WO2002068684A2 - Méthode d'extension d'amorce spécifique d'allèle - Google Patents

Méthode d'extension d'amorce spécifique d'allèle Download PDF

Info

Publication number
WO2002068684A2
WO2002068684A2 PCT/GB2002/000794 GB0200794W WO02068684A2 WO 2002068684 A2 WO2002068684 A2 WO 2002068684A2 GB 0200794 W GB0200794 W GB 0200794W WO 02068684 A2 WO02068684 A2 WO 02068684A2
Authority
WO
WIPO (PCT)
Prior art keywords
base
primer
extension
specific
primers
Prior art date
Application number
PCT/GB2002/000794
Other languages
English (en)
Other versions
WO2002068684A8 (fr
WO2002068684A3 (fr
Inventor
Joakim Lundeberg
Afshin Ahmadian
Pål NYRÉN
Original Assignee
Pyrosequencing Ab
Dzieglewska, Hanna
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from GB0104560A external-priority patent/GB0104560D0/en
Priority claimed from US09/791,190 external-priority patent/US20030104372A1/en
Application filed by Pyrosequencing Ab, Dzieglewska, Hanna filed Critical Pyrosequencing Ab
Priority to AU2002233540A priority Critical patent/AU2002233540A1/en
Publication of WO2002068684A2 publication Critical patent/WO2002068684A2/fr
Publication of WO2002068684A8 publication Critical patent/WO2002068684A8/fr
Publication of WO2002068684A3 publication Critical patent/WO2002068684A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
    • C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6858—Allele-specific amplification

Definitions

  • the present invention relates to an improved assay for detecting mutations and genetic variations based upon the use of allele-specific primers.
  • SNPs single nucleotide polymorphisms
  • This method exploits the difference in primer extension efficiency by a DNA polymerase of a matched over a mismatched primer 3' -end.
  • a sample is divided into two extension reaction mixtures that contain the same reagents except for the primers, which differ at the 3 '-end.
  • the alternating primer is designed to match one allele perfectly but mismatch the other allele at the 3 '-end. Because the polymerase differs in extension efficiency for matched versus mismatched 3 '-ends, the allele-specific extension reaction thus provides information on the presence or absence of one allele.
  • the present invention solves the deficiencies of the prior art by providing a method of allele-specific extension that allows accurate discrimination between matched and mismatched configurations.
  • the present methods are useful for high throughput SNP analysis.
  • the present invention provides methods of allele- specific primer extension useful for detecting mutations and genomic variations.
  • a nucleotide degrading enzyme preferably apyrase
  • nucleotides are degraded before extension in reactions having slow kinetics due to mismatches, but not in reactions having fast kinetics due to matches of primer and allelic target.
  • the primers for the allele- specific primer extension reactions are designed such that the 3 ' -end base is complementary to the target, the penultimate (3'-l end) base is allele-specific, and the base two positions from the 3 '-end (3 ' -2 end) is non- complementary to (e.g.
  • the primer target duplex is stable and extension occurs.
  • duplex stability is disrupted and no detectable extension occurs .
  • Fig. 1 depicts the results of allele-specific extension for the three variants of the single nucleotide polymorphisms codon 72 (p53) and wiaf 1764.
  • the SNP status, which was determined separately for each sample, and the extension primers are shown at the top of the Figure.
  • Fig. la shows the raw data obtained using the luminometric assay without apyrase (top panel) and with apyrase (lower panel) .
  • the arrows point out the signal of pyrophosphate (0.02 :M) which was added to the reaction mixture prior to the nucleotide addition in all samples to serve as a positive control as well as for peak calibration.
  • Fig. IB shows the extension results of these samples using fluorescently labelled nucleotides spotted on a glass slide, with apyrase (lower panel) and without apyrase (top panel) .
  • Fig. 2 is a schematic depiction of a method of apyrase mediated allele specific extension using barcodes as tags on the 5' -ends of allele-specific primers.
  • Fig. 3 is a schematic depiction of a method of allele-specific extension in solution followed by hybridization to a DNA microarray.
  • Fig. 4 is a schematic depiction of an apyrase mediated allele specific reaction in which Taq Man probes are used to measure primer extension.
  • Fig. 5 depicts raw data of an apyrase mediated allele specific reaction utilizing a microarray format.
  • Fig. 6 depicts bioluminometric analysis of a SNP by double allele-specific primer extension on double stranded DNA.
  • Fig. 7 depicts allele specific extension using a primer having an introduced mismatch.
  • Fig. 8 is a schematic depiction of a method of detecting unknown mutations using partially overlapping extension primers .
  • Fig. 9 is a diagram showing the average intensities measured in an allele specific extension reaction.
  • the present invention relates to methods for detecting bases in a nucleic acid target.
  • the present methods are useful for detecting mutations and genomic variations, and particularly single nucleotide polymorphisms (SNPs) , and may be used with single stranded or double stranded DNA targets .
  • SNPs single nucleotide polymorphisms
  • the present invention provides a method of detecting a base at a predetermined position in a DNA molecule.
  • the method utilizes DNA polymerase catalyzed primer extension. Pairs of primers are designed that are specific for (i.e. complementary to) an allele of interest, but that differ at the 3'- terminus, which position corresponds to the polymorphic nucleotide. In one primer, the 3 '-terminus is complementary to the non-mutated nucleotide; in the other primer, the 3 ' -terminus is complementary to the mutated nucleotide.
  • the primers are used in separate extension reactions of the same sample.
  • the 3 '-terminus of the primer will be a match or mismatch for the target.
  • the DNA polymerase discriminates between a match and mismatch, and exhibits faster reaction kinetics when the 3 '-terminus of the primer matches the template.
  • measurement of the difference in primer extension efficiency by the DNA polymerase of a matched over a mismatched 3 ' -terminus allows the determination of a non-mutated versus mutated target sequence .
  • the addition of a nucleotide degrading enzyme in the extension reaction minimizes the extension of mismatched primer configurations by removal of nucleotides before incorporation but allows extension when reaction kinetics are fast, i.e. in a matched configuration.
  • the present invention thus reduces or eliminates false positive results seen in prior art methods.
  • the present invention thus provides a method for detecting an allele-specific base at a predetermined position in a target nucleic acid molecule comprising providing a first and a second hybridization mixture, said first hybridization mixture comprising said target nucleic acid molecule, and a primer that hybridizes to a region of said target nucleic acid molecule and that has a 3 '-terminus that is complementary to a non-mutated base at said predetermined position, said second hybridization mixture comprising said target nucleic acid molecule, and a primer that hybridizes to a region of said target nucleic acid molecule and that has a 3 '-terminus that is complementary to a mutated base at said predetermined position; adding a primer extension reaction mixture to each of said first and second hybridization mixtures, said primer extension reaction mixture comprising a DNA polymerase, nucleotides, and a nucleotide degrading enzyme; and determining primer extension efficiency in each of said first and second mixtures, whereby greater efficiency in the mixture comprising
  • samples may be prepared, primers synthesized, and primer- extension reactions conducted by methods known in the art, and disclosed for example by Higgins et al . (1997) Biotechniques 23:710; Newton et al . (1989) Lancet 2:1481; Goergen et al . (1994) J. Med. Virol. 43:97; and Newton et al . (1989) Nucleic Acids Res. 17:2503, the disclosures of which are incorporated by reference.
  • SNP sites may be amplified prior to analysis, for example by PCR, including nested and multiplex PCR. SNP containing templates may be immobilized. This publication also describes how the nucleotide-degrading enzyme may be used.
  • the nucleotide degrading enzyme is preferably added after primer hybridization and preferably with the extension reaction mixture.
  • a thermostable nucleotide degrading enzyme is used for PCR reactions.
  • any nucleotide-degrading enzyme may be used, capable of non-specifically degrading nucleotides. This publication also describes how the nucleotide-degrading enzyme may be used.
  • nucleotide-degrading enzyme includes all enzymes capable of non-specifically degrading nucleotides, including at least nucleoside triphosphates (NTPs) , but optionally also di- and mono- phosphates, and any mixture or combination of such enzymes, provided that a nucleoside triphosphatase or other NTP degrading activity is present.
  • NTPs nucleoside triphosphates
  • nucleoside triphosphatase or other NTP degrading activity is present.
  • nucleotide-degrading enzymes having a phosphatase activity may conveniently be used according to the invention, any enzyme having any nucleotide or nucleoside degrading activity may be used, e.g.
  • nucleoside triphosphate degrading enzyme activity is essential for the invention.
  • Nucleoside di- and/or mono-phosphate degrading enzymes or enzyme activities are optional and may be used in combination with a nucleoside tri-phosphate degrading enzyme activity.
  • Suitable such enzymes include most notably apyrase which is both a nucleoside diphosphatase and triphosphatase, catalysing the reactions NTP -» NMP + 2Pi and NTP ⁇ NDP + Pi (where NTP is a nucleoside triphosphate, NDP is a nucleoside diphospate, NMP is a nucleotide monophosphate and Pi is phosphate) .
  • Apyrase may be obtained from Sigma Chemical Company.
  • Other suitable nucleotide triphosphate degrading enzymes include Pig Pancreas nucleoside triphosphate diphosphohydrolase (Le Bel et al .. 1980, J. Biol . Chem. , 255, 1227-1233) . Further enzymes are described in the literature .
  • nucleoside tri-, di- or monophosphatases may be used. Such enzymes are described in the literature and different enzymes may have different characteristics for deoxynucleotide degradation, eg. different Km, different efficiencies for a different nucleotides etc. Thus, different combinations of nucleotide degrading enzymes may be used, to increase the efficiency of the nucleotide degradation step in any given system. For example, in some cases, there may be a problem with contamination with kinases which may convert any nucleoside diphosphates remaining to nucleoside triphosphates, when a further nucleoside triphosphate is added.
  • nucleoside disphosphatase it may be advantageous to include a nucleoside disphosphatase to degrade the nucleoside diphosphates.
  • nucleoside disphosphatase it may be advantageous to include a nucleoside disphosphatase to degrade the nucleoside diphosphates.
  • all nucleotides may be degraded to nucleosides by the combined action of nucleoside tri-, di- and monophosphatases.
  • the nucleotide-degrading enzyme is selected to have kinetic characteristics relative to the polymerase such that nucleotides are first efficiently incorporated by the polymerase, and then any non-incorporated nucleotides are degraded.
  • the K,,, of the nucleotide-degrading enzyme may be higher than that of the polymerase such that nucleotides which are not incorporated by the polymerase are degraded.
  • the nucleotide-degrading enzyme or enzymes are simply included in the polymerase reaction mix.
  • the amount of nucleotide-degrading enzyme to be used may readily be determined for each particular system, depending on the reactants selected, reaction conditions etc.
  • the nucleotide-degrading enzyme (s) may be included during the polymerase reaction step. This may be achieved simply by adding the enzyme (s) to the polymerase reaction mixture prior to or simultaneously with the polymerase reaction (i.e. the chain extension or nucleotide incorporation) , e.g. prior to or simultaneously with, the addition of the polymerase and/or nucleotides to the sample/primer.
  • the nucleotide-degrading enzyme (s) may simply be included in solution in a reaction mix for the polymerase reaction, which may be initiated by addition of the polymerase or nucleotide (s) .
  • the nucleotide degrading enzyme is apyrase, which is commercially available, for example from Sigma Chemical Co., St. Louis, Mo. USA.
  • apyrase which is commercially available, for example from Sigma Chemical Co., St. Louis, Mo. USA.
  • Those of ordinary skill in the art can determine a suitable amount of apyrase or other nucleotide degrading enzyme to degrade unincorporated nucleotides in extension reactions having slow kinetics due to a mismatch at the 3 ' -terminus of the primer.
  • a typical 50 :1 extension reaction mixture may contain for 1 to 15 mU, and preferably from 5 to 10 mU, of apyrase .
  • primer extension can be measured, and thus the ratio of extension using the primer having a matched 3 '-terminus and extension using the primer having an unmatched 3 '-terminus determined, by methods known in the art. If two primers are used in each reaction, PCR products can be generated and measured. Other methods of measuring primer extension include mass spectroscopy (Higgins et al . (1997) Biotechniques 23:710), luminometric assays, in which incorporation of nucleotides is monitored in real-time using an enzymatic cascade, (Nyren et al . (1997) Anal. Biochem.
  • the method of the invention may advantageously be performed using labelled nucleotides in the primer extension reactions to provide a convenient way of monitoring (e.g. detecting or measuring) the primer extension reactions; it may be detected whether or not incorporation has taken place by detecting the label carried on the nucleotide, or the relative or respective rates (or efficiencies) of nucleotide incorporation.
  • the invention thus provides a method of detecting a base at a pre-determined position in a nucleic acid molecule, said method comprising: performing primer extension reactions using base- specific detection primers, each primer being specific for a particular base at said predetermined position, and comparing said primer extensions to determine which base is present at said position, wherein said primer extension reactions are performed using labelled nucleotides and wherein a nucleotide-degrading enzyme is present during the primer extension reaction.
  • this method of the invention may be used to detect a base change at a particular predetermined position, by determining which base is present at that position.
  • the method may thus be used to detect mutations, or genetic variation (e.g. allelic variation) based on base changes.
  • the base detected may thus be allele-specific .
  • the method has particular utility in the detection of single base changes or single nucleotide polymorphisms (SNPs) .
  • the primers used may thus be allele-specific.
  • the method may be used to detect base changes (e.g. polymorphisms or mutations) which are known or unknown. Thus known or unknown base changes may be identified.
  • allele-specific assays based on the use of allele-specific primers are well known in the art and widely described in the literature. Any such "allele-specific" primers may be used as the "base- specific" primer in the method of the invention.
  • the base-specific primer is designed to be specific for, or selective for, a particular base, for example a base the presence or absence of which it is desired to detect.
  • Such a primer will only be extended (e.g. detectably extended) or will have a greater extension efficiency (or higher rate of extension) in the presence of that base in the target (i.e.
  • primers therefore "match” or “mismatch” the particular base for which they are selective or specific.
  • base- specific, or allele-specific primers may be designed to comprise a "match” or "mismatch” for the target base at their 3' end (i.e. at the 3' terminus).
  • 3' base (i.e. the base at the 3' terminus) of the primer is designed either to match (i.e. to be complementary) to a particular base (e.g. a particular allele, or mutation) or mismatch it (i.e. be non-complementary) .
  • the 3 ' base may be complementary to the non- mutated (e.g. wild-type) base and in a second primer i.e. may be complementary to a mutated base (e.g. the mutation it is desired to detect) .
  • two primers may be used (so called allele-specific primers) the first "matched" to the one base which may occur, and the second "matched” to the other base which may occur.
  • more than one base may occur, more than two base- specific primers may be used, each specific for (or “matched to") each of the bases which may occur.
  • the method of the invention thus comprises the use of at least two (or two or more) base-specific primers, e.g. 2, 3 or 4 primers.
  • the method of the invention may be adapted to the detection of unknown mutations, simply by providing primers specific for each of the 4 bases (A, T, C or G) which may occur at a particular, (i.e. pre-determined) position. Thus, each position in a target sequence may be "scanned" for mutations.
  • base-specific primers which differ at their 3 ' terminus represents one way of performing the method
  • the method of the invention is not so limited, and alternative primer designs are also possible, as again is well known and widely described in the art.
  • allele-specific (or base specific) primers may comprise a match (or mismatch) for the target base at other positions, for example at the 3'-l position of the primer (i.e. the penultimate base of the primer) .
  • the "allele-specific" (or “base- specific") base in the primer need not be the 3' base, but it may be present at other positions e.g. the -1 or -2 (ante-penultimate) position.
  • the primer may also comprise other modifications (e.g. other mismatches) at other positions to aid or improve "base- specify” (i.e. discrimination between the "matched” and “mismatched” situation) . Again, such principles of primer design are also discussed in the literature.
  • a further aspect of the present invention is based on modified primer design and is discussed further below.
  • the primer extension reactions may be performed as described above.
  • the target nucleic acid molecule may be contacted with each said base-specific primer in conditions under which hybridisation (or annealing) of the primers, and subsequently primer extension, may occur.
  • hybridisation mixtures comprising template (i.e. target nucleic molecule) and primer may be prepared (i.e. 1 to 4 hybridisation mixtures depending on the number of primers used) .
  • Polymerase and nucleotides for the performance of the primer extension reaction may then be added.
  • the nucleotide degrading enzyme may be included in the primer extension reaction mixture, or added separately.
  • the primer extension reactions performed using the different base-specific primers are then compared. More particularly, in this comparison step, the rates of extension may be compared (e.g. the respective or relative rates) . Thus, efficiencies of the primer extension reactions may be compared.
  • the respective rates, or efficiencies, of the primer extension reactions may be determined for each of the different primers and compared.
  • a greater efficiency, or higher extension rate is indicative of the presence of the base for which the primer is specific (i.e. "matched").
  • a detection (i.e. base-specific) primer matches the template (i.e. the target base) a high extension rate (or efficiency) will be observed.
  • the primer is not a matched primer, the extension rate (or efficiency) will be lower.
  • the difference in primer extension rate (or efficiency) over a matched or mismatched primer can be used for discrimination between bases, and thus to determine which base is present at said pre-determined position.
  • the nucleotides used for incorporation in the primer extension reaction may carry a label, preferably a detectable label , which may be used to detect whether or not the nucleotide has been incorporated, or to follow or monitor the primer extension reaction to detect the rate or efficiency of nucleotide incorporation.
  • a label may be any label giving or leading to a detectable signal (which may be directly or indirectly detectable, for example a moiety which takes part in a reaction (e.g. an enzymic or antibody-based reaction) which generates a detectable signal) .
  • Directly detectable labels are preferred, and especially labels based on dyes which may be spectrophotometrically or fluorescently detectable. Fluorescent labels are especially preferred.
  • Labelled nucleotides for use in sequencing are well known in the art and widely described in the literature and any of these may be used.
  • WO 00/53812 describes, inter alia, methods of sequencing based on dye-labelled (particularly fluorescently labelled) nucleotides, which may be used according to the present invention. See also US-A-6, 087, 095.
  • the label for example the dye (e.g. fluorophore)
  • a cleavable linker which can be cleaved to remove the label from the nucleotide when desired. Cleavage may be accomplished, for example, by chemical reaction (e.g. acid or base treatment) or by oxidation or reduction of the linkage or by light treatment, or enzymically, depending on the nature of the linkage.
  • cleavable linkages are described in detail in WO 00/53812.
  • a preferred example is a disulphide linkage which may be cleaved by reduction, e.g. with a reducing agent such as dithiothreitol .
  • Dyes for example fluorophores, e.g. cyanine fluorophores (e.g. cyanine 3 or cyanine 5 fluorophores) may be conjugated via disulphide bonds to a nucleotide as described in WO 00/53812.
  • the label may be attached to the 3' moiety of the deoxyribose group of a nucleotide, such that cleavage and removal of the label group from the nucleotide generates a 3 ' OH group.
  • Modified labelled nucleotides known as "false terminators" where a blocking group may be removed from the modified nucleotide are also described in EP-A-0745688 and US-A- 5,302,509.
  • the present method may be performed in a solid phase microarray format, for example on a chip, whereby samples are extended in solution followed by hybridization to a microarray. (Fig. 3) .
  • the method may be performed in a microarray format in which the primers or samples (templates) are immobilised. Allele-specific primer extension on microarrays is known in the art and described for example by Pastinen et al . (2000) Genome Research 10:1031. The method may also be performed a liquid phase assay using barcodes as tags on the 5 '-ends of allele-specific primers as described by Fan et al . (2000) Genome Res. 10:853.
  • a liquid- phase multiplex apyrase mediated allele specific extension of a set of SNPs may be performed in a single tube (if the barcodes on the matched and mismatched primers are different) or in two tubes (if the barcodes on the matched and mismatched primers are identical) .
  • the extension products can be hybridized to barcodes on the chip.
  • a modular probe as described by O'Meara et al . (1998) Anal. Biochem. 255:195 and O'Meara et al . (1998) J. Clin. Microbiol . 36:2454 may be utilized to improve the hybridization efficiency.
  • the modular probe hybridizes to its complementary segment on the immobilized oligonucleotide and improves the hybridization of a barcode that is immediately downstream.
  • the present method may also be performed using "Taq Man” probes, which are probes labelled with a donor- acceptor dye pair that functions via fluorescence resonance transfer energy (FRET) as described by Livak et al. (1995) PCR Methods Appl . 4:357.
  • FRET fluorescence resonance transfer energy
  • a Taq Man probe After PCR amplification, a Taq Man probe is used which hybridizes 15 to 20 bases downstream of a 3 ' -end allele-specific primer. Apyrase-mediated allele specific extension is then performed.
  • DNA polymerase extends the primer and degrades the Taq Man probe by its 5 ' -nuclease activity, thus leading to increased donor fluorescence.
  • apyrase degrades the nucleotides and the fluorescence level remains unchanged.
  • Extension products may also be distinguished by mass difference or by the use of double-stranded- specific intercalating dyes.
  • allele specific primer extension with a nucleotide degrading enzyme is performed using a double stranded DNA template. If double stranded DNA is generated by PCR, the excess of primers, nucleotides and other reagents must first be removed by methods known in the art such as treatment with alkaline phosphatase and exonuclease I. Two pairs of allele-specific primers are used. One pair is complementary to the forward strand and one to the reverse strand. The primer pairs differ in their 3 '-ends as described above. Allele-specific extension is performed on both strands of the double- stranded DNA.
  • the present invention provides a method of detecting a mutation in a DNA molecule.
  • the mutation is not predefined, as in a SNP (i.e. it is unknown) .
  • the method utilizes DNA polymerase catalyzed primer extension.
  • primers are designed that each comprise a region that is specific for (i.e., complementary to) a target nucleic acid of interest or to a region interest in a target nucleic acid, e.g. a particular stretch of nucleotides, but that differ (e.g.
  • primer has a different nucleotide base (A, C, G or T) at a "base specific" (or “allele-specific” position) , for example at the 3 '-terminus.
  • base specific or "allele-specific” position
  • the "allele-specific" base or different nucleotide may be present at another position, e.g. the 3'-l position.
  • the primers are used in separate extension reactions of the same sample of target nucleic acid. Depending upon which base is present in the target nucleic acid at the position corresponding to the 3 ' -terminus of the primer (or any other "allele- specific" position) , only one of the primers will match the target.
  • the DNA polymerase discriminates between a match and mismatch, and exhibits faster reaction kinetics when the 3 '-terminus allele-specific base of the primer matches the template.
  • measurement of the difference in primer extension efficiency by the DNA polymerase of the matched over the three mismatched 3 ' - termini allows determination of the base at the position in the target nucleic acid that corresponds to the 3 ' - terminus of the primer (or analogously, at any other
  • the identity of the target base may be determined by determining which primer is extended (i.e. which base is incorporated) with the greatest rate or efficiency (or highest extension rate) .
  • nucleotide degrading enzyme in the extension reaction minimizes the extension of mismatched primer configurations by removal of nucleotides before incorporation, but allows extension when reaction kinetics are fast, i.e., in a matched configuration, thereby reducing or eliminating false positive results.
  • Samples may be prepared, primers synthesized, and primer-extension reactions conducted by methods known in the art as described hereinabove. Primers may be immobilized. Samples of target nucleic acids may be amplified prior to analysis, for example by PCR, including nested and multiplex PCR. Target nucleic acids may be immobilized.
  • each position in a target nucleic acid may be evaluated by using overlapping sets of extension primers.
  • each position in a target region may be scanned for mutations using this method of the invention, simply by appropriately selecting or designing a detection primer such that the base at the selected "allele-specific" position in the primer (e.g. the 3 '-terminus) corresponds to, or is complementary to the base to be scanned, i.e. the target base at the desired position.
  • the primers may be spotted onto a surface to provide an array, followed by hybridization to target nucleic acid, extension, measurement of extension, and comparison of extensions .
  • allele specific extension is performed using a pair of primers in which the 3 ' -end base is complementary to the target, the penultimate (3'-l end) base is allele- specific (mutated or nonmutated) and the base two positions from the 3 ' -end (3 ' -2 end) is non- complementary to (for example the same as) the target.
  • the allele-specific base in the primer matches the target template, i.e. one mismatch is present (2 bases from the 3 ' -end)
  • the primer-target duplex is stable and extension occurs.
  • the allele-specific base does not match the target, i.e.
  • the assay may be performed in all the embodiments as described above, in the presence or absence of a nucleotide degrading enzyme. An example of the method is depicted in Fig. 7.
  • Genome 10:204 and nucleotide position 196 (A/G) on the GPIIIa gene (Newman et al . (1989) J. Clin. Invst. 83:1778) .
  • the outer duplex PCR for wiaf 1764 and p53 gene (94°C 1 min, 50°C 40s and 72°C 2 min for 35 cycles) was followed by specific inner PCRs (94°C 1 min, 50°C 40s and 72°C 1 min for 35 cycles) generating ⁇ 80 bp fragments for each SNP (Table 1) .
  • the outer duplex PCR condition for MTHFR and GPIIIa genes was 95°C 30s, 60°C 1 min and 72°C 1 min.
  • the outer and inner amplification mixtures comprised of 10 mM Tris-HCl (pH 8.3), 2 mM MgCl 2 , 50 mM KC1, 0.1% (v/v) Tween 20, 0.2 mM dNTPs, 0.1 ⁇ M of each primer and 1 unit of AmpliTaq DNA polymerase (Perkin- Elmer, Norwalk, Connecticut, USA) in a total volume of 50 ⁇ l . Five microliters of total human DNA (1 ng/ ⁇ l) were used as outer PCR template.
  • one of the primers in the respective set was biotinylated at the 5 ' -end to allow immobilization.
  • 40 ⁇ l biotinylated inner PCR products were immobilized onto streptavidin- coated super paramagnetic beads (Dynabeads M280; Dynal, Oslo, Norway) .
  • Single-stranded DNA was obtained by incubating the immobilized PCR product in 12 ⁇ l 0.1 M NaOH for 5 min. The immobilized strand was then used for hybridization to extension primers (Tablel) .
  • the immobilized strand was resuspended in 32 ⁇ l H 2 0 and 4 ⁇ l annealing buffer (100 mM Tris-acetate pH 7.75, 20 mM Mg-acetate) .
  • the single stranded DNA was divided into two parallel reactions in a microtiter-plate (18 ⁇ l/well) and 0.1 M (final concentration) of primers were added to the single stranded templates in a total volume of 20 ⁇ l . Allele discrimination between the allelic variants was investigated by the use of Klenow DNA polymerase using two separate SNP primers that only differed in the 3 ' -end position (Table 1) . Hybridization was performed by incubation at 72°C for 5 min and then cooling to room temperature.
  • the extension reaction mixture contained 10 U exonuclease-deficient (exo-) Klenow DNA polymerase (Amersham Pharmacia Biotech, Uppsala, Sweden) , 4 ⁇ g purified luciferase/ml (BioThema, Dalar ⁇ , Sweden) , 15 mU recombinant ATP sulfurylase, 0.1 M Tris-acetate (pH 7.75), 0.5 mM EDTA, 5 mM Mg-acetate, 0.1% (w/v) bovine serum albumin
  • the single stranded templates were prepared using magnetic beads as outlined above.
  • the immobilized strand was resuspended in 100 ⁇ l H 2 0 and 12 ⁇ l annealing buffer (100 mM Tris-acetate pH 7.75, 20 mM Mg-acetate).
  • the single stranded DNA was divided into two parallel reactions in a microtiter-plate (56 ⁇ l/well) and 0.1 ⁇ M (final concentration) of primers (Table 1) were added to the single stranded templates in a total volume of 60 ⁇ l .
  • Hybridization was performed by incubation at 72°C for 5 min and then cooling to room temperature.
  • the reaction mixture was then further divided into two separate reactions (30 ⁇ l) for direct comparison of the extensions with and without apyrase.
  • the extension mixture contained 20 U exonuclease-deficient (exo-) Klenow DNA polymerase (Amersham Pharmacia Biotech) , Tris-acetate (pH 7.75), 0.5 mM EDTA, 5 mM Mg-acetate, 0.1% (w/v) bovine serum albumin (BioThema) , 1 mM dithiothreitol and optionally 8 mU of apyrase (Sigma Chemical Co.) in a total volume of 70 ⁇ l .
  • the extension mixture also contained nucleotides, dATP, dGTP, dTTP and dCTP (1.4 ⁇ M final concentration), where dCTP was labeled with Cy5 or Cy3 (Amersham Pharmacia Biotech) .
  • the reaction was carried out for 15 min at room temperature.
  • the resulting extension products were washed twice with Tris-EDTA and the non-biotinylated extension products were isolated by adding 25 ⁇ l 0.1 M NaOH.
  • the eluted strand was neutralized by 12.5 ⁇ l 0.2 M HCl and was printed on a glass slide by the GMS 417 Arrayer (Genetic Microsystem, USA) and then was scanned using GMS 418 Scanner (Genetic Microsystem, USA) .
  • the obtained results were analyzed using GenePix2.0 software (Axon Instruments, USA) .
  • the amplicons of wiaf 1764 were immobilized onto streptavidin coated beads as outlined above.
  • the biotinylated inner primer was primer 3 and not primer 4 (Table 1) with the reason that for this assay the eluted strand is the extension substrate, thus to have the same match and mismatch configurations, the biotinylated inner primer was changed.
  • the immobilized PCR product of wiaf 1764 was incubated in 20 ⁇ l 0.1 M NaOH for 5 min.
  • the eluted strand was neutralized by 10 ⁇ l 0.2 M HCl and 4 ⁇ l annealing buffer (100 mM Tris-acetate pH 7.75, 20 mM Mg- acetate) was added.
  • the eluted and neutralized single stranded DNA was divided into two parallel reactions in a microtiter-plate (17 ⁇ l/well) and extension primers (0.1 ⁇ M) were added. Hybridization was performed by incubation at 72°C for 5 min and then cooling to room temperature. Here, the extension primers were modified to have amino groups at the 5 '-end to allow covalent binding to pre-activated Silyated Slides (Cel Associates Inc, Texas, USA) . In order to improve hybridization and extension the primers were extended with a 15-mer spacer (T 15 ) in the 5' -end (Table 1) .
  • T 15 15-mer spacer
  • One microliter of the primer-template hybrid was manually spotted on Silyated Slides (Cel Associates Inc) and the covalent coupling was performed in a humid chamber at 37°C for 16h. After coupling, 1 mU apyrase (1 ⁇ l) was added to each spot. A polymerization mixture was prepared and 4 ⁇ l was added to the spots immediately after addition of apyrase.
  • the polymerization mixture contained Tris-acetate (pH 7.75), 0.5 mM EDTA, 5 mM Mg-acetate, 0.1% (w/v) bovine serum albumin (BioThema), 1 mM dithiothreitol, 0.08 ⁇ M (final concentration) dCTP labeled with Cy3 (Amersham Pharmacia Biotech) and 1 U exonuclease-deficient (exo-) Klenow DNA polymerase (Amersham Pharmacia Biotech) . Polymerization was allowed to proceed for 15 min and the microarray slide was washed briefly with water and then scanned using GMS 418 Scanner (Genetic Microsystem, USA) . The data was analyzed by using GenePix2.0 software (Axon Instruments, USA) .
  • the assays included a luminometric assay and two assays based on fluorescent labeled nucleotides. All the results obtained with these assays were confirmed by pyrosequencing.
  • Four SNPs with the eight alternative 3 ' -end primer-template configurations were investigated (Table 1 and Table 2) .
  • the SNPs were codon 72 of the p53 gene (C or G) , wiaf 1764 (G or T) , nucleotide position 677 in the MTHFR gene (C or T) and nucleotide position 196 in the GPIIIa gene (G or A) .
  • Figure 1A shows the results of the luminometric assay with and without apyrase, for codon 72 of the p53 gene and wiaf 1764.
  • codon 72 is homozygous G (sample gl) (see Table 2)
  • the mismatch signal is as high as the match signal but the slope of the curve indicates slower reaction kinetics (Figure 1A top panel, extension 2) .
  • the same was observed for wiaf 1764 homozygous T (sample g055) (see Table 2) .
  • apyrase was included in the allele-specific extension of these samples ( Figure 1A, lower panel) a dramatic difference was observed.
  • the previous high signals for mismatch configurations disappeared with the addition of apyrase.
  • the extension ratios were calculated by taking the ratio of the high versus the low end-point signals.
  • the ratio for sample gl in the p53 gene was 1.1 without apyrase and 13.9 with apyrase and for the sample g055 in wiaf 1764 the ratio was 1 without apyrase and 5 with apyrase (Table 2) .
  • an extension ratio below or equal to 2 was interpreted as a sample being heterozygous. If the ratio was above or equal to 2.5 the SNP was scored as homozygous with the nucleotide at the 3 ' -end of the primer that produced the higher signal.
  • Ratios between 2 and 2.5 were interpreted as uncertain.
  • Figure 1A and Table 2 in all cases with addition of apyrase the extension signals and extension ratios resulted in a correct genotype with the luminometric assay as compared to the pyrosequencing data.
  • the extension ratios for all heterozygous SNPs were between 1.1 and 1.4 and the lowest extension ratio for a homozygous sample was 5.
  • five out of eight mismatches contributed with so high extension signals that the SNPs were wrongly scored (ratios in bold) .
  • the primer- template mismatches that were extended in these cases were G-G, C-T, G-T, T-G and C-A.
  • Figure IB also shows the raw data of similar extensions on DNA immobilized on magnetic beads using fluorescent detection using a labeled nucleotide instead of a luminometric detection system.
  • extension is performed by the same polymerase and the same primers, meaning that the discrimination behavior should be as in the luminometric assay.
  • the results are in good agreement with the luminometric assay (Table 2) . Without apyrase the same mismatches gave high fluorescent signals leading to that the same homozygous samples were wrongly scored as heterozygous (ratios in bold in Table 2) . However in presence of apyrase, no ambiguities or discordant results were observed ( Figure IB lower panel and Table 2) .
  • FIG. 5 shows the raw- data of the analysis without and with apyrase.
  • a direct comparison of the raw data obtained for samples of wiaf 1764 using both assays shows that the results of extension on chip are correct when apyrase is used while the same homozygous sample as in the other two assays (g055) has led to a high mismatch signal when apyrase was not used.
  • a major advantage of using apyrase mediated allele specific extension is that the technique is applicable for high throughput genotyping.
  • the present method may also be performed using barcodes (Fan et al . (2000) Genome Res. 10:853) as tags on the 5 '-ends of allele-specific primers.
  • barcodes Fran et al . (2000) Genome Res. 10:853
  • a multiplex AMASE of a set of SNPs is performed in a single tube (if the barcodes on the match and mismatch are different) or in two tubes (if the barcodes on the match and mismatch are identical) .
  • the double-stranded AMASE products are heat separated and hybridized to barcode complementary oligonucleotides on the chip ( Figure 2) .
  • a modular probe is utilized (O'Meara et al . (1998) J. Clin. Microbiol. 36:2454).
  • the modular probe can hybridize to its complementary segment of the immobilized oligonucleotide and improve the hybridization of barcode that is immediately downstream.
  • this example shows that single nucleotide polymorphisms can rapidly be scored with allele-specific primers in extension reactions. Furthermore, the present method can be used in a high- throughput format using microarrays.
  • 1 and 2 primers used in the outer PCR.
  • Extension 1 Extension 2 • apyrase + apyrase ⁇ apyrase + apyrase p53 gl G/G ⁇ G- -G- 1.1 13.9 1.2 4.9 (G/C) c- /
  • AMASE Apyrase mediated allele-specific extension
  • Amino linked oligonucleotide capture probes suspended at a concentration of 20 ⁇ M in 3X SSC/0.01% sakrosyl were spotted using a GMS 418 arrayer
  • the arrays Prior to use in hybridization, the arrays were prehybridized with buffer containing 5X Denharts solution, 6X SSC, 0.5% SDS and 0.1 ⁇ g/ ⁇ l herring sperm DNA at 50 °C for 15 minutes followed by a brief rinse in dH 2 0.
  • the capture probes were synthesised with an amino group at the 5' end to facilitate covalent immobilisation on the glass slide.
  • a carbon spacer was also synthesised at the 3 ' end to prevent any possible extension of the capture probe during hybridization, albeit unlikely due to the high salt conditions.
  • the sequences of the capture probes and the allele specific extension primers are listed in Table 3.
  • PCR was carried out on human genomic DNA as previously described (Ahmadian et al . (2000) Anal. Biochem. 280:103)) to amplify 3 SNPs.
  • the SNPs were codon 72 (C/G) in the p53 gene, nucleotide position 677 (C/T) in the methylenetetrahydrofolate reductase (MTHFR) gene and nucleotide position 196 (A/G) on the glycoprotein Ilia (GP3a) gene.
  • C/G codon 72
  • MTHFR methylenetetrahydrofolate reductase
  • A/G glycoprotein Ilia
  • the biotinylated PCR-products ( ⁇ 80 bp) were immobilised onto streptavidin-coated paramagnetic beads (Dynabeads ® M-280, Dynal , Oslo, Norway) and by strand-specific elution a pure template for extension was obtained. Briefly, 100 ⁇ l of the PCR- products was captured by incubation for 15 minutes at room temperature with 5 mg/ml of beads in 100 ⁇ l binding/washing buffer (10 mM Tris-HCl (pH 7.5) 1 mM EDTA, 2 M NaCl, 1 mM ⁇ -mercaptoethanol , 0.1 % Tween ® 20) .
  • the strands were separated by incubation with 4 ⁇ l of 0.1 M NaOH for 5 minutes.
  • the alkaline supernatant with the non-biotinylated strand was neutralised with 2.2 ⁇ l of 0.17 mM HCl and 1 ⁇ l of 100 mM Tris-Acetate pH 7.5, 20 mM MgAc 2 .
  • the single strand DNA prepared above was divided into two aliquots and 2.5 pmoles of allele specific primers were annealed by incubation at 72 °C for 5 minutes in a volume of 20 ⁇ l .
  • the annealed primer-DNA template was then further divided into two separate reactions for direct comparison of extension with and without apyrase. When multiplex extension was performed, single strand DNA from the 3 templates was mixed and allele specific primers were annealed.
  • Extension was performed in solution on 10 ⁇ l of the annealed DNA (corresponds to 25 ul of each PCR product) in a 60 ⁇ l volume containing 100 mM Tris-Acetate, 0.5 mM EDTA and 5 mM Mg-acetate with 1.4 ⁇ M pmoles of cy5 labelled dNTPs, 2.5 ⁇ g BSA, 1.25 mM DTT, 10 Units exonuclease-deficient (exo-) Klenow DNA polymerase and optionally 8 mU apyrase.
  • Double strand DNA Double strand DNA
  • PCR product One hundred and sixty microlitres of PCR product was treated with 16 Units of calf alkaline phosphatase and 32 Units exonuclease I at room temperature for 30 minutes.
  • the enzymes were inactivated by incubation at 95 °C for 12 minutes and the DNA was divided into two aliquots and annealed to 5 pmoles of allele specific primers (incubation at 95° C for 2 minutes followed by incubation at 72 °C for 5 minutes) in a volume of 100 ⁇ l .
  • the annealed primer-DNA template was then further divided into two separate reactions for direct comparison of extension with and without apyrase.
  • Extension was carried out on 50 ⁇ l of annealed double strand DNA (corresponds to 40 ⁇ l PCR product) in a lOO ⁇ l as described above. Following incubation at RT for 15 minutes, 25 ⁇ l 20X SSC and 12 ⁇ l 10% SDS was added to the extension mixture and 100 ⁇ l was hybridized to the slide as described above.
  • the slides were scanned at optimal laser/PMT values using the GMS 417 scanner (Affymetrix, USA) and the features quantitated using GenePix 2.0 software (Axon Instruments, USA) . Since different extension/hybridization experiments were compared, the micorarray data was subjected to a normalization procedure. This involved including a 66 mer oligonucleotide control and 18 mer extension probe (Table 3) together with the target DNA that was subjected to extension and hybridization. Since the intensity of this control should be constant from slide to slide it was used to normalize the slides for comparative purposes. Extension ratios were calculated by taking the ratio of the high versus the low signal .
  • results of AMASE for simultaneous genotyping of 3 SNPs on DNA microarrays are shown in Table 4. Inclusion of apyrase resulted in the correct genotype being called in all cases. However when apyrase was omitted, SNPs were incorrectly genotyped in 3 samples (illustrated in boldface type) if the criteria of a ratio ⁇ 2.5 is required to call a homozygous genotype and ⁇ 1.5 for a heterozygous sample. Two replicates of each feature were spotted which allows an estimation of the variability of the method and the standard deviation for each feature is shown in Table 4. The results in Table 4 are based on extension of single strand DNA while preliminary results for genotyping of double strand DNA gave ratios of 3.9 ⁇ 0.2 (with apyrase) versus 2.7 ⁇ 0.4
  • PCR amplification of wiaf 1764 was performed as described in the foregoing examples.
  • the excess of primers, nucleotides and the released PPi in the PCR had to be removed.
  • the enzymes shrimp alkaline phosphatase (4 U) (Roche Diagnostics) and E. coli exonuclease I (8 U) (Amersham Pharmacia Biotech, Uppsala, Sweden) were added to 40 ⁇ l of each PCR product.
  • Shrimp alkaline phosphatase was used to degrade PPi and the dNTPs while exonuclease I removed single-stranded DNA molecules including PCR primers. The enzymatic degradation was allowed to proceed for 30 min at room temperature. The mixtures were then heated to 97° C for 12 min to deactivate the enzymes. The samples were divided into two tubes (20 ⁇ l in each) and pairs of allele-specific primer (0.25 ⁇ M) (one complementary to the forward strand and one complementary to the reverse strand) were added into each tube.
  • the sequence of primers was A-forward TACAACACTCCCTTCAGATCA, A-reverse TACCATTTGTTAAGCTTTTGT., C-forward TACA ACACTCCCTTCAGATCC and C-reverse ACCATTTGTTAAGCTTTTGG.
  • the primer pairs in different tubes differed only in their 3 '-ends (underlined bases indicate the alternating 3 ' -ends) to allow discrimination by allele-specific extension using DNA polymerase.
  • the samples were incubated at 97° C for 2 min and then cooled to room temperature, allowing hybridization of allele-specific primer pairs. The content of each well was then further divided into two separate reactions for comparison of extension analysis with and without apyrase.
  • Extension and real-time luminometric monitoring was performed at 25°C in a Luc96 pyrosequencer instrument (Pyrosequencing, Uppsala, Sweden) .
  • An extension reaction mixture was added to the samples (10 ⁇ l) with annealed primers (the substrate) to a final volume of 50 ⁇ l .
  • the extension reaction mixture contained 10 U exonuclease-deficient (exo-) Klenow DNA polymerase (Amersham Pharmacia Biotech, Uppsala, Sweden) , 4 ⁇ g purified luciferase/ml (BioThema, Dalar ⁇ , Sweden) , 15 mU recombinant ATP sulfurylase, 0.1 M Tris-acetate (pH 7.75), 0.5 mM EDTA, 5 mM Mg-acetate, 0.1% (w/v) bovine serum albumin (BioThema), 1 mM dithiothreitol, 10 ⁇ M adenosine 5 ' -phosphosulfate (APS), 0.4 mg polyvinylpyrrolidone /ml (360 000) , 100 ⁇ g D- luciferin/ml (BioThema) and 8 mU of apyrase (Sigma Chemical Co., St. Louis, MO, USA) when applicable.
  • pyrophosphate Prior to nucleotide addition and measuring of emitted light, pyrophosphate (PPi) was added to the reaction mixture (0.08 ⁇ M) .
  • the PPi served as a positive control for the reaction mixture as well as peak calibration. All the four nucleotides (Amersham Pharmacia Biotech,
  • FIG 6 shows the results of bioluminometric analysis of wiaf 1764.
  • the SNP wiaf 1764 has the variants G and/or T (C and/or A) .
  • Two pairs of allele-specific primers were used to analyze this SNP, one complementary to the forward strand and one complementary to the reverse strand.
  • the primer pairs differed in their 3 ' -ends to allow discrimination by allele-specific extension using DNA polymerase, (extension 1 and extension 2 in Figure 6) .
  • extension 1 and extension 2 in Figure 6
  • Prior to hybridization of allele-specific primers the PCR products were treated by shrimp alkaline phosphatase and exonuclease I to remove the excess of primers, nucleotides and PPi.
  • the advantage of using two primers in AMASE is that these can be utilized in a PCR amplification assay when a thermostable nucleotide-degrading enzyme (e.g. alkaline phosphatase) is available.
  • a thermostable nucleotide-degrading enzyme e.g. alkaline phosphatase
  • a perfectly match primer pair will give rise to amplification while mismatch primer pair will not.
  • the PCR products are directly analyzed by a luminometric assay since the same primer pair is used in allele- specific extension.
  • Another advantage of using two allele-specific primers is that the sensitivity increases by a factor of two because signals of two extensions are obtained instead of one.
  • the present example describes a method of allele- specific extension using apyrase and an introduced mismatch in the allele-specific primer, with non- stringent conditions for extension.
  • PCR amplification of GPIIIa gene was performed as described in the foregoing .examples .
  • the SNP in the GPIIIa gene has the variants C/T (G/A) .
  • the PCR products were immobilized on magnetic beads and single- stranded DNA was obtained by alkaline treatment as described in the foregoing examples. The immobilized single-stranded DNA was used as target template in the assay.
  • Two different primers were designed. The sequence of primers was CTG TCT TAC AGG CCC TGC CTG CG for GPIIIC and CTG TCT TAC AGG CCC TGC CTG TG for
  • the immobilized strand was resuspended in 32 ⁇ l H 2 0 and 4 ⁇ l annealing buffer (100 mM Tris-acetate pH 7.75, 20 mM Mg-acetate) .
  • the single stranded DNA was divided into two parallel reactions in a microtiter- plate (18 ⁇ l/well) and 0.2 ⁇ M (final concentration) of primers were added to the single stranded templates in a total volume of 20 ⁇ l .
  • the primers were designed so that the 3 ' -end was one base after the SNP site and was complementary to the target DNA (indicated in i talics) .
  • the base before the 3 ' -end (3'-l) was complementary to the SNP variants and was the only difference between the two allele-specific primers (underlined bases).
  • the base before the SNP site (3 '-2) on both primers was an introduced mismatch to the target DNA (G on the primers and G on the target DNA) . Therefore, when the allele-specific base in the primer does not match to the target template, two mismatches (positions 3'-l and 3' -2) and one match (position 3 ' ) will be made between the template and the last 3 bases in the primer (Fig. 7) .
  • the allele-specific primer contains a matching base to the target DNA at the 3'-l position (T to A match)
  • two complementary bases are made (at 3'-l and 3" position) between the primer and template.
  • the mismatch base at position 3 ' -2 does not remove the two complementary bases at 3'-l and 3', which leads to extension.
  • sample 1267 that is homozygous G.
  • both allele-specific bases are complementary to the respective variant and give rise to extension signals.
  • a microarray assay was used to detect unknown mutations in a 15 base stretch in exon 5 of the p53 tumour suppressor gene.
  • Partially overlapping extension primers were designed, but instead of two variants differing only in the 3' -end nucleotides as for SNPs, all four possible variants of 3 ' -end were used ( Figure 8) .
  • These extension primers were then allowed to hybridize to template, followed by extension in si tu using fluorescent nucleotides. After the extension the microarray was scanned and fluorescent intensities were measured and compared.
  • Four different templates were used: a 100% WT template and three mutated templates in a 50% mixture with WT template.
  • the allele specific extension primers were synthesized with a 5' amino group, which facilitates covalent immobilization on the glass slide. A spacer sequence of 15 T residues was included at the 5' end of the gene specific sequence that contained 18 nucleotides (Table 5) . The gene specific sequences of the extension primers were designed to have a Tm of 62-64°C with the 3 ' -nucleotide hybridizing at the variant position. In addition, amino linked oligonucleotides, which are printed on the arrays to act as hybridization and extension controls, were synthesized (Table 6) . A labeled hybridizing oligonucleotide, which was used for normalization, was synthesized with a Cy3 label (Table 6)
  • 210A 15 GTTGTGAGGCGCTGCCCC 217T ⁇ iGGCGCTGCCCCCACCATT 210G (T) 15 GTTGTGAGGCGCTGCCCG 218A GCGCTGCCCCCACCATGA
  • Amino linked oligonucleotide capture probes suspended at a concentration of 20 ⁇ M in 150 mM sodium phosphate pH 8.5 and 0.06% sarkosyl were spotted using a GMS 417 arrayer (Affymetrix, USA) or a Genetix arrayer equipped with solid pins (Genetix, UK) on 3D-link activated slides (Motorola Life Sciences, IL, USA) .
  • Sarkosyl was added to the spotting solution as it improved spot uniformity.
  • the arrays were printed in 2- 3 different areas on the slides with either 1 or 4 hits/dot and with 2-4 replicate spots in each array.
  • the extension primer solutions Prior to spotting the extension primer solutions were spiked with 2 ⁇ M of the 18-mer amino linked hybridization control oligonucleotide, which hybridizes to a labeled oligonucleotide with the duplex serving as a hybridization and normalization control.
  • the second 18-mer oligonucleotide which acts as an extension control, was also printed on the slide. This oligonucleotide hybridizes to a 66-mer extension control target oligonucleotide (mixed with the sample DNA) and the duplex serves as a positive control for extension. After printing, the arrays were incubated overnight in a humid chamber followed by post coupling as outlined by the manufacturer.
  • the slides were incubated at 50°C for 15 minutes in blocking solution (50 mM ethanol amine, 0. IM Tris pH 9 and 0.1% SDS), rinsed twice in dH 2 0 and washed with 4X SSC/0.1% SDS (prewarmed to 50°C) for 15 to 60 minutes. The arrays were then rinsed in H 2 0 and dried by centrifugation for 3 minutes at 800rpm.
  • blocking solution 50 mM ethanol amine, 0. IM Tris pH 9 and 0.1% SDS
  • 4X SSC/0.1% SDS prewarmed to 50°C
  • Hybridization was performed at 58°C for 20 minutes followed by two washes in 2X SSC/0.1% SDS (preheated to 58°C) for 5 minutes proceeded by washing in 0.2X SSC and 0. IX SSC for 1 minute. The slides were dried by centrifugation at 800 rpm for 1 minute prior to scanning with the Cy5 laser.
  • 100 ⁇ l of an extension mix was prepared containing 80 mM Tris-Acetate, 0.4 mM EDTA, 1.4 mM MgAc 2 , 0.5 mM DTT, 2 ⁇ g E.
  • Extension was performed for 15 minutes at 28°C followed by a washing procedure performed as described above .
  • the slides were scanned using the GMS 418 scanner (Affymetrix, SA) .
  • the optimal parameters were laser and photomultiplier tube (PMT) settings of 100 % and 50% respectively for Cy5 and laser and PMT settings of 100% and 50% for Cy3.
  • PMT laser and photomultiplier tube
  • Sixteen-bit TIFF images were then imported into GenePix 2.0 software (Axon Instruments, USA) for analysis. After the median local background was subtracted from the mean signal of the spots, means for the 8 spots of each allele specific extension primer printed on each slide were calculated.
  • the Cy3 channel signal was used as a visual aid as to see if the hybridization were evenly distributed on the chip.
  • This example demonstrates the use of the micro array assay to detect unknown mutations in a 15-base stretch in exon 5 of the p53 tumour suppresser gene .
  • Partially overlapping extension primers were designed, but instead of two variants differing only in the 3 '-end nucleotides as for SNPs, all four possible variants of 3' -end were used (Figure 8) . This was to allow for all three possible mutations instead of two allelic variants.
  • 60 partially overlapping oligonucleotides were spotted on the chip.
  • These extension primers were then allowed to hybridise to a synthetic 60-mer oligonucleotide template, followed by extension in situ using fluorescent nucleotides. After the extension the microarray was scanned and fluorescent intensities were measured and compared (Figure 9) .
  • Four different templates were used - 100% WT template and three mutant templates in a 50% mixture with the WT template (Table 7) .

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

L'invention concerne des méthodes d'extension d'amorce spécifique d'allèle utiles dans la détection de mutations et de variations génétiques. L'invention concerne, plus particulièrement, une méthode de détection d'une base au niveau d'une position prédéfinie dans une molécule d'acide nucléique. La méthode de l'invention consiste: à effectuer des réaction d'extension d'amorce au moyen d'amorces de détection à spécificité de base, chaque amorce étant spécifique pour une base particulière au niveau de la position prédéfinie, et à comparer ces extensions d'amorce afin de déterminer quelle base est présente au niveau de cette position, les réactions d'extension d'amorce étant effectuées au moyen de nucléotides marqués et une enzyme de dégradation de nucléotide étant présente durant la réaction d'extension d'amorce.
PCT/GB2002/000794 2001-02-23 2002-02-22 Méthode d'extension d'amorce spécifique d'allèle WO2002068684A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2002233540A AU2002233540A1 (en) 2001-02-23 2002-02-22 Allele-specific primer extension assay

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
GB0104560A GB0104560D0 (en) 2001-02-23 2001-02-23 Method
GB0104560.8 2001-02-23
US09/791,190 US20030104372A1 (en) 1996-12-23 2001-02-23 Allele specific primer extension
US09/791,190 2001-02-23
US7192602A 2002-02-07 2002-02-07
US10/071,926 2002-02-07

Publications (3)

Publication Number Publication Date
WO2002068684A2 true WO2002068684A2 (fr) 2002-09-06
WO2002068684A8 WO2002068684A8 (fr) 2003-12-04
WO2002068684A3 WO2002068684A3 (fr) 2007-12-27

Family

ID=27256081

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2002/000794 WO2002068684A2 (fr) 2001-02-23 2002-02-22 Méthode d'extension d'amorce spécifique d'allèle

Country Status (2)

Country Link
AU (1) AU2002233540A1 (fr)
WO (1) WO2002068684A2 (fr)

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004094666A1 (fr) * 2003-04-24 2004-11-04 Dzieglewska, Hanna Essais de detection de mutations propres aux alleles
WO2005075496A1 (fr) * 2004-02-06 2005-08-18 Canadian Blood Services Procede de determination simultane d'un groupe sanguin et de genotypes d'antigene plaquette sanguine
GB2433992A (en) * 2006-01-05 2007-07-11 Univ Cardiff Allele-specific sequencing
WO2012055069A1 (fr) 2010-10-27 2012-05-03 Capitalbio Corporation Molécules marquées par un luminophore couplées à des particules pour des dosages sur micropuce
US20120276524A1 (en) * 2009-11-16 2012-11-01 Genomictree, Inc. Genotyping method
WO2013123031A3 (fr) * 2012-02-15 2015-03-12 Janssen Diagnostics, Llc Procédé extrêmement sensible de détection de mutations à faible fréquence
US9803236B2 (en) 2010-08-06 2017-10-31 Tsinghua University Microarray-based assay integrated with particles for analyzing molecular interactions
WO2018211477A1 (fr) * 2017-05-18 2018-11-22 Pharmacogenetics Limited Capture à l'échelle du génome de segments d'éléments inter-transposables pour l'analyse de séquence génomique d'échantillons d'adn humain présentant une contamination microbienne
US10167499B2 (en) 2013-12-05 2019-01-01 Capitalbio Technoloogy Corporation Luminophore-labeled molecules coupled with particles for microarray-based assays
CN109371115A (zh) * 2018-08-24 2019-02-22 山东德诺生物科技有限公司 用于检测rs5918的引物探针组及其应用
EP3856931A4 (fr) * 2018-09-25 2022-06-29 Co-Diagnostics, Inc. Conception spécifique d'allèles d'amorces coopératives pour génotypage de variants d'acide nucléique amélioré
US11492666B2 (en) * 2017-02-15 2022-11-08 Pacific Biosciences Of California, Inc. Distinguishing sequences by detecting polymerase dissociation

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0530794A1 (fr) * 1991-09-06 1993-03-10 Roche Diagnostics GmbH Méthode pour la détection d'acides nucléiques ayant une séquence similaire
EP0593789A1 (fr) * 1992-05-08 1994-04-27 Sumitomo Metal Industries, Ltd. Methode de determination de la mutation pre-c du virus de l'hepatite b
WO1998028440A1 (fr) * 1996-12-23 1998-07-02 Pyrosequencing Ab Methode de sequençage d'adn sur la base de la detection d'une liberation de pyrophosphate
WO2000053812A2 (fr) * 1999-03-12 2000-09-14 President And Fellows Of Harvard College Amplification par replique de reseaux d'acides nucleiques
EP1061135A2 (fr) * 1999-06-17 2000-12-20 Becton Dickinson and Company Procédés et oligonucléotides pour la détection des variations des séquences d'acides nucléiques

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0530794A1 (fr) * 1991-09-06 1993-03-10 Roche Diagnostics GmbH Méthode pour la détection d'acides nucléiques ayant une séquence similaire
EP0593789A1 (fr) * 1992-05-08 1994-04-27 Sumitomo Metal Industries, Ltd. Methode de determination de la mutation pre-c du virus de l'hepatite b
WO1998028440A1 (fr) * 1996-12-23 1998-07-02 Pyrosequencing Ab Methode de sequençage d'adn sur la base de la detection d'une liberation de pyrophosphate
WO2000053812A2 (fr) * 1999-03-12 2000-09-14 President And Fellows Of Harvard College Amplification par replique de reseaux d'acides nucleiques
EP1061135A2 (fr) * 1999-06-17 2000-12-20 Becton Dickinson and Company Procédés et oligonucléotides pour la détection des variations des séquences d'acides nucléiques

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
AHMADIAN A ET AL: "Genotyping by apyrase-mediated allele-specific extension." NUCLEIC ACIDS RESEARCH. ENGLAND 15 DEC 2001, vol. 29, no. 24, 15 December 2001 (2001-12-15), page E121 XP002236747 ISSN: 1362-4962 *
FAN J-B ET AL: "Parallel genotyping of human SNPs using generic high-density oligonucleotide tag arrays" GENOME RESEARCH 2000 UNITED STATES, vol. 10, no. 6, 2000, pages 853-860, XP002236784 ISSN: 1088-9051 cited in the application *

Cited By (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7262032B2 (en) 2003-04-24 2007-08-28 Afshin Ahmadian Allele-specific mutation detection assay using an enzyme-disabling agent
WO2004094666A1 (fr) * 2003-04-24 2004-11-04 Dzieglewska, Hanna Essais de detection de mutations propres aux alleles
US8728735B2 (en) 2004-02-06 2014-05-20 Canadian Blood Services Method for the simultaneous determination of blood group and platelet antigen genotypes
WO2005075496A1 (fr) * 2004-02-06 2005-08-18 Canadian Blood Services Procede de determination simultane d'un groupe sanguin et de genotypes d'antigene plaquette sanguine
GB2433992A (en) * 2006-01-05 2007-07-11 Univ Cardiff Allele-specific sequencing
US20120276524A1 (en) * 2009-11-16 2012-11-01 Genomictree, Inc. Genotyping method
US9695473B2 (en) 2009-11-16 2017-07-04 Genomictree, Inc. Genotyping method
US9803236B2 (en) 2010-08-06 2017-10-31 Tsinghua University Microarray-based assay integrated with particles for analyzing molecular interactions
EP2633067A4 (fr) * 2010-10-27 2014-03-12 Capitalbio Corp Molécules marquées par un luminophore couplées à des particules pour des dosages sur micropuce
US9310375B2 (en) 2010-10-27 2016-04-12 Capitalbio Corporation Luminophore-labeled molecules coupled with particles for microarray-based assays
EP2633067A1 (fr) * 2010-10-27 2013-09-04 CapitalBio Corporation Molécules marquées par un luminophore couplées à des particules pour des dosages sur micropuce
WO2012055069A1 (fr) 2010-10-27 2012-05-03 Capitalbio Corporation Molécules marquées par un luminophore couplées à des particules pour des dosages sur micropuce
WO2013123031A3 (fr) * 2012-02-15 2015-03-12 Janssen Diagnostics, Llc Procédé extrêmement sensible de détection de mutations à faible fréquence
US10167499B2 (en) 2013-12-05 2019-01-01 Capitalbio Technoloogy Corporation Luminophore-labeled molecules coupled with particles for microarray-based assays
US10982267B2 (en) 2013-12-05 2021-04-20 Capitalbio Technology Corporation Luminophore-labeled molecules coupled with particles for microarray-based assays
US11492666B2 (en) * 2017-02-15 2022-11-08 Pacific Biosciences Of California, Inc. Distinguishing sequences by detecting polymerase dissociation
WO2018211477A1 (fr) * 2017-05-18 2018-11-22 Pharmacogenetics Limited Capture à l'échelle du génome de segments d'éléments inter-transposables pour l'analyse de séquence génomique d'échantillons d'adn humain présentant une contamination microbienne
CN109371115A (zh) * 2018-08-24 2019-02-22 山东德诺生物科技有限公司 用于检测rs5918的引物探针组及其应用
EP3856931A4 (fr) * 2018-09-25 2022-06-29 Co-Diagnostics, Inc. Conception spécifique d'allèles d'amorces coopératives pour génotypage de variants d'acide nucléique amélioré

Also Published As

Publication number Publication date
WO2002068684A8 (fr) 2003-12-04
AU2002233540A1 (en) 2002-09-12
AU2002233540A8 (en) 2008-02-14
WO2002068684A3 (fr) 2007-12-27

Similar Documents

Publication Publication Date Title
US20210123091A1 (en) Multiplex targeted amplification using flap nuclease
US10837059B2 (en) Multiplex nucleic acid reactions
US20030104372A1 (en) Allele specific primer extension
US7955794B2 (en) Multiplex nucleic acid reactions
US6090553A (en) Use of uracil-DNA glycosylase in genetic analysis
AU704625B2 (en) Method for characterizing nucleic acid molecules
EP0843735B2 (fr) Detection de sequences nucleotidiques connues induite par la glycosylase
AU2002210862B2 (en) Method for the amplification and optional characterisation of nucleic acids
US7175982B1 (en) Method for the characterization of nucleic acid molecules involving generation of extendible upstream DNA fragments resulting from the cleavage of nucleic acid at an abasic site
US20080293589A1 (en) Multiplex locus specific amplification
US20050250147A1 (en) Digital profiling of polynucleotide populations
US7262032B2 (en) Allele-specific mutation detection assay using an enzyme-disabling agent
US20050287553A1 (en) Method for the quantification of methylated DNA
WO2002018659A2 (fr) Procede servant a determiner des alleles
WO2002068684A2 (fr) Méthode d'extension d'amorce spécifique d'allèle
EP2246438B1 (fr) Reactions multiplex d'acides nucléiques
WO2004007755A2 (fr) Reactions d'acides nucleiques multiplexes
US20090075251A1 (en) Method for analysis of cytosine methylation

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SD SE SG SI SK SL TJ TM TN TR TT TZ UA UG US UZ VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
NENP Non-entry into the national phase in:

Ref country code: DE

WWW Wipo information: withdrawn in national office

Country of ref document: DE

CFP Corrected version of a pamphlet front page
CR1 Correction of entry in section i

Free format text: IN PCT GAZETTE 36/2002 DUE TO A TECHNICAL PROBLEM AT THE TIME OF INTERNATIONAL PUBLICATION, SOME INFORMATION WAS MISSING (81). THE MISSING INFORMATION NOW APPEARS IN THE CORRECT VERSION.

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase in:

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP