WO2002077153A2 - The human psychosine receptor - Google Patents

Abstract

The present invention is directed to the psychosine (galactosylsphingosine) receptor (named TDAG8), antibodies that specifically bind to that receptor, and the use of the receptor to identify agonists or antagonists of TDAG8 receptor activity.

Description

THEHUMANPSYCHOSINE RECEPTOR

U.S. Government Rights

This invention was made with United States Government support under Grant No. NIGMS ROl GM52722, awarded by National Institutes of Health. The United States Government has certain rights in the invention.

Related Application

This application claims priority under 35 U.S.C. §119(e) to U.S. Provisional Application Serial No. 60/252,068, filed November 20, 2000, the disclosure of which is incorporated herein in its entirety.

Field of the Invention

The present invention is directed to the TDAG8 G-protein coupled receptor that functions as a receptor for psychosine (galactosylsphingosine) and related glycosphingolipids. More particularly, the present invention is directed to the use of the TDAG8 receptor for isolating receptor agonists and antagonists as well as antibodies raised against the TDAG8 receptor.

Background of the Invention

G-protein coupled receptors (GPCRs) are proteins responsible for transducing a signal within a cell. GPCRs have usually seven transmembrane domains. Upon binding of a ligand to an extra-cellular portion or fragment of a GPCR, a signal is transduced within the cell that results in a change in a biological or physiological property or behaviour of the cell. GPCRs, along with G-proteins and effectors (intracellular enzymes and channels modulated by G-proteins), are the components of a modular signaling system that connects the state of intra-cellular second messengers to extra-cellular inputs. GPCR genes and gene products can modulate various physiological processes and are potential causative agents of disease. The GPCRs seem to be of critical importance to both the central nervous system and peripheral physiological processes.

The GPCR protein superfamily is represented in five families: Family I, receptors typified by rhodopsin and the beta2-adrenergic receptor and currently represented by over 200 unique members; Family II, the parathyroid hormone/calcitonin/secretin receptor family; Family III, the metabotropic glutamate receptor family, Family IV, the CAMP receptor family, important in the chemotaxis and development of D. discoideum; and Family V, the fungal mating pheromone receptor such as STE2. G proteins represent a family of heterotrimeric proteins composed of α, β and γ subunits, that bind guanine nucleotides. These proteins are usually linked to cell surface receptors (receptors containing seven transmembrane domains) for signal transduction. Indeed, following ligand binding to the GPCR, a conformational change is transmitted to the G protein, which causes the α-subunit to exchange a bound GDP molecule for a GTP molecule and to dissociate from the βγ-subunits.

The GTP-bound form of the α, β and γ-subunits typically functions as an effector- modulating moiety, leading to the production of second messengers, such as cAMP (e.g. by activation of adenyl cyclase), diacylglycerol or inositol phosphates.

Greater than 20 different types of α-subunits are known in humans. These subunits associate with a small pool of β and γ subunits. Examples of mammalian G proteins include Gi, Go, Gq, Gs and Gt. G proteins are described extensively in Lodish et al., Molecular Cell Biology (Scientific American Books Inc., New York, N.Y., 1995; and also by Downes and Gautam, 1999, The G-Protein Subunit Gene Families. Genomics 62:544-552), the contents of both of which are incorporated herein by reference. Known and uncharacterized GPCRs currently constitute major targets for drug action and development. There are ongoing efforts to identify new G protein coupled receptors that can be used to screen for new agonists and antagonists having potential prophylactic and therapeutical properties. More than 300 GPCRs have been cloned to date, excluding the family of olfactory receptors. Mechanistically, approximately 50- 60% of all clinically relevant drugs act by modulating the functions of various GPCRs (Cudermann et al., J. Mol Med., 73:51-63, 1995). Mouse and human TDAG8 (T cell Death Associated Gene protein # 8) receptor sequences have appeared in the scientific literature as orphan receptors (human: Kyaw et al. DNA Cell Biol. 17:493; 1998, mouse: Choi, Lee & Choi Cell. Immunol. 168: 78; 1996) and are represented in the public DNA database (Genbank accession number u95218 (hum), u39827 (mus)). Based on amino acid sequence comparison, the TDAG8 receptor is believed to be a member of the OGR1/GPR4 cluster. In particular, the human TDAG8 amino acid sequence is most closely related to its mouse ortholog (79% identity) followed by human GPR4 (41%), human OGRl (36%) and an orphan GPCR named G2A (30% identical). The TDAG8 gene sequence has been deposited in the HTGS division of Genbank (accn_ac015473, all57955) and is found on human chromosome 14 in the same general region as the G2A and OGRl genes. The TDAG8 receptor is so named because its mRNA level increases during the programmed cell death of immature T lymphocytes.

Summary of the Invention

The present invention is directed to an orphan G protein-coupled receptor, named TDAG8 (also called GPR 65) that is identified herein as a receptor for the glycosphingolipid, psychosine (PSY). Structurally related glycosphingolipids including glucosyl psychosine (glucosylsphingosine), lactosyl psychosine (lactosylsphingosme) and lysosulfatide (galactose-3 -sulfate sphingosine) also are identified herein as agonists of the TDAG8 receptor. Furthermore, the present application discloses that activation of human and mouse TDAG8 (e.g., with PSY) results in a disjunction between mitosis and cytokinesis such that cells become giant, multinuclear and assume a globoid morphology.

In accordance with one embodiment, the present invention provides antibodies generated against TDAG8, a method for screening for agonists and antagonists of TDAG8 receptor activity, and the use of TDAG8 receptor antagonists to treat disorders associated with excessive activation of the TDAG8 receptor.

Brief Description of the Drawings

The objects and features of the invention can be better understood with reference to the following detailed description and accompanying drawings. Fig. 1A and IB. Inhibition of forskolin-evoked cAMP accumulation in TDAG8

DNA transfected RH7777 cells. Clonal populations of RH7777 cells transfected with the TDAG8 receptor DNA (Fig. 1 A, lane 1) or plasmid vector (Fig. 1 A, lane 2) were treated with forskolin and challenged with PSY. Cyclic AMP contents per well in forskolin- treated cells were 115.3 ± 15.8 pmol. Fig 1A show that no response was obtained in mock-transfected RH7777 cells treated with 10 μM PSY. Fig. IB demonstrates the ligand selectivity at the TDAG8 receptor (10 μ M of each lipid was used) in TDAG8 DNA transfected RH7777 cells. Lanes 1-9 represent no lipid (i.e. vehicle = 0.1% fatty acid free bovine serum albumin), PSY, SPC, GluPSY, LacPSY, Lysosulfatides, N-acetyl PSY, Ceramide 1-P and LPC, respectively.

Detailed Description of the Invention Definitions

In describing and claiming the invention, the following terminology will be used in accordance with the definitions set forth below.

As used herein, "nucleic acid," "DNA," and similar terms also include nucleic acid analogs, i.e. analogs having other than a phosphodiester backbone. For example, the so-called "peptide nucleic acids," which are known in the art and have peptide bonds instead of phosphodiester bonds in the backbone, are considered within the scope of the present invention.

The term "peptide" encompasses a sequence of 3 or more amino acids wherein the amino acids are naturally occurring or synthetic (non-naturally occurring) amino acids. Peptide mimetics include peptides having one or more of the following modifications:

1. peptides wherein one or more of the peptidyl — C(O)NR — linkages (bonds) have been replaced by a non-peptidyl linkage such as a — CH2_carbamate linkage ( — CH

2OC(O)NR— ), a phosphonate linkage, a -CH2_sulfonamide (-CH — S(O)2NR— ) linkage, a urea ( — NHC(O)NH — ) linkage, a — CH₂ -secondary amine linkage, or with an alkylated peptidyl linkage (— C(O)NR— ) wherein R is C j .C4 alkyl;

2. peptides wherein the N-terminus is derivatized to a — NRRι group, to a — NRC(O)R group, to a — NRC(O)OR group, to a — NRS(O)2R group, to a — NHC(O)NHR group where R and R are hydrogen or C1 4 alkyl with the proviso that R and Rj are not both hydrogen; 3. peptides wherein the C terminus is derivatized to — C(O)R2 where R 2 is selected from the group consisting of C1 4 alkoxy, and — NR3R4 where R3 and R4 are independently selected from the group consisting of hydrogen and C1 4 alkyl.

Naturally occurring amino acid residues in peptides are abbreviated as recommended by the IUPAC-IUB Biochemical Nomenclature Commission as follows: Phenylalanine is Phe or F; Leucine is Leu or L; Isoleucine is He or I; Methionine is Met or M; Norleucine is Nle; Valine is Val or V; Serine is Ser or S; Proline is Pro or P; Threonine is Thr or T; Alanine is Ala or A; Tyrosine is Tyr or Y; Histidine is His or H; Glutamine is Gin or Q; Asparagine is Asn or N; Lysine is Lys or K; Aspartic Acid is Asp or D; Glutamic Acid is Glu or E; Cysteine is Cys or C; Tryptophan is Trp or W; Arginine is Arg or R; Glycine is Gly or G, and X is any amino acid. Other naturally occurring amino acids include, by way of example, 4-hydroxyproline, 5-hydroxylysine, and the like. "Synthetic" or "non-naturally occurring" amino acids refer to amino acids that do not naturally occur in vivo but which, nevertheless, can be incorporated into the peptide structures described herein. The resulting "synthetic peptide" contain amino acids other than the 20 naturally occurring, genetically encoded amino acids at one, two, or more positions of the peptides. For instance, naphthylalanine can be substituted for trytophan to facilitate synthesis. Other synthetic amino acids that can be substituted into peptides include L-hydroxypropyl, L-3,4-dihydroxyphenylalanyl, alpha-amino acids such as L-alpha-hydroxylysyl and D-alpha-methylalanyl, L-alpha.-methylalanyl, beta.-amino acids, and isoquinolyl. D amino acids and non-naturally occurring synthetic amino acids can also be incorporated into the peptides. Other derivatives include replacement of the naturally occurring side chains of the 20 genetically encoded amino acids (or any L or D amino acid) with other side chains.

As used herein, the term "purified", "isolated" and like terms relate to the isolation of a molecule or agent in a form that is substantially free of contaminants normally associated with the molecule or agent in a native or natural environment. For example, isolated polypeptides or isolated polynucleotides preferably comprise less than 50% (by weight), less than 40%, and more preferably, less than 2% contaminating polypeptides and polynucleotides, respectively, of an unlike nature (e.g., with less than 95%-100% sequence identity). The term "TDAG8 polypeptide," as used herein refers to a polypeptide having at least 60% (or higher, e.g., 65%, 70%, 80%, 95% or 100%) identity to a polypeptide represented by SEQ ID NO. 2, specifically binds to psychosine and activates a signaling activity of the TDAG8.

The term TDAG8 receptor encompasses both an isolated TDAG8 polypeptide, as well as a TDAG polypeptide that is associated with or is embedded in a lipid membrane that is either natural (e.g., part of a cell extract) or unnatural (e.g., part of a liposome or viral budded membrane). Nucleic acid duplex or hybrid stability is expressed as the melting temperature or Tm, the temperature at which a nucleic acid duplex dissociates into its component single stranded DNAs. The equation for calculating the Tm of nucleic acids is well known in the art. As indicated by standard references, a simple estimate of the Tm value may be calculated by the equation: Tm (°C) = 81.5 + 0.41(% G+C), when a nucleic acid is in aqueous solution at IM NaCl (see e.g., Anderson and Young, Quantitative Filter Hybridization, in Nucleic Acid Hybridization (1985)). This melting temperature is used to define the stringency conditions of the hybridization and washes for hybridization reactions. Typically a 1% mismatch results in a 1°C decrease in the Tm, and the temperature of the final wash in the hybridization reaction is reduced accordingly (for example, if two sequences have > 95% identity, the final wash temperature is decreased from the Tm by 5°C). In practice, the change in Tm can be between 0.5°C and 1.5°C per 1% mismatch. As used herein, "stringent conditions" refers to hybridization conditions and/or amplification conditions in which a probe or primer will specifically hybridize to a target nucleic acid while not binding substantially to non-target nucleic acids. "Stringent conditions" typically involve hybridizing at about 50°C to about 68°C in 5x SSC/5x

Denhardt's solution 1.0% SDS, and washing in 0.2x SSC/0.1% SDS at about 60°C to about 68°C. In particular, "highly stringent conditions" are defined as conducting the hybridization and wash conditions at about -2°C Tm. "Moderate stringent conditions" are defined as conducting the hybridization and wash conditions at about -5°C Tm. The use of hybridization conditions based on the melting temperature (Tm) of a nucleic acid binding complex (e.g., a probe or primer bound to a target sequence), is taught in Berger and Kimmel (1987, Guide to Molecular Cloning Techniques, Methods in Enzymology, Vol 152, Academic Press, San Diego CA). As used herein, a "molecular probe" is any detectable molecule, or is a molecule that produces a detectable molecule upon reacting with a biological molecule (e.g., polypeptide or nucleic acid).

As used herein, "expression" refers to a level, form, or localization of product. For example, "expression of a protein" refers to one or more of the level, form (e.g., presence, absence or quantity of modifications, or cleavage or other processed products), or localization of the protein. As used herein, "reporter molecule" refers to a nucleic acid or polypeptide product that is detectable when expressed by a cell comprising the molecule. Preferably, a reporter molecule allows a quantitative measurement of the expression of a nucleic acid sequence to which it is operably linked. Reporter polypeptides may be proteins capable of emitting light such as Green Fluorescent Protein (GFP) (Chalfie et al., 1994, Science 11: 263:802-805) or luciferase (Gould et al., 1988, Anal. Biochem. 15: 175: 5-13), or may be proteins which can catalyze a substrate (e.g., such as β-galactosidase). Reporter polypeptides also can be intracellular or cell surface proteins detectable by antibodies. Reporter molecules additionally, or alternatively, can be detected by virtue of a unique nucleic acid sequence not normally contained within the cell.

As used herein, "GFP" refers to a member of a family of naturally occurring fluorescent proteins, whose fluorescence is primarily in the green region of the spectrum. The term includes mutant forms of the protein with altered or enhanced spectral properties. Some of these mutant forms are described in Cormack, et al, 1996, Gene 173: 33-38 and Ormo, 1996, Science 273:1392-1395, the entireties of which are incorporated herein by reference. The term also includes polypeptide analogs, fragments or derivatives of GFP polypeptides which differ from naturally-occurring forms by the identity or location of one or more amino acid residues, (e.g., by deletion, substitution or insertion) and which share some or all of the properties of the naturally occurring forms so long as they generate detectable signals (e.g., fluorescence). Wild type GFP absorbs maximally at 395 nm and emits at 509 nm. High levels of GFP expression have been obtained in cells ranging from yeast to human cells. The term also includes Blue Fluorescent Protein (BFP), the coding sequence for which is described in Anderson, et al, 1996, Proc. Natl. Acad. Sci. USA 93:16, 8508-8511, incorporated herein by reference. As used herein, "regulatory element" refers to a genetic element that controls the expression of nucleic acid sequences. For example, a promoter is a regulatory element that directs the transcription of an mRNA. Other regulatory elements include enhancers and other transcription factor binding sites, splicing signals, polyadenylation signals, transcription termination signals, internal ribosome entry sites (IRES), etc. As used herein, the term "operably linked" refers to functional linkage between a nucleic acid regulatory element (such as a promoter, and/or array of transcription factor binding sites) and a second nucleic acid sequence (such as a nucleic acid encoding a reporter polypeptide), where the regulatory element directs transcription of the nucleic acid corresponding to the second sequence.

As used herein, the term "selectable marker" refers to a gene which encodes an activity that confers on a cell comprising the gene the ability to grow in medium in which the cell would otherwise not survive. For example, the gene can encode an essential nutrient or be involved in the metabolism of an essential nutrient. Alternatively, a selectable marker may confer resistance to an antibiotic or drug or can convert a toxic product into a non-toxic product such that only cells comprising the gene are capable of surviving in the presence of the antibiotic, drug or toxic product. As used herein, a "difference in expression" refers to an increase or decrease in expression. A difference may be an increase or a decrease in a quantitative measure (e.g., amount of a polypeptide or RNA encoding the polypeptide) or a change in a qualitative measure (e.g., a change in the localization of a polypeptide). Where a difference is observed in a quantitative measure, the difference according to the invention will be at least about 10% greater or less than the level in a normal standard sample. Where a difference is an increase, the increase may be as much as about 20%, 30%, 50%, 70%, 90%, 100% (2-fold) or more, up to and including about 5-fold, 10-fold, 20-fold, 50-fold or more. Where a difference is a decrease, the decrease may be as much as about 20%, 30%, 50%, 70%, 90%, 95%, 98%, 99% or even up to and including 100% (no specific polypeptide or RNA present). It should be noted that even qualitative differences may be represented in quantitative terms if desired. For example, a change in the intracellular localization of a polypeptide may be represented as a change in the percentage of cells showing the original localization.

As used herein, "TDAG8 signaling activity" refers to the initiation or propagation of signaling by a TDAG8 polypeptide. TDAG8 signaling activity is monitored by measuring a detectable step in a signaling cascade by assaying one or more of the following: stimulation of GDP for GTP exchange on a G protein; alteration of adenylate cyclase activity; protein kinase C modulation; phosphatidylinositol breakdown (generating second messengers diacylglycerol and inositol triphosphate); intracellular calcium flux; localization of the receptor, disjunction of mitosis and cytokinesis, the accumulation of psychosine or other structurally related glycosphingolipids in a cell, DNA content, numbers of multinuclear cells; activation of MAP kinases; modulation of tyrosine kinases; modulation of reporter gene expression or activity, and the like. A detectable step in a signaling cascade is considered initiated or mediated if the measurable activity is altered by 10% or more above or below a baseline established in the substantial absence of a ligand for TDAG8 (e.g., such as psychosine), relative to any of the TDAG8 activity assays described further below. As used herein, a "second messenger" refers to a molecule, generated or caused to vary in concentration by the activity of a G-protein Coupled Receptor, that participates in the transduction of a signal from that GPCR. Non-limiting examples of second messengers include cAMP, diacylglycerol, inositol triphosphate, and intracellular calcium. The term "change in the level of second messenger" refers to an increase or decrease of at least 10% in the detected level of a give second messenger relative to the amount detected in an assay performed in the absence of a candidate modulator.

As used herein, an "aequorin-based assay" refers to an assay for GPCR activity that measures intracellular calcium flux induced by activated GPCRs, wherein intracellular calcium flux is measured by the luminescence of aequorin expressed in the cell.

As used herein, "binding" refers to the physical association of a ligand (e.g., psychosine or a structurally related glycosphingolipid) with a receptor (e.g., TDAG8). As the term is used herein, binding is specific if it occurs with an EC₅₀ or a I of 5,000 nM or less, generally in the range of 5,000 nM to 10 pM. For example, binding is specific if the EC50 or Kd is 5,000 nM, 3,500 nM, 1 ,000nM, 500nM, 250 nM, 100 nM, 50 nm, InM, 950 pM, 900 pM, 850 pM, 800 pM, 750 pM, 700 pM, 650 pM, 600 pM, 550 pM, 500 pM, 450 pM, 400 pM, 350 pM, 300 pM, 250 pM, 200 pM, 150 pM, 100 pM, 75 pM, 50 pM, 25 pM, or 10 pM or less.

As used herein, "a decrease in binding" refers to a decrease of at least 10% in the amount of binding detected in a given assay with a known or suspected modulator of

TDAG activity relative to binding detected in an assaying lacking the known or suspected modulator.

As used herein, the term "EC₅₀ of an agent" refers to that concentration of an agent at which a given activity, including binding of psychosine or other ligand of TDAG8 and/or a functional activity of TDAG8 (e.g., a signaling activity), is 50% maximal for that TDAG8 activity in the absence of the agent (measured using the same assay). Stated differently, the "EC₅₀" is the concentration of agent that gives 50% activation, when 100% activation is set at the amount of activity of TDAG8 which does not increase with the addition of more ligand/agonist (e.g., psychosine or a structurally related glycosphingolipid).

As used herein, "IC₅₀" refers to the concentration of an agent that reduces the maximal activation of a TDAG8 receptor by 50%. As used herein "% identity" refers to a degree of identity between two or more sequences or regions of sequences calculated after maximal alignment of the sequences using techniques known in the art. See, e.g., Computational Molecular Biology, Lesk, A.M., ed., Oxford University Press, New York, 1988; Biocomputing, Informatics, and Genome Projects, Smith, D.W., ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, A.M., and Griffin, H.G., eds., Humana Press, New Jersey, 1994; Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991; and Carillo et al., 1998, SIAM J. Applied Math. 48: 1073. Preferred computer program methods to determine identity and similarity between two sequences include, but are not limited to, the GCS program package (Devereux et al, 1984, Nucleic Acids Research 12(1): 387) BLASTP, BLASTN, and FASTA (Atschul et al., 1990, J. Molec. Biol. 215: 403).

As used herein "a correlation" refers to a statistically significant relationship determined using routine statistical methods known in the art. For example, in one aspect, statistical significance is determined using a Student's unpaired t-test, considering differences as statistically significant at p<0.05.

As used herein a "diagnostic probe" is a probe whose binding to a tissue and/or cell sample provides an indication of the presence or absence of a particular trait. In one aspect, a probe is considered diagnostic if it binds to a diseased tissue and/or cell ("disease samples")in at least about 80% of samples tested comprising diseased tissue/cells and binds to less than 10% of non-diseased tissue/cells in samples ("non- disease" samples). Preferably, the probe binds to at least about 90% or at least about 95% of disease samples and binds to less than about 5% or 1% of non-disease samples.

As used herein, the term "detectably labeled" refers to the property of a molecule that has a structural modification that incorporates a functional group (label) that can be readily detected. Detectable labels include, but are not limited to, fluorescent agents, isotopic agents, chemiluminescent agents, quantum dot labels, biotin, enzymes, electron- dense reagents, and haptens or proteins (e.g., for which antibodies and antisera can be generated). Means of detection include, but are not limited to, spectroscopic, photochemical, radiochemical, biochemical, immunochemical, or chemical means. As used herein, "delivering" when used in reference to an agent, means the addition of the agent to an assay mixture or to a cell or cell membrane fraction. The term also refers to the administration of the agent to an animal. Such administration can be, for example, by injection (in a suitable carrier, e.g., sterile saline or water) or by inhalation, or by an oral, transdermal, rectal, vaginal, or other common route of administration.

As used herein, "effective amount" refers to the amount of a TDAG8 modulating agent that results in a change of TDAG8 activity as defined herein (e.g., an at least 10% increase or decrease in a TDAG8 activity).

As used herein, the term "bioactive fragments" or "bioactive fragment" of a TDAG8 polypeptide encompasses natural or synthetic portions of the full-length TDAG8 receptor that are capable of specific binding to their natural ligand(s) (e.g., psychosine and/or a structurally related glycosphingolipid). As used herein, a "candidate modulator" or "candidate agent" refers to a composition being evaluated for the ability to modulate ligand binding to a TDAG8 polypeptide and/or the ability to modulate the activity of a TDAG8 polypeptide. Candidate modulators can be natural or synthetic agents, including, for example, small molecules, agents contained in extracts of animal, plant, bacterial, or fungal cells as well as conditioned medium from such cells.

As used herein, the term "small molecule" refers to a agent having a molecular mass of less than 3000 daltons, preferably less than 2000 or 1500 daltons, still more preferably less than 1000, and most preferable less than 600 daltons. A small "organic molecule" is a small molecule that comprises carbon. As used herein, a "TDAG8 polynucleotide" refers to a polynucleotide that encodes a TDAG8 polypeptide as defined herein, or the complement thereof.

As used herein, the term "conditions permitting binding of a ligand of a TDAG8 receptor to TDAG8" refers to conditions of, for example, temperature, salt concentration, pH and protein concentration under which TDAG8 binds to a ligand, for example, psychosine or a structurally related glycosphingolipid. Exact binding conditions will vary depending on the nature of the assay, for example, whether the assay uses viable cells or only the membrane fractions of cells. However, favored conditions generally will include physiological salt (e.g., 90 mM) and pH (e.g., about 7.0 to 8.0). Temperatures for binding can vary from 15°C to 37°C, but will preferably be between room temperature and about 30°C. The concentration of TDAG8 and a ligand in a binding reaction will also vary, but concentration of ligand will preferably range from about 0.1 pM (e.g., in a reaction with labeled ligand, where concentration is generally below the Kd) to 1-10 μM (e.g., in a reaction where ligand is a competitor).

As used herein, the term "sample" refers to the source of molecules being tested for the presence of an agent that modulates binding to or signaling activity of a TDAG8 polypeptide. A sample can be an environmental sample, a natural extract of animal, plant, yeast, or bacterial cells or tissues, a clinical sample, a synthetic sample, or conditioned medium from recombinant cells or other cultured cells.

As used herein, a "membrane fraction" refers to a preparation of cellular lipid membranes comprising a TDAG8 polypeptide. As the term is used herein, a "membrane fraction" is distinct from a cellular homogenate, in that at least a portion (i.e., at least 10% and preferably, more) or non-membrane-associated cellular constituents have been removed. The term "membrane-associated" refers to those cellular constituents that are either integrated into a lipid membrane or are physically associated with a component that is integrated into a lipid membrane.

As used herein, a "glycosphingolipid which is structurally related to psychosine" includes but is not limited to: glucosyl psychosine, lysosulfatide, and lactosyl psychosine. "Treating" as used herein includes administering therapy to prevent, cure, or alleviate the symptoms associated with, a malady, disorder, affliction, disease or injury in a patient.

Methods for Identifying Agents that Modulate TDAG8 Activity

The present invention is based on the recent discovery that the previously orphan G protein coupled receptor, TDAG8, is a specific psychosine receptor. The mouse and human TDAG8 sequences have appeared in the scientific literature as orphan receptors

(human: Kyaw et al., DNA Cell Biol. 17: 493; 1998, mouse: Choi, Lee & Choi, Cell.

Immunol. 168:78; 1996) and are represented in the public DNA database (Genbank accession number u95218 (hum), u39827 (mus)). The nucleic acid sequence and amino acid sequence of human TDAG8 are set forth as SEQ ID NO: 1 and SEQ ID NO: 2, respectively.

In one embodiment of the present invention, nucleic acid sequences encoding the

TDAG8 receptor or bioactive fragments thereof are inserted into expression vectors and used to transfect cells to enhance the expression of those receptors on the target cells. Preferably, the nucleic acid sequences encoding the TDAG8 receptor are inserted into a eukaryotic expression vector in a manner that operably links the gene sequences to the appropriate regulatory sequences, and TDAG8 is expressed in a eukaryotic host cell. Suitable eukaryotic host cells include human embryonic kidney cells (i.e. HEK293), rat cells (such as Rh7777) and insect cell lines (such as Sf9). Vectors useful for expressing nucleic acid sequences in such cell lines are known to those skilled in the art. The expression vectors, including viral and plasmid based constructs, can be introduced into these cells in vitro or in vivo using standard delivery mechanisms. Host cells transfected with an expression vector that expresses the TDAG8 receptor or a bioactive fragment thereof are also within the scope of the present invention. The transformed cells include cells that transiently express the exogenously introduced TDAG8 gene product as well as those cells that stably express the gene. Accordingly, one aspect of the present invention is directed to host cell lines that contain recombinant genes that express the TDAG8 receptor. As used herein a host cell is any cell that contains a nucleic acid sequence that has been introduced into the cell and expresses a gene product encoded by the introduced nucleic acid sequence. In one embodiment the host cell comprises the nucleic acid sequence of SEQ ID NO: 1 or a bioactive fragment of that sequence. In accordance with one embodiment, a eukaryotic host cell is provided selected from the group consisting of mammalian cells (e.g., human cells) and insect cells, wherein the host cell comprises an exogenously introduced nucleic acid sequence comprising the sequence of SEQ ID NO: 1 or a nucleic acid sequence that hybridizes to the complement of SEQ ID NO: 1 under stringent conditions. In one embodiment the introduced nucleic acid sequence comprises the sequence of SEQ ID NO: 1 operably linked to a non-native promoter (e.g., a promoter not naturally associated with the sequence of SEQ ID NO: 1, including promoters not naturally found in the cell) and the host cell is selected from the group consisting of HEK293, Sf9 and RH7777 cells.

The ability of PSY to activate TDAG8 was demonstrated using a cell-based assay that measures cAMP levels in cells treated with forskolin (See Fig. 1). RH7777 hepatoma cells when treated with forskolin will normally accumulate cAMP, even when such cells are also contacted with PSY. However, this forskolin-driven increase in cAMP levels is inhibited when the RH7777 hepatoma cells express the TDAG8 receptor and are contacted with PSY. Furthermore, the TDAG8 mediated PSY-induced inhibition of forskolin-driven cAMP is concentration-dependent; increased concentrations of PSY further inhibit cAMP accumulation (EC₅Q = 3.4 μM) in these cells. This response was also evoked by structurally-related glycosphingolipids, e.g., GlcPSY, LacPSY and lysosulfatide, but not by N-acetyl PSY, sphingosine 1 -phosphate, lysophosphatidic acid, ceramide 1 -phosphate, or lysophosphatidylcholine (See Fig. IB). Similar results were found using the orthologous mouse TDAG8 DNA. The PSY response (i.e. inhibiting forskolin-driven increase in cAMP levels) was not blocked by pre-treatment of cultures with pertussis toxin (PTX, 100 ng/ml, and 24 hr), suggesting the involvement of PTX- insensitive G proteins, perhaps G_αz. Sphingosylphosphorylcholine (SPC) also was active in this assay, but this response, which was pertussis toxin sensitive, probably proceeds through an endogenous receptor in RH7777 cells.

The ability of PSY to activate TDAG8 was confirmed by this lipid' s evoking Ca²⁺ transients in TDAG8-expressing HEK293 cells and the PSY-driven internalization of a TDAG8/green fluorescent protein fusion protein in HEK293T cells. Both actions were mimicked by related lysoglycolipids (e.g. GlcPSY, lysosulfatide) but not by SPC or N- acetyl PSY at concentrations up to 10 μM.

Agents that modulate the activity of TDAG8 therefore can be identified in a number of ways that take advantage of the interaction of the receptor with PSY or a structurally related glycosphingolipid. For example, the ability to reconstitute

TDAG8/PSY binding either in vitro, on cultured cells or in vivo provides a target for the identification of agents that disrupt that binding. Assays based on disruption of binding can identify agents, such as small organic molecules, from libraries or collections of such molecules. Alternatively, such assays can identify agents in samples or extracts from natural sources, e.g., plant, fungal or bacterial extracts or even in human tissue samples (e.g., tumor tissue or tissue from a patient having a lipid storage disease). Modulators of TDAG8/ligand binding can be screened for using a binding assay and/or a functional assay that measures downstream signaling mediated through activation of the receptor or a bioactive fragment thereof. Both binding assays and functional assays can be validated using known ligands of TDAG8 (e.g., such as PSY, GlcPSY, lysosulfatide, lactosyl psychosine, and other agonists as these become identified).

The host cells of the present invention can be used in assays to detect modulators (e.g., antagonists and agonists) of TDAG8 receptor activity. In accordance with one embodiment, a method for identifying antagonists of a TDAG8 receptor is provided. The method comprises taking a host cell that expresses a TDAG8 receptor or a bioactive fragment thereof and exposing the cell to a TDAG8 ligand (e.g., an agonist) while in the presence of one or more test agents and observing the impact of the test agent on the activity of the TDAG8 receptor/bioactive fragment. In one embodiment, two groups of TDAG8-expressing cells are prepared. The first group is exposed to the TDAG8 ligand/agonist and represents a control while the second group of cells is exposed to both the TDAG8 ligand/agonist and potential antagonist test agents. Comparison of the TDAG8 activity between the two groups will reveal when a TDAG8 antagonist is present among the test agents, e.g., when there is a significant decrease in activity in the presence of the agent as determined using statistical methods routine in the art, e.g., setting p values < 0.05. Alternatively, if the level of activation of the receptor is known for a particular concentration of agonist (i.e. a standard curve has been established), simply referring to such data will reveal whether a test agent is having an antagonist effect (e.g., by detecting a significant difference from the standard curve). Therefore, it is not necessary to simultaneously measure TDAG8 receptor activity in the absence of the test agents as part of the method of screening for TDAG8 antagonists.

In one embodiment a method of identifying an agent that modulates the function of a TDAG8 receptor comprising an amino acid sequence according to SEQ ID NO: 2 is provided. The method comprises contacting the TDAG8 receptor with a candidate modulator and measuring the signaling activity of said TDAG8 receptor in the presence of the candidate modulator. More particularly, in one embodiment the activity measured in the presence of said candidate modulator is compared to the activity measured in a separate sample wherein said TDAG8 receptor is contacted with a TDAG ligand at its EC₅₀. The candidate modulator is identified as an agent that modulates the function of TDAG8 when the amount of said activity measured in the presence of said candidate modulator is at least 50% of the amount induced by said TDAG8 ligand present at its EC₅₀.

Agonists can be screened for by taking a host cell that expresses a TDAG8 receptor or a bioactive fragment thereof and exposing the cell to a test agent (e.g., candidate agonist) and observing the impact of the test agent on the activity of the TDAG8 receptor. Agonists can be identified as test agents which result in an activity that is similar (e.g., is less than 10% and preferably, less than 5% different from a TDAG8 activity measured in a given assay) or greater than the activity induced by binding of psychosine or a structurally related glycosphingolipid (e.g., GlcPSY, lysosulfatide, lactosyl psychosine, and others) to the TDAG8 receptor. In accordance with one embodiment the host cell used to screen for agonist or antagonists of TDAG8 is a eukaryotic cell, and more preferably is selected from the group consisting of HEK293, RH7777 and Sf9 cells. In one preferred embodiment the host cell used to detect TDAG antagonist and agonists comprises an HEK293 or RH7777 cell containing the amino acid sequence set forth in SEQ ID NO: 2. In accordance with one method of screening for antagonist of TDAG8, the cell is contacted with a glycosphingolipid selected from the group consisting of psychosine, glucosyl psychosine, lysosulfatide, and lactosyl psychosine. In one preferred embodiment the TDAG8 agonist used is psychosine. The cell is also contacted, either simultaneously with the glycosphingolipid administration or shortly thereafter, with one or more test agents. The cells are then incubated (under conditions suitable for cell viability) in the presence of the glycosphingolipid and the test agent for a predetermined length of time, and then the activity of the TDAG8 receptor is measured.

Overexpression of GPCRs can lead to constitutive activation (see, e.g., Kjelsberg et al., 1992, J. Biol. Chem. 267: 1430; McWhinney et al., 2000, J. Biol. Chem. 275: 2087; Ren et al., 1993, J. Biol. Chem. 268: 16483; Samama et al., 1993, J. Biol. Chem. 268: 4625; Parma et al., 1993, Nature 365: 649; Parma et al., 1998, J. Pharmacol. Exp. Ther. 286: 85; and Parent et al, 1996, J. Biol. Chem. 271: 7949). Therefore, in one aspect, a nucleic acid encoding a TD AG8 receptor or biologically active fragment thereof is operably linked to a strong promoter (e.g., such as a CMV early promoter) to overexpress TDAG8 in a cell. The overexpressing TDAG8 cells can be used to screen for inverse agonists of TDAG8 by contacting the cells with candidate modulators and screening for agents that reduce the constitutive activity of the receptor. Preferably, agents are identified which reduce activity by at least 10%.

Candidate modulators of TDAG8 receptor activity also can be identified by screening for agents which bind to a TDAG8 receptor or bioactive fragment thereof

("TDAG polypeptides"), or which inhibit or enhance (e.g., by at least 10%) the binding of a ligand (e.g., such as PSY, GlcPSY, lysosulfatide, lactosyl psychosine, and other agonists as these become identified) for TDAG8. Binding assays can be performed in an assay using substantially purified TDAG8 polypeptide (e.g., polypeptide substantially free of membrane components) such as produced from a coupled in vitro transcription/translation system or by the affinity purification of a recombinant tagged TDAG8 polypeptide (e.g., a TDAG8 polypeptide fused to Glutathionine-S-transferase, secreted alkaline phosphatase, a FLAG tag, a Myc tag, a 6X-His peptide, and other tags as are known in the art) expressed by a host cell such as a bacterial, yeast, insect, or mammalian cell. The tag portion of a tagged TDAG8 polypeptide can be cleaved from the TDAG8 polypeptide using methods routine in the art.

In one embodiment, TDAG8 polypeptides are used to isolate ligands that bind to the polypeptides under physiological conditions. The method comprises the steps of contacting the TDAG8 polypeptides with a mixture of agents under physiological conditions, removing unbound and non-specifically bound material, and isolating the agents that remain bound to the TDAG8 polypeptides. Preferably, the TDAG8 polypeptides are bound to a solid support using standard techniques to allow rapid screening. As used herein the term "solid support" refers to a solvent-insoluble substrate that is capable of forming linkages (preferably covalent bonds) with soluble molecules. The support can be either biological in nature, such as, without limitation, a cell or bacteriophage particle, or synthetic, such as, without limitation, an acrylamide derivative, agarose, cellulose, nylon, silica, or magnetized particles. In one embodiment, a solid surface comprises functionalized silica or agarose beads.

Binding assays also can be performed using membrane extracts comprising TDAG polypeptides or bioactive fragments thereof. For example, the polypeptide/bioactive fragment can be part of a membrane extract of a host cell which has been transfected with a nucleic acid encoding the TDAG8 receptor or bioactive fragment thereof, a liposome, or a virally budded membrane. Methods for preparation of cellular membrane fractions are known in the art (see, e.g., Hubbard and Cohn, 1975, J. Cell. Biol. 64: 461-479). Such methods can be applied to cells that endogenously express or recombinantly express TDAG8. Alternatively, membrane-free polypeptides can be integrated into membrane preparations by dilution of detergent solutions of the purified TDAG8 polypeptide (see, e.g., as described in Salamon et al., 1996, Biophys. J. 71: 283- 294).

Binding assays can be used to identify agents that inhibit the binding of psychosine or a structurally related glycosphingolipid ("ligand") to TDAG8. For example, competition assays can be performed with labeled ligand in the presence or absence of increasing concentrations of a candidate modulator. To validate and calibrate the assay, control competition reactions using increasing concentrations of unlabeled ligand can be performed. After incubation in an appropriate binding buffer (see, Example 1, below), cells are washed extensively and bound labeled ligand is measured as appropriate for a given label (e.g., by scintillation counting, fluorescence, enzyme assay, etc.). A decrease of at least 10% in the amount of labeled ligand bound in the presence of candidate modulator indicates displacement of binding by the candidate modulator. In one aspect, candidate modulators are considered to bind specifically in this and other assays described herein if they displace 50% of labeled ligand (at subsaturating doses of ligand) at a concentration of 10 μM or less (i.e., the EC₅₀ is 10 μM or less).

Alternatively, binding or displacement of binding can be monitored by surface plasmon resonance (SPR) in which a detectable change in mass occurs near a sensor on which TDAG8 polypeptide is immobilized when a ligand is bound or displaced from the TDAG8 polypeptide. This change in mass is measurable as resonance units versus time after introduction or removal of a ligand or candidate modulator to or from an aqueous medium in contact with the sensor and can be used for quantitative measurements of ligand binding.

For example, a TDAG8 polypeptide can be immobilized on a sensor chip which comprises a thin film lipid membrane (e.g., such as a research grade CM5 chip, available from Biacore AB) according to methods known in the art (see, e.g., Salamon et al., 1996, Biophys J. 71: 283-294; Salamon et al, 2001, Biophys. J. 80: 1557-1567; Salamon et al., 1999, Trends Biochem. Sci. 24: 213-219; and Sarrio et al., 2000, Mol. Cell. Biol. 20: 5164-5174, each of which is incorporated herein by reference). A ligand of TDAG8 can be pre-bound to immobilized TDAG8 polypeptide, and a candidate modulator introduced into a fluid in contact with the sensor (e.g., at a flow rate from 10 μl/min flow rate and a concentration ranging from 1 nM to 100 μM) or the sensor can be pre-incubated with the modulator and then contacted with the ligand. A decrease of 10% or more in the amount of a ligand bound TDAG8 in the presence of candidate modulator, relative to the amount of ligand bound in the absence of candidate modulator, indicates that the candidate modulator inhibits the interaction of TDAG8 and the ligand. Conditions for ligand binding to TDAG8 in an SPR assay can be fine-tuned by one of skill in the art using the conditions reported by Sarrio et al., 2000, supra, as a starting point.

Another method of measuring inhibition of binding of a ligand of TDAG8 to a TDAG8 polypeptide relies on fluorescence resonance energy transfer (FRET). FRET is a quantum mechanical phenomenon that occurs between a fluorescence donor (D) and a fluorescence acceptor (A) in close proximity to each other (usually < 100 A of separation) if the emission spectrum of D overlaps with the excitation spectrum of A. In one aspect, a ligand of a TDAG8 polypeptide and a TDAG8 polypeptide are labeled with a complementary pair of donor and acceptor fluorophores. While brought closely together by binding interaction the fluorescence emitted upon excitation of the donor fluorophore will have a different wavelength than that emitted in response to the same excitation wavelength in the absence of the binding interaction. Thus, bound vs. unbound TDAG8 polypeptides can be quantitated by measuring emission intensity at each wavelength. Donor: Acceptor pairs of fluorophores with which to label molecules are well known in the art. Of particular interest are variants of the A. victoria GFP known as Cyan FP (CFP, Donor(D)) and Yellow FP (YFP, Acceptor(A)). The GFP variants can be made as fusion proteins with TDAG8 polypeptides and vectors for the expression of GFP variants as fusions are known in the art. Ligands can be chemically conjugated to an appropriate complementary GFP variant using methods known in the art. A variation on FRET uses fluorescence quenching to monitor molecular interactions. For example a TDAG8 polypeptide can be labeled with a fluorophore while a ligand of the TDAG8 polypeptide can be labeled with a molecule (e.g., a "quencher") that quenches the fluorescence of the fluorophore when it is brought into close apposition with the fluorophore. In this scenario, a change in fluorescence upon excitation is indicative of a change in the association of the TDAG8 polypeptide and ligand. For example, an increase in fluorescence of the labeled TDAG8 polypeptide can be used to identify modulators that can displace a ligand bearing a quencher molecule. Alternatively, the TDAG8 polypeptide can be labeled with the quencher and the ligand labeled with the fluorophore. For quenching assays, a 10% or greater increase in the intensity of fluorescent emission in samples containing a candidate modulator, relative to samples without the candidate modulator, can be used to identify a candidate modulator which inhibits a TDAG8: ligand interaction. In addition to the surface plasmon resonance and FRET methods, fluorescence polarization measurement is useful to quantitate TDAG8: ligand binding. The fluorescence polarization value for a fluorescently-tagged molecule depends on the rotational correlation time or tumbling rate. Complexes, such as those formed by TDAG8 associating with a fluorescently labeled ligand, will have higher polarization values than uncomplexed, labeled ligand. The inclusion of a candidate inhibitor of a TDAG8: ligand interaction results in a decrease in fluorescence polarization, relative to a mixture without the candidate inhibitor, if the candidate inhibitor disrupts or inhibits the interaction of TDAG8 with the ligand. Fluorescence polarization is well suited for the identification of small molecules that disrupt the formation of receptor:ligand complexes. A decrease of 10% or more in fluorescence polarization in samples containing a candidate modulator, relative to fluorescence polarization in a sample lacking the candidate modulator, indicates that the candidate modulator inhibits a TDAG8: ligand interaction.

Another alternative for monitoring TDAG8:ligand interactions is a biosensor assay. ICS biosensors have been described by AMBRI (Australian Membrane

Biotechnology Research Institute; http//www.ambri.com.au/). In this technology, the association of macromolecules such as TDAG8 and a ligand, such as PSY, is coupled to the closing of gramacidin-facilitated ion channels in suspended membrane bilayers and thus to a measurable change in the admittance (similar to impedence) of the biosensor. This approach is linear over six orders of magnitude of admittance change and is ideally suited for large scale, high throughput screening of small molecule combinatorial libraries. A 10% or greater change (increase or decrease) in admittance in a sample containing a candidate modulator, relative to the admittance of a sample lacking the candidate modulator, indicates that the candidate modulator inhibits the interaction of TDAG8 and ligand.

It should be understood that a candidate modulator, once identified as a ligand, can be used in assays to identify additional candidate modulators. In practice, the use of a small molecule ligand has the benefit that non-polypeptide chemical agents are generally cheaper and easier to produce in purified form. Thus, a small molecule ligand may be better suited to high-throughput assays for the identification of agonists, antagonists or inverse agonists in some assays than a glycosphingolipid ligand such as PSY.

Any of the binding assays described can be used to determine the presence of an agent in a sample, e.g., a tissue sample, that binds to a TDAG receptor molecule, or that affects the binding of a glycosphingolipid ligand, such as PSY, to TDAG8 receptor. To do so, TDAG8 polypeptide is reacted with a glycosphingolipid ligand in the presence or absence of the sample, and ligand binding is measured. A decrease of 10% or more in the binding of glycosphingolipid ligand indicates that the sample contains an agent that modulates the ligand' s binding to the receptor. Such as assay may be desirable to diagnose or prognose the presence of a disorder associated with dysregulation of TDAG8 signaling.

Candidate modulators identified in these types of assays can be screened in assays using whole host cells in binding assays or in functional assays described further below to validate that they act as antagonists or agonists or inverse agonists of TDAG8 receptors or bioactive fragments when these are expressed on the surface of whole cells.

TDAG8 receptor activity can be measured through a wide variety of means as described in Example 1. For example, activation of the TDAG8 receptor can result in a disjunction between mitosis and cytokinesis such that activated cells become giant, multinuclear and assume a globoid morphology. Therefore, in one embodiment, candidate modulators of TDAG8 activity are identified by monitoring the effect of a modulator contacted with a population of cells expressing the TDAG8 receptor, or a bioactive fragment thereof, on mitosis and/or cytokinesis in the population. In one aspect, the cells are TDAG-expressing HEK293 or RH7777 cells and the effect of a candidate modulator on mitosis and/or cytokinesis is determined by monitoring the occurrence of multinuclear globoid cells in the population. The presence of an antagonist of TDAG8 activity will inhibit (e.g., by at least 10%) the formation of such multinuclear cells while the presence of an agonist will induce the formation of such cells. Thus the number of multinuclear globoid cells generated will indicate whether or not one of the test agents represents an antagonist or agonist, respectively.

Multinuclear globoid cells can be detected either visually (by human eye or by an electronic sensor or using an automated microscope system, such as described in U.S. Patent 5,740,270) or through the use of flow cytometry. In one embodiment the cells are stained with DAPI or other DNA-specific fluorescent marker and the multinuclear globoid cells are detected based on fluorescence of the cells.

An antagonist of TDAG8 receptor activity will decrease ligand-induced internalization of the receptor. Therefore, in one embodiment, TDAG8 receptor activity is monitored by detecting the internalization of the receptor or a bioactive fragment thereof upon binding to its ligand. The TDAG8 receptor can be labeled to aid in detecting the receptor's cellular localization using standard techniques known to those skilled in the art. In one aspect, the TDAG8 polypeptide or bioactive fragment thereof can be expressed in a cell as a fusion protein. For example, a TDAG8 polypeptide or bioactive fragment thereof can be fused to a fluorescent polypeptide such as GFP or EGFP.

For GPCRs, such as TDAG8, another measure of receptor activity is the binding of GTP by cell membranes containing TDAG8 receptors. In the method described by Traynor and Nahorski, 1995, Mol. Pharmacol. 47: 848-854, incorporated herein by reference, G-protein coupling to membranes can be evaluated by measuring the binding of labeled GTP. For example, samples comprising membranes isolated from cells expressing the TDAG8 polypeptide can be incubated in a buffer promoting binding of the polypeptide to ligand, in the presence of radiolabeled GTP and unlabeled GDP (e.g., in 20 mM HEPES, pH 7.4, 100 mM NaCl, and 10 mM MgCl₂, 80 pM ³⁵S-GTPγS and 3 μM GDP), with and without a candidate modulator. The assay mixture is incubated for a suitable period of time to permit binding to and activation of the receptor (e.g., 60 minutes at 30°C), after which time unbound labeled GTP is removed (e.g., by filtration onto GF/B filters). Bound, labeled GTP can be measured by liquid scintillation counting. A decrease of 10% or more in labeled GTP binding as measured by scintillation counting in a sample containing a candidate modulator, relative to a sample without the modulator, indicates that the candidate modulator identifies the modulator as one which inhibits TDAG8 activity.

A similar GTP-binding assay can be performed without ligand to identify agents that act as agonists. In this case, ligand-stimulated GTP binding is used as a standard. A agent is considered an agonist if it induces at least 50% of the level of GTP binding induced by ligand (e.g., PSY) when the agent is present at 10 μM or less, and preferably will induce a level which is the same as or higher than that induced by ligand.

GTPase activity can be measured by incubating cell membrane extracts containing a TDAG8 polypeptide with γ³²P-GTP. Active GTPase will release the label as inorganic phosphate, which can be detected by separation of free inorganic phosphate in a 5% suspension of activated charcoal in 20 mM H₃PO₄, followed by scintillation counting. Controls would include assays using membrane extracts isolated from cells not expressing TDAG8 (e.g., mock-transfected cells), in order to exclude possible nonspecific effects of the candidate modulator. In order to assay for the effect of a candidate modulator on TDAG8-regulated GTPase activity, cell membrane samples can be incubated with a ligand (e.g., PSY), with and without the modulator, and a GTPase assay can be performed as described above. A change (increase or decrease) of 10% or more in the level of GTP binding or GTPase activity relative to samples without modulator is indicative of TDAG8 modulation by a candidate modulator.

In another aspect, TDAG8 activity is evaluated by monitoring calcium flux in TDAG8-expressing cells in the presence or absence of a candidate modulator. In one aspect, an aequorin-based assay is used. An aequorin-based assay takes advantage of the responsiveness of cytoplasmic or mitochondrial apoaequorin to intracellular calcium release induced by the activation of GPCRs (Stables et al., 1997, Anal. Biochem. 252:115-126; Detheux et al., 2000, J. Exp. Med., 192 1501-1508; both of which are incorporated herein by reference). Briefly, TDAG8-expressing cells are transfected to express apoaequorin. Cells are incubated with 5 μM Coelenterazine H (Molecular

Probes) or another apoaquorin cofactor for a suitable period of time to permit signaling activity to be monitored, for example, about 4 hours at room temperature, washed in culture medium, resuspended (e.g., at a concentration of 0.5 x 10⁶ cells/ml) and then mixed with candidate modulators or with a suitable buffer or medium as a control. Light emission by aequorin is recorded by a luminometer and results are expressed as Relative Light Units (RLU). Controls include assays using membranes isolated from cells not expressing TDAG8 (mock-transfected), in order to exclude possible non-specific effects of the candidate modulator.

Aequorin activity or intracellular calcium levels are "changed" if light intensity increases or decreases by 10% or more in a sample of cells, expressing a TDAG8 polypeptide and treated with a candidate modulator, relative to a sample of cells expressing the TDAG8 polypeptide but not treated with the candidate modulator or relative to a sample of cells not expressing the TDAG8 polypeptide (mock-transfected cells) but treated with the candidate modulator. When performed in the absence of a ligand of TDAG8 (e.g., such as PSY), the assay can be used to identify an agonist of TDAG8 activity. When the assay is performed in the presence of a ligand polypeptide, it can be used to assay for an antagonist. In another aspect, the effect of a candidate modulator on the activity of a TDAG8 polypeptide is evaluated by assaying for adenylate cyclase activity. Assays for adenylate cyclase activity are described by Kenimer & Nirenberg, 1981, Mol. Pharmacol. 20: 585- 591, incorporated herein by reference. That assay is a modification of the assay taught by Solomon et al., 1974, Anal. Biochem. 58: 541-548, also incorporated herein by reference. Briefly, an exemplary assay comprises an 100 μl reaction mix containing 50 mM Tris-Hcl (pH 7.5), 5 mM MgCl₂, 20 mM creatine phosphate (disodium salt), 10 units (71 μg of protein) of creatine phosphokinase, 1 mM α-³²P-ATP (tetrasodium salt, 2 μCi), 0.5 mM cyclic AMP, G-³H-labeled cyclic AMP (approximately 10,000 cpm), 0.5 mM Ro20-1724, 0.25% ethanol, and 50-200 μg of a protein homogenate to be tested (i.e., a homogenate from cells expressing or not expressing a TDAG8 polypeptide, treated or not treated with a ligand and with or without a candidate modulator). Reaction mixtures are generally incubated at 37°C for 6 minutes. Following incubation, reaction mixtures are deproteinized by the addition of 0.9 ml of cold 6% trichloroacetic acid. Tubes are centrifuged at 1800 x g for 20 minutes and each supernatant solution is added to a Dowex AG50W-X4 column. The cAMP fraction from the column is eluted with 4 ml of 0.1 mM imidazole-HCl (pH 7.5) into a counting vial. Control reactions preferably include assays performed using protein homogenates from cells that do not express a TDAG8 polypeptide. According to the invention, adenylate cyclase activity is "changed" if it increases or decreases by 10% or more in a sample taken from cells treated with a candidate modulator of TDAG8 activity, relative to a similar sample of cells not treated with the candidate modulator or relative to a sample of cells not expressing the TDAG8 polypeptide (mock-transfected cells) but treated with the candidate modulator. Intracellular or extracellular cAMP also can be measured to monitor changes in the activity of the receptor, for example, using a cAMP radioimmunoassay (RIA) or cAMP binding protein according to methods widely known in the art. For example, Horton & Baxendale, 1995, Methods Mol. Biol. 41: 91-105, which is incorporated herein by reference, describes an RIA for cAMP. A number of kits for the measurement of c AMP are commercially available, such as the High Efficiency Fluorescence Polarization-based homogeneous assay marketed by LJL Biosystems and NEN Life Science Products. Control reactions should be performed using extracts of mock-transfected cells to exclude possible non-specific effects of some candidate modulators.

The level of cAMP is "changed" if the level of cAMP detected in cells, expressing a TDAG8 polypeptide and treated with a candidate modulator of TDAG8 activity (or in extracts of such cells), using the RIA-based assay of Horton & Baxendale, 1995, supra, as an exemplary method increases or decreases by at least 10% relative to the cAMP level in similar cells not treated with the candidate modulator.

The activity of GPCR's, such as TDAG8, that activate the breakdown of phospholipids also can be monitored for changes due to the activity of known or suspected modulators of TDAG8 by measuring phospholipid breakdown, and the resulting production of second messengers, such as DAG and/or inositol triphosphate (IP₃). Methods of measuring each of these are described in Phospholipid Signaling Protocols, edited by Ian M. Bird. Totowa, NJ, Humana Press, 1998, which is incorporated herein by reference. See also Rudolph et al, 1999, J. Biol. Chem. 274: 11824-11831, incorporated herein by reference, which also describes an assay for phosphatidylinositol breakdown. Assays should be performed using cells or extracts of cells expressing TDAG8, treated or not treated with a ligand, with or without a candidate modulator. Control reactions should be performed using mock-transfected cells, or extracts from them in order to exclude possible non-specific effects of some candidate modulators. According to the invention, phosphatidylinositol breakdown, and diacylglycerol and/or inositol triphosphate levels are "changed" if they increase or decrease by at least 10% in a sample from cells expressing a TDAG8 polypeptide and treated with a candidate modulator, relative to the level observed in a sample from cells expressing a TDAG8 polypeptide that is not treated with the candidate modulator. Growth factor receptor tyrosine kinases tend to signal via a pathway involving activation of Protein Kinase C (PKC), which is a family of phospholipid- and calcium- activated protein kinases. PKC activation ultimately results in the transcription of an array of proto-oncogene transcription factor-encoding genes, including c-fos, c-myc and c-jun, proteases, protease inhibitors, including collagenase type I and plasminogen activator inhibitor, and adhesion molecules, including intracellular adhesion molecule I (ICAM I). Assays designed to detect increases in gene products induced by PKC can be used to monitor PKC activation and thereby receptor activity. In addition, the activity of receptors that signal via PKC can be monitored through the use of reporter gene constructs driven by the control sequences of genes activated by PKC activation. This type of reporter gene-based assay is discussed in more detail below.

For a more direct measure of PKC activity, the method of Kikkawa et al., 1982, J. Biol. Chem. 257: 13341, incorporated herein by reference, can be used. This assay measures phosphorylation of a PKC substrate peptide, which is subsequently separated by binding to phosphocellulose paper. This PKC assay system can be used to measure activity of purified kinase, or the activity in crude cellular extracts. Protein kinase C sample can be diluted in 20 mM HEPES/ 2 mM DTT immediately prior to assay.

One substrate which can be used for the assay is the peptide Ac-FKKSFKL-NH2, (SEQ ID NO: 9) derived from the myristoylated alanine-rich protein kinase C substrate protein (MARCKS). The K_m of the enzyme for this peptide is approximately 50 μM. Other basic, protein kinase C-selective peptides known in the art can also be used, at a concentration of at least 2 -3 times their K_m. Cofactors required for the assay include calcium, magnesium, ATP, phosphatidylserine and diacylglycerol. Depending upon the intent of the user, the assay can be performed to determine the amount of PKC present (activating conditions) or the amount of active PCK present (non-activating conditions). For most purposes according to the invention, non-activating conditions will be used, such that the PKC that is active in the sample when it is isolated is measured, rather than measuring the PKC that can be activated. For non-activating conditions, calcium is omitted in the assay in favor of EGTA.

The assay can be performed in a mixture containing 20 mM HEPES, pH 7.4, 1-2 mM DTT, 5 mM MgCl₂, 100 μM ATP, ~1 μCi γ-³²P-ATP, 100 μg/ml peptide substrate (-100 μM), 140 μM / 3.8 μM phosphatidylserine/diacylglycerol membranes, and 100 μM calcium (or 500 μM EGTA). 48 μl of sample, diluted in 20 mM HEPES, pH 7.4, 2 mM DTT is used in a final reaction volume of 80 μl. Reactions preferably are performed at 30°C for 5-10 minutes, followed by addition of 25 μl of 100 mM ATP, 100 mM EDTA, pH 8.0, which stops the reactions.

After the reaction is stopped, a portion (85 μl) of each reaction is spotted onto a Whatman P81 cellulose phosphate filter, followed by washes: four times 500 ml in 0.4% phosphoric acid, (5-10 min per wash); and a final wash in 500 ml 95% EtOH, for 2-5 min. Bound radioactivity is measured by scintillation counting. Specific activity (cpm/nmol) of the labeled ATP is determined by spotting a sample of the reaction onto P81 paper and counting without washing. Units of PKC activity, defined as nmol phosphate transferred per min, are calculated as follows:

The activity, in UNITS (nmol/min) is:

= fcpm on paper) x (105 μl total /85 μl spotted) (assay time, min) (specific activity of ATP cpm/nmol).

An alternative assay can be performed using a Protein Kinase C Assay Kit sold by PanVera (Cat. # P2747).

Assays are performed on extracts from cells expressing a TDAG8 polypeptide, treated or not treated with a ligand with or without a candidate modulator. Control reactions should be performed using mock-transfected cells, or extracts from them in order to exclude possible non-specific effects of some candidate modulators.

According to the invention, PKC activity is "changed" by a candidate modulator when the units of PKC measured by either assay described above increase or decrease by at least 10%, in extracts from cells expressing TDAG8 and treated with a candidate modulator, relative to a reaction performed on a similar sample from cells not treated with a candidate modulator.

MAP kinase activity can be assayed using any of several kits available commercially, for example, the p38 MAP Kinase assay kit sold by New England Biolabs (Cat # 9820) or the FlashPlate™ MAP Kinase assays sold by Perkin-Elmer Life Sciences. MAP Kinase activity is "changed" if the level of activity is increased or decreased by 10% or more in a sample from cells, expressing a TDAG8 polypeptide, treated with a candidate modulator relative to MAP kinase activity in a sample from similar cells not treated with the candidate modulator, in the presence or absence of ligand.

Direct assays for tyrosine kinase activity using known synthetic or natural tyrosine kinase substrates and labeled phosphate are well known, as are similar assays for other types of kinases (e.g., Ser/Thr kinases). Kinase assays can be performed with both purified kinases and crude extracts prepared from cells expressing a TDAG8 polypeptide, treated with or without a ligand, with or without a candidate modulator. Control reactions should be performed using mock-transfected cells, or extracts from them in order to exclude possible non-specific effects of some candidate modulators. Substrates can be either full-length proteins or synthetic peptides representing the substrates. Pinna & Ruzzene (1996, Biochem. Biophys. Acta 1314: 191-225, incorporated herein by reference) list a number of phosphorylation substrate sites useful for measuring kinase activities. A number of kinase substrate peptides are commercially available. One that is particularly useful is the "Src-related peptide," RRLIEDAEYAARG (SEQ ID NO: 5; available from Sigma # A7433), which is a substrate for many receptor and nonreceptor tyrosine kinases. Because the assay described below requires binding of peptide substrates to filters, the peptide substrates should have a net positive charge to facilitate binding. Generally, peptide substrates should have at least 2 basic residues and a free amino terminus. Reactions generally use a peptide concentration of 0.7-1.5 mM.

Assays are generally carried out in a 25 μl volume comprising 5 μl of 5X kinase buffer (5 mg/mL BSA, 150 mM Tris-Cl (pH 7.5), 100 mM MgCl₂; depending upon the exact kinase assayed for, MnCl₂ can be used in place of or in addition to the MgCl₂), 5 μl of 1.0 mM ATP (0.2 mM final concentration), γ-32P-ATP (100-500 cpm/pmol), 3 μl of 10 mM peptide substrate (1.2 mM final concentration), cell extract containing kinase to be tested (cell extracts used for kinase assays should contain a phosphatase inhibitor (e.g. 0.1-1 mM sodium orthovanadate)), and H₂O to 25 μl. Reactions are performed at 30°C, and are initiated by the addition of the cell extract.

Kinase reactions are performed for 30 seconds to about 30 minutes, followed by the addition of 45 μl of ice-cold 10% trichloroacetic acid (TCA). Samples are spun for 2 minutes in a microcentrifuge, and 35μl of the supernatant is spotted onto Whatman P81 cellulose phosphate filter circles. The filters are washed three times with 500 ml cold 0.5% phosphoric acid, followed by one wash with 200 ml of acetone at room temperature for 5 minutes. Filters are dried and incorporated 32P is measured by scintillation counting. The specific activity of ATP in the kinase reaction (e.g., in cpm/pmol) is determined by spotting a small sample (2-5 μl) of the reaction onto a P81 filter circle and counting directly, without washing. Counts per minute obtained in the kinase reaction (minus blank) are then divided by the specific activity to determine the moles of phosphate transferred in the reaction.

Tyrosine kinase activity is "changed" if the level of kinase activity is increased or decreased by 10% or more in a sample from cells, expressing a TDAG8 polypeptide, treated with a candidate modulator relative to kinase activity in a sample from similar cells not treated with the candidate modulator.

The intracellular signal initiated by binding of an agonist to a receptor, e.g., TDAG8, sets in motion a cascade of intracellular events, the ultimate consequence of which is a rapid and detectable change in the transcription or translation of one or more genes. The activity of the receptor can therefore be monitored by measuring the expression of a reporter gene driven by control sequences responsive to TDAG8 activation. As used herein "promoter" refers to the transcriptional control elements necessary for receptor-mediated regulation of gene expression, including not only the basal promoter, but also any enhancers or transcription-factor binding sites necessary for receptor-regulated expression. By selecting promoters that are responsive to the intracellular signals resulting from agonist binding, and operatively linking the selected promoters to reporter genes whose transcription, translation or ultimate activity is readily detectable and measurable, the transcription based reporter assay provides a rapid indication of whether a given receptor is activated. Reporter genes such as luciferase, CAT, GFP, β-lactamase or β-galactosidase are well known in the art, as are assays for the detection of their products. Genes particularly well suited for monitoring receptor activity are the "immediate early" genes, which are rapidly induced, generally within minutes of contact between the receptor and the effector protein or ligand. The induction of immediate early gene transcription does not require the synthesis of new regulatory proteins. In addition to rapid responsiveness to ligand binding, characteristics of preferred genes useful to make reporter constructs include: low or undetectable expression in quiescent cells; induction that is transient and independent of new protein synthesis; subsequent shut-off of transcription requires new protein synthesis; and mRNAs transcribed from these genes have a short half-life. It is preferred, but not necessary that a transcriptional control element have all of these properties for it to be useful. An example of a gene that is responsive to a number of different stimuli is the c- fos proto-oncogene. The c-fos gene is activated in a protein-synthesis-independent manner by growth factors, hormones, differentiation-specific agents, stress, and other known inducers of cell surface proteins. The induction of c-fos expression is extremely rapid, often occurring within minutes of receptor stimulation. This characteristic makes the c-fos regulatory regions particularly attractive for use as a reporter of receptor activation.

The c-fos regulatory elements include (see, Verma et al, 1987, Cell 51: 513-514): a TATA box that is required for transcription initiation; two upstream elements for basal transcription, and an enhancer, which includes an element with dyad symmetry and which is required for induction by TPA, serum, EGF, and PMA.

The 20 bp c-fos transcriptional enhancer element located between -317 and -298 bp upstream from the c-fos mRNA cap site, is essential for serum induction in serum starved NIH 3T3 cells. One of the two upstream elements is located at -63 to -57 and it resembles the consensus sequence for cAMP regulation.

The transcription factor CREB (cyclic AMP responsive element binding protein) is, as the name implies, responsive to levels of intracellular cAMP. Therefore, the activation of a receptor that signals via modulation of cAMP levels can be monitored by measuring either the binding of the transcription factor, or the expression of a reporter gene linked to a CREB-binding element (termed the CRE, or cAMP response element). The DNA sequence of the CRE is TGACGTCA (SEQ ID NO: 6). Reporter constructs responsive to CREB binding activity are described in U.S. Patent No. 5,919,649.

Other promoters and transcriptional control elements, in addition to the c-fos elements and CREB -responsive constructs, include the vasoactive intestinal peptide (VIP) gene promoter (cAMP responsive; Fink et al, 1988, Proc. Natl. Acad. Sci. 85:6662- 6666); the somatostatin gene promoter (cAMP responsive; Montminy et al, 1986, Proc. Natl. Acad. Sci. 8.3:6682-6686); the proenkephalin promoter (responsive to cAMP, nicotinic agonists, and phorbol esters; Comb et al, 1986, Nature 323:353-356); and the phosphoenolpyruvate carboxy-kinase (PEPCK) gene promoter (cAMP responsive; Short et al, 1986, J. Biol. Chem. 261:9721-9726).

Additional examples of transcriptional control elements that are responsive to changes in GPCR activity include, but are not limited to those responsive to the AP-1 transcription factor and those responsive to NF-κB activity. The consensus AP-1 binding site is the palindrome TGA(C/G)TCA (SEQ ID NO: 7;Lee et al., 1987, Nature 325: 368- 372; Lee et al, 1987, Cell 49: 741-752). The AP-1 site is also responsible for mediating induction by tumor promoters such as the phorbol ester 12-O-tetradecanoylphorbol-β- acetate (TPA), and are therefore sometimes also referred to as a TRE, for TPA-Response Element. AP-1 activates numerous genes that are involved in the early response of cells to growth stimuli. Examples of AP-1 -responsive genes include, but are not limited to the genes for Fos and Jun (which proteins themselves make up AP-1 activity), Fos-related antigens (Fra) 1 and 2, IκBα, ornithine decarboxylase, and annexins I and II. The NF-κB binding element has the consensus sequence GGGGACTTTCC (SEQ ID NO: 8). A large number of genes have been identified as NF-κB responsive, and their control elements can be linked o a reporter gene to monitor GPCR activity. A small sample of the genes responsive to NF-κB includes those encoding IL-lβ (Hiscott et al., 1993, Mol. Cell. Biol. 13: 6231-6240), TNF-α (Shakhov et al., 1990, J. Exp. Med. 171: 35-47), CCR5 (Liu et al, 1998, AIDS Res. Hum. Retroviruses 14: 1509-1519), P-selectin (Pan & McEver, 1995, J. Biol. Chem. 270: 23077-23083), Fas ligand (Matsui et al., 1998, J. Immunol. 161: 3469-3473), GM-CSF (Schreck & Baeuerle, 1990, Mol. Cell. Biol. 10: 1281-1286) and I Bα (Haskill et al, 1991, Cell 65: 1281-1289). Each of these references is incorporated herein by reference. Vectors encoding NF-κB-responsive reporters are also known in the art or can be readily made by one of skill in the art using, for example, synthetic NF-κB elements and a minimal promoter, or using the NF-κB-responsive sequences of a gene known to be subject to NF-i B regulation. Further, NF-κB responsive reporter constructs are commercially available from, for example, CLONTECH.

A given promoter construct should be tested by exposing TDAG8-expressing cells, transfected with the construct, to a ligand of TDAG8. An increase of at least twofold in the expression of reporter in response to ligand indicates that the reporter is an indicator of TDAG8 activity. In order to assay TDAG8 activity with a ligand-responsive transcriptional reporter construct, cells that stably express a TDAG8 polypeptide are stably transfected with the reporter construct. To screen for agonists, the cells are left untreated, exposed to candidate modulators, or exposed to a ligand, and expression of the reporter is measured. The ligand -treated cultures serve as a standard for the level of transcription induced by a known agonist. An increase of at least 50% in reporter expression in the presence of a candidate modulator indicates that the candidate is a modulator of TDAG8 activity. An agonist will induce at least as much, and preferably the same amount or more, reporter expression than the ligand. This approach can also be used to screen for inverse agonists where cells express a TDAG8 polypeptide at levels such that there is an elevated basal activity of the reporter in the absence of ligand or another agonist. A decrease in reporter activity of 10% or more in the presence of a candidate modulator, relative to its absence, indicates that the agent is an inverse agonist. To screen for antagonists, the cells expressing TDAG8 and carrying the reporter construct are exposed to a ligand (or another agonist) in the presence and absence of candidate modulator. A decrease of 10% or more in reporter expression in the presence of candidate modulator, relative to the absence of the candidate modulator, indicates that the candidate is a modulator of TDAG 8 activity.

Controls for transcription assays include cells not expressing TDAG8 but carrying the reporter construct, as well as cells with a promoterless reporter construct. Agents that are identified as modulators of TDAG8-regulated transcription should also be analyzed to determine whether they affect transcription driven by other regulatory sequences and by other receptors, in order to determine the specificity and spectrum of their activity.

The transcriptional reporter assay, and most cell-based assays, are well suited for screening expression libraries for proteins for those that modulate TDAG8 activity. The libraries can be, for example, cDNA libraries from natural sources, e.g., plants, animals, bacteria, etc., or they can be libraries expressing randomly or systematically mutated variants of one or more polypeptides. Genomic libraries in viral vectors can also be used to express the mRNA content of one cell or tissue, in the different libraries used for screening of TDAG8.

Any assays of receptor activity, including the GTP-binding, GTPase, adenylate cyclase, cAMP, phospholipid-breakdown, diacylglycerol, inositol triphosphate, PKC, kinase and transcriptional reporter assays, can be used to determine the presence of a candidate modulator in a sample, e.g.,such as a tissue sample, that affects the activity of the TDAG8 receptor molecule. To do so, generally TDAG8 polypeptide is assayed for activity in the presence and absence of the sample or an extract of the sample. An increase in TDAG8 activity in the presence of the sample or extract relative to the absence of the sample indicates that the sample contains an agonist of the receptor activity. A decrease in receptor activity in the presence of a ligand (e.g., PSY, a structurally related glycosphingolipid, or a newly discovered agonist) and the sample, relative to receptor activity in the presence of ligand, indicates that the sample contains an antagonist of TDAG8 activity. If desired, samples can then be fractionated and further tested to isolate or purify the agonist or antagonist.

The amount of increase or decrease in measured activity necessary for a sample to be said to contain a modulator depends upon the type of assay used. Generally, a 10% or greater change (increase or decrease) relative to an assay performed in the absence of a sample indicates the presence of a modulator in the sample. One exception is the transcriptional reporter assay, in which at least a two-fold increase or 10% decrease in signal is necessary for a sample to be said to contain a modulator. It is preferred that an agonist stimulates at least 50%, and preferably 75% or 100% or more, e.g., 2-fold, 5-fold, 10-fold or greater receptor activation than wild-type ligand. Other functional assays include, for example, microphysiometer or biosensor assays (see Hafner, 2000, Biosens. Bioelectron. 15: 149-158, incorporated herein by reference).

Diagnostic Assays Based upon the Interaction of TDAG 8 and Cellular Agonists or Antagonists

Signaling through GPCRs is instrumental in the pathology of a large number of diseases and disorders. Northern blot analysis revealed that the human TDAG8 gene is expressed predominantly in lymphoid tissues, including peripheral blood leukocytes, spleen, lymph nodes, and thymus (see, Kyaw et al., 1998, DNA Cell. Biol. 17(6): 493- 500). Fluorescent in situ hybridization (FISH) demonstrates that the human TDAG8 gene is located at human chromosome 14q31-32.1, a region in which abnormalities associated with human T-cell lymphoma or leukemia are found (Kyaw et al., 1998, supra). The TDAG8 receptor is so named because its mRNA level increases during the programmed cell death of immature T lymphocytes. Because of its expression in cells of the lymphocyte lineages, TDAG8 can be involved in T-cell associated diseases including, but not limited to: abnormal T cell proliferation, abnormal inflammatory responses, autoimmune diseases, and diseases in response to viral (e.g., HIV types I and II) or bacterial infections.

Additionally, the discovery herein that TDAG8 serves as a receptor for psychosine and structurally related glycosphingolipids provides a system in which to identify aberrant signaling events which arise during lipid storage disorders. For example, Krabbe's disease, in which PSY accumulates to inordinately high levels is characterized by the presence multinuclear, globoid cells in the white matter of the brain, and global de- myelination of central and peripheral neurons. A mouse model of Krabbe's disease (the 'twitcher' mouse) also exists and this model system also exhibits inordinate PSY accumulation, the globoid cell morphology and de-myelination events. In both human Krabbe's disease and the twitcher mouse, the genetic defect is a lack of the enzyme galactosylceramidase, which catalyzes the cleavage of psychosine to galactose and sphingosine. Similar enzyme deficiencies result in the accumulation of glucosyl psychosine (Gaucher's disease) and lysosulfatide (metachromic leukodystrophy).

Accordingly, the interaction of TDAG8 and its ligands (psychosines, related glycosphingolipids, or cellular modulators of TDAG 8 discovered by assays described herein) can be used as the basis of assays for the diagnosis or monitoring of diseases, disorders or processes involving TDAG8 signaling. Diagnostic assays for TDAG8- related diseases or disorders can have several different forms. First, diagnostic assays can measure the amount of TDAG8 and/or ligand in a sample of tissue. Second, assays can evaluate the qualities of the receptor or the ligand. For example, assays that determine whether an individual expresses a mutant or variant form of TDAG 8 can be used diagnostically. Third, assays that measure one or more activities of TDAG8 polypeptide can be used diagnostically.

TDAG8 and ligand levels can be measured and compared to standards in order to determine whether an abnormal level of the receptor or its ligand is present in a sample, either of which indicate probable dysregulation of TDAG8 signaling. Polypeptide levels are measured, for example, by immunohistochemistry using antibodies specific for the polypeptide. In accordance with one embodiment, a sample isolated from an individual suspected of suffering from a disease or disorder characterized by TDAG8 activity is contacted with an antibody for TDAG8 or a ligand, and binding of the antibody is measured as known in the art (e.g., by measurement of the activity of an enzyme conjugated to a secondary antibody). In one embodiment, the TDAG8 antibodies of the present invention are the used in in situ hybridization to determine the expression pattern of the TDAG8 gene in normal and twitcher mice, and to determine what type(s) of leukocytes express TDAG8. The antibodies may be used with or without modification, and may be labeled by joining them, either covalently or non-covalently, with a reporter molecule.

As used herein, the term "antibody" refers to the conventional immunoglobulin molecule, as well as fragments thereof which are specifically reactive with a TDAG8 polypeptide. Antibodies can be fragmented using techniques routine in the art and the fragments screened for their ability to specifically bind to TDAG8 polypeptides. For example, F(ab)₂ fragments can be generated by treating antibody with pepsin. The resulting F(ab)₂ fragment can be treated to reduce disulfide bridges to produce Fab fragments. Fragments also can be obtained from a Fab expression library. TDAG8 antibodies of the present invention are further intended to include monoclonal, polyclonal, bispecific, single-chain, and chimeric and humanized molecules having affinity for a TDAG8 polypeptide conferred by at least one CDR region of a TDAG8- specific antibody. In preferred embodiments, the antibody further comprises a label attached thereto and able to be detected, (e.g., the label can be a radioisotope, fluorescent compound, chemiluminescent compound, enzyme, or enzyme co-factor).

TDAG8 Antibodies can be made using standard protocols known in the art (See, for example, Antibodies: A Laboratory Manual ed. by Harlow and Lane (Cold Spring Harbor Press: 1988)). A mammal, such as a mouse, hamster, or rabbit can be immunized with an immunogenic form of the peptide (e.g., a TDAG8 polypeptide or an antigenic fragment thereof which is capable of eliciting an antibody response, or a fusion protein as described herein above). Immunogens for raising antibodies are prepared by mixing the polypeptides (e.g., isolated recombinant polypeptides or synthetic peptides) with adjuvants. Alternatively, TDAG8 polypeptides or peptides are made as fusion proteins to larger immunogenic proteins. Polypeptides can also be covalently linked to other larger immunogenic proteins, such as keyhole limpet hemocyanin. Alternatively, plasmid or viral vectors encoding TDAG8 can be used to express the polypeptides and generate an immune response in an animal as described in Costagliola et al., 2000, J. Clin. Invest. 105:803-811, which is incorporated herein by reference. In order to raise antibodies, immunogens are typically administered intradermally, subcutaneously, or intramuscularly to experimental animals such as rabbits, sheep, and mice. In addition to the antibodies discussed above, genetically engineered antibody derivatives can be made, such as single chain antibodies.

The progress of immunization can be monitored by detection of antibody titers in plasma or serum. Standard ELISA, flow cytometry or other immunoassays can also be used with the immunogen as antigen to assess the levels of antibodies. Antibody preparations can be simply serum from an immunized animal, or if desired, polyclonal antibodies can be isolated from the serum by, for example, affinity chromatography using immobilized immunogen. To produce monoclonal antibodies specific for TDAG8, antibody-producing splenocytes can be harvested from an immunized animal and fused by standard somatic cell fusion procedures with immortalizing cells such as myeloma cells to yield hybridoma cells. Such techniques are well known in the art, and include, for example, the hybridoma technique (originally developed by Kohler and Milstein, 1975, Nature, 256: 495-497), the human B cell hybridoma technique (Kozbar et al., 1983, Immunology Today, 4: 72), and the EBV-hybridoma technique to produce human monoclonal antibodies (Cole et al., 1985, Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc. pp. 77-96). Hybridoma cells can be screened immunochemically for production of antibodies specifically reactive with a TDAG8 peptide or polypeptide, and monoclonal antibodies isolated from the media of a culture comprising such hybridoma cells. Similar techniques can be used to prepare antibodies reactive with antigenic agents that have been identified as modulators of TDAG8. In addition to immunohistochemistry, another approach to the measurement of

TDAG8 and/or ligand levels uses flow cytometry analysis of cells from an affected tissue. Methods of flow cytometry, including the fluorescent labeling of antibodies specific for TDAG8 or ligand, are well known in the art. Other approaches include radioimmunoassay or ELISA. Methods for each of these are also well known in the art. The amount of binding detected is compared to the binding in a sample of similar tissue from a healthy individual, or from a site on the affected individual that is not so affected. An increase of 10% or more relative to the standard is diagnostic for a disease or disorder characterized by TDAG8 dysregulation.

TDAG8 expression also can be measured by determining the amount of mRNA encoding the polypeptide in a sample of tissue. mRNA can be quantitated by quantitative or semi-quantitative PCR. Methods of "quantitative" amplification are well known to those of skill in the art, and primer sequences for the amplification of TDAG8 can be readily derived from the known sequence of TDAG8. A common method of quantitative PCR involves simultaneously co-amplifying a known quantity of a control sequence using the same primers. This provides an internal standard that can be used to calibrate the PCR reaction. Detailed protocols for quantitative PCR are provided in PCR Protocols, A Guide to Methods and Applications, Innis et al, Academic Press, Inc. N.Y., (1990), which is incorporated herein by reference. An increase of 10% or more in the amount of mRNA encoding TDAG8 or ligand in a sample, relative to the amount expressed in a sample of like tissue from a healthy individual or in a sample of tissue from an unaffected location in an affected individual is diagnostic for a disease or disorder characterized by dysregulation of TDAG 8 signaling. Assays that evaluate whether or not the TDAG8 polypeptide or the mRNA encoding it are wild-type or not can be used diagnostically. In order to diagnose a disease or disorder characterized by TDAG8 or ligand dysregulation in this manner, RNA isolated from a sample is used as a template for PCR amplification of TDAG8 or the ligand, where the ligand is a polypeptide. The amplified sequences are then either directly sequenced using standard methods, or are first cloned into a vector, followed by sequencing. A difference in the sequence that changes one or more encoded amino acids relative to the sequence of wild-type TDAG8 or ligand can be diagnostic of a disease or disorder characterized by dysregulation of TDAG8 signaling. It can be useful, when a change in coding sequence is identified in a sample, to express the variant receptor or ligand and compare its activity to that of wild type TDAG8 or ligand. Among other benefits, this approach can provide novel mutants, including constitutively active and null mutants.

In addition to standard sequencing methods, amplified sequences can be assayed for the presence of specific mutations using, for example, hybridization of molecular beacons that discriminate between wild-type and variant sequences. Hybridization assays that discriminate on the basis of changes as small as one nucleotide are well known in the art. Alternatively, any of a number of "minis equencing" assays can be performed, including, those described, for example, in U.S. Patents 5,888,819, 6,004,744 and 6,013,431 (incorporated herein by reference). These assays and others known in the art can determine the presence, in a given sample, of a nucleic acid with a known polymorphism.

If desired, array or microarray-based methods can be used to analyze the expression or the presence of mutation, in TDAG8 or ligand sequences (agonists or antagonists where these are found to be cellular polypeptides). Array-based methods for minisequencing and for quantitation of nucleic acid expression are well known in the art.

Diagnosis of a disease or disorder characterized by the dysregulation of TDAG8 signaling also can be performed using functional assays. To do so, cell membranes or cell extracts prepared from a tissue sample are used in an assay of TDAG8 activity as described herein (e.g., ligand binding assays, the GTP-binding assay, GTPase assay, adenylate cyclase assay, cAMP assay, phospholipid breakdown, diacyl glycerol or inositol triphosphate assays, PKC activation assay, or kinase assay). The activity detected is compared to that in a standard sample taken from a healthy individual or from an unaffected site on the affected individual. As an alternative, a sample or extract of a sample can be applied to cells expressing TDAG8, followed by measurement of TDAG8 signaling activity relative to a standard sample. A difference of 10% or more in the activity measured in any of these assays, relative to the activity of the standard, is diagnostic for a disease or disorder characterized by dysregulation of TDAG8 signaling.

Pharmaceutical Compositions

Identified agonists and antagonists can be formulated as pharmaceutical compositions and administered to a subject to treat or prevent a disorder characterized by inappropriate stimulation of TDAG8, including diseases associated with overstimulation of TDAG8, such as Krabbe's disease.

In accordance with one embodiment, antibodies to the TDAG8 receptor or to its natural ligand (PSY) can be used to decrease the activity of the TDAG8 receptor. In this embodiment, antibodies can be screened for in any of the assays described above to identify antagonists of TDAG8. Pharmaceutical compositions comprising nucleic acid constructs encoding the TDAG8 receptor, antagonist or agonists of TDAG8 receptor activity can be administered to an individual in need thereof by any number of routes including, but not limited to, oral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, intraventricular, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual, or rectal means. In particular, such compositions can be used to treat a disorder characterized by inappropriate TDAG8 activity.

Modulation of TDAG8 Activity in a Cell

In accordance with one aspect of the present invention, the identification of TDAG8 as a receptor for PSY allows for the development of screening methodologies to identify agonist and antagonists of TDAG8 receptor function. Such agents can then be used to treat diseases that are characterized by inappropriate stimulation of the PSY receptor. For example, it is anticipated that an antagonist of TDAG8 function will be useful in treating the lipid storage disorder Krabbe's disease, wherein PSY accumulates to inordinately high levels. Similarly, TDAG8 antagonists also may be used to treat enzyme deficiencies resulting in the accumulation of glucosyl psychosine (Gaucher's disease) and lysosulfatide (metachromic leukodystrophy). The discovery of psychosine, and structurally related glycosphingolipids, such as glucosyl psychosine and lysosulfatide, as a ligand of TDAG8 provides a method of modulating the activity of a TDAG 8 polypeptide in a cell. TDAG8 activity is modulated in a cell by delivering to that cell an agent that modulates the function of a TDAG8 polypeptide. This modulation can be performed in cultured cells as part of an assay for the identification of additional modulating agents that have a therapeutic effect, for example, in an animal, including a human. Agents include psychosine and its structurally related glycosphingolipids, as Well as additional modulators identified using the screening methods described herein. An agent can be delivered to a cell by adding it to culture medium. The amount to deliver will vary with the identity of the agent and with the purpose for which it is delivered. For example, in a culture assay to identify antagonists of TDAG8 activity, one will preferably add an amount of ligand that half-maximally activates the receptors (e.g., approximately EC₅o), preferably without exceeding the dose required for receptor saturation. This dose can be determined by titrating the amount of ligand to determine the point at which further addition of ligand has no additional effect on TDAG8 activity.

The discovery of a molecular target for psychosine suggests a mechanism for the globoid cell histology characteristic of Krabbe's disease and provides a tool with which to explore the disjunction of mitosis and cytokinesis in cell cultures. In accordance with the present invention a method is provided for treating Krabbe's disease and other disorders associated with inappropriate activation of the TDAG8 receptor. The method comprises administering to an individual in need of such therapy a pharmaceutical composition comprising an antagonist of TDAG8 receptor activity. In addition the PSY receptor gene can also be used in gene therapy protocols to treat a disorder characterized by defective or insufficient TDAG8 activity.

When a modulator of TDAG8 activity is administered to an animal for the treatment of a disease or disorder, the amount administered can be adjusted by one of skill in the art on the basis of the desired outcome. Successful treatment is achieved when one or more measurable aspects of the pathology (e.g., numbers of abnormally proliferating cells, accumulation of inflammatory cells, numbers of multinuclear cells, numbers of cells with abnormal lipid storage) is changed by at least 10% relative to the value for that aspect prior to treatment. Transgenic Animals

Transgenic animals expressing TDAG8 or a TDAG8 ligand where such is a cellular polypeptide, or variants thereof, are useful to study the signaling through TDAG8, as well as for the study of drugs or agents that modulate the activity of TDAG8. A transgenic animal is a non-human animal containing at least one foreign gene, called a transgene, which is part of its genetic material. Preferably, the transgene is contained in the animal's germ line such that it can be transmitted to the animal's offspring. A number of techniques may be used to introduce the transgene into an animal's genetic material, including, but not limited to, microinjection of the transgene into pronuclei of fertilized eggs and manipulation of embryonic stem cells (U.S. Patent No. 4,873,191; Palmiter and Brinster, 1986, Ann. Rev. Genet., 20:465-499; French Patent Application 2593827, all of which are incorporated herein by reference). Transgenic animals can carry the transgene in all their cells or can be genetically mosaic.

According to the method of conventional transgenesis, additional copies of normal or modified genes are injected into the male pronucleus of the zygote and become integrated into the genomic DNA of the recipient mouse. The transgene is transmitted in a Mendelian manner in established transgenic strains. Transgenes can be constitutively expressed or can be tissue specific or even responsive to an exogenous drug, e.g., Tetracycline. A transgenic animal expressing one transgene can be crossed to a second transgenic animal expressing a second transgene such that their offspring will carry and express both transgenes.

Animals bearing a homozygous deletion in the chromosomal sequences encoding either TDAG8 or a ligand of TDAG 8 (wherein the ligand is a cellular polypeptide), or variants thereof, can be used to study the function of the receptor and ligand. Of particular interest is whether a ligand knockout has a distinct phenotype, which may point to whether the ligand is the member of a family of related polypeptides. Of further particular interest is the identification of identification of TDAG8/ligand interactions in specific physiological and/or pathological processes.

Knockout animals are produced by the method of creating gene deletions with homologous recombination. This technique is based on the development of embryonic stem (ES) cells that are derived from embryos, are maintained in culture and have the capacity to participate in the development of every tissue in the animals when introduced into a host blastocyst. Knock out animal is produced by directing homologous recombination to a specific target gene in the ES cells, thereby producing a null allele of the gene. The technology for making knock-out animals is well described (see, for example, Huszar et al, 1997, Cell 88:131; and Obki-Hamazaki et al., 1997, Nature, 390: 165, both of which are incorporated herein by reference). One of skill in the art can generate a homozygous TDAG8 or TDAG8 ligand knock-out animal (e.g., a mouse) using the sequences for TDAG8 and a polypeptide ligand as identified in any of the assays described above to make the gene targeting construct.

The method of targeted homologous recombination has been improved by the development of a system for site-specific recombination based on the bacteriophage PI site specific recombinase Cre. The Cre-loxP site-specific DNA recombinase from bacteriophage PI is used in transgenic mouse assays in order to create gene knockouts restricted to defined tissues or developmental stages. Regionally restricted genetic deletion, as opposed to global gene knockout, has the advantage that a phenotype can be attributed to a particular cell/tissue (Marth, 1996, Clin. Invest. 97: 1999). In the Cre-loxP system one transgenic mouse strain is engineered such that loxP sites flank one or more exons of the gene of interest. Homozygotes for this so called 'floxed gene' are crossed with a second transgenic mouse that expresses the Cre gene under control of a cell/tissue type transcriptional promoter. Cre protein then excises DNA between loxP recognition sequences and effectively removes target gene function (Sauer, 1998, Methods 14:381). There are now many in vivo examples of this method, including, for instance, the inducible inactivation of mammary tissue specific genes (Wagner et al, 1997, Nucleic Acids Res. 25: 4323). One of skill in the art can therefore generate a tissue-specific knock-out animal in which TDAG8 or a TDAG8 ligand is homozygously eliminated in a chosen tissue or cell type.

Kits

The invention provides for kits useful for screening for modulators of TDAG8 activity, as well as kits useful for diagnosis of diseases or disorders characterized by dysregulation of TDAG 8 signaling. Kits useful according to the invention can include the TDAG8 receptor (including a membrane-or cell-associated TDAG8 polypeptide, e.g., on isolated membranes, cells expressing TDAG8, or, on an SPR chip or the isolated TDAG8 polypeptide itself) and an isolated ligand. In one embodiment the ligand is selected from the group consisting of psychosine, glucosyl psychosine, lysosulfatide, and lactosyl psychosine. A kit can also comprise an antibody specific for TDAG8 and/or an antibody for a TDAG8 ligand. In one embodiment such antibodies are monoclonal antibodies, and in a further embodiment the antibodies are labeled. Alternatively, or in addition, a kit can contain cells transformed to express a TDAG8 polypeptide and/or cells transformed to express a ligand where such is a polypeptide. In a further embodiment, a kit according to the invention can contain a polynucleotide encoding a TDAG8 polypeptide and/or a polynucleotide encoding a polypeptide ligand of TDAG8. The various reagents of the kit can be packaged in a variety of containers, e.g., vials, tubes, microtiter well plates, bottles, and the like. Other reagents can be included in separate containers and provided with the kit; e.g., positive control samples, negative control samples, buffers, cells, cell culture media, etc. In a still further embodiment, a kit according to the invention may comprise the specific primers useful for amplification of TDAG8. Kits preferably also will include instructions for use.

The invention will now be further illustrated with reference to the following examples. It will be appreciated that what follows is by way of example only and that modifications to detail may be made while still falling within the scope of the invention.

Example 1: Identification of a Molecular Target of Psychosine and its Role in Globoid Cell Formation Abbreviations:

TDAG8; T cell death associated gene 8, PSY; psychosine (D-galactosyl-βl-1 ' sphingosine), Glc PSY; D-glucosylβl-1' sphingosine, OGRl; ovarian cancer G protein- coupled receptor- 1, GPR4; G protein-coupled receptor-4, SPC; sphingosylphosphorylcholine, GPCR; G protein-coupled receptor, BSA; bovine serum albumin, PTX; pertussis toxin, HKRB; Hepes-Krabs-Ringer Buffer, GFP; green fluorescence protein.

Materials and Methods

Materials: GluPSY, LacPSY, N-acetyl PSY, lysosulfatides were from Matreya Inc. (Pleasant Gap, PA); PSY, sphingosylphosphorylcholine (SPC) was obtained from Avanti Polar Lipids (Alabaster, AL). [γ-³²P]ATP was obtained from ICN Biochemicals (Costa Mesa, CA); pcDNA3 plasmid from Invitrogen (Carlsbad, CA); RH7777 cells (CRL 1601) and HEK293 cells (CRL-1573) from the American Type Culture Collection (Manassas, VA); human multiple tissue expression array and the pEGFP-Nl plasmid from Clontech ((Palo Alto, CA). All other chemicals were from Sigma.

Cloning And Stable Transfection Of TDAG8:

Human TDAG8 was cloned from a genomic DNA library by PCR with two primers, forward primer: AGACTTCTCTGTTTACTTTCT (SEQ ID NO: 3), and reverse primer: CTTCCCTTCAAAACATCCTTG (SEQ ID NO: 4), and subcloned it into the pcDNA3 expression vector. RH7777 or HEK293 cell monolayers were transfected with the TDAG8 plasmid DNA using the calcium phosphate precipitate method and clonal populations expressing the neomycin phosphotransferase gene were selected by addition of geneticin (G418) to the culture media. The RH7777 or HEK293 cells were grown in monolayers at 37°C in a 5% CO₂/95% air atmosphere in growth media consisting of: 90% MEM, 10% fetal bovine serum, 2 mM glutamine and 1 mM sodium pyruvate.

Construction of TDAG8-GFP DNA and Confocal Microscopy: hTDAG8 was subcloned into the pEGFP-Nl vector at EcoRI-XhoI sites and transiently expressed in HEK293T cells by the calcium phosphate precipitation method. Cells were allowed to express the transgene for two days and then cultures were split onto cover slips for an additional day. Indicated concentrations of lipid were added for 2 hours at 37 C and then cover slips were washed with PBS at room temperature twice and fixed with cold 70%) ethanol for 45 minutes. Cover slips were then dried and mounted onto slides using Vectashield with DAPI (Vector Laboratories, Burlingame, CA.). Confocal microscopy was performed using a Micro Systems LSM (Zeiss Germany) and Axiovert 100 inverted scope at an excitation wavelength of 488 nM with 63x magnification for GFP.

cAMP Accumulations and Ca²⁺ Mobilization:

For cAMP assay, cells were plated on 24-well dishes as subconfluent populations. After 24 hr, they were washed with phosphate-buffered saline twice and incubated in HKRB for 10 min. Cells were stimulated with different concentrations of lipid in the presence of 1 μM forskolin and 1 mM IBMX for 15 min. The reaction was stopped by adding IN HCI. After centrifugation to removal cell debris, the cAMP in the supernatant fluid was measured in an automated immunoassay (Gamma flow). Assay of calcium mobilization was performed as described previously. Briefly, intracellular calcium fluxes were measured on cell populations (2-4 x 10° cells) that had been loaded with the calcium sensitive fluorophore, INDO-1, in the presence of 2 mM probenecid. Responses were measured using a temperature-controlled fluorimeter (Aminco SLM 8000C, SLM Instruments, Urbana, IL). Lipids were delivered as aqueous solutions containing 0.1% (w/v) fatty acid-free BSA; this vehicle was determined to elicit no response.

Northern blot Analysis: Northern blot hybridization analysis was carried out according to standard methods. For hybridization, a phosphorus-32-labeled human TDAG8 cDNA fragment was used. The human RNA master blot (Clontech) was hybridized and washed according to the protocol supplied by the manufacturer.

DAPI Staining:

For DAPI staining, cells were grown on cover slips and treated with 10 M PSY for 6 days (RH7777 cultures) or 4 days (HEK293 cells). Following treatment, cells were washed with PBS at room temperature twice and fixed with cold 70% ethanol for 45 minutes. Cover slips were then dried and mounted onto slides using Vectashield with DAPI (Vector Laboratories, Buiiingame, CA.) to display nuclei. Images are obtained using a Zeiss fluorescence microscope and Openlab 2.0 software on a Macintosh G3 computer.

Measurement of Calcium Transients: Assay of calcium mobilization was performed as described previously. Briefly, intracellular calcium fluxes were measured on cell populations (2-4 x 10⁶ cells) that had been loaded with the calcium sensitive fluorophore, INDO-1, in the presence of 2 mM probenecid. Responses, which were measured in a temperature-controlled fluorimeter

(Aminco SLM 8000C, SLM Instruments, Urbana, IL).

Flow Cytometry:

Cells were treated with 10 μM PSY for 6 days, harvested, and then fixed with

70% ethanol. Cells were treated with RNase A (0.1 mg/ml in PBS) at 37°C for 30 min, stained with propidium iodide (50 μg/ml in PBS), and then subjected to flow cytometry with a FACScan™ flowcytometer (Becton Dickinson) for measurement of the DNA content.

Results

The glycosphingolipid, psychosine (D-galactosyl-β-1,1' sphingosine), accumulates in patients with Krabbe's disease (Globoid Cell Leukodystrophy), a hereditary metabolic disorder of children, wherein the psychosine-degrading enzyme, galactosyl ceramidase, is absent. Deficiency of galatosylceramidase results in accumulation of galactosylsphingosine (psychosine, PSY) in developmentally myelin- forming oligodendrocytes and Schwann cells. This accumulation of PSY in the white matter of Krabbe's disease children correlates with apoptosis of oligodendrocytes and globoid cell formation by microglia. In particular, Krabbe's disease is characterized by apoptosis of oligodendrocytes, progressive de-myelination of central and peripheral nerves, paralysis and death. Histopathologically, the disease is characterized by almost total absence of myelin, severe gliosis, and the presence of characteristic multinucleated, globoid cells in the white matter.

The course of the human disease is mimicked by the galactosyl ceramidase (GALC)-deficient twitcher mouse. GALC/GALC twitcher mice are phenotypically normal at age 22 days but henceforward exhibit head twitching, progressive paralysis and death by age 45 days. The homozygous GALC/GALC mice accumulate high levels (120 μM in brain at age 3 Id) of PSY. Although PSY has been long suspected as a molecular agent in Krabbe's disease and its mouse model, the mechanism of action of PSY is not understood. As disclosed herein, a cluster of G protein coupled receptors that includes two recently identified lysosphingomyelin (sphingosylphosphorylcholine) receptors

(OGRl and GPR4), an 'orphan' receptor (i.e. ligand unknown previously) named TDAG8 (T-cell Death-Associated Gene 8, so named because it is one of the genes expressed to high levels during the programmed cell death of immature T lymphocytes), was found to be a specific receptor for PSY. When expressed in RH7777 hepatoma cells, human TDAG8 mediated PSY- induced inhibition of forskolin-driven cAMP rise in a concentration-dependent manner (EC₅₀ = 3.4 uM) (Fig. 1A). This response was evoked also by structurally-related lysolipids, e.g., GlcPSY, LacPSY and lysosulfatide, but not by N-acetyl PSY, sphingosine 1 -phosphate, lysophosphatidic acid, ceramide 1 -phosphate, or lysophosphatidylcholine (Fig. IB). Similar results were found using the orthologous mouse TDAG8 DNA. The PSY response was not blocked by pre-treatment of cultures with pertussis toxin (PTX, 100 ng/ml, and 24 hr), suggesting the involvement of PTX- insensitive G proteins, perhaps G_αz Sphingosylphosphorylcholine (SPC) also was active in this assay, but this response, which was pertussis toxin sensitive, probably proceeds through an endogenous receptor in RH7777 cells. The ability of PSY to activate TDAG8 was confirmed by this lipid' s evoking Ca²⁺ transients in TDAG8/HEK293 cells and the PSY-driven internalization of a TDAG8/green fluorescent protein fusion protein in

HEK293T cells. Both actions were mimicked by related lysoglycolipids (e.g. GlcPSY, lysosulfatide) but not by SPC or N-acetyl PSY at concentrations up to 10 μM.

The generation of giant, multinuclear (globoid) cells characteristic of Krabbe's disease was reproduced in vitro by treating human U937 monocyte cells with PSY. Furthermore, RT/PCR revealed that TDAG8 is expressed in U937 cells but not in other cell lines (e.g. HEK293, K562, etc.) that do not form globoid cells in response to PSY treatment. To discover the human tissues that express TDAG8, a human multiple tissue RNA array was probed with radiolabeled TDAG8 DNA. TDAG8 RNA was found most prominently in extracts of spleen (fetal and adult), lymph node and peripheral blood leukocytes, although a low level signal was found in virtually all human tissue extracts. This expression pattern, coupled the observation that THP1 and HL60 cell cultures express TDAG8 is consistent with TDAG8 gene expression in monocytes and macrophages, including tissue macrophages such as microglia.

To test the hypothesis that PSY acting via TDAG8 mediates the disjunction of mitogenesis and cytokinesis characteristic of globoid cells, cell cultures transfected with TDAG8 DNA were treated with PSY and the nuclear/DNA content was quantified. When TDAG8-expressing RH7777 cells were treated with 10 μM PSY, multinuclear globoid cells were observed by DAPI staining (Table 1). Likewise, TDAG8/HEK293 cells became multinuclear in response to PSY treatment, and both receptor and ligand were required to generate the globoid phenotype. The expression of TDAG8 without the PSY treatment or PSY treatment in the absence of TDAG8 DNA transfection failed to produce multinuclear, globoid cells. In concert with the structure activity profile found with inhibition of cAMP and calcium mobilization, GlcPSY and lysosulfatide mimicked the action of PSY in evoking globoid cell formation, while N-acetyl PSY and SPC did not.

The identification of a PSY receptor (i.e., TDAG8) and the function of this ligand- receptor pair in evoking globoid cell formation has several implications. First, TDAG8 is the third member of the OGRl receptor cluster found to have a lipid ligand; OGRl and GPR4 respond to SPC (but not PSY), while a fourth member of this cluster, G2A remains to be de-orphaned. Second, TDAG8, presumably acting through some heterotrimeric G proteins, blocks cell division but not nuclear division and thus provides a tool that might be useful in exploring mechanisms of cytokinesis. It is noteworthy that two tissues that contain multinuclear cells, placenta (trophoblasts) and lung (macrophages in response to cytomegalovirus infection) are prominent in expressing TDAG8 RNA. Third, the structure activity profile of TDAG8 ligands suggests that the TDAG8 might be involved in the pathogenesis of related lipid storage disorders such as Gaucher's disease (accumulation of GlcPSY), which is characterized by hepatomegaly, splenomegaly and - osteoporotic erosion and metacliromatic leukodystrophy (lysosulfatide accumulation), which is characterized by myelin degeneration. Fourth and finally, the identification of a molecular target for PSY and related lipids provides a platform on which a medicinal chemistry, including the discovery and optimization of receptor blockers, can be built. TDAG8 antagonists can prove useful clinically in altering the course of some lipid storage disorders.

Table 1. PSY induces multinuclear cells in TDAG8-expressing RH7777 cells.

Treatment % of Count of multinuclear cells multinuclear cells /Total cell count

(mean ± s.e.m.) (No. of experiments)

None 2.18 ± 0.48 % 32/1437 ^• (3)

PSY 39.32 ± 3.38 % ** 378/984 (6)

GluPSY 44.08 + 4.08 % * 392/890 (6)

Lysosulfatide 21.16 ± 3.24 % * 243/1138 (3)

LacPSY 4.10 ± 0.29 % 67/1617 (3)

SPC 6.27 ± 0.74 % 57/900 (3)

Significance were shown as ** : P < 0.005, * : P < 0.05. Variations, modifications, and other implementations of what is described herein will occur to those of ordinary skill in the art without departing from the spirit and scope of the invention.

All references, patents, patent applications, and PCT publications are incorporated herein by reference in their entireties.

Claims

1. A method of identifying an antagonist of a TDAG8 receptor comprising:

(a) contacting a TDAG8 receptor or a bioactive fragment thereof with a test compound in the presence of an agonist of TDAG8; and

(b) measuring TDAG8 activity, wherein a decrease in TDAG8 activity relative to the activity of a TDAG8 receptor or bioactive fragment thereof in the absence of said test compound, identifies said test compound as an antagonist of said TDAG8 receptor.

2. A method of identifying an agonist of a TDAG8 receptor comprising:

(a) contacting a TDAG8 receptor or a bioactive fragment thereof with a test compound; and

(b) measuring TDAG8 activity, wherein an increase in TDAG8 activity relative to the activity of a TDAG8 receptor or bioactive fragment thereof, in the absence of said test compound, identifies said test compound as an antagonist.

3. A method of identifying an agent that modulates the function of a TD AG8 receptor, comprising the amino acid sequence as set forth in SEQ ID NO: 2, said method comprising:

(a) contacting a TDAG8 receptor with a TDAG8 ligand in the presence and absence of a candidate modulator under conditions permitting the binding of said ligand to said TDAG8 receptor; and

(b) measuring a signaling activity of said TDAG8 receptor, wherein a difference in the activity in the presence of said candidate modulator relative to the activity in the absence of said candidate modulator identifies said candidate modulator as an agent that modulates the function of the TDAG8 receptor.

4. A method of identifying an agent that modulates the function of a TDAG8 receptor, comprising the amino acid sequence as set forth in SEQ ID NO: 2, said method comprising: (a) contacting a TDAG8 receptor with a TDAG8 ligand in the presence and absence of a candidate modulator under conditions permitting the binding of ligand to said TDAG8 receptor; and

(b) measuring binding of said TDAG8 receptor to said ligand, wherein a difference in binding in the presence of said candidate modulator, identifies said candidate modulator as an agent which modulates the function of the TDAG8 receptor.

5. The method according to claim 1 , 2, 3, or 4, wherein said TDAG8 ligand is a glycosphingolipid selected from the group consisting of psychosine, glucosyl psychosine, lysosulfatide, and lactosyl psychosine.

6. The method of claim 1, 2, 3, or 4, wherein said contacting step (a) further comprises contacting one or more cells expressing said receptor with said candidate modulator.

7. The method of claim 6, wherein said one or more cells of said contacting step (a) is transfected with a vector comprising a nucleic acid molecule encoding said receptor.

8. The method of claim 1, 2, 3, or 4, wherein said contacting step (a) comprises contacting a membrane fragment comprising a TDAG polypeptide with said candidate modulator.

9. The method of claim 1, 2, 3, or 4, wherein said test compound is an antibody.

10. The method of claim 1, 2, or 3, wherein said measuring step (b) further comprises detecting multinuclear cells.

11. The method of claim 10, wherein said detecting is by flow cytometry.

12. The method of claim 10, wherein said detecting further comprises labeling said cells using DAPI.

13. The method of claim 1, 2, or 3, wherein said measuring step (a) comprises measuring one or more of: cAMP, intracellular calcium, localization of the receptor, disjunction of mitosis and cytokinesis, the accumulation of psychosine in a cell, DNA content, and numbers of multinuclear cells.

14. The method of claim 6, wherein the cells are RH7777 cells.

15. The method of claim 6, wherein the cells are HEK293 cells.

16. An antibody that binds to the amino acid sequence of SEQ ID NO: 2.

17. A kit comprising a TDAG8 polypeptide and a ligand of TDAG8.

18. The kit according to claim 17, wherein said ligand is a glycosphingolipid selected from the group consisting of psychosine, glucosyl psychosine, lysosulfatide, and lactosyl psychosine.

19. The kit according to claim 17, wherein said TDAG8 polypeptide is on the surface of a cell.

20. The kit according to claim 1 , wherein said TDAG8 polypeptide is within a cell membrane fragment.

21. The kit according to claim 19, wherein said cell comprises an exogenously introduced nucleic acid sequence comprising SEQ ID NO: 1.

22. The kit according to claim 19, wherein said cell is a HEK293, RH7777, or Sf9 cell.

23. An isolated cell selected from the group consisting of human and insect cells, wherein said transgenic cell comprises an exogenously introduced nucleic acid sequence comprising the sequence of SEQ ID NO: 1 or a nucleic acid sequence that hybridizes to the complement of SEQ ID NO: 1 under stringent conditions.

24. The isolated cell of claim 23 wherein the host cell is HEK293.

25. The isolated cell of claim 23 wherein the host cell is Sf9.

26. Isolated membrane fragment of the cell of claim 24, said fragment comprising a TDAG8 polypeptide.

27. A method of stimulating the activity of the TDAG receptor, said method comprising the steps of contacting a cell that expresses the TDAG receptor with an agent selected from the group consisting of psychosine, glucosyl psychosine, lysosulfatide, and lactosyl psychosine.