WO2002061092A2 - Regulation de la lysyl oxydase humaine - Google Patents
Regulation de la lysyl oxydase humaine Download PDFInfo
- Publication number
- WO2002061092A2 WO2002061092A2 PCT/EP2002/000807 EP0200807W WO02061092A2 WO 2002061092 A2 WO2002061092 A2 WO 2002061092A2 EP 0200807 W EP0200807 W EP 0200807W WO 02061092 A2 WO02061092 A2 WO 02061092A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- lysyl oxidase
- polypeptide
- seq
- polynucleotide
- amino acid
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0012—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7)
- C12N9/0014—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on the CH-NH2 group of donors (1.4)
- C12N9/0022—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on the CH-NH2 group of donors (1.4) with oxygen as acceptor (1.4.3)
Definitions
- the invention relates to the regulation of human lysyl oxidase.
- Lysyl oxidase (EC 1.4.3.13) is an extracellular copper-dependent enzyme, which catalyzes the oxidative deamination of peptidyl lysine residues in precursors of various collagens and elastins, yielding alpha-aminoadipic-delta-semialdehyde. Because of the importance of this enzyme, there is a need in the art to identify related enzymes, which can be regulated to provide therapeutic effects.
- Yet another embodiment of the invention is a method of screening for agents which decrease extracellular matrix degradation.
- a test compound is contacted with a lysyl oxidase polypeptide comprising an amino acid sequence selected from the group consisting of:
- amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO: 2; the amino acid sequence shown in SEQ ID NO: 2;
- amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO: 28; and the amino acid sequence shown in SEQ ID NO: 28.
- Binding between the test compound and the lysyl oxidase polypeptide is detected.
- a test compound which binds to the lysyl oxidase polypeptide is thereby identified as a potential agent for decreasing extracellular matrix degradation.
- the agent can work by decreasing the activity of the lysyl oxidase.
- Another embodiment of the invention is a method of screening for agents which decrease extracellular matrix degradation.
- a test compound is contacted with a poly- nucleotide encoding a lysyl oxidase polypeptide, wherein the polynucleotide comprises a nucleotide sequence selected from the group consisting of:
- nucleotide sequences which are at least about 55% identical to the nucleotide sequence shown in SEQ ID NO: 1; the nucleotide sequence shown in SEQ ID NO: 1; nucleotide sequences which are at least about 55% identical to the nucleotide sequence shown in SEQ ID NO: 26; and the nucleotide sequence shown in SEQ ID NO: 26.
- a test compound which binds to the polynucleotide is identified as a potential agent for decreasing extracellular matrix degradation.
- the agent can work by decreasing the amount of the lysyl oxidase through interacting with the lysyl oxidase mRNA.
- Another embodiment of the invention is a method of screening for agents which regulate extracellular matrix degradation.
- a test compound is contacted with a lysyl oxidase polypeptide comprising an amino acid sequence selected from the group consisting of:
- amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO: 2; the amino acid sequence shown in SEQ ID NO: 2;
- amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO: 28; and the amino acid sequence shown in SEQ ID NO: 28.
- a lysyl oxidase activity of the polypeptide is detected.
- a test compound which increases lysyl oxidase activity of the polypeptide relative to lysyl oxidase activity in the absence of the test compound is thereby identified as a potential agent for increasing extracellular matrix degradation.
- a test compound which decreases lysyl oxidase activity of the polypeptide relative to lysyl oxidase activity in the absence of the test compound is thereby identified as a potential agent for decreasing extracellular matrix degradation.
- Even another embodiment of the invention is a method of screening for agents which decrease extracellular matrix degradation.
- a test compound is contacted with a lysyl oxidase product of a polynucleotide which comprises a nucleotide sequence selected from the group consisting of:
- nucleotide sequences which are at least about 55% identical to the nucleotide sequence shown in SEQ ID NO: 1; the nucleotide sequence shown in SEQ ID NO: 1;
- nucleotide sequences which are at least about 55% identical to the nucleotide sequence shown in SEQ ID NO: 26; and the nucleotide sequence shown in SEQ ID NO: 26.
- Binding of the test compound to the lysyl oxidase product is detected.
- a test com- pound which binds to the lysyl oxidase product is thereby identified as a potential agent for decreasing extracellular matrix degradation.
- Still another embodiment of the invention is a method of reducing extracellular matrix degradation.
- a cell is contacted with a reagent which specifically binds to a polynucleotide encoding a lysyl oxidase polypeptide or the product encoded by the polynucleotide, wherein the polynucleotide comprises a nucleotide sequence selected from the group consisting of:
- nucleotide sequences which are at least about 55% identical to the nucleotide sequence shown in SEQ ID NO: 1 ; the nucleotide sequence shown in SEQ ID NO: 1;
- nucleotide sequences which are at least about 55% identical to the nucleotide sequence shown in SEQ ID NO: 26; and the nucleotide sequence shown in SEQ ED NO: 26. Lysyl oxidase activity in the cell is thereby decreased.
- the invention thus provides a human lysyl oxidase that can be used to identify test compounds that may act, for example, as activators or inhibitors at the enzyme's active site.
- Human lysyl oxidase and fragments thereof also are useful in raising specific antibodies that can block the enzyme and effectively reduce its activity.
- Fig. 1 shows the DNA-sequence encoding a lysyl oxidase Polypeptide (SEQ ID NO: 1
- Fig. 2 shows the amino acid sequence deduced from the DNA-sequence of Fig.1
- Fig. 3 shows the amino acid sequence of the protein identified by SwissProt
- Fig. 4 shows the DNA-sequence encoding a lysyl oxidase Polypeptide (SEQ ID NO: 4).
- Fig. 5 shows the amino acid sequence of a lysyl oxidase Polypeptide (SEQ ID NO: 5).
- Fig. 6 shows the DNA-sequence encoding a lysyl oxidase Polypeptide (SEQ ID NO: 1
- Fig. 7 shows the DNA-sequence encoding a lysyl oxidase Polypeptide (SEQ ID NO: 7).
- Fig. 8 shows the DNA-sequence encoding a lysyl oxidase Polypeptide (SEQ ID NO: 8).
- Fig. 9 shows the DNA-sequence encoding a lysyl oxidase Polypeptide (SEQ ID NO: 9).
- Fig. 10 shows the DNA-sequence encoding a lysyl oxidase Polypeptide (SEQ ID NO: 10).
- Fig. 11 shows the DNA-sequence encoding a lysyl oxidase Polypeptide (SEQ ID NO: 1
- Fig. 12 shows the DNA-sequence encoding a lysyl oxidase Polypeptide (SEQ ID NO: 1
- Fig. 13 shows the DNA-sequence encoding a lysyl oxidase Polypeptide (SEQ ID NO: 1
- Fig. 14 shows the DNA-sequence encoding a lysyl oxidase Polypeptide (SEQ ID NO: 14).
- Fig. 15 shows the DNA-sequence encoding a lysyl oxidase Polypeptide (SEQ ID NO: 15).
- Fig. 16 shows the DNA-sequence encoding a lysyl oxidase Polypeptide (SEQ ID NO: 1
- Fig. 17 shows the DNA-sequence encoding a lysyl oxidase Polypeptide (SEQ ID NO: 17).
- Fig. 18 shows the DNA-sequence encoding a lysyl oxidase Polypeptide (SEQ ID NO: 18).
- Fig. 19 shows the DNA-sequence encoding a lysyl oxidase Polypeptide (SEQ ID NO: 19).
- Fig. 20 shows the DNA-sequence encoding a lysyl oxidase Polypeptide (SEQ TD NO: 20).
- Fig. 21 shows the DNA-sequence encoding a lysyl oxidase Polypeptide (SEQ ID NO: 1
- Fig. 22 shows the DNA-sequence encoding a lysyl oxidase Polypeptide (SEQ ID NO: 1
- Fig. 23 shows the DNA-sequence encoding a lysyl oxidase Polypeptide (SEQ ID NO: 1
- Fig. 24 shows the amino acid sequence deduced from the DNA-sequence of Fig.22 (SEQ ID NO: 28).
- Fig. 25 shows the amino acid sequence of the protein identified by Swissnew Accession No. Q9Y4K0
- Fig. 26 shows the BLASTP - alignment of LBRI_332_protein (SEQ ID NO: 2) against swiss
- Fig. 27 shows the BLOCKS search results.
- Fig. 28 shows the HMMPFAM - alignment of 332_protein (SEQ ID NO: 2) against pfam
- Fig. 29 shows the Expression profile of human lysyl oxidase.
- Fig. 30 shows the Expression profile of human lysyl oxidase.
- Fig. 31 shows the Expression profile of human lysyl oxidase.
- Fig. 32 shows the BLASTP - alignment of 332_ext__protein (SEQ ID NO: 28) against swissnew
- Fig. 33 shows the HMMPFAM - alignment of 332_ext__protein (SEQ ID NO: 28) against pfam
- Fig. 34 shows the HMMPFAM - alignment of 332_ext_protein (SEQ TD NO: 28) against pfam
- Fig. 35 shows the HMMPFAM - alignment of 332_ext_protein (SEQ ID NO: 28) against pfam
- Fig. 36 shows the HMMPFAM - alignment of 332_ext_protein (SEQ ID NO: 28) against pfam
- Fig. 37 shows the HMMPFAM - alignment of 332_ext_protein (SEQ ID NO: 28) against pfam
- the invention relates to an isolated polynucleotide being selected from the group consisting of: a) a polynucleotide encoding a lysyl oxidase polypeptide comprising an amino acid sequence selected from the group consisting of:
- amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO: 2; the amino acid sequence shown in SEQ ID NO: 2;
- amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO: 28; and the amino acid sequence shown in SEQ ID NO: 28.
- e a polynucleotide which represents a fragment, derivative or allelic variation of a polynucleotide sequence specified in (a) to (d) and encodes a lysyl oxidase polypeptide.
- Human lysyl oxidase comprises the amino acid sequence shown in SEQ ID NO: 2 or 28. Coding sequences for human lysyl oxidase are shown in SEQ ID NO: 1 and 26. These sequence is contained within the longer sequences shown in SEQ TD
- Nu erous ESTs with sequences identical to regions of the target are expressed in tumors and highly proliferative tissues (e.g., retinoblastoma, ovarian cancer, trabecular bone cells, pancreatic adenocarcinoma, testis, 8-9 week fetus, malignant melanoma metastatic to lymph node, pooled human melanocyte, fetal heart, pregnant uterus, well-differentiated endometrial adenocarcinoma, seven pooled tumors, 20 week-post conception fetal_liver_spleen, senescent fibroblasts, pooled kidney tumors, and breast).
- highly proliferative tissues e.g., retinoblastoma, ovarian cancer, trabecular bone cells, pancreatic adenocarcinoma, testis, 8-9 week fetus, malignant melanoma metastatic to lymph node, pooled human melanocyte, feta
- Human lysyl oxidase is 49% identical over 218 amino acids to swiss
- BLOCKS search shows several lysyl oxidase copper-binding regions in the target sequence (Fig. 27).
- HMMPFAM search also identifies a lysyl oxidase pFAM domain at e- value of 2.1 e- 150 (FIG.3).
- lysyl oxidase of the invention is expected to be useful for the same purposes as previously identified lysyl oxidase enzymes. Lysyl oxidase activity may be related to chronic fibrosis in lung, liver, kidney and related diseases (1, 2, 3). In many cases of malignant transformation, lysyl oxidase is down-regulated, mainly at the mRNA level. Expression of lysyl oxidase has been correlated with suppression of transformed phenotype, implicating its potential role in tumor suppression, (see 4 and
- lysyl oxidase activity up-regulation has also been observed in a few malignancies, such as squamous cell carcinoma (6) and invasive and/or metastatic breast cancer cell lines (7).
- a study of several osteosarcoma cell clones indicates that lysyl oxidase activity appears not to be closely related to lysyl oxidase messenger RNA levels among the different cell clones (8). It is, therefore, possible that products of related genes may be involved in the observed lysyl oxidase activity (8).
- human lysyl oxidase is believed to be useful in therapeutic methods to treat disorders such as COPD, cancer, cardiovascular disease, genitourinary diseases, and metabolic diseases.
- Human lysyl oxidase also can be used to screen for human lysyl oxidase activators and inhibitors.
- Polvpeptides are believed to be useful in therapeutic methods to treat disorders such as COPD, cancer, cardiovascular disease, genitourinary diseases, and metabolic diseases.
- Human lysyl oxidase also can be used to screen for human lysyl oxidase activators and inhibitors.
- Human lysyl oxidase polypeptides according to the invention comprise at least 6, 10, 15, 20, 25, 50, 75, 100, 125, 150, 175, 200, 225, 250, or 265 contiguous amino acids selected from the amino acid sequence shown in SEQ ID NO: 2 or 28 or a biologically active variant thereof, as defined below.
- a lysyl oxidase polypeptide of the invention therefore can be a portion of a lysyl oxidase protein, a full-length lysyl oxidase protein, or a fusion protein comprising all or a portion of a lysyl oxidase protein.
- naturally or non-naturally occurring lysyl oxidase polypeptide variants have amino acid sequences which are at least about 50, 55, 60, 65, or 70, preferably about 75, 80, 85, 90, 96, 96, 98, or 99% identical to the amino acid sequence shown in SEQ ID NO: 2 or 28 or a fragment thereof. Percent identity between a putative lysyl oxidase polypeptide variant and an amino acid sequence of SEQ ID NO: 2 or 28 is determined by conventional methods. See, for example, Altschul et al, Bull. Math.
- the trimmed initial regions are examined to determine whether the regions can be joined to for man approximate alignment with gaps.
- the highest scoring regions of the two amino acid sequences are aligned using a modification of the Needleman-Wunsch- Sellers algorithm (Needleman and Wunsch, J. Mol. Biol.48:444 (1970); Sellers, SLAM J. Appl. Math. 26:787 (1974)), which allows for amino acid insertions and deletions.
- FASTA FASTA program by modifying the scoring matrix file ("SMATPJX"), as explained in Appendix 2 of Pearson, Meth. Enzymol. 183:63 (1990).FASTA can also be used to determine the sequence identity of nucleic acid molecules using a ratio as disclosed above. For nucleotide sequence comparisons, the ktup value can range between one to six, preferably from three to six, most preferably three, with other parameters set as default.
- Variations in percent identity can be due, for example, to amino acid substitutions, insertions, or deletions.
- Amino acid substitutions are defined as one for one amino acid replacements. They are conservative in nature when the substituted amino acid has similar structural and/or chemical properties. Examples of conservative replacements are substitution of a leucine with an isoleucine or valine, an aspartate with a glutamate, or a threonine with a serine.
- Amino acid insertions or deletions are changes to or within an amino acid sequence. They typically fall in the range of about 1 to 5 amino acids.
- Guidance in determining which amino acid residues can be substituted, inserted, or deleted without abolishing biological or immunological activity of a lysyl oxidase polypeptide can be found using computer programs well known in the art, such as DNASTAR software.
- Whether an amino acid change results in a biologically active lysyl oxidase polypeptide can readily be determined by assaying for lysyl oxidase activity, as described for example, in Konishi et al, Gastroenterology 89, 709-15, 1985.
- Fusion proteins are useful for generating antibodies against lysyl oxidase polypeptide amino acid sequences and for use in various assay systems. For example, fusion proteins can be used to identify proteins that interact with portions of a lysyl oxidase polypeptide. Protein affinity chromatography or library-based assays for protein- protein interactions, such as the yeast two-hybrid or phage display systems, can be used for this purpose. Such methods are well known in the art and also can be used as drug screens.
- a lysyl oxidase polypeptide fusion protein comprises two polypeptide segments fused together by means of a peptide bond.
- the first polypeptide segment comprises at least 6, 10, 15, 20, 25, 50, 75, 100, 125, 150, 175, 200, 225, 250, or 265 contiguous amino acids of SEQ ID NO: 2 or 28 or of a biologically active variant, such as those described above.
- the first polypeptide segment also can comprise full- length lysyl oxidase protein.
- the second polypeptide segment can be a full-length protein or a protein fragment.
- Proteins commonly used in fusion protein construction include ⁇ -galactosidase, ⁇ - glucuronidase, green fluorescent protein (GFP), autofluorescent proteins, including blue fluorescent protein (BFP), glutathione-S-transferase (GST), luciferase, horseradish peroxidase (HRP), and chloramphenicol acetyltransferase (CAT).
- epitope tags are used in fusion protein constructions, including histidine (His) tags, FLAG tags, influenza hemagglutinin (HA) tags, Myc tags, VSV-G tags, and thioredoxin (Trx) tags.
- Other fusion constructions can include maltose binding protein (MBP), S-tag, Lex a DNA binding domain (DBD) fusions, GAL4 DNA binding domain fusions, and herpes simplex virus (HSV) BP16 protein fusions.
- a fusion protein also can be engineered to contain a cleavage site located between the lysyl oxidase polypeptide-encoding sequence and the heterologous protein sequence, so that the lysyl oxidase polypeptide can be cleaved and purified away from the heterologous moiety.
- a fusion protein can be synthesized chemically, as is known in the art.
- a fusion protein is produced by covalently linking two polypeptide segments or by standard procedures in the art of molecular biology.
- Recombinant DNA methods can be used to prepare fusion proteins, for example, by making a DNA construct which comprises coding sequences selected from SEQ ID NO: 1 or 26 in proper reading frame with nucleotides encoding the second polypeptide segment and expressing the DNA construct in a host cell, as is known in the art.
- kits for constructing fusion proteins are available from companies such as Promega Corporation (Madison, WT), Stratagene (La Jolla, CA), CLONTECH (Mountain View, CA), Santa Cruz Biotechnology (Santa Cruz, CA), MBL International Corporation (MIC;
- Species homologs of human lysyl oxidase polypeptide can be obtained using lysyl oxidase polypeptide polynucleotides (described below) to make suitable probes or primers for screening cDNA expression libraries from other species, such as mice, monkeys, or yeast, identifying cDNAs which encode homologs of lysyl oxidase polypeptide, and expressing the cDNAs as is known in the art.
- Polynucleotides described below
- a lysyl oxidase polynucleotide can be single- or double-stranded and comprises a coding sequence or the complement of a coding sequence for a lysyl oxidase polypeptide. Coding sequences for human lysyl oxidase are shown in SEQ ID NO: 1 and 26.
- nucleotide sequences encoding human lysyl oxidase polypeptides, as well as homologous nucleotide sequences which are at least about 50, 55, 60, 65, 70, preferably about 75, 90, 96, 98, or 99% identical to the nucleotide sequence shown in
- SEQ ID NO: 1 or 26 or their complements also are lysyl oxidase polynucleotides. Percent sequence identity between the sequences of two polynucleotides is determined using computer programs such as ALIGN which employ the FASTA algorithm, using an affine gap search with a gap open penalty of -12 and a gap extension penalty of -2.
- cDNA Complementary DNA
- species homologs, and variants of lysyl oxidase polynucleotides that encode biologically active lysyl oxidase polypeptides also are lysyl oxidase polynucleotides.
- Polynucleotide fragments comprising at least 8, 9, 10, 11, 12, 15, 20, or 25 contiguous nucleotides of SEQ ID NO: 1 or 26 or their complements also are lysyl oxidase polynucleotides. These fragments can be used, for example, as hybridization probes or as antisense oligonucleotides.
- variants and homologs of the lysyl oxidase polynucleotides described above also are lysyl oxidase polynucleotides.
- homologous lysyl oxidase polynucleotide sequences can be identified by hybridization of candidate polynucleotides to known lysyl oxidase polynucleotides under stringent conditions, as is known in the art. For example, using the following wash conditions-2X SSC (0.3 M NaCl, 0.03 M sodium citrate, pH 7.0), 0.1% SDS, room temperature twice, 30 minutes each; then 2X SSC,
- homologous sequences can be identified which contain at most about 25-30% basepair mismatches. More preferably, homologous nucleic acid strands contain 15-25% basepair mismatches, even more preferably 5-15% basepair mismatches.
- Species homologs of the lysyl oxidase polynucleotides disclosed herein also can be identified by making suitable probes or primers and screening cDNA expression libraries from other species, such as mice, monkeys, or yeast.
- Human variants of lysyl oxidase polynucleotides can be identified, for example, by screening human cDNA expression libraries. It is well known that the T m of a double-stranded DNA decreases by 1-1.5°C with every 1% decrease in homology (Bonner et al, J. Mol. Biol. 81, 123 (1973).
- Variants of human lysyl oxidase polynucleotides or lysyl oxidase polynucleotides of other species can therefore be identified by hybridizing a putative homologous lysyl oxidase polynucleotide with a polynucleotide having a nucleotide sequence of SEQ ID NO: 1 or 26 or the complement thereof to form a test hybrid.
- the melting temperature of the test hybrid is compared with the melting temperature of a hybrid comprising polynucleotides having perfectly complementary nucleotide sequences, and the number or percent of basepair mismatches within the test hybrid is calculated.
- Nucleotide sequences which hybridize to lysyl oxidase polynucleotides or their complements following stringent hybridization and/or wash conditions also are lysyl oxidase polynucleotides.
- Stringent wash conditions are well known and understood in the art and are disclosed, for example, in Sambrook et al, MOLECULAR CLONING: A LABORATORY MANUAL, 2d ed., 1989, at pages 9.50-9.51.
- T m of a hybrid between a lysyl oxidase polynucleotide having a nucleotide sequence shown in SEQ ID NO: 1 or 26 or the complement thereof and a polynucleotide sequence which is at least about 50, preferably about 75, 90, 96, or 98% identical to one of those nucleotide sequences can be calculated, for example, using the equation of Bolton and McCarthy, Proc. Natl. Acad. Sci. U.S.A. 48, 1390 (1962):
- Stringent wash conditions include, for example, 4X SSC at 65°C, or 50% formamide, 4X SSC at 42°C, or 0.5X SSC, 0.1% SDS at 65°C.
- Highly stringent wash conditions include, for example, 0.2X SSC at 65°C.
- a lysyl oxidase polynucleotide can be isolated free of other cellular components such as membrane components, proteins, and lipids.
- Polynucleotides can be made by a cell and isolated using standard nucleic acid purification techniques, or synthesized using an amplification technique, such as the polymerase chain reaction (PCR), or by using an automatic synthesizer. Methods for isolating polynucleotides are routine and are known in the art. Any such technique for obtaining a polynucleotide can be used to obtain isolated lysyl oxidase polynucleotides.
- restriction enzymes and probes can be used to isolate polynucleotide fragments, which comprise lysyl oxidase nucleotide sequences.
- Isolated polynucleotides are in preparations that are free or at least 70, 80, or 90% free of other molecules.
- Human lysyl oxidase cDNA molecules can be made with standard molecular biology techniques, using lysyl oxidase mRNA as a template. Human lysyl oxidase cDNA molecules can thereafter be replicated using molecular biology techniques known in the art and disclosed in manuals such as Sambrook et al. (1989). An amplification technique, such as PCR, can be used to obtain additional copies of polynucleotides of the invention, using either human genomic DNA or cDNA as a template. Altematively, synthetic chemistry techniques can be used to synthesize lysyl oxidase polynucleotides.
- the degeneracy of the genetic code allows alternate nucleotide sequences to be synthesized which will encode a lysyl oxidase polypeptide having, for example, an amino acid sequence shown in SEQ ID NO: 2 or 28 or a biologically active variant thereof.
- PCR-based methods can be used to extend the nucleic acid sequences disclosed herein to detect upstream sequences such as promoters and regulatory elements.
- restriction-site PCR uses universal primers to retrieve unknown sequence adjacent to a known locus (Sarkar, PCR Methods Applic. 2, 318-322, 1993). Genomic DNA is first amplified in the presence of a primer to a linker sequence and a primer specific to the known region. The amplified sequences are then subjected to a second round of PCR with the same linker primer and another specific primer internal to the first one. Products of each round of PCR are transcribed with an appropriate RNA polymerase and sequenced using reverse transcriptase.
- Inverse PCR also can be used to amplify or extend sequences using divergent primers based on a known region (Triglia et al, Nucleic Acids Res. 16, 8186, 1988).
- Primers can be designed using commercially available software, such as OLIGO 4.06 Primer Analysis software (National Biosciences Inc., Madison, Minn.), to be 22-30 nucleotides in length, to have a GC content of 50% or more, and to anneal to the target sequence at temperatures about 68-72°C.
- the method uses several restriction enzymes to generate a suitable fragment in the known region of a gene. The fragment is then circularized by intramolecular ligation and used as a PCR template.
- capture PCR involves PCR amplifica- tion of DNA fragments adjacent to a known sequence in human and yeast artificial chromosome DNA (Lagerstrom et al, PCR Methods Applic. 1, 111-119, 1991).
- multiple restriction enzyme digestions and ligations also can be used to place an engineered double-stranded sequence into an unknown fragment of the DNA molecule before performing PCR.
- Randomly-primed libraries are preferable, in that they will contain more sequences which contain the 5' regions of genes. Use of a randomly primed library may be especially preferable for situations in which an oligo d(T) library does not yield a full-length cDNA. Genomic libraries can be useful for extension of sequence into 5' non-transcribed regulatory regions.
- capillary electrophoresis systems can be used to analyze the size or confirm the nucleotide sequence of PCR or sequencing products.
- capillary sequencing can employ flowable polymers for electrophoretic separation, four different fluorescent dyes (one for each nucleotide) that are laser activated, and detection of the emitted wavelengths by a charge coupled device camera.
- Output/light intensity can be converted to electrical signal using appropriate software (e.g. GENOTYPER and Sequence NAVIGATOR, Perkin Elmer), and the entire process from loading of samples to computer analysis and electronic data display can be computer controlled.
- Capillary electrophoresis is especially preferable for the sequencing of small pieces of DNA that might be present in limited amounts in a particular sample.
- Human lysyl oxidase polypeptides can be obtained, for example, by purification from human cells, by expression of lysyl oxidase polynucleotides, or by direct chemical synthesis.
- Human lysyl oxidase polypeptides can be purified from any cell that expresses the polypeptide, including host cells that have been transfected with lysyl oxidase expression constructs.
- a purified lysyl oxidase polypeptide is separated from other compounds that normally associate with the lysyl oxidase polypeptide in the cell, such as certain proteins,. carbohydrates, or lipids, using methods well-known in the art. Such methods include, but are not limited to, size exclusion chromatography, ammonium sulfate fractionation, ion exchange chromatography, affinity chromatography, and preparative gel electrophoresis.
- a preparation of purified lysyl oxidase polypeptides is at least 80% pure; preferably, the preparations are 90%, 95%, or 99% pure. Purify of the preparations can be assessed by any means known in the art, such as SDS-polyacrylamide gel electrophoresis.
- the polynucleotide can be inserted into an expression vector that contains the necessary elements for the transcription and translation of the inserted coding sequence.
- Methods that are well known to those skilled in the art can be used to construct expression vectors containing sequences encoding lysyl oxidase polypeptides and appropriate transcriptional and translational control elements. These methods include in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. Such techniques are described, for example, in Sambrook et al. (1989) and in Ausubel et al, CURRENT
- PROTOCOLS IN MOLECULAR BIOLOGY John Wiley & Sons, New York, N.Y, 1989.
- a variety of expression vector/host systems can be utilized to contain and express sequences encoding a lysyl oxidase polypeptide.
- microorganisms such as bacteria transformed with recombinant bacteriophage, plasmid, or cosmid DNA expression vectors; yeast transformed with yeast expression vectors, insect cell systems infected with virus expression vectors (e.g., baculovirus), plant cell systems transformed with virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or with bacterial expression vectors (e.g., Ti or pBR322 plasmids), or animal cell systems.
- microorganisms such as bacteria transformed with recombinant bacteriophage, plasmid, or cosmid DNA expression vectors
- yeast transformed with yeast expression vectors insect cell systems infected with virus expression vectors (e.g., baculovirus), plant cell systems transformed with virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or with bacterial expression vectors (e.g., Ti or pBR322 plasmids), or animal cell systems.
- control elements or regulatory sequences are those non-translated regions of the vector — enhancers, promoters, 5' and 3' untranslated regions ⁇ which interact with host cellular proteins to carry out transcription and translation. Such elements can vary in their strength and specificity.
- any number of suitable transcription and translation elements including constitutive and inducible promoters, can be used.
- inducible promoters such as the hybrid lacZ promoter of the BLUESCRIPT phagemid (Stratagene, LaJolla, Calif.) or pSPORTl plasmid (Life Technologies) and the like can be used.
- the baculovirus polyhedrin promoter can be used in insect cells.
- Promoters or enhancers derived from the genomes of plant cells e.g., heat shock, RUBISCO, and storage protein genes
- plant viruses e.g., viral promoters or leader sequences
- promoters from mammalian genes or from mammalian viruses are preferable. If it is necessary to generate a cell line that contains multiple copies of a nucleotide sequence encoding a lysyl oxidase polypeptide, vectors based on SV40 or EBV can be used with an appropriate selectable marker.
- a number of expression vectors can be selected depending upon the use intended for the lysyl oxidase polypeptide. For example, when a large quantity of a lysyl oxidase polypeptide is needed for the induction of antibodies, vectors which direct high level expression of fusion proteins that are readily purified can be used. Such vectors include, but are not limited to, multifunctional E. coli cloning and expression vectors such as BLUESCRTPT (Stratagene).
- a sequence encoding the lysyl oxidase polypeptide can be ligated into the vector in frame with sequences for the amino-terminal Met and the subsequent 7 residues of ⁇ -galactosidase so that a hybrid protein is produced.
- pIN vectors Van Heeke & Schuster, J. Biol. Chem. 264, 5503-5509, 1989
- pGEX vectors Promega, Madison, Wis.
- GST glutathione S-transferase
- fusion proteins are soluble and can easily be purified from lysed cells by adsorption to glutathione-agarose beads followed by elution in the presence of free glutathione.
- Proteins made in such systems can be designed to include heparin, thrombin, or factor Xa protease cleavage sites so that the cloned polypeptide of interest can be released from the GST moiety at will.
- yeast Saccharomyces cerevisiae a number of vectors containing constitutive or inducible promoters such as alpha factor, alcohol oxidase, and PGH can be used.
- constitutive or inducible promoters such as alpha factor, alcohol oxidase, and PGH.
- the expression of sequences encoding lysyl oxidase polypeptides can be driven by any of a number of promoters.
- viral promoters such as the 35S and 19S promoters of CaMV can be used alone or in combination with the omega leader sequence from TMV (Takamatsu, EMBO J. 6, 307-311, 1987).
- plant promoters such as the small subunit of RUBISCO or heat shock promoters can be used (Coruzzi et al, EMBO J. 3, 1671-1680, 1984; Broglie et al, Science 224, 838-843, 1984; Winter et al, Results Probl. Cell Differ. 17, 85-105, 1991).
- constructs can be introduced into plant cells by direct DNA transformation or by pathogen-mediated transfection.
- pathogen-mediated transfection Such techniques are described in a number of generally available reviews (e.g., Hobbs or Murray, in MCGRAW HELL YEARBOOK OF SCIENCE AND TECHNOLOGY, McGraw Hill, New York, N ., pp. 191-196, 1992).
- An insect system also can be used to express a lysyl oxidase polypeptide.
- Autographa californica nuclear polyhedrosis virus (AcNPV) is used as a vector to express foreign genes in Spodoptera frugiperda cells or in Trichoplusia larvae.
- Sequences encoding lysyl oxidase polypeptides can be cloned into a non-essential region of the virus, such as the polyhedrin gene, and placed under control of the polyhedrin promoter. Successful insertion of lysyl oxidase polypeptides will render the polyhedrin gene inactive and produce recombinant virus lacking coat protein.
- the recombinant viruses can then be used to infect S. frugiperda cells or Trichoplusia larvae in which lysyl oxidase polypeptides can be expressed (Engelhard et al, Proc. Nat. Acad. Sci. 91, 3224-3227, 1994).
- a number of viral-based expression systems can be used to express lysyl oxidase polypeptides in mammalian host cells.
- sequences encoding lysyl oxidase polypeptides can be ligated into an adenovirus transcription/translation complex comprising the late promoter and tripartite leader sequence. Insertion in a non-essential El or E3 region of the viral genome can be used to obtain a viable virus that is capable of expressing a lysyl oxidase polypeptide in infected host cells (Logan & Shenk, Proc. Natl. Acad. Sci. 81, 3655-3659, 1984).
- transcription enhancers such as the Rous sarcoma virus (RSV) enhancer
- RSV Rous sarcoma virus
- HACs Human artificial chromosomes
- 6M to 10M are constructed and delivered to cells via conventional delivery methods (e.g., liposomes, polycationic amino polymers, or vesicles).
- Specific initiation signals also can be used to achieve more efficient translation of sequences encoding lysyl oxidase polypeptides. Such signals include the ATG initiation codon and adjacent sequences.
- a host cell strain can be chosen for its ability to modulate the expression of the inserted sequences or to process the expressed lysyl oxidase polypeptide in the desired fashion.
- modifications of the polypeptide include, but are not limited to, acetylation, carboxylation, glycosylation, phosphorylation, lipidation, and acyla- tion.
- Post-translational processing which cleaves a "prepro" form of the polypeptide also can be used to facilitate correct insertion, folding and/or function.
- Different host cells that have specific cellular machinery and characteristic mechanisms for post-translational activities e.g., CHO, HeLa, MDCK, HEK293, and WI38
- ATCC American Type Culture Collection
- Stable expression is preferred for long-term, high-yield production of recombinant proteins.
- cell lines which stably express lysyl oxidase polypeptides can be transformed using expression vectors which can contain viral origins of replication and/or endogenous expression elements and a selectable marker gene on the same or on a separate vector. Following the introduction of the vector, cells can be allowed to grow for 1-2 days in an enriched medium before they are switched to a selective medium.
- the purpose of the selectable marker is to confer resistance to selection, and its presence allows growth and recovery of cells which successfully express the introduced lysyl oxidase sequences.
- Resistant clones of stably transformed cells can be proliferated using tissue culture techniques appropriate to the cell type. See, for example, ANIMAL CELL CULTURE, R.I. Freshney, ed., 1986.
- herpes simplex virus thymidine kinase (Wigler et al, Cell 11, 223-32, 1977) and adenine phosphoribosyltransferase (Lowy et al, Cell 22, 817-23, 1980) genes which can be employed in tk " or aprf cells, respectively.
- antimetabolite, antibiotic, or herbicide resistance can be used as the basis for selection.
- dhfr confers resistance to methotrexate (Wigler et al, Proc. Natl. Acad. Sci.
- npt confers resistance to the aminoglycosides, neomycin and G-418 (Colbere-Garapin et al, J. Mol. Biol. 150, 1-14, 1981), and als and pat confer resistance to chlorsulfuron and phosphinotricin acetyltransferase, respectively (Murray, 1992, supra). Additional selectable genes have been described. For example, trpB allows cells to utilize indole in place of tryptophan, or hisD, which allows cells to utilize histinol in place of histidine (Hartman & Mulligan, Proc. Natl. Acad. Sci. 85, 8047-51, 1988).
- Visible markers such as anthocyanins, ⁇ -glucuronidase and its substrate GUS, and luciferase and its substrate luciferin, can be used to identify transformants and to quantify the amount of transient or stable protein expression attributable to a specific vector system (Rhodes et al, Methods Mol. Biol. 55, 121-131, 1995). Detecting Expression
- marker gene expression suggests that the lysyl oxidase polynucleotide is also present, its presence and expression may need to be confirmed. For example, if a sequence encoding a lysyl oxidase polypeptide is inserted within a marker gene sequence, transformed cells containing sequences that encode a lysyl oxidase polypeptide can be identified by the absence of marker gene function. Alternatively, a marker gene can be placed in tandem with a sequence encoding a lysyl oxidase polypeptide under the control of a single promoter. Expression of the marker gene in response to induction or selection usually indicates expression of the lysyl oxidase polynucleotide.
- host cells which contain a lysyl oxidase polynucleotide and which express a lysyl oxidase polypeptide can be identified by a variety of procedures known to those of skill in the art. These procedures include, but are not limited to,
- DNA-DNA or DNA-RNA hybridizations and protein bioassay or immunoassay techniques that include membrane, solution, or chip-based technologies for the detection and/or quantification of nucleic acid or protein.
- the presence of a polynucleotide sequence encoding a lysyl oxidase polypeptide can be detected by DNA-DNA or DNA-RNA hybridization or amplification using probes or fragments or fragments of polynucleotides encoding a lysyl oxidase polypeptide.
- Nucleic acid amplification-based assays involve the use of oligonucleotides selected from sequences encoding a lysyl oxidase polypeptide to detect transformants that contain a lysyl oxidase polynucleotide.
- a variety of protocols for detecting and measuring the expression of a lysyl oxidase polypeptide, using either polyclonal or monoclonal antibodies specific for the polypeptide, are known in the art. Examples include enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), and fluorescence activated cell sorting (FACS).
- ELISA enzyme-linked immunosorbent assay
- RIA radioimmunoassay
- FACS fluorescence activated cell sorting
- a two-site, monoclonal-based immunoassay using monoclonal antibodies reactive to two non-interfering epitopes on a lysyl oxidase polypeptide can be used, or a competitive binding assay can be employed.
- Means for producing labeled hybridization or PCR probes for detecting sequences related to polynucleotides encoding lysyl oxidase polypeptides include oligolabeling, nick translation, end-labeling, or PCR amplification using a labeled nucleotide.
- sequences encoding a lysyl oxidase polypeptide can be cloned into a vector for the production of an mRNA probe.
- RNA probes are known in the art, are commercially available, and can be used to synthesize RNA probes in vitro by addition of labeled nucleotides and an appropriate RNA polymerase such as T7, T3, or SP6. These procedures can be conducted using a variety of commercially available kits (Amersham Pharmacia Biotech, Promega, and US Biochemical). Suitable reporter molecules or labels which can be used for ease of detection include radionuclides, enzymes, and fluorescent, chemiluminescent, or chromogenic agents, as well as substrates, cofactors, inhibitors, magnetic particles, and the like.
- Host cells transformed with nucleotide sequences encoding a lysyl oxidase polypeptide can be cultured under conditions suitable for the expression and recovery of the protein from cell culture.
- the polypeptide produced by a transformed cell can be secreted or contained intracellularly depending on the sequence and/or the vector used.
- expression vectors containing polynucleotides which encode lysyl oxidase polypeptides can be designed to contain signal sequences which direct secretion of soluble lysyl oxidase polypeptides through a prokaryotic or eukaryotic cell membrane or which direct the membrane insertion of membrane-bound lysyl oxidase polypeptide.
- purification facilitating domains include, but are not limited to, metal chelating peptides such as histidine- tryptophan modules that allow purification on immobilized metals, protein A domains that allow purification on immobilized immunoglobulin, and the domain utilized in the FLAGS extension/affinity purification system (Immunex Corp., Seattle, Wash.).
- cleavable linker sequences such as those specific for Factor Xa or enterokinase (Invitrogen, San Diego, CA) between the purification domain and the lysyl oxidase polypeptide also can be used to facilitate purification.
- One such expression vector provides for expression of a fusion protein containing a lysyl oxidase polypeptide and 6 histidine residues preceding a thioredoxin or an enterokinase cleavage site. The histidine residues facilitate purification by IMAC (immobilized metal ion affinity chromatography, as described in Porath et al, Prot.
- enterokinase cleavage site provides a means for purifying the lysyl oxidase polypeptide from the fusion protein.
- Vectors that contain fusion proteins are disclosed in Kroll et al, DNA Cell Biol. 12, 441-453, 1993.
- Sequences encoding a lysyl oxidase polypeptide can be synthesized, in whole or in part, using chemical methods well known in the art (see Caruthers et al, Nucl Acids Ras. Symp. Ser. 215-223, 1980; Horn et al. Nucl. Acids Res. Symp. Ser. 225-232,
- a lysyl oxidase polypeptide itself can be produced using chemical methods to synthesize its amino acid sequence, such as by direct peptide synthesis using solid-phase techniques (Merrifield, J. Am. Chem. Soc. 85, 2149-2154, 1963; Roberge et al, Science 269, 202-204, 1995). Protein synthesis can be performed using manual techniques or by automation. Automated synthesis can be achieved, for example, using Applied Biosystems 431 A Peptide Synthesizer (Perkin Elmer).
- fragments of lysyl oxidase polypeptides can be separately synthesized and combined using chemical methods to produce a full-length molecule.
- the newly synthesized peptide can be substantially purified by preparative high performance liquid chromatography (e.g., Creighton, PROTEINS: STRUCTURES AND
- composition of a synthetic lysyl oxidase polypeptide can be confirmed by amino acid analysis or sequencing (e.g., the Edman degradation procedure; see Creighton, supra). Additionally, any portion of the amino acid sequence of the lysyl oxidase polypeptide can be altered during direct synthesis and/or combined using chemical methods with sequences from other proteins to produce a variant polypeptide or a fusion protein.
- codons preferred by a particular prokaryotic or eukaryotic host can be selected to increase the rate of protein expression or to produce an RNA transcript having desirable properties, such as a half-life that is longer than that of a transcript generated from the naturally occurring sequence.
- nucleotide sequences disclosed herein can be engineered using methods generally known in the art to alter lysyl oxidase polypeptide-encoding sequences for a variety of reasons, including but not limited to, alterations which modify the cloning, processing, and/or expression of the polypeptide or mRNA product.
- DNA shuffling by random fragmentation and PCR reassembly of gene fragments and synthetic oligonucleotides can be used to engineer the nucleotide sequences.
- site-directed mutagenesis can be used to insert new restriction sites, alter glycosylation patterns, change codon preference, produce splice variants, introduce mutations, and so forth.
- Antibody as used herein includes intact immunoglobulin molecules, as well as fragments thereof, such as Fab, F(ab') , and Fv, which are capable of binding an epitope of a lysyl oxidase polypeptide.
- Fab fragment antigen binding protein
- F(ab') fragment antigen binding protein
- Fv fragment antigen binding protein
- An antibody which specifically binds to an epitope of a lysyl oxidase polypeptide can be used therapeutically, as well as in immunochemical assays, such as Western blots, ELISAs, radioimmunoassays, immunohistochemical assays, immunoprecipitations, or other immunochemical assays known in the art.
- immunochemical assays such as Western blots, ELISAs, radioimmunoassays, immunohistochemical assays, immunoprecipitations, or other immunochemical assays known in the art.
- Various immunoassays can be used to identify antibodies having the desired specificity. Numerous protocols for competitive binding or irnmunoradiometric assays are well known in the art. Such immunoassays typically involve the measurement of complex formation between an immunogen and an antibody that specifically binds to the immunogen.
- an antibody which specifically binds to a lysyl oxidase polypeptide provides a detection signal at least 5-, 10-, or 20-fold higher than a detection signal provided with other proteins when used in an immunochemical assay.
- antibodies which specifically bind to lysyl oxidase polypeptides do not detect other proteins in immunochemical assays and can immunoprecipitate a lysyl oxidase polypeptide from solution.
- Human lysyl oxidase polypeptides can be used to immunize a mammal, such as a mouse, rat, rabbit, guinea pig, monkey, or human, to produce polyclonal antibodies.
- a lysyl oxidase polypeptide can be conjugated to a carrier protein, such as bovine serum albumin, thyroglobulin, and keyhole limpet hemocyanin.
- a carrier protein such as bovine serum albumin, thyroglobulin, and keyhole limpet hemocyanin.
- various adjuvants can be used to increase the immunological response.
- adjuvants include, but are not limited to, Freund's adjuvant, mineral gels (e.g., aluminum hydroxide), and surface active substances (e.g.
- BCG Bacilli Calmette-
- Monoclonal antibodies that specifically bind to a lysyl oxidase polypeptide can be prepared using any technique which provides for the production of antibody molecules by continuous cell lines in culture. These techniques include, but are not limited to, the hybridoma technique, the human B-cell hybridoma technique, and the EBV-hybridoma technique (Kohler et al, Nature 256, 495-497, 1985; Kozbor et al, J. Immunol. Methods 81, 31-42, 1985; Cote et al, Proc. Natl. Acad. Sci. 80, 2026-2030, 1983; Cole et al, Mol. Cell Biol. 62, 109-120, 1984).
- chimeric antibodies the splicing of mouse antibody genes to human antibody genes to obtain a molecule with appropriate antigen specificity and biological activity, can be used (Morrison et al, Proc. Natl. Acad. Sci. 81, 6851-6855, 1984; Neuberger et al, Nature 312, 604-608, 1984; Takeda et al, Nature 314, 452-454, 1985).
- Monoclonal and other antibodies also can be "humanized” to prevent a patient from mounting an immune response against the antibody when it is used therapeutically. Such antibodies may be sufficiently similar in sequence to human antibodies to be used directly in therapy or may require alteration of a few key residues.
- humanized antibodies can be produced using recombinant methods, as described in GB2188638B.
- Antibodies that specifically bind to a lysyl oxidase polypeptide can contain antigen binding sites which are either partially or fully humanized, as disclosed in U.S. 5,565,332.
- techniques described for the production of single chain antibodies can be adapted using methods known in the art to produce single chain antibodies that specifically bind to lysyl oxidase polypeptides.
- Antibodies with related specificity, but of distinct idiotypic composition can be generated by chain shuffling from random combinatorial immunoglobin libraries (Burton, Proc. Natl. Acad. Sci. 88, 11120-23, 1991).
- Single-chain antibodies also can be constructed using a DNA amplification method, such as PCR, using hybridoma cDNA as a template (Thirion et al, 1996, Eur. J.
- Single-chain antibodies can be mono- or bispecific, and can be bivalent or tetravalent. Construction of tetravalent, bispecific single-chain antibodies is taught, for example, in Coloma & Morrison, 1997, Nat. Biotechnol. 15, 159-63. Construction of bivalent, bispecific single-chain antibodies is taught in Mallender & Voss, 1994, J. Biol. Chem. 269, 199-206.
- a nucleotide sequence encoding a single-chain antibody can be constructed using manual or automated nucleotide synthesis, cloned into an expression construct using standard recombinant DNA methods, and introduced into a cell to express the coding sequence, as described below.
- single-chain antibodies can be produced directly using, for example, filamentous phage technology (Verhaar et al, 1995, Int. J. Cancer 61, 497-501; Nicholls et al, 1993, J Immunol. Meth. 165, 81-91).
- Antibodies which specifically bind to lysyl oxidase polypeptides also can be produced by inducing in vivo production in the lymphocyte population or by screening immunoglobulin libraries or panels of highly specific binding reagents as disclosed in the literature (Orlandi et al, Proc. Natl. Acad. Sci. 86, 3833-3837, 1989; Winter et al, Nature 349, 293-299, 1991).
- chimeric antibodies can be constructed as disclosed in WO 93/03151.
- Binding proteins which are derived from immunoglobulins and which are multivalent and multispecific, such as the "diabodies" described in WO 94/13804, also can be prepared.
- Antibodies according to the invention can be purified by methods well known in the art. For example, antibodies can be affinity purified by passage over a column to which a lysyl oxidase polypeptide is bound. The bound antibodies can then be eluted from the column using a buffer with a high salt concentration.
- Antisense oligonucleotides are nucleotide sequences that are complementary to a specific DNA or RNA sequence. Once introduced into a cell, the complementary nucleotides combine with natural sequences produced by the cell to form complexes and block either transcription or translation. Preferably, an antisense oligonucleotide is at least 11 nucleotides in length, but can be at least 12, 15, 20, 25, 30, 35, 40, 45, or 50 or more nucleotides long. Longer sequences also can be used. Antisense oligonucleotide molecules can be provided in a DNA construct and introduced into a cell as described above to decrease the level of lysyl oxidase gene products in the cell.
- Antisense oligonucleotides can be deoxyribonucleotides, ribonucleotides, or a combination of both. Oligonucleotides can be synthesized manually or by an automated synthesizer, by covalently linking the 5' end of one nucleotide with the 3' end of another nucleotide with non-phosphodiester internucleotide linkages such alkyl- phosphonates, phosphorothioates, phosphorodithioates, alkylphosphonothioates, alkylphosphonates, phosphoramidates, phosphate esters, carbamates, acetamidate, carboxymethyl esters, carbonates, and phosphate triesters. See Brown, Meth.
- lysyl oxidase gene expression can be obtained by designing antisense oligonucleotides that will form duplexes to the control, 5', or regulatory regions of the lysyl oxidase gene. Oligonucleotides derived from the transcription initiation site, e.g., between positions -10 and +10 from the start site, are preferred. Similarly, inhibition can be achieved using "triple helix" base-pairing methodology.
- Triple helix pairing is useful because it causes inhibition of the ability of the double helix to open sufficiently for the binding of polymerases, transcription factors, or chaperons.
- Therapeutic advances using triplex DNA have been described in the literature (e.g., Gee et al, in Huber & Carr, MOLECULAR AND IMMUNOLOGIC APPROACHES, Futura Publishing Co., Mt. Kisco, NY., 1994).
- An antisense oligonucleotide also can be designed to block translation of mRNA by preventing the transcript from binding to ribosomes.
- Antisense oligonucleotides which comprise, for example, 2, 3, 4, or
- each stretch of complementary contiguous nucleotides is at least 4, 5, 6, 7, or 8 or more nucleotides in length.
- Non-complementary intervening sequences are preferably 1, 2, 3, or 4 nucleotides in length.
- One skilled in the art can easily use the calculated melting point of an antisense-sense pair to determine the degree of mismatching which will be tolerated between a particular antisense oligonucleotide and a particular lysyl oxidase polynucleotide sequence.
- Antisense oligonucleotides can be modified without affecting their ability to hybridize to a lysyl oxidase polynucleotide. These modifications can be internal or at one or both ends of the antisense molecule.
- internucleoside phosphate linkages can be modified by adding cholesteryl or diamine moieties with varying numbers of carbon residues between the amino groups and terminal ribose.
- Modified bases and/or sugars such as arabinose instead of ribose, or a 3 5 '-substituted oligonucleotide in which the 3' hydroxyl group or the 5' phosphate group are substituted, also can be employed in a modified antisense oligonucleotide.
- modified oligonucleotides can be prepared by methods well known in the art. See, e.g., Agrawal et al, Trends Biotechnol. 10, 152-158, 1992; Uhlmann et al, Chem. Rev. 90, 543-584, 1990; Uhlmann et al, Tetrahedron. Lett. 215, 3539-3542, 1987.
- Ribozymes are RNA molecules with catalytic activity. See, e.g., Cech, Science 236, 1532-1539; 1987; Cech, Ann. Rev. Biochem. 59, 543-568; 1990, Cech, Curr. Opin. Struct. Biol. 2, 605-609; 1992, Couture & Stinchcomb, Trends Genet. 12, 510-515, 1996. Ribozymes can be used to inhibit gene function by cleaving an RNA sequence, as is known in the art (e.g., Haseloff et al, U.S. Patent 5,641,673).
- ribozyme action involves sequence-specific hybridization of the ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage.
- Examples include engineered hammerhead motif ribozyme molecules that can specifically and efficiently catalyze endonucleolytic cleavage of specific nucleotide sequences.
- the coding sequence of a lysyl oxidase polynucleotide can be used to generate ribozymes that will specifically bind to mRNA transcribed from the lysyl oxidase polynucleotide.
- Methods of designing and constructing ribozymes which can cleave other RNA molecules in trans in a highly sequence specific manner have been developed and described in the art (see Haseloff et al. Nature 334, 585-591, 1988).
- the cleavage activity of ribozymes can be targeted to specific RNAs by engineering a discrete "hybridization" region into the ribozyme.
- the hybridization region contains a sequence complementary to the target RNA and thus specifically hybridizes with the target (see, for example, Gerlach et al, EP 321,201).
- Specific ribozyme cleavage sites within a lysyl oxidase RNA target can be identified by scanning the target molecule for ribozyme cleavage sites which include the following sequences: GUA, GUU, and GUC. Once identified, short RNA sequences of between 15 and 20 ribonucleotides corresponding to the region of the target RNA containing the cleavage site can be evaluated for secondary structural features which may render the target inoperable.
- Suitability of candidate lysyl oxidase RNA targets also can be evaluated by testing accessibility to hybridization with complementary oligonucleotides using ribonuclease protection assays. Longer complementary sequences can be used to increase the affinity of the hybridization sequence for the target.
- the hybridizing and cleavage regions of the ribozyme can be integrally related such that upon hybridizing to the target RNA through the complementary regions, the catalytic region of the ribozyme can cleave the target.
- Ribozymes can be introduced into cells as part of a DNA construct. Mechanical methods, such as microinjection, liposome-mediated transfection, electroporation, or calcium phosphate precipitation, can be used to introduce a ribozyme-containing DNA construct into cells in which it is desired to decrease lysyl oxidase expression. Alternatively, if it is desired that the cells stably retain the DNA construct, the construct can be supplied on a plasmid and maintained as a separate element or integrated into the genome of the cells, as is known in the art. A ribozyme-encoding
- DNA construct can include transcriptional regulatory elements, such as a promoter element, an enhancer or UAS element, and a transcriptional terminator signal, for controlling transcription of ribozymes in the cells.
- transcriptional regulatory elements such as a promoter element, an enhancer or UAS element, and a transcriptional terminator signal, for controlling transcription of ribozymes in the cells.
- ribozymes can be engineered so that ribozyme expression will occur in response to factors that induce expression of a target gene. Ribozymes also can be engineered to provide an additional level of regulation, so that destruction of mRNA occurs only when both a ribozyme and a target gene are induced in the cells. Differentiallv Expressed Genes
- genes whose products interact with human lysyl oxidase may represent genes that are differentially expressed in disorders including, but not limited to, COPD, cancer, cardiovascular disease, genitourinary diseases, and metabolic diseases. Further, such genes may represent genes that are differentially regulated in response to manipulations relevant to the progression or treatment of such diseases. Additionally, such genes may have a temporally modulated expression, increased or decreased at different stages of tissue or organism development. A differentially expressed gene may also have its expression modulated under control versus experimental conditions. In addition, the human lysyl oxidase gene or gene product may itself be tested for differential expression.
- the degree to which expression differs in a normal versus a diseased state need only be large enough to be visualized via standard characterization techniques such as differential display techniques.
- standard characterization techniques such as differential display techniques.
- Other such standard characterization techniques by which expression differences may be visualized include but are not limited to, quantitative RT (reverse transcriptase), PCR, and Northern analysis.
- RNA or, preferably, mRNA is isolated from tissues of interest.
- RNA samples are obtained from tissues of experimental subjects and from corresponding tissues of control subjects.
- RNA isolation technique that does not select against the isolation of mRNA may be utilized for the purification of such RNA samples. See, for example, Ausubel et al, ed., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, Inc. New York, 1987-1993. Large numbers of tissue samples may readily be processed using techniques well known to those of skill in the art, such as, for example, the single-step RNA isolation process of Chomczynski, U.S. Patent 4,843,155. Transcripts within the collected RNA samples that represent RNA produced by differentially expressed genes are identified by methods well known to those of skill in the art. They include, for example, differential screening (Tedder et al, Proc. Natl. Acad. Sci. U.S.A. 85, 208-12, 1988), subrractive hybridization (Hedrick et al,
- the differential expression information may itself suggest relevant methods for the treatment of disorders involving the human lysyl oxidase.
- treatment may include a modulation of expression of the differentially expressed genes and/or the gene encoding the human lysyl oxidase.
- the differential expression information may indicate whether the expression or activity of the differentially expressed gene or gene product or the human lysyl oxidase gene or gene product are up-regulated or down-regulated.
- the invention provides assays for screening test compounds that bind to or modulate the activity of a lysyl oxidase polypeptide or a lysyl oxidase polynucleotide.
- a test compound preferably binds to a lysyl oxidase polypeptide or polynucleotide. More preferably, a test compound decreases or increases lysyl oxidase activity by at least about 10, preferably about 50, more preferably about 75, 90, or 100% relative to the absence of the test compound.
- Test compounds can be pharmacologic agents already known in the art or can be compounds previously unknown to have any pharmacological activity.
- the compounds can be naturally occurring or designed in the laboratory. They can be isolated from microorganisms, animals, or plants, and can be produced recombinantly, or synthesized by chemical methods known in the art. If desired, test compounds can be obtained using any of the numerous combinatorial library methods known in the art, including but not limited to, biological libraries, spatially addressable parallel solid phase or solution phase libraries, synthetic library methods requiring deconvolution, the "one-bead one-compound” library method, and synthetic library methods using affinity chromatography selection.
- the biological library approach is limited to polypeptide libraries, while the other four approaches are applicable to polypeptide, non-peptide oligomer, or small molecule libraries of compounds. See Lam, Anticancer Drug Des. 12, 145, 1997.
- Test compounds can be screened for the ability to bind to lysyl oxidase polypeptides or polynucleotides or to affect lysyl oxidase activity or lysyl oxidase gene expression using high throughput screening.
- high throughput screening many discrete compounds can be tested in parallel so that large numbers of test compounds can be quickly screened.
- the most widely established techniques utilize 96-well microtiter plates. The wells of the microtiter plates typically require assay volumes that range from 50 to 500 ⁇ l.
- many instruments, materials, pipettors, robotics, plate washers, and plate readers are commercially available to fit the 96-well format.
- free format assays or assays that have no physical barrier between samples, can be used.
- an assay using pigment cells (melanocytes) in a simple homogeneous assay for combinatorial peptide libraries is described by Jayawickreme et al, Proc. Natl. Acad. Sci. U.S.A. 19, 1614-18 (1994).
- the cells are placed under agarose in petri dishes, then beads that carry combinatorial compounds are placed on the surface of the agarose.
- the combinatorial compounds are partially released the compounds from the beads. Active compounds can be visualized as dark pigment areas because, as the compounds diffuse locally into the gel matrix, the active compounds cause the cells to change colors.
- Chelsky "Strategies for Screening Combinatorial Libraries: Novel and Traditional Approaches," reported at the First Annual Conference of The Society for Biomolecular Screening in Philadelphia, Pa. (Nov. 7-10, 1995).
- Chelsky placed a simple homogenous enzyme assay for carbonic anhydrase inside an agarose gel such that the enzyme in the gel would cause a color change throughout the gel.
- beads carrying combinatorial compounds via a photolinker were placed inside the gel and the compounds were partially released by UV-light. Compounds that inhibited the enzyme were observed as local zones of inhibition having less color change.
- test samples are placed in a porous matrix.
- One or more assay components are then placed within, on top of, or at the bottom of a matrix such as a gel, a plastic sheet, a filter, or other form of easily manipulated solid support.
- a matrix such as a gel, a plastic sheet, a filter, or other form of easily manipulated solid support.
- the test compound is preferably a small molecule that binds to and occupies, for example, the active site of the lysyl oxidase polypeptide, such that normal biological activity is prevented.
- small molecules include, but are not limited to, small peptides or peptide-like molecules.
- either the test compound or the lysyl oxidase polypeptide can comprise a detectable label, such as a fluorescent, radioisotopic, chemiluminescent, or enzymatic label, such as horseradish peroxidase, alkaline phosphatase, or luciferase.
- a detectable label such as a fluorescent, radioisotopic, chemiluminescent, or enzymatic label, such as horseradish peroxidase, alkaline phosphatase, or luciferase.
- Detection of a test compound that is bound to the lysyl oxidase polypeptide can then be accomplished, for example, by direct counting of radio- emmission, by scintillation counting, or by determining conversion of an appropriate substrate to a detectable product.
- binding of a test compound to a lysyl oxidase polypeptide can be determined without labeling either of the interactants.
- a microphysio- meter can be used to detect binding of a test compound with a lysyl oxidase polypeptide.
- a microphysiometer e.g., CytosensorTM
- a microphysiometer is an analytical instrument that measures the rate at which a cell acidifies its environment using a light-addressable potentiometric sensor (LAPS). Changes in this acidification rate can be used as an indicator of the interaction between a test compound and a lysyl oxidase polypeptide (McConnell et al, Science 257, 1906-1912, 1992).
- Determining the ability of a test compound to bind to a lysyl oxidase polypeptide also can be accomplished using a technology such as real-time Bimolecular Interaction Analysis (BIA) (Sjolander & Urbaniczky, Anal. Chem. 63, 2338-2345, 1991, and Szabo et al, Curr. Opin. Struct. Biol. 5, 699-705, 1995).
- BIA is a technology for studying biospecific interactions in real time, without labeling any of the interactants (e.g., BIAcoreTM). Changes in the optical phenomenon surface plasmon resonance (SPR) can be used as an indication of real-time reactions between biological molecules.
- a lysyl oxidase polypeptide can be used as a "bait protein" in a two-hybrid assay or three-hybrid assay (see, e.g., U.S. Patent 5,283,317; Zervos et al, Cell 72, 223-232, 1993; Madura et al, J. Biol. Chem. 268,
- the two-hybrid system is based on the modular nature of most transcription factors, which consist of separable DNA-binding and activation domains.
- the assay utilizes two different DNA constructs.
- polynucleotide encoding a lysyl oxidase polypeptide can be fused to a polynucleotide encoding the DNA binding domain of a known transcription factor (e.g., GAL-4).
- a DNA sequence that encodes an unidentified protein (“prey" or "sample” can be fused to a polynucleotide that codes for the activation domain of the known transcription factor.
- the DNA-binding and activation domains of the transcription factor are brought into close proximity. This proximity allows transcription of a reporter gene (e.g., LacZ), which is operably linked to a transcriptional regulatory site responsive to the transcription factor. Expression of the reporter gene can be detected, and cell colonies containing the functional transcription factor can be isolated and used to obtain the DNA sequence encoding the protein that interacts with the lysyl oxidase polypeptide.
- a reporter gene e.g., LacZ
- either the lysyl oxidase polypeptide (or polynucleotide) or the test compound can be bound to a solid support.
- Suitable solid supports include, but are not limited to, glass or plastic slides, tissue culture plates, microtiter wells, tubes, silicon chips, or particles such as beads (including, but not limited to, latex, polystyrene, or glass beads).
- Any method known in the art can be used to attach the enzyme polypeptide (or polynucleotide) or test compound to a solid support, including use of covalent and non-covalent linkages, passive absorption, or pairs of binding moieties attached respectively to the polypeptide (or polynucleotide) or test compound and the solid support.
- Test compounds are preferably bound to the solid support in an array, so that the location of individual test compounds can be tracked. Binding of a test compound to a lysyl oxidase polypeptide (or polynucleotide) can be accomplished in any vessel suitable for containing the reactants. Examples of such vessels include microtiter plates, test tubes, and microcentrifuge tubes.
- the lysyl oxidase polypeptide is a fusion protein comprising a domain that allows the lysyl oxidase polypeptide to be bound to a solid support.
- glutathione-S-transferase fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis, Mo.) or glutathione derivatized microtiter plates, which are then combined with the test compound or the test compound and the non-adsorbed lysyl oxidase polypeptide; the mixture is then incubated under conditions conducive to complex formation (e.g., at physiological conditions for salt and pH).
- Binding of the interactants can be determined either directly or indirectly, as described above. Alternatively, the complexes can be dissociated from the solid support before binding is determined.
- lysyl oxidase polypeptide or polynucleotide
- test compound can be immobilized utilizing conjugation of biotin and streptavidin.
- Biotinylated lysyl oxidase polypeptides (or polynucleotides) or test compounds can be prepared from biotin- NHS(N-hydroxysuccinimide) using techniques well known in the art (e.g., biotinylation kit, Pierce Chemicals, Rockford, 111.) and immobilized in the wells of streptavidin-coated 96 well plates (Pierce Chemical).
- antibodies which specifically bind to a lysyl oxidase polypeptide, polynucleotide, or a test compound, but which do not interfere with a desired binding site, such as the active site of the lysyl oxidase polypeptide, can be derivatized to the wells of the plate. Unbound target or protein can be trapped in the wells by antibody conjugation.
- Methods for detecting such complexes include immunodetection of complexes using antibodies which specifically bind to the lysyl oxidase polypeptide or test compound, enzyme-linked assays which rely on detecting an activity of the lysyl oxidase polypeptide, and SDS gel electrophoresis under non-reducing conditions.
- Screening for test compounds which bind to a lysyl oxidase polypeptide or polynucleotide also can be carried out in an intact cell. Any cell which comprises a lysyl oxidase polypeptide or polynucleotide can be used in a cell-based assay system.
- a lysyl oxidase polynucleotide can be naturally occurring in the cell or can be introduced using techniques such as those described above. Binding of the test compound to a lysyl oxidase polypeptide or polynucleotide is determined as described above.
- Test compounds can be tested for the ability to increase or decrease the lysyl oxidase activity of a human lysyl oxidase polypeptide. Lysyl oxidase activity can be measured, for example, as described in Konishi et al, Gastroenterology 89, 709-15,
- Enzyme assays can be carried out after contacting either a purified lysyl oxidase polypeptide, a cell membrane preparation, or an intact cell with a test compound.
- a test compound that decreases a lysyl oxidase activity of a lysyl oxidase polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% is identified as a potential therapeutic agent for decreasing lysyl oxidase activity.
- a test compound which increases a lysyl oxidase activity of a human lysyl oxidase polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% is identified as a potential therapeutic agent for increasing human lysyl oxidase activity.
- test compounds that increase or decrease lysyl oxidase gene expression are identified.
- a lysyl oxidase polynucleotide is contacted with a test compound, and the expression of an RNA or polypeptide product of the lysyl oxidase polynucleotide is determined.
- the level of expression of appropriate mRNA or polypeptide in the presence of the test compound is compared to the level of expression of mRNA or polypeptide in the absence of the test compound.
- the test compound can then be identified as a modulator of expression based on this comparison.
- test compound when expression of mRNA or polypeptide is greater in the presence of the test compound than in its absence, the test compound is identified as a stimulator or enhancer of the mRNA or polypeptide expression.
- test compound when expression of the mRNA or polypeptide is less in the presence of the test compound than in its absence, the test compound is identified as an inhibitor of the mRNA or polypeptide expression.
- the level of lysyl oxidase mRNA or polypeptide expression in the cells can be determined by methods well known in the art for detecting mRNA or polypeptide. Either qualitative or quantitative methods can be used.
- the presence of polypeptide products of a lysyl oxidase polynucleotide can be determined, for example, using a variety of techniques known in the art, including immunochemical methods such as radioimmunoassay, Western blotting, and immunohistochemistry.
- polypeptide synthesis can be determined in vivo, in a cell culture, or in an in vitro translation system by detecting inco ⁇ oration of labeled amino acids into a lysyl oxidase polypeptide.
- Such screening can be carried out either in a cell-free assay system or in an intact cell.
- Any cell that expresses a lysyl oxidase polynucleotide can be used in a cell- based assay system.
- the lysyl oxidase polynucleotide can be naturally occurring in the cell or can be introduced using techniques such as those described above.
- Either a primary culture or an established cell line, such as CHO or human embryonic kidney 293 cells, can be used.
- compositions of the invention can comprise, for example, a lysyl oxidase polypeptide, lysyl oxidase polynucleotide, ribozymes or antisense oligonucleotides, antibodies which specifically bind to a lysyl oxidase polypeptide, or mimetics, activators, or inhibitors of a lysyl oxidase polypeptide activity.
- compositions can be administered alone or in combination with at least one other agent, such as stabilizing compound, which can be administered in any sterile, biocompatible pharmaceutical carrier, including, but not limited to, saline, buffered saline, dextrose, and water.
- agent such as stabilizing compound
- the compositions can be administered to a patient alone, or in combination with other agents, drugs or hormones.
- compositions of the invention can be administered by any number of routes including, but not limited to, oral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, intraventricular, transdermal, subcutaneous, intraperitoneal, intranasal, parenteral, topical, sublingual, or rectal means.
- Pharmaceutical compositions for oral administration can be formulated using pharmaceutically acceptable carriers well known in the art in dosages suitable for oral administration. Such carriers enable the pharmaceutical compositions to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for ingestion by the patient.
- compositions for oral use can be obtained through combination of active compounds with solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores.
- Suitable excipients are carbohydrate or protein fillers, such as sugars, including lactose, sucrose, mannitol, or sorbitol; starch from corn, wheat, rice, potato, or other plants; cellulose, such as methyl cellulose, hydroxypropylmethyl-cellulose, or sodium carboxymethylcellulose; gums including arabic and tragacanth; and proteins such as gelatin and collagen.
- disintegrating or solubilizing agents can be added, such as the cross-linked polyvinyl pyrrolidone, agar, alginic acid, or a salt thereof, such as sodium alginate.
- Dragee cores can be used in conjunction with suitable coatings, such as concentrated sugar solutions, which also can contain gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
- suitable coatings such as concentrated sugar solutions, which also can contain gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
- Dyestuffs or pigments can be added to the tablets or dragee coatings for product identification or to characterize the quantity of active compound, i.e., dosage.
- compositions that can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a coating, such as glycerol or sorbitol.
- Push-fit capsules can contain active ingredients mixed with a filler or binders, such as lactose or starches, lubricants, such as talc or magnesium stearate, and, optionally, stabilizers.
- the active compounds can be dissolved or suspended in suitable liquids, such as fatty oils, liquid, or liquid polyethylene glycol with or without stabilizers.
- compositions suitable for parenteral administration can be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks' solution, Ringer's solution, or physiologically buffered saline.
- Aqueous injection suspensions can contain substances that increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Additionally, suspensions of the active compounds can be prepared as appropriate oily injection suspensions.
- Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes.
- Non-lipid polycationic amino polymers also can be used for delivery.
- the suspension also can contain suitable stabilizers or agents that increase the solubility of the compounds to allow for the preparation of highly concentrated solutions.
- penetrants appropriate to the particular barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
- compositions of the present invention can be manufactured in a manner that is known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping, or lyophilizing processes.
- the pharmaceutical composition can be provided as a salt and can be formed with many acids, including but not limited to, hydrochloric, sulfuric, acetic, lactic, tartaric, malic, succinic, etc. Salts tend to be more soluble in aqueous or other protonic solvents than are the corresponding free base forms.
- the preferred preparation can be a lyophilized powder which can contain any or all of the following: 1-50 mM histidine, 0.1%-2% sucrose, and 2-7% mannitol, at a pH range of 4.5 to 5.5, that is combined with buffer prior to use. Further details on techniques for formulation and administration can be found in the latest edition of REMINGTON'S PHARMACEUTICAL SCIENCES (Maack Publishing Co., Easton, Pa.). After pharmaceutical compositions have been prepared, they can be placed in an appropriate container and labeled for treatment of an indicated condi- tion. Such labeling would include amount, frequency, and method of administration.
- COPD chronic obstructive pulmonary (or airways) disease
- COPD chronic obstructive pulmonary (or airways) disease
- COPD chronic obstructive pulmonary (or airways) disease
- emphysema a condition defined physiologically as airflow obstruction that generally results from a mixture of emphysema and peripheral airway obstruction due to chronic bronchitis (Senior & Shapiro, Pulmonary Diseases and Disorders, 3d ed., New York, McGraw-Hill, 1998, pp. 659-681, 1998; Barnes, Chest 117, 10S-14S, 2000).
- Emphysema is characterized by destruction of alveolar walls leading to abnormal enlargement of the air spaces of the lung.
- Chronic bronchitis is defined clinically as the presence of chronic productive cough for three months in each of two successive years.
- airflow obstruction is usually progressive and is only partially reversible.
- the most important risk factor for development of COPD is cigarette smoking, although the disease does occur in non-smokers.
- the inflammatory cell population comprises increased numbers of macrophages, neutrophils, and CD8 lymphocytes.
- Inhaled irritants such as cigarette smoke, activate macrophages which are resident in the respiratory tract, as well as epithelial cells leading to release of chemokines (e.g., interleukin-8) and other chemotactic factors.
- chemokines e.g., interleukin-8
- chemotactic factors act to increase the neutrophil/- monocyte trafficking from the blood into the lung tissue and airways.
- Neutrophils and monocytes recruited into the airways can release a variety of potentially damaging mediators such as proteolytic enzymes and reactive oxygen species.
- Matrix degradation and emphysema along with airway wall thickening, surfactant dysfunction, and mucus hypersecretion, all are potential sequelae of this inflammatory response that lead to impaired airflow and gas exchange.
- Cardiovascular diseases include the following disorders of the heart and the vascular system: congestive heart failure, myocardial infarction, ischemic diseases of the heart, all kinds of atrial and ventricular arrhythmias, hypertensive vascular diseases, and peripheral vascular diseases.
- Heart failure is defined as a pathophysiologic state in which an abnormality of cardiac function is responsible for the failure of the heart to pump blood at a rate commensurate with the requirement of the metabolizing tissue. It includes all forms of pumping failure, such as high-output and low-output, acute and chronic, right-sided or left-sided, systolic or diastolic, independent of the underlying cause.
- MI Myocardial infarction
- Ischemic diseases are conditions in which the coronary flow is restricted resulting in a perfusion which is inadequate to meet the myocardial requirement for oxygen.
- This group of diseases includes stable angina, unstable angina, and asymptomatic ischemia.
- Arrhythmias include all forms of atrial and ventricular tachyarrhythmias (atrial tachycardia, atrial flutter, atrial fibrillation, atrio-ventricular reentrant tachycardia, preexcitation syndrome, ventricular tachycardia, ventricular flutter, and ventricular fibrillation), as well as bradycardic forms of arrhythmias.
- Vascular diseases include primary as well as all kinds of secondary arterial hypertension (renal, endocrine, neurogenic, others). The disclosed gene and its product may be used as drug targets for the treatment of hypertension as well as for the prevention of all complications.
- Peripheral vascular diseases are defined as vascular diseases in which arterial and/or venous flow is reduced resulting in an imbalance between blood supply and tissue oxygen demand. It includes chronic peripheral arterial occlusive disease (PAOD), acute arterial thrombosis and embolism, inflammatory vascular disorders, Raynaud's phenomenon, and venous disorders.
- PAOD peripheral arterial occlusive disease
- acute arterial thrombosis and embolism inflammatory vascular disorders
- Raynaud's phenomenon Raynaud's phenomenon
- venous disorders venous disorders.
- Cancer is a disease fundamentally caused by oncogenic cellular transformation.
- transformed cells There are several hallmarks of transformed cells that distinguish them from their normal counterparts and underlie the pathophysiology of cancer. These include uncontrolled cellular proliferation, unresponsiveness to normal death-inducing signals (immortalization), increased cellular motility and invasiveness, increased ability to recruit blood supply through induction of new blood vessel formation
- angiogenesis angiogenesis
- genetic instability genetic instability
- dysregulated gene expression Various combinations of these aberrant physiologies, along with the acquisition of drug-resistance frequently lead to an intractable disease state in which organ failure and patient death ultimately ensue.
- Genes or gene fragments identified through genomics can readily be expressed in one or more heterologous expression systems to produce functional recombinant proteins.
- proteins are characterized in vitro for their biochemical properties and then used as tools in high-throughput molecular screening programs to identify chemical modulators of their biochemical activities.
- Agonists and/or antagonists of target protein activity can be identified in this manner and subsequently tested in cellular and in vivo disease models for anti-cancer activity. Optimization of lead compounds with iterative testing in biological models and detailed pharmacokinetic and toxicological analyses form the basis for drug development and subsequent testing in humans.
- This invention further pertains to the use of novel agents identified by the screening assays described above. Accordingly, it is within the scope of this invention to use a test compound identified as described herein in an appropriate animal model.
- an agent identified as described herein e.g., a modulating agent, an antisense nucleic acid molecule, a specific antibody, ribozyme, or a lysyl oxidase polypeptide binding molecule
- an agent identified as described herein can be used in an animal model to determine the efficacy, toxicity, or side effects of treatment with such an agent.
- an agent identified as described herein can be used in an animal model to determine the mechanism of action of such an agent.
- this invention pertains to uses of novel agents identified by the above-described screening assays for treatments as described herein.
- a reagent which affects lysyl oxidase activity can be administered to a human cell, either in vitro or in vivo, to reduce lysyl oxidase activity.
- the reagent preferably binds to an expression product of a human lysyl oxidase gene. If the expression product is a protein, the reagent is preferably an antibody.
- an antibody can be added to a preparation of stem cells that have been removed from the body. The cells can then be replaced in the same or another human body, with or without clonal propagation, as is known in the art.
- the reagent is delivered using a liposome.
- the liposome is stable in the animal into which it has been administered for at least about
- a liposome comprises a lipid composition that is capable of targeting a reagent, particularly a polynucleotide, to a particular site in an animal, such as a human.
- the lipid composition of the liposome is capable of targeting to a specific organ of an animal, such as the lung, liver, spleen, heart brain, lymph nodes, and skin.
- a liposome useful in the present invention comprises a lipid composition that is capable of fusing with the plasma membrane of the targeted cell to deliver its contents to the cell.
- the transfection efficiency of a liposome is about
- a liposome is between about 100 and 500 nm, more preferably between about 150 and 450 nm, and even more preferably between about 200 and 400 nm in diameter.
- Suitable liposomes for use in the present invention include those liposomes standardly used in, for example, gene delivery methods known to those of skill in the art. More preferred liposomes include liposomes having a polycationic lipid composition and/or liposomes having a cholesterol backbone conjugated to polyethylene glycol.
- a liposome comprises a compound capable of targeting the liposome to a particular cell type, such as a cell-specific ligand exposed on the outer surface of the liposome.
- Complexing a liposome with a reagent such as an antisense oligonucleotide or ribozyme can be achieved using methods that are standard in the art (see, for example, U.S. Patent 5,705,151).
- polynucleotide is combined with about 8 ntnol of liposomes, more preferably from about 0.5 ⁇ g to about 5 ⁇ g of polynucleotides are combined with about 8 ntnol liposomes, and even more preferably about 1.0 ⁇ g of polynucleotides is combined with about 8 nmol liposomes.
- antibodies can be delivered to specific tissues in vivo using receptor-mediated targeted delivery.
- Receptor-mediated DNA delivery techniques are taught in, for example, Findeis et al. Trends in Biotechnol. 11, 202-05 (1993);
- a therapeutically effective dose refers to that amount of active ingredient which increases or decreases lysyl oxidase activity relative to the lysyl oxidase activity which occurs in the absence of the therapeutically effective dose.
- the therapeutically effective dose can be estimated initially either in cell culture assays or in animal models, usually mice, rabbits, dogs, or pigs.
- the animal model also can be used to determine the appropriate concentration range and route of administration. Such information can then be used to determine useful doses and routes for administration in humans.
- Therapeutic efficacy and toxicity e.g., ED 50 (the dose therapeutically effective in 50% of the population) and LD 50 (the dose lethal to 50% of the population), can be determined by standard pharmaceutical procedures in cell cultures or experimental animals.
- the dose ratio of toxic to therapeutic effects is the therapeutic index, and it can be expressed as the ratio, LD 50 /ED 5 o.
- compositions that exhibit large therapeutic indices are preferred.
- the data obtained from cell culture assays and animal studies is used in formulating a range of dosage for human use.
- the dosage contained in such compositions is preferably within a range of circulating concentrations that include the ED 50 with little or no toxicity.
- the dosage varies within this range depending upon the dosage form employed, sensitivity of the patient, and the route of administration.
- Dosage and administration are adjusted to provide sufficient levels of the active ingredient or to maintain the desired effect.
- Factors that can be taken into account include the severity of the disease state, general health of the subject, age, weight, and gender of the subject, diet, time and frequency of administration, drug combination(s), reaction sensitivities, and tolerance/response to therapy.
- Long-acting pharmaceutical compositions can be administered every 3 to 4 days, every week, or once every two weeks depending on the half-life and clearance rate of the particular formulation.
- Normal dosage amounts can vary from 0.1 to 100,000 micrograms, up to a total dose of about 1 g, depending upon the route of administration.
- Guidance as to particular dosages and methods of delivery is provided in the literature and generally available to practitioners in the art. Those skilled in the art will employ different formulations for nucleotides than for proteins or their inhibitors. Similarly, delivery of polynucleotides or polypeptides will be specific to particular cells, conditions, locations, etc.
- polynucleotides encoding the antibody can be constructed and introduced into a cell either ex vivo or in vivo using well- established techniques including, but not limited to, transferrin-polycation-mediated DNA transfer, transfection with naked or encapsulated nucleic acids, liposome- mediated cellular fusion, intracellular transportation of DNA-coated latex beads, protoplast fusion, viral infection, electroporation, "gene gun,” and DEAE- or calcium phosphate-mediated transfection.
- Effective in vivo dosages of an antibody are in the range of about 5 ⁇ g to about 50 ⁇ g/kg, about 50 ⁇ g to about 5 mg/kg, about 100 ⁇ g to about 500 ⁇ g/kg of patient body weight, and about 200 to about 250 ⁇ g/kg of patient body weight.
- effective in vivo dosages are in the range of about 100 ng to about 200 ng, 500 ng to about 50 mg, about 1 ⁇ g to about 2 mg, about 5 ⁇ g to about 500 ⁇ g, and about 20 ⁇ g to about 100 ⁇ g of DNA.
- the reagent is preferably an antisense oligonucleotide or a ribozyme.
- Polynucleotides that express antisense oligonucleotides or ribozymes can be introduced into cells by a variety of methods, as described above.
- a reagent reduces expression of a lysyl oxidase gene or the activity of a lysyl oxidase polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% relative to the absence of the reagent.
- the effectiveness of the mechanism chosen to decrease the level of expression of a lysyl oxidase gene or the activity of a lysyl oxidase polypeptide can be assessed using methods well known in the art, such as hybridization of nucleotide probes to lysyl oxidase-specific mRNA, quantitative RT-PCR, immunologic detection of a lysyl oxidase polypeptide, or measurement of lysyl oxidase activity.
- any of the pharmaceutical compositions of the invention can be administered in combination with other appropriate therapeutic agents.
- Selection of the appropriate agents for use in combination therapy can be made by one of ordinary skill in the art, according to conventional pharmaceutical principles.
- the combination of therapeutic agents can act synergistically to effect the treatment or prevention of the various disorders described above. Using this approach, one may be able to achieve therapeutic efficacy with lower dosages of each agent, thus reducing the potential for adverse side effects.
- any of the therapeutic methods described above can be applied to any subject in need of such therapy, including, for example, mammals such as dogs, cats, cows, horses, rabbits, monkeys, and most preferably, humans.
- Human lysyl oxidase also can be used in diagnostic assays for detecting diseases and abnormalities or susceptibility to diseases and abnormalities related to the presence of mutations in the nucleic acid sequences that encode the enzyme. For example, differences can be determined between the cDNA or genomic sequence encoding lysyl oxidase in individuals afflicted with a disease and in normal individuals. If a mutation is observed in some or all of the afflicted individuals but not in normal individuals, then the mutation is likely to be the causative agent of the disease.
- Sequence differences between a reference gene and a gene having mutations can be revealed by the direct DNA sequencing method.
- cloned DNA segments can be employed as probes to detect specific DNA segments.
- the sensitivity of this method is greatly enhanced when combined with PCR.
- a sequencing primer can be used with a double-stranded PCR product or a single-stranded template molecule generated by a modified PCR.
- the sequence determination is performed by conventional procedures using radiolabeled nucleotides or by automatic sequencing procedures using fluorescent tags. Genetic testing based on DNA sequence differences can be carried out by detection of alteration in electrophoretic mobility of DNA fragments in gels with or without denaturing agents. Small sequence deletions and insertions can be visualized, for example, by high resolution gel electrophoresis.
- DNA fragments of different sequences can be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific melting or partial melting temperatures (see, e.g., Myers et al, Science 230, 1242, 1985). Sequence changes at specific locations can also be revealed by nuclease protection assays, such as RNase and S 1 protection or the chemical cleavage method (e.g., Cotton et al, Proc. Natl. Acad. Sci. USA 85, 4397-
- the detection of a specific DNA sequence can be performed by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes and Southern blotting of genomic DNA.
- direct methods such as gel-electrophoresis and DNA sequencing, mutations can also be detected by in situ analysis.
- Altered levels of lysyl oxidase also can be detected in various tissues.
- Assays used to detect levels of the receptor polypeptides in a body sample, such as blood or a tissue biopsy, derived from a host are well known to those of skill in the art and include radioimmunoassays, competitive binding assays, Western blot analysis, and ELISA assays.
- the polynucleotide of SEQ TD NO: 1 is inserted into the expression vector pCEV4 and the expression vector pCEV4-lysyl oxidase polypeptide obtained is transfected into human embryonic kidney 293 cells. From these cells extracts are obtained and lysyl oxidase activity is measured in an assay in which recombinant human [3H] tropoelastin is used as the substrate. Lysyl oxidase activity is measured in the culture media of the above cells. To measure lysyl oxidase activity in the culture medium,
- 0.5 mL of the culture medium is added to a solution containing 0.1 mol/L sodium borate, 0.15 mol/L sodium chloride, and 125 000 cpm [3H]rTE substrate in a final reaction volume of 1 mL.
- This reaction mixture is incubated for 2 hourts at 37°C in the presence or absence of 50 ⁇ mol/L ⁇ -aminopropionitrile.
- the reaction is stopped on ice, and the mixture is spun in a centrifuge at 15 OOOg for 15 minutes at 4°C to remove the insoluble substrate.
- a 700 ⁇ L aliquot of the supernatant is transferred to 10 000-molecular weight cutoff microconcentrating filters and spun at 5000g for 1 hour at 2°C.
- Lysyl oxidase activity is measured in 400 ⁇ L aliquots by liquid scintillation spectrometry, defined as the difference in counts per minute released from paired reaction mixtures carried out in the presence or absence of ⁇ - aminopropionitrile and normalized to cell number. Triplicate assays are performed on triplicate cultures for each experimental condition. It is shown that the polypeptide of SEQ ID NO: 2 has a lysyl oxidase activity.
- Pichia pastoris expression vector pPICZB (Invitrogen, San Diego, CA) is used to produce large quantities of recombinant human lysyl oxidase polypeptides in yeast.
- the lysyl oxidase-encoding DNA sequence is derived from SEQ TD NO: 1 or 26.
- the DNA sequence is modified by well known methods in such a way that it contains at its 5 '-end an initiation codon and at its 3 '-end an enterokinase cleavage site, a His6 reporter tag and a termination codon.
- the modified DNA sequence is ligated into pPICZB.
- This expression vector is designed for inducible expression in Pichia pastoris, driven by a yeast promoter. The resulting pPICZ/md-His6 vector is used to transform the yeast.
- the yeast is cultivated under usual conditions in 5 liter shake flasks and the recombinantly produced protein isolated from the culture by affinity chromatography (Ni-NTA-Resin) in the presence of 8 M urea.
- the bound polypeptide is eluted with buffer, pH 3.5, and neutralized. Separation of the polypeptide from the His6 reporter tag is accomplished by site-specific proteolysis using enterokinase (Invitrogen, San
- Purified lysyl oxidase polypeptides comprising a glutathione-S-transferase protein and absorbed onto glutathione-derivatized wells of 96-well microtiter plates are contacted with test compounds from a small molecule library at pH 7.0 in a physiological buffer solution.
- Human lysyl oxidase polypeptides comprise the amino acid sequence shown in SEQ ID NO: 2 or 28.
- the test compounds comprise a fluorescent tag.
- the samples are incubated for 5 minutes to one hour. Control samples are incubated in the absence of a test compound.
- the buffer solution containing the test compounds is washed from the wells.
- Binding of a test compound to a lysyl oxidase polypeptide is detected by fluorescence measurements of the contents of the wells.
- a test compound that increases the fluorescence in a well by at least 15% relative to fluorescence of a well in which a test compound is not incubated is identified as a compound which binds to a lysyl oxidase polypeptide.
- test compound is administered to a culture of human cells transfected with a lysyl oxidase expression construct and incubated at 37°C for 10 to 45 minutes.
- a culture of the same type of cells that have not been transfected is incubated for the same time without the test compound to provide a negative control.
- RNA is isolated from the two cultures as described in Chirgwin et al, Biochem. 18, 5194-99, 1979).
- Northern blots are prepared using 20 to 30 ⁇ g total RNA and hybridized with a 32 P-labeled lysyl oxidase-specific probe at 65°C in Express-hyb (CLONTECH).
- the probe comprises at least 11 contiguous nucleotides selected from the complement of SEQ TD NO: 1 or 26.
- a test compound that decreases the lysyl oxidase-specific signal relative to the signal obtained in the absence of the test compound is identified as an inhibitor of lysyl oxidase gene expression.
- test compound is administered to a culture of human cells transfected with a lysyl oxidase expression construct and incubated at 37°C for 10 to 45 minutes.
- a culture of the same type of cells that have not been transfected is incubated for the same time without the test compound to provide a negative control, lysyl oxidase activity is measured using the method of Konishi et al, Gastroenterology 89, 709-15, 1985.
- test compound which decreases the lysyl oxidase activity of the lysyl oxidase relative to the lysyl oxidase activity in the absence of the test compound is identified as an inhibitor of lysyl oxidase activity.
- RT-PCR Reverse Transcription-Polymerase Chain Reaction
- the initial expression panel consists of RNA samples from respiratory tissues and inflammatory cells relevant to COPD: lung (adult and fetal), trachea, freshly isolated alveolar type ⁇ cells, cultured human bronchial epithelial cells, cultured small airway epithelial cells, cultured bronchial sooth muscle cells, cultured H441 cells (Clara- like), freshly isolated neutrophils and monocytes, and cultured monocytes
- Body map profiling also is carried out, using total RNA panels purchased from Clontech.
- the tissues are adrenal gland, bone marrow, brain, colon, heart, kidney, liver, lung, mammary gland, pancreas, prostate, salivary gland, skeletal muscle, small intestine, spleen, stomach, testis, thymus, trachea, thyroid, and uterus.
- Quantitative expression profiling is performed by the form of quantitative PCR analysis called "kinetic analysis” firstly described in Higuchi et al, BioTechnology 10, 413-17, 1992, and Higuchi et al, BioTechnology 11, 1026-30, 1993. The principle is that at any given cycle within the exponential phase of PCR, the amount of product is proportional to the initial number of template copies.
- the probe is cleaved by the 5 '-3' endonuclease activity of Taq DNA polymerase and a fluorescent dye released in the medium (Holland et al, Proc. Natl. Acad. Sci. U.S.A.
- the amplification of an endogenous control can be performed to standardize the amount of sample RNA added to a reaction.
- the control of choice is the 18S ribosomal RNA. Because reporter dyes with differing emission spectra are available, the target and the endogenous control can be independently quantified in the same tube if probes labeled with different dyes are used.
- RNA extraction and cDN A preparation Total RNA from the tissues listed above are used for expression quantification. RNAs labeled "from autopsy” were extracted from autoptic tissues with the TRIzol reagent (Life Technologies, MD) according to the manufacturer's protocol.
- RNA Fifty ⁇ g of each RNA were treated with DNase I for 1 hour at 37°C in the following reaction mix: 0.2 U/ ⁇ l RNase-free DNase I (Roche Diagnostics, Germany); 0.4 U/ ⁇ l
- RNase inhibitor PE Applied Biosystems, CA
- 10 mM Tris-HCl pH 7.9 10 mM Tris-HCl pH 7.9
- lOmM MgCl 2 50 mM NaCl
- 1 mM DTT 1 mM DTT
- RNA is extracted once with 1 volume of phenohchloroform:- isoamyl alcohol (24:24:1) and once with chloroform, and precipitated with 1/10 volume of 3 M NaAcetate, pH5.2, and 2 volumes of ethanol.
- RNA from the autoptic tissues Fifty ⁇ g of each RNA from the autoptic tissues are DNase treated with the DNA-free kit purchased from Ambion (Ambion, TX). After resuspension and spectrophoto- metric quantification, each sample is reverse transcribed with the TaqMan Reverse
- RNA Transcription Reagents PE Applied Biosystems, CA
- the final concentration of RNA in the reaction mix is 200 ng/ ⁇ L.
- Reverse transcription is carried out with 2.5 ⁇ M of random hexamer primers.
- TaqMan quantitative analysis Specific primers and probe are designed according to the recommendations of PE Applied Biosystems; the probe can be labeled at the 5' end FAM (6-carboxy-fluorescein) and at the 3' end with TAMRA (6-carboxy- tetramethyl-rhodamine). Quantification experiments are performed on 10 ng of reverse transcribed RNA from each sample. Each determination is done in triplicate.
- FAM 6-carboxy-fluorescein
- TAMRA 6-carboxy- tetramethyl-rhodamine
- Total cDNA content is normalized with the simultaneous quantification (multiplex PCR) of the 18S ribosomal RNA using the Pre-Developed TaqMan Assay Reagents (PDAR) Control Kit (PE Applied Biosystems, CA).
- PDAR Pre-Developed TaqMan Assay Reagents
- the assay reaction mix is as follows: IX final TaqMan Universal PCR Master Mix
- the experiment is performed on an ABI Prism 7700 Sequence Detector (PE Applied Biosystems, CA).
- fluorescence data acquired during PCR are processed as described in the ABI Prism 7700 user's manual in order to achieve better background subtraction as well as signal linearity with the starting target quantity.
- the cell line used for testing is the human colon cancer cell line HCT116.
- Cells are cultured in RPMI-1640 with 10-15% fetal calf serum at a concentration of 10,000 cells per milliliter in a volume of 0.5 ml and kept at 37°C in a 95% air/5%CO 2 atmosphere.
- Phosphorothioate oligoribonucleotides are synthesized on an Applied Biosystems Model 380B DNA synthesizer using phosphoroamidite chemistry. A sequence of 24 bases complementary to the nucleotides at position 1 to 24 of SEQ ID NO: 1 is used as the test oligonucleotide. As a control, another (random) sequence is used: 5'-TCA ACT GAC TAG ATG TAC ATG GAC-3' (SEQ ID NO: 25). Following assembly and deprotection, oligonucleotides are ethanol-precipitated twice, dried, and sus- pended in phosphate buffered saline at the desired concentration.
- oligonucleotides Purity of the oligonucleotides is tested by capillary gel electrophoresis and ion exchange HPLC. The purified oligonucleotides are added to the culture medium at a concentration of 10 ⁇ M once per day for seven days.
- test oligonucleotide for seven days results in significantly reduced expression of human lysyl oxidase as determined by Western blotting. This effect is not observed with the control oligonucleotide.
- the number of cells in the cultures is counted using an automatic cell counter. The number of cells in cultures treated with the test oligonucleotide (expressed as 100%) is compared with the number of cells in cultures treated with the control oligonucleotide. The number of cells in cultures treated with the test oligonucleotide is not more than 30% of control, indicating that the inhibition of human lysyl oxidase has an anti-proliferative effect on cancer cells.
- This non-tumor assay measures the ability of a compound to reduce either the endogenous level of a circulating hormone or the level of hormone produced in response to a biologic stimulus.
- Rodents are administered test compound (p.o., i.p., i.v., i.m., or s.c).
- test compound p.o., i.p., i.v., i.m., or s.c
- Plasma is assayed for levels of the hormone of interest. If the normal circulating levels of the hormone are too low and/or variable to provide consistent results, the level of the hormone may be elevated by a pre-treatment with a biologic stimulus (i.e., LHRH may be injected i.m.
- a biologic stimulus i.e., LHRH may be injected i.m.
- Hollow fibers are prepared with desired cell line(s) and implanted intraperitoneally and/or subcutaneously in rodents. Compounds are administered p.o., i.p., i.v., i.m., or s.c. Fibers are harvested in accordance with specific readout assay protocol, these may include assays for gene expression (bDNA, PCR, or Taqman), or a specific biochemical activity (i.e., cAMP levels. Results are analyzed by Student's t-test or Rank Sum test after the variance between groups is compared by an F-test, with significance at p ⁇ 0.05 as compared to the vehicle control group.
- specific readout assay protocol these may include assays for gene expression (bDNA, PCR, or Taqman), or a specific biochemical activity (i.e., cAMP levels. Results are analyzed by Student's t-test or Rank Sum test after the variance between groups is compared by an F-test, with significance at p ⁇
- Rodents are administered test compound (p.o., i.p., i.v., i.m., or s.c.) according to a predetermined schedule and for a predetermined duration (i.e., 1 week).
- animals are weighed, the target organ is excised, any fluid is expressed, and the weight of the organ is recorded.
- Blood plasma may also be collected. Plasma may be assayed for levels of a hormone of interest or for levels of test agent.
- Organ weights may be directly compared or they may be normalized for the body weight of the animal. Compound effects are compared to a vehicle-treated control group. An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-test. Significance is p value ⁇ 0.05 compared to the vehicle control group. 2.2. Hollow Fiber Proliferation Assay
- Hollow fibers are prepared with desired cell line(s) and implanted intraperitoneally and/or subcutaneously in rodents. Compounds are administered p.o., i.p., i.v., i.m., or s.c. Fibers are harvested in accordance with specific readout assay protocol.
- Cell proliferation is determined by measuring a marker of cell number (i.e., MTT or LDH). The cell number and change in cell number from the starting inoculum are analyzed by Student's t-test or Rank Sum test after the variance between groups is compared by an F-test, with significance at p ⁇ 0.05 as compared to the vehicle control group.
- Hydron pellets with or without growth factors or cells are implanted into a micropocket surgically created in the rodent cornea.
- Compound administration may be systemic or local (compound mixed with growth factors in the hydron pellet).
- Corneas are harvested at 7 days post implantation immediately following intracardiac infusion of colloidal carbon and are fixed in 10% formalin. Readout is qualitative scoring and/or image analysis. Qualitative scores are compared by Rank Sum test. Image analysis data is evaluated by measuring the area of neovascularization (in pixels) and group averages are compared by Student's t-test (2 tail). Significance is p ⁇ 0.05 as compared to the growth factor or cells only group.
- Matrigel containing cells or growth factors, is injected subcutaneously. Compounds are administered p.o., i.p., i.v., i.m., or s.c. Matrigel plugs are harvested at predetermined time point(s) and prepared for readout. Readout is an ELISA-based assay for hemoglobin concentration and/or histological examination (i.e. vessel count, special staining for endothelial surface markers: CD31, factor-8). Readouts are analyzed by Student's t-test, after the variance between groups is compared by an F- test, with significance determined at p ⁇ 0.05 as compared to the vehicle control group.
- Tumor cells or fragments are implanted subcutaneously on Day 0.
- Vehicle and/or compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule starting at a time, usually on Day 1, prior to the ability to measure the tumor burden.
- Body weights and tumor measurements are recorded 2-3 times weekly. Mean net body and tumor weights are calculated for each data collection day.
- Anti- tumor efficacy may be initially determined by comparing the size of treated (T) and control (C) tumors on a given day by a Student's t-test, after the variance between groups is compared by an F-test, with significance determined at p ⁇ 0.05.
- Tumor growth delays are expressed as the difference in the median time for the treated and control groups to attain a predetermined size divided by the median time for the control group to attain that size. Growth delays are compared by generating Kaplan-
- Tumor cells are injected intraperitoneally or intracranially on Day 0.
- Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule starting on Day 1. Observations of morbidity and/or mortality are recorded twice daily. Body weights are measured and recorded twice weekly. Morbidity/mortality data is expressed in terms of the median time of survival and the number of long- term survivors is indicated separately. Survival times are used to generate Kaplan- Meier curves. Significance is p ⁇ 0.05 by a log-rank test compared to the control group in the experiment.
- Tumor cells or fragments are implanted subcutaneously and grown to the desired size for treatment to begin. Once at the predetermined size range, mice are randomized into treatment groups. Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule. Tumor and body weights are measured and recorded 2-3 times weekly. Mean tumor weights of all groups over days post inoculation are graphed for comparison. An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-test to compare tumor sizes in the treated and control groups at the end of treatment. Significance is p ⁇ 0.05 as compared to the control group.
- Tumor measurements may be recorded after dosing has stopped to monitor tumor growth delay.
- Tumor growth delays are expressed as the difference in the median time for the treated and control groups to attain a predetermined size divided by the median time for the control group to attain that size. Growth delays are compared by generating Kaplan-Meier curves from the times for individual tumors to attain the evaluation size. Significance is p value ⁇ 0.05 compared to the vehicle control group.
- Tumor cells or fragments, of mammary adenocarcinoma origin are implanted directly into a surgically exposed and reflected mammary fat pad in rodents.
- the fat pad is placed back in its original position and the surgical site is closed.
- Hormones may also be administered to the rodents to support the growth of the tumors.
- Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule. Tumor and body weights are measured and recorded 2-3 times weekly.
- Mean tumor weights of all groups over days post inoculation are graphed for comparison.
- An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-test to compare tumor sizes in the treated and control groups at the end of treatment. Significance is p ⁇ 0.05 as compared to the control group.
- Tumor measurements may be recorded after dosing has stopped to monitor tumor growth delay.
- Tumor growth delays are expressed as the difference in the median time for the treated and control groups to attain a predetermined size divided by the median time for the control group to attain that size. Growth delays are compared by generating Kaplan-Meier curves from the times for individual tumors to attain the evaluation size. Significance is p value ⁇ 0.05 compared to the vehicle control group.
- this model provides an opportunity to increase the rate of spontaneous metastasis of this type of tumor. Metastasis can be assessed at termination of the study by counting the number of visible foci per target organ, or measuring the target organ weight. The means of these endpoints are compared by Student's t-test after conducting an F-test, with significance determined at p ⁇ 0.05 compared to the control group in the experiment. 3.3.2. Intraprostatic Assay
- Tumor cells or fragments, of prostatic adenocarcinoma origin are implanted directly into a surgically exposed dorsal lobe of the prostate in rodents.
- the prostate is externalized through an abdominal incision so that the tumor can be implanted specifically in the dorsal lobe while verifying that the implant does not enter the seminal vesicles.
- the successfully inoculated prostate is replaced in the abdomen and the incisions through the abdomen and skin are closed.
- Hormones may also be administered to the rodents to support the growth of the tumors.
- Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule.
- Body weights are measured and recorded 2-3 times weekly. At a predetermined time, the experiment is terminated and the animal is dissected.
- the size of the primary tumor is measured in three dimensions using either a caliper or an ocular micrometer attached to a dissecting scope.
- An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-test to compare tumor sizes in the treated and control groups at the end of treatment. Significance is p ⁇ 0.05 as compared to the control group. This model provides an opportunity to increase the rate of spontaneous metastasis of this type of tumor.
- Metastasis can be assessed at termination of the study by counting the number of visible foci per target organ (i.e., the lungs), or measuring the target organ weight (i.e., the regional lymph nodes). The means of these endpoints are compared by Student's t-test after conducting an F-test, with significance determined at p ⁇ 0.05 compared to the control group in the experiment.
- Tumor cells of pulmonary origin may be implanted intrabronchially by making an incision through the skin and exposing the trachea.
- the trachea is pierced with the beveled end of a 25 gauge needle and the tumor cells are inoculated into the main bronchus using a flat-ended 27 gauge needle with a 90° bend.
- Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule. Body weights are measured and recorded 2-3 times weekly. At a predetermined time, the experiment is terminated and the animal is dissected.
- the size of the primary tumor is measured in three dimensions using either a caliper or an ocular micrometer attached to a dissecting scope.
- An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-test to compare tumor sizes in the treated and control groups at the end of treatment. Significance is p ⁇ 0.05 as compared to the control group.
- This model provides an opportunity to increase the rate of spontaneous metastasis of this type of tumor. Metastasis can be assessed at termination of the study by counting the number of visible foci per target organ (i.e., the contralateral lung), or measuring the target organ weight. The means of these endpoints are compared by Student's t-test after conducting an F-test, with significance determined at p ⁇ 0.05 compared to the control group in the experiment.
- Tumor cells of gastrointestinal origin may be implanted intracecally by making an abdominal incision through the skin and externalizing the intestine. Tumor cells are inoculated into the cecal wall without penetrating the lumen of the intestine using a 27 or 30 gauge needle. Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule. Body weights are measured and recorded 2-3 times weekly. At a predetermined time, the experiment is terminated and the animal is dissected. The size of the primary tumor is measured in three dimensions using either a caliper or an ocular micrometer attached to a dissecting scope. An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t- test to compare tumor sizes in the treated and control groups at the end of treatment.
- Significance is p ⁇ 0.05 as compared to the control group.
- This model provides an opportunity to increase the rate of spontaneous metastasis of this type of tumor.
- Metastasis can be assessed at termination of the study by counting the number of visible foci per target organ (i.e., the liver), or measuring the target organ weight. The means of these endpoints are compared by Student's t-test after conducting an F-test, with significance determined at p ⁇ 0.05 compared to the control group in the experiment.
- Tumor cells are inoculated s.c. and the tumors allowed to grow to a predetermined range for spontaneous metastasis studies to the lung or liver. These primary tumors are then excised. Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule which may include the period leading up to the excision of the primary tumor to evaluate therapies directed at inhibiting the early stages of tumor metastasis. Observations of morbidity and/or mortality are recorded daily. Body weights are measured and recorded twice weekly. Potential endpoints include survival time, numbers of visible foci per target organ, or target organ weight. When survival time is used as the endpoint the other values are not determined.
- Survival data is used to generate Kaplan-Meier curves. Significance is p ⁇ 0.05 by a log-rank test compared to the control group in the experiment. The mean number of visible tumor foci, as determined under a dissecting microscope, and the mean target organ weights are compared by Student's t-test after conducting an F-test, with significance determined at p ⁇ 0.05 compared to the control group in the experiment for both of these endpoints.
- Tumor cells are injected into the tail vein, portal vein, or the left ventricle of the heart in experimental (forced) lung, liver, and bone metastasis studies, respectively.
- Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule. Observations of morbidity and/or mortality are recorded daily. Body weights are measured and recorded twice weekly. Potential endpoints include survival time, numbers of visible foci per target organ, or target organ weight. When survival time is used as the endpoint the other values are not determined. Survival data is used to generate Kaplan-Meier curves. Significance is p ⁇ 0.05 by a log-rank test compared to the control group in the experiment.
- the mean number of visible tumor foci, as determined under a dissecting microscope, and the mean target organ ' ⁇ weights are compared by Student's t-test after conducting an F-test, with significance at p ⁇ 0.05 compared to the vehicle control group in the experiment for both endpoints.
- RNA prepared by the Tri-reagent protocol was treated with DNAse I to remove genomic DNA contamination.
- RNA from each cell or tissue source was first reverse transcribed. Eighty-five ⁇ g of total RNA was reverse transcribed using 1 ⁇ mole random hexamer primers, 0.5 mM each of dATP, dCTP, dGTP and dTTP (Qiagen, Hilden, Germany), 3000 U RnaseOut (Invitrogen, Groningen, Netherlands) in a final volume of 680 ⁇ l.
- the first strand synthesis buffer and Omniscript (2 u/ ⁇ l) reverse transcriptase were from Qiagen (Hilden, Germany). The reaction was incubated at 37°C for 90 minutes and cooled on ice. The volume was adjusted to 6800 ⁇ l with water, yielding a final concentration of 12.5 ng/ ⁇ l of starting RNA.
- the human lysyl oxidase forward primer sequence was: Primerl: S'-TCCGGCGGAAGCTCTACAT-S' (SEQ ID NO: 22).
- the human lysyl oxidase reverse primer sequence was Primer2: S'CACCGAGTCACGCTTCGCAAGC 3' (SEQ ID NO: 23).
- the fluorogenic probe, labeled with FAM as the reporter dye and TAMRA as the quencher, is Probe 1: 5 ⁇ -
- CATACTGAACCCCTGGCAGC-3 (SEQ ID NO: 24).
- the following reactions in a final volume of 25 ⁇ l were set up : IX TaqMan buffer A, 5.5 mM MgCl 2 , 200 nM each of dATP, dCTP, dGTP and dUTP, 0.025 U/ ⁇ l AmpliTaq GoldTM, 0.01 U/ ⁇ l AmpErase UNG ® and probe IX, human lysyl oxidase forward and reverse primers each at 200 nM, 200 nM human lysyl oxidase FAM/TAMRA-labeled probe, and 5 ⁇ l of template cDNA.
- Thermal cycling parameters were 2 min HOLD at 50°C, 10 min HOLD at 95°C, followed by melting at 95°C for 15 sec and annealing/extending at 60°C for 1 min for each of 40 cycles.
- the CT-value is calculated as described above.
- the CF-value is calculated as followed :
- PCR reactions were set up to quantitate the housekeeping genes (HKG) for each cDNA sample.
- CTpannel-mean value - CTcDNA-X-mean value CFcDNA-X
- CTcDNA-X + CFcDNA-X CTcor-cDNA-X Calculation of relative expression as follows:
- highest CTcor-cDNA-X 40 is defined as CTcor-cDNA-X [high]
- the results of the mRNA-quantification is shown in Figs. 29- 31.
- the human lysyl oxidase is highly expression in cervix, breast tumor, trachea, prostate BPH, adipose, atrium (heart), aorta and HEP G2 cells.
- the results of the expression profiling suggest surprisingly an association between human lysyl oxidase and cancer, genitourinary diseases, cardiovascular diseases and metabolic diseases.
- Guinea pigs are exposed on a single occasion to tobacco smoke for 50 minutes. Animals are sacrificed between 10 minutes and 24 hour following the end of the exposure and their lungs placed in RNAlaterTM. The lung tissue is homogenised ,and total RNA was extracted using a Qiagen RNeasyTM Maxi kit. Molecular Probes
- RiboGreenTM RNA quantitation method is used to quantify the amount of RNA in each sample.
- RNA is reverse transcribed, and the resultant cDNA is used in a real-time polymerase chain reaction (PCR).
- PCR polymerase chain reaction
- the cDNA is added to a solution containing the sense and anti-sense primers and the 6-carboxy-tetramethyl-rhodamine labeled probe of the lysyl oxidase gene.
- Cyclophilin is used as the housekeeping gene.
- the expression of the lysyl oxidase gene is measured using the TaqMan real-time PCR system that generates an amplification curve for each sample. From this curve a threshold cycle value is calculated: the fractional cycle number at which the amount of amplified target reaches a fixed threshold.
- a sample containing many copies of the lysyl oxidase gene will reach this threshold earlier than a sample containing fewer copies.
- the threshold is set at 0.2, and the threshold cycle O is calculated from the amplification curve.
- the Op value for the lysyl oxidase gene is normalized using the CT value for the housekeeping gene.
- lysyl oxidase gene is increased by at least 3 -fold between 10 minutes and 3 hours post tobacco smoke exposure compared to air exposed control animals.
- Test compounds are evaluated as follows. Animals are pre-treated with a test compound between 5 minutes and 1 hour prior to the tobacco smoke exposure and they are then sacrificed up to 3 hours after the tobacco smoke exposure has been completed. Control animals are pre-treated with the vehicle of the test compound via the route of administration chosen for the test compound. A test compound that reduces the tobacco smoke induced upregulation of lysyl oxidase gene relative to the expression seen in vehicle treated tobacco smoke exposed animals is identified as an inhibitor of lysyl oxidase gene expression.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Applications Claiming Priority (6)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US26431301P | 2001-01-29 | 2001-01-29 | |
US60/264,313 | 2001-01-29 | ||
US30760901P | 2001-07-26 | 2001-07-26 | |
US60/307,609 | 2001-07-26 | ||
US33095401P | 2001-11-05 | 2001-11-05 | |
US60/330,954 | 2001-11-05 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2002061092A2 true WO2002061092A2 (fr) | 2002-08-08 |
WO2002061092A3 WO2002061092A3 (fr) | 2003-08-28 |
Family
ID=27401691
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/EP2002/000807 WO2002061092A2 (fr) | 2001-01-29 | 2002-01-25 | Regulation de la lysyl oxydase humaine |
Country Status (1)
Country | Link |
---|---|
WO (1) | WO2002061092A2 (fr) |
Cited By (8)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
DE102004028302A1 (de) * | 2003-06-13 | 2005-03-24 | COLETICA Ltd. Co. | Stimulierung der Synthese und der Aktivität einer Isoform der Lysyloxidase-ähnlichen LOXL zum Stimulieren der Bildung von elastischen Fasern |
DE102004028300A1 (de) * | 2003-06-13 | 2005-03-24 | COLETICA Ltd. Co. | Stimulierung der Aktivität eines Isoform des Lysyloxidase zum Bekämpfen von einigen Pathologien, die durch eine unvollständige, fehlende oder desorganisierte Elastogenese verursacht sind |
JP2005350436A (ja) * | 2004-06-14 | 2005-12-22 | Coletica | 弾性繊維形成の不全、欠損又は無秩序による病状に対処するための、リシルオキシダーゼのアイソフォームの活性の誘導 |
US7255857B2 (en) | 2004-01-23 | 2007-08-14 | Massachusetts Eye & Ear Infirmary | Lysyl oxidase-like 1 (LOXL1) and elastogenesis |
US8163494B2 (en) | 2002-11-27 | 2012-04-24 | Technion Research & Development Foundation Ltd. | Method for assessing metastatic properties of breast cancer |
US8461303B2 (en) | 2007-08-02 | 2013-06-11 | Gilead Biologics, Inc. | LOX and LOXL2 inhibitors and uses thereof |
WO2015191362A1 (fr) * | 2014-06-11 | 2015-12-17 | Gilead Sciences, Inc. | Méthodes de traitement de maladies cardiovasculaires |
CN113321743A (zh) * | 2021-07-02 | 2021-08-31 | 海南精准医疗科技有限公司 | 一种靶向赖氨酰氧化酶1的嵌合抗原受体及其用途 |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US9107935B2 (en) | 2009-01-06 | 2015-08-18 | Gilead Biologics, Inc. | Chemotherapeutic methods and compositions |
SG2014004816A (en) | 2009-08-21 | 2014-03-28 | Gilead Biologics Inc | Catalytic domains from lysyl oxidase and loxl2 |
-
2002
- 2002-01-25 WO PCT/EP2002/000807 patent/WO2002061092A2/fr not_active Application Discontinuation
Non-Patent Citations (6)
Title |
---|
DATABASE EMBL [Online] EBI; 17 March 1997 (1997-03-17) SAITO H. ET AL.: "Human lysyl oxidase-related protein (WS9-14) mRNA, complete cds." Database accession no. U89942 XP002227338 * |
DATABASE EMBL [Online] EBI; 25 August 2000 (2000-08-25) STRAUSBERG R.: "601462492F1 NIH_MGC_67 Homo sapiens cDNA clone IMAGE:3865799 5', mRNA sequence." Database accession no. BE618237 XP002227337 * |
DATABASE EMBL [Online] EBI; 29 September 2000 (2000-09-29) SUGANO S. ET AL.: "Homo sapiens cDNA: FLJ21889 fis, clone HEP03178." Database accession no. AK025542 XP002227336 * |
DATABASE EMBL [Online] EBI; 7 January 2002 (2002-01-07) MEYERS R.: "Sequence 2 from patent WO0192495" Database accession no. AX323480 XP002227339 * |
DATABASE SWISSPROT [Online] 1 May 1999 (1999-05-01) LANGENAU D.M. ET AL: "Lysyl oxidase-like protein (Fragment)." Database accession no. Q9YHC1 XP002227334 * |
DATABASE SWISSPROT [Online] 1 November 1999 (1999-11-01) LANGENAU D.M. ET AL: "Lysyl oxidase related protein homolog." Database accession no. Q9W6N1 XP002227335 * |
Cited By (19)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US8163494B2 (en) | 2002-11-27 | 2012-04-24 | Technion Research & Development Foundation Ltd. | Method for assessing metastatic properties of breast cancer |
US8906425B2 (en) | 2003-06-13 | 2014-12-09 | Basf Beauty Care Solutions France S.A.S. | Stimulation of the synthesis of the activity of an isoform of lysyl oxidase-like LOXL for stimulating the formation of elastic fibers |
DE102004028300A1 (de) * | 2003-06-13 | 2005-03-24 | COLETICA Ltd. Co. | Stimulierung der Aktivität eines Isoform des Lysyloxidase zum Bekämpfen von einigen Pathologien, die durch eine unvollständige, fehlende oder desorganisierte Elastogenese verursacht sind |
DE102004028300B4 (de) * | 2003-06-13 | 2005-11-24 | COLETICA Ltd. Co. | Stimulierung der Aktivität eines Isoform des Lysyloxidase zum Bekämpfen von einigen Pathologien, die durch eine unvollständige, fehlende oder desorganisierte Elastogenese verursacht sind |
DE102004028302B4 (de) * | 2003-06-13 | 2005-11-24 | COLETICA Ltd. Co. | Stimulierung der Synthese und der Aktivität einer Isoform der Lysyloxidase-ähnlichen LOXL zum Stimulieren der Bildung von elastischen Fasern |
DE102004028302A1 (de) * | 2003-06-13 | 2005-03-24 | COLETICA Ltd. Co. | Stimulierung der Synthese und der Aktivität einer Isoform der Lysyloxidase-ähnlichen LOXL zum Stimulieren der Bildung von elastischen Fasern |
GB2402676B (en) * | 2003-06-13 | 2007-11-21 | Coletica | Cosmetic use by topical application of the lysyl oxidase-like (LOXL) enzyme to stimulate formation of skin elastic fibres |
US7255857B2 (en) | 2004-01-23 | 2007-08-14 | Massachusetts Eye & Ear Infirmary | Lysyl oxidase-like 1 (LOXL1) and elastogenesis |
US7255856B2 (en) | 2004-01-23 | 2007-08-14 | Massachusetts Eye & Ear Infirmary | Lysyl oxidase-like 1 (LOXL1) and elastogenesis |
US7674458B2 (en) | 2004-01-23 | 2010-03-09 | Massachusetts Eye & Ear Infirmary | Lysyl oxidase-like 1 (LOXL1) and elastogenesis |
US8173121B2 (en) | 2004-01-23 | 2012-05-08 | Massachusetts Eye & Ear Infirmary | Lysyl oxidase-like 1 (LOXL1) and elastogenesis |
US8404231B2 (en) | 2004-01-23 | 2013-03-26 | Massachusetts Eye And Ear Infirmary | Lysyl oxidase-like 1 (LOXL1) and elastogenesis |
JP2005350436A (ja) * | 2004-06-14 | 2005-12-22 | Coletica | 弾性繊維形成の不全、欠損又は無秩序による病状に対処するための、リシルオキシダーゼのアイソフォームの活性の誘導 |
US8679485B2 (en) | 2007-08-02 | 2014-03-25 | Gilead Biologics, Inc. | Methods and compositions for treatment and diagnosis of fibrosis, tumor invasion, angiogenesis, and metastasis |
US8461303B2 (en) | 2007-08-02 | 2013-06-11 | Gilead Biologics, Inc. | LOX and LOXL2 inhibitors and uses thereof |
US10494443B2 (en) | 2007-08-02 | 2019-12-03 | Gilead Biologics, Inc. | LOX and LOXL2 inhibitors and uses thereof |
WO2015191362A1 (fr) * | 2014-06-11 | 2015-12-17 | Gilead Sciences, Inc. | Méthodes de traitement de maladies cardiovasculaires |
CN106456772A (zh) * | 2014-06-11 | 2017-02-22 | 吉利德科学公司 | 用于治疗心血管疾病的方法 |
CN113321743A (zh) * | 2021-07-02 | 2021-08-31 | 海南精准医疗科技有限公司 | 一种靶向赖氨酰氧化酶1的嵌合抗原受体及其用途 |
Also Published As
Publication number | Publication date |
---|---|
WO2002061092A3 (fr) | 2003-08-28 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US20020115177A1 (en) | Regulation of human histone deacetylase | |
WO2002061092A2 (fr) | Regulation de la lysyl oxydase humaine | |
WO2002070675A2 (fr) | Regulation de l'histone acetyltransferase humaine | |
WO2002048325A2 (fr) | Regulation de la serine palmitoyltransferase humaine | |
WO2002055712A2 (fr) | Regulation de l'alanine aminotransferase humaine | |
US20020103120A1 (en) | Regulation of human phosphodiesterase-like enzyme | |
US20040096868A1 (en) | Regulation of human gnat acetyltransferase-like protein | |
WO2002036731A2 (fr) | Lipase acide lysosomiale de l'homme | |
WO2003025162A2 (fr) | Regulation du precurseur de la sous-unite alpha de prolyl 4-hydroxylase humaine | |
WO2002053756A2 (fr) | Regulation de glucosamine-6-phosphate desaminase humaine | |
US20040053840A1 (en) | Regulation of human cyclophilin-like protein | |
US20030191060A1 (en) | Regulation of human plc delta-1 | |
US20040265827A1 (en) | Regulation of human steroid 5-alpha reductase | |
WO2003035857A1 (fr) | Regulation de l'alpha-glycerol-3-phosphate deshydrogenase humaine nad-dependante | |
WO2002053713A2 (fr) | Regulation de sulfotransferase humaine | |
WO2003000725A2 (fr) | Regulation de l'enzyme similaire a la ligase b lipoate-proteine humaine | |
US20040058885A1 (en) | Nucleoside diphosphate hydrolase | |
WO2002053714A2 (fr) | Regulation de la phosphatidylinositol-4-phosphate 5-kinase humaine | |
WO2002020747A2 (fr) | Regulation de l'enzyme humaine du type tyrosine phosphatase | |
US20040082051A1 (en) | Regulation of human uridine kinase | |
US20040101877A1 (en) | Regulation of human 3-ss-hydroxysteroid dehydrogenase-isomerase | |
WO2002033062A1 (fr) | Regulation de l'acyl-coa deshydrogenase humaine | |
WO2003048350A1 (fr) | Regulation de la lactate-dehydrogenase humaine | |
WO2003027292A2 (fr) | Regulation de l'enzyme de type acide gras-coa ligase humaine | |
WO2002040651A2 (fr) | Regulation de l'adenosine desaminase humaine specifique a arnt |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SD SE SG SI SK SL TJ TM TN TR TT TZ UA UG US UZ VN YU ZA ZM ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase in: |
Ref country code: JP |
|
WWW | Wipo information: withdrawn in national office |
Country of ref document: JP |