WO2002066675A2

WO2002066675A2 - Methods for detecting mutations

Info

Publication number: WO2002066675A2
Application number: PCT/EP2002/001651
Authority: WO
Inventors: Sabine Kahmann; Oliver MÜLLER
Original assignee: MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V.
Priority date: 2001-02-16
Filing date: 2002-02-15
Publication date: 2002-08-29
Also published as: DE10107317A1; WO2002066675A9; WO2002066675A3

Abstract

The invention relates to methods for detecting mutations in nucleic acids and the use thereof, wherein novel primer combinations enabling differentiation between translation products of a wild type nucleic acid and a mutated nucleic acid are used. The invention also relates to a detection kit and multi-tag vectors as cloning and/or expression vectors, and to the use thereof.

Description

Method for the detection of mutations

description

The present invention relates to methods for detecting mutations in nucleic acids and the use thereof, using novel primer combinations which allow a distinction to be made between translation products of a wild-type nucleic acid and a mutated nucleic acid. The invention further relates to detection kits and multi-tag vectors as cloning and / or expression vectors and the use thereof.

Mutations represent changes in the genetic material of a cell or an organism caused by chemical or physical influences. B. recognizable mutations to changes in structural or regulatory genes and are shown either by the absence or by changes in enzymes, structural proteins, metabolic reactions or metabolic performance. Effects on morphological features can e.g. B. Changes in the pigmentation, body structure or responses to environmental changes. Therefore, a sensitive and specific analysis of mutations plays an important role, especially in research and medical diagnostics.

The most precise method for mutation analysis is DNA sequencing. With this method, DNA of several hundred nucleotides can be sequenced within a few hours. However, this method is a technically very complex method with a relatively low sensitivity. For this reason, DNA sequencing is only used to detect mutations in very few cases. A technically much less complex method, which is also suitable for analyzing a large number of samples, is sequence-specific hybridization, e.g. Such hybridization methods enable sensitive and specific detection of mutations in nucleic acids, but can only be used in cases in which the potential mutations of the nucleic acid are known exactly before the analysis. As a result, hybridization methods can be used only to a very limited extent and only serve to identify or control an expected mutation in a nucleic acid.

Another method for mutation detection in nucleic acids with relatively little technical effort and high sensitivity is the "Single Strand Conformation Polymorphism" (SSCP). This method is based on a detectable conformational change in genes and is therefore only for very few genes and very short gene segments applicable. Mutation detection of an arbitrarily selected nucleic acid can therefore generally not be carried out using this method.

The PTT ("Protein Truncation Test") method is another method for the detection of mutations in nucleic acids. This method is one of the most common due to its great applicability

Process for mutation detection in nucleic acids and enables a

Mutation detection at the protein level using the translation products of the examined nucleic acid. In this method, the isolated genomic DNA or cDNA to be examined is first transcribed and translated in vitro. Radioactively labeled amino acids (e.g. ^3S S methionine) are used in the translation to convert the translated proteins after separation by SDS-polyacrylamide

Detect gel electrophoresis by autoradiography. This method enables a sensitive and specific analysis of mutations based on the molecular weight distribution of the translated proteins, but has numerous disadvantages. Because the mutation detection of the PTT method by SDS polyacrylamide gel electrophoresis and subsequent autoradiography of the translated proteins, this method can only detect mutations that lead to a translation stop and thus to a protein that is significantly smaller than the wild-type protein. Reading frame shift mutations that do not lead to a translation stop and reading frame shift mutations or stop mutations that lead to a translation stop in the region of the 3 ′ end of the nucleic acid under investigation cannot be detected with the PTT method, since the molecular weight difference between mutated Protein and wild-type protein is too low to be detected by SDS polyacrylamide gel electrophoresis. Another disadvantage of the conventional PTT method is that due to the necessary process steps SDS-polyacrylamide gel electrophoresis and autoradiography it is not possible to fully automate the process. Due to the necessary use of radioactive amino acids, the PTT process cannot be carried out in every conventional standard laboratory and is also very expensive to carry out. Another problem that arises with the PTT method is that there is no enrichment of the nucleic acid to be examined before the in vitro transcription and translation. Therefore, only samples can be examined that contain a large number of copies of the nucleic acid to be examined, such as. B. tumors. As a result, the PTT method has a very small area of application, especially in medical diagnostics.

In summary, no suitable method for the detection of mutations in nucleic acids has been described in the literature which simultaneously allows analysis of all types of DNA and RNA as well as sensitive and specific detection of practically all possible relevant mutations, is not radioactive, technically simple and can be automated and is for use in high-throughput systems. The aim of the present invention was therefore to provide methods for the detection of mutations in nucleic acids which do not have the disadvantages mentioned according to the prior art.

According to the invention, this object is achieved by a method for the detection of mutations in nucleic acids, comprising the steps:

(a) amplifying the nucleic acid sought to obtain a double-stranded amplification product using primer combinations which are selected such that the amplification product has a nucleotide sequence which is (i) translatable and (ii) a distinction between translation products of a wild type -Nucleic acid and the translation products of a mutated nucleic acid allowed,

(b) transcribing and translating the amplification products in vitro and

(c) Detecting the translated proteins.

By using primer combinations according to the invention, which are selected such that the amplification product has a nucleotide sequence that is translatable and allows a distinction to be made between translation products, a wild-type nucleic acid and a mutated nucleic acid, a method for mutation detection is provided for the first time Non-radioactive, highly sensitive and specific detection of sequence mutations in nucleic acids, which lead to a loss or to a change in the amino acid composition of a protein segment (see FIG. 1). Because of the low technical complexity of the method according to the invention, the method can be used in any conventional standard laboratory in order to test any type of DNA or RNA for the presence of mutations, without knowing the mutations to be expected. Step (a) of the method according to the invention is based on the amplification of the nucleic acid to be examined in order to obtain a transcribable and translatable amplification product which allows detection of mutations in the nucleic acid. Traditional methods such as PCR or RT-PCR are used for the amplification of the nucleic acid to be investigated, primer combinations being used according to the method according to the invention, which allow a distinction to be made between translation products of a wild-type nucleic acid and a mutated nucleic acid.

The novel primer combinations of the method according to the invention comprise a specific forward primer in the 5 '→ 3' direction

(a) a promoter sequence for transcription,

(b) a translation start motif which enables translation in the reading frame of the wild-type nucleic acid,

(c) at least one sequence section which codes for a detectable first peptide and

(d) a sequence section which is sufficiently identical to the sequence at the 5 'end of the nucleic acid sought to allow specific attachment and amplification and in the 3' → 5 'direction a specific reverse primer with (a) a sequence section, which is sufficiently complementary to the sequence at the 3 'end of the nucleic acid sought to allow specific attachment and amplification, (b) at least one sequence segment which codes for at least one detectable second peptide, which is different from the first peptide, and in the reading frame of the wild-type nucleic acid sought, (c) sequence sections which code for at least one detectable third and fourth peptide, which are different from the first and second peptide, and which lie in the two reading frames which by shifting the reading frame of the wild-type nucleic acid sought, and (d) three stop motifs, one for each possible reading frame, the sequence of the sequence sections (b) and (c) of the reverse primer can be interchanged.

A preferred feature of the method according to the invention is that the two specific primers of the primer combination according to the invention have sequence segments which code for at least one detectable first peptide, at least one detectable second peptide and at least one detectable third and fourth peptide. These sequence sections can be chosen freely, but preferably have a length in the range of 6-100 nucleotides, preferably 9-60 nucleotides and particularly preferably 9-45 nucleotides and code for detectable peptides that are either direct, e.g. B. via direct specific, high-affinity interaction with binding partners such as ligand-receptor, antigen-antibody and / or indirectly, for. B. via an amino acid side chain label, are detectable. However, the invention preferably provides that these sequence sections from the in SEQ. ID NO .: 1 - 20 nucleic acid sequences shown can be selected.

By using the; Novel primer combinations, the present invention provides a method that enables a non-radioactive detection of mutations in nucleic acids at the protein level. At the same time, the method according to the invention allows for the first time a distinction between a stop mutation or a reading frame shift mutation which leads to a stop signal and a reading frame shift mutation which does not lead to a stop signal.

In a preferred embodiment of the method according to the invention, the sequence sections (c) of the forward primer and the Sequence sections (b) and (c) of the reverse primer of the primer combination according to the invention for immunologically detectable peptides, then the peptides are preferably detected via the corresponding specific antibodies. The method according to the invention thus enables highly sensitive and highly specific mutation detection. If the specific forward primer additionally contains sequence sections (c) which code for two different detectable first peptides, step (c) of the method according to the invention - the detection of the translated proteins and thus the mutation detection - can be carried out by means of differential ELISA.

In a further embodiment of the method according to the invention, primer combinations are used in which the specific reverse primer contains sequence segments (c) which code for an identical detectable third and fourth peptide. In this case, the detection of reading frame shift mutations which lie in the two reading frames and which result from shifting the reading frame of the wild-type nucleic acid sought and do not lead to a translation stop is carried out via the same detectable peptide. However, the reading frame of the mutated nucleic acid can no longer be clearly identified. If, on the other hand, the reading frame of the mutated nucleic acid is to be determined more precisely, the reverse primer contains sequence sections (c) which code for different third and fourth peptides.

Step (b) of the method according to the invention for the detection of mutations in nucleic acids comprises the in vitro transcription and translation of the amplification products from step (a). The in vitro transcription and translation of the amplification products is preferably carried out by adding cell lysate. Commercial or self-made lysates from transcriptionally and translationally active mammalian cells, such as reticulocytes from rabbits, plant cells, such as For example, wheat germ and / or bacterial cells, such as E. coli, are used. Depending on the presence of a mutation in the nucleic acid of the sample to be analyzed, three different mixtures of translation products can generally arise in step (b) of the method according to the invention (FIG. 1):

(I) If the nucleic acid you are looking for does not contain any mutations, the

Translation exclusively the wild-type protein which is fused to at least one detectable first peptide at the N-terminus and to at least one detectable second peptide at the C-terminus. (II) Does the nucleic acid searched contain a stop mutation or one

Reading frame shift mutation, which leads to a translation stop, arises during translation of the mutant protein, the

Total amino acid length is shortened compared to the wild-type protein and that is fused to at least one detectable first peptide at the N-terminus, while no detectable peptide is fused to the C-terminus. If the sample also contains non-mutated nucleic acid, then this also arises

Wild type protein (I).

(III) If the nucleic acid sought contains a reading frame shift mutation which does not lead to a translation stop, mutation results in the translation, which has at least one detectable first peptide at the N-terminus and at least one detectable third or at the C-terminus fourth peptide is fused. If the sample also contains non-mutated nucleic acid, wild-type protein (I) is also produced.

The novel primer combination of the method according to the invention enables selective and specific mutation detection, the translation product of the nucleic acid sought (non-mutated, uncut, wild-type protein, mutated, shortened, wild-type protein due to a reading frame shift mutation or a point mutation that leads to a translation stop or / and mutated abbreviated wild-type protein based on a reading frame shift mutation that does not lead to a translation stop) can be identified from the various detectable first, second, third and fourth peptides. If only the translation product of the nucleic acid under investigation is detected, which is fused N-terminally to a detectable first peptide and C-terminally fused to a detectable second peptide, there is no sequence mutation in the nucleic acid sought. If, on the other hand, the translation product of the examined nucleic acid is fused N-terminally to at least one detectable first peptide and C-terminally to at least one detectable third or fourth peptide, the nucleic acid examined contains a reading frame shift mutation which does not lead to a translation stop. If the translation product of the examined nucleic acid has only at least one N-terminally fused detectable first peptide, but no C-terminally fused peptide, the examined nucleic acid has a stop mutation or a reading frame shift mutation that leads to a translation stop, or the (monoallelic) loss of the entire sequence.

Thus, the method according to the invention has succeeded in providing a method for the detection of mutations in nucleic acids, which all

Sequence modulations recorded, which include a reading frame shift and the loss and premature stop of translation

Lead protein section. In addition, the invention enables

Methods of subjecting any type of DNA and / or RNA that can be amplified by conventional PCR and / or RT-PCR to a mutation detection. Due to the non-radioactive detection of mutations in

Based on the presence of the various detectable first, second, third and fourth peptides in the translation product of the nucleic acid under investigation, the method according to the invention can be used in any conventional standard laboratory. In step (c) of the method according to the invention, the translated proteins are detected, preferably comprising the following steps: (i) at least partial removal of non-mutated wild-type protein, (ii) immobilization of the translated proteins and

(iii) protein detection, which can be carried out qualitatively, but preferably also quantitatively.

The translated proteins (ii) are preferably immobilized via a detectable first peptide. The translation products of the nucleic acid sought can be immobilized, for example, on a solid matrix which contains a specific partner for the first peptide. The subsequent protein detection (iii) of the immobilized proteins, which also includes the mutation analysis, preferably comprises the following steps: a) detection of the total amount of the proteins by determining another detectable first peptide or by an antibody against the protein, b) detection of the amount non-mutated wild-type protein by determining a detectable second peptide and / or c) detecting the amount of mutated protein by determining a detectable third and / or fourth peptide.

The presence of a detectable mutation is preferably carried out arithmetically by difference total protein minus wild-type protein (see Figure 1).

The method according to the invention provides two preferred embodiments for the detection of the translated proteins (c):

In a first embodiment, step (c) of the method according to the invention takes place by means of differential ELISA, preferably when it is the detectable peptides are immunologically detectable peptides and if the sequence sections (c) of the specific forward primer of the primer combinations according to the invention code for at least two different detectable first peptides.

In this case the non-mutated wild-type protein (i) is preferably removed by precipitation with matrices or immobilized antibodies which bind to the immunologically detectable second peptide. For the precipitation of the non-mutated wild-type protein with matrices, preferably insoluble matrices are used, such as cellulose or agarose, on which corresponding antibodies and / or other proteins, such as avidin, are immobilized, which are either covalent or noncovalent, but highly affine bind the immunologically detectable second peptide of the wild-type protein. Matrices in the form of magnetic or non-magnetic beads are preferably used, on which antibodies against the immunologically detectable second peptide are immobilized. Commercially available Protein A and / or Protein G matrices are suitable for this. These consist of an insoluble carbohydrate matrix made of cellulose or agarose, to which the bacterial proteins, protein A or protein G, are covalently bound, which in turn do not bind covalently but with very high affinity to almost all classes of antibodies. If the corresponding antibody is bound to the protein A or protein G matrices, the non-mutated wild-type protein is precipitated via the interaction between the antibody and the immunologically detectable second peptide. If the detectable second peptide of the non-mutated wild-type protein biotin is labeled, the precipitation is preferably carried out with matrices such as cellulose or agarose, to which the protein avidin is bound. If, on the other hand, the detectable second peptide is a (His) ₆ tag, the non-mutated wild-type protein can be removed using an Ni-NTA agarose matrix. The method according to the invention thus enables enrichment of the mutated protein and thus a mutation detection in samples that contain only very small amounts of mutated DNA or RNA.

The translated proteins (ii) are preferably immobilized via antibodies against the first detectable first peptide on a microtiter plate, or via binding partners for the first detectable first peptide on a correspondingly modified plate (eg Ni ²⁺ -coated plate, avidin-coated plate ), the sample of the translation products to be analyzed being divided into at least three and preferably at least four aliquots, which are distributed over different depots of the plate.

The subsequent protein detection (iii), which simultaneously the

In this case, mutation analysis includes the following steps: a) detection of the total amount of the immobilized proteins with a monoclonal antibody against a further immunologically detectable first peptide (in a first depot of

Microtiter plate) or by an antibody against the protein, b) detection of the amount of immobilized non-mutated wild-type protein with a monoclonal antibody against a detectable second peptide (in a second depot of the microtiter plate) and / or c) detection of the amount of immobilized mutated protein with monoclonal antibodies against an immunologically detectable third and fourth peptide (in a third and / or fourth depot of the microtiter plate), the mutation being detected by quantification of the detected protein amounts and calculation (differential ELISA).

Alternatively, detection reagents, e.g. B. antibodies are used which carry different labels, such as B. fluorescent dyes with different emission maxima. This leads to a significant simplification of the detection of the translated proteins, since the sample of the translation products to be examined no longer has to be divided into aliquots, but rather an analysis of the various immunologically detectable peptides in one approach, e.g. B. a depot of the plate is made possible.

In a second embodiment, step (c) of the method according to the invention is carried out by means of chromatographic or electrophoretic separation, eg. B. according to size and subsequent detection, preferably when the detectable peptides are immunologically detectable peptides or directly detectable peptides (via avidin matrix or Ni-NTA matrix).

In this case, the removal of the non-mutated wild-type protein (i) is preferably carried out by means of af ﬁ nity chromatography. This affinity chromatographic purification step leads to an enrichment of the mutated proteins. The method according to the invention thus enables mutation detection in samples which contain only very small amounts of mutated DNA or RNA.

The analytical separation and immobilization of the translated proteins (ii) is preferably carried out by means of SDS-polyacrylamide gel electrophoresis and subsequent Western blotting, ie. H. Transfer to a membrane.

The proteins immobilized on the membrane are determined by detection reagents, e.g. B. antibodies against the various immunologically detectable peptides are detected, the protein detection (iii) comprising the following steps: a) detection of the total amount of the proteins with an antibody against an immunologically detectable first peptide or with an antibody against the protein, b) detection of the amount of non-mutated wild-type protein with an antibody against an immunologically detectable second peptide and / or c) detection of the amount of mutated protein with antibodies against an immunologically detectable third and fourth peptide.

If the detection of mutations in nucleic acids takes place according to this preferred embodiment of the method according to the invention by detecting the translated proteins, a highly sensitive and specific mutation detection is made possible. Only proteins that are the result of in vitro translation with the correct start codon and in the desired reading frame are recorded. However, non-specific by-products are not detected. Furthermore, the detection limit of the detection is of the order of magnitude, which even allows detection of mutations in samples which contain only very small amounts of mutated DNA or RNA.

If the translated proteins of the method according to the invention are detected by means of ELISA, the entire method can be automated without problems and adapted to a high-throughput system. Thus, the method according to the invention provides for the first time a method for the detection of mutations in nucleic acids, which enables rapid, highly sensitive, highly specific and automatable mutation detection in any type of DNA and / or RNA.

If the translated proteins are detected by chromatographic or electrophoretic separation and subsequent detection, a further parameter, namely the size of the translated proteins, provides information about the mutations to be detected. In a further embodiment of the invention, an enrichment of the nucleic acid sought is carried out before step (a) of the method according to the invention. The nucleic acid sought is preferably enriched by hybridization to a sequence which is complementary to the sequence sought and which may be immobilized. This step is not necessary for the actual mutation detection, but additionally increases the sensitivity of the subsequent method according to the invention. Enrichment of the nucleotide sequence sought is particularly favorable when the nucleic acid sought is present in the sample in sufficient copy number but only in a very low concentration.

Due to its broad applicability, its high sensitivity, its high specificity and the possibility of automation, the method according to the invention can be used in a wide range of medical diagnostics. For example, the method for tumor diagnosis (early tumor diagnosis, course diagnosis) and tumor characterization (tumor typing) can be used, since practically all mutations of a tumor suppressor gene in the DNA from tumor cells can be detected with the aid of the method according to the invention. For example, body fluids such as stool or urine from a patient can be examined for tumor-specific mutations in DNA with the aim of non-invasive diagnosis of intestinal or bladder tumors. As an analysis object, z. B. the tumor suppressor gene APC, which is mutated in more than 80% of all intestinal tumors, with more than 90% of all APC mutations leading to a premature translation stop. In this case, the total amount of protein is preferably detected (step (a) of protein detection (i)) via a specially developed antibody against the APC gene. In addition to the tumor suppressor gene APC, other tumor suppressor genes such as p53, DCC, msh l, GTBP, mlh l, mlh2, DPC4, RB, WT1, WT2, NF1, NF2, BRCA 1 and BRCA2 are also suitable as analysis objects for the early or course diagnosis of tumors in the lungs, pancreas, throat, abdomen, chest and brain, for tumor Typing in surgically removed tumors from the lungs, intestines and bladder and for the detection of inherited mutations and thus of hereditary diseases in germ, embryo or blood cells.

Tables 1 to 3 show different types of tumors and the associated tumor suppressor genes, which can be diagnosed or typed using the method according to the invention, and the body fluids of a patient to be examined according to the corresponding analysis object.

Table 1: Examples of molecular genetic analysis in early cancer diagnosis

Table 2: Examples for the course diagnosis with molecular genetic methods

Table 3: Examples of tumor typing using molecular genetic methods

Another application is in the analysis of germline mutations. It is advantageous to use intact mRNA from embryonic cells or blood cells for mutation detection. This strategy has the advantage that the edges of the analyzing fragment are not delimited by exon-intron transitions and longer sequence sections can be analyzed in one pass. Ideally, the entire sequence of the transcribed mRNA, ie the full length of the gene in question, can be analyzed. Another object of the invention is a detection kit which contains the primer combinations based on the method according to the invention and z. B. is suitable for use in the diagnosis of tumors, in particular intestinal tumors and bladder tumors.

The detection kit according to the invention for the detection of mutations in nucleic acids comprises:

(a) at least one forward primer in the 5 '→ 3' direction suitable for the amplification reaction, which comprises the following elements: (i) a promoter sequence for transcription,

(ii) a translation start motif that translates into

Reading frame of the wilt-type nucleic acid enables (iii) at least one sequence section which codes for a detectable first peptide and (iv) a sequence section which is sufficiently identical to that

Sequence at the 5 'end of the nucleic acid sought to allow specific attachment and amplification

(b) at least one reverse primer in the 3 '→ 5' direction suitable for the amplification reaction, which comprises the following elements: (i) a sequence section which is sufficiently complementary to the

Sequence at the 3 'end of the nucleic acid sought to allow specific attachment and amplification

(ii) at least one sequence section which codes for at least one detectable second peptide, which is different from the first peptide, and in the reading frame of the sought

Wilt-type nucleic acid is

(iii) Sequence sections which code for at least one detectable third and fourth peptide, which are different from the first and second peptide, and which lie in the two reading frames, which are shifted by the

Reading frame of the wild-type nucleic acid sought arise and (iv) three stop motifs, one for each possible reading frame,

(c) optionally deoxyribonucleotides,

(d) optionally an enzyme suitable for extending the primers,

(e) optionally a buffer suitable for the amplification reaction, optionally further auxiliaries,

(f) optionally cell lysate with high transcription and translation activity,

(g) optionally detection reagents for the various detectable peptides, (h) optionally reagents for protein enrichment and

(i) if necessary, reagents for enriching the sought

Nucleic acid, whereby the sequence of sequence sections (ii) and (iii) of the reverse primer can be interchanged.

The detection kit according to the invention for the detection of mutations in nucleic acids is preferably based on the use of the method described above. An essential feature of the detection kit according to the invention are the two novel forward primers and reverse primers, which have sequence segments which code for at least one detectable first peptide, at least one detectable second peptide and at least one detectable third and fourth peptide, as described above ,

The enzyme suitable for the extension is preferably a thermostable. DNA polymerase that has a 5'-3 'polymerase. The enzyme may also contain 3'-5 'exonuclease activity ("proof reading").

The forward primer preferably has an identical sequence section (iv) and the reverse primer has a complementary sequence section (i) which hybridize with genomic DNA of a tumor suppressor gene from tumor cells, in particular APC-DNA. In a preferred embodiment of the detection kit, the forward primer contains sequence segments (iii) which code for two different detectable first peptides and the reverse primer sequence segments (ii) which code for the same third and fourth detectable peptides. If the detectable peptides are immunologically detectable peptides, the translated proteins (c) are detected and thus the mutation detection is preferably carried out by ELISA.

Another object of the invention is a multi-tag vector as a cloning vector and / or expression vector, which is based on the principle of the primer combinations according to the invention.

The multi-tag vector has a multi-tag sequence that comprises the following sequence sections in the 5 '→ 3' direction:

(a) optionally an expression control sequence comprising a promoter and a translation start motif

(b) at least one sequence section, e.g. B. one to three sequence sections, each of which codes for a different detectable first peptide, the or the

Sequence sections lie in the reading frame of the start codon of a nucleic acid cloned into the multiple cloning site,

(c) a multiple cloning site (MCS) for cloning a nucleic acid, (d) one to three sequence segments which code for different detectable second peptides which are different from the detectable first peptides, the sequence segments in the same or different reading frames with respect to one nucleic acid cloned into the MCS, z. B. (i) all lie in the expected reading frame of the cloned nucleic acid or (ii) the first sequence section lies in the expected reading frame of the cloned nucleic acid and the second and third sequence section in the There are reading frames that result from shifting the expected reading frame of the cloned nucleic acid and (e) three stop codons, one for each possible reading frame.

An essential feature of the multi-tag vector according to the invention are the sequence sections (b) and (d) which code for different detectable first and different detectable second peptides. The detectable first peptides are different from each other. The detectable second peptides are different from the first peptides and different from one another. The sequence sections are freely selectable, but have a length in the range from 6 to 90 nucleotides, preferably 9 to 60 nucleotides and particularly preferably 9 to 45 nucleotides and code for detectable peptides that are either direct and / or indirect, eg. B. are detectable via amino acid side chain labeling. In addition, at least one restriction site for restriction endonucleases is located between the individual sequence sections of the multi-tag sequence. The multiple cloning site (MCS) preferably contains at least one restriction site for restriction endonucleases for cloning a nucleic acid. In a preferred embodiment of the invention, the multi-tag sequence of the multi-tag vector has one of those in SEQ. ID NO. 21 and SEQ. ID NO. 22 sequences indicated.

In addition, the multi-tag vector is optionally provided with further customary elements required for prokaryotic and / or eukaryotic replication and expression, such as, for. B. ori, selection marker (described, inter alia, in Sambrook et. Al).

The multi-tag vector according to the invention can be used as a cloning and / or expression vector for prokaryotic and / or eukaryotic host cells. He can e.g. B. can be used to determine and / or verify the reading frame of a cloned nucleic acid. This will a nucleic acid to be examined first. cloned into the multiple cloning site of the multi-tag vector. The resulting expression plasmid is then transformed into eukaryotic and / or prokaryotic cells for later expression. After expression has taken place, the reading frame of the cloned nucleic acid can be determined by the presence of the various C-terminal detectable second peptides of the expressed translation product. The detectable peptides can be detected directly or indirectly, as described above. The peptides are preferably detected directly via specific antibodies against the various detectable peptides.

Furthermore, the multi-tag vector can be used to test the suitability of the various detectable first and second peptides for the analysis and / or purification of a protein which is encoded by the cloned nucleic acid in one step. For this purpose, the nucleic acid to be cloned is cloned into the multiple cloning site of the multi-tag vector and the expression plasmid thus formed is transformed for expression into eukaryotic and / or prokaryotic cells. The translation product is N-terminally and C-terminally fused to various detectable first and second peptides. These peptides can now be tested in the application in question. Since the individual sequence sections of the multi-tag sequence are delimited by restriction sites, the gene can be cut out of the multi-tag vector together with the appropriate detectable peptide after analysis and ligated into another vector for the actual application.

The following examples and figures are intended to illustrate the invention in more detail. Example 1: Method for the detection of mutations

The method according to the invention is intended to detect mutations in DNA from a stool sample from a possible intestinal tumor patient.

Example 1 a: Dral restriction of 100 μl stool DNA

A Dral restriction cleavage was carried out with 100 μ \ DNA of a stool sample from a possible intestinal tumor patient according to known process techniques and under conventional restriction conditions (Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1 989).

Example 1 b: APC-DNA enrichment

10 μ \ streptavidin-Dynabeads were washed twice with 40 μl 1 x B&W buffer (5 mM Tris-HCl pH 7.5, 0.5 mM EDTA; 1 M NaCI) and then in 100 μ 2 × B&W buffer resuspended. 100 μ \ of the Dral-restricted stool DNA (Example 1 a) were treated with 10 pmol APC1 b-biotin primer (sequence: δ'-TTAAAATATGCCACAGATATTCCTTCATCACAGAAA CAGT-3 ', annealing with APC gene in the range from nt 3559 to nt 3598; 10 pmol / μl) mixed. The DNA was denatured in the PCR device for 5 min at 95 ° C. This was followed by an annealing step for 1 0 min at 56 ° C with subsequent cooling for 10 min at 4 ° C. The DNA was mixed with the Dynabeads and the mixture was incubated overnight at room temperature on a roller. The Dynabeads were then separated with a magnet and the supernatant removed. The Dynabeads were washed twice with 200 μ \ 1 x B&W buffer and once with 500 μ \ distilled water. The APC-DNA-bound Dynabeads were used completely in a subsequent 50 μ \ PCR reaction. Example 1 c: PCR amplification

The Dynabeads with bound APC-DNA produced in Example 1b were mixed with 5.0 μ \ PCR buffer (1 ×), 5.0 vl BSA (1 μglμ \), 1, 0 μ \ dNTP (1 0 mM each) , 2.0 vl 5'-primer (sequence: 5'-GGATCCTAATACGACTCACTA TAGGAACAGACCACCATGTACCCCTACGACGTGCCCGACTACGCCATG TACCCCTACGACGTGCCCGACTACGCCCCTTCATCACAGAAACAGTC-3 ', the 5'-primer contains the area with one tag and one copy of the promoter with one promoter and one transcript which is identical with the sequence of nt 3580 to nt 3600 of the APC gene is 1 0 pmol / μi), 2.0 μ \ 3 'primer (sequence: 5'-CTACGGTGCTGTCCAGGCCC AGCAGGGGGTTGGGGATGGGCTTGCCCGGTGCTGTCCAGGCCCAGCAG GGGGTTGGGGATGGGCTTGCCCCTTGCCGTCGATAAGCCTGGGGTCCA CCTGGTCCTCTGACTTTGTTGGCATGGCAG-3', the 3 ' -Primer contains a region which is complementary to the sequence nt 4759 to nt 4779 of the APC gene, the protein C tag and twice the V5 tag each in the frame alternative to the reading frame of the APC gene and a stop codon; 10 pmol / μl) and 0.5 μ \ HotStarTaq-Polyme lawn (5 U / l) mixed and the mixture made up to a total volume of 50 μ \ with distilled water. The PCR mixture thus prepared was subjected to the following PCR program in a PCR device: (i) a denaturation cycle:

95 ° C, 1 5 min (ii) forty PCR cycles: (a) denaturation 95 ° C, 30 sec

(b) Annealing 56 ° C, 1 min

(c) elongation 72 ° C, 1 min, 30 sec.

The ^'thus obtained PCR product was prepared by known methods (Sambrook et al, Molecular Cloning. A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1989) purified. Example 1 d: In vitro transcription and translation

20 μ of the TNT T7 PCR Quick Master Mix (from Clontech) were mixed with 0.5 μ methionine (1 mM), 2.0 μ distilled water and 2.5 μ PCR product. The mixture was incubated at 30 ° C for 90 min.

Example 1 e: APC protein enrichment

Suitable beads, e.g. Ni-NTA magnetic beads, protein G agarose with bound antibodies, etc. were washed with a suitable buffer (depending on the beads used, for example PBS). The beads were then taken up in 20 μ \ of a suitable buffer (depending on the beads used, for example PBS) and mixed with 20 μ \ of the TNT reaction mixture from Example 1 d. The mixture was incubated overnight at 4 ° C. on a roller. The beads were separated using a magnet or centrifuge and the supernatant removed. The beads were then washed twice with 200 / vl buffer and resuspended in 20 μl of 1 × SDS loading solution.

Example 1f: SDS-PAGE

1-5 μ \ of the TNT reaction mixture from Example 1 d or 1-5 μ \ eluate from Example 1 e were applied to a 1 2% SDS-polyacrylamide gel (acrylamide: bisacryamide 37, 5: 1) and a conventional SDS- Polyacrylamide gel electrophoresis carried out (see for example Sambrook et al., Supra).

Example 1 g: Western blot

After SDS-polyacrylamide gel electrophoresis had been completed, a Semidry Western blot was carried out using a conventional PVDF membrane Procedures carried out (see Sambrook et al., Supra). The PVDF membrane was then removed and incubated for 1 h at room temperature in blocking solution (PBS, 0.1% Tween, 5% skimmed milk powder). The PVDF membrane was then incubated for 1 h at room temperature in antibody solution (anti-HA peroxidase 1: 5000, anti-ProtC 1: 400, anti-V5 1: 1 0000) and three times for 1 min each at room temperature with washing solution (PBS, 0.1% Tween). The membrane was then treated for 1 h at room temperature with a second antibody solution (anti-mouse HRP) and washed three times for 10 min at room temperature with washing solution (PBS, 0.1% Tween). The detection was carried out with ECL-Plus reagent.

Characters:

FIG. 1 shows an overview of the method according to the invention for the detection of mutations in nucleic acids. Starting from purified DNA or RNA, the nucleic acid copies to be analyzed are fished by hybridization to immobilized complementary sequences. When using RNA, reverse transcription is then carried out. The nucleic acid sequence is then amplified in a conventional PCR, using primer combinations according to the invention which comprise specific forward primers and specific reverse primers which allow a distinction to be made between translation products of a wild-type nucleic acid and a mutated nucleic acid. In the subsequent in vitro transcription and translation, three combinations (I to III) of proteins can arise. To increase the detection sensitivity, part of the wild-type protein can be separated. There are two options for the subsequent detection of the mutation, differential ELISA (left) or SDS-polyacrylamide gel electrophoresis with subsequent Western blotting (right). FIG. 2A schematically shows the technique of enriching the gene copies of interest (here: APC genes) by hybridization. Oligonucleotides of the sequence of the APC gene which carry a biotin label are added to the DNA purified from stool. After hybridization with the APC gene copies, the oligonucleotides are fished from the solution with the aid of streptavidin-coupled magnetic beads. After a washing step, the enriched APC gene copies can be used as templates in a PCR reaction.

FIG. 2B shows an agarose gel which illustrates the enrichment of a sought-after DNA sequence from human stool by hybridization to an immobilized synthetic sequence which is complementary to the sought-after sequence. The agarose gel shows the result of PCR reactions based on a DNA sample, the APC gene serving as template in a direct PCR amplification (lanes 2 and 3). After the desired sequence has been enriched by hybridization to a specific complementary primer, the gene can be amplified from the pellet (lanes 6 and 7), but not from the supernatant (lanes 6S and 7S). Conversely, the gene cannot be amplified from the pellet (lanes 4 and 5) without a specific complementary primer, but from the supernatant (lanes 4S and 5S). A DNA marker was applied to lane M and a negative control without DNA was applied to lane 1.

FIG. 3A shows a Western blot in which - starting from control DNA or also human genomic DNA from stool - the various proteins transcribed and translated in vitro can be detected. The proteins were detected with antibodies against the various detectable peptides. A negative control was plotted on lane A. dest. Based on plasmid DNA, the result of the Western blot shows the non-mutated full-length APC protein (wt, APC wt), the protein with a reading frame shift mutation that does not result in a Shortening leads (frameshift) and the protein with a mutation that leads to an early stop of translation (stop, APC Δ).

FIG. 3B shows a Western blot with the result of DNA analysis using the developed method. Lane 1 to 3: plasmid DNA as positive control samples. The different sizes of the fragments of the normal wild-type gene and of the two different mutated sequences which lead to stop mutations can be recognized (stopl, stop2). Lane 4: Tumor DNA shows the normal sequence (wt) and the truncated fragment (mut). Lanes 5 to 8: DNA from two different stool samples (S1, S2) shows the mutated in addition to the normal fragment in both cases. The analyzes were carried out in duplicate. Lane 9: negative control without DNA.

FIG. 4 shows an exemplary illustration of a multi-tag vector. The numbers stand for restriction interfaces. The multiple cloning site (MCS) has 6 interfaces. The interfaces are identified by horizontal lines above the sequence. The sequence sections coding for detectable first and second peptides, the start and stop codons are underlined. A. The multi-tag sequence has that in SEQ. ID NO. 21 indicated sequence. All sequence segments which code for detectable first and second peptides lie in the reading frame defined by the start codon. B. The multi-tag sequence has that in SEQ. ID NO. 22 indicated sequence. Only the sequence sections before the MCS, which code for detectable first peptides, lie in the reading frame (x) defined by the start codon. Behind the MCS are the sequence sections for detectable second peptides in alternatives to that of. Start codon different reading frames (x + 1, x + 2).

FIG. 5 shows some examples of possible peptides with an amino acid sequence as well as a corresponding detection reagent (MAK: monoclonal antibody, pAK: polyclonal antibody) that bind to the protein to be analyzed N- or C-terminal can be fused. The nucleic acid sequences required for this are in SEQ. ID NO: 1 - 20 indicated.

Claims

Expectations

1 . A method for the detection of mutations in nucleic acids comprising the steps of: a) amplifying the nucleic acid sought to obtain a double-stranded amplification product using primer combinations which are selected in such a way that as a mpl if ik atio n sp rod u kt has a nucleotide sequence which (i) is translatable and (ii) allows a distinction to be made between translation products of a wild-type nucleic acid and the translation products of a mutated nucleic acid, b) transcribing and translating the amplification products in vitro and c) detecting the translated proteins.

2. The method according to claim 1, characterized in that an enrichment of the sought before the amplification

Nucleic acid is performed.

3. The method according to claim 2, characterized in that the desired sequence is enriched by hybridization to a sequence which is complementary to the sought sequence and which can be immobilized.

4. The method according to any one of claims 1 to 3, characterized in that the amplification of a sought DNA sequence by PCR and the amplification of a sought RNA sequence is carried out by RT-PCR.

5. The method according to any one of claims 1 to 4, characterized in that one uses a primer combination comprising in the 5 '- * 3' direction with a specific forward primer

(a) a promoter sequence for transcription,

(d) a sequence section which is sufficiently identical to the sequence at the 5 'end of the nucleic acid sought to allow specific attachment and amplification and in the 3' → 5 'direction a specific reverse primer with

(a) a sequence segment which is sufficiently complementary to the sequence at the 3 'end of the nucleic acid sought to allow specific attachment and amplification,

(b) at least one sequence section which codes for at least one detectable second peptide, which is different from the first peptide, and which is in the reading frame of the wild-type nucleic acid sought,. (c) Sequence sections which code for at least one detectable third and fourth peptide, which are different from the first and second peptide, and which lie in the two reading frames, which are caused by shifting the Reading frames of the wild-type nucleic acid sought arise and (d) three stop motifs, one for each possible reading frame, whereby the sequence of sequence sections (b) and (c) of the reverse primer can be interchanged.

6. The method according to claim 5, characterized in that the forward primer contains sequence sections (c) which code for two different detectable first peptides.

7. The method according to claim 5, characterized in that the reverse primer contains sequence sections (c) which code for an identical third and fourth detectable peptide.

8. The method according to any one of claims 5 to 7, characterized in that the peptides either directly or / and indirectly, for. B. be detected via an amino acid side chain label.

9. The method according to any one of claims 5 to 8, characterized in that immunologically detectable peptides are used.

1 0. The method according to any one of claims 5 to 9, characterized in that the peptides have a length in the range of 3 - 30 amino acids.

1 . Method according to one of claims 5 to 1 0, characterized in that a peptide is used which consists of peptides coding by the in SEQ. ID NO. 1-20 nucleic acid sequences shown is selected.

2. The method according to any one of claims 1 to 1 1, characterized in that the in vitro transcription and translation of the

Amplification products (b) by adding cell lysate.

3. The method according to any one of claims 1 to 1 2, characterized in that the detection of the translated proteins (c)

(i) at least partially removing non-mutated ones

Wild-type protein, (ii) immobilization of the translated proteins and (iii) protein detection.

4. The method according to claim 1 3, characterized in that the removal of the non-mutated wild-type protein (i) by precipitation with matrices or immobilized antibodies that bind to a detectable second peptide takes place.

5. The method according to claim 1 3, characterized in that the immobilization of the translated proteins (ii) via a detectable first peptide.

1 6. The method according to claim 1 3, characterized in that the protein detection (iii) comprises the following steps:

(a) detection of the total amount of proteins by determining a further detectable first peptide,

(b) detection of the amount of non-mutated wild-type protein by determination of a detectable second peptide and / or

(c) Detecting the amount of mutant protein by determining a detectable third and fourth peptide.

1 7. The method according to claim 1 6, characterized in that the protein detection (iii) is carried out by means of differential ELISA.

1 8. The method according to claim 1 3, characterized in that the removal of the non-mutated wild-type protein (i) is carried out by affinity chromatography.

1 9. The method according to claim 1 3, characterized in that the immobilization of the translated proteins (ii) and the protein detection (iii) by means of SDS-polyacrylamide gel electrophoresis and subsequent Western blotting.

20. The method according to claim 1 9, characterized in that the protein detection (iii) comprises the following steps: (a) detection of the total amount of the proteins by determining a detectable first peptide, (b) detection of the amount of non-mutated wild-type protein by determination of a detectable second peptide and / or

21. Use of the method according to one of claims 1 to 20 for the detection of mutations in tumor suppressor genes.

22. Use according to claim 21, characterized in that the specific forward primer contains a sequence section (d) and the specific reverse primer contains a sequence section (a) which hybridizes with genomic DNA of a tumor suppressor gene.

23. Use according to claim 21 and 22, characterized in that the tumor suppressor gene is selected from the group consisting of APC, p53, DCC, msh 1, GTBP, mlhl, mlh2, DPC4. , RB, WT1, WT2, NF1, NF2, BRCA1 and BRCA2 genes.

24. Use according to one of claims 21 to 23 for the diagnosis and characterization of tumors, in particular bladder and intestinal tumors.

25. Use of the method according to one of claims 1 to 20 for the detection of mutations in the germline.

26. Use according to claim 25, characterized in that the nucleic acid sought is DNA and / or intact mRNA from embryonic cells or blood cells.

7. Detection kit for the detection of mutations in nucleic acids by the method according to one of claims 1 to 20, comprising: (a) at least one forward primer in the 5 '→ 3' direction suitable for the amplification reaction, which comprises the following elements:

(i) a promoter sequence for transcription,

(ii) a translation start motif that translates into

Reading frame of the wild-type nucleic acid enables (iii) at least one sequence section which codes for a detectable first peptide and

(iv) a sequence section that is sufficiently identical to the sequence at the 5 'end of the sought

Nucleic acid to a specific attachment and

To allow amplification, (b) at least one suitable for the amplification reaction

Reverse primer in 3 '→ 5' direction, which comprises the following elements:

(i) a sequence section which is sufficiently complementary to the sequence at the 3 'end of the nucleic acid sought for a specific attachment and

To allow amplification (ii) at least one sequence section which codes for a detectable second peptide which is different from the first peptide and which is in the reading frame of the wild-type nucleic acid sought,

(iii) Sequence sections which code for at least one detectable third and fourth peptide, which are different from the first and second peptide, and which lie in the two reading frames, which by shifting the reading frame of the wild-type sought

Nucleic acid arise and (iv) three stop motifs, one for each possible reading frame,

(c) optionally deoxyribonucleotides, (d) optionally a suitable one for extending the primers

Enzyme,

(e) optionally a buffer suitable for the amplification reaction and optionally further auxiliaries,

(f) optionally cell lysate with high transcription and translation activity,

(g) if necessary, detection reagents for the various detectable peptides,

(h) optionally reagents for protein enrichment and (i) where appropriate reagents for enrichment of the nucleic acid sought, it being possible for the sequence of sequence sections (i) and (ii) of the reverse primer to be interchanged.

28. Detection kit according to claim 27, characterized in that the forward primer contains sequence sections (c) which code for two different first detectable peptides.

29. Detection kit according to claim 27, characterized in that the reverse primer contains sequence sections (c) which code for an identical third and fourth detectable peptide.

30. Detection kit according to one of claims 27 to 29, characterized in that immunologically or directly detectable peptides are used.

31 Detection kit according to one of Claims 27 to 30, characterized in that the peptides have a length in the range from 3 to 30 amino acids.

32. Detection kit according to one of claims 27 to 31, characterized in that a peptide is used which consists of peptides coding by the in SEQ. ID NO. 1-20 nucleic acid sequences shown is selected.

33. Detection kit according to one of claims 27 to 32, characterized in that the enzyme is a thermostable DNA polymerase.

34. Detection kit according to one of claims 27 to 33, characterized in that the forward primer contains a sequence section (iv) and the reverse primer contains a sequence section (i) which hybridizes with genomic DNA of a tumor suppressor gene.

35. Detection kit according to claim 34, characterized in that the tumor suppressor gene is selected from the group consisting of APC, p53, DCC, msh l, GTBP, mlhl, mlh2, DPC4, RB , WT1, WT2, NF1, NF2, BRCA1 and BRCA2 genes.

36. Use of the detection kit according to one of claims 27 to 35 for the detection of mutations in tumor suppressor genes.

37. Use according to claim 36 for the diagnosis of intestinal tumors and / or bladder tumors.

38. Multi-tag vector as cloning vector and / or expression vector, characterized in that the multi-tag vector has a multi-tag sequence which comprises the following sequence sections:

(a) optionally an expression control sequence comprising a promoter and a translation start motif, (b) at least one sequence section, e.g. B. one to three

Sequence sections which code for a different detectable first peptide, the sequence section or sections being in the reading frame of the start codon of a nucleic acid cloned into the multiple cloning site, (c) a multiple cloning site (MCS) for cloning one

Nucleic acid,

(d) one to three sequence sections which code for different detectable second peptides which are different from the first peptides, the sequence sections being in the same or different reading frames with respect to a nucleic acid cloned into the MCS; B. (i) all lie in the expected reading frame of the cloned nucleic acid or (ii) the first sequence section lies in the expected reading frame of the cloned nucleic acid and the second and third sequence sections lie in the reading frame which result from shifting the expected reading frame of the cloned nucleic acid and

(e) three stop codons, one for each possible reading frame.

39. Multi-tag vector according to claim 38, characterized in that at least one restriction site is located between the individual sequence sections of the multi-tag sequence.

40. Multi-tag vector according to one of claims 38 to 39, characterized in that the multiple cloning site (MCS) contains at least one restriction site.

41. Multi-tag vector according to one of claims 38 to 40, characterized in that the multi-tag sequence each one of the SEQ. ID NO. 21 and SEQ. ID NO. Has 22 specified sequences.

42. Use of the multi-tag vector according to one of claims 38 to 41 to determine and / or verify the reading frame of a nucleic acid cloned into the multi-tag vector.

43. Use of the multi-tag vector according to any one of claims 38 to 41 to determine the suitability of the detectable first and second

Peptides for the analysis and / or purification of a recombinantly produced protein that cloned into the multi-tag vector by

Nucleic acid is encoded to test in one step.