WO2002083727A2

WO2002083727A2 - Nucleic acid sequences of hyperplasies and tumors of the thyroid

Info

Publication number: WO2002083727A2
Application number: PCT/EP2002/004090
Authority: WO
Inventors: Jörn Bullerdiek
Original assignee: Universität Bremen
Priority date: 2001-04-12
Filing date: 2002-04-12
Publication date: 2002-10-24
Also published as: AU2002310840A1; WO2002083727A3; EP1377607A2; DE10118452A1; JP2005503123A

Abstract

The invention relates to a nucleic acid that has a modified expression caused by hyperplasies and/or tumors, said nucleic acid comprising a nucleic acid sequence selected from the group including SEQ.ID.No. 1 to 12 and SEQ.ID.No. 16 to 19.

Description

Nucleic acid sequences from hyperplasias and thyroid tumors

description

The present invention relates to nucleic acids with changed expression in hyperplasias and / or tumors, nucleic acids coding for the human homologues to CAT, DC2, hereinafter also referred to as CAT and DC2, and PKCgamma and in particular homologues thereof, vectors and cells containing them encoded polypeptides, antibodies directed against it, methods for determining compounds suitable as tumor therapeutic agents, methods for determining genes which are involved in the development of thyroid tumors and uses of the said nucleic acids.

The importance of the thyroid gland as a result of its hormone production for the control of the growth and development of the body has long been known in medicine, as has the obvious changes, at least in some cases, in the true sense of the word, with a dysfunction of this gland.

With regard to the pathogenesis of goitre and thyroid tumors in general, it has not yet been possible to develop a comprehensive idea, particularly at the molecular level. Two concepts are currently under discussion, one of which is based on the assumption that the hyperplastic tissue is considered conditional as a result of chronic stimulation by a trophic hormone, which ultimately results in the growth of polyclonal nodes. This concept is called non-neoplastic endocrine hyperplasia (NNEH). The second concept assumes that the nodes represent real clonal tumors.

In the case of the thyroid gland, it has been shown that the simple concept of non-neoplastic endocrine hypoclasia applicable to other glands is not applicable. An overview of the considerations currently being made in this area can be found in Studer, H. (1995); Endocrine Reviews, Vol. 16, No. 4, pages 411-426.

For the treatment of goitre and thyroid tumors, an early diagnosis is necessary in order to use suitable therapeutic concepts. The present invention is based on the object of providing means for the diagnosis and therapy of functional disorders of the thyroid gland, hyperplasia of the thyroid gland and tumors of the thyroid gland at the molecular level, in particular nucleic acid sequences which are involved in and are also suitable for the pathogenicity mechanisms are to be provided investigate, as well as those that affect or can influence the pathogenicity mechanisms.

In addition, medicines based thereon and pharmaceutical compositions in general are to be provided.

Furthermore, kits for the diagnosis and / or therapy of functional disorders of the thyroid gland, hyperplasia of the thyroid gland and tumors of the thyroid gland as well as methods for detecting these are to be provided.

According to the invention the object is achieved by the subject matter of the independent claims. Further embodiments result from the subclaims.

According to the invention, the object is also achieved in a first aspect by a nucleic acid with changed expression in hyperplasias and / or tumors, wherein it comprises a nucleic acid sequence which is selected from the group SEQ. ID. No. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 16, 17, 18 and 19, hereinafter also as SEQ. ID. No. 1 to 12 and SEQ. ID. No. 16-19.

In one embodiment it is provided that the tumor is selected from the group comprising epithelial tumors with a change in the chromosomal band 19q and tumors with a change in the chromosomal band 19ql3.

In a further embodiment it is provided that the hype phlasia is selected from the group comprising hype phlasias of the thyroid gland.

A still further embodiment provides that SEQ. ID. No. 1, 2, 7, 10, 11 and / or 12 encoded for a CAT, in particular a human CAT, or a part thereof. In a further embodiment it is provided that SEQ. ID. No. 3, 4, 8, 16 and / or 17 for a DC2, in particular a human DC2, or a part thereof.

In a still further embodiment it is provided that SEQ. ID. No. 5, 6, 9, 18 and / or 19 for PKCgamma, in particular human PKCgamma, or a part thereof.

In a further aspect, the object is achieved according to the invention by a nucleic acid comprising a nucleic acid sequence which would code for the same amino acid sequence without the degeneracy of the genetic code as one of the nucleic acid according to the invention.

In a further aspect, the object is achieved according to the invention by a nucleic acid which hybridizes to or with one of the nucleic acids according to the invention.

In a still further aspect, the object is achieved by a vector, the vector comprising at least one of the nucleic acids according to the invention.

One embodiment provides that the vector further comprises at least one element which is selected from the group comprising promoters, terminators and enhancers.

Another embodiment provides that the vector is an expression vector.

In yet another embodiment it is provided that at least one promoter is in the reading frame with at least one part of a nucleic acid coding for a polypeptide according to one of Claims 1 to 8.

In a further aspect, the object is achieved according to the invention by a polypeptide which is encoded by one of the nucleic acids according to the invention.

In one embodiment it is provided that the polypeptide is modified.

In a further aspect, the object is achieved according to the invention by a cell, in particular an isolated cell, which comprises a vector according to the invention. In a further aspect, the object is achieved according to the invention by an antibody which is directed against a polypeptide according to the invention.

In one embodiment it is provided that the antibody is directed against a nucleic acid according to the invention.

In a further aspect, the object is achieved according to the invention by a ribozyme which is directed against a nucleic acid according to the invention.

In one embodiment it is provided that the ribozyme comprises at least part of one of the nucleic acids according to the invention.

In a further aspect, the object is achieved according to the invention by an anti-sense nucleic acid comprising a sequence which is complementary or identical to one of the nucleic acids according to the invention.

In a further aspect, the object is achieved according to the invention by RNAi comprising a sequence which is complementary to or identical to one of the nucleic acids according to the invention, the RNAi preferably comprising a region with a length of 21 to 23 nucleotides which is complementary or identical ,

In a further aspect, the object is achieved according to the invention by a method for determining a compound which influences, in particular inhibits, the action of a translation product of a nucleic acid according to one of the preceding claims, characterized by the following steps:

Providing the translation product and the compound

Contacting the translation product and the compound in a system representing the effect of the translation product, and Determine whether a change in the effect of the translation product occurs under the influence of the compound.

In a still further aspect, the object is achieved according to the invention by a method for determining a compound which influences, in particular inhibits, the action of a transcription product of a nucleic acid according to one of the preceding claims, characterized by the following steps:

Providing the transcription product and the connection

Contacting the transcription product and the compound in a system representing the effect of the transcription product, and

Determine whether a change in the effect of the transcription product occurs under the influence of the compound.

In one embodiment of the two methods according to the invention mentioned above, it is provided that the system is selected from the group comprising cellular expression systems, cell-free expression systems, assay for determining the interaction between compound and translation products, and assay for determining the interaction between compound and transcription products.

In a further aspect, the object is achieved according to the invention by a method for determining genes which are responsible for the formation of hypoplastic and tumors, in particular the thyroid, comprising the following steps:

Determining the breakpoints in the case of chromosomal translocations of the hypoplastic and tumors,

Determining genes that are within a range of 400 kbp, preferably 150 kbp, in any direction from the breakpoint range, and Determine whether the translation / transcription of the gene in a cell of Hypeφlasie or the tumor is changed compared to a non-Hypeφlasie cell or a non-tumor cell.

In a still further aspect, the object is achieved according to the invention by using one of the nucleic acid and / or a ribozyme according to the invention and / or an antisense nucleic acid and / or an RNAi according to the invention for the diagnosis and / or therapy of functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors.

In a further aspect, the object is achieved according to the invention by using one of the nucleic acid and / or a ribozyme according to the invention and / or an antisense nucleic acid and / or an RNAi according to the invention for the manufacture of a medicament, in particular for the therapy and / or prevention of Functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors.

In a further aspect, the object is achieved according to the invention by using a polypeptide according to the invention for the diagnosis and / or therapy of functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors.

In a further aspect, the object is achieved according to the invention by the use of a polypeptide according to the invention for the manufacture of a medicament, in particular for the therapy and / or prevention of functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors.

In a further aspect, the object is achieved according to the invention by using an antibody according to the invention for the diagnosis and / or therapy of functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors.

In a further aspect, the object is achieved according to the invention by using an antibody according to the invention for the production of a medicament. In a still further aspect, the object is achieved according to the invention by a kit for diagnosing functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors, characterized in that the kit comprises at least one element which is selected from the group comprising a Nucleic acid, a vector, a polypeptide, a cell, an antibody, an antisense nucleic acid, RNAi and a ribozyme, each according to the present invention.

In a further aspect, the object is achieved according to the invention by a method for detecting functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or tumors of the thyroid gland, characterized by the steps:

Contacting thyroid material with the agent selected from the group comprising a nucleic acid, a vector, a polypeptide, an antibody, an antisense nucleic acid, RNAi, a ribozyme and a cell, each according to the present invention, and

Determine whether there are malfunctions of the thyroid gland and / or hypothyroidism of the thyroid gland and / or tumors of the thyroid gland.

One embodiment provides that the thyroid material is present ex vivo.

In a further aspect, the object is achieved according to the invention by using a nucleic acid according to the invention as a primer and / or as a probe.

In a still further aspect, the object is achieved according to the invention by a primer for displaying and / or screening and / or detecting a nucleic acid, the primer or the probe being complementary to part of one of the nucleic acids according to the invention or identical to it.

In a further aspect, the object is achieved according to the invention by a method for representing a nucleic acid which comprises a sequence which can be detected in thyroid tumors or goitre in which a translocation with a breaking point in the chromosome mosomal band 19ql3 is present, the sequence lying within the cliromosomal band 19ql3, characterized in that the method comprises the steps:

Provision of at least one of the primers according to the invention, for carrying out a polymerase chain reaction,

Provide a nucleic acid sequence taken from band 19ql3 of human chromosome 19 or one of the nucleic acid according to the invention according to one of the

Mixing the nucleic acid sequence or the nucleic acid with the primers,

Perform a polymerase chain reaction.

In a further aspect, the object is achieved according to the invention by a pharmaceutical composition, characterized in that it comprises:

at least one agent selected from the group comprising a nucleic acid, a vector, a polypeptide, a cell, an antibody, an antisense nucleic acid, RNAi, a ribozyme, each in accordance with the present invention, and combinations thereof, and

at least one pharmaceutically acceptable carrier.

In a still further aspect, the object is achieved according to the invention by a method for the treatment and / or prophylaxis of tumors and hypoplasia, it being provided that a compound is administered to a patient which prevents or amplifies the effects of the changed expression of one of the nucleic acids according to the invention ,

In a further aspect, the object is achieved according to the invention by the use of a compound which prevents the effects of the changed expression of the nucleic acids according to one of the preceding claims for the manufacture of a medicament. In one embodiment it is provided that the medicament is for the treatment and / or prophylaxis of tumors and / or hypoplasias, in particular tumors and / or hypoplasias of the thyroid gland.

In a further aspect, the object is achieved according to the invention by using a nucleic acid with a sequence, the sequence being selected from the group comprising SEQ. ID. No. 1 - 12 and SEQ. ID. No. 16 - 19 comprises, or derivatives thereof and / or encoded polypeptides or derivatives thereof for the manufacture of a medicament, in particular for the treatment of functional disorders of the thyroid gland and or hypothyroidism of the thyroid gland and / or thyroid tumors and / or for the manufacture of a diagnostic agent, in particular for the Diagnosis of functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors.

In one embodiment it is provided that the polypeptide has an amino acid sequence according to SEQ BD No. 13, SEQ ID No. 14 and / or SEQ. ID No. 15 has.

In a further embodiment it is provided that the nucleic acid with the nucleic acid according to one of the sequences SEQ ID No. 1 - 12 and / or SEQ ID No. 16-19 would hybridize without the degeneracy of the genetic code.

In a further aspect, the object is achieved according to the invention by using a polypeptide with a sequence, the sequence being selected from the group consisting of SEQ. ID. No. 13-15, or derivatives thereof for the manufacture of a medicament, in particular for the treatment of functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors and / or for the manufacture of a diagnostic agent, in particular for the diagnosis of functional disorders of the thyroid gland and / or Hypothyroidism of the thyroid gland and / or thyroid tumors.

In a further aspect, the object is achieved according to the invention by a method for screening an agent for treating functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors and / or a diagnostic agent for the diagnosis of functional disorders of the thyroid gland and / or hypothyroidism Thyroid and / or thyroid tumors, comprising the steps: a) providing a candidate connection, b) providing an expression system and / or activity system; c) contacting the candidate connection with the expression system and / or the activity system; d) determining whether, under the influence of the candidate compound, the expression and / or the activity of a nucleic acid with a sequence, the sequence being selected from the group comprising SEQ. ID. No. 1 - 12 and SEQ. ID. No. 16-19 comprises, or derivatives thereof and / or polypeptides encoded and / or polypeptides with a sequence according to SEQ. ED. No. 13 - 15 or derivatives thereof is changed.

In one embodiment it is provided that the candidate connection is contained in a connection library.

In a further embodiment it is provided that the candidate compound is selected from the group of compound classes which comprises peptides, proteins, antibodies, anticalins, functional nucleic acids and small molecules.

In yet another embodiment it is provided that the functional nucleic acids are selected from the group comprising aptamers, aptazymes, ribozymes, Spiegelmers, antisense oligonucleotides and RNAi.

In a further aspect, the object is achieved according to the invention by using a nucleic acid with a sequence, the sequence being selected from the group comprising SEQ. ID. No. 1 - 12 and SEQ. ID. No. 16-19 comprises, or derivatives thereof and / or encoded polypeptides or derivatives thereof and / or a polypeptide with a sequence according to SEQ. ID. No. 13-15 or a derivative thereof and / or an especially natural interaction partner of a nucleic acid with a sequence, the sequence being selected from the group consisting of SEQ. ID. No. 1 - 12 and SEQ. ID. No. 16-19 comprises, or derivatives thereof and / or polypeptides encoded thereof or derivatives thereof and / or a nucleic acid coding therefor and / or the interaction partner of a polypeptide with a sequence according to SEQ. ID. No. 13 - 15 or a derivative thereof as a target molecule for development and / or Production of a diagnostic agent for the diagnosis of functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors, and / or for the development and / or manufacture of a medicament for the prevention and / or treatment of functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors.

In one embodiment it is provided that the medicament or the diagnostic agent comprises an agent which is selected from the group comprising antibodies, peptides, anticalins, small molecules, antisense molecules, aptamers, Spiegelmers and RNAi molecules.

In one embodiment it is provided that the agent with a polypeptide with a sequence according to SEQ. ID. No. 13-15 or a derivative thereof or an interaction partner thereof.

In a particularly alternative embodiment, it is provided that the agent interacts with a nucleic acid with a sequence, the sequence being selected from the group consisting of SEQ. ID. No. 1 - 12 and SEQ. ID. No. 16-19 comprises, or derivatives thereof and / or with a nucleic acid coding for an especially natural interaction partner, in particular with mRNA, genomic nucleic acid or cDNA.

In a further aspect, the object is achieved according to the invention by using a polypeptide which interacts with a peptide which is encoded by a nucleic acid with a sequence, the sequence being selected from the group comprising SEQ. ID. No. 1 - 12 and SEQ. ED. No. 16-19 comprises, or derivatives thereof and / or a polypeptide according to SEQ. ID. No. 13 - 15 and / or with a particularly natural interaction partner thereof interacts for the development or manufacture of a diagnostic agent for the diagnosis of functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors, and / or for the development or manufacture of a medicament for prevention and / or treatment of functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors. In one embodiment it is provided that the polypeptide is selected from the group comprising antibodies and binding polypeptides.

In a further aspect, the object is achieved according to the invention by using a nucleic acid which interacts with a polypeptide, the polypeptide being encoded by a nucleic acid with a sequence, the sequence being selected from the group comprising SEQ. D. No. 1 - 12 and SEQ. ED. No. 16-19 comprises, or derivatives thereof and / or a polypeptide according to SEQ. ED. No. 13 - 15 and / or with a particularly natural interaction partner thereof for the development or manufacture of a diagnostic agent for the diagnosis of functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors, and / or for the development or manufacture of a medicament for prevention and / or Treatment of functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors.

In one embodiment it is provided that the nucleic acid is selected from the group comprising aptamers and Spiegelmers.

In a further aspect, the object is achieved according to the invention by using a first nucleic acid which interacts with a second nucleic acid, the second nucleic acid having a sequence, the sequence being selected from the group comprising SEQ. ID. No. 1 - 12 and SEQ. ED. No. 16-19, or derivatives thereof and / or interacts with a nucleic acid which is suitable for an interaction partner of a polypeptide with a sequence according to SEQ. ID. No. 13, 14 or 15 coded, for the development or manufacture of a medicament for the prevention and / or treatment of functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors.

In one embodiment it is provided that the first nucleic acid interacting is an antisense oligonucleotide, a ribozyme and / or RNAi.

In a further embodiment it is provided that the second nucleic acid is the respective cDNA or mRNA. In a further aspect, the object is achieved according to the invention by a pharmaceutical composition comprising at least one agent which is selected from the group as defined by at least one of the uses according to the invention and at least one pharmaceutically acceptable carrier, in particular for the prevention and / or treatment of functional disorders Thyroid and / or hypothyroidism of the thyroid and / or thyroid tumors.

In a further aspect, the object is achieved according to the invention by means of a kit for characterizing the state of a thyroid gland or a tissue which builds it up or one or more cells which build it up, comprising at least one agent which is defined by at least one of the uses according to the invention.

The present invention is based on the surprising finding that there are a number of genes or nucleic acid sequences, the expression of which compared to normal tissue can be associated with the occurrence of tumors and hypothyroidism and seems to be causally connected with it.

In the context of the present invention, it was found that, in the case of certain hyperslasias or tumors, there is a change in the expression of certain genes or sequences. The change here is intended either to increase expression or to increase

the expression can be understood. The measure of expression of the gene in question or the sequence in question in cells or tissues, which is or is different from cells of the hypoplastic or tumors, serves as a reference.

The tumors in question include the first group of epithelial tumors, in particular those with a change in the chromosomal band 19q, and the second group of tumors which have a change in the band 19ql3. Change is to be understood here to mean in particular a chromosome translocation, chromosome deletion, chromosome insertion and chromosome inversion.

The first group of tumors in particular also includes tumors of the thyroid gland and preferably epithelial tumors of the thyroid gland. The second group of tumors to ^¬ summarizes, among other things, leukemia (such as chronic lymphocytic leukemia, acute myeloid Leu kemia), B-cell lymphomas, gliomas, malignant fibrous histocytomas, osteosarcomas, leiomyosarcomas, liposarcomas, ovarian tumors, breast tumors, kidney carcinomas, pancreatic carcinomas and gallbladder carcinomas.

According to the WHO classification, the tumors of the thyroid are mostly epithelial in origin and can be divided into benign and malignant forms. In benign thyroid tumors, a distinction is made between "real" adenomas and thyroid hypoglasias (benign, adenomatous goiter nodules), which are referred to as "tumor-like lesions". These hypypelasias are usually polyclonal nodes and often have a variable, macrofollicular structure, with incomplete capsule formation. In contrast, thyroid adenomas are encapsulated tumors that are derived from the follicular epithelium. These mostly solitary tumors have a uniform structure and differ structurally from the adjacent thyroid tissue. They can be subdivided microscopically (fine tissue) according to their degree of differentiation into normofollicular (simple / simple), macrofollicular (colloid), microfollicular (fetal), trabecular or solid (embryonic) adenomas.

The abbreviation CAT used here stands for "cationic amino acid transporter" (transporter for cationic amino acids). This transporter is responsible for the transport of cationic amino acids and thus for the supply of cells with amino acids. As a result of the fact that some of the amino acids act as neurotransmitters some of the transporters are also involved in signal forwarding, and it cannot currently be ruled out that CAT-A may have a different function.

The homology found in the context of the present invention is based on a comparison of the human sequences with CAT3 from Rattus norvegicus.

The well-known DC2 is a ubiquitous protein in cells that was first described in connection with Sophosila and there in connection with early embryonic development. DC2 has protein kinase activity. In humans, DC was first described in conjunction * ^¬ han gö with dendritic cells.

PKCgamma here stands for protein kinase C gamma, which mediates the phosphorylation of serine and threonine and is thus involved in the regulation of transcription. in this respect already results from this general function of protein kinase C garnma that this is a target that allows an intervention in the transcription process in the cell and thus also a starting point for both the diagnosis and the therapy of tumors and hypersplasias, as described here are offers. What was surprising for the inventors was the finding that this factor influencing the transcription is of central importance for the events in connection with the tumors described here.

It is within the scope of the present invention that the sequences according to the invention also include the respective complementary sequences.

The scope of the present invention also includes those nucleic acid sequences which, in particular under the standard conditions for Northern blot hybridizations, for the detection of single-copy sequences with the sequences according to SEQ.ID.No 1 to SEQ.ID.No. Hybridize 12.

The method according to the invention for determining a compound which influences the action of a translation product of one of the nucleic acids according to the invention can also be a method for screening a compound library. Compound libraries of this type are preferably libraries of low molecular weight compounds. Basically, the procedure is such that the translation product of one of the nucleic acids according to the invention is brought into contact with a compound in a system, the system representing the action of the said translation product and thus an action of the compound on the translation product or in the form of a detectable signal , This effect can be expressed, for example, in a changed function with regard to strength, substrate specificity (recognition, binding, transport) and / or receptor specificity or affinity or the membrane association, i.e. in the signal forwarding. The effect could also have an impact on enzymatic processes in the cell. The effect can be checked both in the cell-free, in the cellular system, in cell culture and in transgenic animal models (in vitro, in vivo and in situ).

Insofar as reference is made in the present methods or applications relating to tumors or Hypeφlasien should here under all be understood herein in connection with the nucleic acids according to Inventive ^¬ disclosed tumors or Hypeφlasien comprises. The present nucleic acid sequences thus open up new possibilities both for diagnosis and for therapy and for examining the mechanisms associated with the occurrence of goitre and thyroid tumors or thyroid carcinomas. In particular, knowledge of the sequence gives the possibility of i. Suitable diagnostic or therapeutic agents at the molecular level. S. of - pharmaceutical - compositions and medicines to be used directly or indirectly.

The nucleic acid sequences according to the invention can be used in a manner known to those skilled in the art for the design of suitable diagnostically and therapeutically usable agents in the above sense, as well as kits and methods.

Nucleic acid is understood to mean both DNA sequences and RNA sequences, including hybrids thereof, including derivatives derived therefrom with a modified backbone, such as PNA and LNA. This also includes that the nucleic acids are single-stranded, double-stranded or as a triple structure.

It was also envisaged that the stringency of the DNA, i. H. whether this is, for example, single-stranded or double-stranded changes over the length of the nucleic acid sequence.

In particular, it can also be provided that the nucleic acid sequence according to the invention is not present completely, but as a fragment.

Furthermore, it is within the scope of the disclosure herein that the nucleic acid sequences may be in a mutated form. Mutation herein all that Inversio ^¬ nen, insertions and deletions are known to those skilled mutations that can occur within a nucleic acid sequence to be understood, including point mutations and non-point mutations.

In particular with regard to the interaction of the nucleic acid according to the invention with other nucleic acids, the criterion of hybridization is to be used here, which is generally recognized in the art. It will be recognized that by choosing more appropriate Hybridization conditions the stringency of the hybridization can be changed within a certain range and thus a hybridization of the nucleic acid sequences according to the invention to nucleic acid sequences is possible, the degree of deviation of which can vary from the incompletely corresponding, ie complementary sequence.

The nucleic acid sequence in the sense of the invention is also to be understood as that sequence which would hybridize with one of the sequences according to the invention if it were not for the degeneration of the genetic code. This means that in view of the open reading frame or the open reading frame present in the nucleic acid sequence according to the invention, this can be translated into an amino acid sequence using the genetic code. As a result of the degeneration of the genetic code, however, it is possible, starting from the amino acid sequence thus obtained, to use the genetic code again to obtain a nucleic acid sequence which is so different that it can be taken on its own with the nucleic acid sequence used for the determination of the amino acid sequence can no longer hybridize.

Starting from the nucleic acids disclosed herein, it is possible for a person skilled in the art to generate a suitable antisense nucleic acid, in particular antisense RNA, which can interact with the nucleic acid sequences according to the invention. Because of this interaction, the processes involving the nucleic acid sequences can be directly influenced. This interaction can take place, for example, at the level of transcription as well as at the level of translation.

Nucleic acid sequences are to be understood here generally to mean nucleic acid sequences which can be obtained by isolation from the tissue mentioned in situ or ex vivo, for example from corresponding cell, tissue or organ cultures. However, corresponding nucleic acid sequences which can be isolated from gene banks, in particular human gene banks and more preferably gene banks of the human chromosome 19, are also to be understood here. Furthermore, the term nucleic acid sequences is also intended to include those nucleic acids which can be prepared by means of suitable synthesis techniques, including the polymerase chain reaction, and other biochemical and chemical synthesis processes known in the prior art. The sequences according to the invention can also be modified.

Modification is to be understood here to mean, inter alia, fragmentation, insertion, deletion and reversion of (partial) sequences of the inventive nucleic acid sequences. This also includes the insertion of other nucleic acid sequences. These nucleic acid sequences can, for example, code for certain domains, serve as spacers and serve as elements for regulating translation and transcription.

Furthermore, the nucleic acids according to the invention can be modified in such a way that they comprise sequences or molecules which allow interaction with other molecules. This can take place, for example, in the form of a binding site to a solid support or a sequence which mediates the binding to a nucleic acid-binding protein.

Furthermore, the nucleic acid sequences according to the invention can be labeled. In this context, marking should basically be understood to mean both direct and indirect marking. Labeling can be done using the labels and labeling methods known in the art and includes radioactive, non-radioactive and fluorescent labeling. Non-radioactive labels include, among others, the use of digoxygenin, avidin, streptavidin and biotin.

Vector is to be understood here to mean in particular recombinant vectors, as are known in the art. Such vectors include, among others, viral vectors such as adenoviral or retroviral vectors and phage systems, as well as plasmid vectors, including cosmid vectors, and artificial chromosomes that can be used in prokaryotic and / or eukaryotic systems.

In addition to the nucleic acid sequences according to the invention, the vectors according to the invention can comprise further elements which are known in the prior art. The respective elements, such as promoters, terminators and enhancers, are selected in accordance with the respective host cell system in a manner known to those skilled in the art. In particular ^¬ sondere here is thinking about choosing an appropriate eukaryotic promoter and indu ^¬ ducible promoter. In addition to the elements mentioned, it is also possible for such vectors to contain elements which lead to at least the required nucleic acid sequence according to the invention, or a part thereof, is integrated into the genome of the host cell system.

It is also possible for at least one of the elements mentioned in the reading frame (“in-frame”) to be connected to at least one open reading frame of the nucleic acid sequences according to the invention, and it is particularly advantageous if the transcription rate of the special open reading frame is introduced by means of an additionally introduced promoter is checked, the promoter then typically being at a suitable distance and “in-frame” with the open reading frame.

It can further be provided that an open reader alimony of the nucleic acid sequences according to the invention, preferably under the aforementioned conditions, has a signal sequence which allows the gene product encoded by the open reading frame to be translocated via a membrane and, if appropriate, as a result thereof to further modify the gene product. Such signal sequences include those for the transport of the synthesized protein to the endoplasmic reticulum, Golgi apparatus, to lysosomes, to cell organelles, such as mitochondria and chloroplasts, and to the cell nucleus. The passage through various cellular compartments that is possible in this way allows a post-translational modification and thus possibly a further advantageous development of the gene product.

In addition to signal sequences, such a construct can also contain additional nucleic acid sequences which lead to the gene product of an open reading frame of the nucleic acid sequences according to the invention forming a fusion protein, wherein the fused-on part can correspond to a domain of another protein and z. B. serves the detection of the gene product of the open reading frame of the sequences according to the invention, or the interaction with other molecules or structures in the biological system, wherein the biological system is preferably the cell.

In addition to the above and the other for the skilled person from the description erge ^¬ reproduced advantages of the inventive nucleic acid sequences are inherent to this and the polypeptides derived from the cited nucleic acid sequences or encoded by these. On the one hand, these polypeptides can be derived directly from an open reading frame of the nucleic acid sequence according to the invention, or they are in a host organism expressed vector according to the invention in a manner known to those skilled in the art. Typically, the host organism is first transformed with the vector according to the invention, the host organism is multiplied and the polypeptide is obtained from the host organism, or in the case of its secretion into the medium, from the latter.

In addition to the direct use of the polypeptides according to the invention and the nucleic acids coding for them to influence the - cellular - events in thyroid tissue, these can also be used in the purification, for example via affinity chromatography, of other components involved in the cellular events, or for the production of suitable antibodies, which then , among other things, can in turn be used for therapeutic and or diagnostic purposes. In this way, interaction partners of the polypeptides according to the invention can be determined or isolated, among other things.

Depending on the respective existing requirements, such as post-translational modification or the desired degree of purity and the like, either a prokaryotic or a eukaryotic host organism can be advantageous when producing the polypeptides according to the invention in a host organism.

The polypeptide according to the invention can be modified in a suitable manner. Modification is understood to mean, among other things, a fragmentation, in particular shortening, of the molecule. Modification as used herein also includes labeling the polypeptide. The latter can be done using both high molecular and low molecular weight compounds and includes radioactive, non-radioactive and fluorescent labeling. A label can also be present, for example, in the form of phosphorylation or glycosylation of the protein. Corresponding labeling methods or modification methods are known in the art (see, for example, Protein Methods, 2 ^nd ed., DM Bollag et al., Wiley Liss, Inc., New York, NY, 1996) and are included in full here.

According to the invention, modification is also understood to mean any form of post-translational modification, as known to those skilled in the art, in particular proteolytic processing of the polypeptide, attachment or removal of residues at the N-terminus, acetylation of the N-terminus, myristoylation of the N-terminus, attachment of glycosyl Phosphatidyl residues, farnesyl residues or geranylgeranyl residues at the C-terminus, N-glycosylation, O-glycosylation, Attachment of glycosaminoglycan, hydroxylation, phosphorylation, ADP ribosylation and formation of disulfide bridges.

It is also within the scope of the present invention that the polypeptide according to the invention arises from mutation (s), in particular amino acid mutation (s), from a polypeptide according to the invention. Amino acid mutation is understood to mean a mutation in which an amino acid is replaced by an amino acid with a similar side chain (conservative mutation), for example I to L or D to E, and a mutation in which an amino acid is replaced by another amino acid. without this exchange having an adverse effect on the function of the encoded polypeptide (silent mutation). The function of the encoded polypeptide can be checked by a suitable assay. Suitable functional assays for CAT, i.e. H. Transporter for cationic amino acids, for DC2, d. H. for the corresponding kinase activity, and for PCKgamma, d. H. for the protein kinase Cgamma, are known to those skilled in the art and are described, for example, for CAT in Closs EI et al. Biochemistry 36 (21): 6462-8; Wu F et al. Amm J Physiol Regul Integr Comp Physiol 278 (6): R1506-12; and Palacin M et al. Physiol Rev 78 (4): 969-1054) or for PKCG described in Becton DL et al, J Cell Physiol 125 (3): 485-91; Persons DA et al, Cell Growth Differ 2 (1): 7-14 and Perander M et al., J. Biol. Chem 276 (16): 13015-24.

Further advantages can be realized with the cells according to the invention. These include the production of corresponding nucleic acid sequences or gene products derived therefrom.

In particular, the insertion of the nucleic acid sequences according to the invention in the genome of a cell is of particular importance, for example for the further study of the influence of such sequences, in particular in the cellular environment. Gene dose effects and the like can be investigated or used for diagnostic and / or therapeutic purposes. A state in which, starting from diploid cells, only one chromosome inserts one or more of the nucleic acid sequences according to the invention, and preferably in the position corresponding to their position in band 19ql3, and the second chromosome does not contain any chromosome translocation including the chromosomal bath 19ql3, appears to be particularly advantageous having. Such cells can serve, for example, as a positive and / or negative control in a diagnostic approach. O

It is within the scope of the present invention that, in addition to the respective translation product according to the invention or the nucleic acid (s) coding for it, as described herein, other means can also be used to effect the effects of the respective translation product or the nucleic acid coding therefor generate or suppress. Such agents can be determined in a so-called screening method. In a first step, one or more so-called candidate connections are made available. Candidate compounds within the meaning of the present invention are those compounds whose suitability is to be determined in a test system, the diseases disclosed herein, in particular thyroid dysfunctions and / or thyroid hypothyroidism and / or thyroid tumors, or as diagnostic agents for diagnosis to be consulted. If the candidate compound shows a corresponding effect in the test system described, it represents a corresponding, ie in principle suitable means for the treatment of these diseases. In a second step, the candidate compound is then administered with a (translation product) expression system or with a (translation product) activity system Brought in contact. A translation product expression system is an expression system which shows the expression of the translation product, the extent of the expression being fundamentally changeable. A translation product activation system is essentially an expression system, whereby here the focus is less on the expression of the translation product than on its activity or its activation state and its ability to be influenced. It is remarkable that the translation product as such does not have to be the result of an actual expression process, but can also be added to the corresponding activity system as a polypeptide or protein. In this case, it is specifically determined whether the activity of the translation product or the nucleic acid coding for it changes under the influence of a candidate compound. Regardless of the presence of the respective specific expression system or activity system, in principle both a reduction in expression or activity and an increase in expression or activity can take place. The expression system and / or the activity system is typically an in vitro approach, such as, for example, a cell extract or a fragment of a cell extract, such as, for example, a cell nucleus extract. However, a translation product expression system in the sense of the present invention can also be a cell, preferably a cell of the thyroid gland, the hypothyroidism of the thyroid gland or the cells forming a thyroid tumor.

A determination of the extent to which the expression system is increased or decreased can be determined at each level of expression, ie, for example, by increasing or decreasing the amount of the nucleic acid coding for the translation product, in particular the mRNA, or else that in the expression system the influence of the translation product produced by the candidate compound, ie the respective protein. The techniques required for this, such as a method for quantifying mRNA, are known to the person skilled in the art and are described, for example, in Sambrook et al. (Sambrook, Joseph: Molecular Cloning: A laboratory manual / J. Sambrook; EF Fritsch; T. Maniatis - Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Pr) .ess, 19XX 1st edition udT Maniatis, Thomas P .: Molecular cloning; 3rd edition: Joseph Sambrook and David W. Russell; Literature ISBN 0-87969-309-6 ISBN 0-87969-576-5 ISBN 0- 87969-577-3 1st - 2nd ed., 4th [Dr.]. - 1989) Furthermore, the person skilled in the art is also familiar with methods for determining the content of the amount of translation product, for example by using suitable antibodies. Antibodies can be produced according to the generally known methods described, for example, in Current Protocols (“Current Protocols in Protein Science”, published by Coligan JE; Dünn BM, Hidde LP Speicher DW, Wingfield PT; John Wiley & Sons). It is also it is possible for the produced translation product to carry a label in the context of the expression system, suitable labels being known to those skilled in the art, for example such a label being His ₆ (Janknecht R et al. (1991) Proc Natl Acad Sei USA) 88 (20): 8972-6).

In the case of the translation product activity system, the increase in activity or reduction in the activity of the translation product is typically tested in a functional assay, as has already been described in connection with the definition of the mutated translation products, more precisely the mutated polypeptides according to the invention.

The contacting of candidate compounds and translation product expression system or activity system generally takes place by adding a preferably aqueous solution of the candidate compound to the corresponding reaction system, ie the expression system or the activity system, which is also generally referred to herein Test systems are called. The aqueous solution can preferably be a buffer solution.

As a rule, candidate compounds are used in such a way that in each test only one individual candidate compound is used in the corresponding test system. It is also within the scope of the present invention that corresponding tests are carried out in parallel and in a high-throughput system. In the last step of the screening method according to the invention, consisting in determining whether the expression or activity of the translation product or a nucleic acid coding therefor is changed under the influence of the candidate compound, the behavior of the test system is generally compared without adding the candidate compound with that of the test system with the addition of the candidate compound. The candidate connection will preferably be contained in a connection library. In principle, each connection library is conceivable as a connection library, regardless of the connection class. Suitable compound libraries are, for example, libraries of small molecules. However, it is also within the scope of the present invention that classes of compounds other than small molecules are used, such as, for example, peptides, proteins, antibodies, anticalins and functional nucleic acids.

It is within the scope of the present invention that the translation product according to the invention or the nucleic acid coding therefor is used as the target molecule for the generation of the abovementioned classes of compounds, such as in particular peptides, proteins, antibodies, anticalins and functional nucleic acids. The corresponding connections, i. H. Peptides, proteins, antibodies, anticalins and functional nucleic acids can then be used in the screening method according to the invention.

It is also within the scope of the present invention that those compounds, ie peptides, proteins, antibodies, anticalins and functional nucleic acids, which are generated against the translation product according to the invention or the nucleic acid (s) coding therefor, are used as agents in the sense of The present invention can be used, ie as a means for the therapy of functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors or as corresponding diagnostic means. Peptides and, in particular, binding peptides within the meaning of the present invention are preferably proteins and peptides which bind to the translation product according to the invention or one or the interaction partner (s), in particular the natural interaction partner (s), of the translation product according to the invention, preferably in biological systems, in particular in the Thyroid or Hypeφlasien the thyroid or thyroid tumors and the cells building them bind. The same also applies to the antibodies, anticalins, functional nucleic acids and small molecules described herein in connection with the use according to the invention. At the same time, each member of the compound classes mentioned above can preferably interact with the translation product according to the invention or a nucleic acid coding therefor and thus influence the corresponding activity of the translation product or the nucleic acid coding therefor.

However, it is also within the scope of the present invention to generate or use such members or to subject them to a corresponding screening process which interact with the interaction partner, in particular the natural interaction partner of the translation product according to the invention, or a nucleic acid coding therefor and influence the expression or activity of the interaction partner or the nucleic acid coding therefor. Here, too, the term “influence” denotes either an increase or a decrease in expression, the level of expression or the activity, as is generally disclosed herein. As a result of the interaction of the said members with the interaction partners of the translation product according to the invention or of the nucleic acid coding therefor, the expression on the translation product becomes Coupled cascade of reactions interrupted, so that the naturally observed effect of the translation product according to the invention or the nucleic acid encoded by it is interrupted, which is used in the context of the therapy or diagnosis disclosed herein regarding functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors can be.

These peptides, hereinafter also referred to as binding peptides or binding proteins, can be screened or produced using methods known in the art, such as phage display. The techniques are known to those skilled in the art. The process for generating such peptides is typically such that a peptide Library is created, for example in the form of phages, and this library is brought into contact with a target molecule, in the present case for example with a translation product or the natural interaction partner of the translation product. The binding peptides are typically removed as a complex together with the target molecule from the non-binding members of the library. It is within the knowledge of the experts in this field that the binding properties depend at least to a certain extent on the specific test conditions, such as salinity and the like. After the peptides binding to the target molecule with a higher or stronger affinity have been separated from the non-binding members of the library or from the target molecule, in the present case from the translation product according to the invention, these can then be characterized. Possibly. an amplification step is required before the characterization, for example by increasing the corresponding phages coding for the peptide or the peptides or protein (s). The characterization preferably comprises the sequencing of the peptides binding to the translation product or its natural interaction partner, depending on which of the two molecules was used as the target molecule in the phage display screening method. The length of the peptides is basically not limited. Typically, however, peptides with a length of 8-20 amino acids are obtained or used in such methods. The size of the libraries is 10 ² - 10 ¹⁸ , preferably 10 ⁸ - 10 ¹⁵ different peptides. A special form of peptides binding to target molecules are the anticalins, as described, for example, in German patent application DE 197 42 706.

In the light of the technical teaching disclosed herein, antibodies against a gene product, in particular a translation product according to the invention such as a polypeptide, or the nucleic acid sequences according to the invention can then also be produced. In this case, too, the advantages known to the person skilled in the art from the presence of antibodies to chemical compounds generally result, in particular in in vitro and in vivo applications. In particular, the antibodies can be used, for example, to purify the compounds according to the invention, ie the nucleic acids according to the invention and / or the polypeptides or translation products according to the invention, to detect them, but also to influence the biological activity, including the bioavailability, of the compounds to which the antibodies are based is directed, both in situ and ex vivo, in vivo and / or in vitro. More specifically, the use of monoclonal antibodies Products are specifically detected or an interaction of the gene products or nucleic acid sequence with other cellular components is influenced at the cellular level and thus specifically intervened in the cellular process. Depending on the action of the particular compounds to which the antibody is directed and on which it develops its action in the system under consideration, stimulating and inhibiting effects can in principle be achieved.

Antibodies are understood here to mean both polyclonal antibodies and monoclonal antibodies. However, monoclonal antibodies are particularly preferred due to the increased specificity. However, applications are conceivable in which, on the one hand, the purity or specificity of polyclonal antibodies is sufficient or the multiplicity of specificities and other properties realized in polyclonal antibodies can be used advantageously. The production and use of antibodies is described, for example, in Antibodies: A Laboratory Manual (E. Harlow & D. Lane, Cold Spring Harbor Laboratory, NY, 1988) and is incorporated herein.

It is also within the scope of this invention that the antibody can also be a single-chain antibody.

It is also within the scope of the present invention that the antibody is fragmented, in particular shortened. This includes that the antibody is fragmented, especially shortened. This includes that the antibody is largely truncated as long as the antibody-specific property, i. H. Binding to a defined epitope is given. Truncation is particularly advantageous when the corresponding antibody is to be used at the cellular level, since it has improved permeation and diffusion properties compared to a complete antibody.

In addition, other forms of modification are also provided that are known to those skilled in the art and are described, for example, in Antibodies: A Laboratory Manual (E. Harlow & D. Lane, Cold Spring Harbor Laboratory, NY, 1988). In general, it can be stated that the modification of antibodies can in principle be carried out in a similar way to that of polypeptides and, to a certain extent, of nucleic acids, and what has been said above applies analogously to the antibody according to the invention. 2S

Another class of compounds that can be used in the screening method according to the invention as well as in the production of medicaments and diagnostic agents according to the invention are functional nucleic acids. Functional nucleic acids are to be understood here in particular to mean aptamers, aptazymes, ribozymes, Spiegelmers, antisense oligonucleotides and RNAi.

Aptamers are D-nucleic acids, either single-stranded or double-stranded, based on RNA or DNA, which bind specifically to a target molecule. The production of aptamers is described, for example, in European Patent EP 0 533 838. The procedure is as follows:

A mixture of nucleic acids, i.e. H. potential aptamers is provided, each nucleic acid consisting of a segment of at least eight consecutive, randomized nucleotides and this mixture with the target, in the present case thus with a translation product, in particular a translation product according to the invention, nucleic acid (s) coding / coding therefor Interaction partners of the translation product, in particular the natural interaction partners, and / or nucleic acids coding for them, is brought into contact, nucleic acids which bind to the target, possibly on the basis of an increased affinity compared to the affinity of the candidate mixture, are separated from the rest of the candidate mixture and the nucleic acids thus obtained which bind to the target are amplified. These steps are repeated several times, so that at the end of the method, nucleic acids specifically binding to the respective target or target molecule, namely the so-called aptamers, are obtained. It is within the scope of the present invention that these aptamers can be stabilized, for example by introducing certain chemical groups that are known to those skilled in the art of aptamer development. Aptamers are currently used therapeutically. It is also within the scope of the present invention that the aptamers thus produced are used for target validation and as lead substances for the development of medicaments, in particular of small molecules.

The production or production of Spiegelmers is based on a fundamentally similar principle, which within the scope of the present invention is based on a translation product according to the invention, the nucleic acid (s) coding therefor, the translation product Interaction partners, in particular the natural interaction partners, and / or the nucleic acid (s) coding for them can be developed as the target molecule. The production of Spiegelmeres is described, for example, in international patent application WO 98/08856. Spiegelmers are L-nucleic acids, ie they consist of L-nucleotides, and are essentially characterized by the fact that they have a very high stability in biological systems and, at the same time, comparable to the aptamers, can specifically interact with or bind to a target molecule. In the manufacture of Spiegelmers, | proceeded in such a way that a heterogeneous population is generated from D-nucleic acids, the population is brought into contact with the optical antipode of the target molecule, in the present case thus, for example, with the D-enantiomer of the naturally occurring L-enantiomer of a translation product, so that D -Nucleic acids are separated which have not interacted with the optical antipode of the target molecule, the D-nucleic acids which have interacted with the optical antipode of the target molecule are determined, if necessary separated and sequenced and then L-nucleic acids are synthesized which are identical in sequence to that previously determined for the D-nucleic acid (s). Similar to the process for the production of aptamers, it is also possible here, by repeating the steps several times, to enrich or generate suitable nucleic acids, ie Spiegelmers, which the translation product, one or more of its, in particular, natural interaction partners, depending on which of the above λ ^ compounds is used as the target molecule, or bind a nucleic acid coding therefor.

Another form of functional nucleic acids that can be used according to the invention are so-called aptazymes. Aptazymes are described, for example, by Piganeau, N. et al. (2000), Angew. Chem. Int. Ed., 39, No. 29, pages 4369-4373. This is a specific form of aptamers which are distinguished by the fact that, in addition to the portion of the aptamer that binds specifically to the target molecule, in the present case a translation product according to the invention or an interaction partner thereof, it can also contain a portion of ribozyme with which As a result, after binding of the target molecule of the aptamer portion of the aptazyme, the ribozyme portion is activated and this results in a cleavage of a nucleic acid which acts as a substrate of the ribozyme portion of the aptazyme. With a corresponding design of the ribozyme substrate, a change in the fluorescence due to a change in the spatial arrangement of a fluorescence donor relative to a fluorescence acceptor on the ribozyme substrate can be observed, for example. In this respect, Aptazyme are suitable in particular for use in the context of target validation relating to a translation product and its interaction partners and as a diagnostic agent in the sense of the present invention. Nevertheless, therapeutic use to the extent disclosed in connection with the ribozymes described herein is also possible.

What is common to the abovementioned classes of compounds is that they essentially bind to the respective protein, ie. H. bind the or a, preferably a translation product according to the invention or the interaction partner thereof, but it is also within the scope of the present invention that these classes of compounds and in particular the functional nucleic acids as the target molecule encode the proteins or polypeptides ( n) subject to nucleic acid (s).

Another class of compounds which can be produced or developed using a translation product, preferably a translation product according to the invention, and / or an interaction partner thereof and in particular the nucleic acid (s) coding for them are ribozymes, antisense oligonucleotides and RNAi.

All these classes of compounds have in common that they are not at the level of the translation product, i.e. develop their effect on the level of the proteins (translation product and interaction partner thereof), but on the level of the nucleic acid (s) coding for the respective protein, in particular the mRNA coding for a translation product or the mRNA coding for an interaction partner of the translation product. In principle, the corresponding genomic DNA or the corresponding cDNA is also suitable as the target molecule.

Ribozymes are catalytically active nucleic acids, which are preferably made up of RNA and consist of two parts. The first part is responsible for a catalytic activity, whereas the second part is responsible for a specific interaction with a target nucleic acid. If an interaction occurs between the target nucleic acid and the second part of the ribozyme, typically by hybridization of base regions that are essentially complementary to one another, the catalytic part of the ribozyme can hydrolyze the target nucleic acid either intramolecularly or intermolecularly, the latter being preferred in the event that the catalytic action of the ribozyme is a phosphodiesterase activity. As a result, there is a - possibly further - degradation of the coding nucleic acid, the titer of the target molecule being reduced both intracellularly and extracellularly both at the nucleic acid and the protein level, and thus a therapeutic approach for the treatment of functional disorders Thyroid and / or hypothyroidism of the thyroid and / or thyroid tumors is provided. Ribozymes, their use and construction principles are known to those skilled in the art and are described, for example, in Doherty and Doudna (Ribozyme structures and mechanisms. Annu Rev Biophys Biomol Struct 2001; 30: 457-75) and Lewin and Hauswirth (Ribozyme gene therapy: applications for molecular medicine. Trends Mol Med 2001, 7: 221-8).

With a view to a pharmaceutical composition which comprises a ribozyme in addition to the pharmaceutically acceptable carrier or the use of the ribozyme according to the invention as a medicament, and in particular for the treatment of functional disorders, hypothyroidism and tumors of the thyroid gland, it is also possible for the ribozyme to be constructed in this way that it acts specifically on one or more of the nucleic acid sequences according to the invention and thus also controls expression or translation here at the cellular level, which is particularly important from the therapeutic but also the diagnostic aspect. Due to the fact that ribozymes show both intra- and intermolecular catalytic effects, it can also be provided that the nucleic acid sequences according to the invention are changed in such a way that regions of themselves are cleaved by the ribozyme activity of the changed region. This also opens up a particularly therapeutic possibility, the design of which is possible for the person skilled in the art in the light of the sequence information now available.

Ribozymes, similar to the nucleic acid sequences themselves according to the invention, are particularly advantageous, but not only when they are introduced into the effector cell, for example by means of gene therapy. However, it is also conceivable that corresponding modifications are made ex vivo and cells modified in this way are then available for reimplantation, either allogeneic or autogenous. The production and use of ribozymes is disclosed in Ribozyme Protocols (Philip C. Turner, Ed., Humana Press, Totowa, NY, 1997) and is incorporated herein. The use of antisense oligonucleotides for the production of a medicament or diagnostic agent in the sense of the present invention is based on a basically similar mechanism of action. Due to base complementarity, antisense oligonucleotides typically hybridize with a target RNA, nomially with mRNA and thereby activate RNaseH. RNaseH is activated by both phosphodiester and phosphorothioate-coupled DNA. However, phosphorodiester-coupled DNA is rapidly degraded by cellular nucleases with the exception of phosphorothioate-coupled DNA. These resistant, non-naturally occurring DNA derivatives do not inhibit RNaseH when hybridized to RNA. In other words, antisense polynucleotides are only effective as a DNA-RNA hybrid complex. Examples of such antisense oligonucleotides can be found, inter alia, in US Pat. No. 5,849,902 or US Pat. No. 5,989,912. In principle, the essential concept of the antisense oligonucleotides is to provide a complementary nucleic acid against certain RNA. In other words, based on the knowledge of the nucleic acid sequence of a translation product or its or its interaction partner (s), in particular the respective mRNA, suitable antisense oligonucleotides can be produced by base complementarity, which lead to a degradation of the coding nucleic acid, in particular the mRNA , This degradation can then be recorded qualitatively or quantitatively in an expression or activity system.

Another class of compounds that can be used, identified or produced as a medicament or diagnostic agent in the sense of the present invention is the so-called RNAi. RNAi is a double-stranded RNA that mediates RNA interference and is typically about 21 to 23 nucleotides in length. One of the two strands of the RNA corresponds to a sequence of a gene or of the gene to be degraded. In other words, based on the knowledge of the nucleic acid (s) coding for a translation product and / or its interaction partner, in particular the mRNA, a double-stranded RNA can be produced, one of the two RNA strands complementary to that for the translation product and / or whose interaction partner is coding nucleic acid (s), preferably to the mRNA, and this then leads to the degradation of the corresponding coding nucleic acid and, consequently, to a reduction in the titer of the respective translation products, ie the proteins. The generation and use of RNAi as a medicament or diagnostic agent is described, for example, in international patent applications WO 00 / 44S95 and WO 01/75164. With a view to the mechanisms of action of the classes of compounds described above, namely ribozymes, antisense oligonucleotides and RNAi, it is therefore within the scope of the present invention, in addition to the translation product according to the invention, ie the respective polypeptide or protein, and its especially natural interaction partner (n ) also the nucleic acid (s) coding for it, in particular the corresponding mRNA, cDNA or genomic DNA, for the manufacture of a medicament for the treatment of functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors or for the manufacture thereof a diagnostic agent for the diagnosis of the above-mentioned diseases or functional disorders and for monitoring the course of the disease or the therapy used, either directly or as a target molecule.

When using the translation product according to the invention, the nucleic acid coding therefor, the translation product interaction partner (s), in particular the natural interaction partner (s), and / or the nucleic acid (s) coding for them as the target molecule for the Production or development of a medicament for the treatment or therapy of functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors, as well as in the production and / or development of means for the diagnosis of the same, libraries of small molecules can also be used , Here, too, the target molecule is brought into contact with a library and those members of the library that bind to it are determined, if necessary separated from the other members of the library or from the target molecule and optionally further characterized. Again, the characterization of the small molecule will be done according to procedures known to those skilled in the art. B. identify the compound and determine the molecular structure. The libraries have as few as two and as many as several hundred thousand members.

In connection with the various classes of compounds disclosed herein that can be used as therapeutic or diagnostic agents according to the invention, one aspect is that certain classes interact directly with or bind to a translation product or its interaction partner. However, it is also within the scope of the present invention that the said compounds of the different classes, in particular if they are peptides, antibodies, anticalins, aptamers, Aptazyme and Spiegelmere acts to block the interaction partner of the translation product by means of a more or less specific interaction for the translation product. In this respect, the term use of a translation product is also to be understood to mean the use of one or more of the translation product interaction partners (see ), such as. Receptors and transcription and translation factors. The methods described herein are then to be modified to the extent that instead of the translation product protein or the nucleic acid coding for it, an interaction partner thereof is used in the various selection methods, assays, screening methods or production methods. Interaction partners of PKCG are, inter alia, compounds containing phospholipids and phosphatidylserine residues, the binding of the latter being independent of phospholipids, but dependent on Ca 2+ (Pawelcyk T, Kowara, R. Matecki, A; Mol. Cell Biocehm. 2000 Jim ; 209 (1-2): 69-77). Another binding partner of PKCG is phorbol dibutyrate (PDBuVdiacylglycerol and lipid binding domains (CaLB) (Quest AF, Bell, RM; J Biiol. Chem. 1994 Aug 5: 269 (31): 20000-12). PKCG also shows an interaction and thus a form binding to the PH domains of tea family protein throsine kinases Btk and Emt (similar to ltk and Tsk); this involves an interaction with PKC genes (Pawelczyk T, Matecki A, Dettlaff A; FEBS Lett 1998 Feb 13 ; 423 (1): 31-4. Interaction partners of CAT-A and CAT-AI are, among others, generally amino acids and viruses

In the context of the present invention, interaction partners of a translation product, in particular of a translation product according to the invention, in particular natural interaction partners, refer to those molecules and structures with which said translation product interacts. In particular, those molecules and structures with which the protein interacts in a biological system under normal and / or under pathological conditions are included.

With regard to the design of the kit for diagnosis and / or therapy of functional disorders, hypothyroidism and tumors of the thyroid gland, it should be noted that the exact design of such a kit, ie which component (s) is or are explicitly included therein, is known to the person skilled in the art in this field , and in particular are possible in the light of the statements made above with regard to the effect or usability of the nucleic acid sequences according to the invention disclosed herein and their translation product. The invention In any case, the modern kit will comprise at least one of the elements according to the invention, which is selected from the group comprising the nucleic acid (s) according to the invention, the vector, the polypeptide, the cell, the antibody, the ribozyme and the various compounds of the various classes as characterized here, in particular the antibodies, peptides, proteins, anticalins, small molecules, aptamers, Spiegelmers, ribozymes, aptazymes, antisense oligonucleotides and RNAi, specifically for the nucleic acids or translation products according to the invention and the interaction partners thereof, in particular the natural interaction partners and the nucleic acids coding therefor, each preferably in its form according to the invention. Further elements of the kit according to the invention are selected from the group comprising buffers, negative controls, positive controls and instructions for use. The individual compounds or constituents are typically contained in the kit in dry or liquid form, preferably portioned for the individual application. The kit can preferably be used to determine functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors. With regard to the use of the cells according to the invention, their use as a reimplant or as a positive and / or negative control in corresponding diagnostic or therapeutic approaches is possible in particular.

In the method according to the invention for the detection of functional disorders and hypoplastic and / or tumors of the thyroid gland, also i. S. of carcinomas and goitre, it is possible that the thyroid material is present in situ, ex vivo, in vivo or in vitro. The term "thyroid material", as used herein, refers in particular to material, preferably cellular material, of the thyroid gland in its normal and / or pathogenic state. The term thyroid material thus also includes material from thyroid glands with a functional disorder, from hypothyroidism of the thyroid gland, from tumors of the Thyroid gland, including carcinomas and goiter The determination of whether there is a functional disorder, hypothyroidism and / or tumor is ultimately made by comparing the effect of the agent or agents used according to the invention on the thyroid material to be examined with its effect on "normal" thyroid tissue , Further embodiments of the method according to the invention result for the person skilled in the art on the basis of the disclosure contained herein. The statements made above with regard to the various embodiments and the advantages which can thus be achieved also apply mutatis mutandis to the medicaments according to the invention, and in particular to such agents for the diagnosis and / or therapy of functional disorders, hypothyroidism and / or thyroid tumors in the form of the sequence according to the invention ( en), or its use, in the form of the vector according to the invention, or its use, in the form of the polypeptide according to the invention, or its use, in the form of the cell according to the invention, or its use, in the form of the ribozyme, or its use which are disclosed herein. The same also applies to the compounds prepared or selected according to the invention from the group comprising binding peptides, anticalins and functional nucleic acids, what these compounds have in common is that they act against the nucleic acid sequences according to the invention or the polypeptides encoded thereby or their interaction partner (s) or the nucleic acids coding therefor are directed, ie are produced or selected against them as the target molecule. The corresponding medicaments can contain one or more of the aforementioned agents or compounds.

The same also applies to the pharmaceutical compositions according to the invention. It is possible for a pharmaceutical composition to comprise only one of the listed compounds in addition to the pharmaceutically acceptable carrier. Alternatively, it is also within the scope of the invention that the pharmaceutical composition has several of the compounds mentioned in addition to the pharmaceutically acceptable carrier.

The term pharmaceutically acceptable carrier should be understood here to mean all carriers known to the person skilled in the art, which are typically selected depending on the form of administration. A pharmaceutically acceptable carrier can include water, buffer solutions, alcoholic solutions, and the like.

With regard to the method according to the invention for the production of primers, it should be pointed out that these are those which allow a specific representation of the nucleic acid sequences according to the invention, or parts thereof.

In the method according to the invention for representing a nucleic acid sequence according to the invention, from whatever source, the nucleic acid sequences according to the invention zen or sequences corresponding to these, using primers according to the invention as primers for a polymerase chain reaction, in all of their various designs, can be used. The design of suitable primers and the implementation of polymerase chain reactions is in PCR & PCR 2: A practical approach (MJ McPherson, P. Quirke and GR Taylor, Eds., IRL Press, Oxford, England 1991, & MJ McPherson and BD Harnes, Eds., IRL Press, Oxford, England 1995) and is incorporated herein.

The nucleic acids according to the invention, including the nucleic acid sequences according to the invention, are, on the one hand, the homologue to the human CAT genes disclosed herein, which is also referred to herein as CAT or as CAT-A or CAT-Al in special forms of the CAT homologue according to the invention the human DC2 gene and the PKCgamma gene, the N-terminus of which is known.

Nucleic acids or nucleic acid sequences according to the invention are in particular also the nucleic acids listed below, which are labeled with “SEQ. ED. No. "Nucleic acid sequences referred to herein include those nucleic acids or nucleic acid sequences which are referred to below as" SEQ. ED. No. " partially or completely include designated nucleic acid sequences and include further nucleotides, in particular at the 5 'and / or 3' end, those nucleic acids which, in addition to the “SEQ. ID. No. "sequences referred to herein contain further nucleotides, in the case of the CAT-A or CAT-Al sequence or gene according to the invention supplemented by further nucleotides from BC 93504, in the case of the PKCG gene supplemented by further nucleotides from BC 277497 or BC 829651 and in the case of DC2, ie the DC2 homolog according to the invention, supplemented by further nucleotides from BC 280723 or BC 93504. The relative arrangement of the above-mentioned clones is shown in FIG. 11.

Furthermore, the nucleic acids according to the invention are those nucleic acids which code for a polypeptide, the polypeptide having or comprising a sequence as described herein with one or more of the “SEQ. ID. No. "Finally, nucleic acids according to the invention are also those which comprise one or more exons and / or one or more of the introns of one or more of the nucleic acids according to the invention disclosed herein.

The polypeptides according to the invention, which are also referred to herein briefly as polypeptides, are in particular translation products of one or more of the nucleic acids according to the invention. ren. The translation products can be complete or abbreviated. These translation products are referred to herein either generally as a translation product, regardless of the number, or as a translation product according to the invention. Translation products or polypeptides according to the invention in the sense of the present invention are in particular those parts of the corresponding polypeptides which are part of a domain structure, in particular of such a domain which is present extracellularly in a cellular system.

Those for the nucleic acids according to the invention, in particular for the CAT homologue according to the invention and DC2 homologs, which are not known as such in the prior art, as well as PKCgamma are identified or represented by the following nucleic acid sequences: The genomic sequence starting from 19ql3.4 on Cosmid 15841, continuous via BAC 280723, ends with the last bp of BAC 829651. The sequences are published with the accession numbers AC01 1453 (BAC280723), AC008753 (BAC 829651). The length of this genomic sequence is 293395 base pairs. The nucleic acid sequence coding for the C-terminus for PKCgamma can be identified or represented as follows: The genomic sequence comes from 19ql3.4 and is described in the sequence stored under the access number AC00S440. This is below or overlapping BAC 829651. The length of the nucleic acid is 243085 base pairs. The nucleic acid sequence coding for the C-terminus of PKCgamma can furthermore be characterized by the following sequences: The genomic sequence comes from 19ql3.4 and is deposited with the accession number AC022318 and is below or overlapping from the sequence in BAC 829651. The total length of the Sequence is 191422 base pairs.

The sequences disclosed herein particularly include human sequences, where:

SEQ. ED. No. 1 an EST (Acc No. BE 564764) of CAT-A or CAT-Al, SEQ. ED. No. 2 an EST (Acc. No. BF 029168) of CAT-A or CAT-Al, SEQ. ED. No. 3 an EST (Acc. No. AF201937) of the human DC2 gene, SEQ. ED. No. 4 an EST (Acc. No. BE 271492) of the human DC2 gene, SEQ. ED. No. 5 an EST (Acc. No. AF 345987) of the human PKCG gene, SEQ. ED. No. 6 corresponds to an EST (Acc. No. X 625337) of the human PKCG gene, and SEQ. ED. No. 7: cDNA sequence of the CAT homologous gene on 19ql3.4, length 647 bp, SEQ. ED. No. 8: cDNA sequence of the DC2-homologous gene on 19ql3.4 (sequence according to the invention), length 749 bp; and

SEQ. ED. No. 9: cDNA sequence of the PKCgamma-homologous gene on 19ql3.4, length 3457 bp, almost 100% homology as far as comparable, composed of Acc. No. X625337 and AF345987, and

SEQ. ED. No. 10: the cDNA of the CAT homologous gene disclosed herein as CAT-A, SEQ. ED. No. 11: the cDNA sequence of a splice variant of CAT-A, referred to herein as CAT-Al,

SEQ. ED. No. 12 the genomic sequence of CAT-A or CAT-Al; SEQ. ED. No. 13 the amino acid sequence of CAT-A reading frame (ORFstartl), SEQ. ED. No. 14 the amino acid sequence of CAT-A reading frame (ORFstart2), SEQ. ID. No. 15 the amino acid sequence of CAT-A reading frame (ORF3), SEQ. ID. No. 16 denotes the genomic sequence of the DC2 gene according to the invention, which is homologous to the DC2 gene known in the prior art, and consequently represents a further form of the family of the DC2 genes;

SEQ. ID. No. 17: the cDNA sequence of the DC2-homologous gene or the sequence according to SEQ. ID. No. 16;

SEQ. ID. No. 18: the genomic sequence of PKCG; and SEQ. ID. No. 19: the cDNA from PKCG, hence from SEQ. ID. No. 18 is.

It is within the scope of the present invention that any use disclosed herein for one or more of the polypeptides according to the invention or the compounds derived therefrom, such as small molecules, binding peptides, antibodies, anticalins and functional nucleic acids, is in principle also for the use disclosed in each case other molecules or compounds mentioned above is hereby disclosed.

The invention is explained below with reference to the figures and examples and the sequence listing, from which further features, embodiments and advantages of the invention result. It shows:

1 shows a metaphase of the cell line S 141.2 with t (2; 19) (pl2; ql3) after G-banding, the chromosomes 19, (19) and (2) being marked with an arrow (a); Fig. L (b) the same measurement tapish after FISH with the B AC clone 280723 (the hybridization signals are located on the chromosomes 19 of (19) and (2));

2 shows a schematic representation of the breakpoint cluster region in benign shield diabetes tumors with 19q 13 aberrations. The FISH mapping data of the six tumors tested in the study show that the breakpoints of the benign thyroid tumors with 19ql3 translocations in the region map about 150 kbp 3 'to RITA. The cosmid, BAC, and PAC clones match the physical map of chromosome 19 from the Lawrence Livermore National Laboratory. The circled numbers refer to the newly established STS markers RSTS1-RSTS 10 (for comparison see Tab. 2);

3 shows the results of a Northern blot hybridization to RNA isolated from thyroid adenoma cell line S121 / SV40 and fibroblasts, using a 1092 bp cDNA probe from exon 1 to exon 5. The 5.5 kb and 6.2 kb transcripts were found in the fibroblasts and the adenoma cell line; and

4 shows the genomic location of the CAT-A gene;

Figure 5 shows the genomic organization of CAT-A;

6 shows an organizational sketch of the mRNA of CAT-A;

Fig. 7 shows the various open reading frames, such as open reading frames referred to herein as ORFstart1, ORFstart2 and ORF3, with possible amino acid sequences;

8 shows the location of the PKCG gene;

9 shows a Northern blot for the detection of PKCG on thyroid carcinoma cells and normal thyroid tissue;

10 shows the result of a semi-quantitative RT-PCR of the PKCG gene; 11 shows a representation of the various genes or partial gene sequences described here for the first time relating to CAT-A or CAT-Al, the DC-2 homologue and protein kinase Cgamma;

12 shows the result of a transmembrane domain analysis using the DAS program of the gene product from ORFstartl;

13 shows the result of a transmembrane domain analysis using the DAS program of the gene product from ORFstart2;

14 shows the result of a transmembrane domain analysis using the DAS program of the gene product of ORF3;

Figure 15 shows the CAT-A cDNA;

Figure 16 shows the protein or amino acid sequence of ORFstart1 from CAT-A cDNA;

Figure 17 shows the protein or amino acid sequence of ORFstart2 from C AT-A cDNA;

Figure 18 shows the protein or amino acid sequence of ORF3 from CAT-A cDNA;

Figure 19 shows the CAT-Al cDNA;

20 shows the genomic organization or sequence of CAT-A or CAT-Al with further sequence information;

21 shows the cDNA of CAT-A with further sequence information;

22 shows the genomic sequence of the DC2-homologous gene according to the invention;

23 shows the genomic sequence of the DC2-homologous gene according to the invention with further sequence information; 24 shows the cDNA of the DC2-homologous gene with further sequence information;

25 shows the cDNA of PKCG with further sequence information; and

26 shows the genomic sequence of PKCG with further sequence information.

Example 1: Cytogenetic analysis of thyroid hyperplasia and thyroid adenoma

Thyroid hyplasias and adenomas are common changes in the thyroid epithelium. One can differentiate between lesions with clonal chromosomal changes and those with apparently normal karyotypes. The cytogenetic changes are very likely related to tumorigenesis. In our studies, we found clonal aberrations in about 20% of the cases. Changes in the chromosomal band 19ql3 represent the most common structural aberration. The importance of translocation for the development and progression of thyroid tumors is not yet known. We were able to show through molecular genetic studies that the breakpoints in translocations of chromosome 19 in band ql3 cluster in a genomic range of 150 kbp.

Cell culture and chromosome analysis were carried out using the method already described for pleomoid adenomas of the parotid gland (Bullerdiek et al., 1987). The karyotypes were described according to the ISCN of 1995. The cell lines were obtained by transformation with a construct which contains the SV40 "early region" (Beige et al., 1992). Two new cell lines were made from the primary tumors S172 and S290.1. These cell lines and four primary tumors were used in FISH studies. The karyotype descriptions are summarized in Table 1. PAC clone 13174 (Genome Systems, USA), cosmid clones 15841 and 29573, and BAC clones 41372, 28072 and 829651, which are described according to the Lawrence Livermore National Laboratory (LLNL) nomenclature, were used for the localization of the breakpoint (Ashworth et al, 1995). The cosmid clones obtained from the human chromosome 19 specific "flow-sorted" cosmid library of the LLNL (deJong et al., 1998; Trask et al., 1992; Ashworth et al, 1995) were used. The BAC clones come from the human library CIT-HSPC and were isolated by the LLNL. Cosmid and BAC fragments were digested with E-coRI, separated in 0.8% agarose gels, cut out of the gel, isolated from the gel piece using the glass ball technique (QIAExII, QIAGEN, Hilden, Germany) and placed in the pGEMl lzf (+) - vector cloned (Promega, Mannheim, Germany). Plasmid, cosmid, PAC and BAC DNA were isolated using a standard method for alkaline lysis and purified using anion exchange columns (QIAGEN, Hilden, Germany). DNA digestion was carried out according to standard procedures, taking into account manufacturer information. The sequencing was carried out on a 373 DNA sequencer (Applied Biosystems, Weiterstadt, Germany) using vector-specific and insert-specific primers. For the positional localization of the STSse, Cosmide, PACs and BACs, their DNA was digested with the restriction enzymes EcoRI, BamHI or Hindlll, separated in 0.8% agarose gels and on nylon membranes of the type Hybond N + (Amersham Pham acia, Freiburg, Germany) transferred. PCR-amplified STS or plasmid DNAs labeled with DIG-dUTP (Röche; Mannheim, Germany) served as probes. The labeling was carried out by randomly priming the DIG-dUTPS into the DNA. The ExpressHyb hybridization solution (Clontech Laboratories, Palo Alto, USA) was used for both the pre-hybridization and the hybridization. The probes were visualized using chemiluminescence (Röche, Mannheim, Germany). The polymerase chain reaction (PCR) was carried out with the temperatures and primers as listed in Table 2. PCR analyzes were carried out according to standard procedures. About 60 ng of template DNA were amplified in a volume of 50 μl with 400 ng of each primer, 300 μM dNTPs, 1 × PCR buffer (contains 1.5 mM MgC12) and 2.5U AmpliTaq (Perkin Elmer Applied Biosystems, Weiterstadt, Germany). The PCR products were separated on 1.5% agarose gels, cut from the gel, isolated from the gel using the glass ball technique (QIAExII, QIAGEN, Hilden, Germany) and into the pCR2.1 vector (Invitrogen, San Diego, CA) cloned. Fluorescence in situ hybridization (FISH) analyzes were performed after GTG banding of the same metaphases. The metaphases were treated with subsequent FISH studies according to the protocol of Kievits et al. (1990). For probe production, cosmid, PAC and BAC DNA were labeled using the nick translation method with biotin-14-dATP (Gibco BRL, Life Technologies GmbH, Eggenstein, Germany). 20 metaphases were examined per cosmid, PAC or BAC probe, with the exception of case S532.1, in which only 2 metaphases could be evaluated. The chromosomes were counter-stained with propidium iodide, analyzed on a Zeiss Axiophot fluorescence microscope using a FITC filter (Zeiss Oberkochem, Germany) and with the Power Gene Karyotyping System (PSI, Hailadale, UK). The FISH studies were carried out on four primary tumors of the thyroid gland (S476.1, S141.2, S172, S532.1) and on two cell lines from thyroid neoplasia. The cell lines, like the primary tumors, show a change in the chromosomal band 19ql3. The results of these analyzes showed that in all primary tumors the breakpoints are located in a region spanned by the BAC clone 280723. With this BAC clone, signals were obtained both on normal chromosome 19 and on the two derivative chromosomes. In further FISH investigations, signals were obtained with the cosmids 15841 and 29573, PAC 13174 and BAC 41372 proximal to the break points, whereas the BAC 829651 showed signals distal to the break points. The cell line from the primary tumor S172, ie cell line S172 / SV40, also showed signals on the normal chromosome 19 and on both derivative chromosomes after hybridization with the BAC clone 280723. The cell line S290.1 / SV40 showed signals on the derivative chromosomes and on the normal chromosome 19 when hybridized with the PAC clone 13174. This means that the break point in chromosome 19 correspondingly in a segment of about 150 kbp for all tumors examined the sequence between cosmid 15841 and BAC clone 829651. For further characterization of the region, the BAC clones 93504, 41372, 280723 and 829651 (LLNL), the PAC clone 13174 (Genome Systems, USA) and the Cosmid clones 30316, 15841, 29573 and 20019 (LLNL) using the Restriction mapping and addition of sequencing data combined in a contig. Ten new STSs were produced from this sequence data and were obtained either by sequencing the enser ends in plasmids or cosmids or by internal sequencing in BAC, PAC and cosmid clones. Oligonucleotide sequences for these PCR approaches and the product sizes of the PCR amplificates are listed in Table 2. The contig is 470 kbp in length, three of the STSs are within the breakpoint region, one is below, and six STSs are located proximal to the breakpoint.

Sequence homologies to three ESTs were found in the immediate vicinity or within the breakpoint region using sequence analysis methods. A comparison of the ESTs with the genomic sequence of the region allowed the structure of these genes to be reconstructed. An EST (accession no. BE271492, AF201937) lies within the 150 kbp breakpoint region, ie between cosmid clones 15841 and 29573. The cDNA of BE271492 was isolated from the ovarian adenocarcinoma cell line library NIH_MGC_9. The AF201937 cDNA was extracted from dendritic cells isolated (see Genbank entry for AF201937). It contains 3 exons, 469, 250 and 80 bp long, which are separated by an approx. 320 bp and an approx. 340 bp long intron. This gene is oriented towards the telomer. The exons have approximately 95-85% homology with sequences from the bi-point region. The mRNA of this gene codes for a protein, DC2, which is ubiquitously expressed. The gene's cDNA could be derived from a wide variety of tissue types such as adipose tissue; Brain, intestine, eye, heart, liver, kidney, thyroid, testis, skin; etc. be isolated.

Another EST (BE564764, BF029168) begins about 4kb upstream of the STS marker RSTS5, on the cosmid clone 15841. Both ESTs come from the NIH_MGC_53 library, which was produced from a bladder carcinoma cell line. The orientation of the ESTs is directed against the centromer, and thus this gene with its 3'UTR is still within the breakpoint region. When compared with the genomic region, an exon / intron structure could be shown. As far as can be seen from the sequence data, this gene extends over at least 5 kbp. The first three exons have 100% homology with the compared genomic sequence, exons 4 and 5 had a homology of 93% and 68%, respectively. These ESTs have an 85% homology with the gene for the cationic amino acid transporter (CAT) from rattus norwegicus over a distance of 110 bp. The introns vary in size from approximately 500 bp to approximately 2 kbp.

A third EST (AF3459S7, X62533) was found below the break point. The homology to the genomic sequence below the break point range is approximately 100% as far as comparable. The orientation of the associated gene is directed against the centromere. This gene codes for the protein kinase C gamma. The first known exon begins about 145 kbp downstream of the breakpoint region. On this exon, the starting point for the translation is about 1100 bp upstream of the exon. An alternative starting point is about 1600 bp upstream of the known sequence. A comparison with the genomic sequence allowed the creation of an intron / exon structure. As far as can be seen from the data, this gene consists of at least six exons. It is expected that 5 'of the known sequence, ie in the direction of the breakpoint region, will have further exons. A size estimate of approximately 500 bp for intron 1 and approximately 1000 bp for intron 2 can already be given for the first two introns. PKCgamma cDNA has so far been isolated from brain, stomach, and leukocytes. The cDNA or mRNA sequences of all of the above ESTs were checked for expression in a Virtual Northern (SAGE, serial analysis of gene expression; http://www.ncbi.nlm.nih.gov/SAGE/). In this online analysis, selected sequences of the ESTs (tags) are compared with the sequences arranged in libraries. Although these results represent the frequency of the day rather than the actual gene expression, it is nevertheless a reliable tool for initial evaluations. Tags from ESTs BE271492 and AF201937 (DC2) are present in many libraries, particularly strong "expression" can be found in libraries of meduloblastomas, breast adenocarcinomas, normal vascular endothelium cell lines, normal skin and prostate carcinomas. Tags from ESTs AF345987 and X62533 (PKCgamma) were only found in two libraries made from normal brain and astrocytoma cell lines, respectively. Tags of ESTs BE564764 and BF029168 could not be found in the libraries.

Ashworth LK, Batzer MA, Brandriff B, Brandscomp E, de Jong P, Garcia E, Garnes JA, Gordon LA, Lamardin JE, Lennon G, Mohrenweiser H, Olsen AS, Slezak T, Carrano AV: An integrated metric physical map of human chromosome 19. Nature Genet 11: 422-427 (1995).

de Jong PJ, Yokabata K, Chen C, Lohman F, Pederson L, McNinch J, van Dilla M: Human chromosome-specific partial digest libraries in lambda and cosmid vectors. Cytogenet Cell Genet 51: 985 (1985).

Bullerdiek J, Böschen C, Bartnitzke S: Aberrations of chromosome 8 in mixed salivary gland tumors: cytogenetic findings on seven cases. Cancer Genet Cytogenet 24: 205-212 (1987).

Beige G, Kazmierczak B, Meyer-Bolte K, Bartnitzke S, Bullerdiek J: Expression of SV40 T-antigen in lipoma with a chromosomal translocation t (3; 12) is not sufficient for direct immortalization. Cell Biol Int Rep 16: 339-347 (1992).

ISCN (1995): An International System for Cytogenetic Nomenclature. Mitelman F (ed.) (S Karger, Basel 1995). Kievits T, Dauwerse JG, Wiegant J, Devilee P, Breuning MH, Cornelisse CJ, van Ommen GJB, Pearson PL: Rapid subchromosomal localization of cosmids by nonradioactive in situ hybridization. Cytogenet Cell Genet 53: 134-136 (1990).

Trask B, Cliristensen M, Fertitta A, Bergmann A, Ashworth L, Branscomp E, Carrano A, Van den Engh G: Fluorescence in situ hybridization mapping of human chiOmosome 19: Mapping and verification of cosmid contigs formed by random restriction enzyme fingeiprinting. Genomics 14: 162-167 (1992).

Table 1: Arrangement of the DNA probes (cosmid, PAC, BAC) used for the FISH studies on four benign primary thyroid tumors and two SV40-transformed cell lines derived from benign thyroid tumors show all aberrations that Band 19ql3 concern.

Tumor No DNA Probe Translocation Location of FISH signals relative to the break point

S141.2 cl5841 t (2; 19) (pl2; ql3) proximal c29573 proximal

BAC 41372 proximal

BAC 280723 spanning

BAC S29651 distal

PAC 13174 proximal

S172 c29573 t (2; 19) (pl2; ql3) proximal

BAC 41372 proximal

BAC 280723 spanning

BAC 829651 distal

PAC 13174 proximal

S476.1 c29573 t (5; 19) (ql3; ql3) proximal

BAC 41372 proximal BAC 280723 spanning BAC 829651 distal PAC 13174 proximal

S172 / SV40 BAC 280723 t (2; 19) (pl3; ql3) spanning BAC 829651 distally

S290.1 / SV40 c30316 t (l l; 19) (q23; ql3) proximal C15841 proximal BAC 41372 proximal PAC 13174 * spanning BAC 829651 distal

S532.1 BAC 280723 t (14; 19) (q22; ql3) spanning

Table 2: Primers for PCR amplification of STS markers that have been physically mapped.

Marker GenBank Forward product

Accession number reverse primer (bp)

primer

RSTS 1 G64894 TCCTGGCTCATAATTCCATAACCCTTGGT

GTGCGCCACCTTTTCAGAGTTCTTTTGT 423 RSTS2 G64900 TTATGCCTGATTCAGTGACACTACTTTTTC

CGGCTGCCTCTAACATACGGAAGATTC 397

RSTS3 G64895 GAGGCTGACGCGGCGGCTCTATCTC

AGCGGTTGCGTCACCGGTGCAGAAG 113 RSTS4AF260531 ATATACGTGTATCAGTTTCAGAATGC

T ATTTT AAAGTC AGAC ATG AAAAAGG 188

RSTS5AF260970 GGGCCAGGAAAATGCACGGAAGTGAAG

CCCGGGCTTGTGGAATTAACTGAGCAG 360 RSTS6 G64896 TTATGTGGGCCCC AA ACC ATTACTGATACTC CTCATGCCCATAAACCCCTAAATTCCTTGT 385 RSTS7G64897 GCCTGCTAAGCCTCTGTGCCTAGTAAAG

GGTATCAGAAAGGTACAATCCCTATGTCTC 1S9 RSTS8G64901 CCCAAAAGATCCCAAGTCCAGGCAGAAAG

CCTGGGAAGCTCACAAGGGTGGAAGAC 397 RSTS9G64898 GTACATTGGCATCCGCAGGGGTAAC

CCTCTCAAGGCGTGCTTTTTCGTAAGA 406

RSTS10 G64899 AGCCCGCTCGTATCTATGG

TGAGGACTACTTGGGCACAGG 301

Example 2: Characterization of a human CAT homologous gene

In the characterization of the genes occurring in the breakpoint region of thyroid tumors, a new human gene was found which, based on the corresponding sequences from Rattus norwegicus, is homologous to the CAT genes. CAT genes are genes that code for transporter proteins of cationic amino acids. The gene discovered by the present inventors is hereinafter referred to as CAT-A or CAT-Al. CAT-Al represents a splice variant of CAT-A, as will be demonstrated in the following.

The CAT-A or CAT-Al gene is located exactly in the ql3.4 region of human chromosome 19. It is partly in the breakpoint region of the thyroid tumor. The CAT-A / Al gene is located in the BAC CTB-167G5 (BC93504) with the gene bank number AC01 1487. H. the 3 'end is organized towards the centromer.

An overview of the location of CAT-A can be found in FIG. 4.

The CAT-A mRNA is currently reported as 1437 nucleotides and is cDNA in SEQ. ID. No. 10 shown. It should be noted that CAT-A and CAT-Al are currently much shorter than the members of the human CAT family. Example 3: Genomic organization of CAT-A

The genomic organization of CAT-A and its splice variant CAT-Al is shown in Fig. 4. The genomic DNA sequence of the homologue disclosed here for the first time to the human DC2 already known in the prior art is given a length of 5278 base pairs. It should be noted that the 5 'end has not yet been determined. However, it is possible, starting from the disclosure given here, to carry out further sequencing and to this extent to complement the sequence. On the other hand, it will be recognized by those skilled in the art that, based on the information given herein, completion is possible and in particular the various representatives of the compound classes of the peptides, proteins, antibodies, anticalins and functional nucleic acids have already been prepared or selected on the basis of the disclosure given here can be.

In the case of CAT-A, a total of 4 exons are known, with exon being 1 312 base pairs long, exon 2 167 base pairs, exon 3 108 base pairs and exon 4 850 base pairs.

CAT-Al, on the other hand, has five exons that result from the fact that exon 4 includes an alternative splice site. In this respect, exons 1 to 3 of CAT-Al are identical to the first three exons of CAT-A, the fourth exon of CAT-Al, i. H. Exon 4a, however, is only 200 base pairs long and exon 5 of CAT-Al 381 base pairs.

Characterization of the mRNA for CAT-A

The length of the CAT-A mRNA is currently given as 1437 nucleotides. There are two reading frames, each with a start codon. The two reading frames and the translation products thereof are also referred to herein as ORFstartl and ORFstart2. A third reading frame, also contained in CAT-A, referred to herein as ORF3, does not have a start codon, ie sequencing has not yet progressed to the extent that this could be clearly identified, and includes ORFstart2. ORF3 and ORFstart2 therefore have the same reading frame. Characterization of the CAT-Al mRNA

The CAT-Al mRNA is currently 1168 nucleotides in length. It differs from the CAT-A mRNA by a different 3 'end, which may not, however, encode. The sequence for this is as SEQ. ED. No. 1 1 disclosed herein.

Example 4: Characterization of the different reading frames of the CAT-A mRNA

1. Characterization of the ORFstartl reading frame

Possible transmembrane domains of the different reading frames were determined using a total of 3 different software programs. The corresponding software programs are "DAS" transmembrane prediction, which can be loaded via the following URL address: http://www.sbc.su.se/~miklos/DAS/. This method was developed by Cserzo at al (M. Cserzo, E. Wallin, I. Simon, G. von Heijne and A. Elofsson: Prediction of transmembrane alpha-helices in procariotic membrane proteins: the Dense Alignment Surface method; Prot. Eng. Vol. 10, no. 6 , 673-676, 1997).

According to the result shown in FIG. 12, the ORFstartl reading frame has two transmembrane domains.

Another method for determining transmembrane domains is provided by the so-called HMMTOP server. HMMTOP is an automatic server for the prediction of transmembrane helices and topologies of proteins, as described by G.E. Tusnady were developed by the Institute of Enzymology. The corresponding URL address is http://www.enzim.hu/hmmtop/index.html. The process is also described in Tusnady, G.E. at al. (G.E Tusnady and I. Simon (1998) Principles Governing Amino Acid Composition of Integral Membrane Proteins: Applications to Topology Prediction. J. Mol. Biol. 283, 489-506)

The result of the HMMTOP server regarding the reading frame ORFstartl can be summarized as follows. Here too, two transmembrane helices are identified and assigned to positions 72 - 88 and 95 - 112. The N-terminus is arranged outwards, ie extracellularly. Another method for predicting transmembrane regions is the so-called TMpred program. The algorithm is based on a statistical analysis of TMbase, a database of naturally occurring transmembrane proteins. The prediction is performed using a combination of several weighted matrices. The corresponding LTRL address is: www.ch.embnet.org/software/TMPRED form.html. The process is also described by Hofmann at al. (K. Hofmann & W. Stoffel (1993) TMbase - A database of membrane spanning proteins segments Biol. Chem. Hoppe-Seyler 374,166).

As a result of using TMpred, two models are considered that differ in the number of transmembrane helices. In a clearly preferred model, the N-terminus is intracellularly oriented and comprises three strong transmembrane helices. Positions 1-21 have an orientation from the inside to the outside, the amino acids of the positions 66 to 87 have an orientation from the outside to the inside, and the amino acids 95 to 114 have an orientation from the inside to the outside.

The model proposed as an alternative has two strong transmembrane helices, the first helix comprising amino acid positions 8-30 and the orientation from the outside inwards and the second helix comprising the amino acid position 95-114 with an orientation from the inside out.

2. Characterization of the reading frame ORFstart2

The amino acid sequence encoded by this reading frame is called SEQ. ID. No. 14 specified herein.

The characterization of the ORFstart2 reading frame using the three software programs described above for the determination of transmembrane helices gave the following result:

Three transmembrane helices were determined using the “DAS” transmembrane protein program. The N-terminus is arranged intracellularly. The length of the amino acid sequence of this reading frame is 119 amino acids. The result of the analysis applied using the DAS program is shown in Fig. 13.

A further analysis of the ORFstart2 reading frame using the HMMTOP server also revealed the presence of three transmembrane helices, namely in the region of amino acids 38-57, 70-89 and 98-117.

Two possible models were considered again using the TMpred method. The highly preferred model resulted in three strong transmembrane helices, the helices from amino acid positions 38-57 with an orientation from the inside out, from amino acid positions 69-90 with an orientation from the outside in and from amino acid positions 99-119 with an orientation extend from the inside out.

The alternative model also comprises three strong transmembrane helices, with the amino acids of positions 38-58 being a transmembrane helix with an orientation from the outside in, the amino acid positions 72-90 with an orientation from the inside out, and the Amino acid positions 100-118 with an orientation from the outside inwards.

3. Characterization of the ORF3 reading frame

The protein encoded by this reading frame is herein SEQ. ID. No. 15 discloses and comprises a total of 140 amino acids. This reading frame has a 34% homology with regard to amino acids 1 - 130 to the three-member family of the soluble carrier family 7 (solute canϊer family 7) (cationic amino acid transporter, Y ⁺ system). The corresponding gene bank entry can be found under the accession number Genbank Acc. AAL37184.

A further homology exists with regard to amino acids 107-130 to the ectropic retrovirus receptor from Rattus norwegicus. A homology of 62% is found here. This sequence can be found as Genbank entry BAB83893. Characterization of this reading frame using the DAS method revealed the existence of a total of three transmembrane domains. The analysis result is shown as Fig. 14 herein. Analysis using the HMMTOP program also revealed three transmembrane helices formed from amino acids 59-78, 91-110 and 119-138.

An analysis using TMpred finally showed three strong transmembrane helices based on two models. In the preferred model, these are formed from the amino acids at positions 79-80 with an inside-out orientation, 90-110 with an outside-in orientation, and 120-140 with an inside-out orientation.

The alternative model also has three strong transmembrane helices, which are formed from the amino acids at positions 59-79 with an outside-in orientation, from 93-111 with an inside-out orientation and from positions 121-139 with an orientation from outside to inside.

In connection with the present invention, in particular when using the different translation products of the sequences according to the invention or the polypeptides according to the invention, as they, among others, the subject of the sequences SEQ. ID. No. 13-15 can act as target molecules. It is particularly noteworthy that these are transmembrane proteins, which is important insofar as the development of molecules of the various classes of compounds discussed here, i. H. Peptides, proteins, antibodies, anticalins and functional nucleic acids, but also small molecules, the accessibility of parts of these sequences is particularly easy insofar as parts of these target molecules are arranged extracellularly, as can be seen from the above descriptions of the transmembrane domains.

Example 5: Overexpression of PKCG in thyroid carcinoma cells

The extent to which PKCG was overexpressed in thyroid carcinoma cells was investigated using semi-quantitative PCR and Northern blot analysis. The semi-quantitative RT-PCR was carried out on cDNA of the anaplastic thyroid carcinoma S227, the thyroid adenoma cell line S40.2, normal thyroid tissue, the cell line HeLa, the breast carcinoma cell line MCF-7 and the cell line EFM-19.

HPKCGupl (5'-ccttgcccctctcctgcccacctc-3 ') and HPKCGlo2 (5'-gggacggctgtagaggctgtatggagttcagaag-3') were used as primers, which at PKR? 209 lbp open reading frame on the mRNA level? include and amplify a fragment of 2424bp.

In order to compare the RT-PCR of the PKC? that amplify a product of 299bp. The batches (50 μl total volume per batch) contained 2 μl cDNA, 5 μl lOxPCR buffer, in each case 1 μl primer, l μl 2mM dNTP mix, 1.5 μl 15mM MgC12 and 0.5 μl Taq polymerase as well as 38 μl bidest. H2O.

The RT-PCR conditions were the same for the named primer pairs (HPKCGupl / lo2 and GAPDH2 / 3) with the exception of the annealing temperatures (HPKCGupl / lo2: 6S ° C; GAPDH2 / 3: 52 ° C at 30sec.) and were 95 ° C (30sec.) for the denaturation and 72 ° C (45sec.) for the extension. In total, these steps were carried out in 35 cycles. Before the start there was a single denaturation at 95 ° C (3min.) And finally an additional extension at 72 ° C for 10min. The RT-PCR was detected by gel electrophoresis.

Northern blot analysis was carried out as follows:

A 2.4 kbp PKCG-specific fragment, which includes the ORF, was used as the molecular probe. The radioactive labeling with ³ "P was based on the principle of" random primer extension ". After a pre-hybridization of the membrane in ExpressHyb ™ hybridization solution (Clontech Laboratories, Palo Alto, USA) for 30 min at 68 ° C, the membrane was hybridized with 100 g probe in ExpressHyb ™ hybridization solution for 60 min at 68 ° C. The membrane was then washed twice for 20 min at room temperature in 2 x SSC / 0.05% SDS and four times for 10 min at 50 ° C in 0.1 x SSC / 0.1% SDS. The signals were detected on a STORM phosphor imager (Molecular Dynamics, Sunnyvale, USA).

The result regarding the Northern blot analysis is shown in FIG. 9, the result of the semi-quantitative PCR in FIG. 10.

The human PKCG gene is approximately 150 kb from the breakpoint area of the thyroid tumors. Regulatory elements of the PKCG gene can be affected by rearrangement in the breakpoint region. For these reasons, PKCG represents a target molecule in connection with functional disorders of the thyroid dilise and / or hypothyroidism of the thyroid gland and / or thyroid tumors. The relative position of the PKCG gene is shown in FIG. 8. As can be seen from the Northern blot analysis, PKCG is overexpressed in thyroid carcinoma cells. The detection was carried out with a PKCG-specific probe, which was used for hybridization purposes. The hybridization conditions herein generally and specifically correspond to those disclosed in the examples.

The thyroid carcinoma was transferred to a cell line that also shows a change on chromosome 19 and was the subject of the studies described in this example.

The results described above in connection with the Northern blot analysis were also confirmed by means of a semi-quantitative PCR. After semiquantitative RT-PCR with PKCG-specific primers, expression in a thyroid carcinoma cell was determined. The following is plotted on the agarose gel shown in FIG. 10: in lane 1 a marker (marker III (Röche), λ-DNA cut with HindIII-EcoRI), lane 2 a cell line of anaplastic thyroid carcinoma S277, lane 3 the cell line of the thyroid adenoma S40.2, lane 4 normal thyroid tissue, lane 5 a Heia cell, ie breast cancer, lane 6 the cell line MCF7 (ATCC number HTB-22, also an adenocarcinoma), lane 7 the cell line EFM19, a human breast cancer cell line (DSMZ number ACC231), lane 8 a negative control, lane 9 a positive control (detection of GAP dehydrogenase to prove the isolation of cDNA). 10 thus shows that in the case of anaplastic thyroid carcinoma S277 the expression of the PKCG gene, in the present case with a length of 2442 kb, could be determined. PKCG gene activity was also found in the MCF7 cell line. In Fig. 10 the corresponding bands are indicated by an arrow.

The features of the invention disclosed in the above description, the sequence listing and the claims can be essential both individually and in any combination for the implementation of the invention in its various embodiments. The disclosure content of the claims is hereby incorporated by reference.

Claims

Expectations

1. Nucleic acid with changed expression in Hypeφlasien and / or tumors, characterized in that it comprises a nucleic acid sequence that is selected from the group that SEQ. ID. No. 1 to 12 and SEQ. ID. No. 16-19 includes.

2. Nucleic acid according to claim 1, characterized in that the tumor is selected from the group comprising epithelial tumors with a change in the chromosomal band 19q and tumors with a change in the chromosomal band 19ql3.

3. Nucleic acid according to claim 1 or 2, characterized in that the Hypeφlasie is selected from the group comprising Hypeφlasien the thyroid.

4. Nucleic acid according to one of claims 1 to 3, characterized in that SEQ. ID. No. 1, 2, 7, 10, 11 and / or 12 encoded for a CAT, in particular a human CAT, or a part thereof.

5. Nucleic acid according to one of claims 1 to 3, characterized in that SEQ. ID. No. 3, 4, 8, 16 and / or 17 for a DC2, in particular a human DC2, or a part thereof.

6. Nucleic acid according to one of claims 1 to 3, characterized in that SEQ. ID. No. 5, 6, 9, 18 and / or 19 for PKCgamma, in particular human PKCgamma, or a part thereof.

7. Nucleic acid comprising a nucleic acid sequence which would code for the same amino acid sequence without the degeneracy of the genetic code as a nucleic acid according to one of claims 1 to 6.

8. nucleic acid that hybridizes to one of the nucleic acids according to any one of claims 1 to 7.

9. Vector, characterized in that it comprises a nucleic acid according to one of the preceding claims.

10. Vector according to Anspmch 9, characterized in that it further comprises at least one element which is selected from the group comprising promoters, terminators and enhancers.

11. Vector according to Anspmch 9 or 10, characterized in that the vector is an expression vector.

12. Vector according to Anspmch 9 to 1 1, characterized in that at least one promoter is in the reading frame with at least one part of a nucleic acid coding for a polypeptide according to one of claims 1 to 8.

13. Polypeptide encoded by a nucleic acid according to one of claims 1 to 8.

14. Polypeptide according to Anspmch 13, characterized in that it is modified.

15. Cell, in particular an isolated cell, which comprises a vector according to any one of claims 9 to 12.

16. Antiköφer, characterized in that it is directed against a polypeptide according to Anspmch 13 or 14.

17. Antiköφer according to Anspmch 16, characterized in that it is directed against a nucleic acid according to any one of claims 1 to 8.

18. Ribozyme, characterized in that it is directed against a nucleic acid according to one of claims 1 to 8.

19. Ribozyme according to Anspmch 18, characterized in that it comprises at least part of a nucleic acid according to one of claims 1 to 8.

20. Anti-sense nucleic acid comprise a sequence which is complementary to one of the nucleic acid sequences according to one of claims 1 to 8.

21. RNAi comprising a sequence that is complementary or identical to one of the nucleic acids according to one of claims 1 to 8, wherein the RNAi preferably comprises a region with a length of 21 to 23 nucleotides that is complementary or identical.

22. A method for determining a compound which influences, in particular inhibits, the action of a translation product of a nucleic acid according to one of the preceding claims, characterized by the following steps:

Providing the translation product and the compound

Contacting the translation product and the compound in a system representing the effect of the translation product, and

Determine whether a change in the effect of the translation product occurs under the influence of the compound.

23. A method for determining a compound which influences, in particular inhibits, the action of a transcription product of a nucleic acid according to one of the preceding claims, characterized by the following steps:

Providing the transcription product and the connection

24. The method according to Anspmch 22 or 23, characterized in that the system is selected from the group, the cellular expression systems, cell-free expression systems, assay for determining the interaction between compound and translation products, and assay for determining the interaction between compound and transcription products.

25. A method for the determination of genes which are responsible for the formation of hypoplastic and tumors, in particular the thyroid, comprises the following steps:

Determining genes that are within a range of 400 kbp, preferably 150 kbp, in any direction from the breakpoint range, and

Determine whether the translation / transcription of the gene in a cell of Hypeφlasie or the tumor is changed compared to a non-Hypeφlasie cell or a non-tumor cell.

26. Use of a nucleic acid according to one of claims 1 to 8 and / or a ribozyme according to Anspmch 18 or 19 and / or of an antisense nucleic acid according to Anspmch 20 and / or an RNAi according to Anspmch 21 for the diagnosis and / or therapy of functional sequences Thyroid and / or hypothyroidism of the thyroid and / or thyroid tumors.

27. Use of a nucleic acid according to one of claims 1 to 8 and / or a ribozyme according to Anspmch 18 or 19 and / or of an antisense nucleic acid according to Anspmch 20 and / or an RNAi according to Anspmch 21 for the manufacture of a medicament, in particular for therapy and / or prevention of functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors.

28. Use of a polypeptide according to any one of claims 13 to 14 for diagnosis and or therapy of functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors.

29. Use of a polypeptide according to any one of claims 13 to 14 for the manufacture of a medicament, in particular for the therapy and or prevention of functional currents of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors.

30. Use of an antibody according to one of claims 16 to 17 for diagnosis and / or therapy of functional currents of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors.

31. Use of an Antiköφers according to any one of claims 16 to 17 for the manufacture of a medicament.

32. Kit for the diagnosis of functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors, characterized in that the kit comprises at least one element which is selected from the group comprising a nucleic acid, a vector, a polypeptide, a cell , Antiköφer, an antisense nucleic acid, RNAi and a ribozyme, each according to one of the preceding claims.

33. Method for the detection of functional currents of the thyroid gland and / or hypothyroidism of the thyroid gland and / or tumors of the thyroid dilise, characterized by the steps:

Contacting thyroid material with the agent selected from the group comprising a nucleic acid, a vector, a polypeptide, an antibody, an antisense nucleic acid, RNAi, a ribozyme and a cell, each according to one of the preceding claims, and

Determine whether there are functional thyroid glands and / or hypothyroidism and / or thyroid tumors.

34. Method according to Anspmch 33, characterized in that the thyroid material is present ex vivo.

35. Use of a nucleic acid according to one of claims 1 to 8 as a primer and / or as a probe.

36. Primer for displaying and / or screening and / or detecting a nucleic acid, characterized in that it is complementary to part of a nucleic acid sequence according to one of claims 1 to 8.

37. A method for displaying a nucleic acid which comprises a sequence which can be detected in thyroid tumors or goiter in which there is a translocation with a site in the chiOmosomal band 19ql3, the sequence being within the chromosomal band 19ql3, characterized in that the Procedure which includes steps:

Provision of primers according to Anspmch 36, for carrying out a polymerase chain reaction,

Providing a nucleic acid sequence taken from band 19ql3 of human chromosome 19 or a nucleic acid according to one of claims 1 to 8,

Mixing the nucleic acid sequence or the nucleic acid with the primers,

Perform a polymerase chain reaction.

38. Pharmaceutical composition, characterized in that it comprises:

at least one agent selected from the group comprising a nucleic acid, a vector, a polypeptide, a cell, an antibody, an antisense nucleic acid, RNAi, a ribozyme, each according to one of the preceding claims, and combinations thereof, and

at least one pharmaceutically acceptable carrier.

39. A method for the treatment and / or prophylaxis of tumors and hypoplasia, characterized in that a compound is administered to a patient, which prevents the effects of the changed expression of the nucleic acids according to any one of the preceding claims.

40. Use of a compound which prevents the effects of the changed expression of the nucleic acids according to one of the preceding claims, for the manufacture of a medicament.

41. Use according to claim 40, characterized in that the medicament for the treatment and / or prophylaxis of tumors and / or hypoplasias, in particular tumors and / or hypoplasia of the thyroid gland.

42. Use of a nucleic acid with a sequence, the sequence being selected from the group that SEQ. ED. No. 1 - 12 and SEQ. ID. No. 16 - 19, or derivatives thereof and / or polypeptides or derivatives thereof encoded for the manufacture of a medicament, in particular for the treatment of functional disorders of the thyroid gland and / or hypothyroidism of the thyroid dilise and / or thyroid tumors and / or for the manufacture of a diagnostic agent, in particular for the diagnosis of functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors.

43. Use according to Anspmch 42, characterized in that the polypeptide has an amino acid sequence according to SEQ ID No. 13, SEQ ID No. 14 and / or SEQ. ID No. 15 has.

44. Use according to claim 42 or 43, characterized in that the nucleic acid with the nucleic acid according to one of the sequences SEQ ID No. 1 - 12 and / or SEQ ID No. 16-19 would hybridize without the degeneracy of the genetic code.

45. Use of a polypeptide with a sequence, the sequence being selected from the group comprising SEQ. ID. No. 13-15 comprises, or derivatives thereof for the manufacture of a medicament, in particular for the treatment of functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors and / or for the manufacture of a diagnostic agent, in particular for the diagnosis of functional disorders of the thyroid gland and / or Hypothyroidism of the thyroid gland and / or thyroid tumors.

46. Method for screening an agent for the treatment of functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors and / or a dia- Gnostic agent for the diagnosis of functional disorders of the thyroid gland and / or hypothyroidism of the thyroid dilise and / or thyroid tumors, comprising the steps:

e) providing a candidate connection, f) providing an expression system and / or activity system; g) contacting the candidate connection with the expression system and / or the activity system; h) determining whether, under the influence of the candidate compound, the expression and / or the activity of a nucleic acid with a sequence, the sequence being selected from the group that SEQ. ID. No. 1 - 12 and SEQ. ID. No. 16-19 comprises, or derivatives thereof and / or polypeptides encoded and / or polypeptides with a sequence according to SEQ. ID. No. 13 - 15 or derivatives thereof is changed.

47. Method according to Anspmch 46, characterized in that the candidate connection is contained in a connection library.

48. Method according to Anspmch 46 or 47, characterized in that the candidate compound is selected from the group of compound classes which comprises peptides, proteins, antibodies, anticalins, functional nucleic acids and small molecules.

49. The method according to Anspmch 48, characterized in that the functional nucleic acids are selected from the group comprising aptamers, aptazymes, ribozymes, Spiegelmers, antisense oligonucleotides and RNAi.

50. Using a nucleic acid with a sequence, the sequence being selected from the group consisting of SEQ. ID. No. 1 - 12 and SEQ. ID. No. 16-19 comprises, or derivatives thereof and / or encoded polypeptides or derivatives thereof and / or a polypeptide with a sequence according to SEQ. ID. No. 13-15 or a derivative thereof and / or an in particular natural interaction partner of a nucleic acid with a sequence, the sequence being selected from the group that SEQ. ID. No. 1 - 12 and SEQ. ID. No. 16-19, or derivatives thereof and / or polypeptides encoded thereof or derivatives thereof and / or a nucleic acid coding therefor and / or the interaction partner of a polypeptide with a Sequence according to SEQ. ID. No. 13 - 15 or a derivative thereof as a target molecule for the development and / or production of a diagnostic agent for the diagnosis of functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors, and / or for the development and / or production of a medicament for prevention and / or treatment of functional disorders of the thyroid dilise and / or hypothyroidism of the thyroid gland and / or thyroid tumors.

51. Use according to claim 50, characterized in that the medicament or the diagnostic agent comprises an agent which is selected from the group comprising antibodies, peptides, anticalins, small molecules, antisense molecules, aptamers, Spiegelmers and RNAi molecules ,

52. Use according to claim 51, characterized in that the agent with a polypeptide with a sequence according to SEQ. ID. No. 13-15 or a derivative thereof or an interaction partner thereof.

53. Use according to claim 51, characterized in that the agent interacts with a nucleic acid with a sequence, the sequence being selected from the group comprising SEQ. ID. No. 1 - 12 and SEQ. ID. No. 16-19 comprises, or derivatives thereof and / or with a nucleic acid coding for an especially natural interaction partner, in particular with mRNA, genomic nucleic acid or cDNA.

54. Use of a polypeptide that interacts with a peptide encoded by a nucleic acid with a sequence, the sequence being selected from the group consisting of SEQ. ID. No. 1 - 12 and SEQ. ID. No. 16-19 comprises, or derivatives thereof and / or a polypeptide according to SEQ. ID. No. 13 - 15 and / or with a particularly natural interaction partner thereof interacts to develop or manufacture a diagnostic agent for diagnosing functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors, and / or to develop or manufacture a medicament for prevention and / or treatment of functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors.

55. Use according to Anspmch 54, characterized in that the polypeptide is selected from the group comprising antibodies and binding polypeptides.

56. Use of a nucleic acid which interacts with a polypeptide, the polypeptide being encoded by a nucleic acid with a sequence, the sequence being selected from the group that SEQ. ED. No. 1 - 12 and SEQ. ID. No. 16-19 comprises, or derivatives thereof and / or a polypeptide according to SEQ. ID. No. 13 - 15 and / or with a particularly natural interaction partner thereof for the development or manufacture of a diagnostic agent for the diagnosis of functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors, and / or for the development or manufacture of a medicament for prevention and / or Treatment of functional disorders of the thyroid dilise and / or hypothyroidism of the thyroid gland and / or thyroid tumors.

57. Use according to Anspmch 56, characterized in that the nucleic acid is selected from the group comprising aptamers and Spiegelmers.

58. Use of a first nucleic acid which interacts with a second nucleic acid, the second nucleic acid having a sequence, the sequence being selected from the group comprising SEQ. ED. No. 1 - 12 and SEQ. ID. No. 16-19, or derivatives thereof and / or interacts with a nucleic acid which is suitable for an interaction partner of a polypeptide with a sequence according to SEQ. ID. No. 13, 14 or 15 codes for the development or manufacture of a medicament for the prevention and / or treatment of functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors.

59. Use according to claim 58, characterized in that the interacting first nucleic acid is an antisense oligonucleotide, a ribozyme and / or RNAi.

60. Use according to Anspmch 58 or 59, characterized in that the second nucleic acid is the respective cDNA or mRNA.

61. A pharmaceutical composition comprising at least one agent selected from the group as defined by the use according to any one of claims 50 to 60, and at least one pharmaceutically acceptable carrier, in particular for the prevention and / or treatment of functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors.

62. Kit for characterizing the condition of the thyroid gland, comprising at least one agent defined by the use according to one of claims 50 to 60.