Nukleinsäuresequenzen von Hyperplasien und Tumoren der Schilddrüse Nucleic acid sequences from hyperplasias and thyroid tumors
Beschreibungdescription
Die vorliegende Erfindung betrifft Nukleinsäuren mit bei Hyperplasien und/oder Tumoren geänderter Expression, Nukleinsäuren codierend für die humanen Homologen zu CAT, DC2, hierin im Folgenden auch CAT und DC2 genannt, und PKCgamma und insbesondere Homologen davon, diese enthaltenden Vektoren und Zellen, von diesen codierte Polypeptide, dagegen gerichtete Antikörper, Verfahren zum Bestimmen von als Tumortherapeutika geeigneten Verbindungen, Verfahren zum Bestimmen von Genen, die an der Entstehung von Schilddrüsentumoren beteiligt sind und Verwendungen der besagten Nukleinsäuren.The present invention relates to nucleic acids with changed expression in hyperplasias and / or tumors, nucleic acids coding for the human homologues to CAT, DC2, hereinafter also referred to as CAT and DC2, and PKCgamma and in particular homologues thereof, vectors and cells containing them encoded polypeptides, antibodies directed against it, methods for determining compounds suitable as tumor therapeutic agents, methods for determining genes which are involved in the development of thyroid tumors and uses of the said nucleic acids.
Die Bedeutung der Schilddrüse infolge ihrer Hormonproduktion für die Kontrolle des Wachstums und der Entwicklung des Körpers ist in der Medizin ebenso wie die mit einer Funktionsstörung dieser Drüse zumindest in einigen Fällen im wahrsten Sinne des Wortes augenfälligen Veränderungen seit langem bekannt.The importance of the thyroid gland as a result of its hormone production for the control of the growth and development of the body has long been known in medicine, as has the obvious changes, at least in some cases, in the true sense of the word, with a dysfunction of this gland.
Hinsichtlich der Pathogenese von Strumen und Schilddrüsentumoren allgemein ist es insbesondere auf molekularer Ebene noch nicht gelungen, eine umfassende Vorstellung zu entwickeln. Derzeit werden zwei Konzepte diskutiert, wobei eines davon ausgeht, dass das hyperplastische Gewebe als infolge chronischer Stimulation durch ein trophisches Hormon, was letztendlich das Wachstum polyklonaler Knoten zur Folge hat, bedingt betrachtet wird. Dieses Konzept wird als nicht-neoplastische endokrine Hyperplasie (NNEH) bezeichnet. Das zweite Konzept geht davon aus, dass die Knoten echte klonale Tumoren darstellen.With regard to the pathogenesis of goitre and thyroid tumors in general, it has not yet been possible to develop a comprehensive idea, particularly at the molecular level. Two concepts are currently under discussion, one of which is based on the assumption that the hyperplastic tissue is considered conditional as a result of chronic stimulation by a trophic hormone, which ultimately results in the growth of polyclonal nodes. This concept is called non-neoplastic endocrine hyperplasia (NNEH). The second concept assumes that the nodes represent real clonal tumors.
Im Falle der Schilddrüse hat sich gezeigt, dass das auf andere Drüsen anwendbare einfache Konzept der nicht-neoplastischen endokrinen Hypeφlasie nicht anwendbar ist. Eine Übersicht über die derzeit auf diesem Gebiet angestellten Überlegungen findet sich bei Studer, H. (1995); En- docrine Reviews, Vol. 16, No. 4, Seiten 411-426.In the case of the thyroid gland, it has been shown that the simple concept of non-neoplastic endocrine hypoclasia applicable to other glands is not applicable. An overview of the considerations currently being made in this area can be found in Studer, H. (1995); Endocrine Reviews, Vol. 16, No. 4, pages 411-426.
Für die Behandlung von Strumen und Schilddrüsentumoren ist somit eine frühzeitige Diagnose erforderlich, um geeignete therapeutische Konzepte zur Anwendung gelangen zu lassen.
Der vorliegenden Erfindung liegt die Aufgabe zugrunde, Mittel zur Diagnose und Therapie von FunktionsstöiTingen der Schilddrüse, Hyperplasien der Schilddrüse und Tumoren der Schilddrüse auf der molekularen Ebene bereitzustellen, insbesondere sollen Nukleinsäuresequenzen bereitgestellt werden, die an den Pathogenitätsmechanismen beteiligt und auch geeignet sind, diese weitergehend zu untersuchen, sowie solche, die auf die Pathogenitätsmechanismen einwirken oder diese beeinflussen können.For the treatment of goitre and thyroid tumors, an early diagnosis is necessary in order to use suitable therapeutic concepts. The present invention is based on the object of providing means for the diagnosis and therapy of functional disorders of the thyroid gland, hyperplasia of the thyroid gland and tumors of the thyroid gland at the molecular level, in particular nucleic acid sequences which are involved in and are also suitable for the pathogenicity mechanisms are to be provided investigate, as well as those that affect or can influence the pathogenicity mechanisms.
Darüber hinaus sollen darauf aufbauende Medikamente sowie allgemein pharmazeutische Zusammensetzungen bereitgestellt werden.In addition, medicines based thereon and pharmaceutical compositions in general are to be provided.
Desweiteren sollen Kits zur Diagnose und/oder Therapie von Funktionsstörungen der Schilddrüse, Hyperplasien der Schilddrüse und Tumoren der Schilddrüse ebenso wie Verfahren zum Nachweisen dieser zur Verfügung gestellt werden.Furthermore, kits for the diagnosis and / or therapy of functional disorders of the thyroid gland, hyperplasia of the thyroid gland and tumors of the thyroid gland as well as methods for detecting these are to be provided.
Erfindungsgemäß wird die Aufgabe gelöst durch den Gegenstand der unabhängigen Ansprüche. Weitere Ausführungsformen ergeben sich aus den Unteransprüchen.According to the invention the object is achieved by the subject matter of the independent claims. Further embodiments result from the subclaims.
Erfindungsgemäß wird die Aufgabe in einem ersten Aspekt auch gelöst durch eine Nukleinsaure mit bei Hyperplasien und/oder Tumoren geänderter Expression, wobei sie eine Nukleinsauresequenz umfasst, die ausgewählt ist aus der Gruppe, die SEQ. ID. No. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 16, 17, 18 und 19 umfasst, im folgenden auch als SEQ. ID. No. 1 bis 12 und SEQ. ID. No. 16 - 19 bezeichnet.According to the invention, the object is also achieved in a first aspect by a nucleic acid with changed expression in hyperplasias and / or tumors, wherein it comprises a nucleic acid sequence which is selected from the group SEQ. ID. No. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 16, 17, 18 and 19, hereinafter also as SEQ. ID. No. 1 to 12 and SEQ. ID. No. 16-19.
In einer Ausfuhrungsform ist vorgesehen, dass der Tumor ausgewählt ist aus der Gruppe, die epitheliale Tumoren mit einer Veränderung der chromosomalen Bande 19q und Tumore mit einer Veränderung der chromosomalen Bande 19ql3 umfasst.In one embodiment it is provided that the tumor is selected from the group comprising epithelial tumors with a change in the chromosomal band 19q and tumors with a change in the chromosomal band 19ql3.
In einer weiteren Ausfuhrungsform ist vorgesehen, dass die Hypeφlasie ausgewählt ist aus der Gruppe, die Hypeφlasien der Schilddrüse umfasst.In a further embodiment it is provided that the hype phlasia is selected from the group comprising hype phlasias of the thyroid gland.
In einer noch weiteren Ausfuhrungsform ist vorgesehen, dass SEQ. ID. No. 1, 2, 7, 10, 11 und/oder 12 für ein CAT, insbesondere ein humanes CAT, oder einen Teil davon codiert.
In einer weiteren Ausführungsform ist vorgesehen, dass SEQ. ID. No. 3, 4, 8, 16 und/oder 17 für ein DC2, insbesondere ein humanes DC2, oder einen Teil davon codiert.A still further embodiment provides that SEQ. ID. No. 1, 2, 7, 10, 11 and / or 12 encoded for a CAT, in particular a human CAT, or a part thereof. In a further embodiment it is provided that SEQ. ID. No. 3, 4, 8, 16 and / or 17 for a DC2, in particular a human DC2, or a part thereof.
In einer noch weiteren Ausführungsform ist vorgesehen, dass SEQ. ID. No. 5, 6, 9, 18 und/oder 19 für PKCgamma, insbesondere humanes PKCgamma, oder einen Teil davon codiert.In a still further embodiment it is provided that SEQ. ID. No. 5, 6, 9, 18 and / or 19 for PKCgamma, in particular human PKCgamma, or a part thereof.
In einem weiteren Aspekt wird die Aufgabe erfindungsgemäß gelöst durch eine Nukleinsaure umfassend eine Nukleinsauresequenz die ohne die Degeneriertheit des genetischen Codes für die gleiche Aminosäuresequenz codieren würde wie eine der erfmdungsgemäßen Nukleinsaure.In a further aspect, the object is achieved according to the invention by a nucleic acid comprising a nucleic acid sequence which would code for the same amino acid sequence without the degeneracy of the genetic code as one of the nucleic acid according to the invention.
In einem weiteren Aspekt wird die Aufgabe erfindungsgemäß gelöst durch eine Nukleinsaure, die an eine oder mit einer der erfindungsgemäßen Nukleinsäuren hybridisiert.In a further aspect, the object is achieved according to the invention by a nucleic acid which hybridizes to or with one of the nucleic acids according to the invention.
In einem noch weiteren Aspekt wird die Aufgabe gelöst durch einen Vektor, wobei der Vektor zumindest eine der erfindungsgemäßen Nukleinsäuren umfasst.In a still further aspect, the object is achieved by a vector, the vector comprising at least one of the nucleic acids according to the invention.
In einer Ausfuhrungsform ist vorgesehen, dass der Vektor weiterhin mindestens ein Element umfasst, das ausgewählt ist aus der Gruppe, die Promotoren, Terminatoren und Enhancer umfasst.One embodiment provides that the vector further comprises at least one element which is selected from the group comprising promoters, terminators and enhancers.
In einer weiteren Ausfuhrungsfomi ist vorgesehen, dass der Vektor ein Expressionsvektor ist.Another embodiment provides that the vector is an expression vector.
In einer noch weiteren Ausfuhrungsform ist vorgesehen, dass mindestens eine Promotor im Leserahmen mit mindestens einem für ein Polypeptid codierenden Teil einer Nukleinsaure nach einem der Ansprüche 1 bis 8 ist.In yet another embodiment it is provided that at least one promoter is in the reading frame with at least one part of a nucleic acid coding for a polypeptide according to one of Claims 1 to 8.
In einem weiteren Aspekt wird die Aufgabe erfindungsgemäß gelöst durch ein Polypeptid, das codiert durch eine der erfindugsgemäßen Nukleinsaure codiert wird.In a further aspect, the object is achieved according to the invention by a polypeptide which is encoded by one of the nucleic acids according to the invention.
In einer Ausfuhrungsform ist vorgesehen, dass das Polypeptid modifiziert ist.In one embodiment it is provided that the polypeptide is modified.
In einem weiteren Aspekt wird die Aufgabe erfindungsgemäß gelöst durch eine Zelle, insbesondere eine isolierte Zelle, die einen erfindungsgemäßen Vektor umfasst.
In einem weiteren Aspekt wird die Aufgabe erfmdungsgemäß gelöst durch einen Antiköφer, der gegen ein erfindungsgemäßes Polypeptid gerichtet ist.In a further aspect, the object is achieved according to the invention by a cell, in particular an isolated cell, which comprises a vector according to the invention. In a further aspect, the object is achieved according to the invention by an antibody which is directed against a polypeptide according to the invention.
In einer Ausführungsform ist vorgesehen, dass der Antiköφer gegen eine erfindungsgemäße Nukleinsaure gerichtet ist.In one embodiment it is provided that the antibody is directed against a nucleic acid according to the invention.
In einem weiteren Aspekt wird die Aufgabe erfindungsgemäß gelöst durch ein Ribozym, das gegen eine erfindungsgemäße Nukleinsaure gerichtet ist.In a further aspect, the object is achieved according to the invention by a ribozyme which is directed against a nucleic acid according to the invention.
hi einer Ausführungsform ist vorgesehen, dass das Ribozym zumindest einen Teil einer der erfindungsgemäßen Nukleinsäuren umfasst.In one embodiment it is provided that the ribozyme comprises at least part of one of the nucleic acids according to the invention.
In einem weiteren Aspekt wird die Aufgabe erfindungsgemäß gelöst durch eine Anti-sense Nukleinsaure umfassen eine Sequenz, die komplementär oder identisch zu einer der erfindungsgemäßen Nukleinsäuren ist.In a further aspect, the object is achieved according to the invention by an anti-sense nucleic acid comprising a sequence which is complementary or identical to one of the nucleic acids according to the invention.
In einem weiteren Aspekt wird die Aufgabe erfindungsgemäß gelöst durch RNAi umfassend eine Sequenz, die komplementär zu oder identisch ist mit einer der erfindungsgemäßen Nukleinsäuren , wobei bevorzugterweise die RNAi einen Bereich mit einer Länge von 21 bis 23 Nukleo- tiden umfasst, der komplementär oder identisch ist.In a further aspect, the object is achieved according to the invention by RNAi comprising a sequence which is complementary to or identical to one of the nucleic acids according to the invention, the RNAi preferably comprising a region with a length of 21 to 23 nucleotides which is complementary or identical ,
In einem weiteren Aspekt wird die Aufgabe erfindungsgemäß gelöst durch ein Verfahren zum Bestimmen einer Verbindung, die die Wirkung eines Translationsproduktes einer Nukleinsaure nach einem der vorangegangenen Ansprüche beeinflusst, insbesondere inhibiert, gekennzeichnet durch die folgenden Schritte:In a further aspect, the object is achieved according to the invention by a method for determining a compound which influences, in particular inhibits, the action of a translation product of a nucleic acid according to one of the preceding claims, characterized by the following steps:
Bereitstellen des Translationsproduktes und der VerbindungProviding the translation product and the compound
Inkontaktbringen des Translationsproduktes und der Verbindung in einem System, das die Wirkung des Translationsproduktes darstellt, und
Bestimmen, ob unter dem Einfluss der Verbindung eine Änderung der Wirkung des Translationsproduktes auftritt.Contacting the translation product and the compound in a system representing the effect of the translation product, and Determine whether a change in the effect of the translation product occurs under the influence of the compound.
In einem noch weiteren Aspekt wird die Aufgabe erfindungsgemäß gelöst durch ein Verfahren zum Bestimmen einer Verbindung, die die Wirkung eines Transkriptionsproduktes einer Nukleinsaure nach einem der vorangegangenen Ansprüche beeinflusst, insbesondere inhibiert, gekennzeichnet durch die folgenden Schritte:In a still further aspect, the object is achieved according to the invention by a method for determining a compound which influences, in particular inhibits, the action of a transcription product of a nucleic acid according to one of the preceding claims, characterized by the following steps:
Bereitstellen des Transkriptionsproduktes und der VerbindungProviding the transcription product and the connection
Inkontaktbringen des Transkriptionsproduktes und der Verbindung in einem System, das die Wirkung des Transkriptionsproduktes darstellt, undContacting the transcription product and the compound in a system representing the effect of the transcription product, and
Bestimmen, ob unter dem Einfluss der Verbindung eine Änderung der Wirkung des Transkriptionsproduktes auftritt.Determine whether a change in the effect of the transcription product occurs under the influence of the compound.
In einer Ausfülirungsform der beiden vorstehend genannten erfmdungsgemäßen Verfahren ist vorgesehen, dass das System ausgewählt ist aus der Gruppe, die zelluläre Expressionssysteme, zellfreie Expressionssysteme, Assay zur Bestimmung der Wechselwirkung zwischen Verbindung und Translationsprodukte, und Assay zur Bestimmung der Wechselwirkung zwischen Verbindung und Transkriptionsprodukte umfasst.In one embodiment of the two methods according to the invention mentioned above, it is provided that the system is selected from the group comprising cellular expression systems, cell-free expression systems, assay for determining the interaction between compound and translation products, and assay for determining the interaction between compound and transcription products.
In einem weiteren Aspekt wird die Aufgabe erfindungsgemäß gelöst durch ein Verfahren zur Bestimmung von Genen, die für die Entstehung von Hypeφlasien und Tumoren, insbesondere der Schilddrüse, verantwortlich sind, umfassend die folgenden Schritte:In a further aspect, the object is achieved according to the invention by a method for determining genes which are responsible for the formation of hypoplastic and tumors, in particular the thyroid, comprising the following steps:
Ermitteln der Bruchpunkte bei chromosomalen Translokationen der Hypeφlasien und der Tumoren,Determining the breakpoints in the case of chromosomal translocations of the hypoplastic and tumors,
Bestimmen von Genen, die innerhalb eines Bereichs von 400 kbp, bevorzugterweise 150 kbp, in jede Richtung ab dem Bruchpunktbereich liegen, und
Bestimmen, ob die Translation/ Transkription des Gens in einer Zelle der Hypeφlasie oder des Tumors gegenüber einer nicht-Hypeφlasie-Zelle oder einer nicht-Tumor-Zelle verändert ist.Determining genes that are within a range of 400 kbp, preferably 150 kbp, in any direction from the breakpoint range, and Determine whether the translation / transcription of the gene in a cell of Hypeφlasie or the tumor is changed compared to a non-Hypeφlasie cell or a non-tumor cell.
In einem noch weiteren Aspekt wird die Aufgabe erfindungsgemäß gelöst durch die Verwendung einer der erfindungsgemäßen Nukleinsaure und/oder eines erfmdungsgemäßen Ribozyms und/oder von einer erfindungsgemäßen Antisense-Nukleinsäure und/oder einer erfindungsgemäßen RNAi zur Diagnose und/oder Therapie von Funktionsstörungen der Schilddrüse und/oder Hypeφlasien der Schilddrüse und/oder Schilddrüsentumoren.In a still further aspect, the object is achieved according to the invention by using one of the nucleic acid and / or a ribozyme according to the invention and / or an antisense nucleic acid and / or an RNAi according to the invention for the diagnosis and / or therapy of functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors.
In einem weiteren Aspekt wird die Aufgabe erfindungsgemäß gelöst durch die Verwendung einer der erfindungsgemäßen Nukleinsaure und/oder eines erfindungsgemäßen Ribozyms und/oder von einer erfindungsgemäßen Antisense-Nukleinsäure und/oder einer erfindungsgemäßen RNAi zur Herstellung eines Medikaments, insbesondere zur Therapie und/oder Prävention von Funktionsstörungen der Schilddrüse und/oder Hypeφlasien der Schilddrüse und/oder Schilddrüsentu- moren.In a further aspect, the object is achieved according to the invention by using one of the nucleic acid and / or a ribozyme according to the invention and / or an antisense nucleic acid and / or an RNAi according to the invention for the manufacture of a medicament, in particular for the therapy and / or prevention of Functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors.
In einem weiteren Aspekt wird die Aufgabe erfindungsgemäß gelöst durch die Verwendung eines erfindungsgemäßen Polypeptids zur Diagnose und/oder Therapie von Funktionsstörungen der Schilddrüse und/oder Hypeφlasien der Schilddrüse und/oder Schilddrüsentumoren.In a further aspect, the object is achieved according to the invention by using a polypeptide according to the invention for the diagnosis and / or therapy of functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors.
In einem weiteren Aspekt wird die Aufgabe erfindungsgemäß gelöst durch die Verwendung eines erfindungsgemäßen Polypeptids zur Herstellung eines Medikaments, insbesondere zur Therapie und/oder Prävention von FunktionsstöiTingen der Schilddrüse und/oder Hypeφlasien der Schilddrüse und/oder Schilddrüsentumoren.In a further aspect, the object is achieved according to the invention by the use of a polypeptide according to the invention for the manufacture of a medicament, in particular for the therapy and / or prevention of functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors.
In einem weiteren Aspekt wird die Aufgabe erfindungsgemäß gelöst durch die Verwendung eines erfindungsgemäßen Antiköφers zur Diagnose und/oder Therapie von Funktionsstörungen der Schilddrüse und/oder Hypeφlasien der Schilddrüse und/oder Schilddrüsentumoren.In a further aspect, the object is achieved according to the invention by using an antibody according to the invention for the diagnosis and / or therapy of functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors.
In einem weiteren Aspekt wird die Aufgabe erfindungsgemäß gelöst durch die Verwendung eines erfindungsgemäßen Antiköφers zur Herstellung eines Medikaments.
In einem noch weiteren Aspekt wird die Aufgabe erfindungsgemäß gelöst durch einen Kit zur Diagnose von Funktionsstörungen der Schilddrüse und/oder Hypeφlasien der Schilddrüse und/oder Schilddrüsentumoren, dadurch gekennzeichnet, dass der Kit mindestens ein Element umfasst, das ausgewählt ist aus der Gruppe, die eine Nukleinsaure, einen Vektor, ein Polypeptid, eine Zelle, einen Antiköφer, eine Antisense-Nukleinsäure, RNAi und ein Ribozym, jeweils gemäß der vorliegenden Erfindung, umfasst.In a further aspect, the object is achieved according to the invention by using an antibody according to the invention for the production of a medicament. In a still further aspect, the object is achieved according to the invention by a kit for diagnosing functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors, characterized in that the kit comprises at least one element which is selected from the group comprising a Nucleic acid, a vector, a polypeptide, a cell, an antibody, an antisense nucleic acid, RNAi and a ribozyme, each according to the present invention.
In einem weiteren Aspekt wird die Aufgabe erfindungsgemäß gelöst durch ein Verfahren zum Nachweis von Funktionsstörungen der Schilddrüse und/oder Hypeφlasien der Schilddrüse und/oder Tumoren der Schilddrüse, gekennzeichnet durch die Schritte:In a further aspect, the object is achieved according to the invention by a method for detecting functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or tumors of the thyroid gland, characterized by the steps:
Kontaktieren von Schilddrüsenmaterial mit dem Agens, das ausgewählt ist aus der Gruppe, die eine Nukleinsaure, einen Vektor, ein Polypeptid, einen Antiköφer, eine Antisense- Nukleinsäure, RNAi, ein Ribozym und eine Zelle, jeweils gemäß der vorliegenden Erfindung, umfasst, undContacting thyroid material with the agent selected from the group comprising a nucleic acid, a vector, a polypeptide, an antibody, an antisense nucleic acid, RNAi, a ribozyme and a cell, each according to the present invention, and
Bestimmen, ob Funktionsstörungen der Schilddrüse und/oder Hypeφlasien der Schilddrüse und/oder Tumore der Schilddrüse vorliegen.Determine whether there are malfunctions of the thyroid gland and / or hypothyroidism of the thyroid gland and / or tumors of the thyroid gland.
In einer Ausfülirungsform ist vorgesehen, dass das Schilddrüsenmaterial ex vivo vorliegt.One embodiment provides that the thyroid material is present ex vivo.
In einem weiteren Aspekt wird die Aufgabe erfindungsgemäß gelöst durch die Verwendung einer erfindungsgemäßen Nukleinsaure als Primer und/oder als Sonde.In a further aspect, the object is achieved according to the invention by using a nucleic acid according to the invention as a primer and / or as a probe.
In einem noch weiteren Aspekt wird die Aufgabe erfindungsgemäß gelöst durch einen Primer zum Darstellen und/oder Screenen und/oder Detektieren einer Nukleinsaure, wobei der Primer oder die Sonde zu einem Teil einer der erfmdungsgemäßen Nukleinsäuren komplementär oder mit diesem identisch ist.In a still further aspect, the object is achieved according to the invention by a primer for displaying and / or screening and / or detecting a nucleic acid, the primer or the probe being complementary to part of one of the nucleic acids according to the invention or identical to it.
In einem weiteren Aspekt wird die Aufgabe erfindungsgemäß gelöst durch ein Verfahren zum Darstellen einer Nukleinsaure, die eine Sequenz umfasst, welche in Schilddrüsentumoren oder Strumen nachgewiesen werden kann, bei denen eine Translokation mit Bruchstelle in der chro-
mosomalen Bande 19ql3 vorliegt, wobei die Sequenz innerhalb der cliromosomalen Bande 19ql3 liegt, dadurch gekennzeichnet, dass das Verfahren die Schritte umfasst:In a further aspect, the object is achieved according to the invention by a method for representing a nucleic acid which comprises a sequence which can be detected in thyroid tumors or goitre in which a translocation with a breaking point in the chromosome mosomal band 19ql3 is present, the sequence lying within the cliromosomal band 19ql3, characterized in that the method comprises the steps:
Bereitstellen von zumindest einem der erfmdungsgemäßen Primern, zum Durchfuhren einer Polymerase- Kettenreaktion,Provision of at least one of the primers according to the invention, for carrying out a polymerase chain reaction,
Bereitstellen eine der Bande 19ql3 des humanen Chromosoms 19 entnommenen Nukleinsauresequenz oder einer der erfindungsgemäßen Nukleinsaure nach einem der,Provide a nucleic acid sequence taken from band 19ql3 of human chromosome 19 or one of the nucleic acid according to the invention according to one of the
Mischen der Nukleinsauresequenz bzw. der Nukleinsaure mit den Primern,Mixing the nucleic acid sequence or the nucleic acid with the primers,
Durchführen einer Polymerase-Kettenreaktion.Perform a polymerase chain reaction.
In einem weiteren Aspekt wird die Aufgabe erfindungsgemäß gelöst durch eine pharmazeutische Zusammensetzung, dadurch gekennzeichnet, dass sie umfasst:In a further aspect, the object is achieved according to the invention by a pharmaceutical composition, characterized in that it comprises:
mindestens ein Agens, das ausgewählt ist aus der Gruppe, die eine Nukleinsaure, einen Vektor, ein Polypeptid, eine Zelle, einen Antiköφer, eine Antisense-Nukleinsäure, RNAi, ein Ribozym, jeweils gemäß der vorliegenden Erfindung, sowie Kombinationen davon umfasst, undat least one agent selected from the group comprising a nucleic acid, a vector, a polypeptide, a cell, an antibody, an antisense nucleic acid, RNAi, a ribozyme, each in accordance with the present invention, and combinations thereof, and
mindestens einen pharmazeutisch akzeptablen Träger.at least one pharmaceutically acceptable carrier.
In einem noch weiteren Aspekt wird die Aufgabe erfindungsgemäß gelöst durch ein Verfahren zur Behandlung und/oder Prophylaxe von Tumoren und Hypeφlasien, wobei vorgesehen ist, dass eine Verbindung an einen Patienten verabreicht wird, die die Auswirkungen der geänderten Expression einer der erfindungemäßen Nukleinsäuren verhindert oder verstärkt.In a still further aspect, the object is achieved according to the invention by a method for the treatment and / or prophylaxis of tumors and hypoplasia, it being provided that a compound is administered to a patient which prevents or amplifies the effects of the changed expression of one of the nucleic acids according to the invention ,
hi einem weiteren Aspekt wird die Aufgabe erfindungsgemäß gelöst durch die Verwendung einer Verbindung, die die Auswirkungen der geänderten Expression der Nukleinsäuren nach einem der vorangegangen Ansprüche verhindert, zur Herstellung eines Medikamentes.
In einer Ausführungsform ist vorgesehen, dass das Medikament für die Behandlung und/oder Prophylaxe von Tumoren und/oder Hypeφlasien, insbesondere von Tumoren und/oder Hypeφlasien der Schilddrüse ist.In a further aspect, the object is achieved according to the invention by the use of a compound which prevents the effects of the changed expression of the nucleic acids according to one of the preceding claims for the manufacture of a medicament. In one embodiment it is provided that the medicament is for the treatment and / or prophylaxis of tumors and / or hypoplasias, in particular tumors and / or hypoplasias of the thyroid gland.
In einem weiteren Aspekt wird die Aufgabe erfindungsgemäß gelöst durch die Verwendung einer Nukleinsaure mit einer Sequenz, wobei die Sequenz ausgewählt ist aus der Gruppe, die SEQ. ID. No. 1 - 12 und SEQ. ID. No. 16 - 19 umfasst, oder Derivate davon und/oder davon codierte Polypeptide oder Derivate davon zur Herstellung eines Medikaments, insbesondere zur Behandlung von Funktionsstörungen der Schilddrüse und oder Hypeφlasien der Schilddrüse und/oder Schilddrüsentumoren und/oder zur Herstellung eines diagnostischen Mittels, insbesondere für die Diagnose von Funktionsstörungen der Schilddrüse und/oder Hypeφlasien der Schilddrüse und/oder Schilddrüsentumoren.In a further aspect, the object is achieved according to the invention by using a nucleic acid with a sequence, the sequence being selected from the group comprising SEQ. ID. No. 1 - 12 and SEQ. ID. No. 16 - 19 comprises, or derivatives thereof and / or encoded polypeptides or derivatives thereof for the manufacture of a medicament, in particular for the treatment of functional disorders of the thyroid gland and or hypothyroidism of the thyroid gland and / or thyroid tumors and / or for the manufacture of a diagnostic agent, in particular for the Diagnosis of functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors.
In einer Ausfülirungsform ist vorgesehen, dass das Polypeptid eine Aminosäuresequenz gemäß SEQ BD No. 13, SEQ ID No. 14 und/oder SEQ. ID No. 15 aufweist.In one embodiment it is provided that the polypeptide has an amino acid sequence according to SEQ BD No. 13, SEQ ID No. 14 and / or SEQ. ID No. 15 has.
In einer weiteren Ausführungsform ist vorgesehen, dass die Nukleinsaure mit der Nukleinsaure gemäß einer der Sequenzen SEQ ID No. 1 - 12 und/oder SEQ ID No. 16 - 19 ohne die Degene- riertheit des genetischen Codes hybridisieren würde.In a further embodiment it is provided that the nucleic acid with the nucleic acid according to one of the sequences SEQ ID No. 1 - 12 and / or SEQ ID No. 16-19 would hybridize without the degeneracy of the genetic code.
In einem weiteren Aspekt wird die Aufgabe erfmdungsgemäß gelöst durch die Verwendung eines Polypeptids mit einer Sequenz, wobei die Sequenz ausgewählt ist aus der Gruppe, die SEQ. ID. No. 13 - 15 umfasst, oder Derivate davon zur Herstellung eines Medikaments, insbesondere zur Behandlung von FunktionsstöiTingen der Schilddrüse und/oder Hypeφlasien der Schilddrüse und/oder Schilddrüsentumoren und/oder zur Herstellung eines diagnostischen Mittels, insbesondere für die Diagnose von Funktionsstörungen der Schilddrüse und/oder Hypeφlasien der Schilddrüse und/oder Schilddrüsentumoren.In a further aspect, the object is achieved according to the invention by using a polypeptide with a sequence, the sequence being selected from the group consisting of SEQ. ID. No. 13-15, or derivatives thereof for the manufacture of a medicament, in particular for the treatment of functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors and / or for the manufacture of a diagnostic agent, in particular for the diagnosis of functional disorders of the thyroid gland and / or Hypothyroidism of the thyroid gland and / or thyroid tumors.
In einem weiteren Aspekt wird die Aufgabe erfindungsgemäß gelöst durch ein Verfahren zum Screenen eines Mittels zur Behandlung von Funktionsstörungen der Schilddrüse und/oder Hypeφlasien der Schilddrüse und/oder Schilddrüsentumoren und/oder eines diagnostischen Mittels für die Diagnose von Funktionsstörungen der Schilddrüse und/oder Hypeφlasien der Schilddrüse und/oder Schilddrüsentumoren, umfassend die Schritte:
a) Bereitstellen einer Kandidaten- Verbindung, b) Bereitstellen eines Expressionsssystems und/oder Aktivitätssystems; c) Inkontaktbringen der Kandidaten-Verbindung mit dem Expressionssystem und/oder dem Aktivitätssystem; d) Bestimmen, ob unter dem Einfluss der Kandidaten- Verbindung die Expression und/oder die Aktivität einer Nukleinsaure mit einer Sequenz, wobei die Sequenz ausgewählt ist aus der Gruppe, die SEQ. ID. No. 1 - 12 und SEQ. ID. No. 16 - 19 umfasst, oder Derivate davon und/oder davon codierte Polypeptide und/oder Polypeptide mit einer Sequenz gemäß SEQ. ED. No. 13 - 15 oder Derivate davon verändert wird.In a further aspect, the object is achieved according to the invention by a method for screening an agent for treating functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors and / or a diagnostic agent for the diagnosis of functional disorders of the thyroid gland and / or hypothyroidism Thyroid and / or thyroid tumors, comprising the steps: a) providing a candidate connection, b) providing an expression system and / or activity system; c) contacting the candidate connection with the expression system and / or the activity system; d) determining whether, under the influence of the candidate compound, the expression and / or the activity of a nucleic acid with a sequence, the sequence being selected from the group comprising SEQ. ID. No. 1 - 12 and SEQ. ID. No. 16-19 comprises, or derivatives thereof and / or polypeptides encoded and / or polypeptides with a sequence according to SEQ. ED. No. 13 - 15 or derivatives thereof is changed.
In einer Ausführungsform ist vorgesehen, dass die Kandidaten-Verbindung in einer Verbindungsbibliothek enthalten ist.In one embodiment it is provided that the candidate connection is contained in a connection library.
In einer weiteren Ausführungsform ist vorgesehen, dass die Kandidaten-Verbindung ausgewählt ist aus der Gruppe von Verbindungsklassen, die Peptide, Proteine, Antiköφer, Anticaline, funktionale Nukleinsäuren und kleine Moleküle umfasst.In a further embodiment it is provided that the candidate compound is selected from the group of compound classes which comprises peptides, proteins, antibodies, anticalins, functional nucleic acids and small molecules.
In einer noch weiteren Ausführungsform ist vorgesehen, dass die funktionalen Nukleinsäuren ausgewählt sind aus der Gruppe, die Aptamere, Aptazyme, Ribozyme, Spiegelmere, Antisense- Oligonukleotide und RNAi umfasst.In yet another embodiment it is provided that the functional nucleic acids are selected from the group comprising aptamers, aptazymes, ribozymes, Spiegelmers, antisense oligonucleotides and RNAi.
In einem weiteren Aspekt wird die Aufgabe erfindungsgemäß gelöst durch die Verwendung einer Nukleinsaure mit einer Sequenz, wobei die Sequenz ausgewählt ist aus der Gruppe, die SEQ. ID. No. 1 - 12 und SEQ. ID. No. 16 - 19 umfasst, oder Derivate davon und/oder davon codierte Polypeptide oder Derivate davon und/oder eines Polypeptids mit einer Sequenz gemäß SEQ. ID. No. 13 - 15 oder eines Derivates davon und/oder eines insbesondere natürlichen Wechselwirkungspartners einer Nukleinsaure mit einer Sequenz, wobei die Sequenz ausgewählt ist aus der Gruppe, die SEQ. ID. No. 1 - 12 und SEQ. ID. No. 16 - 19 umfasst, oder Derivate davon und/oder davon codierte Polypeptide oder Derivate davon und/oder einer dafür codierenden Nukleinsaure und/oder der Wechsel Wirkungspartner eines Polypeptids mit einer Sequenz gemäß SEQ. ID. No. 13 - 15 oder eines Derivates davon als Zielmolekül für die Entwicklung und/oder
Herstellung eines diagnostischen Mittels zur Diagnose von Funktionsstörungen der Schilddrüse und/oder Hypeφlasien der Schilddrüse und/oder Schilddrüsentumoren, und/oder für die Entwicklung und oder Herstellung eines Medikaments zur Prävention und/oder Behandlung von Funktionsstörungen der Schilddrüse und/oder Hypeφlasien der Schilddrüse und/oder Schilddrüsentumoren.In a further aspect, the object is achieved according to the invention by using a nucleic acid with a sequence, the sequence being selected from the group comprising SEQ. ID. No. 1 - 12 and SEQ. ID. No. 16-19 comprises, or derivatives thereof and / or encoded polypeptides or derivatives thereof and / or a polypeptide with a sequence according to SEQ. ID. No. 13-15 or a derivative thereof and / or an especially natural interaction partner of a nucleic acid with a sequence, the sequence being selected from the group consisting of SEQ. ID. No. 1 - 12 and SEQ. ID. No. 16-19 comprises, or derivatives thereof and / or polypeptides encoded thereof or derivatives thereof and / or a nucleic acid coding therefor and / or the interaction partner of a polypeptide with a sequence according to SEQ. ID. No. 13 - 15 or a derivative thereof as a target molecule for development and / or Production of a diagnostic agent for the diagnosis of functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors, and / or for the development and / or manufacture of a medicament for the prevention and / or treatment of functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors.
In einer Ausführungsform ist vorgesehen, dass das Medikament oder das diagnostische Mittel ein Agens umfasst, das ausgewählt ist aus der Gruppe, die Antiköφer, Peptide, Anticaline, kleine Moleküle, Antisense-Moleküle, Aptamere, Spiegelmere und RNAi-Moleküle umfasst.In one embodiment it is provided that the medicament or the diagnostic agent comprises an agent which is selected from the group comprising antibodies, peptides, anticalins, small molecules, antisense molecules, aptamers, Spiegelmers and RNAi molecules.
In einer Ausführungsform ist vorgesehen , dass das Agens mit einem Polypeptid mit einer Sequenz gemäß SEQ. ID. No. 13 - 15 oder einem Derivat davon oder einem Wechselwirkungspartner davon in Wechselwirkung tritt.In one embodiment it is provided that the agent with a polypeptide with a sequence according to SEQ. ID. No. 13-15 or a derivative thereof or an interaction partner thereof.
In einer insbesondere alternativen Ausführungsform ist vorgesehen, dass das Agens mit einer Nukleinsaure mit einer Sequenz in Wechselwirkung tritt, wobei die Sequenz ausgewählt ist aus der Gruppe, die SEQ. ID. No. 1 - 12 und SEQ. ID. No. 16 - 19 umfasst, oder Derivate davon und/oder mit einer für einen insbesondere natürlichen Wechselwirkungspartner codierenden Nukleinsaure, insbesondere mit mRNA, genomischer Nukleinsaure oder cDNA in Wechselwirkung tritt.In a particularly alternative embodiment, it is provided that the agent interacts with a nucleic acid with a sequence, the sequence being selected from the group consisting of SEQ. ID. No. 1 - 12 and SEQ. ID. No. 16-19 comprises, or derivatives thereof and / or with a nucleic acid coding for an especially natural interaction partner, in particular with mRNA, genomic nucleic acid or cDNA.
In einem weiteren Aspekt wird die Aufgabe erfindungsgemäß gelöst durch die Verwendung eines Polypeptids, das mit einem Peptid in Wechselwirkung tritt, das von einer Nukleinsaure mit einer Sequenz codiert wird, wobei die Sequenz ausgewählt ist aus der Gruppe, die SEQ. ID. No. 1 - 12 und SEQ. ED. No. 16 - 19 umfasst, oder Derivate davon und/oder einem Polypeptid gemäß SEQ. ID. No. 13 - 15 und/oder mit einem insbesondere natürlichen Wechselwirkungspartner davon in Wechselwirkung tritt zur Entwicklung oder Herstellung eines diagnostischen Mittels zur Diagnose von Funktionsstörungen der Schilddrüse und/oder Hypeφlasien der Schilddrüse und/oder Schilddrüsentumoren, und/oder zur Entwicklung oder Herstellung eines Medikaments zur Prävention und/oder Behandlung von Funktionsstörungen der Schilddrüse und/oder Hypeφlasien der Schilddrüse und/oder Schilddrüsentumoren.
In einer Ausführungsform ist vorgesehen, dass das Polypeptid ausgewählt ist aus der Gruppe, die Antiköφer und bindende Polypeptide umfasst.In a further aspect, the object is achieved according to the invention by using a polypeptide which interacts with a peptide which is encoded by a nucleic acid with a sequence, the sequence being selected from the group comprising SEQ. ID. No. 1 - 12 and SEQ. ED. No. 16-19 comprises, or derivatives thereof and / or a polypeptide according to SEQ. ID. No. 13 - 15 and / or with a particularly natural interaction partner thereof interacts for the development or manufacture of a diagnostic agent for the diagnosis of functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors, and / or for the development or manufacture of a medicament for prevention and / or treatment of functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors. In one embodiment it is provided that the polypeptide is selected from the group comprising antibodies and binding polypeptides.
In einem weiteren Aspekt wird die Aufgabe erfindungsgemäß gelöst durch die Verwendung einer Nukleinsaure, die mit einem Polypeptid in Wechselwirkung tritt, wobei das Polypeptid von einer Nukleinsaure mit einer Sequenz codiert, wobei die Sequenz ausgewählt ist aus der Gruppe, die SEQ. D. No. 1 - 12 und SEQ. ED. No. 16 - 19 umfasst, oder Derivate davon und/oder einem Polypeptid gemäß SEQ. ED. No. 13 - 15 und/oder mit einem insbesondere natürlichen Wechselwirkungspartner davon zur Entwicklung oder Herstellung eines diagnostischen Mittels zur Diagnose von Funktionsstörungen der Schilddrüse und/oder Hypeφlasien der Schilddrüse und/oder Schilddrüsentumoren, und/oder zur Entwicklung oder Herstellung eines Medikaments zur Prävention und/oder Behandlung von Funktionsstörungen der Schilddrüse und/oder Hypeφlasien der Schilddrüse und/oder Schilddrüsentumoren.In a further aspect, the object is achieved according to the invention by using a nucleic acid which interacts with a polypeptide, the polypeptide being encoded by a nucleic acid with a sequence, the sequence being selected from the group comprising SEQ. D. No. 1 - 12 and SEQ. ED. No. 16-19 comprises, or derivatives thereof and / or a polypeptide according to SEQ. ED. No. 13 - 15 and / or with a particularly natural interaction partner thereof for the development or manufacture of a diagnostic agent for the diagnosis of functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors, and / or for the development or manufacture of a medicament for prevention and / or Treatment of functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors.
In einer Ausführungsform ist vorgesehen, dass die Nukleinsaure ausgewählt ist aus der Gruppe, die Aptamere und Spiegelmere umfasst.In one embodiment it is provided that the nucleic acid is selected from the group comprising aptamers and Spiegelmers.
In einem weiteren Aspekt wird die Aufgabe erfindungsgemäß gelöst durch die Verwendung einer ersten Nukleinsaure, die mit einer zweiten Nukleinsaure in Wechselwirkung tritt, wobei die zweite Nukleinsaure eine Sequenz aufweist, wobei die Sequenz ausgewählt ist aus der Gruppe, die SEQ. ID. No. 1 - 12 und SEQ. ED. No. 16 - 19 umfasst, oder Derivate davon und/oder mit einer Nukleinsaure in Wechselwirkung tritt, die für einen Wechselwirkungspartner eines Polypeptids mit einer Sequenz gemäß SEQ. ID. No. 13, 14 oder 15 codiert, zur Entwicklung oder Herstellung eines Medikaments zur Prävention und/oder Behandlung von Funktionsstörungen der Schilddrüse und/oder Hypeφlasien der Schilddrüse und/oder Schilddrüsentumoren.In a further aspect, the object is achieved according to the invention by using a first nucleic acid which interacts with a second nucleic acid, the second nucleic acid having a sequence, the sequence being selected from the group comprising SEQ. ID. No. 1 - 12 and SEQ. ED. No. 16-19, or derivatives thereof and / or interacts with a nucleic acid which is suitable for an interaction partner of a polypeptide with a sequence according to SEQ. ID. No. 13, 14 or 15 coded, for the development or manufacture of a medicament for the prevention and / or treatment of functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors.
In einer Ausführungsform ist vorgesehen, dass die in Wechselwirkung tretende ersten Nukleinsaure ein Antisense-Oligonukleotid, ein Ribozym und/oder RNAi ist.In one embodiment it is provided that the first nucleic acid interacting is an antisense oligonucleotide, a ribozyme and / or RNAi.
In einer weiteren Ausführungsform ist vorgesehen dass die zweite Nukleinsaure die jeweilige cDNA oder mRNA ist.
In einem weiteren Aspekt wird die Aufgabe erfindungsgemäß gelöst durch Pharmazeutische Zusammensetzung umfassend mindestens ein Agens, das ausgewählt ist aus der Gruppe, wie durch zumindest eine der erfmdungsgemäßen Verwendung definiert, und mindestens einen pharmazeutisch akzeptablen Träger, insbesondere zur Prävention und/oder Behandlung von Funktionsstörungen der Schilddrüse und/oder Hypeφlasien der Schilddrüse und/oder Schilddrüsentumoren.In a further embodiment it is provided that the second nucleic acid is the respective cDNA or mRNA. In a further aspect, the object is achieved according to the invention by a pharmaceutical composition comprising at least one agent which is selected from the group as defined by at least one of the uses according to the invention and at least one pharmaceutically acceptable carrier, in particular for the prevention and / or treatment of functional disorders Thyroid and / or hypothyroidism of the thyroid and / or thyroid tumors.
In einem weiteren Aspekt wird die Aufgabe erfindungsgemäß gelöst durch einen Kit für die Charakterisierung des Zustandes einer Schilddrüse bzw. eines diese aufbauenden Gewebes bzw. einer oder mehrerer diese aufbauende Zellen, umfassend mindestens ein Agens, das durch mindestens eine der erfindungsgemäßen Verwendungen definiert ist.In a further aspect, the object is achieved according to the invention by means of a kit for characterizing the state of a thyroid gland or a tissue which builds it up or one or more cells which build it up, comprising at least one agent which is defined by at least one of the uses according to the invention.
Der vorliegenden Erfindung liegt die überraschende Erkenntnis zugrunde, dass es eine Reihe von Genen bzw. Nukleinsäuresequenzen gibt, deren gegenüber normalem Gewebe geänderte Expression mit dem Auftreten von Tumoren und Hypeφlasien in Verbindung gebracht werden kann und kausal damit verbunden zu sein scheint.The present invention is based on the surprising finding that there are a number of genes or nucleic acid sequences, the expression of which compared to normal tissue can be associated with the occurrence of tumors and hypothyroidism and seems to be causally connected with it.
Im Rahmen der vorliegenden Erfindung wurde festgestellt, dass es im Falle bestimmter Hypeφlasien bzw. Tumoren zu einer Änderung der Expression bestimmter Gene bzw. Sequenzen kommt. Unter Änderung soll dabei hierin insbesondere entweder eine Erhöhung der Expression oder aber eine
der Expression verstanden werden. Als Referenz dient dabei das Maß der Expression des in Frage stehenden Gens bzw. der in Frage stehenden Sequenz in Zellen bzw. Gewebe, die bzw. das verschieden ist bzw. sind von Zellen der Hypeφlasien bzw. Tumoren.In the context of the present invention, it was found that, in the case of certain hyperslasias or tumors, there is a change in the expression of certain genes or sequences. The change here is intended either to increase expression or to increase the expression can be understood. The measure of expression of the gene in question or the sequence in question in cells or tissues, which is or is different from cells of the hypoplastic or tumors, serves as a reference.
Zu den hier in Frage stehenden Tumoren gehört die erste Gruppe der epithelialen Tumoren, insbesondere solche mit einer Veränderung in der chromosomalen Bande 19 q, und die zweite Gruppe der Tumoren, die eine Veränderung in der Bande 19ql3 aufweisen. Unter Veränderung soll dabei hierin insbesondere eine Chromosomentranslokation, Chromosomendeletion, Chromo- someninsertion und Chromosomeninversion verstanden werden.The tumors in question include the first group of epithelial tumors, in particular those with a change in the chromosomal band 19q, and the second group of tumors which have a change in the band 19ql3. Change is to be understood here to mean in particular a chromosome translocation, chromosome deletion, chromosome insertion and chromosome inversion.
Die erste Gruppe von Tumoren umfasst dabei insbesondere auch Tumoren der Schilddrüse und bevorzugterweise epitheliale Tumoren der Schilddrüse. Die zweite Gruppe von Tumoren um¬ fasst, unter anderem, Leukämien (wie chronisch lymphatische Leukämie, akut myeloische Leu-
kämie), B-Zell-Lymphome, Gliome, maligne fibröse Histozytome, Osteosarkome, Leiomyosar- kome, Liposarkome, Ovarialtumore, Brusttumore, Nierenkarzinome, Pankreaskarzinom und Gallenblasenkarzinome.The first group of tumors in particular also includes tumors of the thyroid gland and preferably epithelial tumors of the thyroid gland. The second group of tumors to ¬ summarizes, among other things, leukemia (such as chronic lymphocytic leukemia, acute myeloid Leu kemia), B-cell lymphomas, gliomas, malignant fibrous histocytomas, osteosarcomas, leiomyosarcomas, liposarcomas, ovarian tumors, breast tumors, kidney carcinomas, pancreatic carcinomas and gallbladder carcinomas.
Nach der WHO-Klassifikation sind die Tumoren der Schilddrüse meist epithelialen Usprungs und lassen sich in benigne und maligne Formen unterteilen. Bei den benignen Schilddrüsentumoren wird zwischen „echten" Adenomen und Schilddrüsenhypeφlasien (benigne, adenomatöse Strumaknoten), die als „Tumor-ähnliche Läsionen" bezeichnet werden, unterschieden. Diese Hypeφlasien sind meist polyklonale Knoten und haben oft einen variablen, makrofollikulären Aufbau, mit unvollständiger Kapselbildung. Schilddrüsenadenome dagegen sind gekapselte Tumoren, die sich vom Follikelepithel ableiten. Diese meist solitär auftretenden Tumoren sind gleichförmig aufgebaut und unterscheiden sich strukturell vom angrenzenden Schilddrüsengewebe. Sie lassen sich mikroskopisch (feingeweblich) nach ihrem Differenzierungsgrad in normo- follikuläre (simpel/einfach), makrofollikuläre (kolloid), mikrofollikuläre (fetal), trabekuläre oder solide (embryonal) Adenome unterteilen.According to the WHO classification, the tumors of the thyroid are mostly epithelial in origin and can be divided into benign and malignant forms. In benign thyroid tumors, a distinction is made between "real" adenomas and thyroid hypoglasias (benign, adenomatous goiter nodules), which are referred to as "tumor-like lesions". These hypypelasias are usually polyclonal nodes and often have a variable, macrofollicular structure, with incomplete capsule formation. In contrast, thyroid adenomas are encapsulated tumors that are derived from the follicular epithelium. These mostly solitary tumors have a uniform structure and differ structurally from the adjacent thyroid tissue. They can be subdivided microscopically (fine tissue) according to their degree of differentiation into normofollicular (simple / simple), macrofollicular (colloid), microfollicular (fetal), trabecular or solid (embryonic) adenomas.
Die hierin verwendete Abkürzung CAT steht für „cationic amino acid transporter" (Transporter für kationische Aminosäuren) . Dieser Transporter ist für den Transport von kationischen Aminosäuren und damit für die Versorgung der Zellen mit Aminosäuren verantwortlich. Infolge der Tatsache, dass einige der Aminosäuren als Neurotransmitter fungieren sind einige der Transporter auch an der Signalweiterleitung beteiligt. Derzeit kann nicht ausgeschlossen werden, dass CAT-A möglicherweise eine davon abweichende Funktion aufweist.The abbreviation CAT used here stands for "cationic amino acid transporter" (transporter for cationic amino acids). This transporter is responsible for the transport of cationic amino acids and thus for the supply of cells with amino acids. As a result of the fact that some of the amino acids act as neurotransmitters some of the transporters are also involved in signal forwarding, and it cannot currently be ruled out that CAT-A may have a different function.
Die im Rahmen der vorliegenden Erfindung festgestellte Homologie basiert auf einem Vergleich der humanen Sequenzen mit CAT3 von Rattus norvegicus.The homology found in the context of the present invention is based on a comparison of the human sequences with CAT3 from Rattus norvegicus.
Das bekannte DC2 ist ein bei Zellen ubiquitäres Protein, das erstmals im Zusammenhang Dro- sophila und dort im Zusammenhang mit der frühen Embryonalentwicklung beschrieben wurde. DC2 weist eine Proteinkinase-Aktivität auf. Beim Menschen wurde DC erstmals im Zusammen¬ han *gö mit dendritischen Zellen beschrieben.The well-known DC2 is a ubiquitous protein in cells that was first described in connection with Sophosila and there in connection with early embryonic development. DC2 has protein kinase activity. In humans, DC was first described in conjunction * ¬ han gö with dendritic cells.
PKCgamma steht hierin für Protein Kinase C gamma, die die Phosphorylierung von Serin und Threonin vermittelt und auf diesem Weg an der Transkriptionsregulation beteiligt ist. Insoweit
ergibt bereits aus dieser allgemeinen Funktion von Protein Kinase C garnma, dass diese ein Target ist, das einen Eingriff in das Transkriptionsgeschehen in der Zelle erlaubt und damit auch einen Ansatzpunkt für sowohl die Diagnose wie auch die Therapie von Tumoren und Hypeφlasien, wie sie hierin beschrieben sind, bietet. Überraschend war für die Erfinder dabei die Erkenntnis, dass dieser die Transkription beeinflussende Faktor für die Geschehnisse im Zusammenhang mit den hierin beschriebenen Tumoren von zentraler Bedeutung ist.PKCgamma here stands for protein kinase C gamma, which mediates the phosphorylation of serine and threonine and is thus involved in the regulation of transcription. in this respect already results from this general function of protein kinase C garnma that this is a target that allows an intervention in the transcription process in the cell and thus also a starting point for both the diagnosis and the therapy of tumors and hypersplasias, as described here are offers. What was surprising for the inventors was the finding that this factor influencing the transcription is of central importance for the events in connection with the tumors described here.
Es ist im Rahmen der vorliegenden Erfindung, dass die erfindungsgemäßen Sequenzen auch die jeweils komplementären Sequenzen umfassen.It is within the scope of the present invention that the sequences according to the invention also include the respective complementary sequences.
Im Rahmen der vorliegenden Erfindung sind weiterhin umfasst solche Nukleinsäuresequenzen, die insbesondere unter den Standard-Bedingungen für Northern-Blot-Hybridisierungen für den Nachweis von single-copy-Sequenzen mit den Sequenzen gemäß SEQ.ID.No 1 bis SEQ.ID.No. 12 hybridisieren.The scope of the present invention also includes those nucleic acid sequences which, in particular under the standard conditions for Northern blot hybridizations, for the detection of single-copy sequences with the sequences according to SEQ.ID.No 1 to SEQ.ID.No. Hybridize 12.
Bei dem erfindungsgemäßen Verfahren zum Bestimmen einer Verbindung, die die Wirkung eines Translationsproduktes einer der erfindungsgemäßen Nukleinsäuren beeinflusst kann es sich auch um ein Verfahren zum Screenen einer Verbindungsbibliothek handeln. Derartige Verbindungsbibliotheken sind bevorzugterweise Bibliotheken niedermolekularer Verbindungen. Grundsätzlich wird dabei so vorgegangen, dass das Translationsprodukt einer der erfindungsgemäßen Nukleinsäuren mit einer Verbindung in einem System in Kontakt gebracht wird, wobei das System die Wirkung des besagten Translationsproduktes und damit eine Wirkung der Verbindung auf das Translationsprodukt darstellt bzw. in Form eines detektierbaren Signals widergibt. Diese Wirkung kann sich beispielsweise in einer veränderten Funktion hinsichtlich Stärke, Substratspezifität (Erkennung, Bindung, Transport) und/oder Rezeptorspezifität bzw. -affinität oder der Membranassoziation ausdrücken, d.h. in der Signalweiterleitung. Die Wirkung könnte ebenfalls einen Einfluss auf enzymatische Prozesse in der Zelle haben. Die Wirkung kann dabei sowohl im zellfreien, im zellulären System, in der Zellkultur und in transgenen Tiermodellen übeφriift werden (in vitro, in vivo und in situ).The method according to the invention for determining a compound which influences the action of a translation product of one of the nucleic acids according to the invention can also be a method for screening a compound library. Compound libraries of this type are preferably libraries of low molecular weight compounds. Basically, the procedure is such that the translation product of one of the nucleic acids according to the invention is brought into contact with a compound in a system, the system representing the action of the said translation product and thus an action of the compound on the translation product or in the form of a detectable signal , This effect can be expressed, for example, in a changed function with regard to strength, substrate specificity (recognition, binding, transport) and / or receptor specificity or affinity or the membrane association, i.e. in the signal forwarding. The effect could also have an impact on enzymatic processes in the cell. The effect can be checked both in the cell-free, in the cellular system, in cell culture and in transgenic animal models (in vitro, in vivo and in situ).
Soweit bei den erfindungsgemäßen Verfahren oder Anwendungen Bezug genommen wird auf Tumoren oder Hypeφlasien sollen hierunter alle hierin im Zusammenhang mit den erfindungs¬ gemäßen Nukleinsäuren offenbarten Tumoren oder Hypeφlasien umfasst verstanden werden.
Mit den vorliegenden Nukleinsäuresequenzen eröffnen sich somit neue Möglichkeiten sowohl zur Diagnose als auch zur Therapie sowie der Untersuchung der mit dem Auftreten von Strumen und Schilddrüsentumoren bzw. Schilddrüsenkarzinomen verbundenen Mechanismen. Insbesondere wird durch Kenntnis der Sequenz die Möglichkeit gegeben, auf molekularer Ebene geeignete diagnostische bzw. therapeutische Mittel i. S. von - pharmazeutischen - Zusammensetzungen sowie Medikamenten mittelbar oder unmittelbar einzusetzen.Insofar as reference is made in the present methods or applications relating to tumors or Hypeφlasien should here under all be understood herein in connection with the nucleic acids according to Inventive ¬ disclosed tumors or Hypeφlasien comprises. The present nucleic acid sequences thus open up new possibilities both for diagnosis and for therapy and for examining the mechanisms associated with the occurrence of goitre and thyroid tumors or thyroid carcinomas. In particular, knowledge of the sequence gives the possibility of i. Suitable diagnostic or therapeutic agents at the molecular level. S. of - pharmaceutical - compositions and medicines to be used directly or indirectly.
Die erfindungsgemäßen Nukleinsäuresequenzen können in für den Fachmann auf diesem Gebiet bekannter Art und Weise für die Gestaltung geeigneter diagnostisch und therapeutisch einsetzbarer Mittel im obigen Sinne sowie Kits und Verfahren verwendet werden.The nucleic acid sequences according to the invention can be used in a manner known to those skilled in the art for the design of suitable diagnostically and therapeutically usable agents in the above sense, as well as kits and methods.
Unter Nukleinsaure sollen dabei sowohl DNA-Sequenzen als auch RNA- Sequenzen, einschließlich Hybriden davon, verstanden werden, einschließlich hiervon abgeleiteter Derivate mit geändertem Rückgrat wie PNA und LNA. Dies schließt auch ein, dass die Nukleinsäuren einzelsträn- gig, doppelsträngig oder als Tripelstruktur vorliegen.Nucleic acid is understood to mean both DNA sequences and RNA sequences, including hybrids thereof, including derivatives derived therefrom with a modified backbone, such as PNA and LNA. This also includes that the nucleic acids are single-stranded, double-stranded or as a triple structure.
Es kam ebenfalls vorgesehen sein, dass sich die Strängigkeit der DNA, d. h. ob diese beispielsweise einzelsträngig oder doppelsträngig vorliegt, über die Länge der Nukleinsauresequenz ändert.It was also envisaged that the stringency of the DNA, i. H. whether this is, for example, single-stranded or double-stranded changes over the length of the nucleic acid sequence.
Insbesondere kann auch vorgesehen sein, dass die erfmdungsgemäß e Nukleinsauresequenz nicht vollständig, sondern als Fragment vorliegt.In particular, it can also be provided that the nucleic acid sequence according to the invention is not present completely, but as a fragment.
Desweiteren ist es innerhalb des Umfangs der hierin vorliegenden Offenbarung, dass die Nukleinsäuresequenzen in mutierter Form vorliegen können. Unter Mutation sollen hierin alle dem Fachmann bekannten Mutationen, die innerhalb einer Nukleinsauresequenz auftreten können, verstanden werden, einschließlich Punktmutationen sowie Nichtpunktmutationen, d. h. Inversio¬ nen, Insertionen und Deletionen.Furthermore, it is within the scope of the disclosure herein that the nucleic acid sequences may be in a mutated form. Mutation herein all that Inversio ¬ nen, insertions and deletions are known to those skilled mutations that can occur within a nucleic acid sequence to be understood, including point mutations and non-point mutations.
Insbesondere unter dem Aspekt der Interaktion der erfindungsgemäßen Nukleinsaure mit anderen Nukleinsäuren soll hierin das Kriterum der Hybridisierung herangezogen werden, welches in der Technik allgemein anerkannt ist. Es wird anerkannt werden, dass durch Wahl geeigneter
Hybridisierungsbedingungen die Stringenz der Hybridisierung innerhalb eines bestimmten Bereiches verändert werden kann und somit eine Hybridisierung der erfindungsgemäßen Nukleinsäuresequenzen an Nukleinsäuresequenzen möglich wird, deren Grad der Abweichung von der unvollständig korrespondierenden, d. h. komplementären Sequenz schwanken kann.In particular with regard to the interaction of the nucleic acid according to the invention with other nucleic acids, the criterion of hybridization is to be used here, which is generally recognized in the art. It will be recognized that by choosing more appropriate Hybridization conditions the stringency of the hybridization can be changed within a certain range and thus a hybridization of the nucleic acid sequences according to the invention to nucleic acid sequences is possible, the degree of deviation of which can vary from the incompletely corresponding, ie complementary sequence.
Unter Nukleinsauresequenz im erfindungsgemäßen Sinne soll auch jene Sequenz verstanden werden, die mit einer der erfmdungsgemäßen Sequenzen hybridisieren würde, wenn nicht die Degeneration des genetischen Codes wäre. Dies bedeutet, dass mit Blick auf den in der erfindungsgemäßen Nukleinsauresequenz vorhandenen offenen Leserahmen, bzw. die offenen Leserahmen, diese(r) unter Verwendung des genetischen Codes in eine Aminosäuresequenz transla- tiert werden kann/können. Infolge der Degeneration des genetischen Codes ist es jedoch möglich, ausgehend von der solchermaßen erhaltenen Aminosäuresequenz, wieder unter Verwendung des genetischen Codes eine Nukleinsauresequenz zu gewinnen, die so verschieden ist, dass sie für sich genommen, mit der für die Bestimmung der Aminosäuresequenz herangezogenen Nukleinsauresequenz möglicherweise nicht mehr hybridisieren kann.The nucleic acid sequence in the sense of the invention is also to be understood as that sequence which would hybridize with one of the sequences according to the invention if it were not for the degeneration of the genetic code. This means that in view of the open reading frame or the open reading frame present in the nucleic acid sequence according to the invention, this can be translated into an amino acid sequence using the genetic code. As a result of the degeneration of the genetic code, however, it is possible, starting from the amino acid sequence thus obtained, to use the genetic code again to obtain a nucleic acid sequence which is so different that it can be taken on its own with the nucleic acid sequence used for the determination of the amino acid sequence can no longer hybridize.
Ausgehend von den hierin offenbarten Nukleinsäuren ist es für den Fachmann möglich, eine geeignete antisense-Nukleinsäure, insbesondere antisense-RNA zu erzeugen, die mit den erfindungsgemäßen Nukleinsäuresequenzen interagieren kann. Aufgrund dieser Interaktion ist eine direkte Beeinflussung der die Nukleinsäuresequenzen involvierenden Vorgänge möglich. Diese Interaktion kann beispielsweise auf der Ebene der Transkription ebenso wie auf der Ebene der Translation erfolgen.Starting from the nucleic acids disclosed herein, it is possible for a person skilled in the art to generate a suitable antisense nucleic acid, in particular antisense RNA, which can interact with the nucleic acid sequences according to the invention. Because of this interaction, the processes involving the nucleic acid sequences can be directly influenced. This interaction can take place, for example, at the level of transcription as well as at the level of translation.
Unter Nukleinsäuresequenzen sollen hierin allgemein Nukleinsäuresequenzen verstanden werden, die durch Isolierung aus dem genannten Gewebe in situ oder ex vivo, beispielsweise aus entsprechenden Zeil-, Gewebe- oder Organkulturen, gewonnen werden können. Es sollen hierin jedoch auch entsprechende Nukleinsäuresequenzen verstanden werden, die aus Genbanken, insbesondere menschlichen Genbanken und noch bevorzugter Genbanken des menschlichen Chromosoms 19, isolierbar sind. Des Weiteren soll hierin der Begriff Nukleinsäuresequenzen auch solche Nukleinsäuren umfassen, die mittels geeigneter Synthesetechniken herstellbar sind, einschließlich der Polymerasekettenreaktion, und anderer im Stand der Technik bekannter, biochemischer und chemischer Syntheseverfahren.
Die erfindungsgemäßen Sequenzen können darüber hinaus modifiziert vorliegen.Nucleic acid sequences are to be understood here generally to mean nucleic acid sequences which can be obtained by isolation from the tissue mentioned in situ or ex vivo, for example from corresponding cell, tissue or organ cultures. However, corresponding nucleic acid sequences which can be isolated from gene banks, in particular human gene banks and more preferably gene banks of the human chromosome 19, are also to be understood here. Furthermore, the term nucleic acid sequences is also intended to include those nucleic acids which can be prepared by means of suitable synthesis techniques, including the polymerase chain reaction, and other biochemical and chemical synthesis processes known in the prior art. The sequences according to the invention can also be modified.
Unter Modifikation soll hierin unter anderem Fragmentierung, Insertion, Deletion und Reversion von (Teil-)Sequenzen der erfinderischen Nukleinsäuresequenzen verstanden werden. Dies schließt auch die Insertion anderer Nukleinsäuresequenzen ein. Diese Nukleinsäuresequenzen können beispielsweise für bestimmte Domänen codieren, als Spacer dienen sowie als Elemente zur Translations- und Transkriptionsregulierung dienen.Modification is to be understood here to mean, inter alia, fragmentation, insertion, deletion and reversion of (partial) sequences of the inventive nucleic acid sequences. This also includes the insertion of other nucleic acid sequences. These nucleic acid sequences can, for example, code for certain domains, serve as spacers and serve as elements for regulating translation and transcription.
Weiterhin können die erfmdungsgemäßen Nukleinsäuren dergestalt modifiziert sein, dass sie Sequenzen oder Moleküle umfassen, die eine Interaktion mit anderen Molekülen erlauben. Dies kann beispielsweise in Form einer Bindungsstelle an einen festen Träger oder einer Sequenz, die die Bindung an ein Nukleinsäure-bindendes Protein vermittelt, erfolgen.Furthermore, the nucleic acids according to the invention can be modified in such a way that they comprise sequences or molecules which allow interaction with other molecules. This can take place, for example, in the form of a binding site to a solid support or a sequence which mediates the binding to a nucleic acid-binding protein.
Weiterhin können die erfindungsgemäßen Nukleinsäuresequenzen markiert sein. Hierin soll unter Markierung grundsätzlich sowohl direkte als auch indirekte Markierung verstanden werden. Eine Markierung kann unter Verwendung der im Stand der Technik bekannten Markierungen sowie Markierungsverfahren erfolgen und schließt radioaktive, nicht-radioaktive und Fluoreszenzmarkierung ein. Nicht-radioaktive Markierungen umfassen, unter anderem, die Verwendung von Digoxygenin, Avidin, Streptavidin und Biotin.Furthermore, the nucleic acid sequences according to the invention can be labeled. In this context, marking should basically be understood to mean both direct and indirect marking. Labeling can be done using the labels and labeling methods known in the art and includes radioactive, non-radioactive and fluorescent labeling. Non-radioactive labels include, among others, the use of digoxygenin, avidin, streptavidin and biotin.
Unter Vektor sollen hierin insbesondere rekombinante Vektoren, wie sie in der Technik bekannt sind, verstanden werden. Derartige Vektoren schließen, unter anderem, virale Vektoren, wie beispielsweise adenovirale oder retrovirale Vektoren und Phagensysteme, sowie Plasmidvektoren, einschließlich Cosmidvektoren, und künstliche Chromosomen, die in prokaryontischen und/oder eukaryontischen Systemen verwendet werden können, ein.Vector is to be understood here to mean in particular recombinant vectors, as are known in the art. Such vectors include, among others, viral vectors such as adenoviral or retroviral vectors and phage systems, as well as plasmid vectors, including cosmid vectors, and artificial chromosomes that can be used in prokaryotic and / or eukaryotic systems.
Neben den erfindungsgemäßen Nukleinsäuresequenzen können die erfindungsgemäßen Vektoren weitergehende Elemente umfassen, die im Stand der Technik bekannt sind. Die jeweiligen Elemente, wie beispielsweise Promotoren, Terminatoren und Enhancer, werden entsprechend dem jeweiligen Wirtszellsystem in für den Fachmann bekannter Art und Weise ausgewählt. Insbe¬ sondere ist hierbei an die Auswahl eines geeigneten eukaryontischen Promotors und eines indu¬ zierbaren Promotors gedacht. Neben den genannten Elementen ist es auch noch möglich, dass in derartigen Vektoren solche Elemente enthalten sind, die dazu führen, dass zumindest die erfm-
dungsgemäße Nukleinsauresequenz, oder ein Teil davon, in das Genom des Wirtszellsystems integriert wird.In addition to the nucleic acid sequences according to the invention, the vectors according to the invention can comprise further elements which are known in the prior art. The respective elements, such as promoters, terminators and enhancers, are selected in accordance with the respective host cell system in a manner known to those skilled in the art. In particular ¬ sondere here is thinking about choosing an appropriate eukaryotic promoter and indu ¬ ducible promoter. In addition to the elements mentioned, it is also possible for such vectors to contain elements which lead to at least the required nucleic acid sequence according to the invention, or a part thereof, is integrated into the genome of the host cell system.
Es ist auch möglich, dass mindestens eines der genannten Elemente im Leserahmen („in-frame") mit mindestens einem offenen Leserahmen der erfindungsgemäßen Nukleinsäuresequenzen verbunden ist, und ganz besonders vorteilhaft ist es, wenn mittels eines zusätzlich eingeführten Promotors die Transkriptionsrate des speziellen offenen Leserahmens kontrolliert wird, wobei der Promotor dann typischerweise in geeignetem Abstand und „in-frame" mit dem offenen Leserahmen ist.It is also possible for at least one of the elements mentioned in the reading frame (“in-frame”) to be connected to at least one open reading frame of the nucleic acid sequences according to the invention, and it is particularly advantageous if the transcription rate of the special open reading frame is introduced by means of an additionally introduced promoter is checked, the promoter then typically being at a suitable distance and “in-frame” with the open reading frame.
Dabei kann weiterhin vorgesehen sein, dass ein offener Leseralimen der erfindungsgemäßen Nukleinsäuresequenzen, bevorzugt unter den vorgenannten Bedingungen, eine Signalsequenz aufweist, die eine Translokation des vom offenen Leserahmen codierten Genproduktes über eine Membran, und ggf. infolge dessen eine weitergehende Modifikation des Genprodukts erlaubt. Derlei Signalsequenzen schließen solche für den Transport des synthetisierten Proteins zum En- doplasmatischen Retikulum, Golgi-Apparat, zu Lysosomen, zu Zellorganellen, wie Mitochond- rien und Chloroplasten, sowie zum Zellkern ein. Das solchermaßen mögliche Durchlaufen verschiedener zellulärer Kompartimente erlaubt eine posttranslationale Modifikation und damit ggf. eine weitergehende vorteilhafte Ausbildung des Genproduktes.It can further be provided that an open reader alimony of the nucleic acid sequences according to the invention, preferably under the aforementioned conditions, has a signal sequence which allows the gene product encoded by the open reading frame to be translocated via a membrane and, if appropriate, as a result thereof to further modify the gene product. Such signal sequences include those for the transport of the synthesized protein to the endoplasmic reticulum, Golgi apparatus, to lysosomes, to cell organelles, such as mitochondria and chloroplasts, and to the cell nucleus. The passage through various cellular compartments that is possible in this way allows a post-translational modification and thus possibly a further advantageous development of the gene product.
Neben Signalsequenzen kann ein derartiges Konstrukt auch zusätzliche Nukleinsäuresequenzen enthalten, die dazu führen, dass das Genprodukt eines offenen Leserahmens der erfindungsgemäßen Nukleinsäuresequenzen ein Fusionsprotein ausbildet, wobei der anfusionierte Teil einer Domäne eines anderen Proteins entsprechen kann und z. B. der Detektion des Genproduktes des offenen Leserahmens der erfindungsgemäßen Sequenzen dient, oder der Interaktion mit anderen Molekülen bzw. Strukturen im biologischen System, wobei das biologische System bevorzugt die Zelle ist.In addition to signal sequences, such a construct can also contain additional nucleic acid sequences which lead to the gene product of an open reading frame of the nucleic acid sequences according to the invention forming a fusion protein, wherein the fused-on part can correspond to a domain of another protein and z. B. serves the detection of the gene product of the open reading frame of the sequences according to the invention, or the interaction with other molecules or structures in the biological system, wherein the biological system is preferably the cell.
Neben den vorgenannten und den weiteren sich für den Fachmann aus der Beschreibung erge¬ benden Vorteile der erfindungsgemäßen Nukleinsäuresequenzen sind diese auch den aus den genannten Nukleinsäuresequenzen ableitbaren bzw. von diesen codierten Polypeptiden inhärent. Diese Polypeptide können zum einen direkt aus einem offenen Leserahmen der erfindungsgemäßen Nukleinsauresequenz abgeleitet werden, oder sind durch einen in einem Wirtsorganismus
exprimierten erfindungsgemäßen Vektor in für den Fachmann bekannter Weise herstellbar. Dabei wird typischerweise der Wirtsorganismus zunächst mit dem erfindungsgemäßen Vektor transformiert, der Wirtsorganismus vermehrt und das Polypeptid aus dem Wirtsorganismus, bzw. im Falle einer Sekretion desselben in das Medium, aus diesem gewonnen.In addition to the above and the other for the skilled person from the description erge ¬ reproduced advantages of the inventive nucleic acid sequences are inherent to this and the polypeptides derived from the cited nucleic acid sequences or encoded by these. On the one hand, these polypeptides can be derived directly from an open reading frame of the nucleic acid sequence according to the invention, or they are in a host organism expressed vector according to the invention in a manner known to those skilled in the art. Typically, the host organism is first transformed with the vector according to the invention, the host organism is multiplied and the polypeptide is obtained from the host organism, or in the case of its secretion into the medium, from the latter.
Neben einer direkten Verwendung der erfindungsgemäßen Polypeptide und der sie codierenden Nukleinsäuren zur Beeinflussung des - zellulären - Geschehens in Schilddrüsengewebe können diese auch in der Reinigung, beispielsweise über Affinitätschromatographie, von am zellulären Geschehen beteiligten anderen Komponenten, oder zur Herstellung geeigneter Antiköφer verwendet werden, die dann, unter anderem, ihrerseits zu therapeutischen und oder diagnostischen Zwecken verwendbar sind. Auf diese Art und Weise lassen sich unter anderem somit Wechselwirkungspartner der erfindungsgemäßen Polypeptide ermitteln bzw. isolieren.In addition to the direct use of the polypeptides according to the invention and the nucleic acids coding for them to influence the - cellular - events in thyroid tissue, these can also be used in the purification, for example via affinity chromatography, of other components involved in the cellular events, or for the production of suitable antibodies, which then , among other things, can in turn be used for therapeutic and or diagnostic purposes. In this way, interaction partners of the polypeptides according to the invention can be determined or isolated, among other things.
In Abhängigkeit von den jeweils bestehenden Erfordernissen, wie posttranslationaler Modifikation oder erwünschtem Reinheitsgrad und dergleichen, kann bei Herstellung der erfindungsgemäßen Polypeptide in einem Wirtsorganismus entweder ein prokaryontischer oder ein eukaryon- tischer Wirtsorganismus von Vorteil sein.Depending on the respective existing requirements, such as post-translational modification or the desired degree of purity and the like, either a prokaryotic or a eukaryotic host organism can be advantageous when producing the polypeptides according to the invention in a host organism.
Das erfindungsgemäße Polypeptid kann in geeigneter Weise modifiziert werden. Unter Modifikation soll, unter anderem, eine Fragmentierung, insbesondere Verkürzung, des Moleküls verstanden werden. Modifikation im hierin verwendeten Sinne beinhaltet auch die Markierung des Polypeptids. Letzteres kann mittels sowohl hochmolekularer als auch niedermolekularer Verbindungen erfolgen und schließt die radioaktive, nicht-radioaktive und Fluoreszenzmarkierung ein. Eine Markierung kann auch beispielsweise in Form einer Phosphorylierung oder Glycosylierung des Proteins vorliegen. Entsprechende Markierungsverfahren bzw. Modifikationsverfahren sind in der Technik bekannt (siehe z. B. Protein Methods, 2πd ed., D. M. Bollag et al., Wiley Liss, Inc., New York, NY, 1996) und werden hierin vollumfänglich aufgenommen.The polypeptide according to the invention can be modified in a suitable manner. Modification is understood to mean, among other things, a fragmentation, in particular shortening, of the molecule. Modification as used herein also includes labeling the polypeptide. The latter can be done using both high molecular and low molecular weight compounds and includes radioactive, non-radioactive and fluorescent labeling. A label can also be present, for example, in the form of phosphorylation or glycosylation of the protein. Corresponding labeling methods or modification methods are known in the art (see, for example, Protein Methods, 2 nd ed., DM Bollag et al., Wiley Liss, Inc., New York, NY, 1996) and are included in full here.
Unter Modifikation wird erfindungsgemäß auch jede Form von posttranslationaler Modifikation, wie unter Fachleuten bekannt, verstanden, insbesondere proteolytische Verarbeitung des Polypeptids, Anhängen oder Abtrennen von Resten am N-Terminus, Acetylierung des N-Terminus, Myristoylierung des N-Terminus, Anhängen von Glycosyl-Phosphatidyl-Resten, Farnesyl- Resten oder Geranylgeranyl-Resten an den C-Terminus, N-Glycosylierung, O-Glycosylierung,
Anhängen von Glycosaminoglycan, Hydroxylierung, Phosphorylierung, ADP-Ribosylierung und Bildung von Disulfidbrücken.According to the invention, modification is also understood to mean any form of post-translational modification, as known to those skilled in the art, in particular proteolytic processing of the polypeptide, attachment or removal of residues at the N-terminus, acetylation of the N-terminus, myristoylation of the N-terminus, attachment of glycosyl Phosphatidyl residues, farnesyl residues or geranylgeranyl residues at the C-terminus, N-glycosylation, O-glycosylation, Attachment of glycosaminoglycan, hydroxylation, phosphorylation, ADP ribosylation and formation of disulfide bridges.
Ebenso ist es im Rahmen der vorliegenden Erfindung, dass das erfindungsgemäße Polypeptid durch Mutation(en), insbesondere Aminosäuremutation(en) aus einem erfindungsgemäßen Polypeptid hervorgeht oder hervorgegangen ist. Unter Aminosäuremutation wird soλvohl eine Mutation verstanden, bei der eine Aminosäure durch eine in ihrer Seitenkette ähnliche Aminosäure ausgetauscht wird (konservative Mutation), beispielsweise I zu L oder D zu E, sowie eine Mutation, bei der eine Aminosäure durch eine andere Aminosäure ausgetauscht wird, ohne dass dieser Austausch sich nachteilig auf die Funktion des codierten Polypeptids auswirkt (stille Mutation). Die Funktion des codierten Polypeptids kann durch einen geeigneten Assay übeφriift werden. Geeignete funktionale Assays für CAT, d. h. Transporter für kationische Aminosäuren, für DC2, d. h. für die entsprechende Kinase-Aktivität, und für PCKgamma, d. h. für die Protein-Kinase Cgamma, sind den Fachleuten auf dem Gebiet bekannt und beispielsweise für CAT beschrieben in Closs EI et al. Biochemistry 36(21): 6462-8; Wu F et al. Amm J Physiol Regul Integr Comp Physiol 278(6) : R1506-12 ; und Palacin M et al .Physiol Rev 78(4) : 969-1054) oder für PKCG beschrieben in Becton DL et al, J Cell Physiol 125 (3): 485-91 ; Persons DA et al, Cell Growth Differ 2(1): 7 - 14 und Perander M et al., J. Biol. Chem 276(16) : 13015-24.It is also within the scope of the present invention that the polypeptide according to the invention arises from mutation (s), in particular amino acid mutation (s), from a polypeptide according to the invention. Amino acid mutation is understood to mean a mutation in which an amino acid is replaced by an amino acid with a similar side chain (conservative mutation), for example I to L or D to E, and a mutation in which an amino acid is replaced by another amino acid. without this exchange having an adverse effect on the function of the encoded polypeptide (silent mutation). The function of the encoded polypeptide can be checked by a suitable assay. Suitable functional assays for CAT, i.e. H. Transporter for cationic amino acids, for DC2, d. H. for the corresponding kinase activity, and for PCKgamma, d. H. for the protein kinase Cgamma, are known to those skilled in the art and are described, for example, for CAT in Closs EI et al. Biochemistry 36 (21): 6462-8; Wu F et al. Amm J Physiol Regul Integr Comp Physiol 278 (6): R1506-12; and Palacin M et al. Physiol Rev 78 (4): 969-1054) or for PKCG described in Becton DL et al, J Cell Physiol 125 (3): 485-91; Persons DA et al, Cell Growth Differ 2 (1): 7-14 and Perander M et al., J. Biol. Chem 276 (16): 13015-24.
Mit den erfindungsgemäßen Zellen lassen sich weitergehende Vorteile realisieren. Diese umfassen unter anderem die Herstellung entsprechender Nukleinsäuresequenzen bzw. daraus abgeleiteter Genprodukte.Further advantages can be realized with the cells according to the invention. These include the production of corresponding nucleic acid sequences or gene products derived therefrom.
Insbesondere die Insertion der erfindungsgemäßen Nukleinsäuresequenzen im Genom einer Zelle ist von besonderer Bedeutung, beispielsweise für das weitere Studium des Einflusses derartiger Sequenzen, insbesondere im zellulären Umfeld. Dabei können Gendosiseffekte und dergleichen untersucht bzw. zu diagnostischen und/oder therapeutischen Zwecken ausgenutzt werden. Ganz besonders vorteilhaft scheint dabei ein Zustand, bei dem ausgehend von diploiden Zellen lediglich ein Chromosom eine oder mehrere der erfindungsgemäßen Nukleinsäuresequenzen, und bevorzugt in der ihrer Position in Bande 19ql3 entsprechenden Position insertiert, enthält und das zweite Chromosom keine Chromosomentranslokation unter Einbeziehung der chromosomalen Bnade 19ql3 aufweist. Derartige Zellen können beispielsweise als Positiv- und/oder Negativkontrolle in einem diagnostischen Ansatz dienen.
oIn particular, the insertion of the nucleic acid sequences according to the invention in the genome of a cell is of particular importance, for example for the further study of the influence of such sequences, in particular in the cellular environment. Gene dose effects and the like can be investigated or used for diagnostic and / or therapeutic purposes. A state in which, starting from diploid cells, only one chromosome inserts one or more of the nucleic acid sequences according to the invention, and preferably in the position corresponding to their position in band 19ql3, and the second chromosome does not contain any chromosome translocation including the chromosomal bath 19ql3, appears to be particularly advantageous having. Such cells can serve, for example, as a positive and / or negative control in a diagnostic approach. O
Es ist im Rahmen der vorliegenden Erfindung, dass neben dem jeweiligen erfindungsgemäßen Translationsprodukt oder der/den dafür codierenden Nukleinsäure(n), wie hierin beschrieben, auch andere Mittel verwendet werden können, um die von dem jeweiligen Translationsprodukt oder der dafür codierenden Nukleinsaure ausgehenden Wirkungen zu erzeugen oder auch zu unterdrücken. Derartige Mittel können im Rahmen eines sogenannten Screening- Verfahrens ermittelt werden. Dabei wird in einem ersten Schritt eine oder mehrere sogenannte Kandidatenverbindungen bereitgestellt. Kandidatenverbindungen im Sinne der vorliegenden Erfindung sind dabei solche Verbindungen, deren Eignung in einem Testsystem festgestellt werden soll, die hierin offenbarten Erkrankungen, insbesondere Funktionsstörungen der Schilddrüse und/oder Hypeφlasien der Schilddrüse und/oder Schilddrüsentumoren, zu behandeln bzw. als diagnostische Mittel für die Diagnose derselben herangezogen zu werden. Zeigt die Kandidatenverbindung in dem beschriebenen Testsystem eine entsprechende Wirkung, stellt sie ein entsprechendes, d. h. prinzipiell geeignetes Mittel zur Behandlung dieser Erkrankungen dar. In einem zweiten Schritt wird sodann die Kandidatenverbindung mit einem (Translationsprodukt- )Expressionssystem oder mit einem (Translationsprodukt-)Aktivitätssystem in Kontakt gebracht. Ein Translationsprodukt-Expressionssystem ist dabei ein Expressionssystem, welches die Expression des Translationsproduktes zeigt, wobei der Umfang der Expression grundsätzlich veränderbar ist. Ein Translationsprodukt-Aktivierungssystem ist dabei im Wesentlichen ein Expressionssystem, wobei hier weniger auf die Expression des Translationsproduktes als vielmehr auf dessen Aktivität bzw. dessen Aktivierungszustand und dessen Beeinflussbarkeit abgestellt wird. Dabei ist beachtlich, dass das Translationsprodukt als solches nicht das Ergebnis eines tatsächlichen Expressionsvorganges sein muss, sondern auch dem entsprechenden Aktivitätssystem bereits als Polypeptid oder Protein zugegeben werden kann. Konkret wird in diesem Falle festgestellt, ob sich unter dem Einfluss einer Kandidatenverbindung die Aktivität des Translationsproduktes oder der für es codierenden Nukleinsaure verändert. Dabei kann unabhängig vom Vorliegen des jeweiligen konkreten Expressionssystems oder Aktivitätssystem grundsätzlich sowohl eine Verringerung der Expression bzw. Aktivität als auch eine Erhöhung der Expression bzw. Aktivität erfolgen. Typischerweise handelt es sich bei dem Expressionssystem und/oder dem Aktivitässystem um einen in vitro-Ansatz, wie beispielsweise einen Zellextrakt oder ein Fragment eines Zellextraktes wie beispielweise einen Zellkernextrakt. Ein Translationsprodukt- Expressionssystem im Sinne der vorliegenden Erfindung kann jedoch auch eine Zelle sein, be-
vorzugterweise eine Zelle der Schilddrüse, der Hypeφlasien der Schilddrüse oder der einen Schilddrüsentumoren ausbildenden Zellen.It is within the scope of the present invention that, in addition to the respective translation product according to the invention or the nucleic acid (s) coding for it, as described herein, other means can also be used to effect the effects of the respective translation product or the nucleic acid coding therefor generate or suppress. Such agents can be determined in a so-called screening method. In a first step, one or more so-called candidate connections are made available. Candidate compounds within the meaning of the present invention are those compounds whose suitability is to be determined in a test system, the diseases disclosed herein, in particular thyroid dysfunctions and / or thyroid hypothyroidism and / or thyroid tumors, or as diagnostic agents for diagnosis to be consulted. If the candidate compound shows a corresponding effect in the test system described, it represents a corresponding, ie in principle suitable means for the treatment of these diseases. In a second step, the candidate compound is then administered with a (translation product) expression system or with a (translation product) activity system Brought in contact. A translation product expression system is an expression system which shows the expression of the translation product, the extent of the expression being fundamentally changeable. A translation product activation system is essentially an expression system, whereby here the focus is less on the expression of the translation product than on its activity or its activation state and its ability to be influenced. It is remarkable that the translation product as such does not have to be the result of an actual expression process, but can also be added to the corresponding activity system as a polypeptide or protein. In this case, it is specifically determined whether the activity of the translation product or the nucleic acid coding for it changes under the influence of a candidate compound. Regardless of the presence of the respective specific expression system or activity system, in principle both a reduction in expression or activity and an increase in expression or activity can take place. The expression system and / or the activity system is typically an in vitro approach, such as, for example, a cell extract or a fragment of a cell extract, such as, for example, a cell nucleus extract. However, a translation product expression system in the sense of the present invention can also be a cell, preferably a cell of the thyroid gland, the hypothyroidism of the thyroid gland or the cells forming a thyroid tumor.
Eine Feststellung darüber, inwieweit eine Erhöhung oder Verringerung des Expressionssystems erfolgt, kann dabei auf einer jeden Ebene der Expression festgestellt werden, d. h. beispielsweise durch Zunahme oder Abnahme der Menge der für das Translationsprodukt codierenden Nukleinsaure, insbesondere der mRNA, oder aber auch des im Expressionssystem unter dem Einfluss der Kandidatenverbindung hergestellten Translationsproduktes, d. h. des jeweiligen Proteins. Die hierfür erforderlichen Techniken wie beispielsweise ein Verfahren zur Quantifizierung von mRNA sind dem Fachmann auf dem Gebiet bekannt und beispielsweise beschrieben in Sambrook et al. (Sambrook, Joseph: Molecular Cloning: A laboratory manual/ J. Sambrook; E.F. Fritsch; T. Maniatis - Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Pr).ess, 19XX 1. Aufl. u.d.T. Maniatis, Thomas P.: Molecular Cloning; Verf. der 3. Auflage: Joseph Sambrook und David W. Russell; LiteraturangabenISBN 0-87969-309-6 ISBN 0-87969-576-5 ISBN 0- 87969-577-3 1. - 2. ed., 4. [Dr.]. - 1989) Des Weiteren sind dem Fachmann auch Verfahren bekannt zur Bestimmung des Gehaltes der Menge von Translationsprodukt, beispielsweise durch Verwendung geeigneter Antiköφer. Antiköφer können nach den allgemein bekannten und beispielsweise in Current Protocols („Current Protocols in Protein Science", hrsg. von Coligan J.E.; Dünn B.M., Hidde L.P. Speicher D.W., Wingfield P.T.; John Wiley & Sons) beschriebenen Verfahren hergestellt werden. Weiterhin ist es möglich, dass im Rahmen des Expressionssystems das hergestellte Translationsprodukt eine Markierung trägt, wobei geeignete Markierungen den Fachleuten auf dem Gebiet bekannt sind. Eine derartige geeignete Markierung ist beispielsweise die Markierung mit His6 (Janknecht R et al. (1991) Proc Natl Acad Sei USA 88 (20): 8972-6).A determination of the extent to which the expression system is increased or decreased can be determined at each level of expression, ie, for example, by increasing or decreasing the amount of the nucleic acid coding for the translation product, in particular the mRNA, or else that in the expression system the influence of the translation product produced by the candidate compound, ie the respective protein. The techniques required for this, such as a method for quantifying mRNA, are known to the person skilled in the art and are described, for example, in Sambrook et al. (Sambrook, Joseph: Molecular Cloning: A laboratory manual / J. Sambrook; EF Fritsch; T. Maniatis - Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Pr) .ess, 19XX 1st edition udT Maniatis, Thomas P .: Molecular cloning; 3rd edition: Joseph Sambrook and David W. Russell; Literature ISBN 0-87969-309-6 ISBN 0-87969-576-5 ISBN 0- 87969-577-3 1st - 2nd ed., 4th [Dr.]. - 1989) Furthermore, the person skilled in the art is also familiar with methods for determining the content of the amount of translation product, for example by using suitable antibodies. Antibodies can be produced according to the generally known methods described, for example, in Current Protocols (“Current Protocols in Protein Science”, published by Coligan JE; Dünn BM, Hidde LP Speicher DW, Wingfield PT; John Wiley & Sons). It is also it is possible for the produced translation product to carry a label in the context of the expression system, suitable labels being known to those skilled in the art, for example such a label being His 6 (Janknecht R et al. (1991) Proc Natl Acad Sei USA) 88 (20): 8972-6).
Im Falle des Translationsprodukt-Aktivitätssystems wird dabei die Erhöhung der Aktivität oder Verringerung der Aktivtät des Translationsproduktes typischerweise in einem funktionalen Assay getestet, wie bereits im Zusammenhang mit der Definition der mutierten Translationsprodukte, genauer der mutierten erfmdungsgemäßen Polypeptide, beschrieben wurde.In the case of the translation product activity system, the increase in activity or reduction in the activity of the translation product is typically tested in a functional assay, as has already been described in connection with the definition of the mutated translation products, more precisely the mutated polypeptides according to the invention.
Das in Kontakt bringen von Kandidatenverbindungen und Translationsprodukt- Expressionssystem oder -Aktivitätssystem erfolgt dabei in der Regel durch Zugeben einer bevorzugterweise wässrigen Lösung der Kandidatenverbindung zu dem entsprechenden Reaktionssystem, d. h. dem Expressionssystem oder dem Aktivitätssystem, die hierin auch allgemein als
Testsysteme bezeichnet werden. Die wässrige Lösung kann dabei bevorzugterweise eine Pufferlösung sein.The contacting of candidate compounds and translation product expression system or activity system generally takes place by adding a preferably aqueous solution of the candidate compound to the corresponding reaction system, ie the expression system or the activity system, which is also generally referred to herein Test systems are called. The aqueous solution can preferably be a buffer solution.
Die Verwendung von Kandidatenverbindungen erfolgt in der Regel in der Form, dass in einem jeden Test jeweils nur eine einzelne Kandidatenverbindung in dem entsprechenden Testsystem verwendet wird. Dabei ist es auch im Rahmen der vorliegenden Erfindung, dass entsprechende Tests parallel und in einem Hochdurchsatzverfahren (engl. high through-put System) durchgefühlt werden. In dem letzten Schritt des erfindungsgemäßen Screening-Verfahrens, bestehend in dem Bestimmen, ob unter dem Einfluss der Kandidatenverbindung die Expression bzw. Aktivität des Translationsproduktes oder einer dafür codierenden Nukleinsaure verändert wird, erfolgt in der Regel durch Vergleich des Verhaltens des Testsystems ohne Zusatz der Kandidatenverbindung mit demjenigen des Testsystems mit Zusatz der Kandidatenverbindung. Bevorzugterweise wird die Kandidatenverbindung in einer Verbindungsbibliothek enthalten sein. Als Verbindungsbibliothek ist dabei grundsätzlich eine jede Verbindungsbibliothek unabhängig von der Verbindungsklasse denkbar. Geeignete Verbindungsbibliotheken sind beispielsweise Bibliotheken kleiner Moleküle. Es ist jedoch auch im Rahmen der vorliegenden Erfindung, dass andere Verbindungsklassen als kleine Moleküle verwendet werden, wie beispielsweise Peptide, Proteine, Antiköφer, Anticaline und funktionale Nukleinsäuren.As a rule, candidate compounds are used in such a way that in each test only one individual candidate compound is used in the corresponding test system. It is also within the scope of the present invention that corresponding tests are carried out in parallel and in a high-throughput system. In the last step of the screening method according to the invention, consisting in determining whether the expression or activity of the translation product or a nucleic acid coding therefor is changed under the influence of the candidate compound, the behavior of the test system is generally compared without adding the candidate compound with that of the test system with the addition of the candidate compound. The candidate connection will preferably be contained in a connection library. In principle, each connection library is conceivable as a connection library, regardless of the connection class. Suitable compound libraries are, for example, libraries of small molecules. However, it is also within the scope of the present invention that classes of compounds other than small molecules are used, such as, for example, peptides, proteins, antibodies, anticalins and functional nucleic acids.
Dabei ist es im Rahmen der vorliegenden Erfindung, dass das erfindungsgemäße Translationsprodukt bzw. die dafür codierende Nukleinsaure als Zielmolekül (engl. ,target') für die Erzeugung der vorstehend genannten Verbindungsklassen wie insbesondere Peptide, Proteine, Antiköφer, Anticaline und funktionale Nukleinsäuren verwendet werden. Die entsprechenden Verbindungen, d. h. Peptide, Proteine, Antiköφer, Anticaline und funktionale Nukleinsäuren, können sodann in dem erfindungsgemäßen Screening-Verfahren verwendet werden.It is within the scope of the present invention that the translation product according to the invention or the nucleic acid coding therefor is used as the target molecule for the generation of the abovementioned classes of compounds, such as in particular peptides, proteins, antibodies, anticalins and functional nucleic acids. The corresponding connections, i. H. Peptides, proteins, antibodies, anticalins and functional nucleic acids can then be used in the screening method according to the invention.
Es ist weiterhin im Rahmen der vorliegenden Erfindung, dass jene Verbindungen, d. h. Peptide, Proteine, Antiköφer, Anticaline und funktionale Nukleinsäuren, die gegen das erfindungsgemäße Translationsprodukt bzw. die dafür codierende(n) Nukleinsäure(n) erzeugt werden, als Mittel im Sinne der vorliegenden Erfindung verwendet werden, d. h. als Mittel für die Therapie von Funktionsstörungen der Schilddrüse und/oder Hypeφlasien der Schilddrüse und/oder Schilddrüsentumoren bzw. als entsprechende diagnostische Mittel.
Peptide und insbesondere bindende Peptide im Sinne der vorliegenden Erfindung sind dabei bevorzugterweise solche Proteine und Peptide, die an das erfindungsgemäße Translationsprodukt oder einen oder den/die Wechselwirkungspartner, insbesondere den/die natürlichen Wechselwirkungspartner, des erfindungsgemäßen Translationsproduktes, bevorzugterweise in biologischen Systemen, insbesondere in der Schilddrüse bzw. Hypeφlasien der Schilddrüse oder Schilddrüsentumoren und der sie aufbauenden Zellen, binden. Gleiches gilt auch für die hierin im Zusammenhang mit der erfindungsgemäßen Verwendung beschriebenen Antiköφer, Anticaline, funktionalen Nukleinsäuren und kleinen Moleküle. Gleichzeitig kann ein jedes Mitglied der vorstehend genannten Verbindungsklassen bevorzugterweise mit dem erfindungsgemäßen Translati- onsprodukt oder einer dafür codierenden Nukleinsaure in Wechselwirkung treten und somit die entsprechende Aktivität des Translationsproduktes bzw. der dazu codierenden Nukleinsaure beeinflussen.It is also within the scope of the present invention that those compounds, ie peptides, proteins, antibodies, anticalins and functional nucleic acids, which are generated against the translation product according to the invention or the nucleic acid (s) coding therefor, are used as agents in the sense of The present invention can be used, ie as a means for the therapy of functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors or as corresponding diagnostic means. Peptides and, in particular, binding peptides within the meaning of the present invention are preferably proteins and peptides which bind to the translation product according to the invention or one or the interaction partner (s), in particular the natural interaction partner (s), of the translation product according to the invention, preferably in biological systems, in particular in the Thyroid or Hypeφlasien the thyroid or thyroid tumors and the cells building them bind. The same also applies to the antibodies, anticalins, functional nucleic acids and small molecules described herein in connection with the use according to the invention. At the same time, each member of the compound classes mentioned above can preferably interact with the translation product according to the invention or a nucleic acid coding therefor and thus influence the corresponding activity of the translation product or the nucleic acid coding therefor.
Es ist jedoch auch im Rahmen der vorliegenden Erfindung, derartige Mitglieder zu erzeugen bzw. zu verwenden bzw. einem entsprechenden Screening-Verfahren zu unterziehen, die mit dem Wechselwirkungspartner, insbesondere dem natürlichen Wechselwirkungspartner des erfindungsgemäßen Translationsproduktes, oder einer dafür codierenden Nukleinsaure, in Wechselwirkung treten und die Expression bzw. Aktivität des Wechselwirkungspartners oder der dafür codierenden Nukleinsaure beeinflussen. Auch hier bezeichnet der Begriff „beeinflussen" entweder Erhöhung oder Verringerung der Expression, des Expressionsumfangs oder der Aktivität, wie hierin allgemein offenbart. Infolge der Wechselwirkung der besagten Mitglieder mit den Wechselwirkungspartnern des erfindungsgemäßen Translationsproduktes bzw. der dafür codierenden Nukleinsaure wird somit die an das Translationsprodukt gekoppelte Kaskade von Reaktionen unterbrochen, so dass die natürlicherweise beobachtete Wirkung des erfindungsgemäßen Translationsproduktes bzw. der von ihr codierten Nukleinsaure unterbrochen wird, was im Rahmen der hierin offenbarten Therapie bzw. Diagnose betreffend Funktionsstörungen der Schilddrüse und/oder Hypeφlasien der Schilddrüse und/oder Schilddriisentumoren verwendet werden kann.However, it is also within the scope of the present invention to generate or use such members or to subject them to a corresponding screening process which interact with the interaction partner, in particular the natural interaction partner of the translation product according to the invention, or a nucleic acid coding therefor and influence the expression or activity of the interaction partner or the nucleic acid coding therefor. Here, too, the term “influence” denotes either an increase or a decrease in expression, the level of expression or the activity, as is generally disclosed herein. As a result of the interaction of the said members with the interaction partners of the translation product according to the invention or of the nucleic acid coding therefor, the expression on the translation product becomes Coupled cascade of reactions interrupted, so that the naturally observed effect of the translation product according to the invention or the nucleic acid encoded by it is interrupted, which is used in the context of the therapy or diagnosis disclosed herein regarding functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors can be.
Diese Peptide, im folgenden hierin auch als bindende Peptide oder bindende Proteine bezeichnet, können mit im Stand der Technik bekannten Verfahren, wie beispielsweise phage-display gesc- reent bzw. hergestellt werden. Die Techniken sind den Fachleuten auf dem Gebiet bekannt. Dabei wird bei der Erzeugung derartiger Peptide typischerweise so vorgegangen, dass eine Peptid-
Bibliothek angelegt wird, beispielsweise in Form von Phagen, und diese Bibliothek in Kontakt gebracht wird mit einem Zielmolekül, im vorliegenden Falle beispielsweise mit einem Translationsprodukt oder dem natürlichen Wechselwirkungspartner des Translationsproduktes. Die bindenden Peptide werden sodaim typischerweise als Komplex zusammen mit dem Zielmolekül von den nicht bindenden Mitgliedern der Bibliothek entfernt. Es ist dabei im Rahmen der Kenntnisse der Fachleute auf diesem Gebiet, dass die Bindungseigenschaften zumindest bis zu einem bestimmten Umfang von den jeweils konkret vorliegenden Versuchsbedingungen, wie beispielsweise Salzgehalt und dergleichen, abhängen. Nach Abtrennen der mit einer höheren oder stärkeren Affinität an das Zielmolekül bindenden Peptide von den nicht-bindenden Mitgliedern der Bibliothek bzw. vom Zielmolekül, im vorliegenden Fall vom erfindungsgemäßen Translationsprodukt, können diese sodann charakterisiert werden. Ggf. ist vor der Charakterisierung ein Amplifikationsschritt, beispielsweise durch Vermehrung der entsprechenden, das Peptid bzw. die Peptide oder Protein(e) codierenden Phagen erforderlich. Die Charakterisierung umfasst bevorzugterweise die Sequenzierung der an das Translationsprodukt oder seinen natürlichen Wechselwirkungspartner, je nachdem, welches der beiden Moleküle als Zielmolekül in dem phage- display Screening-Verfahren eingesetzt wurde, bindenden Peptide. Die Peptide sind dabei hinsichtlich ihrer Länge grundsätzlich nicht beschränkt. Typischerweise werden in derartigen Verfahren jedoch Peptide mit einer Länge von 8 - 20 Aminosäuren erhalten bzw. verwendet. Die Größe der Bibliotheken beträgt 102 - 1018, bevorzugterweise 108 - 1015 verschiedene Peptide. Eine spezielle Form von an Zielmolekülen bindenden Peptiden stellen die Anticaline dar, wie sie beispielsweise in der deutschen Patentanmeldung DE 197 42 706 beschrieben sind.These peptides, hereinafter also referred to as binding peptides or binding proteins, can be screened or produced using methods known in the art, such as phage display. The techniques are known to those skilled in the art. The process for generating such peptides is typically such that a peptide Library is created, for example in the form of phages, and this library is brought into contact with a target molecule, in the present case for example with a translation product or the natural interaction partner of the translation product. The binding peptides are typically removed as a complex together with the target molecule from the non-binding members of the library. It is within the knowledge of the experts in this field that the binding properties depend at least to a certain extent on the specific test conditions, such as salinity and the like. After the peptides binding to the target molecule with a higher or stronger affinity have been separated from the non-binding members of the library or from the target molecule, in the present case from the translation product according to the invention, these can then be characterized. Possibly. an amplification step is required before the characterization, for example by increasing the corresponding phages coding for the peptide or the peptides or protein (s). The characterization preferably comprises the sequencing of the peptides binding to the translation product or its natural interaction partner, depending on which of the two molecules was used as the target molecule in the phage display screening method. The length of the peptides is basically not limited. Typically, however, peptides with a length of 8-20 amino acids are obtained or used in such methods. The size of the libraries is 10 2 - 10 18 , preferably 10 8 - 10 15 different peptides. A special form of peptides binding to target molecules are the anticalins, as described, for example, in German patent application DE 197 42 706.
Im Lichte der hierin offenbarten technischen Lehre können sodann auch Antiköφer gegen ein Genprodukt, insbesondere ein erfindungsgemäßes Translationsprodukt wie ein Polypeptid, oder die erfindungsgemäßen Nukleinsäuresequenzen hergestellt werden. Damit ergeben sich auch in diesem Falle die dem Fachmann allgemein aus dem Vorhandensein von Antiköφern gegen chemische Verbindungen bekannten Vorteile, insbesondere bei in vitro- und in vivo-Anwendungen. Insbesondere ist mit den Antiköφern beispielsweise eine Reinigung der erfindungsgemäßen Verbindungen, d. h. der erfindungsgemäßen Nukleinsäuren und/oder der erfindungsgemäßen Polypeptide bzw. Translationsprodukte möglich, deren Detektion, aber auch die Beeinflussung der biologischen Aktivität, einschließlich der biologischen Verfügbarkeit, der Verbindungen, auf die der Antiköφer gerichtet ist, sowohl in situ, als auch ex vivo, in vivo und/oder in vitro. Genauer gesagt köm en insbesondere unter Verwendung von monoklonalen Antiköφern die Gen-
Produkte spezifisch detektiert werden bzw. auf zellulärer Ebene eine Interaktion der Genprodukte bzw. Nukleinsauresequenz mit anderen zellulären Komponenten beeinflusst und somit spezifisch in das zelluläre Geschehen eingegriffen werden. In Abhängigkeit von der Wirkung der jeweiligen Verbindungen, auf die der Antiköφer gerichtet ist und auf die er im betrachteten System seine Wirkung entfaltet, können prinzipiell stimulierende wie inhibierende Effekte erzielt werden.In the light of the technical teaching disclosed herein, antibodies against a gene product, in particular a translation product according to the invention such as a polypeptide, or the nucleic acid sequences according to the invention can then also be produced. In this case, too, the advantages known to the person skilled in the art from the presence of antibodies to chemical compounds generally result, in particular in in vitro and in vivo applications. In particular, the antibodies can be used, for example, to purify the compounds according to the invention, ie the nucleic acids according to the invention and / or the polypeptides or translation products according to the invention, to detect them, but also to influence the biological activity, including the bioavailability, of the compounds to which the antibodies are based is directed, both in situ and ex vivo, in vivo and / or in vitro. More specifically, the use of monoclonal antibodies Products are specifically detected or an interaction of the gene products or nucleic acid sequence with other cellular components is influenced at the cellular level and thus specifically intervened in the cellular process. Depending on the action of the particular compounds to which the antibody is directed and on which it develops its action in the system under consideration, stimulating and inhibiting effects can in principle be achieved.
Unter Antiköφer werden hierin sowohl polyklonale Antiköφer als auch monoklonale Antikörper verstanden. Besonders bevorzugt jedoch sind monoklonale Antiköφer aufgrund der erhöhten Spezifität. Es sind jedoch Anwendungsfälle denkbar, in denen zum einen die Reinheit bzw. Spe- zifität von polyklonalen Antiköφern ausreichend bzw. die Vielzahl der bei polyklonalen Antiköφern realisierten Spezifitäten und anderen Eigenschaften in vorteilhafter Weise genutzt werden können. Die Herstellung und Verwendung von Antiköφern ist beispielsweise in Antibodies: A Laboratory Manual (E. Harlow & D. Lane, Cold Spring Harbor Laboratory, NY, 1988) beschrieben und wird hierin mit einbezogen.Antibodies are understood here to mean both polyclonal antibodies and monoclonal antibodies. However, monoclonal antibodies are particularly preferred due to the increased specificity. However, applications are conceivable in which, on the one hand, the purity or specificity of polyclonal antibodies is sufficient or the multiplicity of specificities and other properties realized in polyclonal antibodies can be used advantageously. The production and use of antibodies is described, for example, in Antibodies: A Laboratory Manual (E. Harlow & D. Lane, Cold Spring Harbor Laboratory, NY, 1988) and is incorporated herein.
Weiterhin ist es im Rahmen dieser Erfindung, dass der Antiköφer auch ein einzelkettiger Antiköφer sein kann.It is also within the scope of this invention that the antibody can also be a single-chain antibody.
Es ist auch im Rahmen der vorliegenden Erfindung, dass der Antiköφer fragmentiert, insbesondere verkürzt ist. Dies schließt ein, dass der Antiköφer fragmentiert, insbesondere verkürzt ist. Dies schließt ein, dass der Antiköφer weitestgehend trunkiert ist, solange noch die Antiköφer spezifische Eigenschaft, d. h. Bindung an ein definiertes Epitop, gegeben ist. Trunkierung ist besonders dann von Vorteil, wenn der entsprechende Antiköφer auf zellulärer Ebene verwendet werden soll, da er gegenüber einem vollständigen Antiköφer verbesserte Permeations- und Diffusionseigenschaften aufweist.It is also within the scope of the present invention that the antibody is fragmented, in particular shortened. This includes that the antibody is fragmented, especially shortened. This includes that the antibody is largely truncated as long as the antibody-specific property, i. H. Binding to a defined epitope is given. Truncation is particularly advantageous when the corresponding antibody is to be used at the cellular level, since it has improved permeation and diffusion properties compared to a complete antibody.
Darüber hinaus sind auch noch andere Formen der Modifikation vorgesehen, die dem Fachmann auf dem Gebiet bekannt sind und beispielsweise beschrieben sind in Antibodies: A Laboratory Manual (E. Harlow & D. Lane, Cold Spring Harbor Laboratory, NY, 1988). Allgemein kann festgehalten werden, dass die Modifizierung von Antiköφern prinzipiell in ähnlicher Weise erfolgen kann, wie die von Polypeptiden und, in bestimmtem Umfang, von Nukleinsäuren, und das hierzu oben Gesagte gilt sinngemäß auch für den erfindungsgemäßen Antiköφer.
2SIn addition, other forms of modification are also provided that are known to those skilled in the art and are described, for example, in Antibodies: A Laboratory Manual (E. Harlow & D. Lane, Cold Spring Harbor Laboratory, NY, 1988). In general, it can be stated that the modification of antibodies can in principle be carried out in a similar way to that of polypeptides and, to a certain extent, of nucleic acids, and what has been said above applies analogously to the antibody according to the invention. 2S
Eine weitere Verbindungsklasse, die im Rahmen des erfindungsgemäßen Screening- Verfahrens ebenso wie bei der erfindungsgemäßen Herstellung von Medikamenten und diagnostischen Mitteln verwendet werden kann, sind funktionale Nukleinsäuren. Unter funktionalen Nukleinsäuren sollen hierin insbesondere Aptamere, Aptazyme, Ribozyme, Spiegelmere, Antisense- Oligonukleotide und RNAi verstanden werden.Another class of compounds that can be used in the screening method according to the invention as well as in the production of medicaments and diagnostic agents according to the invention are functional nucleic acids. Functional nucleic acids are to be understood here in particular to mean aptamers, aptazymes, ribozymes, Spiegelmers, antisense oligonucleotides and RNAi.
Aptamere sind D-Nukleinsäuren, entweder einzelsträngig oder doppelsträngig, auf RNA- oder DNA-Basis, die spezifisch an ein Zielmolekül binden. Die Herstellung von Aptameren ist bspw. beschrieben im Europäischen Patent EP 0 533 838. Dabei wird wie folgt vorgegangen:Aptamers are D-nucleic acids, either single-stranded or double-stranded, based on RNA or DNA, which bind specifically to a target molecule. The production of aptamers is described, for example, in European Patent EP 0 533 838. The procedure is as follows:
Eine Mischung aus Nukleinsäuren, d. h. potentiellen Aptameren, wird bereitgestellt, wobei eine jede Nukleinsaure aus einem Segment aus wenigstens acht aufeinanderfolgenden, randomisierten Nukleotiden besteht und diese Mischung mit dem Target, im vorliegenden Falle somit mit einem Translationsprodukt, insbesondere einem erfindungsgemäßen Translationsprodukt, dafür codierender/codierenden Nukleinsäure(n), Wechselwirkungspartnern des Translationsproduktes, insbesondere den natürlichen Wechselwirkungspartnern, und/oder für sie codierende(r) Nukleinsäuren) in Kontakt gebracht wird, wobei Nukleinsäuren, die an das Target binden, ggf. auf der Grundlage einer erhöhten Affinität, verglichen mit der Affinität der Kandidatenmischung, vom Rest der Kandidatenmischung abgetrennt werden und die solchermaßen erhaltenen an das Target bindenden Nukleinsäuren amplifiziert werden. Diese Schritte werden mehrfach wiederholt, so dass am Ende des Verfahrens spezifisch an das jeweilige Target oder Zielmolekül bindende Nukleinsäuren, eben die sogenannten Aptamere, erhalten werden. Es ist im Rahmen der vorliegenden Erfindung, dass diese Aptamere stabilisiert werden können, bspw. durch Einführung bestimmter chemischer Gruppen, die den Fachleuten auf dem Gebiet der Aptamer-Entwicklung bekannt sind. Aptamere werden derzeit bereits therapeutisch eingesetzt. Es ist auch im Rahmen der vorliegenden Erfindung, dass die solchermaßen hergestellten Aptamere für die Targetvalidierung und als Leitsubstanzen für die Entwicklung von Medikamenten, insbesondere von kleinen Molekülen, verwendet werden.A mixture of nucleic acids, i.e. H. potential aptamers is provided, each nucleic acid consisting of a segment of at least eight consecutive, randomized nucleotides and this mixture with the target, in the present case thus with a translation product, in particular a translation product according to the invention, nucleic acid (s) coding / coding therefor Interaction partners of the translation product, in particular the natural interaction partners, and / or nucleic acids coding for them, is brought into contact, nucleic acids which bind to the target, possibly on the basis of an increased affinity compared to the affinity of the candidate mixture, are separated from the rest of the candidate mixture and the nucleic acids thus obtained which bind to the target are amplified. These steps are repeated several times, so that at the end of the method, nucleic acids specifically binding to the respective target or target molecule, namely the so-called aptamers, are obtained. It is within the scope of the present invention that these aptamers can be stabilized, for example by introducing certain chemical groups that are known to those skilled in the art of aptamer development. Aptamers are currently used therapeutically. It is also within the scope of the present invention that the aptamers thus produced are used for target validation and as lead substances for the development of medicaments, in particular of small molecules.
Auf einem grundsätzlich ähnlichen Prinzip beruht die Herstellung oder Erzeugung von Spiegel- meren, die im Rahmen der vorliegenden Erfindung auf der Grundlage eines erfindungsgemäßen Translationsproduktes, der dafür codierenden Nukleinsäure(n), der Translationsprodukt-
Wechselwirkungspartner, insbesondere der natürlichen Wechselwirkungspartner, und/oder der für sie codierenden Nukleinsäure(n) als Zielmolekül entwickelt werden können. Die Herstellung von Spiegelmeren ist bspw. beschrieben in der internationalen Patentanmeldung WO 98/08856. Spiegelmere sind L-Nukleinsäuren, d.h. bestehen aus L-Nukleotiden, und zeichnen sich im wesentlichen dadurch aus, dass sie in biologischen Systemen eine sehr hohe Stabilität aufweisen und gleichzeitig, vergleichbar den Aptameren, mit einem Zielmolekül spezifisch wechselwirken bzw. an dieses binden können. Bei der Herstellung der Spiegelmere wird dabei| so vorgegangen, dass eine heterogene Population aus D-Nukleinsäuren erzeugt wird, die Population mit dem optischen Antipoden des Zielmoleküls in Kontakt gebracht wird, im vorliegenden Falle somit beispielsweise mit dem D-Enantiomer des natürlicher Weise auftretenden L-Enantiomers eines Translationsproduktes, sodarm jene D-Nukleinsäuren abgetrennt werden, die nicht mit dem optischen Antipoden des Zielmoleküls in Wechselwirkung getreten sind, die D-Nukleinsäuren, die mit der optischen Antipode des Zielmoleküls in Wechselwirkung getreten sind, bestimmt, ggf. abgetrennt und sequenziert werden und anschließend L-Nukleinsäuren synthetisiert werden, die in ihrer Sequenz mit derjenigen zuvor für die D-Nukleinsäure(n) ermittelten Sequenz(en) identisch sind. Ähnlich dem Verfahren zur Herstellung von Aptameren ist es auch hier möglich, durch mehrfaches Wiederholen der Schritte geeignete Nukleinsäuren, d.h. Spiegelmere, anzureichern bzw. zu erzeugen, die das Translationsprodukt, einen oder mehrere seiner insbesondere natürlichen Wechselwirkungspartner, je nachdem, welche der vorstehend genannten λ^erbindun- gen als Zielmolekül eingesetzt wird, oder einer dafür codierenden Nukleinsaure binden.The production or production of Spiegelmers is based on a fundamentally similar principle, which within the scope of the present invention is based on a translation product according to the invention, the nucleic acid (s) coding therefor, the translation product Interaction partners, in particular the natural interaction partners, and / or the nucleic acid (s) coding for them can be developed as the target molecule. The production of Spiegelmeres is described, for example, in international patent application WO 98/08856. Spiegelmers are L-nucleic acids, ie they consist of L-nucleotides, and are essentially characterized by the fact that they have a very high stability in biological systems and, at the same time, comparable to the aptamers, can specifically interact with or bind to a target molecule. In the manufacture of Spiegelmers, | proceeded in such a way that a heterogeneous population is generated from D-nucleic acids, the population is brought into contact with the optical antipode of the target molecule, in the present case thus, for example, with the D-enantiomer of the naturally occurring L-enantiomer of a translation product, so that D -Nucleic acids are separated which have not interacted with the optical antipode of the target molecule, the D-nucleic acids which have interacted with the optical antipode of the target molecule are determined, if necessary separated and sequenced and then L-nucleic acids are synthesized which are identical in sequence to that previously determined for the D-nucleic acid (s). Similar to the process for the production of aptamers, it is also possible here, by repeating the steps several times, to enrich or generate suitable nucleic acids, ie Spiegelmers, which the translation product, one or more of its, in particular, natural interaction partners, depending on which of the above λ ^ compounds is used as the target molecule, or bind a nucleic acid coding therefor.
Eine weitere Form der funktionalen Nukleinsäuren, die erfindungsgemäß veiwendet werden können, sind sogenannte Aptazyme. Aptazyme sind beispielsweise beschrieben von Piganeau, N. et al. (2000), Angew. Chem. Int. Ed., 39, Nr. 29, Seiten 4369-4373. Dabei handelt es sich um eine spezifische Form von Aptameren, die sich dadurch auszeichnen, dass sie neben dem Apta- meranteil, der spezifisch an das Zielmolekül, im vorliegenden Falle ein erfindungsgemäßes Translationsprodukt oder ein Wechselwirkungspartner davon, bindet, noch einen Ribozymanteil enthalten kann mit der Folge, dass nach Bindung des Zielmoleküls des Aptameranteils des Apta- zyms der Ribozymanteil aktiviert wird und es infolge dessen zu einer Spaltung einer als Substrat des Ribozymanteils des Aptazyms fungierenden Nukleinsaure kommt. Bei entsprechender Gestaltung des Ribozymsubstrates kann dabei beispielsweise eine Änderung der Fluoreszenz infolge einer Änderung der räumlichen Anordnung eines Fluoreszenzdonors relativ zu einem Fluoreszenzakzeptor auf dem Ribozymsubstrat beobachtet werden. Aptazyme eignen sich insoweit ins-
besondere für die Anwendung im Rahmen einer Targetvalidierung betreffend ein Translationsprodukt und seiner Wechselwirkungspartner sowie als diagnostisches Mittel im Sinne der vorliegenden Erfindung. Gleichwohl ist auch eine therapeutische Anwendung in dem Umfang möglich, wie sie im Zusammenhang mit den hierin beschriebenen Ribozymen offenbart ist.Another form of functional nucleic acids that can be used according to the invention are so-called aptazymes. Aptazymes are described, for example, by Piganeau, N. et al. (2000), Angew. Chem. Int. Ed., 39, No. 29, pages 4369-4373. This is a specific form of aptamers which are distinguished by the fact that, in addition to the portion of the aptamer that binds specifically to the target molecule, in the present case a translation product according to the invention or an interaction partner thereof, it can also contain a portion of ribozyme with which As a result, after binding of the target molecule of the aptamer portion of the aptazyme, the ribozyme portion is activated and this results in a cleavage of a nucleic acid which acts as a substrate of the ribozyme portion of the aptazyme. With a corresponding design of the ribozyme substrate, a change in the fluorescence due to a change in the spatial arrangement of a fluorescence donor relative to a fluorescence acceptor on the ribozyme substrate can be observed, for example. In this respect, Aptazyme are suitable in particular for use in the context of target validation relating to a translation product and its interaction partners and as a diagnostic agent in the sense of the present invention. Nevertheless, therapeutic use to the extent disclosed in connection with the ribozymes described herein is also possible.
Den vorstehend genannten Verbindungsklassen ist dabei gemein, dass sie im Wesentlichen an das jeweilige Protein, d. h. das bzw. ein, bevorzugterweise ein erfindungsgemäßes, Translationsprodukt oder den Wechselwirkungspartner davon, binden, es ist jedoch auch im Rahmen der vorliegenden Erfindung, dass diese Verbindungsklassen und insbesondere die funktionalen Nukleinsäuren als Targetmolekül die für die vorstehend genannten Proteine bzw. Polypeptide codie- rende(n) Nukleinsäure(n) zum Gegenstand haben.What is common to the abovementioned classes of compounds is that they essentially bind to the respective protein, ie. H. bind the or a, preferably a translation product according to the invention or the interaction partner thereof, but it is also within the scope of the present invention that these classes of compounds and in particular the functional nucleic acids as the target molecule encode the proteins or polypeptides ( n) subject to nucleic acid (s).
Eine weitere Klasse von Verbindungen, die unter Verwendung eines Translationsproduktes, bevorzugterweise eines erfindungsgemäßen Translationsproduktes, und/oder eines Wechselwirkungspartners davon und insbesondere der für diese codierenden Nukleinsäure(n) hergestellt bzw. entwickelt werden können, sind Ribozyme, Antisense-Oligonukleotide und RNAi.Another class of compounds which can be produced or developed using a translation product, preferably a translation product according to the invention, and / or an interaction partner thereof and in particular the nucleic acid (s) coding for them are ribozymes, antisense oligonucleotides and RNAi.
All diesen Klassen von Verbindungen ist dabei gemein, dass sie nicht auf der Ebene des Translationsproduktes, d.h. auf der Ebene der Proteine (Translationsprodukt und Wechselwirkungspartner davon) ihre Wirkung entfalten, sondern auf der Ebene der für das jeweilige Protein codierenden Nukleinsäure(n), insbesondere der für ein Translationsprodukt codierenden mRNA bzw. der mRNA, die für einen Wechselwirkungspartner des Translationsproduktes codiert. Grundsätzlich ist dabei auch die entsprechende genomische DNA oder die korrespondierende cDNA als Zielmolekül geeignet.All these classes of compounds have in common that they are not at the level of the translation product, i.e. develop their effect on the level of the proteins (translation product and interaction partner thereof), but on the level of the nucleic acid (s) coding for the respective protein, in particular the mRNA coding for a translation product or the mRNA coding for an interaction partner of the translation product. In principle, the corresponding genomic DNA or the corresponding cDNA is also suitable as the target molecule.
Bei Ribozymen handelt es sich um katalytisch aktive Nukleinsäuren, die bevorzugterweise aus RNA aufgebaut sind und aus zwei Teilbereichen bestehen. Der erste Teilbereich ist für eine kata- lytische Aktivität verantwortlich, wohingegen der zweite Teil für eine spezifische Wechselwirkung mit einer Ziel-Nukleinsäure verantwortlich ist. Kommt es zur Ausbildung einer Wechselwirkung zwischen der Ziel-Nukleinsäure und dem zweiten Teil des Ribozyms, typischer Weise durch Hybridisierung von zueinander im wesentlichen komplementären Basenbereichen, kann der katalytische Teil des Ribozyms entweder intramolekular oder intermolekular, wobei letzteres bevorzugt ist, die Ziel-Nukleinsäure hydrolysieren für den Fall, dass die katalytische Wirkung
des Ribozyms eine Phosphodiesterase-Aktivität ist. In der Folge kommt es zu einem - ggf. weiteren - Abbau der codierenden Nukleinsaure, wobei der Titer des Zielmoleküls sowohl auf der Nukleinsaure- als auch der Proteinebene sowohl intrazellulär als auch extrazellulär vemngert werden kam und somit ein therapeutischer Ansatz für die Behandlung von Funktionsstörungen der Schilddrüse und/oder Hypeφlasien der Schilddrüse und/oder Schilddriisentumoren bereitgestellt wird. Ribozyme, deren Verwendung sowie Konstruktionsprinzipien sind den Fachleuten auf dem Gebiet bekannt und bspw. beschrieben in Doherty und Doudna (Ribozyme structures and mechanisms. Annu Rev Biophys Biomol Struct 2001;30:457-75) und Lewin und Hauswirth (Ribozyme gene fherapy: applications for molecular medicine. Trends Mol Med 2001, 7:221-8).Ribozymes are catalytically active nucleic acids, which are preferably made up of RNA and consist of two parts. The first part is responsible for a catalytic activity, whereas the second part is responsible for a specific interaction with a target nucleic acid. If an interaction occurs between the target nucleic acid and the second part of the ribozyme, typically by hybridization of base regions that are essentially complementary to one another, the catalytic part of the ribozyme can hydrolyze the target nucleic acid either intramolecularly or intermolecularly, the latter being preferred in the event that the catalytic action of the ribozyme is a phosphodiesterase activity. As a result, there is a - possibly further - degradation of the coding nucleic acid, the titer of the target molecule being reduced both intracellularly and extracellularly both at the nucleic acid and the protein level, and thus a therapeutic approach for the treatment of functional disorders Thyroid and / or hypothyroidism of the thyroid and / or thyroid tumors is provided. Ribozymes, their use and construction principles are known to those skilled in the art and are described, for example, in Doherty and Doudna (Ribozyme structures and mechanisms. Annu Rev Biophys Biomol Struct 2001; 30: 457-75) and Lewin and Hauswirth (Ribozyme gene therapy: applications for molecular medicine. Trends Mol Med 2001, 7: 221-8).
Mit Blick auf eine pharmazeutische Zusammensetzung, welche ein Ribozym neben dem pharmazeutisch akzeptablen Träger umfasst bzw. die Verwendung des erfindungsgemäßen Ribozyms als Medikament, und insbesondere zur Behandlung von Funktionsstörungen, Hypeφlasien und Tumoren der Schilddrüse, ist es auch möglich, dass das Ribozym so konstruiert wird, dass es spezifisch auf eine oder mehrere der erfindungsgemäßen Nukleinsäuresequenzen einwirkt und somit auch hier die Expression bzw. Translation auf zellulärer Ebene kontrolliert, was insbesondere unter dem therapeutischen aber auch diagnostischen Aspekt von Bedeutung ist. Dabei kann aufgrund der Tatsache, dass Ribozyme sowohl intra- als auch intermolekulare katalytische Wirkungen zeigen, auch vorgesehen sein, dass die erfmdungsgemäßen Nukleinsäuresequenzen dergestalt geändert werden, dass Bereiche ihrer selbst durch die Ribozymaktivität des geänderten Bereiches gespalten werden. Auch hierin eröffnet sich eine insbesondere therapeutische Möglichkeit, deren Ausgestaltung dem Fachmann im Lichte der nun vorhandenen Sequenzinformation möglich ist.With a view to a pharmaceutical composition which comprises a ribozyme in addition to the pharmaceutically acceptable carrier or the use of the ribozyme according to the invention as a medicament, and in particular for the treatment of functional disorders, hypothyroidism and tumors of the thyroid gland, it is also possible for the ribozyme to be constructed in this way that it acts specifically on one or more of the nucleic acid sequences according to the invention and thus also controls expression or translation here at the cellular level, which is particularly important from the therapeutic but also the diagnostic aspect. Due to the fact that ribozymes show both intra- and intermolecular catalytic effects, it can also be provided that the nucleic acid sequences according to the invention are changed in such a way that regions of themselves are cleaved by the ribozyme activity of the changed region. This also opens up a particularly therapeutic possibility, the design of which is possible for the person skilled in the art in the light of the sequence information now available.
Ribozyme sind, ähnlich den erfmdungsgemäßen Nukleinsäuresequenzen selbst, besonders dann von Vorteil, aber nicht nur dann, wenn sie, beispielsweise mittels Gentherapie, in die Effektorzelle eingebracht werden. Jedoch ist auch denkbar, dass entsprechende Modifikationen ex vivo vorgenommen werden und solchermaßen modifizierte Zellen dann zur Reimplantation, entweder allogen oder autogen, zur Verfügung stehen. Die Herstellung und Verwendung von Ribozymen ist in Ribozyme Protocols (Philip C. Turner, Ed., Humana Press, Totowa, NY, 1997) offenbart und wird hierin mit einbezogen.
Auf einem grundsätzlich ähnlichen Wirkmechanismus beruht die Verwendung von Antisense- Oligonukleotiden zur Herstellung eines Medikamentes bzw. diagnostischen Mittels im Sinne der vorliegenden Erfindung. Antisense-Oligonukleotide hybridisieren infolge Basenkomplementari- tät typischer Weise mit einer Ziel-RNA, nomialer Weise mit mRNA und aktivieren dadurch RNaseH. RNaseH wird sowohl durch Phosphodiester als auch Phosphorothioat-gekoppelte DNA aktiviert. Phosphorodiester-gekoppelte DNA wird jedoch schnell durch zelluläre Nukleasen mit Ausnalime von Phosphorothioat-gekoppelter DNA abgebaut. Diese resistenten, nicht-natürlicher Weise auftretende DNA-Derivate inhibieren RNaseH nicht, wenn sie mit RNA hybridisiert sind. Mit anderen Worten, Antisense-Polynukleotide sind nur als DNA-RNA-Hybridkomplex wirksam. Beispiele für derartige Antisense-Oligonukleotide finden sich, u.a., in US-Patent US 5,849,902 oder US 5,989,912. Prinzipiell besteht das wesentliche Konzept der Antisense- Oligonukleotide darin, gegen bestimmte RNA eine komplementäre Nukleinsaure bereitzustellen. Mit anderen Worten, ausgehend von der Kenntnis der Nukleinsauresequenz eines Translationsproduktes bzw. seines oder seiner Wechselwirkungspartner(s), insbesondere der jeweiligen mRNA, können durch Basenkomplementarität geeignete Antisense-Oligonukleotide hergestellt werden, die zu einem Abbau der codierenden Nukleinsaure, insbesondere der mRNA, führen. Dieser Abbau kann sodann in einem Expressions- oder Aktivitätssystem qualitativ oder quantitativ erfasst werden.Ribozymes, similar to the nucleic acid sequences themselves according to the invention, are particularly advantageous, but not only when they are introduced into the effector cell, for example by means of gene therapy. However, it is also conceivable that corresponding modifications are made ex vivo and cells modified in this way are then available for reimplantation, either allogeneic or autogenous. The production and use of ribozymes is disclosed in Ribozyme Protocols (Philip C. Turner, Ed., Humana Press, Totowa, NY, 1997) and is incorporated herein. The use of antisense oligonucleotides for the production of a medicament or diagnostic agent in the sense of the present invention is based on a basically similar mechanism of action. Due to base complementarity, antisense oligonucleotides typically hybridize with a target RNA, nomially with mRNA and thereby activate RNaseH. RNaseH is activated by both phosphodiester and phosphorothioate-coupled DNA. However, phosphorodiester-coupled DNA is rapidly degraded by cellular nucleases with the exception of phosphorothioate-coupled DNA. These resistant, non-naturally occurring DNA derivatives do not inhibit RNaseH when hybridized to RNA. In other words, antisense polynucleotides are only effective as a DNA-RNA hybrid complex. Examples of such antisense oligonucleotides can be found, inter alia, in US Pat. No. 5,849,902 or US Pat. No. 5,989,912. In principle, the essential concept of the antisense oligonucleotides is to provide a complementary nucleic acid against certain RNA. In other words, based on the knowledge of the nucleic acid sequence of a translation product or its or its interaction partner (s), in particular the respective mRNA, suitable antisense oligonucleotides can be produced by base complementarity, which lead to a degradation of the coding nucleic acid, in particular the mRNA , This degradation can then be recorded qualitatively or quantitatively in an expression or activity system.
Eine weitere Klasse von Verbindungen, die als Medikament bzw. diagnostisches Mittel im Sinne der vorliegenden Erfindung verwendet, identifiziert oder hergestellt werden kann, ist die sogenannte RNAi. RNAi ist eine doppelsträngige RNA, die RNA-Interferenz vermittelt und typischerweise eine Länge von etwa 21 bis 23 Nukleotiden aufweist. Dabei entspricht einer der beiden Stränge der RNA einer Sequenz eines bzw. des abzubauenden Gens. Mit anderen Worten, ausgehend von der Kenntnis der für ein Translationsprodukt und/oder dessen Wechselwirkungspartner codierenden Nukleinsäure(n), insbesondere der mRNA, kann eine doppelsträngige RNA hergestellt werden, wobei einer der beiden RNA-Stränge komplementär zu der besagten, für das Translationsprodukt und/oder dessen Wechselwirkungspartner codierenden Nukleinsäure(n) ist, bevorzugterweise zur mRNA, und diese dann zum Abbau der entsprechenden codierenden Nukleinsaure führt und damit einhergehend zu einer Verringerung des Titers der jeweiligen Transla- tionsprodukte, d. h. der Proteine. Die Erzeugung und Verwendung von RNAi als Medikament bzw. diagnostisches Mittel ist bspw. beschrieben in den internationalen Patentanmeldungen WO 00/44S95 und WO 01/75164.
Mit Blick auf die Wirkmechanismen der vorstehend beschriebenen Klassen von Verbindungen, nämlich Ribozymen, Antisense-Oligonukleotiden sowie RNAi, ist es somit im Rahmen der vorliegenden Erfindung, neben dem erfindungsgemäßen Translationsprodukt, d. h. dem jeweiligen Polypeptid bzw. Protein, und dessen insbesondere natürlichen Wechselwirkungspartner(n) auch die jeweils dafür codierende(n) Nukleinsäure(n), insbesondere die entsprechende mRNA, cDNA oder genomische DNA, zur Herstellung eines Medikamentes für die Behandlung von FunktionsstöiTingen der Schilddrüse und/oder Hypeφlasien der Schilddrüse und/oder Schilddrüsentumoren bzw. für die Herstellung eines diagnostischen Mittels für die Diagnose der vorstehend genaimten Erkrankungen bzw. FunktionsstöiTingen und für das Überwachen des Verlaufes der Erkrankung bzw. der angesetzten Therapie, entweder direkt oder als Zielmolekül, zu verwenden.Another class of compounds that can be used, identified or produced as a medicament or diagnostic agent in the sense of the present invention is the so-called RNAi. RNAi is a double-stranded RNA that mediates RNA interference and is typically about 21 to 23 nucleotides in length. One of the two strands of the RNA corresponds to a sequence of a gene or of the gene to be degraded. In other words, based on the knowledge of the nucleic acid (s) coding for a translation product and / or its interaction partner, in particular the mRNA, a double-stranded RNA can be produced, one of the two RNA strands complementary to that for the translation product and / or whose interaction partner is coding nucleic acid (s), preferably to the mRNA, and this then leads to the degradation of the corresponding coding nucleic acid and, consequently, to a reduction in the titer of the respective translation products, ie the proteins. The generation and use of RNAi as a medicament or diagnostic agent is described, for example, in international patent applications WO 00 / 44S95 and WO 01/75164. With a view to the mechanisms of action of the classes of compounds described above, namely ribozymes, antisense oligonucleotides and RNAi, it is therefore within the scope of the present invention, in addition to the translation product according to the invention, ie the respective polypeptide or protein, and its especially natural interaction partner (n ) also the nucleic acid (s) coding for it, in particular the corresponding mRNA, cDNA or genomic DNA, for the manufacture of a medicament for the treatment of functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors or for the manufacture thereof a diagnostic agent for the diagnosis of the above-mentioned diseases or functional disorders and for monitoring the course of the disease or the therapy used, either directly or as a target molecule.
Bei der Verwendung des erfindungsgemäßen Translationsproduktes, der dafür codierenden Nukleinsaure, des oder der Translationsprodukt- Wechselwirkungspartner(s), insbesondere des/der natürlichen Wechselwirkungspartner(s), und/oder der für diese codierende(n) Nukleinsäure(n) als Zielmolekül für die Herstellung bzw. Entwicklung eines Medikaments für die Behandlung oder Therapie von Funktionsstörungen der Schilddrüse und/oder Hypeφlasien der Schilddrüse und/oder Schilddriisentumoren, ebenso wie bei der Herstellung und/oder der Entwicklung von Mitteln für die Diagnose derselben, können auch Bibliotheken kleiner Moleküle verwendet werden. Auch dabei wird das Zielmolekül mit einer Bibliothek in Kontakt gebracht und jene Mitglieder der Bibliothek, die daran binden, ermittelt, ggf. von den anderen Mitgliedern der Bibliothek bzw. vom Zielmolekül abgetrennt und optional weiter charakterisiert. Auch hier wird die Charakterisierung des kleinen Moleküls nach den Fachleuten auf diesem Gebiet bekannten Verfahrensweisen erfolgen, so z. B. die Verbindung identifiziert und die Molekularstruktur bestimmt werden. Die Bibliotheken umfassen dabei so wenig wie zwei und soviel wie bis zu mehrere hunderttausend Mitglieder.When using the translation product according to the invention, the nucleic acid coding therefor, the translation product interaction partner (s), in particular the natural interaction partner (s), and / or the nucleic acid (s) coding for them as the target molecule for the Production or development of a medicament for the treatment or therapy of functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors, as well as in the production and / or development of means for the diagnosis of the same, libraries of small molecules can also be used , Here, too, the target molecule is brought into contact with a library and those members of the library that bind to it are determined, if necessary separated from the other members of the library or from the target molecule and optionally further characterized. Again, the characterization of the small molecule will be done according to procedures known to those skilled in the art. B. identify the compound and determine the molecular structure. The libraries have as few as two and as many as several hundred thousand members.
Im Zusammenhang mit den verschiedenen hierin offenbarten Klassen von Verbindungen, die als therapeutisches Mittel oder diagnostisches Mittel erfindungsgemäß verwendet werden können, ist dabei ein Aspekt der, dass bestimmte Klassen direkt mit einem Translationsprodukt oder seinem Wechselwirkungspartner in Wechselwirkung treten bzw. an dieses binden. Es ist jedoch auch im Rahmen der vorliegenden Erfindung, dass die besagten Verbindungen der verschiedenen Klassen, insbesondere wenn es sich dabei um Peptide, Antiköφer, Anticaline, Aptamere,
Aptazyme und Spiegelmere handelt, den Wechselwirkungspartner des Translationsproduktes durch eine mehr oder weniger spezifische Wechselwirkung für das Translationsprodukt blockieren Insoweit ist der Begriff der Verwendung von einem Translationsprodukt hierin auch dahingehend zu verstehen, dass er die Verwendung eines oder mehrerer des/der Translationsprodukt- Wechselwirkungspartner(s), wie bspw. Rezeptoren und Transkriptions- und Translationsfaktoren, umfasst. Die hierin beschriebenen Verfahren sind dann insoweit zu modifizieren, als dass anstelle des Translationsprodukt-Proteins bzw. der für sie codierenden Nukleinsaure, ein Wechselwirkungspartner davon in den verschiedenen Selektionsverfahren, Assays, Screening- Verfahren oder Herstellungsverfahren eingesetzt wird. Wechselwirkungspartner von PKCG sind, unter anderem Phospholipide und Phosphatidylserin-Rest aufweisende Verbindungen, wobei bei letzterem die Bindung unabhängig ist von Phospholipiden, aber abhängig von Ca 2+ (Pawelcyk T, Kowara, R. Matecki, A; Mol. Cell Biocehm. 2000 Jim; 209(1-2): 69-77). Ein weiterer Bindungspartner von PKCG ist Phorboldibutyrat (PDBuVdiacylglycerol und Lipidbindungsdomänen (CaLB) (Quest AF, Bell, RM; J Biiol. Chem. 1994 Aug 5: 269 (31): 20000-12). Weiterhin weist PKCG eine Wechselwirkung und damit eine Form der Bindung mit PH-Domänen von Tee Fam- lien-Protein-Throsinkinasen Btk und Emt (ähnlich zu ltk und Tsk) auf; hierbei erfolgt eine Wechselwirkung mit PKC-Genen (Pawelczyk T, Matecki A, Dettlaff A; FEBS Lett 1998 Feb 13; 423 (1): 31-4. Wechselwirkungspartner von CAT-A bzw. CAT- AI sind, unter anderem, allgemein Aminosäuren und VirenIn connection with the various classes of compounds disclosed herein that can be used as therapeutic or diagnostic agents according to the invention, one aspect is that certain classes interact directly with or bind to a translation product or its interaction partner. However, it is also within the scope of the present invention that the said compounds of the different classes, in particular if they are peptides, antibodies, anticalins, aptamers, Aptazyme and Spiegelmere acts to block the interaction partner of the translation product by means of a more or less specific interaction for the translation product. In this respect, the term use of a translation product is also to be understood to mean the use of one or more of the translation product interaction partners (see ), such as. Receptors and transcription and translation factors. The methods described herein are then to be modified to the extent that instead of the translation product protein or the nucleic acid coding for it, an interaction partner thereof is used in the various selection methods, assays, screening methods or production methods. Interaction partners of PKCG are, inter alia, compounds containing phospholipids and phosphatidylserine residues, the binding of the latter being independent of phospholipids, but dependent on Ca 2+ (Pawelcyk T, Kowara, R. Matecki, A; Mol. Cell Biocehm. 2000 Jim ; 209 (1-2): 69-77). Another binding partner of PKCG is phorbol dibutyrate (PDBuVdiacylglycerol and lipid binding domains (CaLB) (Quest AF, Bell, RM; J Biiol. Chem. 1994 Aug 5: 269 (31): 20000-12). PKCG also shows an interaction and thus a form binding to the PH domains of tea family protein throsine kinases Btk and Emt (similar to ltk and Tsk); this involves an interaction with PKC genes (Pawelczyk T, Matecki A, Dettlaff A; FEBS Lett 1998 Feb 13 ; 423 (1): 31-4. Interaction partners of CAT-A and CAT-AI are, among others, generally amino acids and viruses
Im Rahmen der vorliegenden Erfindung werden unter Wechselwirkungspartnern von einem Translationsprodukt, insbesondere von einem erfindungsgemäßen Translationsprodukt, insbesondere natürlichen Wechselwirkungspartnern, solche Moleküle und Strukturen bezeichnet, mit denen das besagte Translationsprodukt in Wechselwirkung tritt. Dabei sind insbesondere jene Moleküle und Strukturen umfasst, mit denen das Protein in einem biologischen System unter normalen und/oder auch unter pathologischen Bedingungen in Wechselwirkung tritt.In the context of the present invention, interaction partners of a translation product, in particular of a translation product according to the invention, in particular natural interaction partners, refer to those molecules and structures with which said translation product interacts. In particular, those molecules and structures with which the protein interacts in a biological system under normal and / or under pathological conditions are included.
Hinsichtlich der Gestaltung des Kits zur Diagnose und/oder Therapie von Funktionsstörungen, Hypeφlasie und Tumoren der Schilddrüse ist anzumerken, dass die genaue Gestaltung eines derartigen Kits, d. h. welche Komponente(n) explizit darin aufgenommen wird bzw. werden, dem Fachmann auf diesem Gebiet bekannt, und insbesondere möglich sind im Lichte der oben gemachten Ausführungen hinsichtlich der Wirkung bzw. Verwendbarkeit der hierin offenbarten erfindungsgemäßen Nukleinsäuresequenzen und deren Translationsprodukt. Der erfindungsge-
mäße Kit wird in jedem Fall mindestens eines der erfindungsgemäßen Elemente umfassen, das aus der Gruppe ausgewählt ist, die die erfmdungsgemäße(n) Nukleinsäure(n), den Vektor, das Polypeptid, die Zelle, den Antiköφer, das Ribozym sowie die verschiedenen Verbindungen der verschiedenen Klassen, wie sie hierin charakterisiert wurden, insbesondere die Antiköφer, Peptide, Proteine, Anticaline, kleine Moleküle, Aptamere, Spiegelmere, Ribozyme, Aptazyme, Antisense-Oligonukleotide sowie RNAi, spezifisch für die erfmdungsgemäßen Nukleinsäuren oder erfindungsgemäßen Translationsprodukte sowie die Wechselwirkungspartner davon, insbesondere die natürlichen Wechselwirkungspartner, sowie der jeweils dafür codierenden Nukleinsäuren, jeweils bevorzugterweise in ihrer erfindungsgemäßen Ausprägung, umfasst. Weitere Elemente des erfindungsgemäßen Kits sind aus der Gruppe ausgewählt, die Puffer, Negativ-Kontrollen, Positiv-Kontrollen und Benutzungsanweisungen umfasst. Typischer Weise sind die einzelnen Verbindungen bzw. Bestandteile in trockener oder flüssiger Form, bevorzugterweise für den einzelnen Anwendungsfall portioniert, in dem Kit enthalten. Der Kit kann dabei bevorzugterweise verwendet werden zur Bestimmung von Funktionsstörungen der Schilddrüse und/oder Hypeφlasien der Schilddrüse und/oder Schilddriisentumoren. Hinsichtlich der Verwendung der erfindungsgemäßen Zellen ist insbesondere deren Verwendung als Reimplantat bzw. als Positiv- und/oder Negativkontrolle in entsprechenden diagnostischen bzw. therapeutischen Ansätzen möglich.With regard to the design of the kit for diagnosis and / or therapy of functional disorders, hypothyroidism and tumors of the thyroid gland, it should be noted that the exact design of such a kit, ie which component (s) is or are explicitly included therein, is known to the person skilled in the art in this field , and in particular are possible in the light of the statements made above with regard to the effect or usability of the nucleic acid sequences according to the invention disclosed herein and their translation product. The invention In any case, the modern kit will comprise at least one of the elements according to the invention, which is selected from the group comprising the nucleic acid (s) according to the invention, the vector, the polypeptide, the cell, the antibody, the ribozyme and the various compounds of the various classes as characterized here, in particular the antibodies, peptides, proteins, anticalins, small molecules, aptamers, Spiegelmers, ribozymes, aptazymes, antisense oligonucleotides and RNAi, specifically for the nucleic acids or translation products according to the invention and the interaction partners thereof, in particular the natural interaction partners and the nucleic acids coding therefor, each preferably in its form according to the invention. Further elements of the kit according to the invention are selected from the group comprising buffers, negative controls, positive controls and instructions for use. The individual compounds or constituents are typically contained in the kit in dry or liquid form, preferably portioned for the individual application. The kit can preferably be used to determine functional disorders of the thyroid gland and / or hypothyroidism of the thyroid gland and / or thyroid tumors. With regard to the use of the cells according to the invention, their use as a reimplant or as a positive and / or negative control in corresponding diagnostic or therapeutic approaches is possible in particular.
Bei dem erfindungsgemäßen Verfahren zum Nachweis von Funktionsstörungen und Hypeφlasien und/oder Tumoren der Schilddrüse, auch i. S. von Karzinomen und Strumen, ist es möglich, dass das Schilddrüsenmaterial in situ, ex vivo, in vivo oder in vitro vorliegt. Der Begriff „Schilddrüsenmaterial", wie hierin verwendet, bezeichnet insbesondere Material, bevorzugterweise zelluläres Material der Schilddrüse in deren normalem und/oder pathogenen Zustand. Der Begriff des Schilddrüsenmaterials umfasst damit auch Material von Schilddrüsen mit einer Funktionsstörung, von Hypeφlasien der Schilddrüse, von Tumoren der Schilddrüse, einschließlich Karzinomen und Strumen. Die Bestimmung, ob eine Funktionsstörung, Hypeφlasie und/oder Tumor vorliegt, erfolgt letzten Endes durch Vergleich der Wirkung des eingesetzten erfindungsgemäßen Agens bzw. Agenzien auf das zu untersuchende Schilddrüsenmaterial mit dessen/deren Wirkung auf „normales" Schilddrüsengewebe. Weitere Ausgestaltungsformen des erfindungsgemäßen Verfahrens ergeben sich für den Fachmann auf der Grundlage der hierin enthaltenen Offenbarung.
Die oben gemachten Ausführungen hinsichtlich der verschiedenen Ausführungsformen sowie den damit realisierbaren Vorteilen gelten sinngemäß auch für die erfindungsgemäßen Medikamente, und insbesondere für solche Mittel zur Diagnose und/oder Therapie von Funktionsstörungen, Hypeφlasien und/oder Tumoren der Schilddrüse in Form der erfindungsgemäßen Se- quenz(en), bzw. deren Verwendung, in Form des erfindungsgemäßen Vektors, bzw. dessen Verwendung, in Form des erfindungsgemäßen Polypeptids, bzw. dessen Verwendung, in Form der erfmdungsgemäßen Zelle, bzw. deren Verwendung, in Form des Ribozyms, bzw. dessen Verwendung, die hierin offenbart werden. Gleiches gilt auch für die erfindungsgemäß hergestellten bzw. selektierten Verbindungen aus der Gruppe, die bindende Peptide, Anticaline und funktionale Nukleinsäuren umfassen, wobei diesen Verbindungen gemeinsam ist, dass sie gegen die erfindungsgemäßen Nukleinsäuresequenzen oder den davon codierten Polypeptiden oder deren Wechselwirkungspartner(n) oder den dafür codierenden Nukleinsäuren gerichtet sind, d. h. gegen diese als Zielmolekül hergestellt oder selektiert werden. Die entsprechenden Medikamente können einen Gehalt an einem oder mehreren der vorgenannten Agenzien oder Verbindungen aufweisen.In the method according to the invention for the detection of functional disorders and hypoplastic and / or tumors of the thyroid gland, also i. S. of carcinomas and goitre, it is possible that the thyroid material is present in situ, ex vivo, in vivo or in vitro. The term "thyroid material", as used herein, refers in particular to material, preferably cellular material, of the thyroid gland in its normal and / or pathogenic state. The term thyroid material thus also includes material from thyroid glands with a functional disorder, from hypothyroidism of the thyroid gland, from tumors of the Thyroid gland, including carcinomas and goiter The determination of whether there is a functional disorder, hypothyroidism and / or tumor is ultimately made by comparing the effect of the agent or agents used according to the invention on the thyroid material to be examined with its effect on "normal" thyroid tissue , Further embodiments of the method according to the invention result for the person skilled in the art on the basis of the disclosure contained herein. The statements made above with regard to the various embodiments and the advantages which can thus be achieved also apply mutatis mutandis to the medicaments according to the invention, and in particular to such agents for the diagnosis and / or therapy of functional disorders, hypothyroidism and / or thyroid tumors in the form of the sequence according to the invention ( en), or its use, in the form of the vector according to the invention, or its use, in the form of the polypeptide according to the invention, or its use, in the form of the cell according to the invention, or its use, in the form of the ribozyme, or its use which are disclosed herein. The same also applies to the compounds prepared or selected according to the invention from the group comprising binding peptides, anticalins and functional nucleic acids, what these compounds have in common is that they act against the nucleic acid sequences according to the invention or the polypeptides encoded thereby or their interaction partner (s) or the nucleic acids coding therefor are directed, ie are produced or selected against them as the target molecule. The corresponding medicaments can contain one or more of the aforementioned agents or compounds.
Gleiches gilt auch für die erfindungsgemäßen pharmazeutischen Zusammensetzungen. Dabei ist es möglich, dass eine pharmazeutische Zusammensetzung neben dem pharmazeutisch akzeptablen Träger nur eine der aufgeführten Verbindungen umfasst. Alternativ ist es auch im Rahmen der Erfindung, dass die pharmazeutische Zusammensetzung mehrere der genannten Verbindungen neben dem pharmazeutisch akzeptablen Träger aufweist.The same also applies to the pharmaceutical compositions according to the invention. It is possible for a pharmaceutical composition to comprise only one of the listed compounds in addition to the pharmaceutically acceptable carrier. Alternatively, it is also within the scope of the invention that the pharmaceutical composition has several of the compounds mentioned in addition to the pharmaceutically acceptable carrier.
LTnter pharmazeutisch akzeptablem Träger sollen hierin alle dem Fachmann bekannten Träger verstanden werden, die typischerweise in Abhängigkeit von der Applikationsform ausgewählt werden. Ein pharmazeutisch akzeptabler Träger kann, unter anderem, Wasser, Pufferlösungen, alkoholische Lösungen und dergleichen sein.The term pharmaceutically acceptable carrier should be understood here to mean all carriers known to the person skilled in the art, which are typically selected depending on the form of administration. A pharmaceutically acceptable carrier can include water, buffer solutions, alcoholic solutions, and the like.
Hinsichtlich des erfindungsgemäßen Verfahrens zur Herstellung von Primern, sei darauf hingewiesen, dass es sich dabei um solche handelt, die eine spezifische Darstellung der erfindungsgemäßen Nukleinsäuresequenzen, bzw. Teilen davon, erlauben.With regard to the method according to the invention for the production of primers, it should be pointed out that these are those which allow a specific representation of the nucleic acid sequences according to the invention, or parts thereof.
Bei dem erfindungsgemäßen Verfahren zur Darstellung einer erfindungsgemäßen Nukleinsauresequenz können, aus welcher Quelle auch immer, die erfindungsgemäßen Nukleinsäuresequen-
zen bzw. diesen entsprechende Sequenzen unter Verwendung von erfindungsgemäßen Primern als Primer für eine Polymerasekettenreaktion, in all ihren verschiedenen Ausführungen, verwendet werden. Das Design geeigneter Primer sowie die Durchführung von Polymerase- Kettenreaktionen ist in PCR & PCR 2: A practical approach (M. J. McPherson, P. Quirke und G. R. Taylor, Eds., IRL Press, Oxford, England 1991, & M. J. McPherson und B. D. Harnes, Eds., IRL Press, Oxford, England 1995) offenbart und wird hierin mit einbezogen.In the method according to the invention for representing a nucleic acid sequence according to the invention, from whatever source, the nucleic acid sequences according to the invention zen or sequences corresponding to these, using primers according to the invention as primers for a polymerase chain reaction, in all of their various designs, can be used. The design of suitable primers and the implementation of polymerase chain reactions is in PCR & PCR 2: A practical approach (MJ McPherson, P. Quirke and GR Taylor, Eds., IRL Press, Oxford, England 1991, & MJ McPherson and BD Harnes, Eds., IRL Press, Oxford, England 1995) and is incorporated herein.
Die erfindungsgemäßen Nukleinsäuren, einschließlich erfindungsgemäßen Nukleinsäuresequenzen, sind zum einen das hierin offenbarte Homologe zu den humanen CAT-Genen, das hierin auch als CAT bzw. als CAT-A oder CAT-Al in speziellen Ausprägungsformen des erfindungsgemäßen CAT-Homologes bezeichnet wird, Homologe zu dem menschlichen DC2-Gen und des PKCgamma-Gens, dessen N-Terminus bekannt ist.The nucleic acids according to the invention, including the nucleic acid sequences according to the invention, are, on the one hand, the homologue to the human CAT genes disclosed herein, which is also referred to herein as CAT or as CAT-A or CAT-Al in special forms of the CAT homologue according to the invention the human DC2 gene and the PKCgamma gene, the N-terminus of which is known.
Erfmdungsgemäße Nukleinsäuren bzw. Nukleinsäuresequenzen sind insbesondere auch die nachfolgend angeführten Nukleinsäuren, die die mit „SEQ. ED. No." hierin bezeichneten Nukleinsäuresequenzen umfassen, solche Nukleinsäuren bzw. Nukleinsäuresequenzen, die die nachfolgend mit „SEQ. ED. No." bezeichneten Nukleinsäuresequenzen teilweise oder vollständig umfassen und weitergehende Nukleotide, insbesondere am 5 '- und/oder 3 '-Ende umfassen, solche Nukleinsäuren, die in Ergänzung zu den mit „SEQ. ID. No." hierin bezeichneten Sequenzen weitere Nukleotide enthalten, im Falle des erfindungsgemäßen CAT-A- bzw. CAT-Al -Sequenz bzw. -Gens ergänzt durch weitere Nukleotide aus BC 93504, im Falle des PKCG-Gens ergänzt durch weitere Nukleotide aus BC 277497 bzw. BC 829651 und im Falle von DC2, d. h. des erfindungsgemäßen DC2-Homologens, ergänzt durch weitere Nukleotide aus BC 280723 bzw. BC 93504. Die relative Anordnung der vorstehend genannten Klone ist in Fig. 1 1 dargestellt.Nucleic acids or nucleic acid sequences according to the invention are in particular also the nucleic acids listed below, which are labeled with “SEQ. ED. No. "Nucleic acid sequences referred to herein include those nucleic acids or nucleic acid sequences which are referred to below as" SEQ. ED. No. " partially or completely include designated nucleic acid sequences and include further nucleotides, in particular at the 5 'and / or 3' end, those nucleic acids which, in addition to the “SEQ. ID. No. "sequences referred to herein contain further nucleotides, in the case of the CAT-A or CAT-Al sequence or gene according to the invention supplemented by further nucleotides from BC 93504, in the case of the PKCG gene supplemented by further nucleotides from BC 277497 or BC 829651 and in the case of DC2, ie the DC2 homolog according to the invention, supplemented by further nucleotides from BC 280723 or BC 93504. The relative arrangement of the above-mentioned clones is shown in FIG. 11.
Weiterhin sind die erfindungsgemäßen Nukleinsäuren solche Nukleinsäuren, die für ein Polypeptid codieren, wobei das Polypeptid eine Sequenz aufweist bzw. umfasst, wie sie hierin mit einer oder mehreren der „SEQ. ID. No." bezeichnet werden. Schließlich sind erfindungsgemäße Nukleinsäuren auch jene, die ein oder mehrere Exons und/oder ein oder mehrere der Introns einer oder mehrerer der hierin offenbarten erfindungsgemäßen Nukleinsäuren umfassen.Furthermore, the nucleic acids according to the invention are those nucleic acids which code for a polypeptide, the polypeptide having or comprising a sequence as described herein with one or more of the “SEQ. ID. No. "Finally, nucleic acids according to the invention are also those which comprise one or more exons and / or one or more of the introns of one or more of the nucleic acids according to the invention disclosed herein.
Die erfindungsgemäßen Polypeptide, die hierin auch kurz als Polypeptide bezeichnet werden, sind insbesondere Translationsprodukte eines oder mehrer der erfindungsgemäßen Nukleinsäu-
ren. Dabei können die Translationsprodukte vollständig oder verkürzt vorliegen. Diese Translationsprodukte werden hierin entweder allgemein als Translationsprodukt, unabhängig von der Anzahl, oder als erfindungsgemäßes Translationsprodukt bezeichnet. Erfindungsgemäße Translationsprodukte oder Polypeptide im Sinne der vorliegenden Erfindung sind insbesondere jene Teile der entsprechenden Polypeptide, die Teil einer DomänenstiTiktur sind, insbesondere einer solchen Domäne, die in einem zellulären System extrazellulär vorhanden ist.The polypeptides according to the invention, which are also referred to herein briefly as polypeptides, are in particular translation products of one or more of the nucleic acids according to the invention. ren. The translation products can be complete or abbreviated. These translation products are referred to herein either generally as a translation product, regardless of the number, or as a translation product according to the invention. Translation products or polypeptides according to the invention in the sense of the present invention are in particular those parts of the corresponding polypeptides which are part of a domain structure, in particular of such a domain which is present extracellularly in a cellular system.
Die für die erfindungsgemäßen Nukleinsäuren, insbesondere für das erfindungsgemäße CAT- Homologe sowie DC2-Homologe, welche im Stand der Teclinik als solche nicht bekannt sind, sowie PKCgamma werden durch die folgenden Nukleinsäuresequenzen gekennzeichnet bzw. dargestellt: Die genomische Sequenz aus 19ql3.4, beginnend auf Cosmid 15841, fortlaufend über BAC 280723, endet mit dem letzten bp von BAC 829651. Die Sequenzen sind mit den Zugangsnummern (Accession numbers) AC01 1453 (BAC280723), AC008753 (BAC 829651) veröffentlicht. Die Länge dieser genomischen Sequenz beträgt 293395 Basenpaare. Die für den C- Terminus für PKCgamma codierende Nukleinsauresequenz kann dabei wie folgt gekennzeichnet bzw. dargestellt werden: Die genomische Sequenz entstammt 19ql3.4 und wird beschrieben in der unter der Zugangsnummer AC00S440 hinterlegten Sequenz. Diese liegt unterhalb bzw. überlappend von BAC 829651. Die Länge der Nukleinsaure beträgt 243085 Basenpaare. Die für den C-Terminus von PKCgamma codierende Nukleinsauresequenz kann weiterhin durch die folgenden Sequenzen charakterisiert werden: Die genomische Sequenz entstammt aus 19ql3.4 und ist mit der Zugangsnummer AC022318 hinterlegt und liegt unterhalb bzw. überlappend von der Sequenz in BAC 829651. Die Gesamtlänge der Sequenz beträgt 191422 Basenpaare.Those for the nucleic acids according to the invention, in particular for the CAT homologue according to the invention and DC2 homologs, which are not known as such in the prior art, as well as PKCgamma are identified or represented by the following nucleic acid sequences: The genomic sequence starting from 19ql3.4 on Cosmid 15841, continuous via BAC 280723, ends with the last bp of BAC 829651. The sequences are published with the accession numbers AC01 1453 (BAC280723), AC008753 (BAC 829651). The length of this genomic sequence is 293395 base pairs. The nucleic acid sequence coding for the C-terminus for PKCgamma can be identified or represented as follows: The genomic sequence comes from 19ql3.4 and is described in the sequence stored under the access number AC00S440. This is below or overlapping BAC 829651. The length of the nucleic acid is 243085 base pairs. The nucleic acid sequence coding for the C-terminus of PKCgamma can furthermore be characterized by the following sequences: The genomic sequence comes from 19ql3.4 and is deposited with the accession number AC022318 and is below or overlapping from the sequence in BAC 829651. The total length of the Sequence is 191422 base pairs.
Die hierin offenbarten Sequenzen umfassen insbesondere humane Sequenzen, wobei :The sequences disclosed herein particularly include human sequences, where:
SEQ. ED. No. 1 einem EST (Acc No. BE 564764) des CAT-A bzw. CAT-Al, SEQ. ED. No. 2 einem EST (Acc. No. BF 029168) des CAT-A bzw. CAT-Al, SEQ. ED. No. 3 einem EST (Acc. No. AF201937) des humanen DC2-Gens, SEQ. ED. No. 4 einem EST (Acc. No. BE 271492) des humanen DC2-Gens, SEQ. ED. No. 5 einem EST (Acc. No. AF 345987) des humanen PKCG-Gens, SEQ. ED. No. 6 einem EST (Acc. No. X 625337) des humanen PKCG-Gens entspricht, und SEQ. ED. No. 7: cDNA-Sequenz des CAT-homologen Gens auf 19ql3.4, Länge 647 bp,
SEQ. ED. No. 8: cDNA-Sequenz des DC2-homo logen Gens auf 19ql3.4 (erfindungsgemäße Sequenz), Länge 749 bp; undSEQ. ED. No. 1 an EST (Acc No. BE 564764) of CAT-A or CAT-Al, SEQ. ED. No. 2 an EST (Acc. No. BF 029168) of CAT-A or CAT-Al, SEQ. ED. No. 3 an EST (Acc. No. AF201937) of the human DC2 gene, SEQ. ED. No. 4 an EST (Acc. No. BE 271492) of the human DC2 gene, SEQ. ED. No. 5 an EST (Acc. No. AF 345987) of the human PKCG gene, SEQ. ED. No. 6 corresponds to an EST (Acc. No. X 625337) of the human PKCG gene, and SEQ. ED. No. 7: cDNA sequence of the CAT homologous gene on 19ql3.4, length 647 bp, SEQ. ED. No. 8: cDNA sequence of the DC2-homologous gene on 19ql3.4 (sequence according to the invention), length 749 bp; and
SEQ. ED. No. 9: cDNA-Sequenz des PKCgamma-homologen Gens auf 19ql3.4,Länge 3457 bp, fast 100%ige Homologie soweit vergleichbar, zusammengesetzt aus Acc. No. X625337 und AF345987, undSEQ. ED. No. 9: cDNA sequence of the PKCgamma-homologous gene on 19ql3.4, length 3457 bp, almost 100% homology as far as comparable, composed of Acc. No. X625337 and AF345987, and
SEQ. ED. No. 10: die cDNA des hierin als CAT-A offenbarten, CAT-homologen Gens, SEQ. ED. No. 11 : die cDNA-Sequenz einer Splice- Variante von CAT-A, hierin als CAT-Al bezeichnet,SEQ. ED. No. 10: the cDNA of the CAT homologous gene disclosed herein as CAT-A, SEQ. ED. No. 11: the cDNA sequence of a splice variant of CAT-A, referred to herein as CAT-Al,
SEQ. ED. No. 12 die genomische Sequenz von CAT-A bzw. CAT-Al; SEQ. ED. No. 13 die Aminosäuresequenz von CAT-A Leserahmen (ORFstartl), SEQ. ED. No. 14 die Aminosäuresequenz von CAT-A Leserahmen (ORFstart2), SEQ. ID. No. 15 die Aminosäuresequenz von CAT-A Leserahmen (ORF3), SEQ. ID. No. 16 die genomische Sequenz des erfindungsgemäßen DC2-Gens bezeichnet, welches homolog ist zu dem im Stand der Technik bekannten DC2-Gen, mithin eine weitere Form der Familie der DC2-Gene darstellt;SEQ. ED. No. 12 the genomic sequence of CAT-A or CAT-Al; SEQ. ED. No. 13 the amino acid sequence of CAT-A reading frame (ORFstartl), SEQ. ED. No. 14 the amino acid sequence of CAT-A reading frame (ORFstart2), SEQ. ID. No. 15 the amino acid sequence of CAT-A reading frame (ORF3), SEQ. ID. No. 16 denotes the genomic sequence of the DC2 gene according to the invention, which is homologous to the DC2 gene known in the prior art, and consequently represents a further form of the family of the DC2 genes;
SEQ. ID. No. 17: die cDNA-Sequenz des DC2-homologen Gens bzw. der Sequenz gemäß SEQ. ID. No. 16;SEQ. ID. No. 17: the cDNA sequence of the DC2-homologous gene or the sequence according to SEQ. ID. No. 16;
SEQ. ID. No. 18: die genomische Sequenz von PKCG; und SEQ. ID. No. 19: die cDNA von PKCG, mithin von SEQ. ID. No. 18 ist.SEQ. ID. No. 18: the genomic sequence of PKCG; and SEQ. ID. No. 19: the cDNA from PKCG, hence from SEQ. ID. No. 18 is.
Es ist im Rahmen der vorliegenden Erfindung, dass jegliche hierin für eine oder mehrere der erfindungsgemäßen Polypeptide bzw. der davon, wie hierin offenbart, abgeleiteten Verbindungen, wie kleine Moleküle, bindende Peptide, Antiköφer, Anticaline und funktionale Nukleinsäuren, offenbarte Verwendung grundsätzlich auch für die jeweils anderen vorstehend genannten Moleküle oder Verbindungen hiermit offenbart ist.It is within the scope of the present invention that any use disclosed herein for one or more of the polypeptides according to the invention or the compounds derived therefrom, such as small molecules, binding peptides, antibodies, anticalins and functional nucleic acids, is in principle also for the use disclosed in each case other molecules or compounds mentioned above is hereby disclosed.
Die Erfindung wird im folgenden anhand der Figuren und Beispiele sowie dem Sequenzprotokoll erläutert, woraus sich weitere Merkmale, Ausführungsformen und Vorteile der Erfindung ergeben. Dabei zeigt:The invention is explained below with reference to the figures and examples and the sequence listing, from which further features, embodiments and advantages of the invention result. It shows:
Fig. 1 eine Metaphase der Zellinie S 141.2 mit t(2;19)(pl2;ql3) nach G-banding, wobei die Chromosomen 19, der(19) und der(2) mit einem Pfeil markiert ist (a); Fig. l(b) die selbe Me-
taphase nach FISH mit dem B AC-Klon 280723 (die Hybrisierungssignale sind auf den Chromosomen 19 der(19) und der(2) lokalisiert);1 shows a metaphase of the cell line S 141.2 with t (2; 19) (pl2; ql3) after G-banding, the chromosomes 19, (19) and (2) being marked with an arrow (a); Fig. L (b) the same measurement tapish after FISH with the B AC clone 280723 (the hybridization signals are located on the chromosomes 19 of (19) and (2));
Fig. 2 eine schematische Darstellung der Bruchpunkt-Cluster-Region in benignen SchilddiTisentumoren mit 19q 13- Abberationen. Die FISH-Mapping - Daten der in der Studie getesteten sechs Tumoren zeigen, dass die Bruchpunkte der benignen Schilddrüsentumoren mit 19ql3-Translokationen in der Region etwa 150 kbp 3 'zu RITA kartieren. Die Cosmid-, BAC- und PAC-Klone stimmen überein mit der physikalischen Karte des Chromosoms 19 des Lawrence Livermore National Laboratory. Die eingekreisten Zahlen verweisen auf die neu etablierte STS-Marker RSTS1-RSTS 10 (zum Vergleich siehe Tab. 2);2 shows a schematic representation of the breakpoint cluster region in benign shield diabetes tumors with 19q 13 aberrations. The FISH mapping data of the six tumors tested in the study show that the breakpoints of the benign thyroid tumors with 19ql3 translocations in the region map about 150 kbp 3 'to RITA. The cosmid, BAC, and PAC clones match the physical map of chromosome 19 from the Lawrence Livermore National Laboratory. The circled numbers refer to the newly established STS markers RSTS1-RSTS 10 (for comparison see Tab. 2);
Fig. 3 die Ergebnisse einer Northern-Blot-Hybridisierung an RNA, die aus Schilddrüse- nadenom-Zellinie S121/SV40 und Fibroblasten isoliert wurde, unter Verwendung einer 1092 bp cDNA-Sonde von Exon 1 bis Exon 5. Die 5.5 kb - und 6.2 kb-Transkripts wurden in den Fibroblasten und der AdenomZellinie gefunden; und3 shows the results of a Northern blot hybridization to RNA isolated from thyroid adenoma cell line S121 / SV40 and fibroblasts, using a 1092 bp cDNA probe from exon 1 to exon 5. The 5.5 kb and 6.2 kb transcripts were found in the fibroblasts and the adenoma cell line; and
Fig. 4 die genomische Lage des CAT-A-Gens;4 shows the genomic location of the CAT-A gene;
Fig. 5 die genomische Organisation von CAT-A;Figure 5 shows the genomic organization of CAT-A;
Fig. 6 eine Organsiationsskizze der mRNA von CAT-A;6 shows an organizational sketch of the mRNA of CAT-A;
Fig. 7 die verschiedenen offenen Leserahmen, so wie hierin als ORFstartl, ORFstart2 und ORF3 bezeichneten offenen Leserahmen mit möglichen Aminosäureabfolgen;Fig. 7 shows the various open reading frames, such as open reading frames referred to herein as ORFstart1, ORFstart2 and ORF3, with possible amino acid sequences;
Fig. 8 die Lage des PKCG-Gens;8 shows the location of the PKCG gene;
Fig. 9 einen Northern Blot zum Nachweis von PKCG an Schilddrüsenkarzinom-Zellen und Schilddrüsen-Normalgewebe;9 shows a Northern blot for the detection of PKCG on thyroid carcinoma cells and normal thyroid tissue;
Fig. 10 das Ergebnis einer semiquantitativen RT-PCR des PKCG-Gens;
Fig. 1 1 eine Darstellung der verschiedenen, hierin erstmalig beschriebenen Gene oder Genteilsequenzen betreffend CAT-A bzw. CAT-Al, das DC-2-Homologe und Proteinkinase Cgamma;10 shows the result of a semi-quantitative RT-PCR of the PKCG gene; 11 shows a representation of the various genes or partial gene sequences described here for the first time relating to CAT-A or CAT-Al, the DC-2 homologue and protein kinase Cgamma;
Fig. 12 das Ergebnis einer Transmembran-Domänanalyse mittels des Programmes DAS des Genproduktes von ORFstartl;12 shows the result of a transmembrane domain analysis using the DAS program of the gene product from ORFstartl;
Fig. 13 das Ergebnis einer Transmembran-Domänanalyse mittels des Programmes DAS des Genproduktes von ORFstart2;13 shows the result of a transmembrane domain analysis using the DAS program of the gene product from ORFstart2;
Fig. 14 das Ergebnis einer Transmembran-Domänanalyse mittels des Programmes DAS des Genproduktes von ORF3;14 shows the result of a transmembrane domain analysis using the DAS program of the gene product of ORF3;
Fig. 15 die cDNA von CAT-A;Figure 15 shows the CAT-A cDNA;
Fig. 16 die Protein- oder Aminosäuresequenz von ORFstartl von CAT-A-cDNA;Figure 16 shows the protein or amino acid sequence of ORFstart1 from CAT-A cDNA;
Fig. 17 die Protein- oder Aminosäuresequenz von ORFstart2 von C AT-A-cDNA;Figure 17 shows the protein or amino acid sequence of ORFstart2 from C AT-A cDNA;
Fig. 18 die Protein- oder Aminosäuresequenz von ORF3 von CAT-A-cDNA;Figure 18 shows the protein or amino acid sequence of ORF3 from CAT-A cDNA;
Fig. 19 die cDNA von CAT-Al;Figure 19 shows the CAT-Al cDNA;
Fig. 20 die genomische Organisation bzw. Sequenz von CAT-A bzw. CAT-Al mit weitergehenden Sequenzinformationen;20 shows the genomic organization or sequence of CAT-A or CAT-Al with further sequence information;
Fig. 21 die cDNA von CAT-A mit weitergehenden Sequenzinformationen;21 shows the cDNA of CAT-A with further sequence information;
Fig. 22 die genomische Sequenz des erfindungsgemäßen DC2-homologen Gens;22 shows the genomic sequence of the DC2-homologous gene according to the invention;
Fig. 23 die genomische Sequenz des erfindungsgemäßen DC2-homologen Gens mit weitergehender Sequenzinformation;
Fig. 24 die cDNA des DC2-homologen Gens mit weitergehenden Sequenzinformationen;23 shows the genomic sequence of the DC2-homologous gene according to the invention with further sequence information; 24 shows the cDNA of the DC2-homologous gene with further sequence information;
Fig. 25 die cDNA von PKCG mit weitergehenden Sequenzinformationen; und25 shows the cDNA of PKCG with further sequence information; and
Fig. 26 die genomische Sequenz von PKCG mit weitergehenden Sequenzinformationen.26 shows the genomic sequence of PKCG with further sequence information.
Beispiel 1 : Cytogenetische Analyse von Schilddrüsenhyperplasien und SchilddrüsenadenomenExample 1: Cytogenetic analysis of thyroid hyperplasia and thyroid adenoma
Schilddrüsenhypeφlasien und Adenome gehören zu den häufigen Veränderungen des Schilddrüsenepithels. Dabei kann man zwischen Läsionen mit klonalen Chromosomenveränderungen und solchen mit anscheinend normalem Karyotyp unterscheiden. Die zytogenetischen Veränderungen stehen mit sehr hoher Wahrscheinlichkeit mit der Tumorgenese in Zusammenhang. Bei unseren Untersuchungen konnten wir in etwa 20% der Fälle klonale Aberrationen feststellen. Veränderungen in der chromosomalen Bande 19ql3 stellen dabei die häufigste strukturelle Aberration dar. Die Bedeutung der Translokation für die Entstehung und Progression der Schilddriisentumoren ist bisher nicht bekannt. Wir konnten durch molekulargenetische Untersuchungen zeigen, dass die Bruchpunkte bei Translokationen des Chromosoms 19 in der Bande ql3 in einem genomischen Bereich von 150 kbp klustern.Thyroid hyplasias and adenomas are common changes in the thyroid epithelium. One can differentiate between lesions with clonal chromosomal changes and those with apparently normal karyotypes. The cytogenetic changes are very likely related to tumorigenesis. In our studies, we found clonal aberrations in about 20% of the cases. Changes in the chromosomal band 19ql3 represent the most common structural aberration. The importance of translocation for the development and progression of thyroid tumors is not yet known. We were able to show through molecular genetic studies that the breakpoints in translocations of chromosome 19 in band ql3 cluster in a genomic range of 150 kbp.
Zellkultur und Chromosomenanalyse erfolgten nach der schon für pleomoφhe Adenome der Ohrspeicheldrüse beschriebenen Methode (Bullerdiek et al., 1987). Die Beschreibung der Karyo- typen erfolgte nach der ISCN von 1995. Die Zellinien wurden durch Transformation mit einem Konstrukt, das die SV40 "early region" enthält, erhalten (Beige et al., 1992). Zwei neue Zellinien wurden aus den Primärtumoren S172 und S290.1 hergestellt. Diese Zellinien und vier Primärtumoren wurden in FISH-Studien eingesetzt.. Die Karyotyp-Beschreibungen sind in Tabelle 1 zu- sammengefasst. Für die Lokalisation des Bruchpunkts wurde der PAC-Klon 13174 (Genome Systems, USA), die Cosmid-Klone 15841 und 29573, und die BAC-Klone 41372, 28072 und 829651, die nach der Lawrence Livermore National Laboratory (LLNL) Nomenklatur beschrieben sind (Ashworth et al, 1995). Die Cosmid-Klone wurden aus der humanen Chromosom-19- spezifischen "flow-sorted" Cosmid-Library des LLNL erhalten (deJong et al., 1998; Trask et al., 1992; Ashworth et al, 1995) verwendet. Die BAC-Klone stammen aus der humanen Library
CIT-HSPC und wurden durch das LLNL isoliert. Cosmid- und BAC-Fragmente wurden mit E- coRI verdaut, in 0.8%igen Agarose-Gelen aufgetrennt, aus dem Gel ausgeschnitten, mit Hilfe der Glaskugel-Technik (QIAExII, QIAGEN, Hilden, Deutschland) aus dem Gelstück isoliert und in den pGEMl lzf(+)- Vektor kloniert (Promega, Mannheim, Deutschland). Plasmid-, Cosmid-, PAC- und BAC-DNA wurde mit Hilfe einer Standard-Methode für alkalische Lyse isoliert und über Anionen-Austauscher-Säulen aufgereinigt (QIAGEN, Hilden, Deutschland). DNA-Verdau erfolgte nach Standard-Verfahrensweisen unter Berücksichtigung von Herstellerangaben. Die Sequenzierung erfolgte auf einem 373 DNA Sequenzierer (Applied Biosystems, Weiterstadt, Deutschland) unter Benutzung von Vektor-spezifischen und Insert-spezifischen Primern. Für die positionelle Lokalisiemng der STSse, Cosmide, PACs und BACs wurde deren DNA mit den Restriktionsenzymen EcoRI, BamHI bzw. Hindlll verdaut, in 0.8%igen Agarose-Gelen aufgetrennt und auf Nylonmembranen des Typs Hybond N+ (Amersham Pham acia, Freiburg, Deutschland) transferiert. Als Sonden dienten PCR-amplifizierte, mit DIG-dUTP (Röche; Mannheim, Deutschland) markierte STS- bzw. Plasmid-DNAs. Die Markierung erfolgte über zufällige (random-primed) Inkoφoration des DIG-dUTPS in die DNA. Für sowohl die Prähybridisierung als auch für die Hybridisierung wurde die ExpressHyb Hybridisierungslösung (Clontech Laboratories, Palo Alto, USA) benutzt. Die Visualisierung der Sonden erfolgte über Chemilumineszenz (Röche, Mannheim, Deutschland). Die Polymerasekettenreaktion (PCR) wurde mit den Temperaturen und Primern, wie sie in Tabelle 2 aufgeführt sind, durchgeführt. PCR-Analysen erfolgten nach Standard-Verfahrensweisen. Etwa 60 ng Template-DNA wurden in einem Volumen von 50 μl mit 400 ng jedes Primers, 300 μM dNTPs, lxPCR-Puffer (enthält 1.5 mM MgC12) und 2.5U AmpliTaq (Perkin Eimer Applied Biosystems, Weiterstadt, Deutschland) amplifiziert. Die PCR- Produkte wurden auf 1.5%igen Agarose-Gelen aufgetrennt, aus dem Gel geschnitten, mit Hilfe der Glaskugel-Technik (QIAExII, QIAGEN, Hilden, Deutschland) aus dem Gel isoliert und in den pCR2.1-Vektor (Invitrogen, San Diego, CA) kloniert. Fluoreszenz-in-situ-Hybridisierungs (FISH)-Analysen erfolgten nach einer GTG-Bänderung der gleichen Metaphasen. Die Behandlung der Metaphasen mit anschließenden FISH-Studien erfolgte nach dem Protokoll von Kievits et al. (1990). Für die Sondenherstellung wurde Cosmid-, PAC- und BAC-DNA über die Methode der Nick-Translation mit biotin-14-dATP (Gibco BRL, Life Technologies GmbH, Eggenstein, Deutschland) markiert. Pro Cosmid-, PAC- bzw. BAC-Sonde wurden 20 Metaphasen, mit Ausnahme des Falls S532.1, bei dem nur 2 Metaphasen ausgewertet werden konnten, untersucht. Die Chromosomen wurden mit Propidium Iodid gegengefärbt, auf einem Zeiss Axiophot Fluoreszenz Mikroskop mit Hilfe eines FITC-Filters (Zeiss Oberkochem, Deutschland) analysiert und mit
dem Power Gene Karyotyping System (PSI, Hailadale, U.K.) aufgenommen. Die FISH-Studien wurden an vier Primärtumoren der Schilddrüse (S476.1, S141.2, S172, S532.1) und an zwei Zellinien aus Schilddrüsenneoplasien durchgeführt. Die Zellinien wie die Primärtumoren weisen eine Veränderung in der chromosomalen Bande 19ql3 auf. Die Ergebnisse dieser Analysen zeigten, dass in allen Primärtumoren die Bruchpunkte in einer Region lokalisiert sind, die von dem BAC-Klon 280723 überspannt wird. Mit diesem BAC-Klon wurden Signale sowohl auf dem normalen Chromosom 19 als auch auf den beiden derivativen Chromosomen erhalten. Bei weiterführenden FISH-Untersuchungen wurden mit den Cosmiden 15841 und 29573, PAC 13174 und BAC 41372 Signale proximal zu den Bruchpunkten erhalten, wohingegen der BAC 829651 distal zu den Bruchpunkten Signale zeigte. Die Zellinie aus dem Primärtumor S172, d.h. Zellinie S172/SV40, wies nach einer Hybridisierung mit dem BAC-Klon 280723 ebenfalls Signale auf dem normalen Chromosom 19 sowie auf beiden derivativen Chromosomen auf. Die Zellinie S290.1/SV40 zeigte bei Hybridisierung mit dem PAC-Klon 13174 Signale auf den derivativen Chromosomen und auf dem normalen Chromosom 19. Dies bedeutet, dass der Bruchpunkt in Chromosom 19 bei allen untersuchten Tumoren in einem Segment von etwa 150 kbp, entsprechend der Sequenz zwischen dem Cosmid 15841 und dem BAC-Klon 829651, lokalisiert ist. Zur weiteren Charakterisierung der Region wurden die BAC-Klone 93504, 41372, 280723 und 829651 (LLNL), der PAC-Klon 13174 (Genome Systems, USA) und die Cosmid-Klone 30316, 15841, 29573 und 20019 (LLNL) mit Hilfe der Restriktionskartierung und Hinzunahme von Se- quenzierungsdaten in einem Contig zusammengefügt. Aus diesen Sequenzdaten wurden zehn neue STSs hergestellt, die entweder durch Sequenzierung der Ensert-Enden bei Plasmiden oder Cosmiden bzw. durch internes Sequenzieren bei BAC-, PAC- und Cosmid-Klonen erhalten wurden. Oligonukleotid-Sequenzen für diese PCR-Ansätze sowie die Produktgrößen der PCR- Amplifikate sind in Tabelle 2 aufgelistet. Der Contig umfaßt 470 kbp in der Länge, drei der STSs liegen innerhalb der Bruchpunktregion, eins liegt unterhalb und sechs STSs sind proximal zum Bruchpunkt lokalisiert.Cell culture and chromosome analysis were carried out using the method already described for pleomoid adenomas of the parotid gland (Bullerdiek et al., 1987). The karyotypes were described according to the ISCN of 1995. The cell lines were obtained by transformation with a construct which contains the SV40 "early region" (Beige et al., 1992). Two new cell lines were made from the primary tumors S172 and S290.1. These cell lines and four primary tumors were used in FISH studies. The karyotype descriptions are summarized in Table 1. PAC clone 13174 (Genome Systems, USA), cosmid clones 15841 and 29573, and BAC clones 41372, 28072 and 829651, which are described according to the Lawrence Livermore National Laboratory (LLNL) nomenclature, were used for the localization of the breakpoint (Ashworth et al, 1995). The cosmid clones obtained from the human chromosome 19 specific "flow-sorted" cosmid library of the LLNL (deJong et al., 1998; Trask et al., 1992; Ashworth et al, 1995) were used. The BAC clones come from the human library CIT-HSPC and were isolated by the LLNL. Cosmid and BAC fragments were digested with E-coRI, separated in 0.8% agarose gels, cut out of the gel, isolated from the gel piece using the glass ball technique (QIAExII, QIAGEN, Hilden, Germany) and placed in the pGEMl lzf (+) - vector cloned (Promega, Mannheim, Germany). Plasmid, cosmid, PAC and BAC DNA were isolated using a standard method for alkaline lysis and purified using anion exchange columns (QIAGEN, Hilden, Germany). DNA digestion was carried out according to standard procedures, taking into account manufacturer information. The sequencing was carried out on a 373 DNA sequencer (Applied Biosystems, Weiterstadt, Germany) using vector-specific and insert-specific primers. For the positional localization of the STSse, Cosmide, PACs and BACs, their DNA was digested with the restriction enzymes EcoRI, BamHI or Hindlll, separated in 0.8% agarose gels and on nylon membranes of the type Hybond N + (Amersham Pham acia, Freiburg, Germany) transferred. PCR-amplified STS or plasmid DNAs labeled with DIG-dUTP (Röche; Mannheim, Germany) served as probes. The labeling was carried out by randomly priming the DIG-dUTPS into the DNA. The ExpressHyb hybridization solution (Clontech Laboratories, Palo Alto, USA) was used for both the pre-hybridization and the hybridization. The probes were visualized using chemiluminescence (Röche, Mannheim, Germany). The polymerase chain reaction (PCR) was carried out with the temperatures and primers as listed in Table 2. PCR analyzes were carried out according to standard procedures. About 60 ng of template DNA were amplified in a volume of 50 μl with 400 ng of each primer, 300 μM dNTPs, 1 × PCR buffer (contains 1.5 mM MgC12) and 2.5U AmpliTaq (Perkin Elmer Applied Biosystems, Weiterstadt, Germany). The PCR products were separated on 1.5% agarose gels, cut from the gel, isolated from the gel using the glass ball technique (QIAExII, QIAGEN, Hilden, Germany) and into the pCR2.1 vector (Invitrogen, San Diego, CA) cloned. Fluorescence in situ hybridization (FISH) analyzes were performed after GTG banding of the same metaphases. The metaphases were treated with subsequent FISH studies according to the protocol of Kievits et al. (1990). For probe production, cosmid, PAC and BAC DNA were labeled using the nick translation method with biotin-14-dATP (Gibco BRL, Life Technologies GmbH, Eggenstein, Germany). 20 metaphases were examined per cosmid, PAC or BAC probe, with the exception of case S532.1, in which only 2 metaphases could be evaluated. The chromosomes were counter-stained with propidium iodide, analyzed on a Zeiss Axiophot fluorescence microscope using a FITC filter (Zeiss Oberkochem, Germany) and with the Power Gene Karyotyping System (PSI, Hailadale, UK). The FISH studies were carried out on four primary tumors of the thyroid gland (S476.1, S141.2, S172, S532.1) and on two cell lines from thyroid neoplasia. The cell lines, like the primary tumors, show a change in the chromosomal band 19ql3. The results of these analyzes showed that in all primary tumors the breakpoints are located in a region spanned by the BAC clone 280723. With this BAC clone, signals were obtained both on normal chromosome 19 and on the two derivative chromosomes. In further FISH investigations, signals were obtained with the cosmids 15841 and 29573, PAC 13174 and BAC 41372 proximal to the break points, whereas the BAC 829651 showed signals distal to the break points. The cell line from the primary tumor S172, ie cell line S172 / SV40, also showed signals on the normal chromosome 19 and on both derivative chromosomes after hybridization with the BAC clone 280723. The cell line S290.1 / SV40 showed signals on the derivative chromosomes and on the normal chromosome 19 when hybridized with the PAC clone 13174. This means that the break point in chromosome 19 correspondingly in a segment of about 150 kbp for all tumors examined the sequence between cosmid 15841 and BAC clone 829651. For further characterization of the region, the BAC clones 93504, 41372, 280723 and 829651 (LLNL), the PAC clone 13174 (Genome Systems, USA) and the Cosmid clones 30316, 15841, 29573 and 20019 (LLNL) using the Restriction mapping and addition of sequencing data combined in a contig. Ten new STSs were produced from this sequence data and were obtained either by sequencing the enser ends in plasmids or cosmids or by internal sequencing in BAC, PAC and cosmid clones. Oligonucleotide sequences for these PCR approaches and the product sizes of the PCR amplificates are listed in Table 2. The contig is 470 kbp in length, three of the STSs are within the breakpoint region, one is below, and six STSs are located proximal to the breakpoint.
In unmittelbarer LTmgebung bzw. innerhalb der Bruchpunktregion wurden über Sequenzanalyse- Verfahren Sequenzhomologien zu drei ESTs gefunden. Ein Vergleich der ESTs mit der genomischen Sequenz der Region erlaubte die Rekonstruktion der Struktur dieser Gene. Ein EST (ac- cession no. BE271492, AF201937) liegt innerhalb der 150 kbp-Bruchpunktregion, d.h. zwischen den Cosmid-Klonen 15841 und 29573. Die cDNA von BE271492 wurde aus der Ovarial- Adenokarzinom-Zellinien-Library NIH_MGC_9 isoliert. Die cDNA von AF201937 wurde aus
dendritischen Zellen isoliert (s. Genbank-Eintrag zu AF201937). Sie enthält 3 Exons, 469, 250 und 80 bp lang, die durch ein ca. 320 bp und ein ca. 340 bp langes Intron getrennt sind. Dieses Gen ist in Richtung Telomer orientiert. Die Exons weisen etwa 95 - 85 % Homologie mit Sequenzen der BiTichpunktregion auf. Die mRNA dieses Gens codiert für ein Protein, DC2, das ubiquitär exprimiert wird. Die cDNA des Gens konnte aus verschiedensten Gewebentypen wie Fettgewebe; Hirn, Darm, Auge, Herz, Leber, Niere, Schilddrüse, Testis, Haut; usw. isoliert werden.Sequence homologies to three ESTs were found in the immediate vicinity or within the breakpoint region using sequence analysis methods. A comparison of the ESTs with the genomic sequence of the region allowed the structure of these genes to be reconstructed. An EST (accession no. BE271492, AF201937) lies within the 150 kbp breakpoint region, ie between cosmid clones 15841 and 29573. The cDNA of BE271492 was isolated from the ovarian adenocarcinoma cell line library NIH_MGC_9. The AF201937 cDNA was extracted from dendritic cells isolated (see Genbank entry for AF201937). It contains 3 exons, 469, 250 and 80 bp long, which are separated by an approx. 320 bp and an approx. 340 bp long intron. This gene is oriented towards the telomer. The exons have approximately 95-85% homology with sequences from the bi-point region. The mRNA of this gene codes for a protein, DC2, which is ubiquitously expressed. The gene's cDNA could be derived from a wide variety of tissue types such as adipose tissue; Brain, intestine, eye, heart, liver, kidney, thyroid, testis, skin; etc. be isolated.
Ein anderes EST (BE564764, BF029168) beginnt etwa 4kb upstream des STS-Markers RSTS5, auf dem Cosmid-Klon 15841. Beide ESTs stammen aus der Library NIH_MGC_53, die aus einer Blasen__Karzinom-Zellinie hergestellt wurde. Die Orientierung der ESTs richtet sich gegen das Centromer, und damit liegt dieses Gen mit seinem 3'UTR noch innerhalb der Bruchpunktregion. Bei Vergleich mit der genomischen Region konnte eine Exon/Intron-Struktur aufgezeigt werden. Dieses Gen erstreckt sich, soweit aus den Sequenzdaten ersichtlich, über mindestens 5 kbp. Die ersten drei Exons weisen eine 100%ige Homologie mit der verglichenen genomischen Sequenz auf, Exons 4 und 5 wiesen eine Homologie von 93% bzw. 68% auf. Diese ESTs weisen über eine Strecke von 110 bp eine 85%ige Homologie mit dem Gen für den Kationischen Aminosäure-Transporter (cationic amino acid transporter (CAT)) von rattus norwegicus auf. Die Introns variieren in einer Größe von ca. 500 bp bis etwa 2 kbp.Another EST (BE564764, BF029168) begins about 4kb upstream of the STS marker RSTS5, on the cosmid clone 15841. Both ESTs come from the NIH_MGC_53 library, which was produced from a bladder carcinoma cell line. The orientation of the ESTs is directed against the centromer, and thus this gene with its 3'UTR is still within the breakpoint region. When compared with the genomic region, an exon / intron structure could be shown. As far as can be seen from the sequence data, this gene extends over at least 5 kbp. The first three exons have 100% homology with the compared genomic sequence, exons 4 and 5 had a homology of 93% and 68%, respectively. These ESTs have an 85% homology with the gene for the cationic amino acid transporter (CAT) from rattus norwegicus over a distance of 110 bp. The introns vary in size from approximately 500 bp to approximately 2 kbp.
Ein drittes EST (AF3459S7, X62533) wurde unterhalb des Bruchpunkt gefunden. Die Homologie zu der genomischen Sequenz unterhalb des Bruchpunktbereichs beträgt soweit vergleichbar annähernd 100%. Die Orientierung des zugehörigen Gens richtet sich gegen das Centromer. Dieses Gen kodiert für die Protein Kinase C gamma. Das erste bekannte Exon beginnt etwa 145 kbp downstream der Bruchpunktregion. Auf diesem Exon liegt der Startpunkt für die Translation etwa 1100 bp upstream des Exons. Ein alternativer Startpunkt liegt etwa 1600 bp upstream der bekannten Sequenz. Ein Vergleich mit der genomischen Sequenz erlaubte die Erstellung einer Intron/Exon-Struktur. Soweit aus den Daten ersichtlich besteht dieses Gen aus mindestens sechs Exons. Es wird erwartet, dass 5' der bekannten Sequenz, d.h. in Richtung des Bruchpunktbereiches, noch weitere Exons liegen. Bei den ersten beiden Introns kann bereits eine Größenabschätzung mit etwa 500 bp für Intron 1 und etwa 1000 bp für Intron 2 abgegeben werden. PKCgamma cDNA konnte bisher aus Hirn-, Magengewebe, Leukozyten isoliert werden.
Die cDNA bzw. mRNA-Sequenzen aller o.g. ESTs wurden in einem Virtual Northern (SAGE, serial analysis of gene expression; http://www.ncbi.nlm.nih.gov/SAGE/) auf Expression überprüft. Bei dieser Online-Analyse werden ausgewählte Sequenzen der ESTs (Tags) mit den in Libraries geordneten Sequenzen verglichen. Obwohl diese Ergebnisse eher die Häufigkeit des Tags und weniger die tatsächliche Genexpression repräsentieren, ist sie doch ein verläßliches Instrument für erste Evaluationen. Tags von den ESTs BE271492 und AF201937 (DC2) sind in vielen Libraries vorhanden, besonders starke "Expression" findet sich in Libraries aus Medul- loblastomen, Mamma-Adenokarzinomen, normalen vascularen Endothelium-Zellinien, normaler Haut und Prostata Karzinomen. Tags von den ESTs AF345987 und X62533 (PKCgamma) wurden nur in zwei Libraries gefunden, die aus normalem Hirm bzw. Astrocytoma-Zellinien hergestellt wurden. Tags der ESTs BE564764 und BF029168 konnten nicht in den Libraries gefunden werden.A third EST (AF3459S7, X62533) was found below the break point. The homology to the genomic sequence below the break point range is approximately 100% as far as comparable. The orientation of the associated gene is directed against the centromere. This gene codes for the protein kinase C gamma. The first known exon begins about 145 kbp downstream of the breakpoint region. On this exon, the starting point for the translation is about 1100 bp upstream of the exon. An alternative starting point is about 1600 bp upstream of the known sequence. A comparison with the genomic sequence allowed the creation of an intron / exon structure. As far as can be seen from the data, this gene consists of at least six exons. It is expected that 5 'of the known sequence, ie in the direction of the breakpoint region, will have further exons. A size estimate of approximately 500 bp for intron 1 and approximately 1000 bp for intron 2 can already be given for the first two introns. PKCgamma cDNA has so far been isolated from brain, stomach, and leukocytes. The cDNA or mRNA sequences of all of the above ESTs were checked for expression in a Virtual Northern (SAGE, serial analysis of gene expression; http://www.ncbi.nlm.nih.gov/SAGE/). In this online analysis, selected sequences of the ESTs (tags) are compared with the sequences arranged in libraries. Although these results represent the frequency of the day rather than the actual gene expression, it is nevertheless a reliable tool for initial evaluations. Tags from ESTs BE271492 and AF201937 (DC2) are present in many libraries, particularly strong "expression" can be found in libraries of meduloblastomas, breast adenocarcinomas, normal vascular endothelium cell lines, normal skin and prostate carcinomas. Tags from ESTs AF345987 and X62533 (PKCgamma) were only found in two libraries made from normal brain and astrocytoma cell lines, respectively. Tags of ESTs BE564764 and BF029168 could not be found in the libraries.
Ashworth LK, Batzer MA, Brandriff B, Brandscomp E, de Jong P, Garcia E, Garnes JA, Gordon LA, Lamardin JE, Lennon G, Mohrenweiser H, Olsen AS, Slezak T, Carrano AV: An integrated metric physical map of human chromosome 19. Nature Genet 11 :422-427 (1995).Ashworth LK, Batzer MA, Brandriff B, Brandscomp E, de Jong P, Garcia E, Garnes JA, Gordon LA, Lamardin JE, Lennon G, Mohrenweiser H, Olsen AS, Slezak T, Carrano AV: An integrated metric physical map of human chromosome 19. Nature Genet 11: 422-427 (1995).
de Jong PJ, Yokabata K, Chen C, Lohman F, Pederson L, McNinch J, van Dilla M: Human chromosome-specific partial digest libraries in lambda and cosmid vectors. Cytogenet Cell Genet 51 :985 (1985).de Jong PJ, Yokabata K, Chen C, Lohman F, Pederson L, McNinch J, van Dilla M: Human chromosome-specific partial digest libraries in lambda and cosmid vectors. Cytogenet Cell Genet 51: 985 (1985).
Bullerdiek J, Böschen C, Bartnitzke S: Aberrations of chromosome 8 in mixed salivary gland tumors: cytogenetic findings on seven cases. Cancer Genet Cytogenet 24:205-212 (1987).Bullerdiek J, Böschen C, Bartnitzke S: Aberrations of chromosome 8 in mixed salivary gland tumors: cytogenetic findings on seven cases. Cancer Genet Cytogenet 24: 205-212 (1987).
Beige G, Kazmierczak B, Meyer-Bolte K, Bartnitzke S, Bullerdiek J: Expression of SV40 T- antigen in lipoma with a chromosomal translocation t(3;12) is not sufficient for direct immortali- zation. Cell Biol Int Rep 16:339-347 (1992).Beige G, Kazmierczak B, Meyer-Bolte K, Bartnitzke S, Bullerdiek J: Expression of SV40 T-antigen in lipoma with a chromosomal translocation t (3; 12) is not sufficient for direct immortalization. Cell Biol Int Rep 16: 339-347 (1992).
ISCN (1995): An International System for Cytogenetic Nomenclature. Mitelman F (ed.) (S Karger, Basel 1995).
Kievits T, Dauwerse JG, Wiegant J, Devilee P, Breuning MH, Cornelisse CJ, van Ommen GJB, Pearson PL: Rapid subchromosomal localization of cosmids by nonradioactive in situ hybridization. Cytogenet Cell Genet 53:134-136 (1990).ISCN (1995): An International System for Cytogenetic Nomenclature. Mitelman F (ed.) (S Karger, Basel 1995). Kievits T, Dauwerse JG, Wiegant J, Devilee P, Breuning MH, Cornelisse CJ, van Ommen GJB, Pearson PL: Rapid subchromosomal localization of cosmids by nonradioactive in situ hybridization. Cytogenet Cell Genet 53: 134-136 (1990).
Trask B, Cliristensen M, Fertitta A, Bergmann A, Ashworth L, Branscomp E, Carrano A, Van den Engh G: Fluorescence in situ hybridization mapping of human chiOmosome 19: Mapping and verification of cosmid contigs formed by random restriction enzyme fingeiprinting. Genom- ics 14:162-167 (1992).Trask B, Cliristensen M, Fertitta A, Bergmann A, Ashworth L, Branscomp E, Carrano A, Van den Engh G: Fluorescence in situ hybridization mapping of human chiOmosome 19: Mapping and verification of cosmid contigs formed by random restriction enzyme fingeiprinting. Genomics 14: 162-167 (1992).
Tabelle 1 : Anordnung der DNA-Sonden (Cosmid, PAC, BAC), die für die FISH-Studien an vier benignen primären Schilddriisentumoren und zwei SV40-transformierten Zellinien, die von benignen Schilddrüsentumoren abgeleitet wurden, verwendet wurden, zeigen alle Abberationen, die die Bande 19ql3 betreffen.Table 1: Arrangement of the DNA probes (cosmid, PAC, BAC) used for the FISH studies on four benign primary thyroid tumors and two SV40-transformed cell lines derived from benign thyroid tumors show all aberrations that Band 19ql3 concern.
Tumor-Nr DNA-Sonde Translokation Stelle von FISH-Signalen relativ zum BruchpunktTumor No DNA Probe Translocation Location of FISH signals relative to the break point
S141.2 cl5841 t(2;19)(pl2;ql3) proximal c29573 proximalS141.2 cl5841 t (2; 19) (pl2; ql3) proximal c29573 proximal
BAC 41372 proximalBAC 41372 proximal
BAC 280723 überspannendBAC 280723 spanning
BAC S29651 distalBAC S29651 distal
PAC 13174 proximalPAC 13174 proximal
S172 c29573 t(2;19)(pl2;ql3) proximalS172 c29573 t (2; 19) (pl2; ql3) proximal
BAC 41372 proximalBAC 41372 proximal
BAC 280723 überspannendBAC 280723 spanning
BAC 829651 distalBAC 829651 distal
PAC 13174 proximalPAC 13174 proximal
S476.1 c29573 t(5;19)(ql3;ql3) proximalS476.1 c29573 t (5; 19) (ql3; ql3) proximal
BAC 41372 proximal
BAC 280723 überspannend BAC 829651 distal PAC 13174 proximalBAC 41372 proximal BAC 280723 spanning BAC 829651 distal PAC 13174 proximal
S172/SV40 BAC 280723 t(2;19)(pl3;ql3) überspannend BAC 829651 distalS172 / SV40 BAC 280723 t (2; 19) (pl3; ql3) spanning BAC 829651 distally
S290.1/SV40 c30316 t(l l;19)(q23;ql3) proximal C15841 proximal BAC 41372 proximal PAC 13174* überspannend BAC 829651 distalS290.1 / SV40 c30316 t (l l; 19) (q23; ql3) proximal C15841 proximal BAC 41372 proximal PAC 13174 * spanning BAC 829651 distal
S532.1 BAC 280723 t(14;19)(q22;ql3) überspannendS532.1 BAC 280723 t (14; 19) (q22; ql3) spanning
Tabelle 2: Primer für PCR-Amplifikation von STS-Markern, die physikalisch kartiert wurden.Table 2: Primers for PCR amplification of STS markers that have been physically mapped.
Marker GenBank Vorwärts ProduktMarker GenBank Forward product
Zugangsnummer Primer Umgekehrt (bp)Accession number reverse primer (bp)
Primerprimer
RSTS 1 G64894 TCCTGGCTCATAATTCCATAACCCTTGGTRSTS 1 G64894 TCCTGGCTCATAATTCCATAACCCTTGGT
GTGCGCCACCTTTTCAGAGTTCTTTTGT 423 RSTS2 G64900 TTATGCCTGATTCAGTGACACTACTTTTTCGTGCGCCACCTTTTCAGAGTTCTTTTGT 423 RSTS2 G64900 TTATGCCTGATTCAGTGACACTACTTTTTC
CGGCTGCCTCTAACATACGGAAGATTC 397CGGCTGCCTCTAACATACGGAAGATTC 397
RSTS3 G64895 GAGGCTGACGCGGCGGCTCTATCTCRSTS3 G64895 GAGGCTGACGCGGCGGCTCTATCTC
AGCGGTTGCGTCACCGGTGCAGAAG 113 RSTS4AF260531 ATATACGTGTATCAGTTTCAGAATGCAGCGGTTGCGTCACCGGTGCAGAAG 113 RSTS4AF260531 ATATACGTGTATCAGTTTCAGAATGC
T ATTTT AAAGTC AGAC ATG AAAAAGG 188T ATTTT AAAGTC AGAC ATG AAAAAGG 188
RSTS5AF260970 GGGCCAGGAAAATGCACGGAAGTGAAGRSTS5AF260970 GGGCCAGGAAAATGCACGGAAGTGAAG
CCCGGGCTTGTGGAATTAACTGAGCAG 360 RSTS6 G64896 TTATGTGGGCCCC AA ACC ATTACTGATACTC
CTCATGCCCATAAACCCCTAAATTCCTTGT 385 RSTS7G64897 GCCTGCTAAGCCTCTGTGCCTAGTAAAGCCCGGGCTTGTGGAATTAACTGAGCAG 360 RSTS6 G64896 TTATGTGGGCCCC AA ACC ATTACTGATACTC CTCATGCCCATAAACCCCTAAATTCCTTGT 385 RSTS7G64897 GCCTGCTAAGCCTCTGTGCCTAGTAAAG
GGTATCAGAAAGGTACAATCCCTATGTCTC 1S9 RSTS8G64901 CCCAAAAGATCCCAAGTCCAGGCAGAAAGGGTATCAGAAAGGTACAATCCCTATGTCTC 1S9 RSTS8G64901 CCCAAAAGATCCCAAGTCCAGGCAGAAAG
CCTGGGAAGCTCACAAGGGTGGAAGAC 397 RSTS9G64898 GTACATTGGCATCCGCAGGGGTAACCCTGGGAAGCTCACAAGGGTGGAAGAC 397 RSTS9G64898 GTACATTGGCATCCGCAGGGGTAAC
CCTCTCAAGGCGTGCTTTTTCGTAAGA 406CCTCTCAAGGCGTGCTTTTTCGTAAGA 406
RSTS10 G64899 AGCCCGCTCGTATCTATGGRSTS10 G64899 AGCCCGCTCGTATCTATGG
TGAGGACTACTTGGGCACAGG 301TGAGGACTACTTGGGCACAGG 301
Beispiel 2: Charakterisierung eines humanen CAT-homologen GensExample 2: Characterization of a human CAT homologous gene
Bei der Charakterisierung der in der Bruchpunkt-Region von Schilddriisentumoren auftretenden Gene wurde ein neues humanes Gen gefunden, welches, auf der Grundlage der entsprechenden Sequenzen von Rattus norwegicus, zu den CAT-Genen homolog ist. CAT-Gene sind solche Gene, die für Transporter-Proteine von kationischen Aminosäuren codieren. Das durch die vorliegenden Erfinder entdeckte Gen wird hierin im folgenden als CAT-A bzw. CAT-Al bezeichnet. CAT-Al stellt dabei eine Splice-Variante von CAT-A dar, wie im folgenden weiter belegt werden wird.In the characterization of the genes occurring in the breakpoint region of thyroid tumors, a new human gene was found which, based on the corresponding sequences from Rattus norwegicus, is homologous to the CAT genes. CAT genes are genes that code for transporter proteins of cationic amino acids. The gene discovered by the present inventors is hereinafter referred to as CAT-A or CAT-Al. CAT-Al represents a splice variant of CAT-A, as will be demonstrated in the following.
Das CAT-A- bzw. CAT-Al -Gen liegt genau in der Region ql3.4 des menschlichen Chromosoms 19. Es liegt teilweise in der Bruchpunktregion des Schilddrüsentumors. Das CAT-A/Al-Gen liegt im BAC CTB-167G5 (BC93504) mit der Genbanknummer AC01 1487. Die Genrichtung zeigt zum Zentromer, d. h. das 3 '-Ende liegt zum Zentromer her organisiert.The CAT-A or CAT-Al gene is located exactly in the ql3.4 region of human chromosome 19. It is partly in the breakpoint region of the thyroid tumor. The CAT-A / Al gene is located in the BAC CTB-167G5 (BC93504) with the gene bank number AC01 1487. H. the 3 'end is organized towards the centromer.
Eine Übersicht der Lage von CAT-A findet sich in Fig. 4.An overview of the location of CAT-A can be found in FIG. 4.
Die mRNA von CAT-A wird derzeit mit 1437 Nukleotiden angegeben und ist als cDNA in SEQ. ID. No. 10 dargestellt. Dabei ist anzumerken, dass CAT-A und CAT-Al zur Zeit wesentlich kürze sind als die Mitglieder der humanen CAT-Familie.
Beispiel 3: Genomische Organisation von CAT-AThe CAT-A mRNA is currently reported as 1437 nucleotides and is cDNA in SEQ. ID. No. 10 shown. It should be noted that CAT-A and CAT-Al are currently much shorter than the members of the human CAT family. Example 3: Genomic organization of CAT-A
Die genomische Organisation von CAT-A und seiner Splice-Variante CAT-Al ist in Fig. 4 dargestellt. Die genomische DNA-Sequenz des hierin erstmals offenbarten Homologen zu dem im Stand der Technik bereits bekannten humanen DC2 wird mit einer Länge von 5278 Basenpaaren angegeben. Dabei ist anzumerken, dass das 5 '-Ende zur Zeit noch nicht bestimmt wurde. Es ist jedoch möglich, ausgehend von der hierin angegebenen Offenbarung, eine weitere Sequenzierung vorzunehmen und insoweit die Sequenz zu komplementieren. Andererseits wird von den Fachleuten anerkannt werden, dass auf der Gmndlage der hierin gegebenen Informationen eine Vervollständigung möglich ist und insbesondere die verschiedenen Vertreter der Verbindungsklassen der Peptide, Proteine, Antiköφer, Anticaline und funktionalen Nukleinsäuren auf der Gmndlage der hierin gegebenen Offenbarung bereits hergestellt bzw. selektiert werden können.The genomic organization of CAT-A and its splice variant CAT-Al is shown in Fig. 4. The genomic DNA sequence of the homologue disclosed here for the first time to the human DC2 already known in the prior art is given a length of 5278 base pairs. It should be noted that the 5 'end has not yet been determined. However, it is possible, starting from the disclosure given here, to carry out further sequencing and to this extent to complement the sequence. On the other hand, it will be recognized by those skilled in the art that, based on the information given herein, completion is possible and in particular the various representatives of the compound classes of the peptides, proteins, antibodies, anticalins and functional nucleic acids have already been prepared or selected on the basis of the disclosure given here can be.
Im Falle von CAT-A sind insgesamt 4 Exons bekannt, wobei Exon 1 312 Basenpaare lang ist, Exon 2 167 Basenpaare, Exon 3 108 Basenpaare und Exon 4 850 Basenpaare.In the case of CAT-A, a total of 4 exons are known, with exon being 1 312 base pairs long, exon 2 167 base pairs, exon 3 108 base pairs and exon 4 850 base pairs.
CAT-Al besitzt dagegen fünf Exons, die dadurch entstehen, dass Exon 4 eine alternative Splice- Stelle umfasst. Insoweit sind die Exons 1 bis 3 von CAT-Al identisch mit den ersten drei Exons von CAT-A, Das vierte Exon von CAT-Al, d. h. Exon 4a, ist jedoch lediglich 200 Basenpaare lang und Exon 5 von CAT-Al 381 Basenpaare.CAT-Al, on the other hand, has five exons that result from the fact that exon 4 includes an alternative splice site. In this respect, exons 1 to 3 of CAT-Al are identical to the first three exons of CAT-A, the fourth exon of CAT-Al, i. H. Exon 4a, however, is only 200 base pairs long and exon 5 of CAT-Al 381 base pairs.
Charakterisierung der mRNA für CAT-ACharacterization of the mRNA for CAT-A
Die Länge der CAT-A mRNA wird derzeit mit 1437 Nukleotiden angegeben. Dabei existieren zwei Leserahmen, für die jeweils ein Startcodon existiert. Die beiden Leserahmen und die Translationsprodukte davon werden hierin auch als ORFstartl und ORFstart2 bezeichnet. Ein dritter, ebenfalls in CAT-A enthaltener Leserahmen, hierin als ORF3 bezeichnet, besitzt kein Startcodon, d. h. die Sequenzierung ist derzeit noch nicht in dem Umfang fortgeschritten, als dass dieses eindeutig hätte identifiziert werden können, und beinhaltet ORFstart2. ORF3 und ORFstart2 besitzen somit das gleiche Leseraster.
Charakterisierung der CAT-Al mRNAThe length of the CAT-A mRNA is currently given as 1437 nucleotides. There are two reading frames, each with a start codon. The two reading frames and the translation products thereof are also referred to herein as ORFstartl and ORFstart2. A third reading frame, also contained in CAT-A, referred to herein as ORF3, does not have a start codon, ie sequencing has not yet progressed to the extent that this could be clearly identified, and includes ORFstart2. ORF3 and ORFstart2 therefore have the same reading frame. Characterization of the CAT-Al mRNA
Die CAT-Al -mRNA weist derzeit eine Länge von 1168 Nukleotiden auf. Sie unterscheidet sich von der CAT-A mRNA durch ein unterschiedliches 3 '-Ende, das jedoch möglicherweise nicht codiert. Die Sequenz hierzu ist als SEQ. ED. No. 1 1 hierin offenbart.The CAT-Al mRNA is currently 1168 nucleotides in length. It differs from the CAT-A mRNA by a different 3 'end, which may not, however, encode. The sequence for this is as SEQ. ED. No. 1 1 disclosed herein.
Beispiel 4: Charakterisierung der verschiedenen Leserahmen der CAT-A mRNAExample 4: Characterization of the different reading frames of the CAT-A mRNA
1. Charakterisierung des Leserahmens ORFstartl1. Characterization of the ORFstartl reading frame
Unter Verwendung von insgesamt 3 verschiedenen Softwareprogrammen wurden mögliche Transmembran-Domänen der verschiedenen Leserahmen bestimmt. Die entsprechenden Softwareprogramme sind dabei „DAS"-Transmembrane Prediction, das über die folgende URL- Adresse geladen werden kann: http://www.sbc.su.se/~miklos/DAS/. Dieses Verfahren wurde von Cserzo at al. entwickelt (M. Cserzo, E. Wallin, I. Simon, G. von Heijne and A. Elofsson: Prediction of transmembrane alpha-helices in procariotic membrane proteins: the Dense Alignment Surface method; Prot. Eng. vol. 10, no. 6, 673-676, 1997).Possible transmembrane domains of the different reading frames were determined using a total of 3 different software programs. The corresponding software programs are "DAS" transmembrane prediction, which can be loaded via the following URL address: http://www.sbc.su.se/~miklos/DAS/. This method was developed by Cserzo at al (M. Cserzo, E. Wallin, I. Simon, G. von Heijne and A. Elofsson: Prediction of transmembrane alpha-helices in procariotic membrane proteins: the Dense Alignment Surface method; Prot. Eng. Vol. 10, no. 6 , 673-676, 1997).
Gemäß der in Fig. 12 dargestellten Ergebnisses weist der ORFstartl -Leserahmen zwei Transmembran-Domänen auf.According to the result shown in FIG. 12, the ORFstartl reading frame has two transmembrane domains.
Ein weiteres Verfahren zur Bestimmung von Transmembran-Domänen wird durch den sogenannten HMMTOP-Server bereitgestellt. HMMTOP ist ein automatischer Server zum Vorhersagen von Transmembran-Helices und Topologien von Proteinen, wie sie von G.E. Tusnady vom Institute of Enzymology entwickelt wurden. Die entsprechende URL-Adresse lautet http://www.enzim.hu/hmmtop/index.html. Das Verfahren ist ebenfalls beschrieben in Tusnady, G.E. at al. (G.E Tusnady and I. Simon (1998) Principles Governing Amino Acid Composition of Integral Membrane Proteins: Applications to Topology Prediction. J. Mol. Biol. 283, 489-506)Another method for determining transmembrane domains is provided by the so-called HMMTOP server. HMMTOP is an automatic server for the prediction of transmembrane helices and topologies of proteins, as described by G.E. Tusnady were developed by the Institute of Enzymology. The corresponding URL address is http://www.enzim.hu/hmmtop/index.html. The process is also described in Tusnady, G.E. at al. (G.E Tusnady and I. Simon (1998) Principles Governing Amino Acid Composition of Integral Membrane Proteins: Applications to Topology Prediction. J. Mol. Biol. 283, 489-506)
Das Ergebnis des HMMTOP-Servers betreffend den Leserahmen ORFstartl kann wie folgt zu- sammengefasst werden. Auch hier werden zwei Transmembran Helices identifiziert und den Positionen 72 - 88 bzw. 95 - 112 zugeordnet. Der N-Terminus ist dabei nach außen, d. h. extrazellulär, angeordnet.
Ein weiteres Verfahren zur Vorhersage von Transmembran-Regionen ist das sogenannte TMpred-Programm. Der Algorithmus basiert auf einer statistischen Analyse von TMbase, einer Datenbank von natürlicherweise auftretenden Transmembranproteinen. Die Vorhersage wird durchgeführt unter Verwendung einer Kombination von mehreren gewichteten Matrizes. Die entsprechend LTRL- Adresse lautet: www.ch.embnet.org/software/TMPRED form.html. Das Verfahren ist auch beschrieben von Hofmann at al. (K. Hofmann & W. Stoffel (1993) TMbase - A database of membrane spanning proteins segments Biol. Chem. Hoppe-Seyler 374,166).The result of the HMMTOP server regarding the reading frame ORFstartl can be summarized as follows. Here too, two transmembrane helices are identified and assigned to positions 72 - 88 and 95 - 112. The N-terminus is arranged outwards, ie extracellularly. Another method for predicting transmembrane regions is the so-called TMpred program. The algorithm is based on a statistical analysis of TMbase, a database of naturally occurring transmembrane proteins. The prediction is performed using a combination of several weighted matrices. The corresponding LTRL address is: www.ch.embnet.org/software/TMPRED form.html. The process is also described by Hofmann at al. (K. Hofmann & W. Stoffel (1993) TMbase - A database of membrane spanning proteins segments Biol. Chem. Hoppe-Seyler 374,166).
Als Ergebnis der Anwendung von TMpred werden zwei Modelle betrachtet, die sich in der Anzahl der Transmembran-Helices unterscheiden. In einem eindeutig bevorzugten Modell ist der N-Terminus intrazellulär orientiert und umfasst drei starke Transmembran-Helices. Die Positionen 1 - 21 weisen dabei eine Orientierung von innen nach außen auf, die Aminosäuren der Positionen 66 - 87 eine Orientierung von außen nach innen und die Aminosäuren 95 - 1 14 eine Orientierung von innen nach außen.As a result of using TMpred, two models are considered that differ in the number of transmembrane helices. In a clearly preferred model, the N-terminus is intracellularly oriented and comprises three strong transmembrane helices. Positions 1-21 have an orientation from the inside to the outside, the amino acids of the positions 66 to 87 have an orientation from the outside to the inside, and the amino acids 95 to 114 have an orientation from the inside to the outside.
Das alternativ vorgeschlagene Modell weist zwei starke Transmembran-Helices auf, wobei die erste Helix die Aminosäurenpositionen 8 - 30 umfasst und die Orientierung von außen nach innen und die zweite Helix die .Aminosäurenposition 95 - 114 umfasst mit einer Orientierung von innen nach außen.The model proposed as an alternative has two strong transmembrane helices, the first helix comprising amino acid positions 8-30 and the orientation from the outside inwards and the second helix comprising the amino acid position 95-114 with an orientation from the inside out.
2. Charakterisierung des Leserahmens ORFstart22. Characterization of the reading frame ORFstart2
Die von diesem Leserahmen codierte Aminosäuresequenz ist als SEQ. ID. No. 14 hierin angegeben.The amino acid sequence encoded by this reading frame is called SEQ. ID. No. 14 specified herein.
Die Charakterisierung des Leserahmens ORFstart2 unter Anwendung der vorstehend beschriebenen drei Software-Programme zur Bestimmung von Transmembran-Helices ergab dabei das folgende Ergebnis:The characterization of the ORFstart2 reading frame using the three software programs described above for the determination of transmembrane helices gave the following result:
Unter Anwendung des „DAS"-Transmembranprotein-Programmes wurden drei Transmembran- Helices ermittelt. Der N-Terminus ist dabei intrazellulär angeordnet. Die Länge der Aminosäuresequenz dieses Leserahmens beträgt 119 Aminosäuren.
Das Ergebnis der unter Anwendung des DAS-Programmes angewandten Analyse ist in Fig. 13 dargestellt.Three transmembrane helices were determined using the “DAS” transmembrane protein program. The N-terminus is arranged intracellularly. The length of the amino acid sequence of this reading frame is 119 amino acids. The result of the analysis applied using the DAS program is shown in Fig. 13.
Eine weitergehende Analyse des Leserahmens ORFstart2 unter Anwendung des HMMTOP- Servers ergab ebenfalls das Vorhandensein von drei Transmembran-Helices, nämlich im Bereich der Aminosäuren 38 - 57, 70 - 89 und 98 - 1 17.A further analysis of the ORFstart2 reading frame using the HMMTOP server also revealed the presence of three transmembrane helices, namely in the region of amino acids 38-57, 70-89 and 98-117.
LTnter Anwendung des TMpred- Verfahrens wurden zwei mögliche Modelle wiedemm betrachtet. Das stark bevorzugte Modell ergab dabei drei starke Transmembran-Helices, wobei die Helices von den Aminosäurepositionen 38 - 57 mit einer Orientierung von innen nach außen, von Aminosäurepositionen 69 - 90 mit einer Orientierung von außen nach innen und von Aminosäurepositionen 99 - 119 mit einer Orientierung von innen nach außen erstrecken.Two possible models were considered again using the TMpred method. The highly preferred model resulted in three strong transmembrane helices, the helices from amino acid positions 38-57 with an orientation from the inside out, from amino acid positions 69-90 with an orientation from the outside in and from amino acid positions 99-119 with an orientation extend from the inside out.
Das Alternativmodell umfasst gleichfalls drei starke Transmembran-Helices, wobei dort für die Ausbildung der Helices die Aminosäuren der Positionen 38 - 58 eine Transmembran-Helix mit einer Orientierung von außen nach innen, die Aminosäurepositionen 72 - 90 mit einer Orientierung von innen nach außen und die Aminosäurepositionen 100 - 118 mit einer Orientierung von außen nach innen angegeben werden.The alternative model also comprises three strong transmembrane helices, with the amino acids of positions 38-58 being a transmembrane helix with an orientation from the outside in, the amino acid positions 72-90 with an orientation from the inside out, and the Amino acid positions 100-118 with an orientation from the outside inwards.
3. Charakterisierung des Leserahmens ORF33. Characterization of the ORF3 reading frame
Das von diesem Leserahmen codierte Protein ist hierin als SEQ. ID. No. 15 offenbart und umfasst insgesamt 140 Aminosäuren. Dieser Leserahmen weist eine 34 %-ige Homologie hinsichtlich der Aminosäuren 1 - 130 zu der drei Mitglieder umfassenden Familie der löslichen Carrier- Familie 7 (solute canϊer family 7) (kationische Aminosäuretransporter, Y+-System) auf. Der entsprechende Genbankeintrag findet sich unter der Zugangsnummer Genbank Acc. AAL37184.The protein encoded by this reading frame is herein SEQ. ID. No. 15 discloses and comprises a total of 140 amino acids. This reading frame has a 34% homology with regard to amino acids 1 - 130 to the three-member family of the soluble carrier family 7 (solute canϊer family 7) (cationic amino acid transporter, Y + system). The corresponding gene bank entry can be found under the accession number Genbank Acc. AAL37184.
Eine weitere Homologie besteht hinsichtlich der Aminosäuren 107 - 130 zu dem ektropischen Retrovirus-Rezeptor von Rattus norwegicus. Hier wird eine Homologie von 62 % festgestellt. Diese Sequenz findet sich als Genbankeintrag BAB83893.
Eine Charakterisierung dieses Leserahmens unter Anwendung des DAS-Verfahrens ergab die Existenz von insgesamt drei Transmembran-Domänen. Das Analyseergebnis ist als Fig. 14 hierin dargestellt. Die Analyse unter Verwendung des HMMTOP-Programms ergab ebenfalls drei Transmembran-Helices, die von den Aminosäuren 59 - 78, 91 - 110 sowie 119 - 138 ausgebildet wurden.A further homology exists with regard to amino acids 107-130 to the ectropic retrovirus receptor from Rattus norwegicus. A homology of 62% is found here. This sequence can be found as Genbank entry BAB83893. Characterization of this reading frame using the DAS method revealed the existence of a total of three transmembrane domains. The analysis result is shown as Fig. 14 herein. Analysis using the HMMTOP program also revealed three transmembrane helices formed from amino acids 59-78, 91-110 and 119-138.
Eine Analyse unter Anwendung von TMpred schließlich ergab wiedemm unter Zugrundelegung zweier Modelle drei starke Transmembran-Helices. In dem bevorzugten Modell werden diese ausgebildet von den Aminosäuren an den Positionen 79 - 80 mit einer Orientierung von innen nach außen, von 90 - 110 mit einer Orientierung von außen nach innen und von 120 - 140 mit einer Orientierung von innen nach außen.An analysis using TMpred finally showed three strong transmembrane helices based on two models. In the preferred model, these are formed from the amino acids at positions 79-80 with an inside-out orientation, 90-110 with an outside-in orientation, and 120-140 with an inside-out orientation.
Das alternative Modell weist ebenfalls drei starke Transmembran-Helices auf, wobei diese ausgebildet werden von den Aminosäuren an den Positionen 59 - 79 mit einer Onentiemng von außen nach innen, von 93 - 111 mit einer Orientierung von innen nach außen und von Position 121 - 139 mit eine Orientierung von außen nach im en.The alternative model also has three strong transmembrane helices, which are formed from the amino acids at positions 59-79 with an outside-in orientation, from 93-111 with an inside-out orientation and from positions 121-139 with an orientation from outside to inside.
Im Zusammenhang mit der vorliegenden Erfindung, insbesondere bei Verwendung der verschiedenen Translationsprodukte der erfmdungsgemäßen Sequenzen bzw. der erfindungsgemäßen Polypeptide, wie sie, unter anderem, Gegenstand der Sequenzen SEQ. ID. No. 13 - 15 sind, können als Zielmoleküle fungieren. Dabei ist besonders beachtlich, dass es sich dabei um Transmembran-Proteine handelt, was insoweit von Bedeutung ist, als dass bei der Entwicklung von Molekülen der verschiedenen hierin diskutierten Verbindungsklassen, d. h. Peptiden, Proteinen, Antiköφern, Anticalinen und funktionalen Nukleinsäuren, aber auch kleinen Molekülen, die Zugänglichkeit von Teilen dieser Sequenzen insoweit besonders leicht gegeben ist, als dass Teile dieser Zielmoleküle extrazellulär angeordnet sind, wie sich aus den vorstehenden Beschreibungen der Transmembran-Domänen ergibt.In connection with the present invention, in particular when using the different translation products of the sequences according to the invention or the polypeptides according to the invention, as they, among others, the subject of the sequences SEQ. ID. No. 13-15 can act as target molecules. It is particularly noteworthy that these are transmembrane proteins, which is important insofar as the development of molecules of the various classes of compounds discussed here, i. H. Peptides, proteins, antibodies, anticalins and functional nucleic acids, but also small molecules, the accessibility of parts of these sequences is particularly easy insofar as parts of these target molecules are arranged extracellularly, as can be seen from the above descriptions of the transmembrane domains.
Beispiel 5: Überexpression von PKCG in SchilddrüsenkarzinomzellenExample 5: Overexpression of PKCG in thyroid carcinoma cells
Unter Anwendung einer semiquantitativen PCR und einer Northern Blot- Analyse wurde untersucht, inwieweit in Schilddrüsenkarzinomzellen PKCG überexprimiert wurde.
Die Durchführung der semiquantitativen RT-PCR erfolgte an cDNA des anaplastischen Schilddrüsenkarzinoms S227, der Schilddrüsenadenom-Zelllinie S40.2, normalen Schilddrüsengewebes, der Zelllinie HeLa, der Mammakarzinom-Zelllinie MCF-7 und der Zelllinie EFM-19.The extent to which PKCG was overexpressed in thyroid carcinoma cells was investigated using semi-quantitative PCR and Northern blot analysis. The semi-quantitative RT-PCR was carried out on cDNA of the anaplastic thyroid carcinoma S227, the thyroid adenoma cell line S40.2, normal thyroid tissue, the cell line HeLa, the breast carcinoma cell line MCF-7 and the cell line EFM-19.
Als Primer wurden HPKCGupl (5'-ccttgcccctctcctgcccacctc-3') und HPKCGlo2 (5'- gggacggctgtagaggctgtatggagttcagaag-3 ') verwendet, die auf mRNA-Ebene den 209 lbp open reading frame von PKC? einschließen und ein Fragment von 2424bp amplifizieren.HPKCGupl (5'-ccttgcccctctcctgcccacctc-3 ') and HPKCGlo2 (5'-gggacggctgtagaggctgtatggagttcagaag-3') were used as primers, which at PKR? 209 lbp open reading frame on the mRNA level? include and amplify a fragment of 2424bp.
Zum Vergleich der RT-PCR des PKC?-Gens wurde parallel eine RT-PCR an cDNA der oben genannten Gewebe mit den GAPDH-Primern GAPDH2 (5 '-gtgaaggtcggagtcaacg-3 ') und GAPDH3 (5 '-ggtgaagacgccagtggactc-3 ') durchgeführt, die ein Produkt von 299bp amplifizieren. Die Ansätze (50μl Gesamtvolumen pro Ansatz) enthielten 2μl cDNA, 5μl lOxPCR-Puffer, jeweils lμl Primer, l μl 2mM dNTP-Mix, l,5μl 15mM MgC12 und 0,5μl Taq-Polymerase sowie 38μl bidest. H2O.In order to compare the RT-PCR of the PKC? that amplify a product of 299bp. The batches (50 μl total volume per batch) contained 2 μl cDNA, 5 μl lOxPCR buffer, in each case 1 μl primer, l μl 2mM dNTP mix, 1.5 μl 15mM MgC12 and 0.5 μl Taq polymerase as well as 38 μl bidest. H2O.
Die RT-PCR-Bedingungen waren für die genannten Primer-Paare (HPKCGupl/lo2 und GAPDH2/3) dieselben mit Ausnahme der Annealing-Temperaturen (HPKCGupl /lo2: 6S°C; GAPDH2/3: 52°C bei jeweils 30sek.) und betrugen für die Denaturierung 95°C (30sek.) sowie für die Extension 72°C (45sek.). Insgesamt erfolgten diese Schritte in 35 Zyklen. Vor Beginn erfolgte eine einmalige Denaturierung bei 95°C (3min.) und abschließend eine zusätzliche Extension bei 72°C für 10min. Der Nachweis der RT-PCR erfolgte gelelektrophoretisch.The RT-PCR conditions were the same for the named primer pairs (HPKCGupl / lo2 and GAPDH2 / 3) with the exception of the annealing temperatures (HPKCGupl / lo2: 6S ° C; GAPDH2 / 3: 52 ° C at 30sec.) and were 95 ° C (30sec.) for the denaturation and 72 ° C (45sec.) for the extension. In total, these steps were carried out in 35 cycles. Before the start there was a single denaturation at 95 ° C (3min.) And finally an additional extension at 72 ° C for 10min. The RT-PCR was detected by gel electrophoresis.
Die Northern Blot- Analyse wurde wie folgt durchgeführt:Northern blot analysis was carried out as follows:
Als molekulare Sonde wurde ein 2,4kbp PKCG spezifisches Fragment, welches den ORF einschließt, verwendet. Die radioaktive Markierung mit 3"P erfolgte nach dem Prinzip der „random primer extension". Nach einer Prähybridisierung der Membran in ExpressHyb™ Hybridisie- rungslösung (Clontech Laboratories, Palo Alto, U.S.A.) für 30 min bei 68°C erfolgte die Hybridisierung der Membran mit lOOng Sonde in ExpressHyb™ Hybridisierungslösung für 60 min bei 68°C. Danach wurden die Membran zweimal für 20 min bei Raumtemperatur in 2 x SSC / 0.05 % SDS un viermal für 10 min bei 50°C in 0.1 x SSC / 0.1 % SDS gewaschen. Die Signale
wurden auf einem STORM Phosphorimager (Molecular Dynamics, Sunnyvale, U.S.A.) delektiert.A 2.4 kbp PKCG-specific fragment, which includes the ORF, was used as the molecular probe. The radioactive labeling with 3 "P was based on the principle of" random primer extension ". After a pre-hybridization of the membrane in ExpressHyb ™ hybridization solution (Clontech Laboratories, Palo Alto, USA) for 30 min at 68 ° C, the membrane was hybridized with 100 g probe in ExpressHyb ™ hybridization solution for 60 min at 68 ° C. The membrane was then washed twice for 20 min at room temperature in 2 x SSC / 0.05% SDS and four times for 10 min at 50 ° C in 0.1 x SSC / 0.1% SDS. The signals were detected on a STORM phosphor imager (Molecular Dynamics, Sunnyvale, USA).
Das Ergebnis hinsichtlich der Northern Blot-Analyse ist in Fig. 9 dargestellt, das Ergebnis der semiquantitativen PCR in Fig. 10.The result regarding the Northern blot analysis is shown in FIG. 9, the result of the semi-quantitative PCR in FIG. 10.
Das menschliche PKCG-Gen liegt ca. 150 kb vom Bruchpunktbereich der Schilddrüsentumoren entfernt. Regulatorische Elemente des PKCG-Gens können durch Rearrangieren in der Bruchpunktregion betroffen sein. Aus diesen Gründen stellt PKCG ein Targetmolekül im Zusammenhang mit Funktionsstömngen der Schilddilise und/oder Hypeφlasien der Schilddrüse und/oder SchilddiTisentumoren dar. Die relative Lage des PKCG-Gens ist in Fig. 8 dargestellt. Wie aus der Northern Blot-Analyse ersichtlich, wird PKCG in Schilddrüsenkarzinomzellen überexprimiert. Der Nachweis erfolgte mit einer PKCG-spezifischen Sonde, die zu Hybridisierungszwecken eingesetzt wurde. Die Hybridisierungsbedingungen entsprechen hierin allgemein und im speziellen jenen, wie sie in den Beispielen offenbart sind.The human PKCG gene is approximately 150 kb from the breakpoint area of the thyroid tumors. Regulatory elements of the PKCG gene can be affected by rearrangement in the breakpoint region. For these reasons, PKCG represents a target molecule in connection with functional disorders of the thyroid dilise and / or hypothyroidism of the thyroid gland and / or thyroid tumors. The relative position of the PKCG gene is shown in FIG. 8. As can be seen from the Northern blot analysis, PKCG is overexpressed in thyroid carcinoma cells. The detection was carried out with a PKCG-specific probe, which was used for hybridization purposes. The hybridization conditions herein generally and specifically correspond to those disclosed in the examples.
Das Schilddrüsenkarzinom wurde in eine Zellinie überfuhrt, die auch eine Veränderung am Chromosom 19 zeigt, und war Gegenstand der in diesem Beispiel beschriebenen Untersuchungen.,The thyroid carcinoma was transferred to a cell line that also shows a change on chromosome 19 and was the subject of the studies described in this example.
Die vorstehend im Zusammenhang mit der Northern Blot-Analyse beschriebenen Ergebnisse wurden auch mit Hilfe einer semiquantitativen PCR bestätigt. Dabei wurde nach semiquantitativer RT-PCR mit PKCG-spezifischen Primern die Expression in einer Schilddrüsenkarzinomzelle festgestellt. Bei dem in Fig. 10 dargestellten Agarosegel ist dabei Folgendes aufgetragen: In Spur 1 ein Marker (Marker III (Röche), λ-DNA geschnitten mit Hindlll-EcoRI), Spur 2 eine Zellinie des anaplastischen Schilddrüsenkarzinoms S277, Spur 3 die Zellinie des Schilddrüsenadenoms S40.2, Spur 4 normales Schilddrüsengewebe, Spur 5 eine Heia-Zelle, d. h. Mammakarzinom, Spur 6 die Zellinie MCF7 (ATCC-Nummer HTB-22, ebenfalls ein Adenokarzinom), Spur 7 die Zellinie EFM19, eine menschliche Brustkrebszellinie (DSMZ-Nummer ACC231), Spur 8 eine Negativ-Kontrolle, Spur 9 eine Positiv-Kontrolle (Nachweis von GAP-Dehydrogenase zum Beleg der Isoliemng von cDNA).
Aus Fig. 10 ergibt sich somit, dass im Falle des anaplastischen Schilddrüsenkarzinoms S277 die Expression des PKCG-Gens, im vorliegenden Falle mit einer Länge von 2442 kb, festgestellt werden konnte. PKCG-Genaktivität konnte ebenfalls in der Zellinie MCF7 festgestellt werden. In Fig. 10 sind die entsprechenden Banden durch einen Pfeil gekennzeichnet.The results described above in connection with the Northern blot analysis were also confirmed by means of a semi-quantitative PCR. After semiquantitative RT-PCR with PKCG-specific primers, expression in a thyroid carcinoma cell was determined. The following is plotted on the agarose gel shown in FIG. 10: in lane 1 a marker (marker III (Röche), λ-DNA cut with HindIII-EcoRI), lane 2 a cell line of anaplastic thyroid carcinoma S277, lane 3 the cell line of the thyroid adenoma S40.2, lane 4 normal thyroid tissue, lane 5 a Heia cell, ie breast cancer, lane 6 the cell line MCF7 (ATCC number HTB-22, also an adenocarcinoma), lane 7 the cell line EFM19, a human breast cancer cell line (DSMZ number ACC231), lane 8 a negative control, lane 9 a positive control (detection of GAP dehydrogenase to prove the isolation of cDNA). 10 thus shows that in the case of anaplastic thyroid carcinoma S277 the expression of the PKCG gene, in the present case with a length of 2442 kb, could be determined. PKCG gene activity was also found in the MCF7 cell line. In Fig. 10 the corresponding bands are indicated by an arrow.
Die in der vorstehenden Beschreibung, dem Sequenzprotokoll und den Ansprüchen offenbarten Merkmale der Erfindung können sowohl einzeln als auch in beliebiger Kombination für die Verwirklichung der Erfindung in Ihren verschiedenen Ausführungsformen wesentlich sein. Der Offenbarungsgehalt der Ansprüche wird hiermit durch Bezugnahme aufgenommen.
The features of the invention disclosed in the above description, the sequence listing and the claims can be essential both individually and in any combination for the implementation of the invention in its various embodiments. The disclosure content of the claims is hereby incorporated by reference.