WO2002077282A1

WO2002077282A1 - Method of detecting gene

Info

Publication number: WO2002077282A1
Application number: PCT/JP2002/002893
Authority: WO
Inventors: Takeshi Yamamoto; Masafumi Ikeda
Original assignee: International Reagents Corporation
Priority date: 2001-03-27
Filing date: 2002-03-26
Publication date: 2002-10-03
Also published as: JPWO2002077282A1

Abstract

It is intended to provide a method whereby a specific nucleic acid sequence can be conveniently and quickly detected in a homogeneous system. A signal-generating label and a pair of labels provided in such a manner as to weaken the generation of the signal are attached respectively to the 5'-terminus of a probe DNA and the inside of its strand, the 3'-terminus and the inside of the strand, or both to the inside of the strand. Then the thus labeled probe is hybridized with a target nucleic acid and treated with exonuclease to thereby digest the probe DNA from the 5'- or 3'-terminus. Thus a nucleotide labeled with a reporter group or a quencher group within the strand and/or a nucleotide labeled with a substance capable of effectively weakening the signal of the signal generator are released from the probe DNA. Thereby, the effect of weakening the signal from the reporter group by the quencher group is lost or lowered and a detectable signal is generated, which enables the detection and quantification of a nucleic acid having a specific sequence.

Description

Specification

Gene detection method Technical field

The present invention relates to a method for analyzing genes mainly in the fields of clinical chemistry, drug chemistry, biochemistry, and food chemistry, and includes methods for detecting, quantifying, and mutating genomic genes, viruses, bacteria, and other genes. Used for detection of Background art

As an analysis method using a probe nucleic acid containing a sequence complementary to a target nucleic acid, the southern blot hybridization method and the northern blot hybridization method have been widely used for a long time. However, the operation was complicated, took a long time, and had to deal with radioactive materials.

Later, various analytical methods were developed to replace the Southern blot hybridization method and the Northern plot hybridization method! / Puru. In the Cycling Probe Technology (BioTechniques 20, 240-248, 1996), the reaction temperature is constant, and one probe is appropriately labeled with two fluorescent substances so that one can effectively quench the fluorescence of the other. in the detection child fluorescence emitted in can cut and, and _t and force it is possible and this to perform detecting at easily and swiftly homogeneous nucleic acid sequence, in this method, DNA-RNA-texture DNA Since the probe is used, the manufacturing cost of the probe is high.

In addition, the Hybridization Protection Assay was used as a homogeneous analysis method. Law (Clinical Chemistry 35, 1588-1594, 1984) Force S Reported. In this method, after a DNA nucleic acid labeled with an ata-dimeric ester is hybridized to a target nucleic acid and subjected to a hydrolysis treatment, the hybridized acryl-dimethyl ester is converted into a double-stranded nucleic acid. Therefore, it utilizes the fact that only the acridinium ester of the unhybridized probe is hydrolyzed and loses chemiluminescence. However, the hydrolysis operation is complicated and time-consuming.

In addition, a cyclase-assay method using λ-exonuclease (BioTechniques 13, 888-892, 1992), which specifically digests double-stranded DNA, and exonuclease III (JP-A-6-327499) was developed. Have been. In this method, an exonuclease acts on double-stranded DNA formed by hybridization of an oligonucleotide probe with a complementary sequence, and when the probe shortened due to digestion dissociates from the target nucleic acid, A new probe is hybridized and this process is repeated to establish a cycling reaction. The presence or absence of the target nucleic acid can be determined by detecting the degradation product of this probe. This method is useful in that the operation method is simple and the reaction temperature is constant, so that no special temperature control device is required. However, as a method for detecting this degradation product, only a complicated method using a radioactive substance is shown, and there is a problem in practicality. Disclosure of the invention

An object of the present invention is to provide a practical and simple homogeneous measurement method for a nucleic acid detection method using exonuclease. The present inventors have conducted intensive studies and found that a signal-producing label substance and a pair of label substances arranged so as to effectively attenuate the generation of the signal are each bound to a capture probe to obtain a target nucleic acid. To a nucleotide that has a function of effectively attenuating the signal of the signal-labeling substance and / or the signal of the signal-generating substance by the action of a certain exonuclease. The inventors have found that a signal can be obtained by releasing from the probe, and have completed a measurement technique capable of judging the presence / absence of a nucleic acid sequence and quantification using a homogeneous system using this mechanism.

That is, the present invention

1. A homogeneous measurement system for detecting a nucleic acid sequence using an oligonucleotide probe having a signal-generating label substance and a pair of label substances arranged to effectively attenuate the generation of the signal. After the hybridization between the target nucleic acid and the probe DNA, the probe DNA is moved from the 5 ′ or 3 ′ end by the action of 5 ′ → 3, exonuclease or 3 ′ → 5, exonuclease. A signal is obtained by digesting and releasing a signal-generating substance-labeled nucleotide inserted into the probe DNA and / or a nucleotide labeled with a substance having a function of effectively attenuating the signal of the signal-generating substance. A method for detecting a nucleic acid sequence,

2.5, → 3, the method for detecting a nucleic acid sequence according to 1 above, which is characterized by being an exonuclease S

3.3 '→ 5, the method for detecting a nucleic acid sequence according to item 1 above, wherein the exonuclease is exonuclease III; 4. It comprises a measuring reagent or a kit used in the nucleic acid sequence detection method according to any one of the above items 1 to 3. BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 is an explanatory diagram showing a range of a quantifiable amount of DNA (Example 3).

FIG. 2 is an explanatory diagram showing the minimum detection sensitivity (Example 3). BEST MODE FOR CARRYING OUT THE INVENTION

The present invention relates to a method for detecting a target nucleic acid (hereinafter, referred to as “target DNA”) and a method for detecting a gene mutation, which are intended to effectively attenuate the generation of a signal and a signal. Each of the paired labeling substances, which has been bound to a capture probe (hereinafter referred to as “probe DNA”), is hybridized to target DNA, and the signal-generating labeling substance is acted upon by the action of exonuclease. A method for easily determining the presence or absence of a target gene, quantifying it, and detecting a gene mutation using a mechanism whereby a signal is obtained by releasing a nucleotide bound to the probe DNA from the probe DNA. is there.

The combination of the signal-generating label substance and the pair of label substances arranged so as to effectively attenuate the generation of the signal in the present invention may be any combination having such a function. There is no particular limitation as long as it does not substantially hinder the hybridization of the DNA and the target nucleic acid. Preferably, those corresponding to optically detected signals are easy to handle and suitable. Furthermore, even if the optically detected signal is fluorescent, It does not need to be fluorescent and may not be particularly limited. Specifically, for example, the probe substances of probe DNA are Fluorescein and Tetramethylrhodamine, FAM and TAMRA, EDANS and DABCYL, FITC and DABCYL, Fluorescein and DABCYL, Fluorescein and Cy3, FITC and Cy3, Fluorescein and QSY. 7dye, but is not limited to these.

This signal generation labeling substance (hereinafter, also referred to as “reporter group”) is paired with a labeling substance having a function of effectively attenuating the generation of the signal (hereinafter, this is also referred to as “taenching group”). Is used. That is, the reporter group has a function of effectively attenuating the signal generated by the reporter group when the distance from the quenching group is shorter by + minutes. There is no particular limitation on the combination of labeling substances having such a function.For example, in the case of a fluorescent substance, when the fluorescence wavelength of the reporter group and the absorption wavelength of the quenching group have a common spectrum. It can be said that it has a function as such a pair of labeling substances.

Such a method using a pair of labeling substances is generally known as fluorescence resonance energy transfer (FRET) (Patent Publication 2000-509278).

In the present invention, a probe DNA having a pair of quenching groups and a reporter group is used, but if the labeled probe DNA has not been digested with exonuclease, no signal is detected or exonuclease is not detected. The pair of labeling substances must be arranged so that only a significantly lower signal is generated as compared with the case where the reporter group or the quenching group is released by the action of the above. One such example is the 5 'end of the probe DNA. Or 3, a quenching group at the end and a reporter group in the chain; 5, a terminal group at the terminal or 3 'end; a quenching group in the chain; a reporter group and a quenching group in the chain; Those having a reporter group and a quenching group at each end are exemplified. The distance between the quenching group and the reporter group only needs to be able to effectively attenuate the signal generation of one reporter group, but is preferably within 20 bases, more preferably within 10 bases.

The present invention uses a mechanism in which a signal is obtained from a reporter group when a probe DNA is digested by the action of exonuclease and a nucleotide labeled with either a reporter group or a quenching group is released. It is also characterized by detecting a nucleic acid sequence or detecting a gene mutation. The mechanism by which this signal can be obtained is as follows. That is, in the method for detecting a nucleic acid sequence, quenching is performed by hybridizing the probe DNA with the target DNA in a complementary manner and then digesting the probe from the 5 or 3 ′ end by the action of exonuclease. Signal is released by releasing the nucleotide labeled with the quenching group and the Z or reporter group, thereby increasing the distance between the reporter group and the quenching group and weakening the quenching group. It refers to the mechanism that produces it. When the target DNA is not present, the probe DNA is present as a single strand, so it is not digested by the double-strand-specific exonuclease, or is minimally digested. As a result, the signal generation does not occur, and the signal generation is significantly lower than when the target DNA is present. In addition, in a method for detecting a gene mutation, a probe DNA is hybridized with a target DNA to form a heteroduplex, and a base mutation, insertion, or deletion is present in the target DNA. Therefore, a protein having exonuclease activity recognizes a mismatch, bubble, or loop structure generated in the heteroduplex, and a probe is formed only when the mismatch, bubble, or loop structure is present. Digestion of DNA from its ends releases nucleotides labeled with a quenching group or reporter group, resulting in a greater distance between the reporter group and the quenching group, resulting in attenuation by the quenching group. A weak signal causes a signal to be generated. In the absence of mismatches, bubbles, or loop structures, is the digestion by exonucleases minimal, or even minimal, resulting in no signal generation? Signal generation is significantly lower than when a mismatch, bubble or loop structure is present.

The exonuclease used in the nucleic acid sequence detection method can release a nucleotide labeled with a quenching group or a reporter group in a probe DNA from a polynucleotide chain. Any 5 'exonuclease may be used, but examples thereof include 5'exonuclease; Escherichia coli exonuclease III as exonuclease and 3, exonuclease. it can. In addition, the protein having exonuclease activity used in the method for detecting a gene mutation recognizes a mismatch, bubble or loop structure in a heteroduplex, and has a mismatch, bubble or loop structure. Digest the probe DNA from the ends only if present, and use the quenching groups or repo in the probe DNA. Any protein capable of releasing a labeled nucleotide can be used, and is not particularly limited.A protein encoded by the human WRN gene (Nucleic Acids Research 28, 3260-3268 , 2000).

Furthermore, the conditions for carrying out the present invention will be described in detail, but these are merely examples and the present invention is not limited thereto.

Hybridization of the target DNA and the labeled binding probe DNA in the present invention is carried out after the target DNA is denatured into a single strand by denaturation. If the target DNA is single-stranded, there is no need for denaturation and hybridization with the probe DNA can be performed as it is, but hybridization due to the higher-order structure of the single-stranded target DNA is possible. In order to eliminate the possibility of inhibition of the enzyme, it is preferable to carry out a denaturation operation.

The modification method in the present invention may be in accordance with a commonly used method, and examples thereof include a method by thermal denaturation and a method by chemical modification. As a specific method, the method by thermal denaturation is usually performed by heating to 90 ° C or more. Preferably, denaturation is performed by heating at 94-97 ° C for about 5 minutes. The method by chemical denaturation is performed by the action of a denaturant such as urea or formaldehyde, or by increasing the pH. The pH can be increased by using 0.4 to 1. Omol / L NaOH. From the viewpoint of operability and the like, a method based on heat denaturation is preferably used.

The hybridization may be performed according to a commonly used method, but the conditions differ depending on the length of the probe or denatured double-stranded target DNA, base sequence, and Tm (melting temperature). Generally, a pH of 6.4 to 9.0 and a pH of 10 to 1000 mmol / L Hybridization is performed at room temperature to 70 ° C in the presence of stream ions.

In the case of FRET, fluorescence detection conditions include, for example, 5'-end of probe DNA with Dabcyl modification and Fluorescein modification in the chain, 3 '→ 5, degraded from 3' end by the action of exonuclease The emitted fluorescence is detected using a fluorimeter under the conditions of a maximum excitation wavelength of 49.4 nm and a maximum fluorescence wavelength of 51.8 nm.

The signal generated by the degradation of the probe DNA by exonuclease, for example, the fluorescence signal in the case of FRET, increases with the degradation reaction of the probe DNA, and the signal can be monitored during the reaction. However, by selecting an appropriate reaction time, reproducibility and quantitativeness can be improved and the measurement time can be shortened.

As the specimen, DNA extracted from a biological sample can be used, but the amount is often insufficient for analysis. In such a case, the nucleic acid extracted from the biological sample can be amplified by PCR or the like, and the amplified DNA product can be used for the gene mutation analysis according to the present invention. .

The probe DNA can be prepared by, for example, a chemical method using a general DNA synthesizer.

(Example) .

Hereinafter, the present invention will be described specifically with reference to examples, but the present invention is not limited to the following examples. (Example 1)

(1) Preparation of target DNA

As the target DNA, a double-stranded DNA whose human K-ras region was amplified by PCR was used. The sequence of the PCR primer is as follows.

Nucleotide sequence 1: 5'-GAGAGGCCTGCTGAAAATG

Nucleotide sequence 2: 5 '-CCTCTATTGTTGGATCATATTC

Prepare a 50 L reaction mixture containing lOpraol for each primer, 200 μmol / L for each dNTP, 1.25 U (D Ex Taq (Takara Shuzo), 1X Ex Taq buffer (Takara Shuzo), and about 100 ng of human genomic DNA. The gene was amplified by PCR by performing 35 cycles of the reaction at 94 ° C / 30 seconds, 55 ° C / 30 seconds, and 72 ° C / 20 seconds. Upon electrophoresis, a single band was identified, showing a mobility consistent with the expected amplification product size of 128 bp .. The PCR product was not purified and PicoGreen dsDNA Quantitation was performed. Quantification with Kit (Molecular Pres) Pi coGreen is a fluorescent dye that specifically stains dsDNA, and enables quantification of PCR products in the presence of primer DNA (Example 2).

(1) Probe D N A

A model system for detecting nucleic acid sequences was constructed using exonuclease III, which is a 3 'exonuclease, and a probe labeled with Dabcyl at the 5' end and Fluorescein in the chain. As the target DNA, a PCR product obtained by amplifying a partial sequence of the human K-ras gene was used. Oligonucleotide having the base sequence shown below as the probe DNA Leotide was chemically synthesized and used. Dabcyl is labeled at the 5 'end of the probe DNA and fluorescein is labeled in the strand. "Z" in the sequence represents Fluorescein-dT.

Nucleotide sequence 3: 5 '-GCTCCAACZACCACAAGTTTATATTCAGTC

(2) Reaction conditions

In the nucleic acid sequence detection method according to the present invention, the optimal amount of enzyme, probe DNA amount, NaCl concentration, reaction temperature, and hybridization conditions were examined. Based on the results, the operation method of this method was as follows. Determined. That is,

10 M probe D N A 0.5 μL

10 X Exonuclease III buffer (Takara Shuzo) 2 μI

1M NaCl 0.75 μL target D N A 1 μ I

Prepare 5.75 μl of dW in a well of Low Profile Multiplate 96 (MJ Research Inc.) and denature double-stranded target DNA by heating at 95 ° C for 5 minutes using a thermal cycler. Then, cool to 37 ° C and incubate for 1 minute at 37 ° C to hybridize the probe DNA and target DNA, and add 10 L of 1.35 U // L exonuclease III (Takara Shuzo), Incubation was performed at 37 ° C for 30 minutes. Then, the enzyme was heated at 70 ° C for 15 minutes to inactivate exonuclease III, and the fluorescence was read using a fluorescence plate reader CytoFluor Series 4000 (PerSeptive Biosystems) at an excitation wavelength of 485 nm and a fluorescence wavelength of 530 nm. Was measured. The final composition of the reaction mixture was 50 mM Tris-HCl (pH 8.0), 50 mM MgC12, 37.5 mM NaCl lOm Menolecapto ethanol, 375 nM probe DNA, 0.675 U / μL exonucleotide. Case III. (Example 3)

(1) Quantification range ''

The range of the amount of DNA that can be quantified by the method of the present invention was verified. As shown in FIG. 1, a good calibration curve was drawn until the PCR product amount was 300 fmol, indicating that the quantification range of the present method was wide.

(2) Minimum detection sensitivity

Using the PCR products of 0, 0.73, 1.45, 2.9, and 5.8 fmol as the target DNA, the mean value of the relative fluorescence intensity (RFU) and twice the standard deviation (2SD) of each four simultaneous measurements The value obtained by subtracting 2SD from the average RFU value is the minimum target DNA amount that does not fall below the value obtained by adding 2SD to the average RFU value at the target DNA force S0 fraol. Defined. According to this definition, the minimum detection sensitivity of this method was 1.45 fmol, indicating that it was extremely sensitive (Fig. 2). Industrial applicability

According to the present invention, specific detection and quantification of a nucleic acid sequence can be performed by a simple operation, so that automation is also easy. Further, the signal can be measured while the reaction is in progress, and the analysis result can be obtained quickly. As the exonuclease used in the present invention, any exonuclease can be used as long as it can release a nucleotide having a modified reporter group or signal group.

Claims

The scope of the claims

1. A homogeneous measurement system for detecting a nucleic acid sequence using an oligonucleotide probe having a signal-generating label substance and a pair of label substances arranged to effectively attenuate the generation of the signal. After hybridization of the target nucleic acid and the probe DNA, the probe DNA is converted to the 5 ′ or 3 ′ terminal by the action of 5, → 3 ′ exonuclease or 3, → 5 ′ exonuclease. By further digesting and releasing the signal-generating substance-labeled nucleotide inserted into the probe DNA and / or the nucleotide labeled with a substance having a function of effectively attenuating the signal of the signal-generating substance. A method for detecting a nucleic acid sequence, characterized in that a signal is obtained by the following method.

2. The method for detecting a nucleic acid sequence according to claim 1, wherein 2.5 ′ → 3, exonuclease is L exonuclease.

3.3. The method for detecting a nucleic acid sequence according to claim 1, wherein the exonuclease is exonuclease III.

4. A measuring reagent or kit for use in the method for detecting a nucleic acid sequence according to any one of claims 1 to 3. '