WO2002070677A2 - Palmityl transferases - Google Patents

Palmityl transferases Download PDF

Info

Publication number
WO2002070677A2
WO2002070677A2 PCT/EP2002/002424 EP0202424W WO02070677A2 WO 2002070677 A2 WO2002070677 A2 WO 2002070677A2 EP 0202424 W EP0202424 W EP 0202424W WO 02070677 A2 WO02070677 A2 WO 02070677A2
Authority
WO
WIPO (PCT)
Prior art keywords
palmityl
transferases
medicament
herf
diagnostic agent
Prior art date
Application number
PCT/EP2002/002424
Other languages
German (de)
French (fr)
Other versions
WO2002070677A3 (en
Inventor
Markus Conradt
Kay Hofmann
Original Assignee
MEMOREC STOFFEL GmbH - MEDIZINISCH-MOLEKULARE ENTWICKLUNG, KÖLN
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by MEMOREC STOFFEL GmbH - MEDIZINISCH-MOLEKULARE ENTWICKLUNG, KÖLN filed Critical MEMOREC STOFFEL GmbH - MEDIZINISCH-MOLEKULARE ENTWICKLUNG, KÖLN
Priority to AU2002256648A priority Critical patent/AU2002256648A1/en
Publication of WO2002070677A2 publication Critical patent/WO2002070677A2/en
Publication of WO2002070677A3 publication Critical patent/WO2002070677A3/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1025—Acyltransferases (2.3)
    • C12N9/1029—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents

Definitions

  • Palmityltransferases are enzymes which catalyze the formation of an ester or amide, in particular a thioester of palmitic acid with amino acids of a protein, in particular the amino acid residues cysteine, serine, threonine and lysine.
  • Covalent lipid modification anchors numerous signal proteins on the cytoplasmic side of the plasma membrane. Lipid modifications are involved in protein / membrane and protein / protein interaction and are often essential for function. The process of palmitylation is often reversible. The exact meaning has not been elucidated in detail.
  • palmityl transferases have not been homogeneously purified, nor has their structure been analyzed.
  • enzymatic processes there also appears to be non-enzymatic, autocatalytic palmitylation.
  • the present invention provides palmityltransferases with four cysteine residues in a catalytically active structure, two cysteine residues in one motif X ⁇ X 2 HCX 3 X 4 C and two further cysteine residues in one motif CX 5 X 6 X 7 X 8 DHHC, where X x from T, S, C, A; X 2 from K, H, S, W, R; X 3 from G, T, S, N, V, P, C, A; X 4 from I, T, S, V, R, K, A, L; X 5 from V, I; X 6 from H, L, M, E, A, S, G, R; X 7 from E, R, K, V, T, Y, M; X 8 from A, H, F, M, R are selected independently of one another and the motifs RXiX 2 HCX 3 XC and CX 5 X 6 X 7 X 8 DHHC lie between two transmembrane regions.
  • X 2 is one of the amino acids K or S.
  • X 3 is selected from G or S.
  • Preferred Amino acids for the X 4 position are T, I or V.
  • M, E, A and H are particularly preferred, independently of this, for the position X 7 V, R, K and E and for the X 8 -position H and F.
  • the two motifs RXiX 2 HCX 3 X 4 C and CX 5 X 6 X 7 X 8 DHHC are spatially adjacent, in particular only connected by two amino acids Zi and Z 2 .
  • Zi is preferably N or D and Z 2 selected from V, IM, R and W.
  • the palmityl transferase according to the invention represents the previously unidentified palmityl transferase, which are involved in the processing of the small G proteins Ha-Ras and / or N-Ras.
  • the palmityl transferases are palmityl transferases from mammals, in particular from humans.
  • the palmityl transferases according to the invention preferably have catalytically active cysteine residues in a region which lies between two transmembrane regions on the cytoplasmic side.
  • Transmembrane regions can be predicted based on various models if the sequence of a protein is known. They are characterized in that in one area there are predominantly hydrophobic amino acids which are flanked by areas in which there are more hydrophilic amino acids.
  • hErf 1, hErf 2, hErf 4, hErf 5 and hlcErf2 are referred to as hErf 1, hErf 2, hErf 4, hErf 5 and hlcErf2 (hErf 1: SEQ ID No. 1, hErf 2: SEQ ID No. 2, hErf 4: SEQ ID No. 3, hErf 5: SEQ ID No. 4 and hlcErf2: SEQ ID No. 5).
  • variants of the palmityl transferases according to the invention are the subject of the invention.
  • Variants are proteins which are derived from the palmityl transferases according to the invention by one or more mutations, insertions and deletions, in particular by conservative exchanges, in particular, N- or C-terminal shortened or extended forms.
  • These variants according to the invention preferably have less than 20% mutations, insertions and deletions, even more preferably less than 10%.
  • the invention also relates to nucleic acids which code for the palmityl transferases according to the invention.
  • Preferred nucleic acids according to the invention are those with SEQ ID No. 6 - 10 (herf 1: SEQ ID No. 6, herf 2: SEQ ID No. 7, herf 4: SEQ ID No. 8, herf 5: SEQ ID No. 9 and hlcerf2: SEQ ID No. 10).
  • Complementary nucleic acids are also part of the invention.
  • the palmityl transferases according to the invention are involved in the palmitylation of Ha- and / or N-Ras. Ras palmitylation is necessary for targeting Ras to the plasma membrane. Anchoring Ras in the plasma membrane is a prerequisite for the transformation of a cell by Ras, that is, the development of cancer. Ras protein that is not palmitylated has only about 10% of its transforming activity.
  • the palmityltransferase that Ras palmitylates is indirectly involved in the development of cancer.
  • the invention therefore also relates to inhibitors which inhibit the expression or the activity of the palmityl transferases. Such inhibitors can be identified in simple procedures. Corresponding inhibitors can be identified, for example, by measuring the expression or the activity of the palmityl transferases in the presence of potential inhibitors.
  • Suitable inhibitors are, for example, antibodies or antibody fragments (inhibition of activity) or antisense nucleic acids with 12 to 30 nucleotides (inhibition of expression).
  • Antibodies directed against the palmityl transferases are particularly suitable for measuring expression, and are therefore also part of the invention.
  • the palmityl transferases according to the invention are also involved in the palmitylation of other proteins, in particular the ⁇ subunit of various G proteins and non-receptor tyrosine kinases such as p60 src or p59 fyn and related proteins which play a role in signal transduction.
  • Protein palmitylation is also involved in other important processes, e.g. :
  • the processes mentioned can be influenced therapeutically by using the palmityl transferase according to the invention or their inhibitors.
  • Palmityl transferases are suitable for characterizing the palmityl transferases according to the invention or for identifying suitable inhibitors.
  • Corresponding cell lines or bacteria for the expression of a palmityl transferase are therefore also the subject of the invention.
  • the palmityl transferases, nucleic acids, inhibitors and antibodies according to the invention can be contained in medicinal and diagnostic agents. They are particularly suitable for the treatment or diagnosis of cancer that affects the Ras, especially pancreatic, colon, lung and leukemia.
  • Figure 1 shows the tissue distribution in human tissue (Northern blot).
  • FIG. 2 shows an alignment of the sequences according to the invention.
  • the cDNA of hErf 1 was amplified using PCR.
  • the EST clone BE336871 served as a template.
  • the following primers were used for amplification:
  • OMI 62 GGGAATTCATGTCTGTGATGGTGGTGAG
  • OMI 63 GGCTCGAGCTACTTCTCAGCTTCAGCTG
  • the amplified cDNA was subcloned and the sequence subsequently verified.
  • the tissue distribution of the hErf 1 was analyzed using the Northern blot technique. A commercially available blot was used for this (OriGene, Cat #: HB-2010). The first 668 bp of the cDNA was used as a probe. The cDNA fragment was radiolabelled. Hybridization took place overnight at 65 ° C. The radioactive signals were recorded using the Cyclone Storage Phosphor System (both from Packard Instrument Company, Dreieich) measured and evaluated with the OptiQuant program. The blot was normalized with ß-actin.
  • the coding region of the cDNA was cloned into a eukaryotic expression vector under the control of the CMV promoter.
  • HEK293 cells were electroporated with the construct and subsequently selected with G418. Cell pools that survived the selection were examined for hErf 1 overexpression.
  • a C-terminal fragment of hErf 2 was amplified using PCR.
  • the following primers were used for amplification:
  • OMI 73 GGGAATTCATGCTGGCCGGGCACGGC h2 asl: GAGCTAACAGGCCTCTTTGCA
  • the C-terminal end was cloned into the EST clone AI702629, which contains the N-terminal part.
  • the entire coding region was then amplified, subcloned using the primers mentioned above, and the sequence was subsequently verified.
  • the tissue distribution of the hErf 2 was analyzed using the Northern blot technique.
  • a commercially available blot was used for this (OriGene, Cat #: HB-2010).
  • the 500 bp fragment, which consists of the EST clone AI702629 with Notl / EcoRI is digested.
  • the cDNA fragment was radiolabelled. Hybridization took place overnight at 65 ° C.
  • the radioactive signals were measured using the Gyclone Storage Phosphor System (both from Packard Instrument Company, Dreieich) and evaluated using the OptiQuant program.
  • the blot was normalized with ß-actin.
  • the coding region of the cDNA was cloned into a eukaryotic expression vector under the control of the CMV promoter.
  • HEK293 cells were electroporated with the construct and subsequently selected with G418. Cell pools that survived the selection were examined for hErf 2 overexpression.
  • the cDNA of hErf 4 was amplified using PCR.
  • the amplified cDNA was subcloned and the sequence subsequently verified.
  • the tissue distribution of hErf 4 was analyzed using the Northern blot technique. A commercially available blot was used for this (OriGene, Cat #: HB-2010). The first 374 bp of the cDNA was used as a probe. The cDNA fragment was radiolabelled. Hybridization took place overnight at 65 ° C. The radioactive signals were measured using the Cyclone Storage Phosphor System (both from Packard Instrument Company, Dreieich) and evaluated using the OptiQuant program. The blot was normalized with ß-actin.
  • the coding region of the cDNA was cloned into a eukaryotic expression vector under the control of the QMV promoter.
  • HEK293 cells were electroporated with the construct and subsequently selected with G418. Cell pools that survived the selection were examined for hErf 4 overexpression.
  • the cDNA of hErf 5 was amplified using PCR.
  • the EST clone AA143152 served as a template.
  • the following primers were used for amplification:
  • OMI 64 GGGAATTCATGGACTTTCTGGTCCTC
  • OMI 65 GGCTCGAGTCATTCTTGTTTCTTCCTC
  • the amplified cDNA was subcloned and the sequence subsequently verified.
  • the tissue distribution of hErf 5 was analyzed using the Northern blot technique. A commercially available blot was used for this (OriGene, Cat #: HB-2010). The last 550 bp of the coding DNA was used as a probe used. This cDNA fragment was radiolabelled. Hybridization took place overnight at 65 ° C. The radioactive signals were measured using the Cyclone Storage Phosphar System (both from Packard Instrument Company, Dreieich) and evaluated using the OptiQuant program. The blot was normalized with ß-actin.
  • the coding region of the cDNA was cloned into a eukaryotic expression vector under the control of the CMV promoter.
  • HEK293 cells were electroporated with the construct and subsequently selected with G418. Cell pools that survived the selection were examined for hErf 5 overexpression.
  • the cDNA of hlcErf 2 was amplified using the PGR.
  • EST clone AA221013 was used as a template.
  • the following primers were used for amplification:
  • OMI 66 GGGAATTCATGCCCGCAGAGTCTGGAAAG
  • OMI 69 GGTCACACCGAAATCTCATAGG
  • the amplified cDNA was subcloned and the sequence subsequently verified.
  • the tissue distribution of hlcErf 2 was analyzed using the Northern blot technique. A commercially available blot was used for this (OriGene, Cat #: HB-2010). The last 402 bp of the coding region was used as a probe. The cDNA fragment was radiolabelled. The hybridization took place overnight at 65 ° C. The radioactive signals were measured using the Cyclone Storage Phosphor System (both from Packard Instrument Company, Dreieich) and evaluated using the OptiQuant program. The blot was normalized with ß-actin.
  • the coding region of the cDNA was cloned into a eukaryotic expression vector under the control of the CMV promoter.
  • HEK293 cells were electroporated with the construct and subsequently cloned with G418. Cell pools that survived the selection were examined for hlcErf 2 overexpression.

Abstract

Palmityl transferases with four cysteine radicals in a catalystically active structure, wherein two cysteine radicals are disposed according to the following pattern: RX1X2HCX3X4C and two other cysteine radicals are disposed according to the following pattern: CX5X6X7X8DHHC, wherein X1 is independently selected from T, S, C, A; X2 is independently selected from K, H, S, W, R; X3 is independently selected from G, T, S, N, V, P, C, A; X4 is independently selected from I, T, S, V, R, K, A, L; X5 is independently selected from V, I; X6 is independently selected from H, L, M, E, A, S, G, R; X7 is independently selected from E, R, K, V, T, Y, M; X8 is independently selected from A, H, F, M, R and the patterns RX1X2HCX3X4C and CX5X6X7X8DHHC are disposed between two transmembrane regions.

Description

Palmityltransferasen Palmityltransferasen
Gegenstand der vorliegenden Erfindung sind Palmityltransferasen, Nukleinsäuren kodierend für die Palmityltransferasen sowie die damit in Verbindung stehenden Inhibitoren, Antikörper, Arznei- und Diagnostikmittel. Palmityltransferasen sind Enzyme, die die Bildung eines Esters oder Amides, insbesondere eines Thio- esters von Palmitinsäure mit Aminosäuren eines Proteins, insbesondere den Aminosäureresten Cystein, Serin, Threonin und Lysin katalysieren.The present invention relates to palmityl transferases, nucleic acids coding for the palmityl transferases and the inhibitors, antibodies, pharmaceuticals and diagnostic agents associated therewith. Palmityltransferases are enzymes which catalyze the formation of an ester or amide, in particular a thioester of palmitic acid with amino acids of a protein, in particular the amino acid residues cysteine, serine, threonine and lysine.
Kovalente Lipidmodifikation verankern zahlreiche Signalproteine auf der cy- toplasmatischen Seite der Plasmamembran. Lipidmodifikationen sind beteiligt an Protein/Membran- und Protein/Protein-Wechselwirkung und sind häufig essentiell für die Funktion. Der Vorgang der Palmitylierung ist häufig reversibel. Die exakte Bedeutung ist nicht im Detail aufgeklärt.Covalent lipid modification anchors numerous signal proteins on the cytoplasmic side of the plasma membrane. Lipid modifications are involved in protein / membrane and protein / protein interaction and are often essential for function. The process of palmitylation is often reversible. The exact meaning has not been elucidated in detail.
Insbesondere sind die exakten Vorgänge der Palmitylierrung nicht bekannt. Palmityltransferasen sind bisher weder homogen aufgereinigt worden, noch in ihrer Struktur analysiert worden. Neben enzymatischen Prozessen scheint es auch nicht-enzymatische, autokatalytische Palmitylierung zu geben.In particular, the exact processes of palmity formation are not known. So far, palmityl transferases have not been homogeneously purified, nor has their structure been analyzed. In addition to enzymatic processes, there also appears to be non-enzymatic, autocatalytic palmitylation.
Die vorliegende Erfindung stellt Palmityltransferasen mit vier Cysteinresten in einer katalytisch aktiven Struktur bereit, wobei zwei Cysteinreste in einem Motiv XιX2HCX3X4C liegen und sich zwei weitere Cysteinreste in einem Motiv CX5X6X7X8DHHC befinden, wobei Xx aus T, S, C, A; X2 aus K, H, S, W, R; X3 aus G, T, S, N, V, P, C, A; X4 aus I, T, S, V, R, K, A, L; X5 aus V, I; X6 aus H, L, M, E, A, S, G, R; X7 aus E, R, K, V, T, Y, M; X8 aus A, H, F, M, R unabhängig .voneinander ausgewählt werden und die Motive RXiX2HCX3X C und CX5X6X7X8DHHC zwischen zwei Transmembranregion liegen. Für die Motive wurde der Einbuchstabencode der Aminosäuren verwendet, d.h. R = Arg, C = Cys, H = His usw.The present invention provides palmityltransferases with four cysteine residues in a catalytically active structure, two cysteine residues in one motif XιX 2 HCX 3 X 4 C and two further cysteine residues in one motif CX 5 X 6 X 7 X 8 DHHC, where X x from T, S, C, A; X 2 from K, H, S, W, R; X 3 from G, T, S, N, V, P, C, A; X 4 from I, T, S, V, R, K, A, L; X 5 from V, I; X 6 from H, L, M, E, A, S, G, R; X 7 from E, R, K, V, T, Y, M; X 8 from A, H, F, M, R are selected independently of one another and the motifs RXiX 2 HCX 3 XC and CX 5 X 6 X 7 X 8 DHHC lie between two transmembrane regions. The single letter code of the amino acids was used for the motifs, ie R = Arg, C = Cys, H = His etc.
In einer bevorzugten Ausführungsform ist X2 eine der Aminosäuren K oder S. In einer weiteren Ausführungsform ist X3 ausgewählt aus G oder S. Bevorzugte Aminosäuren für die X4-Position sind T, I oder V. Für die X6-Position sind insbesondere M, E, A und H bevorzugt, unabhängig davon, für die Position X7 V, R, K und E und für die X8-Position H und F.In a preferred embodiment, X 2 is one of the amino acids K or S. In a further embodiment, X 3 is selected from G or S. Preferred Amino acids for the X 4 position are T, I or V. For the X 6 position, M, E, A and H are particularly preferred, independently of this, for the position X 7 V, R, K and E and for the X 8 -position H and F.
Die beiden Motive RXiX2HCX3X4C und CX5X6X7X8DHHC sind in einer bevorzugten Ausführungsform räumlich benachbart, insbesondere nur durch zwei Aminosäuren Zi und Z2 verbunden. Dabei ist Zi vorzugsweise N oder D und Z2 ausgewählt aus V, IM, R und W.In a preferred embodiment, the two motifs RXiX 2 HCX 3 X 4 C and CX 5 X 6 X 7 X 8 DHHC are spatially adjacent, in particular only connected by two amino acids Zi and Z 2 . Zi is preferably N or D and Z 2 selected from V, IM, R and W.
Solche Palmityltransferasen sind an der Palmitylierung von Proteinen beteiligt. In einer Ausführurigsform der Erfindung stellt die erfindungsgemäße Palmityltrans- ferase die bisher nicht identifizierte Palmityltransferase dar, die an der Prozessierung der kleinen G-Proteine Ha-Ras und/oder N-Ras beteiligt sind.Such palmityl transferases are involved in the palmitylation of proteins. In one embodiment of the invention, the palmityl transferase according to the invention represents the previously unidentified palmityl transferase, which are involved in the processing of the small G proteins Ha-Ras and / or N-Ras.
Ein Überblick über die Rolle der Palmitylierung durch Palmityltransferasen geben J.T. Dunphy and M.E. Lauder in Biochemica et Biophysica Acta 1436 (1998), 245-261, auf das ausdrücklich Bezug genommen wird.An overview of the role of palmitylation by palmityl transferases is given by J.T. Dunphy and M.E. Lauder in Biochemica et Biophysica Acta 1436 (1998), 245-261, to which express reference is made.
Insbesondere handelt es sich bei den Palmityltransferasen um Palmityltransferasen von Säugetieren, insbesondere von Menschen.In particular, the palmityl transferases are palmityl transferases from mammals, in particular from humans.
Die erfindungsgemäßen Palmityltransferasen weisen bevorzugt katalytisch aktive Cysteinreste in einer Region auf, die zwischen zwei Transmembranbereichen auf der zytoplasmatischen Seite liegt. Transmembranbereiche lassen sich bei Kenntnis der Sequenz eines Proteins aufgrund verschiedener Modelle vorhersagen. Sie sind dadurch gekennzeichnet, dass in einem Bereich überwiegend hydrophobe Aminosäuren liegen, die von Bereichen flankiert werden, in denen eher hydrophile Aminosäuren liegen.The palmityl transferases according to the invention preferably have catalytically active cysteine residues in a region which lies between two transmembrane regions on the cytoplasmic side. Transmembrane regions can be predicted based on various models if the sequence of a protein is known. They are characterized in that in one area there are predominantly hydrophobic amino acids which are flanked by areas in which there are more hydrophilic amino acids.
Besonders bevorzugte Palmityltransferasen der vorliegenden Erfindung werden als hErf 1, hErf 2, hErf 4, hErf 5 und hlcErf2 bezeichnet (hErf 1: SEQ ID No. 1, hErf 2: SEQ ID No. 2, hErf 4: SEQ ID No. 3, hErf 5: SEQ ID No. 4 und hlcErf2: SEQ ID No. 5). Weiterhin sind Varianten der erfindungsgemäßen Palmityltransferasen Gegenstand der Erfindung. Varianten sind Proteine, die durch einen oder mehrere Mutationen, Insertionen und Deletionen, insbesondere durch konservative Austausche, von den erfindungsgemäßen Palmityltransferasen abgeleitet sind, insbesondere , N- oder C-Terminal verkürzte oder verlängerte Formen. Diese erfindungsgemäßen Varianten weisen bevorzugt weniger als 20% Mutationen, Insertionen und Deletionen auf, noch mehr bevorzugt weniger als 10%.Particularly preferred palmityl transferases of the present invention are referred to as hErf 1, hErf 2, hErf 4, hErf 5 and hlcErf2 (hErf 1: SEQ ID No. 1, hErf 2: SEQ ID No. 2, hErf 4: SEQ ID No. 3, hErf 5: SEQ ID No. 4 and hlcErf2: SEQ ID No. 5). Furthermore, variants of the palmityl transferases according to the invention are the subject of the invention. Variants are proteins which are derived from the palmityl transferases according to the invention by one or more mutations, insertions and deletions, in particular by conservative exchanges, in particular, N- or C-terminal shortened or extended forms. These variants according to the invention preferably have less than 20% mutations, insertions and deletions, even more preferably less than 10%.
Auch Nukleinsäuren, die für die erfindungsgemäßen Palmityltransferasen kodieren, sind Gegenstand der Erfindung. Bevorzugte erfindungsgemäße Nukleinsäuren sind solche mit der SEQ ID No. 6 - 10 (herf 1: SEQ ID No. 6, herf 2: SEQ ID No. 7, herf 4: SEQ ID No. 8, herf 5: SEQ ID No. 9 und hlcerf2: SEQ ID No. 10). Auch komplementäre Nukleinsäuren sind Bestandteil der Erfindung.The invention also relates to nucleic acids which code for the palmityl transferases according to the invention. Preferred nucleic acids according to the invention are those with SEQ ID No. 6 - 10 (herf 1: SEQ ID No. 6, herf 2: SEQ ID No. 7, herf 4: SEQ ID No. 8, herf 5: SEQ ID No. 9 and hlcerf2: SEQ ID No. 10). Complementary nucleic acids are also part of the invention.
Die erfindungsgemäßen Palmityltransferasen sind an der Palmitylierung von Ha- und/oder N-Ras beteiligt. Die Palmitylierung von Ras ist notwendig für das Targeting von Ras -zur Plasmamembran. Die Verankerung von Ras in der Plasmamembran ist Vorraussetzung für die Transformation einer Zelle durch Ras, also die Entstehung von Krebs. Ras Protein, dass nicht palmityliert ist, besitzt nur ca. 10% seiner transformierenden Aktivität. Die Palmityltransferase, die Ras palmityliert, ist somit indirekt an der Entstehung von Krebs beteiligt. Daher sind auch Inhibitoren, die die Expression oder die Aktivität der Palmityltransferasen hemmen, Gegenstand der Erfindung. Solche Inhibitoren können in einfachen Verfahren identifiziert werden. Entsprechende Inhibitoren können beispielsweise durch Messung der Expression oder der Aktivität der Palmityltransferasen in Gegenwart von potentiellen Inhibitoren identifiziert werden. Geeignete Inhibitoren sind z.B. Antikörper oder Antikörperfragmente (Hemmung der Aktivität) oder Antisensenukleinsäuren mit 12 bis 30 Nukleotiden (Hemmung der Expression). Insbesondere zur Messung der Expression eignen sich gegen die Palmityltransferasen gerichtete Antikörper, die somit ebenfalls Bestandteil der Erfindung sind.The palmityl transferases according to the invention are involved in the palmitylation of Ha- and / or N-Ras. Ras palmitylation is necessary for targeting Ras to the plasma membrane. Anchoring Ras in the plasma membrane is a prerequisite for the transformation of a cell by Ras, that is, the development of cancer. Ras protein that is not palmitylated has only about 10% of its transforming activity. The palmityltransferase that Ras palmitylates is indirectly involved in the development of cancer. The invention therefore also relates to inhibitors which inhibit the expression or the activity of the palmityl transferases. Such inhibitors can be identified in simple procedures. Corresponding inhibitors can be identified, for example, by measuring the expression or the activity of the palmityl transferases in the presence of potential inhibitors. Suitable inhibitors are, for example, antibodies or antibody fragments (inhibition of activity) or antisense nucleic acids with 12 to 30 nucleotides (inhibition of expression). Antibodies directed against the palmityl transferases are particularly suitable for measuring expression, and are therefore also part of the invention.
Die erfindungsgemäßen Palmityltransferasen sind auch an der Palmitylierung anderer Proteine beteiligt, insbesondere der α Untereinheit verschiedener G- Proteine und Nicht-Rezeptor Tyrosin Kinasen wie p60 src oder p59 fyn und verwandter Proteine, die in der Signaltransduktion eine Rolle spielen.The palmityl transferases according to the invention are also involved in the palmitylation of other proteins, in particular the α subunit of various G proteins and non-receptor tyrosine kinases such as p60 src or p59 fyn and related proteins which play a role in signal transduction.
Die Palmitylierung von Proteinen ist auch an anderen wichtigen Prozessen beteiligt, z.B. :Protein palmitylation is also involved in other important processes, e.g. :
• Targeting von Proteinen die an der Signaltransduktion beteiligt sind in spezialisierte Bereiche der Plasmamembran, die eine charakteristische Lipid Zusammensetzung besitzen.• Targeting of proteins involved in signal transduction in specialized areas of the plasma membrane that have a characteristic lipid composition.
• Clustering von Proteinen (z.B. Ionenkanälen) an den Nervenendigungen zur schnellen und gezielten Übertragung von Signalen.• Clustering of proteins (e.g. ion channels) at the nerve endings for fast and targeted transmission of signals.
• Regulation von Protein-Protein Interaktionen, zum Beispiel der Affinität von Gsα für die ßγ Untereinheit.• Regulation of protein-protein interactions, for example the affinity of G s α for the ßγ subunit.
Durch Einsatz der erfindungsgemäßen Palmityltransferase bzw. deren Inhibitoren lassen sich die genannten Prozesse therapeutisch beeinflussen.The processes mentioned can be influenced therapeutically by using the palmityl transferase according to the invention or their inhibitors.
Zur Charakterisierung der erfindungsgemäßen Palmityltransferasen bzw. zur Identifizierung von geeigneten Inhibitoren eignen sich die Palmityltransferasen überexprimierende Zellinien oder Bakterien. Entsprechende Zellinien oder Bakterien zur Expression einer Palmityltransferase sind daher ebenfalls Gegenstand der Erfindung.Cell lines or bacteria overexpressing the palmityl transferases are suitable for characterizing the palmityl transferases according to the invention or for identifying suitable inhibitors. Corresponding cell lines or bacteria for the expression of a palmityl transferase are therefore also the subject of the invention.
Die erfindungsgemäßen Palmityltransferasen, Nukleinsäuren, Inhibitoren und Antikörper können in Arznei- und Diagnostikmitteln enthalten sein. Sie eignen sich insbesondere zur Behandlung oder Diagnose von Krebs, der auf die Entar- tung von Ras zurückzuführen ist, insbesondere von Bauchspeicheldrüsen-, Dickdarm-, Lungen-Krebs und Leukämie.The palmityl transferases, nucleic acids, inhibitors and antibodies according to the invention can be contained in medicinal and diagnostic agents. They are particularly suitable for the treatment or diagnosis of cancer that affects the Ras, especially pancreatic, colon, lung and leukemia.
Die Erfindung wird durch die folgenden Beispiele näher erläutert.The invention is illustrated by the following examples.
Figur 1 zeigt die Gewebeverteilung in humanem Gewebe (Nothern Blot).Figure 1 shows the tissue distribution in human tissue (Northern blot).
Figur 2 zeigt ein Alignment der erfindungsgemäßen Sequenzen.FIG. 2 shows an alignment of the sequences according to the invention.
Experimentelle ProtokolleExperimental protocols
hErf lheF l
Klonierung der kodierenden Region der cDNA:Cloning the coding region of the cDNA:
Die cDNA der hErf 1 wurde mit Hilfe der PCR amplifiziert. Als Template diente der EST Klon BE336871. Zur Amplifikation wurden folgende Primer verwendet:The cDNA of hErf 1 was amplified using PCR. The EST clone BE336871 served as a template. The following primers were used for amplification:
OMI 62 : GGGAATTCATGTCTGTGATGGTGGTGAG OMI 63 : GGCTCGAGCTACTTCTCAGCTTCAGCTGOMI 62: GGGAATTCATGTCTGTGATGGTGGTGAG OMI 63: GGCTCGAGCTACTTCTCAGCTTCAGCTG
Die amplifizierte cDNA wurde subkloniert und nachfolgend die Sequenz verifiziert.The amplified cDNA was subcloned and the sequence subsequently verified.
Gewebeverteilung :Tissue distribution:
Die Gewebeverteilung der hErf 1 wurde mit Hilfe der Northern Blot Technik analysiert. Hierzu wurde ein käuflich erworbener Blot verwendet (OriGene, Cat#: HB-2010). Als Sonde wurden die ersten 668 bp der cDNA verwendet. Das cDNA Fragment wurde radioaktiv markiert. Die Hybridisierung fand über Nacht bei 65°C statt. Die radioaktiven Signale wurden mit Hilfe des Cyclone Storage Phosphor System (beides von Packard Instrument Company, Dreieich) gemessen und mit dem Programm OptiQuant ausgewertet. Der Blot wurde mit ß-actin normalisiert.The tissue distribution of the hErf 1 was analyzed using the Northern blot technique. A commercially available blot was used for this (OriGene, Cat #: HB-2010). The first 668 bp of the cDNA was used as a probe. The cDNA fragment was radiolabelled. Hybridization took place overnight at 65 ° C. The radioactive signals were recorded using the Cyclone Storage Phosphor System (both from Packard Instrument Company, Dreieich) measured and evaluated with the OptiQuant program. The blot was normalized with ß-actin.
hErf 1 stabil überexprimierende Zellpools:hErf 1 stably overexpressing cell pools:
Die kodierende Region der cDNA wurde unter der Kontrolle des CMV Promotors in einen eukaryontischen Expressionsvektor kloniert. HEK293 Zellen wurden mit dem Konstrukt elektroporiert und nachfolgend mit G418 selektioniert. Zellpools, die die Selektion überlebten wurden auf hErf 1 Überexpression untersucht.The coding region of the cDNA was cloned into a eukaryotic expression vector under the control of the CMV promoter. HEK293 cells were electroporated with the construct and subsequently selected with G418. Cell pools that survived the selection were examined for hErf 1 overexpression.
hErf 2:heF 2:
Klonierung der kodierenden Region der cDNA:Cloning the coding region of the cDNA:
Ein C-terminales Fragment von hErf 2 wurde mit Hilfe der PCR amplifiziert. Als Template diente eine Mischung aus cDNAs, die aus etwa 30 verschiedenen Zelllinien gewonnen wurde (Array-Mix). Zur Amplifikation wurden folgende Primer verwendet:A C-terminal fragment of hErf 2 was amplified using PCR. A mixture of cDNAs, which was obtained from about 30 different cell lines (array mix), served as template. The following primers were used for amplification:
OMI 73 : GGGAATTCATGCTGGCCGGGCACGGC h2 asl: GAGCTAACAGGCCTCTTTGCAOMI 73: GGGAATTCATGCTGGCCGGGCACGGC h2 asl: GAGCTAACAGGCCTCTTTGCA
Um die vollständige cDNA zu erhalten wurde das C-terminale Ende in den EST klon AI702629, der den N-terminalen Teil enthält, kloniert. Anschließend wurde die gesamte kodierende Region mit den oben genannten Primern amplifiziert subkloniert und nachfolgend die Sequenz verifiziert.In order to obtain the complete cDNA, the C-terminal end was cloned into the EST clone AI702629, which contains the N-terminal part. The entire coding region was then amplified, subcloned using the primers mentioned above, and the sequence was subsequently verified.
Gewebeverteilung :Tissue distribution:
Die Gewebeverteilung der hErf 2 wurde mit Hilfe der Northern Blot Technik analysiert. Hierzu wurde ein käuflich erworbener Blot verwendet (OriGene, Cat#: HB-2010). Als Sonde wurde das 500bp Fragment verwendet, das aus dem Verdau des EST Klones AI702629 mit Notl/EcoRI entsteht. Das cDNA Fragment wurde radioaktiv markiert. Die Hybridisierung fand über Nacht bei 65°C statt. Die radioaktiven Signalen wurden mit Hilfe des Gyclone Storage Phosphor System (beides von Packard Instrument Company, Dreieich) gemessen und mit dem Programm OptiQuant ausgewertet. Der Blot wurde mit ß- actin normalisiert.The tissue distribution of the hErf 2 was analyzed using the Northern blot technique. A commercially available blot was used for this (OriGene, Cat #: HB-2010). The 500 bp fragment, which consists of the EST clone AI702629 with Notl / EcoRI is digested. The cDNA fragment was radiolabelled. Hybridization took place overnight at 65 ° C. The radioactive signals were measured using the Gyclone Storage Phosphor System (both from Packard Instrument Company, Dreieich) and evaluated using the OptiQuant program. The blot was normalized with ß-actin.
hErf 2 stabil überexprimierende Zellpools:hErf 2 stably overexpressing cell pools:
Die kodierende Region der cDNA wurde unter der Kontrolle des CMV Promotors in einen eukaryontischen Expressionsvektor kloniert. HEK293 Zellen wurden mit dem Konstrukt elektroporiert und nachfolgend mit G418 selektioniert. Zellpools, die die Selektion überlebten wurden auf hErf 2 Überexpression untersucht.The coding region of the cDNA was cloned into a eukaryotic expression vector under the control of the CMV promoter. HEK293 cells were electroporated with the construct and subsequently selected with G418. Cell pools that survived the selection were examined for hErf 2 overexpression.
hErf4:hErf4:
Klonierung der kodierenden Region der cDNA:Cloning the coding region of the cDNA:
Die cDNA der hErf 4 wurde mit Hilfe der PCR amplifiziert. Als Template diente eine Mischung aus cDNAs, die aus etwa 30 verschiedenen Zelllinien gewonnen wurde (Array-Mix).The cDNA of hErf 4 was amplified using PCR. A mixture of cDNAs, which was obtained from about 30 different cell lines (array mix), served as template.
h.4 atg sl : egg gag ggt gaa aeg ttt c h4 e asl : cat ctt ato eta tga agc atah.4 atg sl: egg gag ggt gaa aeg ttt c h4 e asl: cat ctt ato eta tga agc ata
Die amplifizierte cDNA wurde subkloniert und nachfolgend die Sequenz verifiziert.The amplified cDNA was subcloned and the sequence subsequently verified.
Gewebeverteilung :Tissue distribution:
Die Gewebeverteilung der hErf 4 wurde mit Hilfe der Northern Blot Technik analysiert. Hierzu wurde ein käuflich erworbener Blot verwendet (OriGene, Cat#: HB-2010). Als Sonde wurden die ersten 374 bp der cDNA verwendet. Das cDNA Fragment wurde radioaktiv markiert. Die Hybridisierung fand über Nacht bei 65°C statt. Die radioaktiven Signale wurden mit Hilfe des Cyclone Storage Phosphor System (beides von Packard Instrument Company, Dreieich) gemessen und mit dem Programm OptiQuant ausgewertet. Der Blot wurde mit ß-actin normalisiert.The tissue distribution of hErf 4 was analyzed using the Northern blot technique. A commercially available blot was used for this (OriGene, Cat #: HB-2010). The first 374 bp of the cDNA was used as a probe. The cDNA fragment was radiolabelled. Hybridization took place overnight at 65 ° C. The radioactive signals were measured using the Cyclone Storage Phosphor System (both from Packard Instrument Company, Dreieich) and evaluated using the OptiQuant program. The blot was normalized with ß-actin.
hErf 4 stabil überexprimierende Zellpools:hErf 4 stably overexpressing cell pools:
Die kodierende Region der cDNA wurde unter der Kontrolle des QMV Promotors in einen eukaryontischen Expressionsvektor kloniert. HEK293 Zellen wurden mit dem Konstrukt elektroporiert und nachfolgend mit G418 selektioniert. Zellpools, die die Selektion überlebten wurden auf hErf 4 Überexpression untersucht.The coding region of the cDNA was cloned into a eukaryotic expression vector under the control of the QMV promoter. HEK293 cells were electroporated with the construct and subsequently selected with G418. Cell pools that survived the selection were examined for hErf 4 overexpression.
hErf 5:heF 5:
Klonierung der kodierenden Region der cDNA:Cloning the coding region of the cDNA:
Die cDNA der hErf 5 wurde mit Hilfe der PCR amplifiziert. Als Template diente der EST Klon AA143152. Zur Amplifikation wurden folgende Primer verwendet:The cDNA of hErf 5 was amplified using PCR. The EST clone AA143152 served as a template. The following primers were used for amplification:
OMI 64: GGGAATTCATGGACTTTCTGGTCCTC OMI 65: GGCTCGAGTCATTCTTGTTTCTTCCTCOMI 64: GGGAATTCATGGACTTTCTGGTCCTC OMI 65: GGCTCGAGTCATTCTTGTTTCTTCCTC
Die amplifizierte cDNA wurde subkloniert und nachfolgend die Sequenz verifiziert.The amplified cDNA was subcloned and the sequence subsequently verified.
Gewebeverteilung :Tissue distribution:
Die Gewebeverteilung der hErf 5 wurde mit Hilfe der Northern Blot Technik analysiert. Hierzu wurde ein käuflich erworbener Blot verwendet (OriGene, Cat#: HB-2010). Als Sonde wurde die letzten 550 bp der kodierenden DNA verwendet. Dieses cDNA Fragment wurde radioaktiv markiert. Die Hybridisierung fand über Nacht bei 65°C statt. Die radioaktiven Signale wurden mit Hilfe des Cyclone Storage Phosphar System (beides von Packard Instrument Company, Dreieich) gemessen und mit dem Programm OptiQuant ausgewertet. Der Blot wurde mit ß-actin normalisiert.The tissue distribution of hErf 5 was analyzed using the Northern blot technique. A commercially available blot was used for this (OriGene, Cat #: HB-2010). The last 550 bp of the coding DNA was used as a probe used. This cDNA fragment was radiolabelled. Hybridization took place overnight at 65 ° C. The radioactive signals were measured using the Cyclone Storage Phosphar System (both from Packard Instrument Company, Dreieich) and evaluated using the OptiQuant program. The blot was normalized with ß-actin.
\ hErf 5 stabil überexprimierende Zellpools:\ hErf 5 stable overexpressing cell pools:
Die kodierende Region der cDNA wurde unter der Kontrolle des CMV Promotors in einen eukaryontischen Expressionsvektor kloniert. HEK293 Zellen wurden mit dem Konstrukt elektroporiert und nachfolgend mit G418 selektioniert. Zellpools, die die Selektion überlebten wurden auf hErf 5 Überexpression untersucht.The coding region of the cDNA was cloned into a eukaryotic expression vector under the control of the CMV promoter. HEK293 cells were electroporated with the construct and subsequently selected with G418. Cell pools that survived the selection were examined for hErf 5 overexpression.
hlcErf2:hlcErf2:
Klonierung der kodierenden Region der cDNA:Cloning the coding region of the cDNA:
Die cDNA der hlcErf 2 wurde mit Hilfe der PGR amplifiziert. Als Template diente der EST klon AA221013. Zur Amplifikation wurden folgende Primer verwendet:The cDNA of hlcErf 2 was amplified using the PGR. EST clone AA221013 was used as a template. The following primers were used for amplification:
OMI 66: GGGAATTCATGCCCGCAGAGTCTGGAAAG OMI 69: GGTCACACCGAAATCTCATAGGOMI 66: GGGAATTCATGCCCGCAGAGTCTGGAAAG OMI 69: GGTCACACCGAAATCTCATAGG
Die amplifizierte cDNA wurde subkloniert und nachfolgend die Sequenz verifiziert.The amplified cDNA was subcloned and the sequence subsequently verified.
Gewebeverteilung :Tissue distribution:
Die Gewebeverteilung der hlcErf 2 wurde mit Hilfe der Northern Blot Technik analysiert. Hierzu wurde ein käuflich erworbener Blot verwendet (OriGene, Cat#: HB-2010). Als Sonde wurde die letzten 402 bp der kodierenden Region verwendet. Das cDNA Fragment wurde radioaktiv markiert. Die Hybridisierung fand über Nacht bei 65°C statt. Die radioaktiven Signale wurden mit Hilfe des Cyclone Storage Phosphor System (beides von Packard Instrument Company, Dreieich) gemessen und mit dem Programm OptiQuant ausgewertet. Der Blot wurde mit ß-actin normalisiert.The tissue distribution of hlcErf 2 was analyzed using the Northern blot technique. A commercially available blot was used for this (OriGene, Cat #: HB-2010). The last 402 bp of the coding region was used as a probe. The cDNA fragment was radiolabelled. The hybridization took place overnight at 65 ° C. The radioactive signals were measured using the Cyclone Storage Phosphor System (both from Packard Instrument Company, Dreieich) and evaluated using the OptiQuant program. The blot was normalized with ß-actin.
hlcErf 2 stabil »überexprimierende Zellpools:hlcErf 2 stable »overexpressing cell pools:
Die kodierenden Region der cDNA wurde unter Kontrolle des CMV Promotors in einen eukaryontischen Expressionsvektor kloniert. HEK293 Zellen wurden mit dem Konstrukt elektroporiert und nachfolgend mit G418 kloniert. Zellpools, die die Selektion überlebten wurden auf hlcErf 2 Überexpression untersucht. The coding region of the cDNA was cloned into a eukaryotic expression vector under the control of the CMV promoter. HEK293 cells were electroporated with the construct and subsequently cloned with G418. Cell pools that survived the selection were examined for hlcErf 2 overexpression.

Claims

Patentansprüche claims
1. Palmityltransferasen mit vier Cysteinresten in einer katalytisch aktiven Struktur, wobei zwei Cysteinreste in einem Motiv RXιX2HCX3X4C liegen und sich zwei weitere Cysteinreste in einem Motiv CX5X6X X8DHHC befinden, wobei Xi aus T, S, C, A; X2 aus K, H, S, W, R; X3 aus G, T, S, N, V, P, C, A; X4 aus I, T, s/v, R, K, A, L; X5 aus V, I; X6 aus H, L, M, E, A, S, G, R; X7 aus E, R, K, V, T, Y, M; X8 aus A, H, F, M, R unabhängig voneinander ausgewählt werden und die Motive RX!X2HCX3X4C und CXsXeXrXsDHHC zwischen zwei Transmembranregion liegen.1. Palmityl transferases with four cysteine residues in a catalytically active structure, two cysteine residues in one motif RXιX 2 HCX 3 X 4 C and two further cysteine residues in one motif CX 5 X 6 XX 8 DHHC, where Xi from T, S, C, A; X 2 from K, H, S, W, R; X 3 from G, T, S, N, V, P, C, A; X 4 from I, T, s / v, R, K, A, L; X 5 from V, I; X 6 from H, L, M, E, A, S, G, R; X 7 from E, R, K, V, T, Y, M; X 8 from A, H, F, M, R can be selected independently and the motifs RX ! X 2 HCX 3 X 4 C and CXsXeXrXsDHHC lie between two transmembrane regions.
2. Palmityltransferasen nach Anspruch 1, wobei Xx aus T, S, C, A; X2 aus K, S; X3 aus G, S; X4 aus 1, T, V; X5 aus V, I; X6 aus H, M, E, A; X7 aus E, R, K, V; X8 aus H, F unabhängig voneinander ausgewählt werden und die Motive RXiX2HCX3X4C und CXsXeXyXsDHHC mit zwei Resten ZχZ2 verbunden sind, wobei Zi aus N, D und Z2 aus V, N, R, W unabhängig voneinander ausgewählt sind.2. palmityl transferases according to claim 1, wherein X x from T, S, C, A; X 2 from K, S; X 3 from G, S; X 4 from 1, T, V; X 5 from V, I; X 6 from H, M, E, A; X 7 from E, R, K, V; X 8 from H, F are selected independently of one another and the motifs RXiX 2 HCX 3 X 4 C and CXsXeXyXsDHHC are connected with two residues ZχZ 2 , Zi being selected from N, D and Z 2 from V, N, R, W independently of one another are.
3. Palmityltransferase nach Anspruch 1 oder 2, dadurch gekennzeichnet, dass die Palmityltransferase eine der Sequenzen SEQ ID No. 1 - 5 aufweist.3. Palmityltransferase according to claim 1 or 2, characterized in that the palmityltransferase is one of the sequences SEQ ID No. 1-5.
4. Nukleinsäuren kodierend für eine Palmityltransferase nach mindestens einem der Ansprüche 1 bis 3, bevorzugt mit der SEQ ID No. 6 - 10.4. Nucleic acids coding for a palmityl transferase according to at least one of claims 1 to 3, preferably with SEQ ID No. 6-10.
5. Inhibitoren, dadurch gekennzeichnet, dass sie die Expression oder Aktivität der Palmityltransferase nach mindestens einem der Ansprüche 1 bis 3 hemmen.5. Inhibitors, characterized in that they inhibit the expression or activity of the palmityl transferase according to at least one of claims 1 to 3.
6. Antikörper, gerichtet gegen Palmityltransferasen nach mindestens einem der Ansprüche 1 bis 3. 6. Antibody directed against palmityl transferases according to at least one of claims 1 to 3.
7. Verfahren zur Identifizierung von Inhibitoren, dadurch gekennzeichnet, dass die Aktivität der Palmityltransferasen nach mindestens einem der Ansprüche 1 bis 3 in Gegenwart von potentiellen Inhibitoren gemessen wird.7. A method for identifying inhibitors, characterized in that the activity of the palmityl transferases is measured according to at least one of claims 1 to 3 in the presence of potential inhibitors.
8. Arzneimittel oder Diagnostikmittel enthaltend eine Palmityltransferase nach mindestens einem der Ansprüche 1 bis 3, eine Nukleinsäure nach Anspruch 4, einen Inhibitor nach Anspruch 5 und/oder einen Antikörper nach Anspruch 6.8. Medicament or diagnostic agent containing a palmityl transferase according to at least one of claims 1 to 3, a nucleic acid according to claim 4, an inhibitor according to claim 5 and / or an antibody according to claim 6.
9. Verwendung des Arzneimittels oder Diagnostikmittels nach Anspruch 8 zur Diagnose oder Behandlung von Erkrankungen, die mit der Palmitylierung eines Proteins, insbesondere von Ras ursächlich verbunden sind, insbesondere Krebs.9. Use of the medicament or diagnostic agent according to claim 8 for the diagnosis or treatment of diseases which are causally linked to the palmitylation of a protein, in particular ras, in particular cancer.
10. Verwendung des Arzneimittels oder Diagnostikmittels nach Anspruch 8 zur Diagnose oder Behandlung von Erkrankungen, die mit einem gestörten Targeting von Proteinen in spezialisierte Bereiche der Plasmamembran die eine charakteristische Lipid Zusammensetzung besitzen verbunden sind.10. Use of the medicament or diagnostic agent according to claim 8 for the diagnosis or treatment of diseases which are associated with a disturbed targeting of proteins in specialized areas of the plasma membrane which have a characteristic lipid composition.
11. Verwendung des Arzneimittels nach Anspruch 8 zur Diagnose oder Behandlung von Erkrankungen, die ursächlich mit dem Clustering von Proteinen an den Nervenendigungen zur schnellen und gezielten Übertragung von Signalen verbunden sind.11. Use of the medicament according to claim 8 for the diagnosis or treatment of diseases which are causally associated with the clustering of proteins at the nerve endings for the rapid and targeted transmission of signals.
12. Verwendung des Arzneimittels oder Diagnostikmittels nach Anspruch 8 zur Beeinflussung der Regulation von Protein-Protein Interaktionen zum Beispiel der Affinität von Gsα für die ßγ Untereinheit.12. Use of the drug or diagnostic agent according to claim 8 for influencing the regulation of protein-protein interactions, for example the affinity of G s α for the ßγ subunit.
13. Zellinien oder Bakterien zur Expression einer Palmityltransferase nach mindestens einem der Ansprüche 1 bis 3. 13. Cell lines or bacteria for expressing a palmityl transferase according to at least one of claims 1 to 3.
PCT/EP2002/002424 2001-03-07 2002-03-06 Palmityl transferases WO2002070677A2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2002256648A AU2002256648A1 (en) 2001-03-07 2002-03-06 Palmityl transferases

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE10110761.7 2001-03-07
DE10110761 2001-03-07

Publications (2)

Publication Number Publication Date
WO2002070677A2 true WO2002070677A2 (en) 2002-09-12
WO2002070677A3 WO2002070677A3 (en) 2003-09-12

Family

ID=7676486

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2002/002424 WO2002070677A2 (en) 2001-03-07 2002-03-06 Palmityl transferases

Country Status (2)

Country Link
AU (1) AU2002256648A1 (en)
WO (1) WO2002070677A2 (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000008155A2 (en) * 1998-08-07 2000-02-17 Incyte Pharmaceuticals, Inc. Human receptor-associated proteins
WO2000053756A2 (en) * 1999-03-08 2000-09-14 Genentech, Inc. Secreted and transmembrane polypeptides and nucleic acids encoding the same
EP1074617A2 (en) * 1999-07-29 2001-02-07 Helix Research Institute Primers for synthesising full-length cDNA and their use

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000008155A2 (en) * 1998-08-07 2000-02-17 Incyte Pharmaceuticals, Inc. Human receptor-associated proteins
WO2000053756A2 (en) * 1999-03-08 2000-09-14 Genentech, Inc. Secreted and transmembrane polypeptides and nucleic acids encoding the same
EP1074617A2 (en) * 1999-07-29 2001-02-07 Helix Research Institute Primers for synthesising full-length cDNA and their use

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
LIU LI ET AL: "Purification of a protein palmitoyltransferase that acts on H-ras protein and on a C-terminal N-ras peptide." JOURNAL OF BIOLOGICAL CHEMISTRY, Bd. 271, Nr. 38, 1996, Seiten 23269-23276, XP002222888 ISSN: 0021-9258 *

Also Published As

Publication number Publication date
WO2002070677A3 (en) 2003-09-12
AU2002256648A1 (en) 2002-09-19

Similar Documents

Publication Publication Date Title
DE60021497T2 (en) Human cyclic nucleotide-specific phosphodiesterase
DE69918123T2 (en) METHOD AND REAGENT SET FOR DETECTING PROTEIN PROTEIN INTERACTIONS
DE69932153T2 (en) PHOSPHODIESTERASE 10
DE69334146T2 (en) PEPTIDES WITH GDP-EXCHANGE FACTORY ACTIVITY, NUCLEIC ACID SEQUENCES THAT ARE CODED FOR, THEIR PREPARATION AND USE
DE69434492T2 (en) PHOSPHODIESTERASE OF THE HUMAN BRAIN
EP0955369B1 (en) High active alkaline phosphatase
EP0936270A2 (en) Serin protease from prostate
WO1999007855A1 (en) Neutral sphingomyelinase
WO2002070677A2 (en) Palmityl transferases
EP0902092A2 (en) Method for the identification of target genes for transcription factors
EP0942995A1 (en) Novel calpaines, production and use thereof
DE69838565T2 (en) Nucleic acids of CIITA genes
DE60117788T2 (en) HUMAN WINGLESS-SIMILAR GENES
DE69333154T2 (en) GENE CODING THE PROSTAGLAND RECEPTOR, THEREFORE TRANSFORMED CELL AND ITS EXPRESSION PRODUCT
DE69731682T2 (en) TAB1 protein and DNA coding for it
DE60122301T2 (en) KALIUM CHANNEL PROTEIN KCNQ5, A GOAL FOR DISEASES OF THE CENTRAL NERVOUS SYSTEM AND HEART TUBE SYSTEM
DE60123754T2 (en) NEW TRANSCRIPTION FACTOR CARP-2
WO1999010480A2 (en) New tissue-specific calpaines, their production and their use
EP1348760B1 (en) Production of inactive mutants or mutants with a low activity of an alkaline phosphatase and their expression in yeast
DE60038025T2 (en) HIGH AFFINITY-choline
WO1997035015A2 (en) Tyrosine-phosphatase-related protein
DE102004063265B4 (en) Method for determining the function of nucleic acid sequences and the expression products encoded thereby
DE10222845A1 (en) Cloning, expression and characterization of the overall sequence of phosphodiesterase 8B
DE19815128A1 (en) Transgenic animal model for human cardio-myopathy
DE69033766T3 (en) ENDO-F-FREE-PNgase

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SD SE SG SI SK SL TJ TM TN TR TT TZ UA UG US UZ VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP