip with fluorescent hybridization detection ensure concentration ratios between the maximum and the minimum concentrations of complementary DNA (RNA), which can be determined with an error of approx. 10%, of less than approx. 10: 1 (maximum 50 : 1 ). For many applications, especially in the field of proteomics (measurement of the RNA for determining the expression of different proteins), this dynamic range is not large enough. The concentration ratios of different RNA can differ by more than 1000 times.

In view of this problem, the object of the present invention is to create a method with which the hybridization detection can be carried out with greater sensitivity. The invention also enables the sensitivity of individual spots on the DNA or RNA or PNA chip to be controlled and thus considerably expands the dynamic range of the chips. The solution is that to detect the nucleic acid that the sequence

3'- ai a ₂ a ₃ ... a _n bη b ₂ b ₃ ... b _m -5 '

includes, in the measuring cell oligonucleotide with the sequence (further - "amplification sequence")

5'- b ' ₁ b' ₂ b ' ₃ ... b' _m a ' ₁ a' ₂ a ' ₃ ... a ^, _n -3'

is added (Fig. 2 a). As already mentioned, outer nucleotides may be missing in this sequence. However, the length of the complementary sequence must be long enough so that the melting point of the sequence

3'- a. a ₂ a ₃ ... a _n b ₁ b ₂ b ₃ ... b _m -5 '

after hybridization with

5'- b ' ₁ b' ₂ b ' ₃ ... b' _m a ' ₁ a' ₂ a ' ₃ ... a' _n -3 '

is above the temperature used in the analysis.

Between the sequences 5'-b'ι b ' ₂ b' ₃ ... b ' _m -3' and 5'-a 'a' ₂ a '... a' _n -3 '

there may be a spacer; in this case the whole sequence has the following structure:

5'- b'-i b ' ₂ b' ₃ ... b ' _m -spacer-a'i a' a ' ₃ ... a' _n -3 '. The spacer can consist of any chemical compounds, e.g. B. from biopolymers or oligomers (DNA, RNA, oligopeptides), synthetic polymers (polyethylene glycols, polyacrylic acid, etc.) or other chemical compounds. The spacer can also have certain labels (markings) which simplify the detection or improve the detection sensitivity directly or by forming further structures (for example via avidin-biotin binding). Examples of these labels are: radioactive labeling, dye, fluorophore, enzyme. Biotin, streptavidin, avidin, hapten, antibodies, His-Tag, nanoparticles. Liposomes, redox-active groups and molecules (especially feritin, porfirin, phthalocyanine, quinones, cytochromes), magnetic particles.

Hybridization results in a double-stranded nucleic acid (Fig. 2 b), which is longer in this process than nucleic acids from conventional processes (Fig. 2 b). 1); this enables the detection of the hybridization to take place with a much greater sensitivity. It is also important that this amplification can be controlled by changing the concentration of the added "amplification sequence". This method is particularly advantageous when hybridizing on the surface, for example on a filter, on micro- or nano-beads, on DNA Chips (or RNA or PNA chips) or on the surface of other sensors which are used for nucleic acid analyzes In this case, this invention makes it possible to increase the surface concentration of the nucleic acids to be detected Weiden used for hybridization detection, e.g. when using the following methods: radioactive labeling, mass spectroscopy, ellipsometry, surface plasmon resonance, UV spectroscopy, CD spectroscopy, Brewster angle microscopy, quartz microbalance, sensors with surface acoustic waves, interferometric sensors, Voltammetry, impedance spectroscopy, intercalating e Dyes, intercalating electrochemically active substances, enzymatic labeling. Markings with dyes, markings with electrochemically active substances. Labeling by ligands (avidin, biotin, His-Tag). The use of the possibility of controlling the sensitivity of individual hybridization spots enables the dynamic range of the DNA or RNA array to be expanded.

Example 1: Assessment of the gain effect

Using the Langmuir isotherm with a and b as the reciprocal binding constants of nucleotides A with A 'and B with B' (physically speaking, a and b are the concentrations of the complementary nucleotides at which half of the nucleotides on the surface with A ( A ') or B (B') is hybridized), we obtain the following calculated values θ _s for the respective layers / ^' (with natural number), which is the proportion of nucleotides to which the hybridization took place in the Λth layer , display (Fig. 3):

Degree of coverage of the first layer (s = 1), d. H. Proportion of nucleotides with hybridization in the first layer:

θ, = - (1) a + c

Degree of coverage of the second layer (s = 2), ie percentage of nucleotides with hybridization in the second layer: θ ₂ = θ _{l 7} ≤- = - ^ - - ^ - (2) b + ca + cb + c

Degree of coverage of the third layer (s = 3), i.e. H. Proportion of nucleotides with hybridization in the third layer:

θ ₃ = θ. (3) a + c (a + c) ² h + c

u. s. w.

The gain factor α can be seen as the ratio of the amount of DNA per unit surface area to the amount of DNA without the addition of the enhancement sequence

5'- b'-, b ' ₂ b' ₃ ... b ' _m a'. Define a ₂ ' ₃ ... a' _n -3 ', ie:

lim ö _, a = ^ - (4)

The calculation of the limit results in the following equation:

_{a =} (a ₊ b) {b ₊ c) -c ^> ₍₅₎ ab + bc + ac

If the bond is weak (b »c and / or a» c), α = l, i.e. the gain is approximately 1. If the bond is strong (b «c and a« c), the gain is:

α = - ^ 7 (6) a + b

If a ~ b «10 nanomoles / L (typical for 15-20-mer complementary nucleotides), an amplification factor of α * 1000 is obtained with a concentration of the amplification nucleotide of 10 μmole / L, ie the theoretical amplification amounts to the approx. 1000 times. Example 2. Extending the dynamic range of the hybridization array.

It follows from (5) or (6) that the amplification is dependent on the concentration of the amplification nucleotide added. The amplification can thus be controlled, which is important for the expansion of the dynamic range of hybridization arrays, in particular Hil ^¬ the quantitative RNA detection in proteomic applications (investigation of gene activity or protein expression). The example illustrates this application.

Let us consider a hybridization array for the detection of several different RNA of different concentrations in a measurement sample: let's denote the RNA with the highest concentration with RNA X (concentration eg 1 nanomole / L), the one with the lowest concentration with RNA Y (concentration eg 10 femtomole / L). The simultaneous measurement of all RNA using conventional methods leads to very large measurement errors, since the dynamic range of measurement systems (including differences in the amount of receptor sequences in different spots, limited signal / noise ratio of the measurement system, and other sources of error) is usually less than 100- is fold.

The new method enables much more precise measurements here. For this purpose, the corresponding amplification sequences are added in different concentrations. Let's add 10 μmole / L of the amplification sequence for RNA Y and the much smaller amount of 100 nmole / L of the amplification sequence for RNA X. The signals of the arrays balance each other out, and thus enable their simultaneous measurements. Since the added concentrations of amplification nucleotides are known, the concentrations of individual RNA types can be determined by calculation (see equations (5). (6)).

Example 3: Application of the new amplification method for the hybridization detection by means of surface plasmon resonance

The measurements were carried out using a Biosuplar-2 surface plasmon resonance spectrometer from Analytical μ-Systems (Regensburg, Germany). The gold-coated SPR substrates supplied by this company were coated with 16-Mercatohcxadekansäιιre, then NH ₂ -modified 30-mer ss-DNA oligonucleotides were immobilized on COOH groups via EDC activation. The amplification sequence was constructed as described in Example 4 and ordered from the company Interaktiva (Ulm, Germany). Hybridization was carried out in 1 M NaCl, 10 mM TRIS-HC1, pH 7.6. The Measurement without adding the amplification sequence does not allow detection of the hybridization: detection is only possible by adding the amplification sequence.

Example 4: Design of the amplification sequence

Patent EP 1076720 describes the nucleotide sequences for detection of EnterohemoiThagic Escherichia Coli (EHEC), e.g. :

SEρ ID N 15: 5 '- AATTCCCTTAATCCGGAGCTATTCGTATGA - 3' (A)

In order to obtain an amplification sequence for the detection of this sequence, we construct a complementary sequence:

3 '- TTAAGGGAATTAGGCCTCGATAAGCATACT - 5 ",

finally we divide this sequence into two parts (same or different length), e.g.

3 '- TTAAGGGAATTAGG- 5' and 3 '- CCTCGATAAGCATACT - 5',

move to:

3 '- CCTCGATAAGCATACT - 5' and 3 "- TTAAGGGAATTAGG- 5 '

and "connect":

3 "- CCTCGATAAGCATACTTTAAGGGAATTAGG- 5 '(B)

The resulting sequence (B) could be used as an amplification sequence in the detection of sequence (A). A spacer (short nucleotide sequence, polymer, etc.) can be inserted to avoid steric obstacles:

3 '- CCTCGATAAGCATACT-spacer-TTAAGGGAATTAGG- 5'

When using a labeled assay, e.g. this spacer contain a marker:

3 '- CCTCGATAAGCATACT-spacer-mark-spacer-TTAAGGGAATTAGG- 5'

The following is an explanation of the invention using the attached figures: Fig. 1: Conventional methods for hybridization in liquid phase (a, b) or on a surface (c, d) using a single (a, c) or multiple (b, d) nucleotide receptors.

Fig. 2: New method for hybridization in the liquid phase (a) or on a surface (b, c), in which due to the hybridization of the nucleotides to be detected

3'- a. a ₂ a ₃ ... a _n b ₁ b ₂ b ₃ ... b _m -5 '

and the added nucleotides 5'- b'i b ' ₂ b' ₃ ... b ' _m ' i a ' ₂ a' ... a ' _n -3' (a) long double-stranded nucleotides (b, c , d). When hybridizing on a surface, the nucleotide can be on the surface

5'- a ', a' ₂ a ' ₃ ... a' _n -3 '(c) or

5'- b'i b 'b' ₃ ... b ' _m a' _f a ' ₂ a' ... a ' _n -3'.

Fig. 3: Mechanism of amplification and sequential growth of the concentration of substances or markers per unit of the surface.

The nucleotide sequence to be detected: 3'- a. a ₂ a ₃ ... a _n bi b ₂ b ... b _m -5 '

The following sequence was immobilized on the surface: 5'- a'i a ' ₂ a' ₃ ... a ' _n -3'

The added reinforcement sequence:

y- b ' ₁ b' ₂ b ' ₃ ... b' _m a ' ₁ a' ₂ a ' ₃ ... a' _n -y

The possible spacer with or without labeling was designated M, a and b are the corresponding reciprocal binding constants of the nucleotides

3'- a ₁ a ₂ a ₃ ... a _n b ₁ b ₂ b ₃ ... b _m -5 'with 5'- a'. a ' ₂ a' ₃ ... a ' _n -3' or

5'- b ^ b ' ₂ b' ₃ ... b ' _m a'. a ' ₂ a' ₃ ... a ' _n -3' with 3'- aa ₂ a ₃ ... a _n / ?, b ₂ b ₃ ... b _m -5 '.

θj is the degree of coverage for the hybridized nucleotide layer "i" (see figure).

Fig. 4: Comparison of the SPR signals of the hybridization of a complementary DNA (l) and the adsorption of a non-complementary DNA (2) without amplification (a) or with amplification by adding the amplification sequence (b), which leads to the formation of longer ones DNA chains leads.

Claims

Controllable amplification of sensitivity in the detection of hybridization

1. A method for controllably increasing the sensitivity of Hybridisicrungsnachweismcthoden, characterized in that for better detection of the sequence

3'- a. a ₂ a ₃ ... a _n bi b ₂ b ₃ ... b _m -5 'of the nucleic acid, the nucleic acid with the sequence 5'- b'i b' ₂ b ' ₃ ... b' _m a ' i a ' ₂ a' ₃ ... a ' _n -3' is added.

Here denote:

3 'is the 3' end and 5 'the 5' end of the nucleic acid, a, and a) (with / natural number from 1 to n), b _j and b) (with) natural number from 1 to m) individual nucleotides of any nucleotide sequence, α, and α as well as b, and b ', are the complementary nucleotides.

2. A method for increasing the sensitivity of hybridization methods, characterized in that for better detection of the nucleic acid sequence

3'- ai a ₂ a ₃ ... a _n bi b ₂ b ₃ ... b _m -5 ', PNA (peptide nucleic acid) with the sequence b'i b' ₂ b ' ₃ ... b' _m a'i a 'a' ... a ' _{n is} added.

Here denote:

3 'the 3' end and 5 'the 5' end of the nucleic acid chain, a, and a'i (with / natural number from 1 to n), b _t and b) (with / natural number from 1 to m) individual nucleotides of any nucleotide sequence, α, and α ', and b, and b', are the complementary nucleotides.

3. Use of the method according to claim 1 to 2 for the detection of a PiOtein-nucleic acid sequence.

4. The method according to one or more of the preceding claims, characterized in that the added sequence can be represented as follows: b ' _x b'χ + ι b' _{x + 2} ... b ' _m a'i a' _2nd a '... a' _n -y with x, y natural numbers> l, m - x> 3, n - y> 3,

Partial edge nucleotides are thus missing from the sequences.

5. The method according to one or more of the preceding claims, characterized in that the nucleic acid sequences to be hybridized are not completely complementary to each other.

6. The method according to one or more of the preceding claims, characterized in that the nucleic acid added has a spacer between the partial sequences b 'and a':

5'- b'i b ' ₂ b' ₃ ... b'm-spacer-a'i a ' ₂ a' ₃ ... a ' _n -3', the spacer being an arbitrary chemical compound.

7. The method according to claim 6, characterized in that the spacer is an oligomer. in particular selected from polynucleotides, polypeptides, poly sugars, polyacrylic acid and their derivatives, polyethylene glycol and their derivatives.

8. The method according to one or more of the preceding claims, characterized in that the nucleic acid added has a label.

9. The method according to one or more of the preceding claims, characterized in that the spacer has a label.

10. The method according to one or more of the preceding claims, characterized in that the label is selected from the following group: radioactive label, dye, fluorophore, enzyme, biotin, streptavidin, avidin, haptcn. Antibodies, His-Tag, nanoparticles, liposomes, redox-active groups and molecules, especially feritin, porfirin, phthalocyanine, quinones, cytochromes, magnetic particles.

1 1. The method according to one or more of the preceding claims, characterized in that the hybridization on the surface, in particular on a DNA chip, RNA chip, PNA chip, nanoparticles, electrode surface, Lichtlciter surface. Piezo crystal surface, glass surface, polymer surface, metal surface, silicon or silicon oxide surface takes place.

12. The method according to one or more of the preceding claims, characterized in that one of the following technologies is used for the detection of hybridization: surface plasmon resonance. radioactive measurement. Quartz crystal microbalance, electrochemical impedance, surface acoustic waves. Fluorescence, ellipsometry. Colorimetry, signals of oxidation or reduction of the redox-active molecules and interferometry, thermometry.

13. The method according to one or more of the preceding claims, characterized in that the sequence of the nucleotides 3'- a? a ₂ a ₃ ... a _n bi b ₂ b ₃ ... b _m -5 'an area of the sequences important for the detection, in particular of pathogens microorganisms, the modification area of the gene-modified organisms, the disease-causing area of the human genome, the area of the human genome linked to a disease, the apoptosis-relevant area of the human genome, in particular p53, is the same.

14. Sequence of chemically bound nucleotides (DNA, RNA, PNA) consisting of sequences of nucleotides 5'- / _>'. b ' ₂ b' ₃ ... b ' _m —a'i a' ₂ a ' ₃ ... a' _n -3 'characterized in that the sequence 3'- a- aa ₃ ... a _n bi b ₂ b ₃ ... b _m -5 'is part of one of the following sequences: pathogenic microorganisms, modification region of the modified organisms, disease-causing region of the human genome, region of the human genome linked to a disease, apoptosis region of the human genome, especially p53. Denote here: 3 'the 3' end and 5 'the 5' end of the nucleic acid, a, and a (with / natural number from 1 to n), b _s and b (with j natural number from 1 to m) are individual nucleotides of any nucleotide sequence, a, and a'i and b, and b ', are the nucleotides which are complementary to each other.

15. Sequence of chemically bound nucleotides (DNA, RNA, PNA) consisting of the sequences of nucleotides 5'- b'i b ' ₂ b' ₃ ... b ' _m -spacer- a'i a' ₂ a ' ₃ ... a ' _n -3' characterized in that 3'- a _? a ₂ a ₃ ... a _n bi b ₂ b ... b _m -5 'contain a part or a whole sequence of the nucleotides described in one or more of the patents mentioned below: EP 1 132398, EP1 135510, US6287764, JP8191695, US6271444, US6271016. US627101 1, IL103766, 1L98941, JP2001128679, WO0155426, WO0155377, WO0155374. US6268549, EP 1 123976, JP2001 103988, US200101 1078, EP 1 1223 15, JP20010955 1, JP2001078788, TW394776, WO0151631, WO0149828, EP 1 1 18670, US6262342. US6262244, US6255473, US62551 13, US6255077, US6255078, US6255077, US6255064, TW420688, WO0146250, WO0146249, WO0146246, WO0146226, WOO 146225, WOO 146224, US6252140, US6252136, US6252046, US6251862, US6251664, US6251648, US6251634, US6251607, US6251586, US6251403 , US6248589, US6248574, US6248554, US6248333, TW413702, TW402638, EP1 1 12358, CN1300852, WO0144484, WO0144477. EP1 1 10969, WOO 142481, WO0142452, WO0142448, WO0142447, US6245515. US6242221, US6242218, US6242193, RU2146705, RU2146292, RU2146290, EP 1 108784. WO0140301, WO0139797, US6239331, US6238924, US6238918, US6238950, EP1 10668760, US5038, US62389, US62389, US62389, US62389, US62389, US62389, US62389, US6238, US62389, US6238, US62389, US62389, US62389, US62389, US62389, US6238, US6238950 WOO 136456, WOO 136455, WOO 136442, US6229005, US6228609, US6225532, WO0132693, US6221849, US6221676, US6221640, IE62261 L, IE64966L, IE63126L, CZ20003421, CZ20001873, CZ200781008, CZ2878001802, CZ2878001802, CZ2878001002, US6218508, US6218107, CZ9903146, CZ9700491, CZ9700490, CZ9700488, CZ9005008, CZ286304, CZ286303, CZ286302, IE370289L, US6215048, US6215042, US621 1432, US6210943, IE6287LL. IE126185L, IE60488L, EP 1094069, WO0125441, WO0125417, WO0125278, WO0124832, US619421 1, US6187548, US6172186, EP1092773, US6207810, US6207436, EP 1076720. NZ287563, JP114127207, EP1 19209706, EP1 129339701, JP114320770, EP1 14339701, EP1 127339701, EP1 19203706, EP1067710, JP112900620, EP112127006, EP1106116 US5183737, US6054275, FR2768747, EP1 132398, NZ208282, AU7156100, EP1 132398, IE913456, GR3024963T, WO9206198, EP0551324, CA2091984, AU8656691, AU660945, JP9252787, FR277585616, EP0 132178465, EP0 132178506, EP0 132178, EP0 132328, , NZ229954, NZ260101, JP81 16998, JP6169779, FR2768747, US5215917, EP0391319, CA2013581, DK230890, or nucleotides that are complementary to or a part of the aforementioned. Here: 3 'denote the 3' end and 5 'the 5' end of the nucleic acid, a, and a '(with / natural number from 1 to n) and b _j and b) (with j natural number from 1 to m) individual nucleotides of any nucleotide sequence, a, and _ / ', and b, and b' - nucleotides complementary to one another.

16. Sequence according to claims 14 to 15, characterized in that a spacer is inserted between b ' _m and a'i, the spacer being any chemical compound, in particular selected from polynucleotides, polypeptides, poly sugars, polyacrylic acid and its derivatives, polyethylene glycol and their Derivatives, is.

17. Sequence according to claim 16, characterized in that the spacer has a label.

18. Sequence according to claim 17, characterized in that the label is selected from the following group: radioactive label. Dye, fluorophore. Enzyme, biotin, streptavidin, avidin, hapten, antibodies, His-Tag, nanoparticles, liposomc, redox-active groups and molecules, especially feritin, porfirin, phthalocyanine, quinones, cytochromes, magnetic particles.