WO2002077216A2 - Nouveaux polypeptides - Google Patents

Nouveaux polypeptides Download PDF

Info

Publication number
WO2002077216A2
WO2002077216A2 PCT/EP2002/003393 EP0203393W WO02077216A2 WO 2002077216 A2 WO2002077216 A2 WO 2002077216A2 EP 0203393 W EP0203393 W EP 0203393W WO 02077216 A2 WO02077216 A2 WO 02077216A2
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
llr
gene
cells
polypeptide according
Prior art date
Application number
PCT/EP2002/003393
Other languages
English (en)
Other versions
WO2002077216A3 (fr
Inventor
Rainer De Martin
Erhard Hofer
Renate Hofer-Warbinek
Frank Stephan Kalthoff
Hans-Joachim Lipp
Diana Mechtcheriakova
Johannes Schmid
Yuri Sobanov
Original Assignee
Novartis Ag
Novartis Pharma Gmbh
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Novartis Ag, Novartis Pharma Gmbh filed Critical Novartis Ag
Priority to AU2002256708A priority Critical patent/AU2002256708A1/en
Priority to EP02726212A priority patent/EP1373485A2/fr
Priority to JP2002576659A priority patent/JP2004529638A/ja
Publication of WO2002077216A2 publication Critical patent/WO2002077216A2/fr
Publication of WO2002077216A3 publication Critical patent/WO2002077216A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/04—Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/06—Antipsoriatics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/08—Antiallergic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/7056—Lectin superfamily, e.g. CD23, CD72
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/93—Ligases (6)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies

Definitions

  • the invention relates to polynucleotide encoding a polypeptide (protein) isolated from PHA-activated lymphocytes, endothelial cells, or dendritic cells (DCs).
  • the invention also relates to inhibiting or activating the action of such polynucleotide and/or polypeptide (protein).
  • Endothelial cells make up the inner surface of large and small blood vessel and mediate the transmigration of cells of the immune system into the underlying tissue.
  • Non-stimulated EC represent an anticoagulant surface that ensures unobstructed blood flow.
  • inflammatory mediators such as TNF ⁇ , IL-1 or lipopolysaccharide (DPS)
  • EC express a variety of molecules including cell adhesion molecules (including e.g. E-selectin, ICAM-1 and VCAM-1), cytokines (IL-1, IL-6, IL-8), components of the coagulation system (tissue factor, PAI-1) and others (iNOS).
  • the inflammatory response is therefore a common underlying mechanism for a variety of diseases including e.g. inflammation, arteriosclerosis, restenosis, reperfiision injury, inflammatory bowel disease, psoriasis and atopic dermatitis.
  • NF-kB transcription factor NF-kB
  • Inhibition of NF-kB by pharmacological or genetic inhibitors has been shown to block the inflammatory and other aspects of EC activation (Wrighton et al. J. Exp. Med. 183 [1996] 1013-1022; Oitzinger et al. Blood 97 [2001] 1611-1617). Inhibitors of NF-kB have therefore wide therapeutic potential.
  • NF-kB e.g. the p65/p50 heterodimer
  • IkBa, -b or -e. IkB subunits when bound to NF-kB, mask the NF-kB nuclear localization signal and thus prevent its nuclear translocation.
  • IKKl/IKKa and IKK2/IK b kinases that specifically phosphorylate IkBa.
  • IKKl/IKKa and IKK2/IK b kinases that specifically phosphorylate IkBa.
  • NEMO/ KKg a third protein
  • IkB kinase complex IKC
  • IKK1, IKK2 and NEMO IkB kinase complex
  • signalosome which may contain other proteins such as the catalytic subunit of PICA (csPKA) and phospho-tyrosine containing proteins.
  • upstream activators of the IKC include the MAP3K type kinases NIK (NF-kB inducing kinase) and MEKK1 (MAPK/ERK kinase kinase 1), the TGFb-inducible kinase TAK1 as well as Akt and the PKC isoforms zeta and theta, reflecting both heterogeneity but also a certain degree of specificity of the NF-kB signalling pathway in regard to different cell types and stimuli.
  • NIK NF-kB inducing kinase
  • MEKK1 MAPK/ERK kinase kinase 1
  • TGFb-inducible kinase TAK1 as well as Akt
  • upstream activators couple to different components
  • IKK2 appears to be of central importance in NF-kB signalling. It has now been found that from cDNA libraries of isolated PHA-activated lymphocytes an IKK2-55 gene may be isolated which has the nucleotide sequence of e.g. SEQ ID NO:l and which encodes a polypeptide which has the amino acid sequence set forth in SEQ ID NO:2 or at least 80 % identity thereto.
  • Endothelial cells are localized to the vasculature. They are connected by junctional complexes and form the endotheliurn, which lines the entire vascular system. They control substance flow between the circulation and the specific organ and are the primary sites of inflammatory responses. Moreover, they are the sites where interactions between circulating cells of the body's own immune defense system and altered cells of the specific organ occur. Exchange of substances, peptides and immune cells between the blood stream and various tissues of the body are controlled by the EC barrier. The selectivity of this EC barrier is critical for the formation of several so-called "blood-tissue" barriers which are indispensable for maintaining the integrity of the respective organ.
  • EC may adjust their constitutive functions, resulting in several types of reversible changes of their functional state, referred to as endothelial dysfunction.
  • EC have to respond in a balanced manner to a multitude of physiological signals which are essential in maintenance of a proper blood flow, providing oxygenation and nutrition of all tissues, and fighting microbial, viral and parasitic infections.
  • EC are also involved in wound repair by induction of growth and regression of new blood vessels, cancer progression, and atherosclerotic lesion development (see e.g. Cines et al. Blood 91 [1998] 3527-3561).
  • Capillary EC may be isolated from human tissue by immunomagnetic beads using specific monoclonal antibodies or Ulex europaeus lectin type 1 coated to magnetic beads (see e.g. Manconi et al. Meth. Cell Science [2000] 22 89-99).
  • cDNA libraries of EC may be generated and gene expression patterns of EC may be obtained by various hybridization techniques such as oligonucleotide fingerprinting, subtractive hybridization or RNA profiling, and sequencing in conventional manner.
  • DC Dendritic cells
  • SEQ ID NO:3 SEQ ID NO:3
  • DINO polypeptide which has the amino acid sequence set forth in SEQ ID NO:4 or at least 80 % identity thereto.
  • DCs Dendritic cells
  • LC Langerhans cells
  • LC Langerhans cells
  • topical application of a reactive hapten may activate LC to migrate out of the epidermis into draining lymph nodes, where LC may present antigen to selected T cells.
  • LCs may provide signals to the T-cells that induce their proliferation and differentiation into effector cells.
  • regulatory and helper T-cells may be formed.
  • DCs have also been shown to engulf all kinds of apoptotic cells and may therefore play a critical role in the maintenance of tolerance to self-antigens (Steinman R.M. and K. Inaba J. Leukoc. Biol. 66 [1999] 205-208).
  • Diseases in which DCs, as the principal regulators of immune responses, play a causal or contributory role may be targets for DC-specific pharmaceutical or iatrigenic intervention such as in chronic inflammatory diseases, autoimmune diseases, or transplant rejection crisis, and including inflammatory skin diseases such as contact hypersensitivity or atopic dermatitis, and in diseases or syndromes in which a significant pathological component is immune suppression, as in AIDS and cancer.
  • DCs may be isolated from peripheral blood by negative selection, i.e. separation from monocytes (CD14+), T-cells (CD3+), B-cells (CD19+) and NK (CD16+)-cells by capturing on specific mAB coated magnetic beads or panning, e.g. according to a conventional method.
  • cDNA libraries of DCs maybe generated and gene expression patterns of DC maybe obtained by various hybridisation techniques such as oligonucleotide fingerprinting, subtractive hybridisation or RNA profiling, and sequencing, e.g. according to a conventional method.
  • Transmembrane receptors of DCs are of importance, since on the one hand they are involved in the uptake of parasites and apoptotic cells leading to antigen presentation by the DCs. On the other hand these receptors interact with soluble ligands and surface bound ligands on T cells and other immune cells. These interactions are involved in regulating DC function as well as the functions of the interacting cells such as T cells. These regulatory events, depending on the differentiation state of the cell and the interacting ligands, include activation and inhibition of DCs, T cells and other immune cells.
  • Receptors with type II transmembrane orientation and a C-type lectin-like domain in their extracellular part have been found to be frequently expressed on various hemopoietic cells, and some have been shown to play important roles in the innate immune response (Weis W.I., Taylor M. E. and Drickamer K. Immunol. Rev. 163 [1998] 19-34).
  • Aside proteins such as CD69 and AICL (Santis A.G. et al. Eur. J. Immunol.
  • NK gene complex Consistent with the idea of a chromosomal area containing several genes important for natural immune cell function, loci mediating resistance to virus infection or mediating lysis of allogeneic lymphocytes have been mapped to this region in rodents.
  • NK cells possess important roles for monitoring proper MHC class I expression (Lopez-Botet M. et al. Sernin. Immunol. 12 [2000] 109-119; Hoglund P. Immunol. Rev. 155 [1997] 11-28).
  • CD94/NKG2A functions as an inhibitory receptor, the CD94/NKG2C receptor can activate NK cells.
  • HLA-E predominatly presents peptides from the leader sequences of other class la molecules and is only transported to the surface when loaded with the appropriate peptides.
  • recognition of HLA-E by the CD94 NKG2A receptor is a sensitive mechanism to monitor proper biosynthesis of MHC class I molecules, which can be down-modulated by many viruses (Alcami A. and U.H. Koszinowski Immunol. Today 21 [2000] 447-55).
  • the function of the activating CD94/NKG2C receptor in this context is still not understood.
  • the activating NKG2D receptor only distantly related to the other NKG2 molecules, forms homodimers and recognizes the class I-like molecule MICA, which is upregulated by stress, e.g. viral infection, and on some tumor cells (Bauer S. et al., Science 285 [1999] 727-729).
  • the corresponding CD94 and NKG2 receptors in mice appear to have comparable functions.
  • DCs are antigen-presenting cell populations in lymphoid and non-lymphoid organs (Hart D.N. Blood 90 [1997] 3245-87). They play important roles in the initiation of antigen- specific T cell proliferation. Immature DCs occur in peripheral non-lymphoid organs, where their principal function is to filter the surrounding tissues for foreign antigens and pathogens. These immature DCs are highly specialized in antigen uptake and processing and stay for long time periods in non-lymphoid tissues. Following antigen uptake these DCs are capable to migrate to T cell-rich areas of secondary lymphoid organs such as lymph nodes or spleen. This is associated with profound phenotypic and functional changes known as DC maturation.
  • DCs upregulate MHC class I and II molecules as well as T cell costimulatory molecules such as CD80 and CD86.
  • Mature DCs are potent stimulators of helper and cytotoxic T cells. Understanding the molecular signals which guide the differentiation of DCs, which in turn program differentiation of lymphocytes is of key importance to be able to manipulate the immune response more efficiently with regard to vaccination strategies or to switch off damaging immune responses. Based on the present finding of the specific expression of LLR-J24 in DCs and its down-modulation during the maturation process it is conceivable that this receptor plays a role during DC maturation or T cell stimulation.
  • LLR-J24 has now been found, isolated from and selectively expressed in monocyte-derived and cord blood progenitor cell-derived DCs (MoDC and CBDC).
  • the LLR-J24-1 gene of nucleotide SEQ ID NO:5 and its splice variant LLR-J24-2 of nucleotide SEQ ID NO:7 are related to but not identical to the NKG2 and CD94 NK receptor chains (Houchins J.P. et al. J. EXP. Med. 173 [1991] 1017-1020; Chang C. et al., Eur. J.
  • the LLR-J24-1 gene may occur in isolated DC-s as the splice variant LLR-J24-2 which consists of the nucleotide sequence of SEQ ID NO:5 and an additional exon encoding a stalk peptide inserted between nucleotides 357 to 358.
  • the splice variant SEQ ID NO:5 is identical to SEQ ID NO:7 but misses nucleotides 358 to 495 which are spliced out.
  • the LLR-J24 gene encodes a novel member of the superfamily of type II transmembrane receptors with a C-type lectin-like domain (CTLD) in their extracellular part (Weis W. I. et al. Immunol. Rev. 163 [1998] 19-34). Its closest relatives are the mouse DECTIN-1 (59 % identity, Ariizumi et al. J. Biol. Chem. 275 [2000] 20157-20167, accession No. AF262985), the human LOX-1 (44 % similarity in CTLD, Sawamura T. Nature 386 [1997] 73-77; accession No. AF035776), CLEC-1 (37 % similarity in CTLD, Colonna M.
  • CTLD C-type lectin-like domain
  • the LLR-J24 gene is located on chromosome 12 in the NK receptor gene complex, which also contains the above-mentioned homologues and additional somewhat more distantly related genes.
  • the LLR-J24-1 gene of SEQ ID NO:5 and NO:7 encodes a typical CTLD and an ITAM-like sequence in its cytoplasmic tail.
  • the sequence of the CTLD is clearly homologous to all the CTLDs of the other members of the superfamily, the cytoplasmic tail is only distantly related or unrelated to the other family members, but clearly homologous to the mouse DECTIN-1 sequence.
  • the LLR-J24-2 gene of SEQ ID NO:7 is identical to SEQ ID NO:5, but contains an additional exon encoding a stalk peptide.
  • the corresponding protein with the stalk peptide is shown in SEQ ID NO:8.
  • the stalk exon nucleotide sequence is depicted as SEQ ⁇ NO:9, and the corresponding stalk peptide as SEQ H) NO:10.
  • the CTLD binds surface peptide structures on other immune cells such as T cells. This may provide a modulating, e.g. costimulatory signal to T cell activation.
  • the CTLD binds also surface structures on other immune cells such as T cells.
  • the receptor is downregulated during DC maturation. This may relieve also an inhibitory signal to T cell activation.
  • the cytoplasmic domain of the receptor regulates DC maturation upon binding of the CTLD to the ligand.
  • the CTLD binds e.g. lipoprotein structures such as membrane structures of parasites, oxLDL and apoptotic cell membranes.
  • the receptor is downregulated during DC maturation when the phagocytotic activity of DC diminishes.
  • the cytoplasmic domain of the receptor mediates internalization and activation of DC maturation upon binding of the CTLD to the ligand.
  • the intracellular version of the receptor without the stalk peptide is involved in monitoring aberrant intracellular structures and parasites and has thus another function than the version comprising the stalk peptide of SEQ ID NO:10.
  • the invention thus provides an isolated
  • IKK2-55 gene comprising a nucleotide sequence encoding an IKK2-55 polypeptide of SEQ ID NO:2;
  • - DINO gene comprising a nucleotide sequence encoding a DINO polypeptide of SEQ ID NO:4;
  • LLR-J24-stalk nucleotide comprising a nucleotide sequence encoding a LLR-J24-stalk peptide of SEQ ID NO:10.
  • the invention further provides an isolated
  • IKK2-55 gene comprising the nucleotide sequence of e.g. SEQ ID NO:l, encoding an IKK2- 55 polypeptide of SEQ ID NO:2;
  • - DINO gene comprising the nucleotide sequence of e.g. SEQ ID NO:3, encoding a DINO polypeptide of SEQ ID NO:4; or
  • nucleotide comprising the nucleotide sequence of e.g. SEQ ID NO:9, encoding a stalk peptide of SEQ ID NO: 10.
  • the invention further provides an isolated
  • the IKK2-55 gene, the DINO gene, the LLR-J24-stalk gene, an isolated polynucleotide encoding the transmembrane protein LLR-J24 and an isolated polynucleotide encoding the extracellular domain of LLR-J24 are designated herein as "Gene(s) according to (of) the invention".
  • a polypeptide of the invention includes a polypeptide of the amino acid sequences of SEQ ID NO:2, SEQ ID NO:4 and SEQ ID NO:10, and includes e.g.
  • a polypeptide of the invention includes a polypeptide which is encoded by a corresponding gene of the invention, including a polynucleotide that hybridizes to the nucleotide sequence of a gene of the invention; e.g. including a sequence, which as a result of the redundancy (degeneracy) of the genetic code, also encodes a corresponding polypeptide of the invention; or e.g. an allelic variant and/or complement of a gene of the invention.
  • a polypeptide of the invention maybe in the form of the "mature" polypeptide, e.g. protein, or may be part of a larger polypeptide, e.g. protein, e.g. of a fusion protein; it may be advantageous to include an additional amino acid sequence which contains e.g. secretory or leader sequences, pro-sequences, sequences which aid in purification, such as multiple histidine residues, or an additional sequence for stability during recombinant production into a polypeptide of the invention.
  • an additional amino acid sequence which contains e.g. secretory or leader sequences, pro-sequences, sequences which aid in purification, such as multiple histidine residues, or an additional sequence for stability during recombinant production into a polypeptide of the invention.
  • a polypeptide of the invention also includes a polypeptide fragment of a polypeptide of the invention.
  • polypeptide fragment is meant to be a polypeptide having an amino acid sequence that entirely is the same in part, but not in all, of the amino acid sequence of a polypeptide of the invention.
  • Such polypeptide fragment may be "free-standing,” or may be part of a larger polypeptide of which such polypeptide fragment forms a part or region, most preferably as a single continuous region.
  • Preferably such polypeptide fragment retains the biological activity of the corresponding polypeptide of the invention.
  • Variants of defined polypeptide (fragment) sequences of the invention also form part of the present invention.
  • Preferred variants are those that vary from the referents by conservative amino acid substitutions, e.g. those that substitute a residue with another of like characteristics. Typically such substitutions are among Ala, Val, Leu and He; among Ser and Thr; among the acidic residues Asp and Glu; among Asn and Gin; and among the basic residues Lys and Arg; or aromatic residues Phe and Tyr.
  • Particularly preferred are variants in which several, 5 to 10, 1 to 5, or 1 or 2 amino acids are substituted, deleted or added, in any combination.
  • a polypeptide of the invention, or fragment thereof includes
  • a polypeptide of the invention or fragment thereof may be produced as appropriate, e.g. in conventional manner.
  • isolated if not otherwise specified herein includes the meaning “separated from the coexisting material”, e.g. “altered by the hand of man", from the natural state.
  • a gene of the invention includes a corresponding nucleotide sequence of SEQ ID NO:l, SEQ ID NO:3, and SEQ ID NO:9, respectively, and allelic variants therof, and its complements, and splice variants therof; including e.g. a polynucleotide that hybridizes to a nucleotide sequence of a gene of the invention, e.g. under stringent conditions, e.g. each nucleotide sequence of a gene of the invention includes a sequence which is different, e.g.
  • “Stringent conditions” includes that hybridization will occur only if there is at least 80 %, e.g. 90 %, such as 95 %, 97 % or 99 % identity between the nucleotide sequence of a gene of the invention and the corresponding polynucleotide that hybridizes therewith.
  • na is the number of amino acid alterations
  • x a is the total number of amino acids in said corresponding amino acid sequence
  • y is percent identity divided by 100; including e.g. a polypeptide encoded by an allelic variant of said gene, or an isoform of the corresponding amino acid sequence generated by alternative splicing of transcripts from the corresponding gene.
  • Identity is a measure of the identiiy of nucleotide sequences or amino acid sequences and maybe calculated by conventional techniques, using e.g. commercially available computer programs.
  • Polypeptide includes any peptide or protein comprising two or more amino acids joined to each other by peptide bonds.
  • Polynucleotide includes any polyribonucleotide or polydeoxyribonucleotide, which may be unmodified RNA or DNA, or modified RNA or DNA, including without limitation single and double stranded RNA, and RNA that is a mixture of single- and double-stranded regions; and RNA hybrid molecules.
  • a gene of the invention encoding a corresponding polypeptide of the invention may be obtained using standard cloning and screening methods, from a cDNA library derived from mRNA in PHA-activated lymphocytes or endothelial cells, or DCs, respectively, e.g. by reverse transcription PCR using mRNA of DCs, e.g. using the expressed sequence tag (EST) analysis (Adams M.D. et al. Science 252 [19911 1651-1656; Adams M.D. et al. Nature 355 [1992] 632- 634; Adams M.D. et al. Nature 377 Suppl.3 [1995] 174).
  • EST expressed sequence tag
  • a gene accordinging to the invention may also be obtained from natural sources, such as genomic DNA libraries, or may be synthesized according to a conventional method.
  • a gene of the invention is useful for the recombinant production of a corresponding polypeptide (fragment) of the invention and, if used for such recombinant production, the gene sequence may include the coding sequence for the mature polypeptide (fragment) by itself; or the coding sequence for the mature polypeptide (fragment) in reading frame with other coding sequences, such as those encoding a leader or secretory sequence, a pre- or pro- or prepro- protein sequence, or other fusion peptide portions.
  • a marker sequence can be encoded which facilitates purification of a fused polypeptide.
  • the marker sequence may be an appropriate conventional marker sequence, e.g.
  • Any gene of the invention may also contain non-coding 5' and 3' sequences, such as transcribed, non-translated sequences, splicing and polyadenylation signals, ribosome binding sites and sequences that stabilize mRNA.
  • a nucleotide sequence which is identical or sufficiently identical to a nucleotide sequence of a gene of the invention, e.g. including a fragment thereof or a splice variant therof, maybe used as an hybridization probe for cDNA and genomic DNA to isolate full-length cDNAs and genomic clones encoding a corresponding polypeptide (fragment) of the mvention; and e.g. to isolate cDNA and genomic clones of other genes (including genes encoding homologs and orthologs from species other than human) that have a high sequence similarity to a gene of the invention.
  • Hybridization may e.g. be carried out according to a conventional method. Typically a sequence similar to a gene sequence is 80 % identical, preferably 90 % identical, more preferably 95 % identical to that of a the gene (fragment) of the invention.
  • a hybridization probe may e.g. comprise at least 15 nucleotides, e.g. at least 30 nucleotides, such as at least 50 nucleotides, preferably between about 30 and about 50 nucleotides; or the cDNA sequence corresponding to the coding region of the entire cDNA sequence or any parts thereof.
  • any appropriate hybridization technique may be used, e.g. comprising the steps of screening an appropriate library under stringent hybridization conditions with a labeled probe having the corresponding polynucletoide sequence or that of a splice variant thereof or a fragment thereof, and isolating full-length cDNA and genomic clones containing said polynucleotide sequence.
  • Hybridization techniques e.g. strigent
  • Stringent hybridization conditions are e.g. as defined above, or alternatively, conditions under overnight incubation at around 40°C in an appropriate solution, e.g. a solution comprising formamide, SSC, sodium phosphate, Denhardt's solution, dextran and salmon sperm DNA, e.g.
  • the invention provides a vector comprising a gene, e.g. a polynucleotide, of the invention.
  • Such vector may be produced as appropriate, e.g. in conventional manner.
  • An appropriate vector maybe provided according to a conventional method.
  • a vector comprising a gene of the present invention may be useful to obtain an expression system which is able to produce a polypeptide encoded by a gene of the mvention recombinantly, e.g. in a host cell, such as in a compatible host cell.
  • a host cell may e.g. be genetically engineered, e.g. by use of a vector comprising a gene of the invention, to incorporate into the host cell an expression system, or a part therof, for expressing a.polypeptide (fragment) of the invention.
  • Cell-free translation systems may also be used to produce a gene of the invention, e.g. using RNAs derived from a DNA construct of the present invention, e.g. in conventional manner.
  • the invention provides an expression system comprising a DNA or RNA molecule, e.g. isolated from the natural environment, e.g. comprising a pre-isolated gene of the invention, wherein said expression system or part thereof is capable of producing a polypeptide of the invention when said expression system or part thereof is present in a compatible host cell.
  • the invention provides:
  • a process for producing a polypeptide of the invention comprising culturing an isolated host cell comprising an expression system of the invention under conditions sufficient for the production of a polypeptide of the invention in the culture and recovering said polypeptide of the invention from the culture;
  • host cells may be genetically engineered to incorporate expression systems or portions thereof for a gene of the present invention.
  • polynucleotides into host cells may be effected as appropriate, e.g. according to a conventional method, e.g. according to Davis et al. BASIC METHODS IN MOLECULAR BIOLOGY (1986); Sambrook et al. MOLECULAR CLONING: A LABORATORY MANUAL 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989), such as calcium phosphate transfection, DEAE-dextran mediated transfection, transvection, microinjection, cationic lipid-mediated transfection, electroporation, transduction, scrape loading, ballistic introduction or infection, or protein transduction. Appropriate host cells may be easily found.
  • host cells examples include bacterial cells such as streptococci, staphylococci, E.coli, Streptomyces and Bacillus subtilis cells; fungal cells, such as yeast cells and Aspergillus cells; insect cells such as Drosophila S2 and Spodoptera Sf9 cells; isolated animal cells such as CHO, COS, HeLa, C127, CCL39, 3T3, BHK, HEK 293 and Bowes melanoma cells; and plant cells.
  • bacterial cells such as streptococci, staphylococci, E.coli, Streptomyces and Bacillus subtilis cells
  • fungal cells such as yeast cells and Aspergillus cells
  • insect cells such as Drosophila S2 and Spodoptera Sf9 cells
  • isolated animal cells such as CHO, COS, HeLa, C127, CCL39, 3T3, BHK, HEK 293 and Bowes melanoma cells
  • plant cells examples include bacterial cells such as streptococci,
  • Appropriate expression systems include e.g. chromosomal, episomal and virus-derived systems, e.g. vectors derived from bacterial plasmids, bacteriophage, transposons, yeast episomes, insertion elements, yeast chromosomal elements, viruses, such as baculoviruses, papova viruses such as SV40, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses and retroviruses, and vectors derived from combinations thereof, such as those derived from plasmid and bacteriophage genetic elements, such as cosmids and phagemids.
  • An expression systems may contain control regions that regulate as well as engender expression.
  • any system or vector suitable to maintain, propagate or express polynucleotides to produce a polypeptide in a host may be used.
  • the appropriate nucleotide sequence may be inserted into an expression system as appropriate, e.g. according to a conventional method, e.g. according to Sambrook et al., MOLECULAR CLONING A LABORATORY MANUAL (supra).
  • polypeptide of the invention For secretion of the translated protein into the lumen of the endoplasmic reticulum, into the periplasmic space or into the extracellular environment, appropriate secretion signals may be incorporated into the desired polypeptide. These maybe heterologous signals. If a polypeptide of the invention is to be expressed for use in screening assays, generally the polypeptide may be produced at the surface of the cell. In this event, the cells may be harvested prior to use in the screening assay. Alternatively the polypeptide may be produced within the cells.
  • a polypeptide of the invention may be recovered and purified from recombinant cell cultures as appropriate, e.g. according to a conventional method, including e.g. detergent extraction, ultracentrifugation, ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography, e.g. high performance liquid chromatography. If a polypeptide of the invention is denatured during isolation and/or purification, regeneration of the active conformation, e.g. refolding of a denaturated polypeptide of the invention, maybe carried out as appropriate, e.g. according to a conventional method.
  • a polypeptide of the invention is denatured during isolation and/or purification, regeneration of the active conformation, e.g. refolding of a denaturated polypeptide of the invention, maybe carried out as appropriate,
  • the cells maybe e.g. lysed before the polypeptide is recovered.
  • a gene (fragment) of the invention or a polypeptide (fragment) of the invention may be used as a research reagent and material for the discovery of treatments and diagnostics to animal and human disease.
  • the transcription factor NF-kB plays a key regulatory role in regulating the expression of immune and inflammatory genes.
  • TKK2 One of the central components of the signal transduction pathway leading to NF-kB activation is TKK2. Proteins that interact with TKK2 can have modulatory function towards IKK2 activity.
  • IKK2-55 was found to interact with IKK2 in yeast two hybrid screens and co-immunoprecipitation. It was found to modulate NF-kB activity as well as the activity of certain promoters. IKK2-55 as well as its pharmacological agonists or antagonists may therefore be used to treat a variety of immunological or inflammation-related diseases, including e.g.
  • a DINO gene of the invention was found to belong to the HERC protein family typically containing a C-terminal HECT domain of about 350 amino acids and various numbers of RCCl repeats at the N-terminal portion.
  • HECT domain proteins constitute a subfamily of E3 ubiquitin ligases transfering ubiquitin from E2 conjugating enzyme to a specific substrate that is destined for degradation by the proteasome.
  • Substrates for HERC family members have been shown to be involved in cell cycle control (cyclin E, p21 and p53), cancer (E6-AP) and in the regulation of TGF- ⁇ family member BMP signaling (Mitsui et al. BBRC 266 [1999] 115-122; Cruz et al. FEBS letters 488 [2001] 74-80; Scheffher et al. Cell 75 [1993] 495-505; Zhu et al. Nature 400 [1999] 687-693). It was found by yeast two hybrid screening that DINO can interact with TSG101 gene.
  • TSG101 modulates MDM2 degradation and MDM2/p53 feedback control by forming a TSG101/MDM2 regulatory loop (Li et al. PNAS 98 [2000] 1619-1624).
  • DINO expression enhances p53 transcriptional activity. It can be expected that DINO is crucially involved in functional interaction between TSG101 and the MDM2/p53 loop and thus will be a mediator of cell proliferation, apoptosis and inflammatory responses.
  • DESK contains five RCCl repeats at the N-terminus and differs from Cepl which has 3 complete and half a repeat.
  • RCCl is a guanine nucleotide exchange factor (GEF) for the small GTPase Ran (Bischoff and Ponstingl Nature 354 [1991] 80-82).
  • GEF guanine nucleotide exchange factor
  • DINO may be expected to exert GEF activity on yet to identify small GTPases and may thus be involved in regulation of cell proliferation, cytosceletal morphology and intracellular transport.
  • DINO was found to be located as a cluster including Herc3 and Cepl on chromosome 4.21-23.
  • a LLR-J24-1 and -2 gene was found to belong to the superfamily of type II transmembrane receptors with a CTLD in their extracellular part (Weis W.I. et al. Immunol. Rev. 163 [1998] 19-34). A significant part of these receptor genes are located in the NK receptor complex on human chromosome 12 (Sobanov, Y. et al. hnmunogenetics 49 [1999] 99-105).
  • the CTLDs of the receptors are typically encoded by three exons.
  • the CTLDs developed during evolution from a C-type carbohydrate recognition domain. This contained a lectin-fold binding Ca and had carbohydrate ligands such as the hepatic asialoglycoprotein receptor.
  • the binding domain of an LLR-J24 gene has the modified characteristics of a CTLD, e.g. it can fold independently of Ca " " " and bind non-carbohydrate ligands.
  • the predicted amino acid sequences of the CTLDs were compared.
  • the highest similarity LLR-J24 was seen with LOX-1 (44 %), CLEC-1 and CLEC-2 are somewhat more distantly related (37 %).
  • CTLD NK receptors consisting of the NKG2 and the CD94 proteins are the next closest related proteins (between 28 % for NKG2-E and 33 % for NKG2-D).
  • the AICL/LLT-1/CD69 group and the KLRF1, MAFA and NKR-Pl receptors are again somewhat more distant and are displayed in separate branches in a multiple alignment.
  • LOX-1 has been found to be expressed by vascular endothelial cells and macrophages. It is dynamically regulated in vivo by inflammatory stimuli such as TNF-alpha, lipopolysaccharide and oxLDL, but also by TGF- ⁇ , angiotensin II and by fluid shear stress in hypertension. Importantly, LOX-1 has been found to be up-regulated in atherosclerotic lesions where it is believed to contribute to foam cell formation and endothelial dysfunction. It was described to bind oxLDL and anionic phospholipids as well as aged red blood cells and apoptotic cells (Sawamura T. et al. Nature 386 [1997] 73-77).
  • LOX-1 is involved in the removal of those cells from the blood stream.
  • molecules and cellular fragments bound to LOX-1 are internalized by endocytosis.
  • the LLR-24J genes can be expected to bind oxidized lipoproteins such as oxLDL, parasite surface structures and apoptotic cell fragments.
  • CLEC-1 and CLEC-2 The other two closely related genes are named CLEC-1 and CLEC-2, the corresponding cDNAs have recently been identified in EST databases and described (Colonna M. et al. Eur. J. Immunol. 30 [2000] 697-704).
  • CLEC-1 mRNA was shown to be preferentially expressed in DCs and was also found in placenta, lung and thymus.
  • CLEC-2 mRNA was also detected in DCs, but in addition showed wider expression in the hematopoietic lineage.
  • NKG2 NK receptor genes The next closest related genes are the NKG2 NK receptor genes. It is now well established that the lectin-like NK receptors possess important roles for monitoring proper MHC class I expression according to the missing-self hypothesis (Hoglund P. et al. Immunol. Rev. 155 [1997] 11-28). hi human NK cells the CD94 chain forms heterodimeric receptors with different NKG2 isoforms, which can bind the non-classical MHC class lb molecule HLA-E (Lopez-Botet M. et al. Semin. Immunol. 12 [2000] 109-119). CD94/NKG2A functions as an inhibitory receptor, the CD94/NKG2C receptor can activate NK cells.
  • HLA-E predominantly presents peptides from the leader sequences of other class I molecules and is only transported to the surface when loaded with the appropriate peptides.
  • recognition of HLA-E by the CD94/NKG2A receptor is a sensitive mechanism to monitor biosynthesis of MHC class I molecules, which can be down-modulated by many viruses.
  • the function of the activating CD94/NKG2C receptor in this context is still not fully understood.
  • the activating NKG2D receptor only distantly related to the other NKG2 molecules, forms homodimers and recognizes the class I-like molecule MICA and MICB, which is upregulated by stress, e.g. viral infection, and on some tumor cells (Bauer S. et al. Science 285 [1999] 727-729).
  • NKG2-D is therefore an activating receptor directly related to NK-mediated killing of virus-infected and transformed cells.
  • LLR-J24 is closest related to NKG2-D.
  • the corresponding CD94 and NKG2 proteins in mice appear to have comparable functions. Furthermore, in mice over fourteen isoforms of Ly49 receptors are involved in monitoring expression of different MHC class I molecules.
  • LLR-J24 can bind to certain MHC class I / peptide complexes or to class I-related molecules up-regulated on virally infected and tumor cells.
  • the sequence of the LLR-J24 genes displays high similarity to the recently described murine DECTIN-1 cDNA with the exception that a stalk exon was missing from the first isolated human cDNA. It could be determined that this is found correctly spliced in a subfraction of about 5 to 10 % of the transcripts ( Figures 9 and 10), the corresponding predicted full-length protein sequences of mouse and human DECTIN-1 were compared. Both sequences show an identity of 59 % (similarity 69 %). The high similarity is conserved in the cytoplasmic and extracellular domains including the stalk domain. Close to the N-terminus of the cytoplasmic domain an ITAM-like sequence is present in the human as well as the murine versions.
  • This sequence differs slightly from a classical ITAM motif as it is found in the CD3- ⁇ chain or the DAP12 molecule (Lanier L. L. et al. Nature 391 [1998] 703-707).
  • the first tyrosine (residue 3) in the motif is 4 amino acid positions before the leucine (residue 7), whereas this distance is 3 amino acid positions in the classical Yx 2 Lx 6 - 8 Y 2 L motif.
  • the following residues of the motif are correctly placed. Both proteins further show consensus sites for N-glycosylation.
  • the lectin-like domain of the human and murine versions lack most of the residues described to be involved in Ca ⁇ -binding suggesting a non-carbohydrate ligand.
  • the transmembrane domain does not display a charged ⁇ unino acid indicating that association with ITAM-containing adapters such as the DAP molecules does not take place.
  • LLR-J24 mRNA The expression of LLR-J24 mRNA in primary human DCs, monocytes, T and B lymphocytes as well as endothelial cells was also investigated.
  • the data obtained show that human LLR-J24 mRNA is abundantly and selectively expressed in monocyte-derived DCs (MoDC) and in DCs derived from CD34 + hematopoietic progenitor cells (HPDC).
  • MoDC monocyte-derived DCs
  • HPDC hematopoietic progenitor cells
  • a small amount of LLR-J24 mRNA is present in primary monocytes, whereas primary T and B lymphocytes as well as endothelial cells, treated or untreated with different stimuli, does not detectably express LLR-J24 transcripts. No expression is visible in Northern blots including several additional cell lines, i.e.
  • RNA in DCs was estimated to be 3.0 to 3.5 kb from the Northern blots, which corresponds to the expected transcript sizes assuming the use of the first or several consecutive polyadenylation signals detected in the gene in a region 1.6 to 1.9 kb downstream from the stop codon.
  • Activation and final maturation of DCs is associated with altered expression of genes that regulate their migration and function. It was therefore tested whether stimulation of DCs by inflammatory mediators, CD40-ligand or zymosan A would lead to a change in expression levels for LLR-J24 mRNA. As shown in Figure 8, treatment of MoDC with a combination of IL-13 and TNF- ⁇ for 18 to 24 hours resulted in a reproducible, three to five-fold reduction of LLR-J24 mRNA. Alternatively, HPDC were activated by mAb specific for the CD40 receptor in the absence or presence of zymosan A stimulating phagocytosis of the yeast particles.
  • Both clones displayed correctly spliced stalk exons as predicted from the genomic sequence.
  • the PCR fragments obtained with primer pairs were further analyzed, which amplify fragments of the mRNA from the 5 '-untranslated region to the stalk exon and from the stalk exon to the sixth exon, respectively.
  • the major obtained products corresponded to the sizes predicted for the correctly spliced exons.
  • the type II lectin-like receptors have been shown to usually dimerize and to form either homodimers or heterodimers combining two different receptor chains. In certain cases the dimerization with a heterologous lectin-like receptor chain has been shown to be necessary for surface expression. This is, for example, the case for the NKG2/CD94 receptors (Carretero M. et al. Eur J Immunol. 27 [1997] 563-567. Therefore, the surface expression of FLAG-tagged recombinant LLR-J24 in 293 cells and HUVEC following transient transfection with the respective expression constructs were evaluated.
  • the invention provides:
  • the invention also provides the use of a gene of the invention as a diagnostic reagent.
  • Detection of a mutated form of a gene of the invention associated with a dysfunction will provide a diagnostic tool, e.g. in a diagnostic assay, that may add to or define a diagnosis of a disease or susceptibility to a disease which results from under-expression, over-expression or altered expression of the corresponding gene or a mutant version therof, and/or a polypeptide of the invention.
  • Individuals carrying mutations in the corresponding gene may be detected at the DNA level according to a conventional method.
  • Nucleic acids for diagnosis may be obtained from a subject's cells, such as from blood, urine, salvia, tissue biopsy or autopsy material.
  • the genomic DNA may be used directly for detection or may be amplified enzymatically by using PCR or other amplification techniques prior to analysis.
  • RNA or cDNA may also be used in the analysis similarly. Deletions and insertions may be detected by a change in size of the amplified product in comparison to the normal genotype. Point mutations may be identified by hybridizing amplified DNA to labeled gene nucleotide sequences of the invention. Perfectly matched sequences may be distinguished from mismatched duplexes by RNase digestion or by differences in melting temperatures.
  • DNA sequence differences may also be detected by alterations in electrophoretic mobility of DNA fragments in gels, with or without denaturing agents, or by direct DNA sequencing, e.g. according to Myers et al. Science 230 (1985) 1242. Sequence changes at specific locations may also be revealed by nuclease protection assays, such as RNase and SI protection or the chemical cleavage method, e.g. according to Cotton et al. Proc. Natl Acad. Sci. USA 85 (1985) 4397-4401.
  • An array of oligonucleotides probes comprising the gene nucleotide sequence of the invention or fragments thereof may be constructed to conduct efficient screening of e.g. genetic mutations.
  • Array technology methods may e.g. be used to address a variety of questions in molecular genetics including gene expression, genetic linkage, and genetic variability, e.g. according to M. Chee et al. Science 274 (1996) 610-613.
  • a diagnostic assay offers a process for diagnosing or determining a susceptibility to diseases, such as immunological or inflammation- related diseases, including e.g. inflammation, arteriosclerosis, restenosis, reperfiision injury, inflammatory bowel disease, psoriasis, atopic dermatitis, transplant rejection, autoimmune diseases, allergy and cancer; through detection of mutation in a gene of the invention.
  • diseases such as immunological or inflammation- related diseases, including e.g. inflammation, arteriosclerosis, restenosis, reperfiision injury, inflammatory bowel disease, psoriasis, atopic dermatitis, transplant rejection, autoimmune diseases, allergy and cancer; through detection of mutation in a gene of the invention.
  • a diagnostic assay offers a process for diagnosing or determining a susceptibility to diseases, e.g. including inflammatory diseases, such as acute or chronic inflammatory diseases, autoimmune diseases, transplant rejection, cancer, atherosclerosis and restenosis.
  • diseases e.g. including inflammatory diseases, such as acute or chronic inflammatory diseases, autoimmune diseases, transplant rejection, cancer, atherosclerosis and restenosis.
  • a diagnostic assay offers a process for diagnosing or determining a susceptibility to diseases related to unbalanced, increased or decreased DC functions, including e.g. chronic inflammatory diseases, autoimmune diseases, transplant rejection crisis, inflammatory skin diseases such as contact hypersensitivity and atopic dermatitis, or virally induced immune suppression, e.g. AIDS, e.g. all forms of suceptibility to viral, bacterial, parasite infectious diseases and cancer.
  • diseases related to unbalanced, increased or decreased DC functions including e.g. chronic inflammatory diseases, autoimmune diseases, transplant rejection crisis, inflammatory skin diseases such as contact hypersensitivity and atopic dermatitis, or virally induced immune suppression, e.g. AIDS, e.g. all forms of suceptibility to viral, bacterial, parasite infectious diseases and cancer.
  • Diseases may be diagnosed e.g. according to a conventional method, e.g. by methods comprising determining from a sample derived from a subject an abnormally decreased or increased level of a gene or polypeptide or gene mRNA of the invention. Decreased or increased expression can be determined at the RNA level e.g. according to a conventional method for the quantisation of polynucleotides, such as, for example, PCR, RT-PCR, RNase protection, Northern blotting and other hybridization methods.
  • Assay techniques that may be used to determine levels of a protein, such as a polypeptide of the invention, in a sample derived from a host may be carried out e.g. according to a conventional method as conventional. Such assay techniques include e.g. radioimmunoassays, competitive-binding assays, Western Blot analysis and ELISA assays.
  • the invention provides a diagnostic kit for a disease or susceptibility to a disease, e.g. such as mentioned above; comprising as a main component a) a gene of the invention, including e.g. allelic variants thereof, or a fragment thereof; or a splice variant thereof; b) a nucleotide sequence complementary to that of a); c) a polypeptide of the invention, including e.g. a polypeptide of an amino acid sequence which has at least 80 % identity thereto, e.g.
  • a fragment or a variant of a polypeptide of the invention including a fragment or a variant of a polypeptide of the invention, or a fragment or a variant of a polypeptide of an amino acid sequence which has at least 80 % identity to said polypeptide of the invention, or d) an antibody to a polypeptide of the invention; e.g. any such kit, a), b), c) or d) may comprise a substantial component, e.g. including an appropriate environment of a sample to be tested, e.g. appropriate means to determine the effect of any of a), b), c) or d) in a sample to be tested.
  • a gene according to the invention is also useful for chromosome identification.
  • the sequence is specifically targeted to and can hybridize with a particular location on an individual human chromosome.
  • the mapping of relevant sequences of the invention to chromosomes is an important first step in correlating those sequences with gene associated disease. Once a sequence has been mapped to a precise chromosomal location, the physical position of the sequence on the chromosome may be correlated with genetic map data. Corresponding data is disclosed in e.g. V. McKusick Mendelian Inheritance in Man (available on line through Johns Hopkins University Welch Medical Library). The relationship between genes and diseases that have been mapped to the same chromosomal region may be identified through linkage analysis (coinheritance of physically adjacent genes).
  • the differences in the cDNA or genomic sequence between affected and unaffected individuals may also be determined. If a mutation is observed in some or all of the affected individuals but not in any normal individuals, then the mutation is likely to be the causative agent of the disease.
  • IKK2-55 localizes to chromosome 12q23.1, in close proximity to the long form of APAFl (apoptotoc protease activating factor 1), and the LLR-J24 gene of the invention has been used for chromosome identification on the short arm of chromosome 12 in the NK receptor gene complex; susceptibilities to viral diseases and arthritis have been mapped to similar syntenic regions in rodents.
  • a polypeptide of the invention or fragment thereof, or cells expressing such polypetide of the invention or fragment thereof, can also be used as immunogens to produce antibodies immunospecific for said polypeptide of the invention.
  • immunospecific means that the antibodies have substantially greater affinity for the said polypeptide of the invention than their affinity for other related or unrelated polypeptides.
  • Antibodies generated against a polypeptide of the invention maybe obtained e.g. by administering such polypeptide, or an epitope-bearing fragment-analogue or cell, to an animal, preferably a non-human, using routine protocols.
  • an appropriate technique which provides antibodies e.g. produced by continuous cell line cultures, may be used, e.g. the hybridoma technique (Kohler, G. and C. Milstein Nature 256 [1975] 495-497), the trioma technique, the human B-cell hybridoma technique (Kozbor et al.
  • Antibodies against a polypeptide of the invention may also be useful in the treatment of diseases, e.g. in case of antibodies against a DINO gene, in diseases such as inflammatory diseases, e.g. acute or chronic inflammatory diseases, autoimmune diseases, transplant rejection, cancer, atherosclerosis and restenosis; or in the case of antibodies against a LLR-J24 gene, in disaeses such as chronic inflammatory diseases, autoimmune diseases, transplant rejection crisis, including e.g. inflammatory skin diseases such as contact hypersensitivity, atopic dermatitis, or virally induced immune suppression, e.g. AIDS, e.g. all forms of suceptibility to viral, bacterial, parasite infectious diseases and cancer.
  • diseases e.g. acute or chronic inflammatory diseases, autoimmune diseases, transplant rejection, cancer, atherosclerosis and restenosis
  • a LLR-J24 gene in disaeses such as chronic inflammatory diseases, autoimmune diseases, transplant rejection crisis, including e.g. inflammatory skin diseases such as contact hypersensitivity,
  • the invention provides an antibody against a polypeptide of the present invention.
  • An antibody of the invention includes a bispecific antibody binding to the LLR-J24 polypeptide and a viral, bacterial or eukaryotic parasite or to a cancer cell.
  • the invention provides a bispecific antibody binding to the LLR-J24 polypeptide and a viral, bacterial or eukaryotic parasite.
  • the invention provides a bispecific antibody binding to the LLR-J24 polypeptide and a cancer cell.
  • bispecific antibody In place of a bispecific antibody another bispecific reagent having the ability to bind to the LLR-J24 polypeptide and a viral, bacterial or eukaryotic parasite or to a cancer cell may also be used.
  • the invention provides a bispecific reagent which is not an antibody and having the ability to bind to the LLR-J24 polypeptide and a viral, bacterial or eukaryotic parasite or to a cancer cell.
  • the invention provides a method of inducing an immunological response in a mammal which comprises delivering a polypeptide of the invention via a vector, directing expression of a corresponding gene of the invention in vivo in order to induce such an immunological response to produce antibodies to protect said animal from diseases; and, in a yet further aspect, an immunological/vaccine formulation (composition) which, when introduced into a mammalian host, induces an immunological response in that mammal to a polypeptide of the invention, wherein the composition comprises a polypeptide of the invention or a gene of the invention.
  • the invention provides a method for inducing an immunological response in a mammal which comprises inoculating the mammal with a DINO polypeptide of the invention, or a fragment thereof, or with a LLR-J24 polypeptide of the invention, or a fragment thereof, respectively, adequate to produce antibody and/or T cell immune response to protect said animal from diseases, e.g. diseases as indicated above, e.g. wherein a LLR-J24 polypeptide of the invention is preferably of SEQ ID NO:6 or SEQ ID NO:8, more preferably ofSEQ ID NO:8.
  • a vaccine formulation may further comprise a suitable carrier.
  • a polypeptide of the invention may be broken down in the stomach, it may be preferably administered parenterally (including subcutaneous, intramuscular, intravenous, intradermal etc. injection), hnmunological/vaccine formulations suitable for parenteral administration include e.g. aqueous and non-aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents or thickening agents.
  • parenterally including subcutaneous, intramuscular, intravenous, intradermal etc. injection
  • hnmunological/vaccine formulations suitable for parenteral administration include e.g. aqueous and non-aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the recipient; and aqueous and non-aque
  • the formulations may be presented in unit-dose or multi-dose containers, for example, sealed ampoules and vials and may be stored in a freeze-dried condition requiring only the addition of a sterile liquid carrier immediately prior to use.
  • the vaccine formulation may also include adjuvant systems for enhancing the immunogenicity of the formulation, such as oil- in water systems and other appropriate systems. The dosage will depend on the specific activity of the vaccine and can be readily determined by routine experimentation.
  • a polypeptide of the invention may be responsible for many biological functions, including those underlying many pathological states. Accordingly, it is desirable to find compounds and drugs which activate, e.g. biocompetantly, e.g. transcriptionally and/or stimulate activity of a polypeptide of the invention, or expression of a gene of the invention on the one hand (agonists) and which can inhibit the function of a polypeptide of the invention or expression of a gene of the invention on the other hand (antagonists).
  • a polypeptide of the invention or functional mimetics thereof e.g.
  • Agonists and antagonists of a IKK2-55 polypeptide of the invention may be used in the treatment of diseases including e.g. immunological or inflammation-related diseases, such as inflammation, arteriosclerosis, restenosis, reperfiision injury, inflammatory bowel disease, psoriasis, atopic dermatitis, transplant rejection, autoimmune diseases, allergy and cancer.
  • diseases including e.g. immunological or inflammation-related diseases, such as inflammation, arteriosclerosis, restenosis, reperfiision injury, inflammatory bowel disease, psoriasis, atopic dermatitis, transplant rejection, autoimmune diseases, allergy and cancer.
  • Agonists and antagonists of a DINO polypeptide of the present invention maybe used in the treatment of diseases including e.g. inflammatory diseases, acute or chronic, autoimmune diseases, transplant rejection, cancer, atherosclerosis and restenosis.
  • Agonists and antagonists of a LLR-J24 polypeptide of the invention maybe used in the treatment of diseases including e.g. chronic inflammatory diseases, autoimmune diseases, transplant rejection crisis, such as inflammatory skin diseases, e.g. contact hypersensitivity, atopic dermatitis, or virally induced immune suppression, e.g. AIDS, e.g. all forms of suceptibility to viral, bacterial, parasite infectious diseases, and cancer.
  • LMWs Low Molecular Weight compounds
  • antisense oligonucleotides may be desirable to modulate the effects of a corresponding polypeptide of the invention and its ligands on the physiology/function of the EC, or DC, respectively.
  • Screening procedures may involve the production of appropriate cells which express the receptor of a polypeptide of the invention on the surface thereof in the case of IKK2-55 or LLR-J24.
  • Appropriate cells include cells e.g. from mammals, yeast and Drosophila.
  • IKK2-55 cells expressing IKK2-55
  • LLR-J24 cells expressing the receptor (or cell membranes containing the expressed receptor)
  • a test compound may be contacted with a test (candidate) compound to observe binding, or stimulation or inhibition of a functional response.
  • a screening assay may be used to test binding of a candidate compound wherein binding to the cells bearing the IKK2-55, or bearing the LLR-J24 receptor, respectively, may be detected by means of a label directly or indirectly associated with the candidate compound or in an assay involving competition with a labeled competitor.
  • a screening assay may be used further to test whether the candidate compound results in a signal generated by activation of the receptor, using detection systems appropriate to the cells bearing the IKK2-55, or the LLR-J24 receptor, respectively, at their surfaces. Inhibitors of activation may be assayed in the presence of a known agonist and the effect on activation by the agonist by the presence of the candidate compound may be observed.
  • a screening assay may comprise the steps of mixing a candidate compound with a solution containing a polypeptide of the invention to form a mixture, determining activity of said polypeptide in the mixture, and comparing the activity of the mixture with the activity of a standard.
  • a gene (cDNA) of the invention, a polypeptide of the invention and antibodies to a polypeptide of the invention may also be used to provide a screening assay for detecting the effect of candidate compounds on the production of said gene (mRNA) and said polypeptide in cells.
  • an ELIS A may be constructed for determining cell associated levels of said polypeptide, e.g. using monoclonal and polyclonal antibodies according to a conventional method, and that ELIS A may be used to discover agents (agonists or antagonists) which may inhibit (antagonist) or enhance (agonist) the production or the activity of said polypeptide in suitably manipulated cells or tissues.
  • An assay for screening may be conducted e.g. according to a conventional method.
  • Examples of potential (antagonists of a gene of the invention include antibodies or, in some cases, oligonucleotides or protein (polypeptides) closely related to the ligand (antagonist bound to a polypeptide of said gene) of said gene, e.g. a fragment of said ligand, or small molecules, which bind to the receptor but do not elicit a response, so that the activity of the receptor is prevented.
  • Examples of potential (antagonists according to the invention include compounds which bind to a polypeptide according to the invention, including e.g. oligopeptides, polypeptides, protein, antibodies, mimetics and small molecules, e.g. low molecular weight compounds (LMW's).
  • LMW's low molecular weight compounds
  • the invention provides a screening assay for identifying an agonist or an antagonist of a polypeptide of the invention which assay comprises as a main component a) a polypeptide of the invention, b) a recombinant cell expressing a polypeptide of the invention, c) a cell membrane expressing a polypeptide of the invention, or d) an antibody to a polypeptide of the invention; and means for a contact with a candidate compound; e.g.
  • determining the effect of the candidate compound on any of a), b), c) or d means for determining the effect of the candidate compound on any of a), b), c) or d); e.g., determining whether in the presence of the candidate compound there is a decrease or enhancement in the production and or the biological activity of a polypeptide according to the invention, e.g. by comparison of the activity of any of a), b), c) or d) in the presence and in the absence of the candidate compound; and in another aspect, a method of identifying an agonist or antagonist, preferably agonist, including e.g. ligands, receptors, antibodies or LMW's, which decreases or enhances the production and/or the biological activity of a polypeptide of the invention, which method comprises
  • step B choosing an agonist or antagonist determined in step B), e.g. choosing an appropriate candidate compound from which an agonist/antagonist effect is positively determined in step B).
  • a), b), c) or d) may comprise a substantial component.
  • a candidate compound includes compound (libraries), from which the effect on any of a), b), c) or d) is unknown .
  • Compound (libraries) include compounds which are set out above as (antagonists to a polypeptide according to the invention.
  • An (antagonist is a candidate compound from which an effect on any of a), b), c) or d) has been found in a screening assay or in a method for identifying (antagonists as described above.
  • An (antagonist may decrease or enhance the production and or the biological activity of a polypeptide according to the invention.
  • the invention provides an antagonist or an agonist, preferably an antagonist, of a polypeptide of the invention, which is characterized in that said antagonist or agonist can be provided by the following method steps: A) contacting a) a polypeptide of the invention, b) a recombinant cell expressing a polypeptide of the invention, c) a cell membrane expressing a polypeptide of the invention, or d) an antibody to a polypeptide of the invention with a candidate compound;
  • step B choosing an agonist or antagonist determined in step B), e.g. choosing an appropriate candidate compound from which an agonist/antagonist effect is positively determined in step B).
  • An (antagonist of IKK2-55 (polypeptide) of the invention may be used in the treatment of diseases, e.g. including immunological or inflammation-related diseases, such as inflammation, arteriosclerosis, restenosis, reperfiision injury, inflammatory bowel disease, psoriasis, atopic dermatitis, transplant rejection, autoimmune diseases, allergy and cancer.
  • An (antagonist of DINO (polypeptide) of the invention may have immune modulatory activities and may be used in the treatment of diseases including e.g. inflammatory diseases, such as acute or chronic inflammatory diseases, autoimmune diseases, transplant rejection, cancer, atherosclerosis and restenosis.
  • An (antagonist of LLR-24 (polypeptide) of the invention may have immune modulatory activities and may be used in the treatment of diseases including e.g. chronic inflammatory diseases, autoimmune diseases, transplant rejection crisis, such as inflammatory skin diseases, e.g. contact hypersensitivity, atopic dermatitis, or virally induced immune suppression, e.g AIDS, e.g. all forms of suceptibility to viral, bacterial, parasite infectious diseases and cancer.
  • An (antagonist of a polypeptide of the invention may thus be useful as a pharmaceutical.
  • one approach comprises administering to a subject an antagonist of a polypeptide of the invention, e.g. in combination with a pharmaceutically acceptable excipient, in an amount effective to inhibit activation of a gene and or polypeptide of the invention by blocking binding of ligands to said polypeptide, or by inhibiting a second signal, and thereby alleviating the abnormal condition caused by e.g. over-, under- or altered expression of said gene (or a mutant version therof).
  • an antagonist of a polypeptide of the invention e.g. in combination with a pharmaceutically acceptable excipient
  • soluble forms of a corresponding polypeptide of the invention in case of DINO or LLR-J24, soluble forms of a corresponding polypeptide of the invention, still capable of binding the ligand in competition with endogenous polypeptide, may be administered.
  • Typical embodiments of such competitors may comprise fragments of said polypeptide of the invention.
  • the invention provides a soluble LLR-J24 polypeptide of the invention which binds to a ligand on T cells or other immune cells and which is able to activate the immune function and e.g. anergy.
  • the invention comprises inhibition of expression of the gene encoding endogenous polypeptide of the invention using expression blocking techniques.
  • oligomers e.g. oligonucleotides which form triple helices with a gene according to the invention may be supplied, e.g. according to Lee et al. Nucleic Acids Res. 6 (1979) 3073; Cooney et al. Science 241 (1988) 456; and Dervan et al. Science 251 (1991) 1360.
  • Such oligomers may be administered per se or may be expressed in vivo.
  • one approach comprises administering to a subject in need of an increased expression of a polypeptide of the invention a therapeutically effective amount of a compound which activates a gene of the invention (agonist), e.g. in combination with a pharmaceutically acceptable excipient, to thereby alleviate the abnormal condition.
  • a compound which activates a gene of the invention agonist
  • gene therapy may be employed to effect the endogenous production of a polypeptide of the invention by the relevant cells in the subject.
  • a gene of the invention may be engineered for expression in a replication defective retroviral vector, e.g. according to a method as indicated above.
  • a retroviral expression construct obtained may be isolated and introduced into a packaging cell transduced with a retroviral plasmid vector containing RNA encoding a polypeptide corresponding to said gene of the invention, such that the packaging cell produces infectious viral particles containing the gene of interest.
  • These producer cells maybe administered to a subject for engineering cells in vivo and expression of the polypeptide in vivo.
  • gene therapy see e.g. Chapter 20, Gene Therapy and other Molecular Genetic-based Therapeutic Approaches (and references cited therein) in Human Molecular Genetics. T Strachan and A P Read, BIOS Scientific Publishers Ltd. (1996).
  • the invention provides an agonist or an antagonist, preferably an antagonist, of the polypetides of the invention for use as a pharmaceutical; e.g. for the treatment or prevention of diseases as indicated above, and, in another aspect:
  • a soluble form of a IKK2-55 polypeptide, or of a LLR-J24 polypeptide, respectively, of the invention for use as a pharmaceutical, e.g. for the treatment of the same diseases wherein an IKK2-55, or LLR-J24, respectively, (antagonist of the invention is suitable.
  • An (ant)antagonist of a polypeptide according to the invention may be administered in the form of a pharmaceutical composition.
  • the invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising an agonist or an antagonist, preferably an antagonist, of the invention as an active ingredient in combination with pharmaceutically acceptable excipient(s)/carrier(s); e.g. a pharmaceutical composition wherein that said antagonist or agonist can be provided by the following method steps:
  • Such pharmaceutical composition may be produced as appropriate, e.g. according to a conventional method, e.g. by mixing an (antagonist provided by the method steps A), B) and C) with excipient(s)/carrier(s) and further processing the mixture obtained, to obtain a pharmaceutical composition for appropriate administration.
  • the invention provides a method of treating abnormal conditions related to both an excess of or an insufficient level, preferably an excess, of expression of a gene of the invention; or related to both an excess and insufficient activity of a polypeptide of the invention, preferably an excess; e.g. in case of IKK2-55 a method of treating diseases, including immunological or inflammation-related diseases, such as inflammation, arteriosclerosis, restenosis, reperfiision injury, inflammatory bowel disease, psoriasis, atopic dermatitis, transplant rejection, autoimmune diseases, allergy and cancer; e.g.
  • diseases including immunological or inflammation-related diseases, such as inflammation, arteriosclerosis, restenosis, reperfiision injury, inflammatory bowel disease, psoriasis, atopic dermatitis, transplant rejection, autoimmune diseases, allergy and cancer; e.g.
  • a method of treating diseases including inflammatory diseases, such as acute or chronic inflammatory diseases, autoimmune diseases, transplant rejection, cancer, atherosclerosis and restenosis; e.g. in case of LLR-24 a method of treating diseases, including chronic inflammatory diseases, autoimmune diseases, transplant rejection crisis, such as inflammatory skin diseases, e.g. contact hypersensitivity, atopic dermatitis, or virally induced immune suppression, e.g. ADDS, e.g. all forms of suceptibility to viral, bacterial, parasite infectious diseases and cancer; comprising administering a therapeutically effective amount of an agonist or antagonist of the invention, which can for example be provided by the method steps A), B) or C) as indicated above, e.g.
  • inflammatory diseases such as acute or chronic inflammatory diseases, autoimmune diseases, transplant rejection, cancer, atherosclerosis and restenosis
  • LLR-24 a method of treating diseases, including chronic inflammatory diseases, autoimmune diseases, transplant rejection crisis, such as inflammatory skin diseases, e.g. contact hypersensitivity,
  • the invention provides a method of treating infection or cancer by administering an effective amount of a bi-specific antibody or reagent according to the invention which is able to increase antigen-uptake and presentation and activation of T cells by DCs, to a subject in need of such treatment.
  • the invention provides a method of treating infection or cancer comprising adniinistering an effective amount of a soluble LLR-J24 protein which is able to activate the immune function to a subject in need of such treatment.
  • IKK2-55 is an intracellular protein.
  • Preferred forms of systemic administration of a pharmaceutical composition of the invention include injection, typically by intravenous injection. Other injection routes, such as subcutaneous, intramuscular, or intraperitoneal, may be used. Alternative means for systemic administration include transmucosal and transdermal administration, e.g. using penetrants such as bile salts or fusidic acids or other detergents. In addition, if properly formulated in enteric or encapsulated formulations, oral administration may also be possible. Administration of a composition according to the invention may also be topical and/or localized, e.g. in the form of cremes, pastes, gels and the like.
  • the dosage range required may depend on the choice of a polypeptide, or an agonist or antagonist of the invention, the route of administration, the nature of the pharmaceutical composition, the nature of the subject's condition, and the judgment of the attending practitioner. Suitable dosages, however, may be in the range of from about 0.1 mg/kg to about 10 mg/kg, such as from about 0.1 mg/kg to about 1 mg/kg of subject. Variations in the needed dosage, however, maybe expected in view of the variety of compounds available and the differing efficiencies of various routes of administration. For example, oral administration would be expected to require higher dosages than administration by intravenous injection. Variations in these dosage levels may be adjusted, e.g. according to standard empirical routine for optimization.
  • Polypeptides used in treatment may also be generated endogenously in a subject who is e.g. in need of such treatment, in treatment modahties often referred to as "gene therapy", e.g. as described above.
  • cells from a subject may be engineered ex vivo with a polynucleotide, such as a DNA or RNA, to encode a IKK2-55 polypeptide e.g. by use of a retroviral plasmid vector.
  • Engineered cells may be introduced into the subject who is e.g. in need of such treatment.
  • genetically modified DCs may be provided which express LLR-J24 constructs which are able to improve antigen-uptake and presentation, e.g. which are able to improve T cell and immune system activation.
  • the invention provides genetically modified dendritic cells which express LLR-J24 constructs which are able to improve antigen-uptake and presentation, e.g. which are able to improve T cell and immune system activation.
  • An antibody, a ligand or a reagent binding to a LLR-J24 polypeptide may inhibit DC formation/maturation, and in consequence may e.g. improve immune function and anergy.
  • the invention provides an antibody, a ligand or a reagent binding to the LLR-J24 polypeptide of the invention, which inhibits DC formation/maturation.
  • IKK2-55 Subcellular localization of IKK2-55. HUVEC were transfected with aYFP-IKK2-55 fusion construct together with CFP fusion genes for different cellular compartments and viewed under the fluorescence microscope. Left row shows localization of IKK2-55 in the yellow channel, the right row shows localization of the markers in the cyan channel. Upper panels: endoplasmatic reticulum (ER); middle panels: mitochondria (mito); lower panels: golgi.
  • HUVEC were transfected with the 5xNF-kB-Luc construct together with different amounts of IKK2-55 as well as Ubiquitin-bgal as internal control and after 2 days stimulated with 100 U/ml TNF ⁇ for 6 hours.
  • IKK2-55 in combination with different kinases
  • HUVEC were transfected with the 5xNF-kB-Luc construct together with IKK2-55, with different kinases (IKK2, NIK, TAK1, p38) as indicated as well as Ubiquitin-bgal as internal control.
  • IKK2, NIK, TAK1, p38 different kinases
  • Ubiquitin-bgal Ubiquitin-bgal
  • Luciferase values are expressed as relative light units and were normalized for /3-gal expression. Dark columns: 500 ng U K2-55; shaded columns: 0 ngIKK2-55
  • RLU-jSgal Relation Light Units per /3-gal Figure 5 (LLR-J24)
  • CTLDs of the genes displayed were aligned and a phylogenetic tree constructed as described in the Examples. All sequences were chosen to start two amino acids before the first absolutely conserved cysteine in the domain. NKG2E and H are two alternatively spliced transcripts from the same gene. For LY49L a hypothetical sequence containing all three CTLD exons spliced comparably to the other genes were chosen, although only aberrantly spliced transcripts have been detected for this gene. The genes consistently found to be closer related to each other using different parameter settings for alignment and tree construction are indicated by brackets on the right. The scale below is a measure for substitution events. Preferential expression of the subfamilies in NK cells, T cells, endothelial cells (EC), monocytic cells (MO), dendritic cells (DC) or more broadly in leukocytes (LEUK) is indicated.
  • Esxpression plasmids for C-terminally FLAG-tagged LOX-1, LLR-J24 and CLEC-1 were transfected into HUVEC. Expression of the proteins was analyzed 24 h post-transfection following staining with anti-FLAG antibodies and secondary Texas Red-labeled antibodies.
  • RNA from MoDC was reverse-transcribed using a specific LLR-J24 primer and PCR performed on the obtained cDNA using different primer pairs as indicated, (a) Displays the amplification of transcripts with and without the stalk exon for MoDC RNA, (b) displays the amplification of the 5'-part and (c) of the 3'-part of the stalk containing transcript for MoDC and HL60 RNA as set out under B in Figure 4A. Lane 6 displays the product obtained from a plasmid containing the full-length LLR-J24 cDNA.
  • Figure 10 shows the product obtained from a plasmid containing the full-length LLR-J24 cDNA.
  • the first primer pair (a) was designed to test the presence of the stalk exon fragment resulting in predicted 505 bp and 367 bp PCR products with and without the stalk exon fragment, respectively.
  • the second primer pair (b) tested correct splicing of the 5'-part
  • the third primer pair (c) correct splicing of the 3 '-part of the stalk exon containing transcripts.
  • BSA bovine serum albumin
  • CB cord blood
  • CTLD C-type lectin-like domain
  • DC dendritic cell dNTPs: deoxynucleotide triphosphate
  • ER endoplasmatic reticulum
  • LPS lipopolysaccharide
  • MNC mononuclear cells
  • PBS phosphate-buffered saline
  • RT-PCR reverse-transcription PCR
  • SCF stem cell factor
  • IKK2-55 gene cDNA clones comprising SEQ ID NO: 1 of an IKK2-55 gene are isolated from libraries of PHA-activated lymphocytes mRNA and by sequence comparison using the BLAST algorithm with the GenBank databases.
  • IKK2-55 encodes a 377 AA protein that does not show any significant homology with entries in the databases. It also does not contain distinct protein motifs present in the Pfam and Prosite databases except a region of low compositional complexity at AA 45-58 and two coiled-coils at 116-259 and 287-323.
  • a genomic clone exists in the database (AC013283.htgs) that resembles the human gene. Searching the human draft genomic sequence with the EST clones, e.g. AI375687, IKK2-55 localizes to chromosome 12q23.1. Thereby the IKK2-55 transcription start site localizes within 2 kb to the transcription start site of APAFl (apoptotoc protease activating factor 1), implicating crosstalk in the regulation of these two genes.
  • APAFl apoptotoc protease activating factor 1
  • Intracellular localization may provide evidence for the function of a protein.
  • Transfection of a YFP-IKK2-55 fusion gene results in localization to perinuclear regions ( Figure 2) that, by cotransfection of different specific markers appears to resemble the endoplasmatic reticulum (ER; the construct contains the targeting sequence of caheticulin fused to CFP; Clontech Living Colors ER Subcellular Localization Vector).
  • a MTN multiple tissue Northern blot; Clontech
  • Clontech multiple tissue Northern blot; Clontech
  • two bands at 2.4 and 4.3 kb are detected predominantly in kidney, liver, placenta, spleen and heart.
  • Kidney 2 pooled tumors (clear cell type), NCI-CGAP-Kidl2 LF2 1
  • Virtual SAGE is performed (the string aaaataagcc is chosen by the program) and high expression in the human breast cancer line MDA-MB-468 that is PTEN -/- is detected.
  • RT-PCR is performed using IKK2-55-specific primers and mRNA from stimulated and control EC. Enhanced IKK2-55 expression is found in EC that had been stimulated with IL-1, with LPS orwithVEGF.
  • IKK2-55 interacts with IKK2 as shown by genetic and biochemical means, JJKK2-55 influence on NF-kB activity was tested.
  • An NF-kB dependent promoter-luciferase reporter construct namely 5xNF-kB-Luc, containing 5 copies of a NF-kB binding site, is used in transient fransfections of HUVEC, with or without TNF ⁇ stimulation.
  • the results are shown in Figure 3 and demonstrate that, depending on the amounts used, IKK2-55 has either stimulatory (low, physiological amounts) or inhibitory (at high amounts) activity.
  • Example 6 DINO gene (homology) cDNA clone comprising SEQ ID NO:3 of the DINO gene isolated from libraries of skin microvascular endothelial cell mRNA and by sequence comparison using the BLASTX algorithm with the SWISSPROT Protein database is found to be homologous to the family of HERC proteins (domain homologous to E6 associated protein carboxy-ter inus and RCCl domain), especially to HERC3 (accession No. D25215). and Cepl (accession no. AB027289).
  • the DINO gene of SEQ ID NO:3 shows an overall homology to HERC3 and Cepl of 37.8 % homology, but the homology is significantly higher (up to 70 %) in the defined protein domains.
  • the HECT domain of HERC proteins is involved in fransfering ubiquitin to specific cellular target proteins destined for degradation or processing.
  • the potential of DINO to induce p53 transcriptional activity may be assayed in a signaling pathway profiling system in vivo.
  • the system is based on cis-acting elements upsfream from the luciferase reporter gene.
  • the pathway is activated by overexpression of DINO in fransfectedHeLa or endothelial cells the expression of luciferase can be measured. In this way, the effects of different drugs, stimuli or co-transfected genes can be studied by assaying for luciferase expression.
  • Example 8 LLR-J24 gene (homology) cDNA clones comprising SEQ ID NO: 5 of an LLR-J24-1 gene are isolated from libraries of DC mRNA and detected in the GenBank expressed sequence tagged database (dbEST). Libraries are searched with short consensus sequences established from the NKG2-A, -C, -D and the human Ly49 genes (Houchins J.P. et al. J. Exp. Med. 173 [1991] 1017-1020; Bull C. et al. Genes and Immunity 1 [2000] 280-287). cDNA clones comprising SEQ ID NO: 7 of the splice variant LLR-J24-2 have been isolated by reverse transcription PCR from mRNA of monocyte-derived DCs.
  • the cDNA clones comprising SEQ ID NO: 5 and SEQ ID NO: 7 were found by sequence comparison using the BLASTX algorithm to be homologous to the superfamily of CTLD receptors.
  • Multiple alignment of the CTLD domains of all known lectin-like genes of the NK receptor complex is performed using the ClustalW method of the Mac Vector 6.5 software with the parameters: Open gap penalty - 7.0, extend gap penalty for pairwise alignment - 2.5, and for multiple alignment -1.0.
  • Accession numbers for the molecules used in the alignment are: NKG2A (X54867), NKG2C (X54869), NKG2E (L14542), NKG2H (AF078550), NKG2D (X54870), LOX-1 (AF035776), CLEC-1 (AF200949), CLEC-2 (AF124841), DCIR (AJ133532), AICL (X96719), LLT-1 (AF133299), CD69 (L07555), KLRF1 (AF175206), MAFA (AF081675), andNKR-PlA (U11276).
  • LY49L hypoxia-resonated LY49L CTLD sequence
  • AF213453 The hypothetical LY49L (hypLy49L) CTLD sequence was obtained by combining the corresponding 3 exons of the gene (AF213453), although a transcript with correctly spliced CRD exons according to the other CTLD genes has so far not been detected for LY49L.
  • Phylogenetic trees are constructed by the MegAlign program of the DNASTAR software version 3.0 according to the nearest neighbor method.
  • the AICL/LLT-1/CD69 group and the KLRF1, MAFA and NKR-Pl receptors are again somewhat more distant and are displayed in separate branches in a multiple alignment.
  • the sequence of LLR-J24-1 displayed high similarity to the recently described murine DECTIN-1 cDNA with the exception that a stalk exon was missing from the human cDNA. It could be shown that a stalk exon is found spliced in a subtraction of about 5 to 10 % of the transcripts ( Figures 9 and 10) as shown for the splice variant LLR-J24-2 in SEQ ID NO:7.
  • the first tyrosine (residue 3) in the motif is 4 amino acid positions before the leucine (residue 7), whereas this distance is 3 amino acid positions in the classical Y 2 Lx6- 8 Y 2L motif.
  • the following residues of the motif are correctly placed.
  • Both proteins further show consensus sites for N-glycosylation.
  • the lectin-like domain of the human and murine versions lack most of the residues described to be involved in Ca ⁇ -binding suggesting a non-carbohydrate ligand.
  • the transmembrane domain does not display a charged amino acid indicating that association with ITAM-containing adapters such as the DAP molecules does not take place.
  • LLR-J24 receptor has a proteineous ligand such as a lipoprotein, a MHC class I homologue or another transmembrane or secreted protein of cellular or parasite ori in.
  • the complete cDNA of a gene of SEQ ID NO:5 maybe obtained by either of the following methods: a) The method of Rapid Amplification of cDNA Ends (RACE) can be utilized to obtain the
  • the polymerase chain reaction can be used to amplify the 5' end of the cDNA from human cDNA libraries using sequential rounds of nested PCR with two sets of primers.
  • One set of antisense primers is specific to the 5' end of the partial cDNA and the other set of primers anneals to a vector specific sequence.
  • RT-PCR was performed according to following protocol: First 40 pg of an oligonucleotide primer specific for LLR-J24 (5'- GATTCCATGTCTAGGGATCTAC -3') is annealed with 3 ⁇ g of total RNA in a volume of 10 ⁇ l containing 50 mM Tris-HCL (pH 8.3), 75 mM KC1 and 3 mM MgCl 2 by heating to 85° followed by cooling to 42° over a period of 30 to 60 min.
  • oligonucleotide primer specific for LLR-J24 5'- GATTCCATGTCTAGGGATCTAC -3'
  • First strand synthesis is then performed in 20 ⁇ l containing 50 mM Tris-HCL (pH 8.3), 75 mM KC1, 3 mM MgCl 2 , 0.5 mM dNTPs, 20 mM DTT and 100 U Superscript Reverse Transcriptase (GIBCO BRL, Rockville, MD).
  • the cDNA contained in 1 ⁇ l of the first strand reaction mix is then employed as a template in a PCR reaction according to standard procedures.
  • the following primers are used:
  • 2nd-4th EXON forward: 5'-GGGAATCCTATGCTTGGTAAT-3', reverse: 5'-TGGAGATGGGTTTTCTTGGG-3 '; 5'-UT-STALK: forward: 5'-CTCCGGTAAGTACCTAGCCCA-3 ⁇ reverse: 5 '-GTGGTTTTGACAGCTTTGGT-3 '; STALK-3'-END: forward: 5'-GAGATCCAATTCAGGAAGCA-3 ⁇ reverse: 5 '-TGGAGATGGGTTTTCTTGGG-3 '.
  • the amplified products are cloned into an appropriate vector and subjected to restriction and sequence analysis. In this way SEQ ID NO:5 and SEQ ID NO:6 are obtained.
  • CBDC Cord blood progenitor cell derived DCs
  • CB samples were collected during healthy full-term deliveries at the obstetric department (Lainzer Hospital, Vienna, Austria) with the informed consent of the mothers.
  • Mononuclear cells (MNC) are isolated within 10 hours of collection by Lymphoprep® (Nycomed Pharma AS, Oslo, Norway) density gradient centrifugation.
  • CD34 + cells are isolated from CB-MNC by positive immunomagetic cell sorting using the MACS CD34+ cell isolation kit from Miltenyi (Miltenyi Biotech, Bergisch Gladbach, Germany) according to the instructions of the manufacturer. The purity of isolated CD34+ cells ranges between 95 % and 99 %.
  • hnmunomagnetically purified CD34 + progenitor cells are seeded in 6-well plates (Costar, Cambridge, MA, USA) at an initial cell density of 5 x 10 4 cells/ml and cultured in RPMI1640 medium (Life Technologies Ltd., Paisley, UK) supplemented with 10 % fetal calf serum (FCS), 2 mM glutamine and 50 ⁇ g/ml each of streptomycin and penicillin.
  • FCS fetal calf serum
  • This CM is further supplemented with SCF (50 U/ml) and Flt3-L (25 U/ml), both purchased from R&D Systems Inc., Minneapolis, MN, USA.
  • CM containing SCF 25 U/ml
  • Flt3-L 12.5 U/ml
  • GM-CSF 300 U/ml, Novartis, Basel, Switzerland
  • TNF ⁇ 50 U/ml
  • TGF/3 5 ng ml; R&D
  • Human monocytes obtained by countercurrent elutriation are seeded into Costar 6-well plates (Costar, Cambridge, MA, USA) at 8 x 10 5 cells/ml in CM supplemented with GM-CSF (300 U/ml) and rIL-4 (200 U/ml). Cultures are fed on day 3 by exchanging half of the medium for fresh CM that had been supplemented with GM-CSF and IL-4 to achieve the final concentrations indicated above.
  • B cells B cells, monocytes or DCs:
  • Human T cells, B cells and monocytes obtained by countercurrent elutriation T cells or B cells are cultured in CM and stimulated for 24 hours in the presence of PHA (10 ⁇ g/ml, Pharmacia Biotech, Uppsala, Sweden) or PWM (10 ⁇ g/ml, Sigma, St. Louis, MO, USA) and rhIL-4 (100 U/ml, Novartis Pharma, Basel, Switzerland), respectively.
  • PHA 10 ⁇ g/ml, Pharmacia Biotech, Uppsala, Sweden
  • PWM 10 ⁇ g/ml, Sigma, St. Louis, MO, USA
  • rhIL-4 100 U/ml, Novartis Pharma, Basel, Switzerland
  • Monocytes, MoDC or HPDC are stimulated with 100 ng/ml LPS (Sigma) or in the presence of 4 ⁇ g/ml of anti-CD40 mAb (mAb clone 626.2) that is further cross-linked in solution by the addition of 2 ⁇ g/ml of F(ab')2 - fragments of goat-anti mouse IgG (Pierce Chemical Corp, Rockford, IL, USA) for 6 hours at 37°C.
  • zymosan A 25 ⁇ g/ml, Sigma
  • anti-CD40 mAb cross-linked by F(ab')2 - fragments of goat-anti mouse IgG is used in conjunction with anti-CD40 mAb cross-linked by F(ab')2 - fragments of goat-anti mouse IgG.
  • final maturation of MoDC is induced by incubation in the presence inflammatory cytokines such as TNF ⁇ (200 U/ml) and JL-l ⁇ (100 U/ml) for 18 to 24 hours as indicated in the Description of the Figures.
  • inflammatory cytokines such as TNF ⁇ (200 U/ml) and JL-l ⁇ (100 U/ml) for 18 to 24 hours as indicated in the Description of the Figures.
  • Total cellular RNA is isolated from the cells following cell lysis in TRIzol reagent (GIBCO/BRL, Rockville, MD, USA), extracting DNA and proteins with chloroform and precipitating the RNA by isopropanol.
  • the receptors of a gene of SEQ ID NO:5 and SEQ ID NO:6 is expressed in either human embryonic kidney 293 (HEK293) cells or adherent CCL39 or dhfr CHO cells and the LLR-J24 gene of the invention is expressed in either human embryonic kidney 293 (KEK293) cells or adherent CCL39 or dhfr CHO cells or recombinant baculovirus-infected Sf9 cells.
  • the expression vectors typically contain the coding regions free of 5' and 3' UTR's downstream of a strong promoter, e.g. CMV-IE and a Koscak sequence as well as an antibiotic resistance gene, e.g. neomycin or zeocin.
  • the cells are transfected with individual receptor cDNAs by lipofectin and selected in the presence of 600 mg/ml G418 (neomycin). After 3 weeks of selection, individual clones are picked and expanded for further analysis. HEK293 or CHO cells transfected with the vector alone serve as negative controls. To isolate cell lines stably expressing the individual receptors, about 96 clones are typically selected and analyzed by RT PCR analysis. Receptor mRNAs are generally detectable in about 50 % of the G418-resistant clones analyzed. Recombinant baculoviruses for expression of the genes are generated, selected, purified and propagated using standard techniques.
  • LLR-J24 was obtained in a modified pcDNA3.1/HisA vector (Invitrogen, Groningen, Netherlands) providing a cytomegalovirus enhancer/promoter and tested in transient transfection.
  • the vector is modified by insertion of oligonucleotides containing a sequence encoding a Flag peptide.
  • the Flag-encoding sequence is inserted between the Hindi ⁇ and BamHI sites of the multiple cloning sites, in the pcDNA3.1/C-Flag modified vector between the Xhol and Apal sites.
  • the two differently modified vectors can be used to provide an N-terminal or C-terminal Flag epitope to proteins by cloning the respective cDNAs into corresponding restriction cleavage sites before or after the Flag sequence, respectively.
  • the coding region of all three genes is then amplified from the cDNA by PCR using specific oligonucleotides providing EcoRI and Notl cleavage sites for insertion into the pcDNA3.1/N-Flag vector or EcoRI and Xhol cleavage sites for insertion into the pcDNA3.1/C-Flag vector.
  • PCR, restriction enzyme digest, fragment purification and ligation into the vector is performed according to established procedures. All constructs were verified by complete sequencing of the inserted DNA fragment.
  • 293 cells and HUVEC are seeded 24 hours prior to transfection in six-well tissue culture plates to reach 80-90 % confluency the next morning.
  • 293 cells are fransfected by the calcium phosphate method using the mammalian transfection kit (Sfratagene, La Jolla, CA, USA).
  • Transient fransfections of HUVEC cells are carried out by using the LipofectamineTM reagent (GJJBCO/BRL, Rockville, MD).
  • hnmunofluorescence assays are performed mainly as described in the following: 24 hours following transfection, cells transfected with the appropriate expression plasmids are washed twice with PBS, fixed for 10 min at room temperature with 3.7 % formaldehyde, 2 % sucrose in (anti-Flag M2 monoclonal antibody, Sigma, St. Louis, MO, USA) are diluted in PBS, 1 % BSA and incubated with the cells for 1 h at room temperature. Cells are washed 3 times for 5 minutes with PBS, incubated with Texas Red-labeled donkey anti-mouse IgG (Accurate Chemical, Westbury, NY, USA) for 1 hour at room temperature and washed with PBS again.
  • a fluorescent groove-binding probe for DNA (Hoechst 333258, Sigma Chemicals, St. Louis, MO, USA) is added to the secondary antibody solution at 500 ng/ml. Results are analyzed in a Nikon Diaphot TMD flourescence microscope (Nikon Ltd.) connected to a cooled charge-coupled device camera (Kappa Gmbh, Gleichen, Germany).
  • LLR-J24-2 is found on the cell surface, whereas LLR-J24-1 accumulates intracellularly:
  • the type U lectin-like receptors have been shown to usually dimerize and to form either homodimers or heterodimers combining two different receptor chains. In certain cases the dimerization with a heterologous lectin-like receptor chain has been shown to be necessary for surface expression. This is, for example, the case for the NKG2/CD94 receptors. Therefore, the surface expression of FLAG-tagged recombinant LLR-J24 was evaluated in comparison to CLEC-1 and LOX-1 in 293 cells and HUVEC following transient transfection with the respective expression constructs. To evaluate surface expression staining of non-permeabilized cells with an anti-FLAG antibody are compared to parallel samples of cells which are permeabilized with Triton X-100 before the staining procedure.
  • the stalkless LLR-J24-1 appears to be homogenously distributed throughout the cytoplasm, but is not appearing at the surface. Similar results are obtained with 293 cells. Thus these data show that the stalk sequence as given in SEQ ID NO:10 is required for surface expression of LLR-J24, likely because it contains a signal for transport to the surface and may facilitates homodimer formation. These data exemplify that LLR-J24-2 functions as a surface receptor whereas LLR-J24-1 may possess an intracellular function.
  • Example 11 LLR-J24 gene (production of recombinant cells and recombinant protein)
  • expression constructs may be prepared for the expression of the full-length transmembrane receptor as well as for soluble versions thereof.
  • Stably transfected cells with recombinant expression of the full-length form are used for monoclonal antibody generation and for functional studies. Soluble receptors can be more easily obtained in purified form and larger quantity and will therefore be used for immunizations and for ligand identification and isolation.
  • constructs providing a tag to the N-terminal and C-terminal ends of the molecules may be used.
  • constructs were prepared without and with FLAG-tags in the pCDNA vector ( Vitrogen). These constructs are used for stably transfecting two different cell lines. Stably transfected cells may be employed for immunization of mice to obtain monoclonal antibodies. Secondly, a hybrid cell line between a mouse hybridoma and a human DC may be used. Such hybrid cells may not express endogenous LLR-J24 and therefore could be candidates for functional studies with stable transfectants because of its partial dendritic properties of human origin.
  • constructs may be designed to prepare a soluble LLR-J24 receptor in larger quantity using the cDNA encoding the extracellular portion fused to a signal sequence for cellular export.
  • the baculovirus system as available from friVitrogen may be used.
  • proteins are also competent to properly bind the HLA-E ligands of the NK receptors. Protein in mg amounts is produced as it is of advantage for immunizations and for experiments to isolate and expression clone potential ligands from cell types interacting with DCs such as T cells.
  • immunoglobulin fusion proteins are produced in COS cells with the extracellular domain fused to the C-terminal end of the immunoglobulin part, since the receptor has type II orientation and may therefore need a free carboxyterminal end for proper bmding.
  • Example 12 LLR-J24 gene (generation of polyclonal and monoclonal antibodies)
  • monoclonal antibodies may be obtained to finally obtain epitope-specifc reagents useful to study structure-function relationships of the receptor.
  • Monoclonal antibodies are generated which mimic ligand binding as well as others which block receptor-ligand interactions. This goal can be achieved by using mouse cell lines stably transfected with the human gene. Expression in cells such as murine MT cells leads to proper surface expression and proper antigenic structure of the molecule, so that reagents with good binding properties to the protein on human dendritic are obtained. Combined immunization protocols using purified recombinant protein as well as recombinant cells are used.
  • lectin-like receptors have been shown to form disulfide-linked heterodimers with different lectin-like proteins and non-covalently associate with signaling adaptor molecules.
  • several isoforms of NKG2 proteins heterodimerize with the CD94 protein to form several variants of inhibitory and activating NK cell receptors.
  • the triggering NKG2/CD94 receptors associate via their NKG2 part with the signaling adaptor DAP 12 (Lanier L.L. et al. Immunity 8 [1998] 693-701).
  • DAP 12 contains ITAM motifs and functions to give activating signals to the cell.
  • NKG2-A/CD94 the inhibitory form
  • NKG2-A/CD94 contains ITIM motifs on the cytoplasmic tail of NKG2-A, which recruit and trigger inhibitory signals via SHP-1 and -2 phosphatases (Palmieri G. et al., J. Immunol. 162 [1999] 7181-8).
  • biotin EZ-Link biotinylation reagent, Pierce
  • LLR-J24 can be immunoprecipitated and potentially co-immunoprecipitating chains scored in Western blots of the precipitate using the corresponding avidin-HRP reagents. Surface-exposed protein chains co-immunoprecipitated and different in size from the LLR-J24 can thus be detected by this method and isolated.
  • metabolically label DCs with S 35 methionine can be used and scored for co-immunoprecipitating proteins following polyacrylamide gel separation of precipitated proteins. Furthermore, known proteins which could interact with the receptor such as the DAP molecules can be tested. Thus a potential interaction with activating and inhibitory signaling molecules is established.
  • Example 14 LLR-J24 gene (ligand screening with LLR-J24 polynucleotide)
  • a collection of putative receptor ligands has been assembled for screening.
  • the collection comprises: various oxLDL compounds and derivatives, carbohydrate compounds, parasite membranes, soluble versions of MHC class I and homologous, MICA, MICB allelic forms, various UL16 binding proteins known to act via the related LOX-1 and NKG2 or other lectin-like receptors; naturally occurring compounds which may be putative agonists for a human lectin-like receptor, non-mammalian, biologically active peptides for which a mammalian counterpart has not yet been identified; and compounds not found in nature, but which activate lectin-like receptors with unknown natural ligands.
  • This collection is used to initially screen the receptor for known ligands, using both functional (i.e. calcium and cAMP release, tyrosine and serine kinase activation, phosphatases such as SHP-1 and -2) as well as binding assays with the various labeled compounds.
  • functional i.e. calcium and cAMP release, tyrosine and serine kinase activation, phosphatases such as SHP-1 and -2
  • binding assays with the various labeled compounds.
  • LLR-J24 is further expected to rather engage with surface molecules of T cells.
  • Activation of LLR-J24 expressing recombinant cells versus the LLR-J24 negative parental cell lines can be evaluated.
  • Activation of CsP + , NFKB and of several MAP kinase pathways is tested.
  • LLR-J24 recombinant are combined with T cells and T cell membrane fractions to evaluate activation.
  • the property of binding to oxLDL also mediates binding of apoptotic cells and such a function would make sense in the context of DCs.
  • Endocytosed apoptotic cell material would be again presented via MHC molecules to T cells and thus infection of cells as cause of apoptosis recognized.
  • the direct binding to lipoproteins on parasites can be tested.
  • LLR-J24 could be involved in the interaction with a surface protein on T cells, such as a MHC homologue, and this interaction might have accessory function for T cell activation.
  • a soluble receptor is used to identify and isolate and clone the ligand. This is done by using expression libraries of T cell cDNA in retroviral vectors, which are available and can be used to express the cDNA library in cells to which the soluble receptor is not binding.
  • Tagged soluble receptor can be used to isolate transduced cells expressing the proper ligand by FACS sorting and the cDNA can be recovered from the sorted cells. If the ligand would have a more complicated structure, e.g. if it would consist of two chains, and these could not be expressed in one cell using the described method, biochemical purification using affinity chromatography with the soluble receptor and standard protein separation techniques may be used.
  • Ligand binding assays provide a direct method for ascertaining receptor pharmacology and are adaptable to a high throughput format.
  • the purified hgand for a receptor is radiolabeled to high specific activity (50-2000 Ci/mmol) for binding studies. A determination is then made that the process of radio labeling does not diminish the activity of the ligand towards its receptor.
  • Assay conditions for buffers, ions, pH and other modulators such as nucleotides are optimized to establish a workable signal to noise ratio for both membrane and whole cell receptor sources.
  • specific receptor binding is defined as total associated radioactivity minus the radioactivity measured in the presence of an excess of unlabeled competing hgand. Where possible, more than one competing hgand is used to define residual nonspecific binding.
  • Example 16 LLR-J24 gene (functional assays)
  • the potential activation or inhibition of cellular signaling in the recombinant DC-like DC/Sp20 versus non-recombinant cells, which do not express LLR-J24 is evaluated.
  • the second approach is to use preparations of monocyte-derived and cord blood-derived primary DCs and cultures matured by induction with CD40 ligand, which are active to stimulate MLR.
  • antibodies and potential soluble ligands such as oxidized LDL or apoptotic cell fragments for potential activation of intracellular signals in the recombinant cells versus the parental cells are scored.
  • Increase in free Ca " * " induction of NFKB and the major MAP kinase pathways MEK/ERK, p38 and JNK are tested. Interference of antibodies with the triggering compound or release of inhibitory function of the receptor can be tested.
  • a potential contribution of the receptor to maturation of DCs and to T cell activation can be evaluated as follows.
  • immature Langerhans-type DCs are prepared and the antibodies tested whether they would inhibit or promote DC maturation/activation during CD40 ligand stimulation.
  • the upregulation of CD80/CD86 is determined by flow cytometry.
  • assay 2 it is evaluated whether the antibodies and the soluble receptor prepared alters the capacity of DCs to stimulate allogeneic T cells. Immature as well as mature DCs are used as stimulators for allogeneic T cells following preincubation of the dendritc cells with the antibodies or of the T cells with soluble receptor.
  • the preferred read-out of T cell stimulation is thymidine incorporation after 5 days.
  • Example 17 LLR-J24 gene (extract/cell supernatant screening)
  • CTLD receptor of the invention is also functionally screened (using calcium, cAMP, kinase functional screens) against tissue extracts to identify natural ligands. Exfracts that produce positive functional responses can be sequencially subfractionated until an activating igand is isolated and identified.
  • Example 18 LLR-J24 gene (calcium and cAMP functional assays)
  • Lectin-like receptors which are expressed in HEK 293 cells have been shown to be coupled functionally to activation of PLC and calcium mobilization, cAMP stimuation and/or tyrosine and serine/threonine kinase activation or inhibition.
  • Basal calcium levels in the HEK 293 cells in receptor-fransfected or vector control cells were observed to be in the normal, 100 nM to 200 nM, range.
  • HEK 293 cells expressing recombinant receptors are loaded with fura 2 and in a single day >150 selected ligands or tissue/cell extracts are evaluated for agonist induced calcium mobilization.
  • HEK 293 cells expressing recombinant receptors are evaluated for the stimulation or inhibition of cAMP production using standard cAMP quantitation assays.
  • Agonists presenting a calcium transient or cAMP flucuation are tested in vector control cells to determine if the response is unique to the transfected cells expressing receptor.
  • RNA regulation of a LLR-J24 gene of the invention RNA regulation of a LLR-J24 gene of the invention:
  • LLR-J24 is preferentially expressed in DCs:
  • LLR-J241 and CLEC-1 are members of one subfamily
  • the expression of LLR-J24 and CLEC-1 mRNA in primary human DCs, monocytes, T and B lymphocytes as well as endothelial cells was investigated.
  • the data obtained show that LLR-J24 mRNA is abundantly and selectively expressed in monocyte-derived DCs (MoDC) and in DCs derived from CD34 + hematopoietic progenitor cells (HPDC).
  • a small amount of LLR-J24 mRNA was also present in primary monocytes, whereas primary T and B lymphocytes as well as endothelial cells, treated or untreated with different stimuli, did not detectably express LLR-J24 transcripts.
  • RNA in DCs was estimated to be 3.0 to 3.5 kb from the Northern blots, which corresponds to the expected transcript sizes assuming the use of the first or several consecutive polyadenylation signals detected in the gene in a region 1.6 to 1.9 kb downstream from the stop codon.
  • LLR-J24 expression is downregulated during functional maturation of DCs:
  • LLR-J24 transcripts are variably spliced:

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Genetics & Genomics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Zoology (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Rheumatology (AREA)
  • Toxicology (AREA)
  • Pain & Pain Management (AREA)
  • Pulmonology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Cardiology (AREA)
  • Vascular Medicine (AREA)
  • Urology & Nephrology (AREA)
  • Cell Biology (AREA)
  • Dermatology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un polypeptide et un gène IKK2-55 isolés; un polypeptide et un gène DINO; un polypeptide et un nucléotide tige LLR-J24, un polynucléotide codant la protéine transmembranaire LLR-J24; un polynucléotide codant le domaine extra-cellulaire de LLR-J24 et d'un polypeptide qui constitue le domaine extra-cellulaire de LLR-J24; leur utilisation dans un procédé d'identification d'un agoniste ou d'un antagoniste d'un tel polypeptide/protéine; et un antagoniste ou un agoniste d'un tel polypeptide/protéine et son utilisation en tant que composition pharmaceutique.
PCT/EP2002/003393 2001-03-27 2002-03-26 Nouveaux polypeptides WO2002077216A2 (fr)

Priority Applications (3)

Application Number Priority Date Filing Date Title
AU2002256708A AU2002256708A1 (en) 2001-03-27 2002-03-26 Ikk2 variant, dino gene, lectin-like receptor gene, and proteins encoded thereby
EP02726212A EP1373485A2 (fr) 2001-03-27 2002-03-26 Nouveaux polypeptides
JP2002576659A JP2004529638A (ja) 2001-03-27 2002-03-26 新規ポリペプチド

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US27918801P 2001-03-27 2001-03-27
US60/279,188 2001-03-27
US28498701P 2001-04-19 2001-04-19
US60/284,987 2001-04-19
US29572601P 2001-06-04 2001-06-04
US60/295,726 2001-06-04

Publications (2)

Publication Number Publication Date
WO2002077216A2 true WO2002077216A2 (fr) 2002-10-03
WO2002077216A3 WO2002077216A3 (fr) 2003-10-23

Family

ID=27403048

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2002/003393 WO2002077216A2 (fr) 2001-03-27 2002-03-26 Nouveaux polypeptides

Country Status (4)

Country Link
EP (1) EP1373485A2 (fr)
JP (3) JP2004529638A (fr)
AU (1) AU2002256708A1 (fr)
WO (1) WO2002077216A2 (fr)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999058675A2 (fr) * 1998-05-14 1999-11-18 Chiron Corporation Genes humains et produits d'expression genique v

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999058675A2 (fr) * 1998-05-14 1999-11-18 Chiron Corporation Genes humains et produits d'expression genique v

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DATABASE EMBL [Online] 31 October 2001 (2001-10-31) ISOGAI T. ET AL.: "Homo sapiens cDNA FLJ31051 fis, clone HSYRA2000605, weakly similar to MYOSIN HEAVY CHAIN, CLONE 203" Database accession no. AK055613 XP002231840 *
DATABASE GENEMBL [Online] 8 February 2001 (2001-02-08) ADACHI,J. ET AL.: "Mus musculus male lung cDNA, RIKEN full-length enriched library clone:1200009F10 product." Database accession no. AK004670 XP002231839 *

Also Published As

Publication number Publication date
JP2008253269A (ja) 2008-10-23
AU2002256708A1 (en) 2002-10-08
JP2004529638A (ja) 2004-09-30
WO2002077216A3 (fr) 2003-10-23
EP1373485A2 (fr) 2004-01-02
JP2008253270A (ja) 2008-10-23

Similar Documents

Publication Publication Date Title
JP3716936B2 (ja) Ｆａｓリガンドおよびその一部、およびそれをコードするＤＮＡ
US20050176044A1 (en) Polynucleotides and polypeptides encoding receptors
US20070264711A1 (en) Human pellino polypeptides
CA2300364A1 (fr) Polypeptides de tumeur de la prostate et compositions antigenes
US20020123617A1 (en) Novel immunoglobulin superfamily members of APEX-1, APEX-2 and APEX-3 and uses thereof
US20060233818A1 (en) Organic compounds
US6232441B1 (en) PIGR-1, a member of immunoglobulin gene superfamily
US5780235A (en) Human voltage-dependent anion channel
WO2006046072A2 (fr) Proteines renfermant vwfa et/ou le domaine ant_ig
US5712115A (en) Human cell death-associated protein
US20030166136A1 (en) Human C-type lectin
WO1997041143A1 (fr) Nouvel homologue de la synaptogyrine
EP1881065A1 (fr) DINO polypeptide
WO2002077216A2 (fr) Nouveaux polypeptides
US5935812A (en) Human GTP binding protein gamma-3
EP1179015A1 (fr) Molecules d'adn codant pour des proteines clax humaines et leurs proteines de fusion solubles
WO1999049023A1 (fr) Element 2-21 de la famille des cytokines
JP2000517175A (ja) ヒトｄｂｉ／ａｃｂｐ様タンパク質
EP0905237A2 (fr) PIGR-2 appartenant au sous-ordre des immunoglobulines
WO2000017349A1 (fr) GENE HsgIII HUMAIN
JP2004290198A (ja) Ｆａｓリガンドおよびその一部、およびそれをコードするＤＮＡ
WO1998036064A1 (fr) Proteines de liaison a des phosphonates
WO2000008055A1 (fr) Gene humain de type vamp-2 (cbcbmh06)
WO1998036064A9 (fr) Proteines de liaison a des phosphonates
WO1999018990A9 (fr) Proteine 3 associee au recepteur de il-1

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LT LU LV MA MD MK MN MX NO NZ OM PH PL PT RO RU SE SG SI SK TJ TM TN TR TT UA US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2002726212

Country of ref document: EP

Ref document number: 2002576659

Country of ref document: JP

WWP Wipo information: published in national office

Ref document number: 2002726212

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642