WO2002077280A1

WO2002077280A1 - Method of screening nucleic acid encoding signal transducer and kit and cells to be used in this method

Info

Publication number: WO2002077280A1
Application number: PCT/JP2001/008370
Authority: WO
Inventors: Takashi Saito; Hisashi Arase
Original assignee: Takashi Saito; Hisashi Arase
Priority date: 2001-03-26
Filing date: 2001-09-26
Publication date: 2002-10-03
Also published as: JPWO2002077280A1

Abstract

A screening system which comprises expressing a test nucleic acid (16) to be screened as an intracellular domain (26) of a chimeric molecular (22), and evaluating, via the expression of a reporter gene (20), whether or not this chimeric molecule (22) can transduce a signal transferred from an extracellular domain receptor (24) as an intracellular signal mediated by the intracellular domain (26) consisting of the above-described test nucleic acid product.

Description

Description Screening method for nucleic acid encoding a signal transduction factor, kit for use in the method, and cell

The present invention relates to a method for screening a nucleic acid that can participate in signal transduction and a kit thereof. The present invention also relates to cells that can be used in the above-described screening method or kit. Furthermore, the present invention relates to a signal transduction factor screened by the screening method and the like of the present invention. Background art

Recent research on intracellular signal transduction regulates various activities of organisms, such as cell proliferation, development and differentiation of organisms, and defense mechanisms against external factors and stress, through signal transduction pathways. It is being revealed.

For example, the immune response in τ lymphocytes also takes place via signaling. That is, when the antigen binds to MHC (major histocompatibility gene) and the complex binds to the receptor on the surface of the T cell and recognizes the antigen, the intracellular component (CD3 molecule) that binds to the receptor ) Is phosphorylated, and phosphorylation of this CD3 molecule activates intracellular enzymes (kinases) and signaling factors that become adapters, thereby activating NFAT (transcription factors) and translocating into the nucleus. It has been clarified that it induces cytokine expression as activated NFAT together with the factor (AP-1) whose expression was induced. In erythroid cells, for example, when erythropoietin binds to the erythropoietin receptor on the cell surface, the intracellular enzyme JAK that binds intracellularly to the erythropoietin receptor is activated. This activation of JAK activates STAT This STAT is translocated into the nucleus to promote gene transcription and induce cell proliferation. In addition, signaling pathways that induce apoptosis via FAS, FADD, and CASPACE are also known.

The various signaling pathways thus identified are actually activated and regulated under physiological conditions, and there is still a need to elucidate many signaling pathways and the factors involved in them. In the situation. It is also conceivable that, even with known signaling pathways, the adabu Yuichi factor that mediates this signaling is not yet known.

Conventional elucidation of signal transduction factors, etc. is screened using some kind of phosphorylation activity as an index, or the phenotype that occurs when the signal transduction pathway is activated (for example, IL-2 production in T cells) ) whereas _c screening is performed as an index, the signal transduction pathway that is relatively elucidated progressed, a system for analyzing the factors that more detailed each path of signal transduction or involvement has been developed. One of them is a method using a chimeric molecule by Bryan A. et al. (Oe / 764: 891-901 (1991), Methods Enzymol, 327: 210-28, 2000)).

This method has been developed to analyze the role of the signaling pathway in T cells, particularly the role of the CD3 chain of the T cell receptor. In this method, a chimeric molecule is constructed in which the extracellular domain of CD8 is linked to the intracellular domain of the CD3ζ chain. Then, this chimeric molecule is expressed in Τ cells separately from Τ cell receptor, and the chimeric molecule is artificially stimulated from outside the cell via CD8 with an anti-CD8 antibody, and a signal is transmitted inside the cell. Was analyzed using IL-2 production as an index. This analysis indicates that a chimeric molecule of the CD3 ^ chain and the extracellular domain of CD8 can activate signaling similar to that of the T cell receptor, and that other molecules of the CD3 complex (a, It has been shown that independent activation signals can be transmitted independently of (5, <<, etc.). As described above, the analysis system using chimeric molecules is effective for detailed analysis of known signal transduction pathways, especially for the analysis of the role of each signal transduction factor. Molecules are used.

Detailed analysis of signal transduction pathways is progressing with the above-described analysis system using chimeric molecules, and a screening system for identifying a new signal transduction factor is required for such an effective system.

In particular, in conventional screening systems, screening is performed using the intermediate activity of signal transduction pathways such as phosphorylation activity divided by the final phenotype of the signal transduction pathway as an index. In order to confirm that the factor obtained by this screening is truly involved in the signal transduction pathway, it is necessary to construct a system in which the factor is knocked out or a system in which the factor is highly expressed, and construct a signal transduction pathway. It was necessary to confirm the impact on the environment. In addition, even if such a time-consuming and complicated analysis was carried out, it was often found that factors obtained by screening did not participate in signal transduction pathways later.

In view of the above problems, the present invention has developed a screening system and the like that can rapidly and reliably screen nucleic acids involved in signal transmission using a chimeric molecule, and identified a novel signal transduction factor. The primary purpose is to do so. Furthermore, it is an object of the present invention to provide a novel signal transduction factor identified by the above-mentioned screening system, and to provide a cell for screening a signal transduction regulator using the novel signal transduction factor. Disclosure of the invention

The principle of the signal transduction factor screening system of the present invention is that a test nucleic acid to be subjected to screening is expressed as an intracellular domain of a chimeric molecule, and the chimeric molecule is transduced by a signal introduced from a receptor of an extracellular domain into a cell. Signal inside This is determined by measuring the expression of the repo overnight gene.

That is, the present invention provides a nucleic acid capable of regulating signal transduction using a receptor capable of introducing an extracellular signal into a cell as an extracellular domain and a transmembrane chimeric molecule comprising a test nucleic acid product as an intracellular domain. This is a screening method, which includes the following steps (1) to (4). (1) preparing a chimeric molecule expression vector capable of expressing the chimeric molecule by linking the receptor gene and a test nucleic acid to be carried in an expression vector; (2) intracellular signaling A step of introducing the chimeric molecule expression vector into a cell holding a repo allele gene whose expression is induced when is activated, and (3) an extracellular signal to a cell into which the quinula molecule expression vector has been introduced. And (4) measuring the expression level of the reporter gene after applying the extracellular signal factor. According to the above invention, the chimeric molecule is expressed in the cell into which the chimeric molecule expression vector has been introduced, and the receptor in the chimeric molecule is expressed in the extracellular domain, and the test nucleic acid product is expressed in the intracellular domain. When an extracellular signal factor is actuated in this state, a signal is transmitted to the intracellular domain via the receptor. Here, if the test nucleic acid product is a factor involved in signal transduction, this signal is transmitted as an intracellular signal. This signal induces the expression of the reporter gene retained in the cell, if necessary, through the adaptic factor in the cell. Therefore, it is possible to determine whether the test nucleic acid product functions as a signal transduction factor by detecting the final expression of the reporter gene. In the present invention, an intracellular signal transduction factor, which is induced when a signal is transmitted in a cell, binds to the upstream of the repo overnight gene to promote the expression of the repo overnight gene. It has a signal transduction factor binding site that can be used to enhance the signal transduction induction detection efficiency. CD 8 was used for the reception In such a case, an anti-CD8 antibody can be used as the extracellular signal factor. Using the GFP gene as the repo overnight gene, it is possible to detect the induction of signal transduction using fluorescence as an index. T cells can be used as the cells. Further, NFAT (nuclear factor of activated T cells) can be used for the signal transduction factor binding site. As the expression vector, a retrovirus vector having a high transfection efficiency can be used. Furthermore, the cell may have a plurality of types of reporter genes, and the plurality of types of reporter genes may be configured to be induced by different signal transduction factors in the cell. .

As described above, according to the present invention, screening is performed using the signal transduction activity of a test nucleic acid product as an index, and therefore, compared to a conventional system using phosphorylation or the like as an index, the signal is more efficiently and reliably obtained. It is possible to screen for factors involved in transmission.

The present invention further provides the principle of the same screening method as the above as a kit. That is, the kit of the present invention comprises a receptor capable of introducing an extracellular signal into a cell as an extracellular domain and a chimeric molecule provided with a test nucleic acid product as an intracellular domain, the nucleic acid capable of participating in signal transduction. This is a kit for screening for Escherichia coli, and includes the following components. (1) an expression vector for carrying the receptor gene and linking the receptor gene and a test nucleic acid to express the chimeric molecule; and (2) activating intracellular signal transduction. And (3) an extracellular signal factor for introducing an extracellular signal into the signal transduced protein expressed on the cell surface.

By making the above-mentioned screening system into a kit, it becomes possible to carry out the above-mentioned screening system quickly and easily. This is a new signaling factor Identification is promoted, and elucidation of new signaling pathways is expected.

The present invention provides cells that can be used for the above screening. That is, a cell for monitoring the regulation of intracellular signal transduction, which holds a reporter gene whose expression changes when intracellular signal transduction is regulated, and has an intracellular upstream of the repo allele gene. A signal transduction factor binding site capable of binding a signal transduction factor and changing the expression of the reporter gene is provided.

Further, the present invention provides a signal transduction factor obtained by using the above-mentioned screening method or the above-mentioned screening kit, and a DNA encoding the same. The signal transduction factor may be an amino acid sequence described in any one of SEQ ID NOs: 7, 12, and 14, or an amino acid having a deletion, insertion, or substitution in each of the amino acid sequences as long as it has a signal transduction activity. Consists of an array. In addition, the DNA encoding the above signal transduction factor is the same as the nucleotide sequence described in any one of SEQ ID NOs: 6, 11, and 13 or the DNA described in any one of SEQ ID NOs: 6, 11, and 13. It consists of a base sequence that hybridizes under stringent conditions.

Furthermore, the present invention provides a cell comprising a signal transduction factor identified by the above-described screening method and the like, and for screening a factor associated with intracellular signal transduction by the factor. This cell comprises (1) a receptor capable of introducing an extracellular signal into the cell as an extracellular domain and a transmembrane quinula molecule having a signal transduction factor as an intracellular domain; and (2) intracellular signaling is regulated. And an intracellular reporter gene whose expression changes when the amino acid sequence or the signal according to any one of SEQ ID NOs: 7, 12, and 14. An amino acid sequence having a deletion, an insertion, or a substitution in each of the amino acid sequences within a range having a transduction activity is provided, and an upstream of the reporter gene is bound with an intracellular signal transduction factor to bind to the reporter gene. Signaling factor binding sites are provided that can alter expression. By further identifying the substance capable of increasing or decreasing the expression of the reporter gene by the signaling factor when the test sample is further applied to the cells, inhibition of the signaling pathway involving the signaling factor is identified. It is also possible to screen for factors and promoting factors. BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 is a diagram schematically showing the screening method of the first embodiment. (A) shows the construction process of the chimeric molecule expression vector. The figure shows the configuration of the chimeric molecule expression vector. (B) shows the process of introducing and expressing the chimeric molecule in the monitor cell. The figure schematically shows the state of the cell when the chimeric molecule is expressed in the monitor cell. (C) shows a step of selecting a cell expressing the repo overnight gene, and (D) shows a step of cloning a test nucleic acid from the selected cell.

FIG. 2 is a diagram schematically showing the construction of pNFAT-GFP.

FIG. 3 is a diagram schematically showing the construction of the pMX-CD8 vector.

FIG. 4 is a histogram diagram showing the results of fractionating GPT-positive cells by flow cytometry in Example 4. (A) shows a histogram of flow cytometry before fractionation, and (B) shows a histogram of flow cytometry after fractionation three times. ,

FIG. 5 is a diagram showing a FACS fractionation pattern when the signal transduction inducing activities of NFAM-1, 2, and 4 were confirmed. In the cells having NFAM-1, 2, and 4, the cell peak moved in the direction of higher fluorescence emission intensity, and in particular, strong fluorescence emission, that is, signal transduction induction was observed in NFAM-1.

FIG. 6 is a diagram showing NFAM-1 which strongly induced signal transduction in comparison with other known ITAM-containing signal transduction factors. BEST MODE FOR CARRYING OUT THE INVENTION

Hereinafter, embodiments of the present invention will be described in detail with reference to the drawings.

(1) A method for screening a nucleic acid encoding a signaling factor

The present invention relates to a method for screening a nucleic acid encoding a signal transduction factor. In the screening method of the present embodiment, a chimeric molecule comprising a test nucleic acid product as an intracellular domain and a receptor molecule as an extracellular domain is expressed in a cell, and an extracellular signal factor acts on the receptor molecule. Here, when the test nucleic acid of the chimeric molecule is involved in signal transmission, it becomes possible to receive a signal from the receptor. This signal is then transmitted intracellularly, ultimately inducing reporter gene expression. Therefore, it is possible to screen for a nucleic acid encoding a signal transduction factor using the final reporter gene expression as an index. The screening method based on the above principle can be specifically carried out by a series of steps described below.

① Chimera molecule expression

In order to express a chimeric molecule in cells, as shown in FIG. 1 (A), a chimeric molecule expression vector in which a cassette encoding a chimeric molecule is carried on an expression vector 10 is prepared. This cassette has a reading frame between the receptor gene 14 and the test nucleic acid 16 across the transmembrane sequence 12 in order to express the receptor as an extracellular domain and the test nucleic acid as an intracellular domain. And a stop codon is inserted downstream of the test nucleic acid 16.

Here, the expression vector 10 is not particularly limited as long as it is a vector that can be efficiently introduced into cells thereafter, and is not limited to a vector that can be introduced as a virus particle or a vector that can be introduced as a plasmid. Either may be used. For example, retrovirus vector, adeno-associated virus vector, vaccinia virus vector, lentivirus vector, herpesvirus vector, alphavirus vector, EB Examples include virus vectors such as virus vectors, papilloma virus vectors, and foamy virus vectors, and non-viral vectors such as cationic ribosomes, ligand DNA complexes, and cancer.

Receptor gene 14 also means a gene that encodes a factor that can introduce an extracellular signal into a cell in addition to a gene that encodes a receptor, and is not limited to a gene that encodes a receptor. . Accordingly, the present receptor gene 14 includes, for example, CD8, CD25 (Letourneur F et al., Cell 69: 1143-57 (1992)) and CD 16 (Kolanus W et al. 74: 171-83 (1993), Romeo C et al., (¾768: 889-97 (1992)) ヽ CD2 (Yamasaki S et al., Mol. Cell. Biol 16: 151-60)

(1996)). Also, EGF-R (Epidermal growth factor receptor) such as growth factor receptor and PDGF-R

(Platelet-derived growth factor receptor) (Seedorf K. et al., J. Biol. Chem. 266: 12424-31 (1991), Adam D. et al. J. Biol Chem. 268: 19882-8 (1993)), GH

(Growth hormone) Yuichi Recept (Behncken SN. Et al., J. Biol. Chem. 275: 17000-7

(2000)), TNF (tumor necrosis factor), Fas (Bazzoni F. et al.) Proc. Natl. Acad.

92: 5376-80 (1995), Ishiwatai'i-Hayasaka H. et al., J. Im uo J. 163: 1258-64

(1999)) can also be used.

It is not necessary to use the full length of the gene, and the gene may be a sequence portion encoding a region capable of receiving an extracellular signal and transmitting a signal to an intracellular domain.

The test nucleic acid 16 is a nucleic acid to be examined whether or not it encodes a signaling factor. As the test nucleic acid 16, genomic DNA, cDNA or the like derived from various mammalian cells can be used. For convenience, a chimera molecule expression vector library may be constructed using, for example, an existing cDNA library and genomic library as shown in FIG. 1 (A). ② Introduction of the chimeric molecule expression vector into cells carrying the repo overnight gene First, before carrying out this step, prepare cells carrying the repo overnight gene shown in Fig. 1 (B). This repo overnight gene 20 is constructed so that expression is induced by detecting that a signal has been transmitted into a cell. In order to be able to detect that a signal has been transmitted in a cell, for example, a site where a signal transduction factor capable of inducing transcription binds upstream of the repo overnight gene 20 (hereinafter referred to as a “signal factor binding site”) ) Can be provided. The signal transduction factor that induces this transcription may be any signal transduction factor that can promote the transcription of the downstream repo overnight gene. For example, NFAT (Hoey, T. et al., Immunity 2: 461- 472 (1995) NF cB (Phillips, E. et al. Genes Dev. 6: 775-87 (1992)), STAT (EHana, M. et al., J. Biol. Chew. 274: 6698-6703 (1999)), etc. The signal factor binding site is selected from those corresponding to the signal factor, for example, when NFAT is used as the signal transduction factor, the NFAT binding sequence is used as the signal transduction factor binding site. It is preferable that a binding sequence corresponding to each of the transfer factors is used.

In addition, it is preferable to select a repo overnight gene whose expression can change the phenotype of a cell. For example, Kufuke GFP (Green fluorescent protein), RFP (Rea fluorescent protein), etc., which emit fluorescence when a gene is expressed, can be suitably used, and emits fluorescence when reacted as a substrate. As a reporter gene, 5-galactosidase gene Prog. Neur. 63: 673-686 (2001)), lactamase gene Prog. Neur. 63: 673-686 (2001)) and the like can be used. In addition, thymidine kinase gene Mol. Cell. Biol. 20: 3266-3273 (2000)), diphtheria toxin A chain gene is a reporter gene that is cytotoxic by its expression and can be detected by cell death. (mJuity 3: 239-250 (1995)). Also, as a reporter gene, Cell surface antigen genes whose expression can be detected using a specific antibody and a separator MACS (Magnetic ceU sorter), such as the CD8 gene (C¾i2cer¾s. 58: 14-19 (1998)), truncated rat CD2 (Immunol Lett. 71: 61-66 (2000)) _N CD24 (Blood 94: 2271-2286 (2000)) can also be used. In addition, a gene encoding Cameleons that detects and fluoresces Ca ²⁺ (rc ^. Neur. 63: 673-686 (2001)), encodes camgai'oos, which emits fluorescence due to structural changes Gene: Prog. Neur. 63: 673-686 (2001)), and a gene encoding pHluoiins that emits fluorescence by detecting a change in pH (¾¾A¾ £ / r. 63: 673-686 (2001)). It can be used as a gene overnight.

Further, the reporter gene is not limited to one type, and a plurality of types may be retained in the cell. In this case, it may be configured such that nucleic acids involved in different signal transduction pathways can be distinguished and screened. For example, the GFP gene is used for one repo overnight gene, and an NFAT binding sequence is arranged upstream thereof. The other repo is using the RKP gene as the gene, and an NFATB binding sequence is located upstream of it. With such a configuration, factors involved in the signal transduction pathway involving NFAT can be identified using green fluorescence as an index, and factors involved in the signal transduction pathway involving NF ATB can be identified by red fluorescence. Can be identified using as an index. By using a plurality of reporter genes and signal transduction factor binding sequences in this way, it becomes possible to simultaneously screen a plurality of types of signal transduction factors.

On the other hand, the cell into which the reporter gene having the above-mentioned signal factor binding site is introduced is not particularly limited. The cell is naturally provided with a receptor, etc., and a signal is transmitted into the cell via the receptor. Preferably, the cell is one that can be used. With such a cell, it was determined whether the introduction of the repo overnight gene described below, and whether the expression of the reporter gene could function as an indicator of signal transduction after the introduction of the sidanal from the receptor. Can be confirmed through expression of the reporter gene in the above. this Examples of such cells include lymphoid cells, hematopoietic cells, and the like. The method of introducing a reporter gene into the cells can be performed by any method that can introduce a nucleic acid into cells, such as electroporation, a lipofection method, or a calcium phosphate method. In addition, retention of the introduced repo gene in a cell can be carried out outside the chromosome using a plasmid or the like, or can be carried out in the chromosome by integration. It is only necessary that the gene be kept stable.

In addition, selection of cells into which the reporter gene has been introduced can be performed by PCR, Southern blotting, stamp lotting, or when the reporter gene is expressed, using the presence or expression of the above-mentioned reporter gene as an index. In addition to the method of detecting a phenotype, a marker gene such as a drug resistance gene may be introduced, and the marker gene may be selected as an index. The phenotype when the reporter gene is expressed can be detected by introducing a signal from the above-described natural receptor to express the reporter gene. In other words, when a cell naturally has a receptor, a specific antibody or the like acts on the receptor, and an external stimulus (signal) is applied to transmit the signal into the cell. Let it. Here, in a cell into which the repo overnight gene has been introduced, the repo overnight gene is expressed by a signal in the cell. Therefore, cells into which the reporter gene has been introduced can be selected using the expression of the repo overnight gene as an index. In such a case, it is possible to select cells into which the repo overnight gene has been introduced, and at the same time, confirm that the repo overnight gene is expressed in response to intracellular signal transduction.

After obtaining cells having the reporter gene, a chimeric molecule expression vector is introduced into the cells. This method of introduction needs to be selected according to the expression vector used. For example, expression vectors such as retrovirus vectors In the case of using a virus vector that forms a virus particle, a commercially available packaging kit can be used to generate the virus particle according to a normal packaging protocol, and then introduce the virus particle by infecting the cell. it can. When a vector that does not generate virus particles is used, the chimeric molecule expression vector must be introduced into cells by electroporation, lipofectin, lipid, calcium phosphate, etc. known to those skilled in the art. Can be.

In cells into which the chimeric molecule expression vector has been introduced as described above, the receptor 24 of the chimeric molecule 22 is expressed in the extracellular domain as shown in Fig. 1 (B), and the cDNA library is contained in the intracellular domain. One or more test nucleic acid products 26 are expressed. Therefore, such cells can be purified by selecting using an antibody that specifically reacts with receptor 124 expressed as an extracellular domain. The yo Ri specifically, to a solid phase bound antibodies specific for the receptions evening one in the chimeric molecule, and _c can be captured by contacting a cell chimeric molecule of interest is expressed recovered It can also be obtained by using a secondary antibody against an antibody specific to the receptor bound to a solid phase (for example, beads). Alternatively, cells expressing the receptor can be fluorescently stained with a fluorescent-labeled specific antibody, and the stained cells can be separated using a cell sorter (FACS or MACS).

③ Action of extracellular signal factor

Applying an extracellular signaling factor to cells into which the chimeric molecule expression vector has been introduced. The extracellular signaling factor may be any as long as it can introduce a signal into the cell from the receptor in the chimeric molecule. In addition to using a natural ligand, an antibody specific to this receptor may be used. For example, for CD8, CD25s CD16 _S CD2, etc., which can be used as a receptor, specific antibodies corresponding thereto can be used. In addition, when EGF-R, PDGF-R, GH receptor, TNF, and Fas such as growth factor receptor were used, The corresponding ligand ゃ specific antibody can be used as an extracellular signal factor.c When the above extracellular signal factor is caused to act on receptors expressing in cells, The extracellular signal may be added. Alternatively, the extracellular signal factor may be immobilized on a plate for culturing cells in advance, and the cells may be cultured in the plate.

工程 Repo overnight gene expression detection process

As described above, the signal is introduced into the receptor on the cell surface by causing the extracellular signal factor to act on the cell. This signal is transmitted to the test nucleic acid product in the intracellular domain constituting the chimeric molecule together with the receptor. If the test nucleic acid product can transmit a signal from outside the cell into the cell, the signal introduced from the receptor is transmitted to an intracellular adapter factor or the like, and finally the reporter gene Expression is induced. Therefore, by detecting the expression of the reporter gene after the action of the extracellular signal factor from changes in the phenotype of the cell, etc., it is possible to determine whether or not the test nucleic acid product is a factor involved in signal transduction. it can. For example, when a gene encoding a protein that emits fluorescence, such as GP, is used as the reporter gene, the phenotype of fluorescence emission in the cells after the action of the extracellular signal factor is used as an index for flow cytometry. By fractionating, cells that hold the test nucleic acid encoding the signal transduction factor can be screened. If there are few positive cells that emit fluorescence during screening and detection is difficult, a cell fraction that is considered to be a positive cell may be amplified by culturing, etc. The steps from the step of applying a stimulus to this step may be repeated again to amplify the target cells.

⑤ Cloning

Cells screened by the above series of steps include factors involved in signal transduction as the intracellular domain of the chimeric molecule. The signal obtained here Confirmation of the action of the transfer factor and confirmation of the strength of the signal transduction activity can be performed using the above-described series of screening methods. That is, the intracellular domain of the chimeric molecule expression vector is recovered from the screened cells and subcloned again into the vector used for constructing the chimeric molecule. The subcloned cells are introduced again into the cells carrying the repo overnight gene, the chimeric molecule is expressed, and a signal is introduced by externally stimulating the receptor. Based on the expression and intensity of the intracellular repo gene at that time, the action and relative intensity of the obtained signaling factor can also be measured.

In addition, the sequence of the signal transduction factor can be determined by recovering the intracellular domain region from the expression vector of the chimeric molecule in the cell and performing cloning and sequence determination according to a standard method. Then, by comparing the sequence determined here with a conventional gene sequence involved in signal transduction, it can be determined whether the gene is a known gene or a new gene as a signal transduction factor.

The active site of the screened signaling factor can be identified by the following procedure. A series of deletions is prepared in which the intracellular domain region in the chimeric molecule expression vector collected above is deleted stepwise using a method known to those skilled in the art or a commercially available kit. These are returned to the above-mentioned expression vector again to construct a chimeric molecule expression vector. Then, similarly to the above-described screening method, these are introduced and expressed in cells holding the above-mentioned reporter gene, and signal transduction is performed using the expression of the reporter gene when an external stimulus is applied as an index. It is determined whether the activity remains. Then, the region retained in the clone in which the activity remains can be identified as a sequence required for signal transduction.

As described above, according to the screening method of the present invention, the signal Since the screening is performed using the transduction activity as a direct index, a signal transduction factor can be obtained with high efficiency. Further, the method of the present invention can be used not only for identification of a novel signal transduction factor, but also for confirmation of signal transduction activity, identification of an active site, and the like.

(2) Kit for Screening for Nucleic Acids That Can Control Signaling The present invention provides a screening kit based on the above-mentioned principle to more easily execute the above-mentioned screening method. The screening kit includes (1) an expression vector for carrying the receptor gene and expressing the chimeric molecule by linking the receptor gene and the test nucleic acid; and (2) activating cell signaling. Including a cell carrying a repo allele gene whose expression is induced upon transformation into a cell, and ③ an extracellular signal factor for introducing an extracellular signal into the signal transducing protein expressed on the cell surface. Can be.

The cells and extracellular signal factors that hold these repo overnight genes can be prepared according to the above description of the screening method. The expression vector can also be adjusted according to the above description of the method, but may be configured as follows to facilitate insertion and excision of a desired nucleic acid as a test nucleic acid. The expression vector is provided with a receptor gene, a transmembrane region, and a stop codon in that order, and a desired nucleic acid as a test nucleic acid is inserted between the transmembrane region and the stop codon. A multi-cleaning site can be provided to obtain In addition, the transmembrane region is not always necessary in consideration of screening of a signal transduction factor having a transmembrane region. However, in the screening of the present invention, not only a transmembrane signal transduction factor but also intracellular Since the purpose is to screen for adapter factors that mediate signal transduction, the expression vector should be provided with a transmembrane region as described above so that such factors can also be screened. Is preferred. The transmembrane region is the receptor used as the extracellular domain. Specific transmembrane domains such as EGF-R, PDGF-R, GH receptor, TNF, Fas, etc., growth factor receptors such as CD25, CD16, CD2, etc. In addition, a transmembrane region different from the receptor molecule may be used as long as it can transmit a signal from the receptor molecule to the intracellular domain.

As the test nucleic acid, cDNA derived from various cells or tissues may be used, and a sample obtained by fragmenting genomic DNA to a desired length may be used. These cDNAs and nucleic acids derived from the genome can be prepared from desired cells according to methods well known to those skilled in the art. Alternatively, cDNAs or genomic DNAs derived from various organisms or tissues may be inserted in advance into the expression vector as test nucleic acids and provided as a chimeric molecule expression library or the like.

In addition to the above configuration, the kit can include necessary reagents, a medium for cell culture, and the like. Further, a protocol indicating the screening method according to the first embodiment and the like can be included.

In addition, the kit described above may be packaged and provided with all the reagents and the like necessary for screening. However, if necessary, it may take a long time to prepare a repo kit. May be provided. By providing such cells in advance, the screening method can be easily carried out.

(3) Signaling factors.

The novel signal transduction factors obtained by the above screening will be useful for elucidating the intracellular signal transduction pathway. In order to analyze what kind of pathway the obtained signaling factor is involved in, known methods for analyzing interactions, such as the TWO-hybrid system developed in yeast, immunoprecipitation, etc. To search for a substance that interacts with the signaling factor, and The transmission pathway can be elucidated or identified. The above TWO-Hybrid system can be carried out according to T. Durfee et al. Genes Dev. 7: 555 (1993) or using MATCHMAKER (clonetech) according to the attached protocol.

In addition, by analyzing the interaction as described above, it is also possible to obtain inhibitors, promoters, and the like for signal transduction factors. Cells that have been screened for the above-described signaling factor are useful for determining whether a substance that interacts with the signaling factor is an inhibitor or a promoter. The cell is provided with a chimeric molecule having an extracellular domain, Recept, and an intracellular domain, a signaling factor linked thereto, and a reporter gene expressed by signal transduction in the cell. It is provided. Therefore, in order to analyze whether the substance is an inhibitor or an accelerator, a signal is introduced into the receptor in the presence of these candidate substances, and the signal transduction through the intracellular domain is performed as compared with the case where these substances are not present. The expression level of the reporter gene is measured to determine whether the activity decreases or increases. If the signal transduction activity is higher than that in the absence of the candidate substance in the measurement result, the candidate substance can be determined to be a promoter for the signal transmission factor, and the signal transduction activity is higher than that in the absence of the candidate substance. Can be determined to be an inhibitor.

In addition, the DNA encoding the above-mentioned signal transduction factor can be used as a probe, a primer, or the like for screening a similar nucleic acid encoding a signal transduction factor in a homologous or heterologous organism. That is, a DNA encoding an intracellular domain is recovered from the screened cells, and the DNA is used as a probe and the like to select a nucleic acid that forms a hybrid, whereby a signal transduction factor can be isolated from a homologous organism or a heterologous organism. The encoded nucleic acid can be further screened.

Specific examples of such a signal transduction factor include, but are not limited to, the polypeptides of SEQ ID NOs: 7, 12, and 14. Instead, a polypeptide comprising an amino acid sequence having a deletion, insertion, or substitution in the amino acid sequence of SEQ ID NO: 7, 12, or 14 can be used as long as it has a signal transduction activity. In the “substitution, deletion, insertion and / or addition” in the amino acid sequence, the number of amino acid mutations and mutation sites are not limited as long as the signal transduction activity is maintained. These polypeptides are useful for preparing a specific antibody against the signal transducing factor and analyzing the interacting substance.

Examples of the nucleic acid encoding the signal transduction factor include the DNAs of SEQ ID NOs: 6, 11, and 13, and as described above, any of the SEQ ID NOs: 6, 11, and 13 DNA that hybridizes with the above DNA under stringent conditions can also be used. The stringent hybridization conditions for isolating DNA can be appropriately selected by those skilled in the art. For example, in a hybridization solution containing 25% formamide, under more severe conditions 50% formamide, 4X SSC, 50mM Hepes ρΗ7.0, 10X Denhardt's solution, 20〃g / ml denatured salmon sperm DNA, 42 After performing the pre-hybridization at ° C, the labeled probe is added, and the hybridization is performed by keeping the temperature at 42 ° C for a while. The cleaning solution and temperature conditions for subsequent cleaning are lxSSC, 0.1% SDS, 37 ° C, more severe conditions are 0.5xSSC, 0.1% SDS, 42 ° C, and more severe conditions are 0.2xSSC, 0.1 % SDSs can be performed at 65 ° C. However, the combination of the above SSC, SDS and temperature conditions is an example, and those skilled in the art will recognize the above or other factors (eg, probe concentration, probe length) that determine the stringency of hybridization. By appropriately combining the hybridization reaction time and the like, it is possible to realize the same stringency as described above.

Example

[Example 1] Preparation of NFAT-GFP T cell hybridoma strain as a monitor cell First, the construction process of pNFAT-GFP plasmid for introduction into cells is shown in FIG. pNFAT-luciferase (Clip stone et al., Nature 357: 695-697 (1992)) has a three-fold co-directional repeat of an NFAT-binding sequence (TAAAGAAAGGAGGAAAAACT: SEQ ID NO: 8) upstream of the luciferasee gene and an IL-2 promoter. The evening minimum unit (sequence number 9) is provided. This plasmid is digested with an enzyme to cut out the NFAT-IL-2 promoter overnight, inserted into pBluescript, and further downstream of pEGFP-N1.

The plasmid was ligated with an EGFP fragment excised from (Clonetech) and a fragment containing a polyA signal to prepare pNFAT-GFP plasmid.

This plasmid was linearized with taI. This linear pNFAT-GFP (30 ig) was converted to a T cell hybridoma cell line 2 B4 (Hedrick, S., et al. Oe7 / 30: 141-152 (1982)).

(1 × 10 ⁷ cells) by electroporation. The electroporation was performed using OPTI-MEM (Gibco-BRL) under the conditions of 300 V and 975 / F using Gene Pulserll (manufactured by Biorad).

Next, cells transfected with NFAT-GFP were screened using the anti-T cell receptor Yuichi Monoclonal Antibody H57.597 (Ralph Kubo, J. Immunol 142: 2736-2742 (1989), available from Pharmingen). did. That is, the signal transduction pathway is activated by being stimulated by the monoclonal antibody, and the cell holding the NFAT-GFP cassette emits green fluorescence. Therefore, the cells emit fluorescence after stimulation with the above-mentioned monoclonal antibody.

By selecting with (FACS), cells retaining NFAT-GFP cassette can be obtained.

More specifically, stimulation with the antibody, or roughness 0.1 M NaHCO ₃ in 10〃G / ml H57.597 were prepared in concentrations antibody (0.3 ml) into each of the 6 well plate Ueru dimethacrylate After performing electroporation under the above conditions, cells on the second day (total number of cells 5 × 10 ⁶ ) are dispensed into each well in ⁵ × 10 ⁵ cells, and 6 hours Performed by incubating. The cells were then FACStai ^'plus emitted fluorescence by the antibody stimulation (Becton Dickinson Inc., California, USA) was measured using a selected group of cells fluorescing.

By repeating the above procedure from the monoclonal antibody stimulation to FACS selection two more times, almost all cells screened finally express GKP upon induction of stimulation through T cell receptor. did.

Furthermore, these cells were separated into single clones by limiting dilution. In order to confirm that these clones express GFP specifically in response to the stimulation of TCR by the anti-T cell receptor monoclonal antibody, the stimulation operation of the above antibody was performed using anti-T cell Recept was performed using an antibody other than the monoclonal antibody. As a result, it was confirmed that antibodies other than the anti-T cell receptor monoclonal antibody did not express GFP and did not emit fluorescence as a background. Among them, a representative clone among the cloned clones was established as a 43-1 cell line, and this cell line was used in the subsequent Examples.

[Example 2] Construction of cDNA library

c mRNA, which is the basis of DNA library construction, was prepared from NK cells.

(1) Preparation of NK cells: NK cells were purified from spleens of 6- to 8-week-old C57BL / 6 mice. Lymphocytes are mixed with an anti-CD4 monoclonal antibody (GK1.5: Pharaiingen) or an anti-CD8 monoclonal antibody (53.6.7: Pharmingen), and then conjugated with anti-mouse IgG antibody and anti-rat IgG antibody. The bound magnetic beads (Poly Science, Inc.) were incubated to remove surface Ig ⁺ (sueface Ig ⁺ : sIg ⁺ ) B cells, CD4 ⁺ T cells and CD8 + T cells. The remaining cells are FITC-labeled anti-DX5 antibodies (5 µg / ml), which are monoclonal antibodies specific to the surface antigen DX5 possessed by NK cells

(Pharmingen, CA) to stain NK cells, followed by microbead-anti-FITC antibody (20-fold dilution, Miltenyi Biotec Inc. Germany) Cupped. Thereafter, NK cells, which are DX5 + cells, were purified by MACS (Miltenyi Biotec Inc.) using a Midi column. A portion of the purified NK cells was human recombinant IL-2 (available from Shionogi and Genzyme) with RPMI-1640 containing 10% FCS and 0.05 mM 2-mercaptophenol (10,000 U / ml) In the presence

Cultured for 7 days.

(2) Purification of mRNA from NK cells and preparation of cDNA library: Poly A + RNA of whole spleen cells or NK cells exposed to IL-2 was purified using mRNA purification kit (Amersham Pharmacia Biotech, NJ). And purified. The synthesis of cDNA from purified mRNA uses random primers and the Superscript Choice System

(Gibco BRL, ML).

On the other hand, the pMX-CD8 vector for introducing the above cDNA was constructed as shown in FIG. As shown in FIG. 3, an oligonucleotide (e.g., gaattcTGAATCGTAGATACTGAgcggccgcc) having EcoBl and No & at the end of the site of the pMX vector (Onislii, M. et al. Exp. Hematol. 24: 324-9 (1996)). A stop codon was introduced using SEQ ID NO: 10) (pMX-STOP). Next, a 5 'primer containing the start codon ATG of the CD8 gene (5, CCG GGA TCC ATG GCC TCA CCG TTG ACC CGC TTT 3': SEQ ID NO: 4) and an EcoRI site immediately after the transmembrane region (TM) Using the attached 3 'primer (5, CCG GAATTC GAT GAG AGT GAT GAT CAAGGA 3': SEQ ID NO: 5), the CD8 plasmid (Nakauchi H et al. Proc. Natl Acad. Sci. USA. 82: 5126-30 (1985)), and PCR was performed to amplify the CD8-TM fragment (SEQ ID NO: 3). The obtained CD8-TM fragment was subcloned into the α¾Ι site of pMX-STOP to construct a pMX-CD8 vector. This PMX-CD8 vector was digested with EcoEI, and the cDNA synthesized above was ligated to this EcoKL site. The cDNA ligated into the vector is transferred to ElectroMAX DH5 combinative cells (Gibco, BRL). More introduced. set of c DNA library was ⁶ X 1 0 6. The average size of these cDNA inserts was about 1 Kb. E. coli is spread in SeaPrep agarose. Husd's DA Quiagen plasriud purification kit (purified using Quiagen).

[Example 3] Preparation of retrovirus library and its infection

Preparation of the retrovirus library was performed using Phoenix-E packaging cells (Nolan, G.D and Shatzman A.R., Curr.Opin.Biotechnol. 9: 447-450 (1998)).

The above-mentioned Phoenix-E cells (1 × 10 ⁶ ) are dispensed into four wells of a 6-well plate (Falcon) for transduction using one library, and cultured using DMEM (5 ml) containing 10% FCS. did. The cDNA library was transduced into Phoenix-E cells using Lipofectamine Plus (Gibco BRL) according to the attached protocol. The next day, the medium was changed using DMEM (5 ml) containing 10% FCS. Two days later, the culture supernatant was collected as a virus supernatant.

On the other hand, 43-1 cells (1 × 10 ⁵ cells) suspended in 10% FCS—RPMI 1640 (100〃1) were dispensed into a 24-well plate. The virus supernatant (100/1) was added thereto and incubated in the presence of DOTAP (Roche) (10 ig / ml). For a single infection, 5 × 10 ⁷ cells of the 43-1 cell line were used. The infection efficiency at this time was measured using a control vector (pMx-GFP: Toshio Kitamura, Int. J, Hematol 67: 351-359 (1998)). Infection efficiency was approximately 20%.

The following procedure was performed to select cells in which the library was transduced and CD8 was expressed on the cell surface (CD8 ⁺ cells). That is, all cells infected with the virus library were reacted with FITC-anti-CD8 monoclonal antibody (5 μg / ml, 500 zl) (Parmingen). Then, the cells were incubated with anti-PTTC monoclonal antibody-conjugated microbeads (20-fold dilution, 500〃1). This Cells expressing CD8 on the cell surface (CD8 + cells) were purified by MACS using a Midi column.

[Example 4] Screening of positive clones in which signal transduction was activated When a signal was introduced from outside the cell using an anti-CD8 monoclonal antibody, cells in which signal transduction was activated were screened.

Specifically, FITC-anti-CD8 monoclonal antibody (53.6.7) diluted to 100 ug / ml with 0.1 M NaHCO ₃ is injected into a 6-well plate and incubated at 4 ° C. And thereby immobilized. Plates coated with antibodies were washed three times with PBS. After washing, 5 × 10 ⁵ cells of the ripelily-infected cells of Example 3 were dispensed into each well and stimulated with the antibody for 12 hours. Thereafter, GFP-positive cells were fractionated using FACStar ^plus (Becton Dickinson). The results of FACS are shown in FIG. 4 (A). Of these, the GFP + fraction indicated by the arrow L in FIG. 4 (A) was collected.

To amplify GKP-positive cells in the recovered GFP ⁺ fraction, two days after the first antibody stimulation, the recovered cells were contacted with the anti-CD8 monoclonal antibody as a second stimulation. Cells that became GF-positive by this second stimulation were similarly fractionated using FACStar ^plus . After a further 7 days, cells whose GFP activity decreased and became GFP negative were fractionated and collected. The next day, the plate was restimulated with the anti-CD8 monoclonal antibody immobilized on the plate, and cells that showed GFP-positive again were fractionated and collected using FACStar ^plus as described above. The results of this final FACS are shown in Fig. 4 (B). This series of amplification procedures enabled visual detection of GFP + cells even in the FACS fractionation pattern.

Two days after the final antibody stimulation, cells were subjected to limiting dilution and cloning. Each of the clones cloned here was added to a 96-well plate on which an anti-monoclonal antibody (ΙΟΟμ ^ ιηΙ, 50μ1 / well) was immobilized, and the antibody was stimulated again. After antibody stimulation, the GFP expression of each clone was analyzed by FACScalibm '(Becton Dickinson). [Example 5] Recovery and sequencing of nucleic acid that activates signal transduction

In Example 4, DNA was collected from clones that expressed GPT by antibody stimulation using an anti-CD8 monoclonal antibody. The recovery was carried out using a standard method, the phenolic phenolic method (Molecular cionmg, Cold Spring Harbor Laboratory Press (1989)). In each of these clones, it is considered that the cDNA insert product is expressed in the cell together with the extracellular domain CD8 as a chimeric molecule. To confirm this insert sequence, the insert was amplified by PCR and recovered. In this PCR, primers 5'-GGATTGGACTTCGCCTGTGA-3 '(SEQ ID NO: 1) and 5, -CCCTTTTTCTGGAGACTAAAT-3' having primers at both ends of the pMx-CD8 vector insert region and the (SEQ ID NO: 2) was used.

Using the same primers, cDNA was directly amplified from the cells, and the amplified fragment was subcloned into a plasmid vector, pPCR script (Stratagene). The insert of this subclone was sequenced using an automatic DNA sequencer (ABI-PRIZM310 or 377, Perkin Elmer). In addition, the sequence sample was performed using the sequence kit of ABI, Appliedd Biosystems.

Known nucleic acids that activate signal transduction by the above sequencing were included. Known nucleic acids detected here include CD3 £, ZAP70, Ig, Ig5, Syk, FcR, etc. as nucleic acids derived from the spleen cell cDNA library, and nucleic acids derived from the NK cell cDNA library. DAP12, FcR and ZAP70 were included. This indicates that the screening system can detect nucleic acids involved in signal transduction, such as molecules having an activation motif (ITAM), enzymes, and adabu yuichi molecule.

At the same time as the known nucleic acids, four novel nucleic acid sequences that activate signal transduction were obtained from the cDNA of spleen cells or NK cells. The nucleic acid sequence obtained here is Because it activates NFAT, it is collectively referred to as "NFAT Activated Molecule (NFAM) j, each of which is called NFAM — :! ~ 4.

[Example 6] Confirmation of signal transduction activation

To confirm the activation of signal transduction in NFAM-1-4 screened in Example 5, each sequence subcloned into the pPCR vector was digested with Eco! IL and separated from the vector. The isolated fragment was ligated to pMx-CD8 vector Eco Rhino 1 and further subcloned. The obtained subclones were transfected into Phoenix-E packaging cells in the same manner as in Example 3. The culture supernatant of the packaging cells was infected to the 43-1 cell line in the same manner as in Example 3.

Next, the cells transduced in the same manner as in Example 4 were subjected to antibody stimulation with an anti-CD8 monoclonal antibody to determine whether or not GFP was expressed: using FACS. As a result, in the cell lines in which NFAM-1, 2, and 4 were subcleaned, peak shift was observed in the fraction having a higher fluorescence intensity as compared with the vector-only control due to the antibody stimulation (FIG. 5). This indicates that extracellular signals were transmitted into cells via NFAM-1, 2, or 4, and that these signals were transmitted as intracellular signals, which promoted NFAT-mediated GFP expression. .

The sequences of NFAM-1, 2, and 4, for which the above activities were confirmed, were determined. The determined nucleic acid sequence and the encoded amino acid sequence are shown in the Sequence Listing. NFAM-1 is shown in SEQ ID Nos. 6 and 7, NFAM-2 is shown in SEQ ID Nos. 11 and 12, and NFAM-4 is shown in SEQ ID Nos. 13 and 14.

As a result of sequencing, NFAM-1 was a transmembrane protein having 116 amino acids as an extracellular domain on one side and 83 amino acids on the other side with a transmembrane domain in between. (Figure 6). In addition, the intracellular region had an ITAM-like structure consisting of YxxLxxxxxxxYxxM. As described above, according to this screening method, nucleic acids involved in signal transduction can be screened from a large amount of test nucleic acids such as a cDNA library. Also, in this screening method, whether the test nucleic acid product has direct signal transduction activity Is selected as an index, so that nucleic acids involved in signal transduction can be reliably screened.

In the screening method, the test nucleic acid can be used not only for screening of a membrane-bound signal transduction factor but also for screening of an adapter factor that mediates signal transduction in cells. Industrial applicability

According to the above-mentioned screening method, it is possible to efficiently select a novel signaling factor. In particular, in the screening of the present invention, any signal transmission factor capable of transmitting the single molecule from Receptor intracellularly and ultimately inducing the expression of Repo overnight gene can be selected. Therefore, it is possible to select not only a membrane-bound signal transduction factor but also an adapter factor that can mediate signal transduction. Therefore, it can contribute to the identification of many unclear signal transduction factors as well as the identification of novel signal transduction pathways. Screening of a substance that interacts with the signal transduction factor obtained here. By screening DNA that forms a hybrid with a nucleic acid encoding the factor, screening of a signal transduction factor in a homologous or heterologous organism can be performed. Further identification and identification of modulators that act on signaling factors to modulate their activity can also be performed.

Claims

The scope of the claims

.1. Method for screening nucleic acids involved in signal transduction using a receptor capable of introducing an extracellular signal into a cell as an extracellular domain and a chimeric molecule having a test nucleic acid product as an intracellular domain And

Preparing a chimeric molecule expression vector capable of expressing the chimeric molecule by linking the gene encoding the receptor and the test nucleic acid to be carried in an expression vector,

A step of introducing the chimeric molecule expression vector into a cell holding a reporter gene whose expression is induced when a signal is transmitted in the cell,

Allowing the extracellular signal factor to act on cells into which the chimeric molecule expression vector has been introduced,

Detecting the expression of the reporter gene after the action of the extracellular signal factor.

2. A signal transduction factor binding capable of promoting expression of the reporter gene by binding to an intracellular signal transduction factor induced when a signal is transmitted in a cell upstream of the reporter gene. The stirling method according to claim 1, further comprising a site.

3. The screening method according to claim 1 or ² , wherein the receptor is CD8, and the extracellular signal factor is an anti-CD8 antibody.

4. The screening method according to any one of claims 1 to 3, wherein the reporter gene is a GFP gene.

5. The screening method according to any one of claims 1 to 4, wherein the cells are T cells.

6. The signaling factor binding site is NFAT (nuclear factor of activated T ceUs). The screening method according to any one of claims 2 to 5, wherein

7. The screening method according to any one of claims 1 to 6, wherein the expression vector is a retrovirus vector.

8. In the cell holding the repo overnight gene, a plurality of types of repo overnight genes are held,

The screening method according to any one of claims 1 to 7, wherein expression of each of the plurality of reporter genes is induced by different signal transduction in a cell. 9. Using a receptor capable of introducing an extracellular signal into a cell as an extracellular domain and a chimeric molecule having a test nucleic acid product as an intracellular domain, a probe for screening nucleic acids involved in signal transduction. And

An expression vector for carrying the receptor gene and linking the receptor gene and a test nucleic acid to express the chimeric molecule;

A cell carrying a repo allele, whose expression is induced when intracellular signaling is activated,

A screening kit, comprising: an extracellular signal factor for introducing an extracellular signal into the signal transducing protein expressed on the cell surface.

10. A signal transduction factor binding site upstream of the reporter gene, to which an intracellular signal transduction factor induced upon activation of signal transduction binds to promote the expression of the reporter gene. The screening kit according to claim 9, further comprising:

11. The signal transduction regulatory nucleic acid screening kit according to claim 9 or 10, wherein the receptor is CD8 and the extracellular signal factor is an anti-CD8 antibody.

12. The screening kit according to any one of claims 9 to 11, wherein the reporter gene is a GFP gene.

13. The screen according to claim 9, wherein the cell is a T cell. Kit.

14. The screening kit according to any one of claims 10 to 13, wherein the signal transduction factor binding site is NFAT (nuclear factor of activated T cells). 15: The screening kit according to any one of claims 9 to 14, wherein the expression vector is a retrovirus vector.

16. The screening according to any one of claims 9 to 15, wherein the expression vector is provided as a library of chimeric molecule expression vectors in which various different test genes are linked to the signal transgene. kit.

17. The cell holding the reporter gene contains a plurality of reporter genes,

The screening key according to any one of claims 9 to 16, wherein the expression of the plurality of repo overnight genes is induced by different intracellular signal transduction.

18. A cell for monitoring the regulation of intracellular signaling, which has a reporter gene whose expression changes when the intracellular signaling is regulated,

A cell, comprising, upstream of the reporter gene, a signal transduction factor binding site capable of binding an intracellular signal transduction factor and changing the expression of the reporter gene.

19. The cell according to claim 18, wherein the signal transduction factor binding site is NFAT (nuclear factor of activated T cells).

20. The cell according to claim 18 or 19, wherein the reporter gene is a GKP gene.

21. The cell according to any one of claims 18 to 20, wherein the cell is a T cell. 22. The screening method according to any one of claims 1 to 8 or claims 9 to 17. A signal transduction factor selected by the screening kit according to any one of 17.

23. consisting of the amino acid sequence described in any one of SEQ ID NOs: 7, 12, and 14, or an amino acid sequence having a deletion, insertion, or substitution in each of the amino acid sequences as long as it has a signal transduction activity. 23. The signaling factor according to claim 22.

24. Encoding a signaling factor: DNA,

A nucleotide sequence that hybridizes under stringent conditions with the nucleotide sequence of any of SEQ ID NOs: 6, 11 and 13 or the DNA of any of SEQ ID NOs: 6, 11 and 13; DNA.

25. A cell for screening for a factor involved in intracellular signaling,

A receptor capable of introducing an extracellular signal into a cell as an extracellular domain and a transmembrane chimeric molecule having a signaling factor as an intracellular domain, and an intracellular reporter whose expression changes when intracellular signal transduction is regulated With genes and

The signaling factor includes an amino acid sequence according to any one of SEQ ID NOs: 7, 12, and 14 or an amino acid sequence having a deletion, insertion, or substitution in each amino acid sequence as long as the amino acid sequence has a signaling activity. And

A cell, comprising, upstream of the reporter gene, a signaling factor binding site capable of binding an intracellular signaling factor and changing the expression of the reporter gene.