WO2002059302A2 - Regulation of human serotonin-like g protein-coupled receptor - Google Patents

Regulation of human serotonin-like g protein-coupled receptor Download PDF

Info

Publication number
WO2002059302A2
WO2002059302A2 PCT/EP2002/000540 EP0200540W WO02059302A2 WO 2002059302 A2 WO2002059302 A2 WO 2002059302A2 EP 0200540 W EP0200540 W EP 0200540W WO 02059302 A2 WO02059302 A2 WO 02059302A2
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
protein
serotonin
coupled receptor
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2002/000540
Other languages
English (en)
French (fr)
Other versions
WO2002059302A3 (en
Inventor
Alex Smolyar
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Bayer AG
Original Assignee
Bayer AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Bayer AG filed Critical Bayer AG
Priority to US10/470,150 priority Critical patent/US20050064404A1/en
Priority to JP2002559589A priority patent/JP2004531226A/ja
Priority to AU2002225030A priority patent/AU2002225030A1/en
Priority to EP02715460A priority patent/EP1358328A2/en
Publication of WO2002059302A2 publication Critical patent/WO2002059302A2/en
Publication of WO2002059302A3 publication Critical patent/WO2002059302A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70571Receptors; Cell surface antigens; Cell surface determinants for neuromediators, e.g. serotonin receptor, dopamine receptor
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • A61P11/06Antiasthmatics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/04Anorexiants; Antiobesity agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/10Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide

Definitions

  • the invention relates to the area of G-protein coupled receptors. More particularly, it relates to the area of human serotonin-like G protein-coupled ' receptor and its regulation. '
  • GPCR G-protein coupled receptors
  • GPCRs include receptors for such diverse agents as dopamine, calcitonin, adrenergic hormones, endothelin, cAMP, adenosine, acetylchohne, serotonin, histamine, thrombin, kinin, follicle stimulating hormone, opsins, endothelial differentiation gene-1, rhodopsins, odorants, cytomegalovirus, G-proteins themselves, effector proteins such as phospholipase C, adenyl cyclase, and phosphodiesterase, and actuator proteins such as protein kinase A and protein kinase C.
  • GPCRs possess seven conserved membrane-spanning domains connecting at least eight divergent hydrophilic loops. GPCRs (also known as 7TM receptors) have been characterized as including these seven conserved hydrophobic stretches of about 20 to 30 amino acids, connecting at least eight divergent hydrophilic loops. Most GPCRs have single conserved cysteine residues in each of the first two extracellular loops, which form disulfide bonds that are believed to stabilize functional protein structure. The seven transmembrane regions are designated as TM1, TM2, TM3,
  • TM4 has been implicated in signal transduction.
  • Phosphorylation and lipidation can influence signal transduction of some GPCRs.
  • Most GPCRs contain potential phosphorylation sites within the third cytoplasmic loop and/or the carboxy terminus.
  • GPCRs such as the ⁇ -adrenergic receptor
  • phosphorylation by protein kinase A and/or specific receptor kinases mediates receptor desensitization.
  • the ligand binding sites of GPCRs are believed to comprise hydrophilic sockets formed by several GPCR transmembrane domains.
  • the hydrophilic sockets are surrounded by hydrophobic residues of the GPCRs.
  • the hydrophilic side of each GPCR transmembrane hejix is postulated to face inward and form a polar ligand binding site.
  • TM3 has been implicated in several GPCRs as having a ligand binding site, such as the TM3 aspartate residue.
  • TM5 serines, a TM6 asparagine, and TM6 or TM7 phenylalanines or tyrosines also are implicated in ligand binding.
  • GPCRs are coupled inside the cell by heterotrimeric G-proteins to various intracellular enzymes, ion channels, and transporters (see Johnson et al, Endoc. Rev. 10, 317-331, 1989).
  • Different G-protein alpha-subunits preferentially stimulate particular effectors to modulate various biological functions in a cell.
  • Phosphorylation of cytoplasmic residues of GPCRs is an important mechanism for the regulation of some GPCRs.
  • the effect of hormone binding is the activation inside the cell of the enzyme, adenylate cyclase.
  • Enzyme activation by hormones is dependent on the presence of the nucleotide GTP.
  • GTP also influences hormone binding.
  • a G-protein connects the hormone receptor to adenylate cyclase. G-protein exchanges GTP for bound GDP when activated by a hormone receptor. The GTP-carrying form then binds to activated adenylate cyclase. Hydrolysis of GTP to GDP, catalyzed by the G-protein itself, returns the G-protein to its basal, inactive form.
  • the G-protein serves a dual role, as an intermediate that relays the signal from receptor to effector, and as a clock that controls the duration ofthe signal.
  • GPCRs receptors Over the past 15 years, nearly 350 therapeutic agents targeting GPCRs receptors have been successfully introduced onto the market. This indicates that these receptors have an established, proven history as therapeutic targets. Clearly, there is an ongoing need for identification and characterization of further GPCRs which can play a role in preventing, ameliorating, or correcting dysfunctions or diseases including, but not limited to, infections such as bacterial, fungal, protozoan, and viral infections, particularly those caused by HIN viruses, pain, cancers, anorexia, bulimia, asthma,
  • Parkinson's diseases acute heart failure, hypotension, hypertension, urinary retention, osteoporosis, angina pectoris, myocardial infarction, ulcers, asthma, allergies, benign prostatic hypertrophy, and psychotic and neurological disorders, including anxiety, schizophrenia, manic depression, delirium, dementia, several mental retardation, and dyskinesias, such as Huntington's disease and Tourett's syndrome.
  • Serotonin is a neuromodulator capable of inducing and modulating a wide variety of behavioral functions such as sleep, appetite, locomotion, sexual activity and vascular contraction. Since the discovery of serotonin (5-hydroxytryptamine, 5-HT) over four decades ago, the cumulative results of many diverse studies have indicated that serotonin plays a significant role in the functioning of the mammalian body, both in »the central nervous system and in peripheral systems.
  • 5-HT has been implicated as being involved in the expression of a number of behaviors, physiological responses, and diseases which originate in the central nervous system. These include such diverse areas as sleeping, eating, perceiving pain, controlling body temperature, controlling blood pressure, depression, schizophrenia, and other bodily states (Fuller, Biology of Serotonergic Transmission 21, 1982; Boullin, Serotonin in Mental Abnormalities 1, 316, 1978; Barchas et al., SEROTONIN AND BEHAVIOR, 1973).
  • Serotonin plays an important role in peripheral systems as well. For example, approximately 90% of the body's serotonin is found in the gastrointestinal system, and serotonin has been found to mediate a variety of contractile, secretory, and electrophysiologic effects in this system. Another example of a peripheral network that is very sensitive to serotonin is the cardiovascular system, which also contains its own source of serotonin, i.e., the platelet.
  • receptor-specific agonists and antagonists are of interest for the treatment of a wide range of disorders, including anxiety, depression, hypertension, migraine, compulsive disorders, schizophrenia, autism, neurodegenerative disorders, such as Alzheimer's disease, Parkinsonism, and Huntington's chorea, and cancer chemotherapy-induced vomiting (Gershon et al, The Peripheral Actions of 5- Hydroxytryptamine 246, 1989; Saxena et al, Journal of Cardiovascular Pharmacology 15, Supplement 7, 990).
  • Serotonin produces its effects on cellular physiology by binding to specialized receptors on the cell surface. It is now recognized that multiple types of receptors exist ' for all neurotransmitters and hormones, including serotonin. The existence of multiple, structurally distinct serotonin receptors has provided the possibility that subtype-selective pharmacologic agents can be produced. The development of such compounds could result in new and increasingly selective therapeutic agents with fewer side effects, since individual receptor subtypes may function to affect specific actions ofthe different parts ofthe central peripheral serotonergic systems.
  • the 5-HT receptors which have been described to date belong either to the family of receptors associated with ion channels (5-HT 3 receptors), or to the family of receptors which interact with G proteins and which possess seven transmembrane domains. Moreover, analysis of the amino acid sequences has shown that the 5-HT receptors which interact with G proteins may be subdivided into two distinct groups: 5-HT, receptors, comprising the mammalian subtypes 5-HT 1A , 5-HT ]B , and 5-HT ]D , as well as three Drosophila 5-HT receptors, and 5-HT 2 receptors comprising the subtypes 5- HT 2 and 5-HT, c .
  • the 5-HT 2 receptors act via phospholipase C, and are responsible for numerous physiological activities of serotonin at the central and peripheral level. At the cardiovascular level, they are involved in the contraction of the blood vessels and in the morphological changes ofthe platelets; in the central nervous system, they act on the sensitization of the neurons to tactile stimuli and on the mediation of the hallucinogenic effects of diethylamidelysergic acid, and of the related phenylisopropylamines. Numerous studies show that the 5-HT 2 receptors described up until now do not account for all the properties which are attributed to them. In particular, certain 5-HT 2 -types effects of serotonin on the peripheral smooth muscles are classified as atypical effects, of which the effects are thought to be mediated by unknown receptors. See U.S. Patent 5,780,245.
  • One embodiment of the invention is a serotonin-like G protein-coupled receptor polypeptide comprising an amino acid sequence selected from the group consisting of: amino acid sequences which are at least about 27% identical to the amino acid sequence shown in SEQ ID NO: 2; and
  • Yet another embodiment of the invention is a method of screening for agents which decrease extracellular matrix degradation.
  • a test compound is contacted with a serotonin-like G protein-coupled receptor polypeptide comprising an amino acid sequence selected from the group consisting of:
  • amino acid sequences which are at least about 27% identical to the amino acid sequence shown in SEQ ID NO: 2;
  • a test compound which binds to the serotonin-like G protein-coupled receptor polypeptide is thereby identified as a potential agent for decreasing extracellular matrix degradation.
  • the agent can work by decreasing the activity ofthe serotonin-like G protein-coupled receptor.
  • Another embodiment of the invention is a method of screening for agents which decrease extracellular matrix degradation.
  • a test compound is contacted with a polynucleotide encoding a serotonin-like G protein-coupled receptor polypeptide, wherein the polynucleotide comprises a nucleotide sequence selected from the group consisting of:
  • nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO: 1 ; and the nucleotide sequence shown in SEQ ID NO: 1.
  • a test compound which binds to the polynucleotide is identified as a potential agent for decreasing extracellular matrix degradation.
  • the agent can work by decreasing the amount ofthe serotonin-like G protein-coupled receptor through interacting with the serotonin-like G protein-coupled receptor mRNA.
  • Another embodiment of the invention is a method of screening for agents which regulate extracellular matrix degradation.
  • a test compound is contacted with a serotonin-like G protein-coupled receptor polypeptide comprising an amino acid sequence selected from the group consisting of:
  • amino acid sequences which are at least about 27% identical to the amino acid sequence shown in SEQ ID NO: 2;
  • a serotonin-like G protein-coupled receptor activity of the polypeptide is detected.
  • a test compound which increases serotonin-like G protein-coupled receptor activity ofthe polypeptide relative to serotonin-like G protein-coupled receptor activity in the absence of the test compound is thereby identified as a potential agent for increasing extracellular matrix degradation.
  • a test compound which decreases serotonin-like G protein-coupled receptor activity of the polypeptide relative to serotonin-like G protein-coupled receptor activity in the absence of the test compound is thereby identified as a potential agent for decreasing extracellular matrix degradation.
  • a test compound is contacted with a serotonin-like G protein-coupled receptor product of a polynucleotide which comprises a nucleotide sequence selected from the group consisting of:
  • nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO: 1 ;
  • Binding of the test compound to the serotonin-like G protein-coupled receptor product is detected.
  • a test compound which binds to the serotonin-like G protein- coupled receptor product is thereby identified as a potential agent for decreasing extracellular matrix degradation.
  • Still another embodiment of the invention is a method of reducing extracellular matrix degradation.
  • a cell is contacted with a reagent which specifically binds to a polynucleotide encoding a serotonin-like G protein-coupled receptor polypeptide or the product encoded by the polynucleotide, wherein the polynucleotide comprises a nucleotide sequence selected from the group consisting of:
  • nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO: 1;
  • Serotonin-like G protein-coupled receptor activity in the cell is thereby decreased.
  • the invention thus provides a human serotonin-like G protein-coupled receptor which can be used to identify test compounds which may act as agonists or antagonists at the receptor site.
  • Human serotonin-like G protein-coupled receptor and fragments thereof also are useful in raising specific antibodies which can block the receptor and effectively prevent ligand binding.
  • Fig. 1 shows the DNA-sequence encoding a serotonin-like G protein-coupled receptor Polypeptide (SEQ ID NO:l).
  • Fig. 2 shows the amino acid sequence deduced from the DNA-sequence of
  • Fig.l (SEQ ID NO:2).
  • Fig. 3 shows the amino acid sequence of the protein identified by SwissProt Accession No. P28222
  • IB RECEPTOR (5-HT-1B) (SEROTONIN RECEPTOR) (SEQ ID NO:3).
  • Fig. 4 shows the DNA-sequence encoding a serotonin-like G protein-coupled receptor Polypeptide (SEQ ID NO:4).
  • Fig. 5 shows the BLASTP - alignment of 414 (SEQ ID NO:2) against swiss
  • Fig. 4 shows the DNA-sequence encoding a serotonin-like G protein-coupled receptor Polypeptide (SEQ ID NO:4).
  • Fig. 5 shows the BLASTP - alignment of 414 (SEQ ID NO:2) against swiss
  • Fig. 8 shows the Predicted amino acid and nucleotide sequences
  • Fig. 9 shows the BLASTN - alignment of 414_DNA against SNP:1275729_867778.
  • Fig. 10 shows the Transmembrane regions of SEQ ID NO:2.
  • F Fiigg.. 1 111 shows the Expression profiles
  • Fig. 12 shows the Expression profiles
  • Fig. 13 shows the Expression profiles DETAILED DESCRIPTION OF THE INVENTION
  • the invention relates to an isolated polynucleotide being selected from the group consisting of: ' a) a polynucleotide encoding a serotonin-like G protein-coupled receptor polypeptide comprising an amino acid sequence selected from the group consisting of: amino acid sequences which are at least about 27% identical to the amino acid sequence shown in SEQ ID NO: 2; and the amino acid sequence shown in SEQ ID NO: 2.
  • a novel 5-HT-like GPCR can be used in therapeutic methods to treat COPD, cardiovascular disorders, cancer, urinary disorders, obesity, diabetes, CNS disorders, asthma, or hematological disorders.
  • Human 5-HT-like GPCR comprises the amino acid sequence shown in SEQ ID NO:2.
  • a coding sequence for human 5-HT-like GPCR is shown in SEQ ID NO:l. This sequence is contained within the longer sequence shown in SEQ ID NO:4. This sequence is located on chromosome 2 and was assembled from the genomic sequence of Accession No. AC060810 using Genescan or Geneid.
  • Human 5-HT-like GPCR of the invention is expected to be useful for the same pu ⁇ ' oses as previously identified serotonin receptors. Human 5-HT-like GPCR is believed to be useful in therapeutic methods to treat disorders such as COPD, cardiovascular disorders, cancer, urinary disorders, obesity, diabetes, CNS disorders, asthma, and hematological disorders. Human 5-HT-like GPCR also can be used to screen for human 5-HT-like GPCR activators and inhibitors.
  • 5-HT-like GPCR polypeptides according to the invention comprise at least 6, 8 10, 12, 15, 18, 20, 25, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, or 347 contiguous amino acids selected from SEQ ID NO:2 or from a biologically active variant thereof, as defined below.
  • a 5-HT-like GPCR polypeptide of the invention therefore can be a portion of a 5-HT-like GPCR protein, a full-length 5-HT-like
  • GPCR protein or a fusion protein comprising all or a portion of a 5-HT-like GPCR protein.
  • a coding sequence for SEQ ID NO:2 is shown in SEQ ID NO:l .
  • 5-HT-like GPCR polypeptide variants which are biologically active, i.e., retain the ability to bind a serotonin or a serotonin-like ligand to produce a biological effect, such as cyclic AMP formation, mobilization of intracellular calcium, or phospho- inositide metabolism, also are 5-HT-like GPCR polypeptides.
  • naturally or non-naturally occurring 5-HT-like GPCR polypeptide variants have amino acid sequences which are at least about 27, 30, 35, 40, 45, 50, 55, 60, 65, 70, preferably about 75, 80, 85, 90, 95, 96, 97, 98, Or 99% identical to the amino acid sequence shown in SEQ ID NO:2 or a fragment thereof.
  • Percent identity between a putative 5- HT-like GPCR polypeptide variant and an amino acid sequence of SEQ ID NO:2 is determined by conventional methods. See, for example, Altschul et al., Bull. Math.
  • the trimmed initial regions are examined to determine whether the regions can be joined to for man approximate alignment with gaps.
  • the highest scoring regions of the two amino acid sequences are aligned using a modification of the Needleman-Wunsch- Sellers algorithm (Needleman and Wunsch, J. Mol. Biol.48:444 (1970); Sellers, SIAM J. Appl. Math. 26:787 (1974)), which allows for amino acid insertions and deletions.
  • FASTA can be introduced into a FASTA program by modifying the scoring matrix file ("SMATRIX"), as explained in Appendix 2 of Pearson, Meth. Enzymol. 183:63 (1990).
  • FASTA can also be used to determine the sequence identity of nucleic acid molecules using a ratio as disclosed above.
  • the ktup value can range between one to six, preferably from three to six, most preferably three, with other parameters set as default..
  • Variations in percent identity can be due, for example, to amino acid substitutions, insertions, or deletions.
  • Amino acid substitutions are defined as one for one amino acid replacements. They are conservative in nature when the substituted amino acid has similar structural and/or chemical properties. Examples of conservative replacements are substitution of a leucine with an isoleucine or valine, an aspartate with a glutamate, or a threonine with a serine.
  • Amino acid insertions or deletions are changes to or within an amino acid sequence. They typically fall in the range of about 1 to 5 amino acids. Guidance in determining which amino acid residues can be substituted, inserted, or deleted without abolishing biological or immunological activity of a 5-HT-like GPCR polypeptide can be found using computer programs well known in the art, such as DNASTAR software. Whether an amino acid change results in a biologically active 5-HT-like GPCR polypeptide can readily be determined by assaying for binding to a ligand or by conducting a functional assay, as described for example, in the specific Examples, below.
  • Fusion proteins are useful for generating antibodies against 5-HT-like GPCR polypeptide amino acid sequences and for use in various assay systems. For example, fusion proteins can be used to identify proteins which interact with portions of a 5-HT-like GPCR polypeptide. Protein affinity chromatography or library-based assays for protein-protein interactions, such as the yeast two-hybrid or phage display systems, can be used for this pmpose. Such methods are well known in the art and also can be used as drug screens.
  • a 5-HT-like GPCR polypeptide fusion protein comprises two polypeptide segments fused together by means of a peptide bond.
  • the first polypeptide segment comprises at 6, 8 10, 12, 15, 18, 20, 25, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, or 347 contiguous amino acids of SEQ ID NO:2 or from a biologically active variant, such as those described above.
  • the first polypeptide segment also can comprise full-length 5-HT-like GPCR protein.
  • the second polypeptide segment can be a full-length protein or a protein fragment.
  • Proteins commonly used in fusion protein construction include ⁇ -galactosidase, ⁇ - glucuronidase, green fluorescent protein (GFP), autofluorescent proteins, including blue fluorescent protein (BFP), glutathione-S-transferase (GST), luciferase, horseradish peroxidase (HRP), and chloramphenicol acetyltransferase (CAT).
  • epitope tags are used in fusion protein constructions, including histidine (His) tags, FLAG tags, influenza hemagglutinin (HA) tags, Myc tags, VSV-
  • G tags and thioredoxin (Trx) tags.
  • Other fusion constructions can include maltose binding protein (MBP), S-tag, Lex a D ⁇ A binding domain (DBD) fusions, GAL4 D ⁇ A binding domain fusions, and he ⁇ es simplex virus (HSV) BP16 protein fusions.
  • MBP maltose binding protein
  • S-tag S-tag
  • GAL4 D ⁇ A binding domain fusions GAL4 D ⁇ A binding domain fusions
  • HSV simplex virus
  • a fusion protein also can be engineered to contain a cleavage site located between the 5-HT-like GPCR polypeptide-encoding sequence and the heterologous protein sequence, so that the 5-HT-like GPCR polypeptide can be cleaved and purified away from the heterologous moiety.
  • a fusion protein can be synthesized chemically, as is known in the art.
  • a fusion protein is produced by covalently linking two polypeptide segments or by standard procedures in the art of molecular biology.
  • Recombinant DNA methods can be used to prepare fusion proteins, for example, by making a DNA construct which comprises coding sequences selected from SEQ ID NO:l in proper reading frame with nucleotides encoding the second polypeptide segment and expressing the DNA construct in a host cell, as is known in the art.
  • kits for constructing fusion proteins are available from companies such as Promega Co ⁇ oration (Madison, WI), Stratagene (La Jolla, CA), CLONTECH (Mountain View, CA), Santa Cruz Biotechnology (Santa Cruz, CA), MBL International Co ⁇ oration (MIC; Watertown, MA), and Quantum Biotechnologies (Montreal, Canada; 1-888-DNA- KITS).
  • Species homologs of human 5-HT-like GPCR polypeptide can be obtained using 5- HT-like GPCR polypeptide polynucleotides (described below) to make suitable probes or primers for screening cDNA expression libraries from other species, such as mice, monkeys, or yeast, identifying cDNAs which encode homologs of 5-HT-like GPCR polypeptide, and expressing the cDNAs as is known in the art.
  • a 5-HT-like GPCR polynucleotide can be single- or double-stranded and comprises a coding sequence or the complement of a coding sequence for a 5-HT-like GPCR polypeptide.
  • a coding sequences for human 5-HT-like GPCR is shown in SEQ ID NO:3.
  • nucleotide sequences encoding human 5-HT-like GPCR polypeptides as well as homologous nucleotide sequences which are at least about 50, preferably about 75, 90, 96, or 98% identical to the nucleotide sequence shown in SEQ ID NO:l also are 5-HT-like GPCR polynucleotides. Percent sequence identity between the sequences of two polynucleotides is determined using computer programs such as ALIGN which employ the FASTA algorithm, using an affine gap search with a gap open penalty of -12 and a gap extension penalty of -2.
  • cDNA Complementary DNA
  • species homologs, and variants of 5-HT-like GPCR polynucleotides which encode biologically active 5-HT-like GPCR polypeptides also are 5-HT- like GPCR polynucleotides.
  • Polynucleotides comprising at least 6, 7, 8, 9, 10, 12, 15, 18, 20, or 25 contiguous nucleotides of SEQ ID NO:l or its complement also are 5-HT-like GPCR polynucleotides.
  • Such polynucleotides can be used, for example, as hybridization probes or antisense oligonucleotides.
  • Variants and homologs ofthe 5-HT-like GPCR polynucleotides described above also are 5-HT-like GPCR polynucleotides.
  • homologous 5-HT-like GPCR polynucleotide sequences can be identified by hybridization of candidate polynucleotides to known 5-HT-like GPCR polynucleotides under stringent conditions, as is known in the art.
  • homologous sequences can be identified which contain at most about 25-30% basepair mismatches. More preferably, homologous nucleic acid strands contain 15-25% basepair mismatches, even more preferably 5-15% basepair mismatches.
  • Species homologs of the 5-HT-like GPCR polynucleotides disclosed herein also can be identified by making suitable probes or primers and screening cDNA expression libraries from other species, such as mice, monkeys, or yeast.
  • Human variants of 5- HT-like GPCR polynucleotides can be identified, for example, by screening human cDNA expression libraries. It is well known that the T m of a double-stranded DNA decreases by 1-1.5 °C with every 1% decrease in homology (Bonner et al, J. Mol. Biol. 81, 123 (1973).
  • Variants of human 5-HT-like GPCR polynucleotides or 5-HT- like GPCR polynucleotides of other species can therefore be identified by hybridizing a putative homologous 5-HT-like GPCR polynucleotide with a polynucleotide having a nucleotide sequence of SEQ ID NO:l or the complement thereof to form a test hybrid.
  • the melting temperature of the test hybrid is compared with the melting temperature of a hybrid comprising 5-HT-like GPCR polynucleotides having perfectly complementary nucleotide sequences, and the number or percent of basepair mismatches within the test hybrid is calculated.
  • Nucleotide sequences which hybridize to 5-HT-like GPCR polynucleotides or their complements following stringent hybridization and/or wash conditions also are 5- HT-like GPCR polynucleotides.
  • Stringent wash conditions are well known and understood in the art and are disclosed, for example, in Sambrook et al, MOLECULAR CLONING: A LABORATORY MANUAL, 2d ed., 1989, at pages 9.50-9.51.
  • T m of a hybrid between a 5-HT-like GPCR polynucleotide having a nucleotide sequence shown in SEQ ID NO:3 or the complement thereof and a polynucleotide sequence which is at least about 50, preferably about 75, 90, 96, or 98% identical to one of those nucleotide sequences can be calculated, for example, using the equation of Bolton and McCarthy, Proc. Natl. Acad. Sci. U.S.A. 48, 1390 (1962):
  • Stringent wash conditions include, for example, 4X SSC at 65 °C, or 50% formamide, 4X SSC at 42 °C, or 0.5X SSC, 0.1% SDS at 65 °C.
  • Highly stringent wash conditions include, for example, 0.2X SSC at 65 °C.
  • a naturally occurring 5-HT-like GPCR polynucleotide can be isolated free of other cellular components such as membrane components, proteins, and lipids.
  • Polynucleotides can be made by a cell and isolated using standard nucleic acid purification techniques, or synthesized using an amplification technique, such as the polymerase chain reaction (PCR), or by using an automatic synthesizer. Methods for isolating polynucleotides are routine and are known in the art. Any such technique for obtaining a polynucleotide can be used to obtain isolated 5-HT-like GPCR polynucleotides.
  • restriction enzymes and probes can ' be used to isolate polynucleotide fragments which comprises 5-HT-like GPCR nucleotide sequences.
  • Isolated polynucleotides are in preparations which are free or at least 70, 80, or 90% free of other molecules.
  • 5-HT-like GPCR cDNA molecules can be made with standard molecular biology techniques, using 5-HT-like GPCR mRNA as a template. 5-HT-like GPCR cDNA molecules can thereafter be replicated using molecular biology techniques known in the art and disclosed in manuals such as Sambrook et al. (1989). An amplification technique, such as PCR, can be used to obtain additional copies of polynucleotides of the invention, using either human genomic DNA or cDNA as a template.
  • PCR-based methods can be used to extend the nucleic acid sequences disclosed herein to detect upstream sequences such as promoters and regulatory elements.
  • restriction-site PCR uses universal primers to retrieve unknown sequence adjacent to a known locus (Sarkar, PCR Methods Applic. 2, 318-322, 1993). Genomic DNA is first amplified in the presence of a primer to a linker sequence and a primer specific to the known region. The amplified sequences are then subjected to a second round of PCR with the same linker primer and another specific primer internal to the first one. Products of each round of PCR are transcribed with an appropriate RNA polymerase and sequenced using reverse transcriptase.
  • Inverse PCR also can be used to amplify or extend sequences using divergent primers based on a known region (Triglia et al, Nucleic Acids Res. 16, 8186, 1988).
  • Primers can be designed using commercially available software, such as OLIGO 4.06 Primer Analysis software (National Biosciences Inc., Madison, Minn.), to be 22-30 nucleotides in length, to have a GC content of 50% or more, and to anneal to the target sequence at temperatures about 68-72 °C.
  • the method uses several restriction enzymes to generate a suitable fragment in the known region of a gene. The fragment is then circularized by intramolecular ligation and used as a PCR template.
  • capture PCR which involves PCR amplification of DNA fragments adjacent to a known sequence in human and yeast artificial chromosome DNA (Lagerstrom et al, PCR Methods Applic. 1, 111-119,
  • Randomly-primed libraries are preferable, in that they will contain more sequences which contain the 5' regions of genes. Use of a randomly primed library may be especially preferable for situations in which an oligo d(T) library does not yield a full-length cDNA. Genomic ' libraries can be useful for extension of sequence into 5' non-transcribed regulatory regions.
  • capillary electrophoresis systems can be used to analyze the size or confirm the nucleotide sequence of PCR or sequencing products.
  • capillary sequencing can employ flowable polymers for electrophoretic separation, four different fluorescent dyes (one for each nucleotide) which are laser activated, and detection of the emitted wavelengths by a charge coupled device camera.
  • Output/light intensity can be converted to electrical signal using appropriate software (e.g. GENOTYPER and Sequence NAVIGATOR, Perkin Elmer), and the entire process from loading of samples to computer analysis and electronic data display can be computer controlled.
  • Capillary electrophoresis is especially preferable for the sequencing of small pieces of DNA which might be present in limited amounts in a particular sample.
  • 5-HT-like GPCR polypeptides can be obtained, for example, by purification from human cells, by expression of 5-HT-like GPCR polynucleotides, or by direct chemical synthesis. Protein Purification
  • 5-HT-like GPCR polypeptides can be purified from any human cell which expresses the receptor, including host cells which have been transfected with 5-HT-like GPCR polynucleotides.
  • a purified 5-HT-like GPCR polypeptide is separated from other compounds which normally associate with the 5-HT-like GPCR polypeptide in the cell, such as certain proteins, carbohydrates, or lipids, using methods well-known in the art. Such methods include, but are not limited to, size exclusion chromatography, ammonium sulfate fractionation, ion exchange chromatography, affinity chromatography, and preparative gel electrophoresis.
  • 5-HT-like GPCR polypeptide can be conveniently isolated as a complex with its associated G protein, as described in the specific examples, below.
  • a preparation of purified 5-HT-like GPCR polypeptides is at least 80%) pure; preferably, the preparations are 90%, 95%, or 99% pure. Purity of the preparations can be assessed by any means known in the art, such as SDS-polyacrylamide gel electrophoresis.
  • a 5-HT-like GPCR polynucleotide can be inserted into an expression vector which contains the necessary elements for the transcription and translation of the inserted coding sequence.
  • Methods which are well known to those skilled in the art can be used to construct expression vectors containing sequences encoding 5-HT-like GPCR polypeptides and appropriate transcriptional and translational control elements. These methods include in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. Such techniques are described, for example, in Sambrook et al.
  • microorganisms such as bacteria transformed with recombinant bacteriophage, plasmid, or cosmid DNA expression vectors; yeast transformed with yeast expression vectors, insect cell systems infected with virus expression vectors (e.g., baculovirus), plant cell systems transformed with virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or with bacterial expression vectors (e.g., Ti or pBR322 plasmids), or animal cell systems.
  • microorganisms such as bacteria transformed with recombinant bacteriophage, plasmid, or cosmid DNA expression vectors
  • yeast transformed with yeast expression vectors insect cell systems infected with virus expression vectors (e.g., baculovirus), plant cell systems transformed with virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or with bacterial expression vectors (e.g., Ti or pBR322 plasmids), or animal cell systems.
  • control elements or regulatory sequences are those non-translated regions of the vector — enhancers, promoters, 5' and 3' untranslated regions ⁇ which interact with host cellular proteins to carry out transcription and translation. Such elements can vary in their strength and specificity.
  • any number of suitable transcription and translation elements including constitutive and inducible promoters, can be used.
  • inducible promoters such as the hybrid lacZ promoter of the BLUESCRIPT phagemid (Stratagene, LaJolla, Calif.) or pSPORTl plasmid (Life Technologies) and the like can be used.
  • the baculovirus polyhedrin promoter can be used in insect cells.
  • Promoters or enhancers derived from the genomes of plant cells e.g., heat shock, RUBISCO, and storage protein genes
  • plant viruses e.g., viral promoters or leader sequences
  • promoters from mammalian genes or from mammalian viruses are preferable. If it is necessary to generate a cell line that contains multiple copies of a nucleotide sequence encoding a 5-HT-like GPCR polypeptide, vectors based on
  • SV40 or EBV can be used with an appropriate selectable marker.
  • a number of expression vectors can be selected depending upon the use intended for the 5-HT-like GPCR polypeptide. For example, when a large quantity of a 5-HT-like GPCR polypeptide is needed for the induction of antibodies, vectors which direct high level expression of fusion proteins that are readily purified can be used. Such vectors include, but are not limited to, multifunctional E. coli cloning and expression vectors such as BLUESCRIPT (Stratagene).
  • a sequence encoding the 5-HT-like GPCR polypeptide can be ligated into the vector in frame with sequences for the amino-terminal Met and the subsequent 7 residues of ⁇ -galactosidase so that a hybrid protein is produced.
  • pIN vectors Van Heeke & Schuster, J. Biol. Chem. 264, 5503-5509, 1989
  • pGEX vectors Promega, Madison, Wis.
  • GST glutathione S-transferase
  • fusion proteins are soluble and can easily be purified from lysed cells by adso ⁇ tion to glutathione-agarose beads followed by elution in the presence of free glutathione.
  • Proteins made in such systems can be designed to include heparin, thrombin, or factor Xa protease cleavage sites so that the cloned polypeptide of interest can be released from the GST moiety at will.
  • yeast Saccharomyces cerevisiae a number of vectors containing constitutive or inducible promoters such as alpha factor, alcohol oxidase, and PGH can be used.
  • constitutive or inducible promoters such as alpha factor, alcohol oxidase, and PGH.
  • GPCR polypeptides can be driven by any of a number of promoters.
  • viral promoters such as the 35S and 19S promoters of CaMV can be used alone or in combination with the omega leader sequence from TMV (Takamatsu, EMBO J. 6, 307-311, 1987).
  • plant promoters such as the small subunit of RUBISCO or heat shock promoters can be used (Coruzzi et al., EMBO J. 3, 1671-1680, 1984; Broglie et al, Science 224, 838-843, 1984; Winter et al, Results Probl. Cell Differ. 17, 85-105, 1991).
  • These constructs can be introduced into plant cells by direct DNA transformation or by pathogen-mediated transfection.
  • An insect system also can be used to express a 5-HT-like GPCR polypeptide.
  • Autographa californica nuclear polyhedrosis virus (AcNPV) is used as a vector to express foreign genes in Spodoptera frugiperda cells or in Trichoplusia larvae.
  • Sequences encoding 5-HT-like GPCR polypeptides can be cloned into a non-essential region of the virus, such as the polyhedrin gene, and placed under control of the polyhedrin promoter.
  • Successful insertion of 5-HT-like GPCR polypeptides will render the polyhedrin gene inactive and produce recombinant virus lacking coat protein.
  • the recombinant viruses can then be used to infect S. frugiperda cells or Trichoplusia larvae in which 5-HT-like GPCR polypeptides can be expressed (Engelhard et al, Proc. Nat. Acad. Sci. 91,
  • a number of viral-based expression systems can be used to express 5-HT-like GPCR polypeptides in mammalian host cells.
  • sequences encoding 5-HT-like GPCR polypeptides can be ligated into an adenovirus transcription/translation complex comprising the late promoter and tripartite leader sequence. Insertion in a non-essential El or E3 region of the viral genome can be used to obtain a viable virus which is capable of expressing a 5- HT-like GPCR polypeptide in infected host cells (Logan & Shenk, Proc. Natl. Acad. Sci. 81, 3655-3659, 1984).
  • transcription enhancers such as the Rous sarcoma virus (RSV) enhancer, can be used to increase expression in mammalian host cells.
  • RSV Rous sarcoma virus
  • HACs Human artificial chromosomes
  • 6M to 10M are constructed and delivered to cells via conventional delivery methods (e.g., liposomes, polycationic amino polymers, or vesicles).
  • Specific initiation signals also can be used to achieve more efficient ' translation of sequences encoding 5-HT-like GPCR polypeptides. Such signals include the ATG initiation codon and adjacent sequences. In cases where sequences encoding a 5-HT- like GPCR polypeptide, its initiation codon, and upstream sequences are inserted into the appropriate expression vector, no additional transcriptional or translational control signals may be needed. However, in cases where only coding sequence, or a fragment thereof, is inserted, exogenous translational control signals (including the ATG initiation codon) should be provided. The initiation codon should be in the correct reading frame to ensure translation of the entire insert. Exogenous trans- lational elements and initiation codons can be of various origins, both natural and synthetic. The efficiency of expression can be enhanced by the inclusion of enhancers which are appropriate for the particular cell system which is used (see Scharf et al, Results Probl. Cell Differ. 20, 125-162, 1994).
  • a host cell strain can be chosen for its ability to modulate the expression of the inserted sequences or to process the expressed 5-HT-like GPCR polypeptide in the desired fashion.
  • modifications of the polypeptide include, but are not limited to, acetylation, carboxylation, glycosylation, phosphorylation, lipidation, and acylation.
  • Post-translational processing which cleaves a "prepro" form of the polypeptide also can be used to facilitate correct insertion, folding and/or function.
  • Different host cells which have specific cellular machinery and characteristic mechanisms for post-translational activities (e.g., CHO, HeLa, MDCK, HEK293, and WI38), are available from the American Type Culture Collection (ATCC; 10801
  • Stable expression is preferred for long-term, high-yield production of recombinant proteins.
  • cell lines which stably express 5-HT-like GPCR polypeptides can be transformed using expression vectors which can contain viral origins of replication and/or endogenous expression elements and a selectable marker gene on the same or on a separate vector. Following the introduction of the vector, cells can be allowed to grow for 1-2 days in an enriched medium before they are switched to a selective medium. The pu ⁇ ose of the selectable marker is to confer resistance to selection, and its presence allows growth and recovery of cells which successfully express the introduced 5-HT-like GPCR sequences. Resistant clones of stably transformed cells can be proliferated using tissue culture techniques appropriate to the cell type. See, for example, ANIMAL CELL CULTURE, R.I. Freshney, ed., 1986.
  • he ⁇ es simplex virus thymidine kinase (Wigler et al, Cell 11, 223-32, 1977) and adenine phosphoribosyltransferase (Lowy et al, Cell 22, 817-23, 1980) genes which can be employed in tkr or apr cells, respectively.
  • antimetabolite, antibiotic, or herbicide resistance can be used as the basis for selection.
  • dhfr confers resistance to methotrexate (Wigler et al, Proc. Natl. Acad. Sci.
  • npt confers resistance to the aminoglycosides, neomycin and G-418 (Colbere-Garapin et al, J. Mol. Biol. 150, 1-14, 1981), and als and ot confer resistance to chlorsulfuron and phosphinotricin acetyltransferase, respectively (Murray, 1992, supra). Additional selectable genes have been described. For example, trpB allows cells to utilize indole in place of tryptophan, or hisD, which allows cells to utilize histinol in place of histidine (Hartman & Mulligan, Proc. Natl. Acad. Sci. 85, 8047-51, 1988).
  • Visible markers such as anthocyanins, ⁇ -glucuronidase and its substrate GUS, and luciferase and its substrate luciferin, can be used to identify transformants and to quantify the amount of transient or stable protein expression attributable to a specific vector system (Rhodes et al, Methods Mol. Biol. 55, 121-131, 1995).
  • marker gene expression suggests that the 5-HT-like GPCR polynucleotide is also present, its presence and expression may need to be confirmed.
  • a sequence encoding a 5-HT-like GPCR polypeptide is inserted within a marker gene sequence, transformed cells containing sequences which encode a 5-HT-like GPCR polypeptide can be identified by the absence of marker gene function.
  • a marker gene can be placed in tandem with a sequence encoding a 5-HT-like GPCR polypeptide under the control of a single promoter. Expression ofthe marker gene in response to induction or selection usually indicates expression ofthe 5-HT-like GPCR polynucleotide.
  • host cells which contain a 5-HT-like GPCR polynucleotide and which express a 5-HT-like GPCR polypeptide can be identified by a variety of procedures known to those of skill in the art. These procedures include, but are not limited to, DNA-DNA or DNA-RNA hybridizations and protein bioassay or immunoassay techniques which include membrane, solution, or chip-based technologies for the detection and/or quantification of nucleic acid or protein. For example, the presence of a polynucleotide sequence encoding a 5-HT-like GPCR polypeptide can be detected by DNA-DNA or DNA-RNA hybridization or amplification using probes or fragments or fragments of polynucleotides encoding a 5-HT-like GPCR polypeptide.
  • Nucleic acid amplification-based assays involve the use of oligonucleotides selected from sequences encoding a 5-HT-like GPCR polypeptide to detect transformants which contain a 5-HT-like GPCR polynucleotide.
  • GPCR polypeptide using either polyclonal or monoclonal antibodies specific for the polypeptide, are known in the art. Examples include enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), and fluorescence activated cell sorting (FACS). A two-site, monoclonal-based immunoassay using monoclonal antibodies reactive to two non-interfering epitopes on a 5-HT-like GPCR polypeptide can be used, or a competitive binding assay can be employed. These and ' other assays are described in Hampton et al, SEROLOGICAL METHODS: A LABORATORY MANUAL, APS Press, St. Paul, Minn., 1990) and Maddox et al, J. Exp. Med. 158, 1211-1216, 1983).
  • Means for producing labeled hybridization or PCR probes for detecting sequences related to polynucleotides encoding 5-HT-like GPCR polypeptides include oligolabeling, nick translation, end-labeling, or PCR amplification using a labeled nucleotide.
  • sequences encoding a 5-HT-like GPCR polypeptide can be cloned into a vector for the production of an mRNA probe.
  • vectors are known in the art, are commercially available, and can be used to synthesize RNA probes in vitro by addition of labeled nucleotides and an appropriate RNA polymerase such as T7, T3, or SP6. These procedures can be conducted using a variety of commercially available kits (Amersham Pharmacia Biotech, Promega, and US Biochemical).
  • Suitable reporter molecules or labels which can be used for ease of detection include radionuclides, enzymes, and fluorescent, chemiluminescent, or chromogenic agents, as well as substrates, cofactors, inhibitors, magnetic particles, and the like.
  • Host cells transformed with nucleotide sequences encoding a 5-HT-like GPCR polypeptide can be cultured under conditions suitable for the expression and recovery of the protein from cell culture.
  • the polypeptide produced by a transformed cell can be secreted or contained intracellularly depending on the sequence and/or the vector used.
  • expression vectors containing polynucleotides which encode 5-HT-like GPCR polypeptides can be designed to contain signal sequences which direct secretion of soluble 5-HT-like GPCR poly- peptides through a prokaryotic or eukaryotic cell membrane or which direct the membrane insertion of membrane-bound 5-HT-like GPCR polypeptide.
  • purification facilitating domains include, but are not limited to, metal chelating peptides such as histidine-tryptophan modules that allow purification on immobilized metals, protein A domains that allow purification on immobilized immunoglobulin, and the domain utilized in the FLAGS extension/affinity purification system (Immunex Co ⁇ ., Seattle, Wash.). Inclusion of cleavable linker sequences such as those specific for
  • Factor Xa or enterokinase (Invitrogen, San Diego, CA) between the purification domain and the 5-HT-like GPCR polypeptide also can be used to facilitate purification.
  • One such expression vector provides for expression of a fusion protein containing a 5-HT-like GPCR polypeptide and 6 histidine residues preceding a thioredoxin or an enterokinase cleavage site. The histidine residues facilitate purification by IMAC (immobilized metal ion affinity chromatography, as described in Porath et al.,-Prot. Exp. Purif.
  • enterokinase cleavage site provides a means for purifying the 5-HT-like GPCR polypeptide from the fusion protein.
  • Vectors which contain fusion proteins are disclosed in Kroll et al, DNA Cell Biol. 12, 441-453, 1993. Chemical Synthesis
  • Sequences encoding a 5-HT-like GPCR polypeptide can be synthesized, in whole or in part, using chemical methods well known in the art (see Caruthers et al, Nucl.
  • a 5-HT-like GPCR polypeptide itself can be produced using chemical methods to synthesize its amino acid sequence, such as by direct peptide synthesis using solid-phase techniques (Merrifield, J. Am. Chem. Soc. 85, 2149-2154, 1963; Roberge et al, Science 269, 202-204, 1995). Protein synthesis can be performed using manual techniques or by automation. Automated synthesis can be achieved, for example, using Applied Biosystems 431 A Peptide Synthesizer (Perkin Elmer).
  • fragments of 5-HT-like GPCR polypeptides can be separately synthesized and combined using chemical methods to produce a full- length molecule.
  • the newly synthesized peptide can be substantially purified by preparative high performance liquid chromatography (e.g., Creighton, PROTEINS: STRUCTURES AND MOLECULAR PRINCIPLES, WH Freeman and Co., New York, N.Y., 1983).
  • the composition of a synthetic 5-HT-like GPCR polypeptide can be confirmed by amino acid analysis or sequencing (e.g., the Edman degradation procedure; see Creighton, supra). Additionally, any portion of the amino acid sequence of the 5-HT-like GPCR polypeptide can be altered during direct synthesis and/or combined using chemical methods with sequences from other proteins to produce a variant polypeptide or a fusion protein.
  • codons preferred by a particular prokaryotic or eukaryotic host can be selected to increase the rate of protein expression or to produce an RNA transcript having desirable properties, such as a half-life which is longer than that of a transcript generated from the naturally occurring sequence.
  • nucleotide sequences disclosed herein can be engineered using methods generally known in the art to alter 5-HT-like GPCR polypeptide-encoding sequences for a variety of reasons, including but not limited to, alterations which modify the cloning, processing, and/or expression of the polypeptide or mRNA product.
  • DNA shuffling by random fragmentation and PCR reassembly of gene fragments and synthetic oligonucleotides can be used to engineer the nucleotide ' sequences.
  • site-directed mutagenesis can be used to insert new restriction sites, alter glycosylation patterns, change codon preference, produce splice variants, introduce mutations, and so forth.
  • Antibody as used herein includes intact immunoglobulin molecules, as well as fragments thereof, such as Fab, F(ab') 2 , and
  • Fv which are capable of binding an epitope of a 5-HT-like GPCR polypeptide.
  • epitopes which involve non-contiguous amino acids may require more, e.g., at least 15, 25, or 50 amino acids.
  • An antibody which specifically binds to an epitope of a 5-HT-like GPCR polypeptide can be used therapeutically, as well as in immunochemical assays, such as Western blots, ELISAs, radioimmunoassays, immunohistochemical assays, immuno- precipitations, or other immunochemical assays known in the art.
  • immunochemical assays such as Western blots, ELISAs, radioimmunoassays, immunohistochemical assays, immuno- precipitations, or other immunochemical assays known in the art.
  • Various immuno- assays can be used to identify antibodies having the desired specificity. Numerous protocols for competitive binding or immunoradiometric assays are well known in the art. Such immunoassays typically involve the measurement of complex formation between an immunogen and an antibody which specifically binds to the immunogen.
  • an antibody which specifically binds to a 5-HT-like GPCR polypeptide provides a detection signal at least 5-, 10-, or 20-fold higher than a detection signal provided with other proteins when used in an immunochemical assay.
  • antibodies which specifically bind to 5-HT-like GPCR polypeptides do not detect other proteins in immunochemical assays and can immunoprecipitate a 5-HT-like
  • 5-HT-like GPCR polypeptides can be used to immunize a mammal, such as a mouse, rat, rabbit, guinea pig, monkey, or human, to produce polyclonal antibodies.
  • a 5-HT-like GPCR polypeptide can be conjugated to a carrier protein, such as bovine serum albumin, thyroglobulin, and keyhole limpet hemocyanin.
  • a carrier protein such as bovine serum albumin, thyroglobulin, and keyhole limpet hemocyanin.
  • various adjuvants can be used to increase the immunological response.
  • adjuvants include, but are not limited to, Freund's adjuvant, mineral gels (e.g., aluminum hydroxide), and surface active substances (e.g.
  • BCG Bacilli Calmette-Gueri
  • Corynebacterium parvum are especially useful.
  • Monoclonal antibodies which specifically bind to a 5-HT-like GPCR polypeptide can be prepared using any technique which provides for the production of antibody molecules by continuous cell lines in culture. These techniques include, but are not limited to, the hybridoma technique, the human B-cell hybridoma technique, and the EBV-hybridoma technique (Kohler et al, Nature 256, 495-497, 1985; Kozbor et al, J. Immunol. Methods 81, 31-42, 1985; Cote et al, Proc. Natl Acad. Sci. 80, 2026-2030, 1983; Cole et al, Mol. Cell Biol. 62, 109-120, 1984).
  • Monoclonal and other antibodies also can be "humanized” to prevent a patient from mounting an immune response against the antibody when it is used therapeutically.
  • Such antibodies may be sufficiently similar in sequence to human antibodies to be used directly in therapy or may require alteration of a few key residues. Sequence differences between rodent antibodies and human sequences can be minimized by replacing residues which differ from those in the human sequences by site directed mutagenesis of individual residues or by grating of entire complementarity determining regions.
  • humanized antibodies can be produced using recombinant methods, as described in GB2188638B.
  • Antibodies which specifically bind to a 5-HT-like GPCR polypeptide can contain antigen binding sites which are either partially or fully humanized, as disclosed in U.S. 5,565,332.
  • single chain antibodies can be adapted using methods known in the art to produce single chain antibodies which specifically bind to 5-HT-like GPCR polypeptides.
  • Antibodies with related specificity, but of distinct idiotypic composition can be generated by chain shuffling from random combinatorial immunoglobin libraries (Burton, Proc. Natl. Acad. Sci. 55, 11120-23, 1991).
  • Single-chain antibodies also can be constructed using a DNA amplification method, such as PCR, using hybridoma cDNA as a template (Thirion et al, 1996, Eur. J. Cancer Prev. 5, 507-11).
  • Single-chain antibodies can be mono- or bispecific, and can be bivalent or tetravalent. Construction of tetravalent, bispecific single-chain antibodies is taught, for example, in Coloma & Morrison, 1997, Nat. Biotechnol. 15, 159-63. Construction of bivalent, bispecific single-chain antibodies is taught in Mallender & Voss, 1994, J. Biol. Chem. 269, 199-206.
  • a nucleotide sequence encoding a single-chain antibody can be constructed using manual or automated nucleotide synthesis, cloned into an expression construct using standard recombinant DNA methods, and introduced into a cell to express the coding sequence, as described below.
  • single-chain antibodies can be produced directly using, for example, filamentous phage technology (Verhaar et al, 1995, Int. J. Cancer 61, 497-501; Nicholls et al, 1993, J. Immunol. Meth. 165, 81- 91).
  • Antibodies which specifically bind to 5-HT-like GPCR polypeptides also can be produced by inducing in vivo production in the lymphocyte population or by screening immunoglobulin libraries or panels of highly specific binding reagents as disclosed in the literature (Orlandi et al, Proc. Natl. Acad. Sci. 86, 3833-3837, 1989;
  • chimeric antibodies can be constructed as disclosed in WO 93/03151.
  • Binding proteins which are derived from immunoglobulins and which are multivalent and multispecific, such as the "diabodies" described in WO 94/13804, also can be prepared.
  • Antibodies according to the invention can be purified by methods well known in the art. For example, antibodies can be affinity purified by passage over a column to which a 5-HT-like GPCR polypeptide is bound. The bound antibodies can then be eluted from the column using a buffer with a high salt concentration.
  • Antisense Oligonucleotides can be purified by methods well known in the art. For example, antibodies can be affinity purified by passage over a column to which a 5-HT-like GPCR polypeptide is bound. The bound antibodies can then be eluted from the column using a buffer with a high salt concentration.
  • Antisense oligonucleotides are nucleotide sequences which are complementary to a specific DNA or RNA sequence. Once introduced into a cell, the complementary nucleotides combine with natural sequences produced by the cell to form complexes and block either transcription or translation. Preferably, an antisense oligonucleotide is at least 11 nucleotides in length, but can be at least 12, 15, 20, 25, 30, 35, 40, 45, or 50 or more nucleotides long. Longer sequences also can be used. Antisense oligonucleotide molecules can be provided in a DNA construct and introduced into a cell as described above to decrease the level of 5-HT-like GPCR gene products in the cell.
  • Antisense oligonucleotides can be deoxyribonucleotides, ribonucleotides, or a combination of both. Oligonucleotides can be synthesized manually or by an auto- mated synthesizer, by covalently linking the 5' end of one nucleotide with the 3' end of another nucleotide with non-phosphodiester internucleotide linkages such alkyl- phosphonates, phosphorothioates, phosphorodithioates, alkylphosphonothioates, alkylphosphonates, phosphoramidates, phosphate esters, carbamates, acetamidate, carboxymethyl esters, carbonates, and phosphate triesters. See Brown, Meth. Mol. Biol. 20, 1-8, 1994; Sonveaux, Meth. Mol. Biol. 26, 1-72, 1994; Uhlmann et al,
  • Modifications of 5-HT-like GPCR gene expression can be obtained by designing antisense oligonucleotides which will form duplexes to the control, 5', or regulatory regions of the 5-HT-like GPCR gene. Oligonucleotides derived from the transcription initiation site, e.g., between positions -10 and +10 from the start site, are preferred. Similarly, inhibition can be achieved using "triple helix" base-pairing methodology. Triple helix pairing is useful because it causes inhibition ofthe ability of the double helix to open sufficiently for the binding of polymerases, transcription factors, or chaperons.
  • An antisense oligonucleotide also can be designed to block translation of mRNA by preventing the transcript from binding to ribosomes. - - '
  • Antisense oligonucleotides which comprise, for example, 2, 3, 4, or 5 or more stretches of contiguous nucleotides which are precisely complementary to a 5-HT-like GPCR polynucleotide, each separated by a stretch of contiguous nucleotides which are not complementary to adjacent 5-HT-like GPCR nucleotides, can provide sufficient targeting specificity for 5-HT-like GPCR mRNA.
  • each stretch of complementary contiguous nucleotides is at least 4, 5, 6, 7, or 8 or more nucleotides in length.
  • Non-complementary intervening sequences are prefer- ably 1, 2, 3, or 4 nucleotides in length.
  • One skilled in the art can easily use the calculated melting point of an antisense-sense pair to determine the degree of mismatching which will be tolerated between a particular antisense oligonucleotide and a particular 5-HT-like GPCR polynucleotide sequence.
  • Antisense oligonucleotides can be modified without affecting their ability to hybridize to a 5-HT-like GPCR polynucleotide. These modifications can be internal or at one or both ends ofthe antisense molecule.
  • internucleoside phosphate linkages can be modified by adding cholesteryl or diamine moieties with varying numbers of carbon residues between the amino groups and terminal ribose. Modified bases and/or sugars, such as arabinose instead of ribose, or a 3',
  • oligonucleotide in which the 3' hydroxyl group or the 5' phosphate group are substituted, also can be employed in a modified antisense oligonucleotide.
  • modified oligonucleotides can be prepared by methods well known in the art. See, e.g., Agrawal et al, Trends Biotechnol. 10, 152-158, 1992; Uhlmann et al, Chem. Rev. 90, 543-584, 1990; Uhlmann et al, Tetrahedron. Lett. 215, 3539-3542, 1987.
  • Ribozymes are RNA molecules with catalytic activity. See, e.g., Cech, Science 236, 1532-1539; 1987; Cech, -4rcn. Rev. Biochem. 59, 543-568; 1990, Cech, Curr. Opin. Struct. Biol. 2, 605-609; 1992, Couture & Stinchcomb, Trends Genet. 12, 510-515, 1996. Ribozymes can be used to inhibit gene function by cleaving an RNA sequence, as is known in the art (e.g., Haseloff et al, U.S. Patent 5,641,673).
  • ribozyme action involves sequence-specific hybridization of the ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage.
  • Examples include engineered hammerhead motif ribozyme molecules that can specifically and efficiently catalyze endonucleolytic cleavage of specific nucleotide sequences.
  • the coding sequence of a 5-HT-like GPCR polynucleotide can be used to generate ribozymes which will specifically bind to mRNA transcribed from the 5-HT-like GPCR polynucleotide.
  • Methods of designing and constructing ribozymes which can cleave other RNA molecules in trans in a highly sequence specific manner have been developed and described in the art (see Haseloff et al. Nature 334, 585-591, 1988).
  • the cleavage activity of ribozymes can be targeted to specific RNAs by engineering a discrete "hybridization" region into the ribozyme.
  • the hybridization region contains a sequence complementary to the target RNA and thus specifically hybridizes with the target (see, for example, Geriach et al, EP 321,201).
  • Specific ribozyme cleavage sites within a 5-HT-like GPCR RNA target can be identified by scanning the target molecule for ribozyme cleavage sites which include the following sequences: GUA, GUU, and GUC. Once identified, short RNA sequences of between 15 and 20 ribonucleotides corresponding to the region of the target RNA containing the cleavage site can be evaluated for secondary structural features which may render the target inoperable. Suitability of candidate 5-HT-like GPCR RNA targets also can be evaluated by testing accessibility to hybridization with complementary oligonucleotides using ribonuclease protection assays.
  • the nucleotide sequence shown in SEQ ID NO: 3 and its complement provide a source of suitable hybridization region sequences. Longer complementary sequences can be used to increase the affinity of the hybridization sequence for the target.
  • the hybridizing and cleavage regions of the ribozyme can be integrally related such that upon hybridizing to the target RNA through the complementary regions, the catalytic region ofthe ribozyme can cleave the target.
  • Ribozymes can be introduced into cells as part of a DNA construct. Mechanical methods, such as microinjection, liposome-mediated transfection, electroporation, or calcium phosphate precipitation, can be used to introduce a ribozyme-containing DNA construct.
  • a ribozyme-encoding DNA construct can include transcriptional regulatory elements, such as a promoter element, an enhancer or UAS element, and a transcriptional terminator signal, for controlling transcription of ribozymes in the cells.
  • ribozymes can be engineered so that ribozyme expression will occur in response to factors which induce expression of a target gene. Ribozymes also can be engineered to provide an additional level of regulation, so that destruction of mRNA occurs only when both a ribozyme and a target gene are induced in the cells. Differentially Expressed Genes
  • genes whose products interact with human 5-HT-like GPCR may represent genes that are differentially expressed in disorders including, but not limited to, COPD, cardiovascular disorders, cancer, urinary disorders, obesity, diabetes, CNS disorders, asthma, and hematological disorders. Further, such genes may represent genes that are differentially regulated in response to manipulations relevant to the progression or treatment of such diseases. Additionally, such genes may have a temporally modulated expression, in- creased or decreased at different stages of tissue or organism development. A differentially expressed gene may also have its expression modulated under control versus experimental conditions. In addition, the human 5-HT-like GPCR gene or gene product may itself be tested for differential expression.
  • the degree to which expression differs in a normal versus a diseased state need only be large enough to be visualized via standard characterization techniques such as differential display techniques.
  • standard characterization techniques such as differential display techniques.
  • Other such standard characterization techniques by which expression differences may be visualized include but are not limited to, quantitative RT (reverse transcriptase), PCR, and Northern analysis.
  • RNA or, preferably, mRNA is isolated from tissues of interest.
  • RNA samples are obtained from tissues of experimental subjects and from corresponding tissues of control subjects.
  • RNA isolation technique that does not select against the isolation of mRNA may be utilized for the purification of such RNA samples. See, for example, Ausubel et al, ed., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, Inc. New York, 1987-1993. Large numbers of tissue samples may readily be processed using techniques well known to those of skill in the art, such as, for example, the single- step RNA isolation process of Chomczynski, U.S. Patent 4,843,155.
  • Transcripts within the collected RNA samples that represent RNA produced by differentially expressed genes are identified by methods well known to those of skill in the art. They include, for example, differential screening (Tedder et al, Proc. Natl. Acad. Sci. U.S.A. 85, 208-12, 1988), subtractive hybridization (Hedrick et al, Nature 308, 149-53; Lee et al, Proc. Natl. Acad. Sci. U.S.A. 88, 2825, 1984), and differential display (Liang & Pardee, Science 257, 967-71, 1992; U.S. Patent 5,262,311), and microarrays.
  • the differential expression information may itself suggest relevant methods for the treatment of disorders involving the human 5-HT-like GPCR.
  • treatment may include a modulation of expression of the differentially expressed genes and/or the gene encoding the human 5-HT-like GPCR.
  • the differential expression information may indicate whether the expression or activity of the differentially expressed gene or gene product or the human 5-HT-like GPCR gene or gene product are up-regulated or down-regulated.
  • the invention provides assays for screening test compounds which bind to or modulate the activity of a 5-HT-like GPCR polypeptide or a 5-HT-like GPCR polynucleotide.
  • a test compound preferably binds to a 5-HT-like GPCR polypeptide or polynucleotide. More preferably, a test compound decreases or increases the effect of serotonin or a serotonin analog as mediated via human 5-HT-like GPCR by at least about 10, preferably about 50, more preferably about 75, 90, or 100% relative to the absence ofthe test compound.
  • Test compounds can be pharmacologic agents already known in the art or can be compounds previously unknown to have any pharmacological activity.
  • the compounds can be naturally occurring or designed in the laboratory. They can be isolated from microorganisms, animals, or plants, and can be produced recombinantly, or synthesized by chemical methods known in the art. If desired, test compounds can be obtained using any of the numerous combinatorial library methods known in the art, including but not limited to, biological libraries, spatially addressable parallel solid phase or solution phase libraries, synthetic library methods requiring deconvolution, the "one-bead one-compound” library method, and synthetic library methods using affinity chromatography selection.
  • the biological library approach is limited to polypeptide libraries, while the other four approaches are applicable to polypeptide, non-peptide oligomer, or small molecule libraries of compounds. See Lam, Anticancer Drug Des. 12, 145, 1997.
  • Test compounds can be screened for the ability to bind to 5-HT-like GPCR polypeptides or polynucleotides or to affect 5-HT-like GPCR activity or 5-HT-like GPCR gene expression using high throughput screening.
  • high throughput screening many discrete compounds can be tested in parallel so that large numbers of test compounds can be quickly screened.
  • the most widely established techniques utilize 96-well microtiter plates. The wells of the microtiter plates typically require assay volumes that range from 50 to 500 ⁇ l.
  • many instruments, materials, pipettors, robotics, plate washers, and plate readers are commercially available to fit the 96-well format.
  • free format assays or assays that have no physical barrier between samples, can be used.
  • an assay using pigment cells (melanocytes) in a simple homogeneous assay for combinatorial peptide libraries is described by
  • Chelsky placed a simple homogenous enzyme assay for carbonic anhydrase inside an agarose gel such that the enzyme in the gel would cause a color change throughout the gel. Thereafter, beads carrying combinatorial compounds via a photolinker were placed inside the gel and the com- pounds were partially released by UV-light. Compounds that inhibited the enzyme were observed as local zones of inhibition having less color change.
  • test samples are placed in a porous matrix.
  • One or more assay components are then placed within, on top of, or at the bottom of a matrix such as a gel, a plastic sheet, a filter, or other form of easily manipulated solid support.
  • a matrix such as a gel, a plastic sheet, a filter, or other form of easily manipulated solid support.
  • the test compound is preferably a small molecule which binds to and occupies the active site of the 5-HT-like GPCR polypeptide, thereby making the ligand binding site inaccessible to substrate such that normal biological activity is prevented.
  • small molecules include, but are not limited to, small peptides or peptide-like molecules.
  • Potential ligands which bind to a polypeptide of the invention include, but are not limited to, the natural ligands of known 5-HT-like GPCRs and analogues or derivatives thereof.
  • either the test compound or the 5-HT-like GPCR polypeptide can comprise a detectable label, such as a fluorescent, radioisotopic, chemiluminescent, or enzymatic label, such as horseradish peroxidase, alkaline phosphatase, or luciferase.
  • a detectable label such as a fluorescent, radioisotopic, chemiluminescent, or enzymatic label, such as horseradish peroxidase, alkaline phosphatase, or luciferase.
  • Detection of a test compound which is bound to the 5-HT-like GPCR polypeptide can then be accomplished, for example, by direct counting of radio- emmission, by scintillation counting, or by determining conversion of an appropriate substrate to a detectable product.
  • binding of a test compound to a 5-HT-like GPCR polypeptide can be determined without labeling either of the interactants.
  • a microphysiometer can be used to detect binding of a test compound with a 5-HT-like GPCR polypeptide.
  • a microphysiometer e.g., CytosensorTM
  • a microphysiometer is an analytical instrument that measures the rate at which a cell acidifies its environment using a light-addressable potentiometric sensor (LAPS). Changes in this acidification rate can be used as an indicator of the interaction between a test compound and a 5-HT- like GPCR polypeptide (McConnell et al, Science 257, 1906-1912, 992).
  • Determining the ability of a test compound to bind to a 5-HT-like GPCR polypeptide also can be accomplished using a technology such as real-time Bimolecular Inter- action Analysis (BIA) (Sjolander & Urbaniczky, Anal. Chem. 63, 2338-2345, 1991, and Szabo et al, Curr. Opin. Struct. Biol. 5, 699-705, 1995).
  • BIA is a technology for studying biospecific interactions in real time, without labeling any of the interactants (e.g., BIAcoreTM). Changes in the optical phenomenon surface plasmon resonance (SPR) can be used as an indication of real-time reactions between biological molecules.
  • a 5-HT-like GPCR polypeptide can be used as a "bait protein" in a two-hybrid assay or three-hybrid assay (see, e.g., U.S. Patent 5,283,317; Zervos et al, Cell 72, 223-232, 1993; Madura et al, J. Biol. Chem. 268, 12046-12054, 1993; Bartel et al, BioTechniques 14, 920-924, 1993; Iwabuchi et al,
  • the assay utilizes two different DNA constructs.
  • polynucleotide encoding a 5-HT-like GPCR polypeptide can be fused to a polynucleotide encoding the DNA binding domain of a known transcription factor (e.g. , GAL-4).
  • a DNA sequence that encodes an unidentified protein can be fused to a polynucleotide that codes for the activation domain of the known transcription factor. If the "bait” and the “prey” proteins are able to interact in vivo to form an protein-dependent complex, the DNA-binding and activation domains of the transcription factor are brought into close proximity. This proximity allows transcription of a reporter gene (e.g., LacZ), which is operably linked to a transcriptional regulatory site responsive to the transcription factor. Expression of the reporter gene can be detected, and cell colonies containing the functional transcription factor can be isolated and used to obtain the DNA sequence encoding the protein which interacts with the 5-HT-like GPCR polypeptide.
  • a reporter gene e.g., LacZ
  • either the 5-HT-like GPCR polypeptide (or polynucleotide) or the test compound can be bound to a solid support.
  • Suitable solid supports include, but are not limited to, glass or plastic slides, tissue culture plates, microtiter wells, tubes, silicon chips, or particles such as beads (including, but not limited to, latex, polystyrene, or glass beads).
  • Any method known in the art can be used to attach the 5-HT-like GPCR polypeptide (or polynucleotide) or test compound to a solid support, including use of covalent and non-covalent linkages, passive abso ⁇ tion, or pairs of binding moieties attached respectively to the polypeptide (or polynucleotide) or test compound and the solid support.
  • Test compounds are preferably bound to the solid support in an array, so that the location of individual test compounds can be tracked. Binding of a test compound to a 5-HT-like GPCR polypeptide (or polynucleotide) can be accomplished in any vessel suitable for containing the reactants. Examples of such vessels include microtiter plates, test tubes, and microcentrifuge tubes.
  • the 5-HT-like GPCR polypeptide is a fusion protein comprising a domain that allows the 5-HT-like GPCR polypeptide to be bound to a solid support.
  • glutathione-S-transferase fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis, Mo.) or glutathione derivatized microtiter plates, which are then combined with the test compound or the test compound and the non-adsorbed 5-HT-like GPCR polypeptide; the mixture is then incubated under conditions conducive to complex formation (e.g., at physiological conditions for salt and pH). Following incubation, the beads or microtiter plate wells are washed to remove any unbound components. Binding of the interactants can be determined either directly or indirectly, as described above. Alternatively, the complexes can be dissociated from the solid support before binding is determined.
  • a 5-HT-like GPCR polypeptide (or polynucleotide) or a test compound can be immobilized utilizing conjugation of biotin and streptavidin.
  • Biotinylated 5-HT-like GPCR polypeptides (or polynucleotides) or test compounds can be prepared from biotin-NHS(N-hydroxysuccinimide) using techniques well known in the art (e.g., biotinylation kit, Pierce Chemicals, Rockford, 111.) and immobilized in the wells of streptavidin-coated 96 well plates (Pierce Chemical).
  • antibodies which specifically bind to a 5-HT-like GPCR polypeptide, polynucleotide, or a test compound, but which do not interfere with a desired binding site, such as the active site of the 5-HT-like GPCR polypeptide can be derivatized to the wells of the plate. Unbound target or protein can be trapped in the wells by antibody conjugation.
  • Methods for detecting such complexes include immunodetection of complexes using antibodies which specifically bind to the 5-HT-like GPCR polypeptide or test compound, enzyme-linked assays which rely on detecting an activity of the 5-HT-like GPCR polypeptide, and SDS gel electrophoresis under non-reducing conditions.
  • Any cell which comprises a 5- HT-like GPCR polypeptide or polynucleotide can be used in a cell-based assay system.
  • a 5-HT-like GPCR polynucleotide can be naturally occurring in the cell or can be introduced using techniques such as those described above. Binding of the test compound to a 5-HT-like GPCR polypeptide or polynucleotide is determined as described above.
  • Test compounds can be tested for the ability to increase or decrease a biological effect of a 5-HT-like GPCR polypeptide. Such biological effects can be determined using the functional assays described in the specific examples, below. Functional assays can be carried out after contacting either a purified 5-HT-like GPCR polypeptide, a cell membrane preparation, or an intact cell with a test compound.
  • a test compound which decreases a functional activity of a 5-HT-like GPCR by at least about 10, preferably about 50, more preferably about 75, 90, or 100% is identified as a potential agent for decreasing 5-HT-like GPCR activity.
  • a test compound which increases 5-HT-like GPCR activity by at least about 10, preferably about 50, more preferably about 75, 90, or 100% is identified as a potential agent for increasing 5- HT-like GPCR activity.
  • Such a screening procedure involves the use of melanophores which are transfected to express a 5-HT-like GPCR polypeptide.
  • a screening technique is described in WO 92/01810 published Feb. 6, 1992.
  • an assay may be employed for screening for a compound which inhibits activation of the receptor polypeptide by contacting the melanophore cells which comprise the receptor with both the receptor ligand (e.g., serotonin or a serotonin analog) and a test compound to be screened. Inhibition of the signal generated by the ligand indicates that a test compound is a potential antagonist for the receptor, i.e., inhibits activation of the receptor.
  • the screen may be employed for identifying a test compound which activates the receptor by contacting such cells with compounds to be screened and determining whether each test compound generates a signal, i.e., activates the receptor.
  • test compounds may be contacted with a cell which expresses a human 5-HT-like GPCR polypeptide and a second messenger response, e.g., signal transduction or pH changes, can be measured to determine whether the test compound activates or inhibits the receptor.
  • a human 5-HT-like GPCR polypeptide for example, transfected CHO cells
  • a second messenger response e.g., signal transduction or pH changes
  • Another such screening technique involves introducing RNA encoding a human 5-
  • HT-like GPCR polypeptide into Xenopus oocytes to transiently express the receptor.
  • the transfected oocytes can then be contacted with the receptor ligand and a test compound to be screened, followed by detection of inhibition or activation of a calcium signal in the case of screening for test compounds which are thought to inhibit activation ofthe receptor.
  • Another screening technique involves expressing a human 5-HT-like GPCR polypeptide in cells in which the receptor is linked to a phospholipase C or D.
  • Such cells include endothelial cells, smooth muscle cells, embryonic kidney cells, etc.
  • the screening may be accomplished as described above by quantifying the degree of activation ofthe receptor from changes in the phospholipase activity.
  • test compounds which increase or decrease 5-HT-like GPCR gene expression are identified.
  • a 5-HT-like GPCR polynucleotide is contacted with a test compound, and the expression of an RNA or polypeptide product of the 5-HT- like GPCR polynucleotide is determined.
  • the level of expression of appropriate mRNA or polypeptide in the presence of the test compound is compared to the level of expression of mRNA or polypeptide in the absence of the test compound.
  • the test compound can then be identified as a modulator of expression based on this comparison. For example, when expression of mRNA or polypeptide is greater in the presence ofthe test compound than in its absence, the test compound is identified as a stimulator or enhancer of the mRNA or polypeptide expression. Alternatively, when expression of the mRNA or polypeptide is less in the presence of the test compound than in its absence, the test compound is identified as an inhibitor of the mRNA or polypeptide expression.
  • the level of 5-HT-like GPCR mRNA or polypeptide expression in the cells can be determined by methods well known in the art for detecting mRNA or polypeptide. Either qualitative or quantitative methods can be used.
  • the presence of polypeptide products of a 5-HT-like GPCR polynucleotide can be determined, for example, using a variety of techniques known in the art, including immunochemical methods such as radioimmunoassay, Western blotting, and immunohistochemistry.
  • polypeptide synthesis can be determined in vivo, in a cell culture, or in an in vitro translation system by detecting inco ⁇ oration of labeled amino acids into a 5-HT-like GPCR polypeptide.
  • Such screening can be carried out either in a cell-free assay system or in an intact cell.
  • Any cell which expresses a 5-HT-like GPCR polynucleotide can be used in a cell-based assay system.
  • the 5-HT-like GPCR polynucleotide can be naturally occurring in the cell or can be introduced using techniques such as those described above.
  • Either a primary culture or an established cell line, such as CHO or human embryonic kidney 293 cells, can be used.
  • compositions of the invention can comprise, for example, a 5-HT-like GPCR polypeptide, 5-HT-like
  • compositions which specifically bind to a 5-HT-like GPCR polypeptide, or mimetics, agonists, antagonists, or inhibitors of a 5-HT-like GPCR polypeptide activity.
  • the compositions can be administered alone or in combination with at least one other agent, such as stabilizing compound, which can be administered in any sterile, biocompatible pharmaceutical carrier, including, but not limited to, saline, buffered saline, dextrose, and water.
  • the compositions can be administered to a patient alone, or in combination with other agents, drugs or hormones.
  • compositions of the invention can be administered by any number of routes including, but not limited to, oral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, intraventricular, transdermal, subcutaneous, intraperitoneal, intranasal, parenteral, topical, sublingual, or rectal means.
  • Pharmaceutical compositions for oral administration can be formulated using pharmaceutically acceptable carriers well known in the art in dosages suitable for oral administration. Such carriers enable the pharmaceutical compositions to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for ingestion by the patient.
  • compositions for oral use can be obtained through combination of active compounds with solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores.
  • Suitable excipients are carbohydrate ' or protein fillers, such as sugars, including lactose, sucrose, mannitol, or sorbitol; starch from corn, wheat, rice, potato, or other plants; cellulose, such as methyl cellulose, hydroxy- propylmethyl-cellulose, or sodium carboxymethylcellulose; gums including arabic and tragacanth; and proteins such as gelatin and collagen.
  • disintegrating or solubilizing agents can be added, such as the cross-linked polyvinyl pyrrolidone, agar, alginic acid, or a salt thereof, such as sodium alginate.
  • Dragee cores can be used in conjunction with suitable coatings, such as concentrated sugar solutions, which also can contain gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
  • suitable coatings such as concentrated sugar solutions, which also can contain gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
  • Dyestuffs or pigments can be added to the tablets or dragee coatings for product identification or to characterize the quantity of active compound, i.e., dosage.
  • Push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a coating, such as glycerol or sorbitol.
  • Push-fit capsules can contain active ingredients mixed with a filler or binders, such as lactose or starches, lubricants, such as talc or magnesium stearate, and, optionally, stabilizers.
  • the active compounds can be dissolved or suspended in suitable liquids, such as fatty oils, liquid, or liquid polyethylene glycol with or without stabilizers.
  • compositions suitable for parenteral administration can be formulated in aqueous solutions, preferably in physiologically compatible buffers such as
  • Aqueous injection suspensions can contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran.
  • suspensions of the active compounds can be prepared as appropriate oily injection suspensions.
  • Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes.
  • Non-lipid polycationic amino polymers also can be used for delivery.
  • the suspension also can contain suitable stabilizers or agents which increase the solubility of the compounds to allow for the preparation of highly concentrated solutions.
  • penetrants appropriate to the particular barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
  • the pharmaceutical compositions ofthe present invention can be manufactured in a manner that is known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping, or lyophilizing processes.
  • the pharmaceutical composition can be provided as a salt and can be formed with many acids, including but not limited to, hydrochloric, sulfuric, acetic, lactic, tartaric, malic, succinic, etc. Salts tend to be more soluble in aqueous or other protonic solvents than are the corresponding free base forms.
  • the preferred preparation can be a lyophilized powder which can contain any or all of the following: 1-50 mM histidine, 0.1%>-2% sucrose, and 2-7% mannitol, at a pH range of 4.5 to 5.5, that is combined with buffer prior to use. Further details on techniques for formulation and administration can be found in the latest edition of REMINGTON'S PHARMACEUTICAL SCIENCES (Maack Publishing Co., Easton, Pa.). After pharmaceutical compositions have been prepared, they can be placed in an appropriate container and labeled for treatment of an indicated condition. Such labeling would include amount, frequency, and method of administration.
  • GPCRs are ubiquitous in the mammalian host and are responsible for many biological functions, including many pathologies. Accordingly, it is ' desirable to find compounds and drugs which stimulate a GPCR on the one hand and which can inhibit the function of a GPCR on the other hand.
  • compounds which activate a GPCR may be employed for therapeutic pu ⁇ oses, such as the treatment of asthma, Parkinson's disease, acute heart failure, urinary retention, and osteoporosis.
  • compounds which activate GPCRs are useful in treating various cardiovascular ailments such as caused by the lack of pulmonary blood flow or hypertension.
  • these compounds may also be used in treating various physiological disorders relating to abnormal control of fluid and electrolyte homeostasis and in diseases associated with abnormal angiotensin-induced aldo- sterone secretion.
  • compounds which inhibit activation of a GPCR can be used for a variety of therapeutic pu ⁇ oses, for example, for the treatment of hypotension and/or hyper- tension, angina pectoris, myocardial infarction, ulcers, asthma, allergies, benign prostatic hypertrophy, and psychotic and neurological disorders including schizophrenia, manic excitement, depression, delirium, dementia or severe mental retardation, dyskinesias, such as Huntington's disease or Tourett's syndrome, among others.
  • Compounds which inhibit GPCRs also are useful in reversing endogenous anorexia, in the control of bulimia, and in treating various cardiovascular ailments such as caused by excessive pulmonary blood flow or hypotension.
  • regulation of 5-HT-like GPCR can be used to treat anxiety, depression, hypertension, migraine, compulsive disorders, schizophrenia, autism, neurodegenerative disorders, such as Alzheimer's disease, Parkinsonism, and Huntington's chorea, and cancer chemotherapy-induced vomiting, as well as sleep and eating disorders, pain control, disorders involving regulation of body temperature and blood pressure.
  • Diabetes mellitus is a common metabolic disorder characterized by an abnormal elevation ' in blood glucose, alterations in lipids and abnormalities (complications) in the cardiovascular system, eye, kidney and nervous system. Diabetes is divided into two separate diseases: type 1 diabetes (juvenile onset), which results from a loss of cells which make and secrete insulin, and type 2 diabetes (adult onset), which is caused by a defect in insulin secretion and a defect in insulin action.
  • Type 1 diabetes is initiated by an autoimmune reaction that attacks the insulin secreting cells (beta cells) in the pancreatic islets.
  • Agents that prevent this reaction from occurring or that stop the reaction before destruction of the beta cells has been accomplished are potential therapies for this disease.
  • Other agents that induce beta cell proliferation and regeneration also are potential therapies.
  • Type II diabetes is the most common of the two diabetic conditions (6% of the population).
  • the defect in insulin secretion is an important cause of the diabetic condition and results from an inability of the beta cell to properly detect and respond to rises in blood glucose levels with insulin release.
  • Therapies that increase the response by the beta cell to glucose would offer an important new treatment for this disease.
  • the defect in insulin action in Type II diabetic subjects is another target for therapeutic intervention. Agents that increase the activity of the insulin receptor in muscle, liver, and fat will cause a decrease in blood glucose and a nomialization of plasma lipids.
  • the receptor activity can be increased by agents that directly stimulate the receptor or that increase the intracellular signals from the receptor.
  • Other therapies can directly activate the cellular end process, i.e. glucose transport or various enzyme systems, to generate an insulin-like effect and therefore a produce beneficial outcome. Because overweight subjects have a greater susceptibility to Type II diabetes, any agent that reduces body weight is a possible therapy.
  • Type I and Type diabetes can be treated with agents that mimic insulin action or that treat diabetic complications by reducing blood glucose levels.
  • agents that reduces new blood vessel growth can be used to treat the eye complications that develop in both diseases.
  • Obesity and overweight are defined as an excess of body fat relative to lean body mass. An increase in caloric intake or a decrease in energy expenditure or both can bring about this imbalance leading to su ⁇ lus energy being stored as fat. Obesity is associated with important medical morbidities and an increase in mortality. The causes of obesity are poorly understood and may be due to genetic factors, environmental factors or a combination ofthe two to cause a positive energy balance. In contrast, anorexia and cachexia are characterized by an imbalance in energy intake versus energy expenditure leading to a negative energy balance and weight loss.
  • Agents that either increase energy expenditure and/or decrease energy intake, abso ⁇ tion or storage would be useful for treating obesity, overweight, and associated comorbidities.
  • Agents that either increase energy intake and/or decrease energy expenditure or increase the amount of lean tissue would be useful for treating cachexia, anorexia and wasting disorders.
  • This gene, translated proteins and agents which modulate this gene or portions of the gene or its products are useful for treating obesity, overweight, anorexia, cachexia, wasting disorders, appetite suppression, appetite enhancement, increases or decreases in satiety, modulation of body weight, and/or other eating disorders such as bulimia.
  • this gene translated proteins and agents which modulate this gene or portions of the gene or its products are useful for treating obesity/overweight-associated comorbidities including hypertension, type 2 diabetes, coronary artery disease, hyperhpidemia, stroke, gallbladder disease, gout, osteoarthritis, sleep apnea and respiratory problems, some types of cancer including endometrial, breast, prostate, and colon cancer, thrombolic disease, polycystic ovarian syndrome, reduced fertility, complications of pregnancy, menstrual irregularities, hirsutism, stress incontinence, and depression.
  • obesity/overweight-associated comorbidities including hypertension, type 2 diabetes, coronary artery disease, hyperhpidemia, stroke, gallbladder disease, gout, osteoarthritis, sleep apnea and respiratory problems, some types of cancer including endometrial, breast, prostate, and colon cancer, thrombolic disease, polycystic ovarian syndrome, reduced fertility, complications of pregnancy, menstrual irregularities, hir
  • CNS disorders which may be treated include brain injuries, cerebrovascular diseases and their consequences, Parkinson's disease, corticobasal degeneration, motor neuron disease, dementia, including ALS, multiple sclerosis, traumatic brain injury, stroke, post-stroke, post-traumatic brain injury, and small-vessel cerebrovascular disease.
  • Dementias such as Alzheimer's disease, vascular dementia, dementia with Lewy bodies, frontotemporal dementia and Parkinsonism linked to chromosome 17, frontotemporal dementias, including Pick's disease, progressive nuclear palsy, corticobasal degeneration, Huntington's disease, thalamic degeneration, Creutzfeld- Jakob dementia, HIV dementia, schizophrenia with dementia, and Korsakoff s psychosis also can be treated.
  • cognitive-related disorders such as mild cognitive impairment, age-associated memory impairment, age-related cognitive decline, vascular cognitive impairment, attention deficit disorders, attention deficit hyperactivity disorders, and memory disturbances in children with learning disabilities, by regulating the activity of human 5HT-like GPCR.
  • Pain that is associated with CNS disorders also can be treated by regulating the activity of human 5HT-like GPCR. Pain which can be treated includes that associated with central nervous system disorders, such as multiple sclerosis, spinal cord injury, sciatica, failed back surgery syndrome, traumatic brain injury, epilepsy, Parkinson's disease, post-stroke, and vascular lesions in the brain and spinal cord (e.g., infarct, hemorrhage, vascular malformation).
  • Non-central neuropathic pain includes that associated with post mastectomy pain, reflex sympathetic dystrophy
  • RSD trigeminal neuralgiaradioculopathy, post-surgical pain, H ⁇ V/AIDS related pain, cancer pain, metabolic neuropathies (e.g., diabetic neuropathy, vasculitic neuropathy secondary to connective tissue disease), paraneoplastic polyneuropathy associated, for example, with carcinoma of lung, or leukemia, or lymphoma, or carcinoma of prostate, colon or stomach, trigeminal neuralgia, cranial neuralgias, and post-he ⁇ etic neuralgia. Pain associated with cancer and cancer treatment also can be treated, as can headache pain (for example, migraine with aura, migraine without aura, and other migraine disorders), episodic and chronic tension-type headache, tension-type like headache, cluster headache, and chronic paroxysmal hemicrania.
  • headache pain for example, migraine with aura, migraine without aura, and other migraine disorders
  • episodic and chronic tension-type headache tension-type like headache, cluster headache, and chronic paroxysmal hemicrania.
  • Cardiovascular diseases include the following disorders of the heart and the vascular system: congestive heart failure, myocardial infarction, ischemic diseases of the heart, all kinds of atrial and ventricular arrhythmias, hypertensive vascular diseases, and peripheral vascular diseases.
  • Heart failure is defined as a pathophysiologic state in which an abnormality of cardiac function is responsible for the failure of the heart to pump blood at a rate commensurate with the requirement of the metabolizing tissue. It includes all forms of pumping failure, such as high-output and low-output, acute and chronic, right-sided or left-sided, systolic or diastolic, independent ofthe underlying cause.
  • MI Myocardial infarction
  • Ischemic diseases are conditions in which the coronary flow is restricted resulting in a perfusion which is inadequate to meet the myocardial requirement for oxygen.
  • This group of diseases includes stable angina, unstable angina, and asymptomatic ischemia.
  • Arrhythmias include all forms of atrial and ventricular tachyarrhythmias (atrial tachycardia, atrial flutter, atrial fibrillation, atrio-ventricular reentrant tachycardia, preexcitation syndrome, ventricular tachycardia, ventricular flutter, and ventricular fibrillation), as well as bradycardic forms of arrhythmias.
  • Vascular diseases include primary as well as all kinds of secondary arterial hypertension (renal, endocrine, neurogenic, others).
  • the disclosed gene and its product may be used as drug targets for the treatment of hypertension as well as for the prevention of all complications.
  • Peripheral vascular diseases are defined as vascular diseases in which arterial and/or venous flow is reduced resulting in an imbalance between blood supply and tissue oxygen demand. It includes chronic peripheral arterial occlusive disease (PAOD), acute arterial thrombosis and embolism, inflammatory vascular disorders, Raynaud's phenomenon, and venous disorders.
  • PAOD peripheral arterial occlusive disease
  • COPD chronic peripheral arterial occlusive disease
  • acute arterial thrombosis and embolism inflammatory vascular disorders
  • Raynaud's phenomenon and venous disorders.
  • COPD chronic obstructive pulmonary (or airways) disease
  • Emphysema is characterized by destruction of alveolar walls leading to abnormal enlargement ofthe air spaces of the lung.
  • Chronic bronchitis is defined clinically as the presence of chronic productive cough for three months in each of two successive years.
  • airflow obstruction is usually progressive and is only partially reversible.
  • the inflammatory cell population comprises increased numbers of macrophages, neutrophils, and CD8 + lymphocytes.
  • Inhaled irritants such as cigarette smoke, activate macrophages which are resident in the respiratory tract, as well as epithelial cells leading to release of chemokines (e.g., interleukin-8) and other chemotactic factors.
  • chemokines e.g., interleukin-8
  • chemotactic factors act to increase the neutro- phil/monocyte trafficking from the blood into the lung tissue and airways.
  • Neutrophils and monocytes recruited into the airways can release a variety of potentially damaging mediators such as proteolytic enzymes and reactive oxygen species.
  • GPCRs have been implicated in the pathology of COPD.
  • the chemokine IL-8 acts through CXCRl and CXCR2, and antagonists for these receptors are under investigation as therapeutics for COPD.
  • Members of the P2Y family of metabotropic receptors may play key roles in normal pulmonary function.
  • the P2Y 2 receptor is believed to be involved in the regulation of mucociliary clearance mechanisms in the lung, and agonists of this receptor may stimulate airway mucus clearance in patients with chronic bronchitis (Yerxa Johnson, Drugs of the Future 24, 759-769, 1999).
  • GPCRs therefore, are therapeutic targets for COPD, and the identification of additional members of existing GPCR families or of novel GPCRs would yield further attractive targets.
  • Cancer is a disease fundamentally caused by oncogenic cellular transformation. There are several hallmarks of transformed cells that distinguish them from their normal counte ⁇ arts and underlie the pathophysiology of cancer. These include uncontrolled cellular proliferation, unresponsiveness to normal death-inducing signals (immortalization), increased cellular motility and invasiveness, increased ability to recruit blood supply through induction of new blood vessel formation (angiogenesis), genetic instability, and dysregulated gene expression. Various combinations of these aberrant physiologies, along with the acquisition of drug-resistance frequently lead to an intractable disease state in which organ failure and patient death ultimately ensue.
  • Genes or gene fragments identified through genomics can readily be expressed in one or more heterologous expression systems to produce functional recombinant proteins. These proteins are characterized in vitro for their biochemical properties and then used as tools in high-throughput molecular screening programs to identify chemical modulators of their biochemical activities. Agonists and/or antagonists of target protein activity can be identified in this manner and subsequently tested in cellular and in vivo disease models for anti-cancer activity. Optimization of lead compounds with iterative testing in biological models and detailed pharmacokinetic and toxicological analyses form the basis for drug development and subsequent testing in humans.
  • allergens typically elicit a specific IgE response and, although in most cases the allergens themselves have little or no intrinsic toxicity, they induce pathology when the IgE response in turn elicits an IgE-dependent or T cell-dependent hypersensitivity reaction.
  • Hypersensitivity re- actions can be local or systemic and typically occur within minutes of allergen ex- posure in individuals who have previously been sensitized to an allergen.
  • the hypersensitivity reaction of allergy develops when the allergen is recognized by IgE antibodies bound to specific receptors on the surface of effector cells, such as mast cells, basophils, or eosinophils, which causes the activation of the effector cells and the release of mediators that produce the acute signs and symptoms of the reactions.
  • effector cells such as mast cells, basophils, or eosinophils
  • Allergic diseases include asthma, allergic rhinitis (hay fever), atopic dermatitis, and anaphylaxis.
  • Asthma is though to arise as a result of interactions between multiple genetic and en- vironmental factors and is characterized by three major features: 1) intermittent and reversible airway obstruction caused by bronchoconstriction, increased mucus production, and thickening ofthe walls ofthe airways that leads to a narrowing ofthe airways, 2) airway hyperresponsiveness caused by a decreased control of airway caliber, and 3) airway inflammation.
  • Certain cells are critical to the inflammatory reaction of asthma and they include T cells and antigen presenting cells, B cells that produce IgE, and mast cells, basophils, eosinophils, and other cells that bind IgE.
  • effector cells accumulate at the site of allergic reaction in the airways and release toxic products that contribute to the acute pathology and eventually to the tissue destruction related to the disorder.
  • Other resident cells such as smooth muscle cells, lung epithelial cells, mucus-producing cells, and nerve cells may also be abnormal in individuals with asthma and may contribute to the pathology. While the airway obstruction of asthma, presenting clinically as an intermittent wheeze and shortness of breath, is generally the most pressing symptom of the disease requiring immediate treatment, the inflammation and tissue destruction associated with the di- sease can lead to irreversible changes that eventually make asthma a chronic disabling disorder requiring long-term management.
  • Glycophorin A Cho and Sharom, Cell. Immunol. 145, 223-39, 1992
  • cyclosporin Alexander et al, Lancet 339, 324-28, 1992
  • a nonapeptide fragment of IL-2 Zav'yalov et al, Immunol. Lett. 31, 285-88, 1992
  • cyclosporin is used as a immuno- suppressant after organ transplantation.
  • G protein-coupled receptors are membrane proteins characterized by seven transmembrane spanning domains that mediate the actions of many extracellular signals. GPCRs .interact with heterotrimeric guanine nucleotide binding regulatory proteins (G proteins) that modulate a variety of second messenger systems or ionic conductances to effect physiological responses. Many of the mediators involved in airway smooth muscle contraction and in the chemoattraction of inflammatory cells exert their effects through GPCR binding. Among the mediators of smooth muscle contraction are leukotrienes, platelet-activating factor, endothelin-1, adenosine, and thromboxane A2.
  • chemokines such as eotaxin, MCP-4, RANTES, and IL-8.
  • Chemokine receptor antagonists similarly are being developed as treatments for asthma. Sarau et al, Mol Pharmacol. 56, 657-63, 1999; Kitaura et al, J. Biol. Chem. 271, 7725-30, 1996; Ligget et al, Am. J. Respir. Crit. Care Med. 152, 394-402, 1995; Panettieri et al, J. Immunol. 154, 2358-65, 1995; Noveral et al,
  • GPCRs may conversely have beneficial effects in asthma.
  • receptor agonists that activate the ⁇ l- and ⁇ 2-adrenergic GPCRs are used therapeutically to relax contracted airway smooth muscle in the treatment of asthma attacks.
  • regulation of GPCRs in either a positive or negative manner may play an important role in the treatment of asthma.
  • G- protein coupled receptors are involved in various hematopoietic processes, e.g. proliferation, differentiation, survival, migration and homing of precursor cells to hematopoietic and lymphoid tissues. Dysfunction of GPCRs may lead to inappropriate production of blood cells resulting in diseases like anemia, leukopenia, thrombocytopenia or different forms of leukemia.
  • GPCRs also play a role in diverse functions of circulating white blood cells, e.g. activation of immune response in lymphocytes, cytokine production by monocytes and chemotaxis of granulocytes. Dysregulated GPCR function may contribute to compromised immune function, allergy and other pathologic conditions of the host defense system.
  • GPCRs mediate activation resulting in platelet aggregation and secretion of mediators eventually leading to hemostasis.
  • Modulation of GPCR function in platelets by pharmacologic or molecular genetic methods has demonstrated key roles of GPCRs in thrombotic diseases and in bleeding disorders thus proving that GPCRs represent appropriate therapeutic drug targets.
  • GPCRs are activated by binding of various classes of ligands ranging from small molecules like serotonin to high molecular peptides like chemokines. Some GPCRs are activated by proteolytic cleavage, e.g. by thrombin. Upon ligand binding, signals from GPCRs are mediated via heterotrimeric G-proteins with the class of the ⁇ -sub- unit determining the further pathway signal transduction. It is conceivable that genes coding for locallynon-standard" GPCRs with unidentified ligands or unknown intracellular signal transduction pathways (e.g. novel G-proteins) or that GPCRs from classes as yet not associated with the hematopoietic and hemo- static systems will be identified.
  • GPCRs specifically expressed in hematopoietic precursor or circulating blood cells represent good targets for therapeutic interventions in dysfunctions of hematopoiesis and hemostasis. See Yang M., Srikaiatkhachom A, Antony M., Chong B.H.; Blood Coagul. Fibrinolysis 1996, 127-33; Arai H., Tsou C.L., Charo I.F.; Proc. Natl. Acad. Sci. USA 94, 14495-14499, 1997; Aragay A.M., Quick M.W.; J. Biol. Chem. 274, 4807-4815, 1999; Davignon I., Catalina M.D., Smith D., Montgomery J., Croy J.,
  • Urinary incontinence is the involuntary loss of urine.
  • Urge urinary incontinence is one of the most common types of UI together with stress urinary incontinence (SUI), which is usually caused by a defect in the urethral closure mechanism.
  • UUI is often associated with neurological disorders or diseases causing neuronal damage, such as dementia, Parkinson's disease, multiple sclerosis, stroke, and diabetes, although it also occurs in individuals with no such disorders.
  • One of the usual causes of UUI is overactive bladder (OAB), which is a medical condition referring to the symptoms of frequency and urgency derived from abnormal contractions and instability ofthe detrusor muscle.
  • OAB overactive bladder
  • OAB OAB
  • drugs that affect peripheral neural control mechanisms or those that act directly on bladder detrusor smooth muscle contraction with a major emphasis on development of anticholinergic agents.
  • These agents can inhibit the parasympathetic nerves, which control bladder voiding, or can exert a direct spasmolytic effect on the detrusor muscle of the bladder. This results in a decrease in intravesicular pressure, an increase in capacity, and a reduction in the frequency of bladder contraction.
  • Orally active anticholinergic drugs such as propantheline (ProBanthine), tolterodine tartrate (Detrol), and oxybutynin (Ditropan), are the most commonly prescribed drugs.
  • 5-HT has an effect on micturition through both central and peripheral mechanisms (Espey & Downie, Eur J Pharmacol 287: 173-177, 1995). Most of the well-characterized 5-HT receptors are G-protein coupled receptors (Raymond et al., Naunyn Schmiedebergs Arch Pharmacol 346: 127-137, 1992).
  • the 5-HT1 family consists of five receptors (5-HT1A, IB, ID, IE and IF) that share the property of inhibiting the enzyme adenylate cyclase when stimulated by serotonin. With the exception of the 5-HT1E receptor, which appears to be limited to the CNS, these receptors are found in both the CNS and the periphery.
  • 5-HT1A receptor selective antagonist WAY100635 The physiological role of 5-HT1A in the control of micturition was elucidated using 5-HT1A receptor selective antagonist WAY100635, which showed a marked block of isovolumetric bladder contraction in anesthetized rats and an increase of bladder capacity without consistently impairing bladder contractility in conscious rats (Lecci et al., J Pharmacol Exp Therap 262: 181-189, 1992.
  • Blockade of spinal 5-HT1A receptors by intrathecal administration of WAY 100635 inhibited the micturition reflex induced by bladder distension as well as bladder contractions elicited by electrical stimulation of the pontine micturition center, whereas it did not show any effect on the ascending pathway.
  • 5-HT1A receptor selective agonist 8-OH-DPAT facilitated the micturition reflex in normal rats and that intravenous administration of 8-OH-DPAT increased the amplitude of reflex-bladder contractions induced by bladder distension in chronically spinalized rats (Khan et al., World J Urol 17:255-260, 1999).
  • 5-HT 1 A receptors at the lumbosacral spinal cord level have an important role in tonic control of the micturition reflex pathway.
  • 5-HT1A antagonists may provide therapeutic benefit to treat overactive bladder and urge urinary incontinence.
  • the 5-HT2 family consists of three receptors (5-HT2A, 2B and 2C) that act through increasing intracellular phosphoinositide metabolism.
  • the 5-HT4 receptor is present in both the CNS and on various tissues of the periphery, where it is positively coupled to adenylate cyclase. There appears to be a negative coupling of the 5-HT5 receptor to adenylate cyclase.
  • the 5-HT6 and 5-HT7 receptors are both positively coupled to adenylate cyclase.
  • the 5-HT6 receptor is found only in the CNS, while 5- HT7 receptors are located in both central and peripheral tissues.
  • the only serotonin receptor that is a member of the ligand-gated ion channel superfamify is the 5-HT3 receptor. When stimulated by serotonin, this receptor conducts a depolarizing cation current into cells.
  • 5-HT3 or 5-HT4 receptors facilitates acetylchohne release (Testa et al, J Pharmacol Exp Ther 290: 1258-1269, 1999.
  • 5-HT receptors are upregulated in the bladder following obstruction (Kakizaki et al., Am J Physiol Regulatory
  • 5-HT3 or 5-HT4 antagonists may be beneficial in the treatment ofthe overactive bladder.
  • This invention further pertains to the use of novel agents identified by the screening assays described above. Accordingly, it is within the scope of this invention to use a test compound identified as described herein in an appropriate animal model.
  • an agent identified as described herein e.g., a modulating agent, an antisense nucleic acid molecule, a specific antibody, ribozyme, or a 5-HT-like GPCR polypeptide binding molecule
  • an agent identified as described herein can be used in an animal model to determine the efficacy, toxicity, or side effects of treatment with such an agent.
  • an agent identified as described herein can be used in an animal model to determine the mechanism of action of such an agent.
  • this invention pertains to uses of novel agents identified by the above-described screening assays for treatments as described herein.
  • a reagent which affects 5-HT-like GPCR activity can be administered to a human cell, either in vitro or in vivo, to reduce 5-HT-like GPCR activity.
  • the reagent preferably binds to an expression product of a human 5-HT-like GPCR gene. If the expression product is a protein, the reagent is preferably an antibody.
  • an antibody can be added to a preparation of stem cells which have been removed from the body. The cells can then be replaced in the same or another human body, with or without clonal propagation, as is known in the art.
  • the reagent is delivered using a liposome.
  • the lipo- some is stable in the animal into which it has been administered for at least about 30 minutes, more preferably for at least about 1 hour, and even more preferably for at least about 24 hours.
  • a liposome comprises a lipid composition that is capable of targeting a reagent, particularly a polynucleotide, to a particular site in an animal, such as a human.
  • the lipid composition of the liposome is capable of targeting to a specific organ of an animal, such as the lung, liver, spleen, heart brain, lymph nodes, and skin.
  • a liposome useful in the present invention comprises a lipid composition that is capable of fusing with the plasma membrane of the targeted cell to deliver its contents to the cell.
  • the transfection efficiency of a liposome is about
  • a liposome is between about 100 and 500 nm, more preferably between about 150 and 450 nm, and even more preferably between about 200 and 400 nm in diameter.
  • Suitable liposomes for use in the present invention include those liposomes standardly used in, for example, gene delivery methods known to those of skill in the art. More preferred liposomes include liposomes having a polycationic lipid composition and/or liposomes having a cholesterol backbone conjugated to polyethylene glycol.
  • a liposome comprises a compound capable of targeting the liposome to a tumor cell, such as a tumor cell ligand exposed on the outer surface of the liposome. Complexing a liposome with a reagent such as an antisense oligonucleotide or ribozyme can be achieved using methods which are standard in the art (see, for example, U.S. Patent 5,705,151).
  • polynucleotide is combined with about 8 nmol of liposomes, more preferably from about 0.5 ⁇ g to about 5 ⁇ g of polynucleotides are combined with about 8 nmol liposomes, and even more preferably about 1.0 ⁇ g of polynucleotides is combined with about 8 nmol liposomes.
  • antibodies can be delivered to specific tissues in vivo using receptor-mediated targeted delivery.
  • Receptor-mediated DNA delivery techniques are taught in, for example, Findeis et al. Trends in Biotechnol. 11, 202-05 (1993);
  • a therapeutically effective dose refers to that amount of active ingredient which increases or decreases 5-HT-like GPCR activity relative to the 5-HT-like GPCR activity which occurs in the absence of the therapeutically effective dose.
  • the therapeutically effective dose can be estimated initially either in cell culture assays or in animal models, usually mice, rabbits, dogs, or pigs.
  • the animal model also can be used to determine the appropriate concentration range and route of administration. Such information can then be used to determine useful doses and routes for administration in humans.
  • Therapeutic efficacy and toxicity e.g., ED 50 (the dose therapeutically effective in 50% of the population) and LD 50 (the dose lethal to 50% of the population), can be determined by standard pharmaceutical procedures in cell cultures or experimental animals.
  • the dose ratio of toxic to therapeutic effects is the therapeutic index, and it can be expressed as the ratio, LD 50 /ED 50 .
  • compositions which exhibit large therapeutic indices are preferred.
  • the data obtained from cell culture assays and animal studies is used in formulating a range of dosage for human use.
  • the dosage contained in such compositions is preferably within a range of circulating concentrations that include the ED 50 with little or no toxicity.
  • the dosage varies within this range depending upon the dosage form employed, sensitivity ofthe patient, and the route of administration.
  • the exact dosage will be determined by the practitioner, in light of factors related to the subject that requires treatment. Dosage and administration are adjusted to provide sufficient levels of the active ingredient or to maintain the desired effect. Factors which can be taken into account include the severity of the disease state, general health of the subject, age, weight, and gender of the subject, diet, time and frequency of administration, drug combination(s), reaction sensitivities, and tolerance/response to therapy. Long-acting pharmaceutical compositions can be administered every 3 to 4 days, every week, or once every two weeks depending on the half-life and clearance rate ofthe particular formulation.
  • Normal dosage amounts can vary from 0.1 to 100,000 micrograms, up to a total dose of about 1 g, depending upon the route of administration.
  • Guidance as to particular dosages and methods of delivery is provided in the literature and generally available to practitioners in the art. Those skilled in the art will employ different formulations for nucleotides than for proteins or their inhibitors. Similarly, delivery of polynucleotides or polypeptides will be specific to particular cells, conditions, locations, etc.
  • polynucleotides encoding the antibody can be constructed and introduced into a cell either ex vivo or in vivo using well- established techniques including, but not limited to, transferrin-polycation-mediated DNA transfer, transfection with naked or encapsulated nucleic acids, liposome- mediated cellular fusion, intracellular transportation of DNA-coated latex beads, protoplast fusion, viral infection, electroporation, "gene gun,” and DEAE- or calcium phosphate-mediated transfection.
  • Effective in vivo dosages of an antibody are in the range of about 5 ⁇ g to about
  • effective in vivo dosages are in the range of about 100 ng to about 200 ng, 500 ng to about 50 mg, about 1 ⁇ g to about 2 mg, about 5 ⁇ g to about 500 ⁇ g, and about 20 ⁇ g to about
  • the reagent is preferably an antisense oligonucleotide or a ribozyme.
  • Polynucleotides which express antisense oligonucleotides or ribozymes can be introduced into cells by a variety of methods, as described above.
  • a reagent reduces expression of a 5-HT-like GPCR gene or the activity of a 5-HT-like GPCR polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% relative to the absence of the reagent.
  • the effectiveness of the mechanism chosen to decrease the level of expression of a 5-HT- like GPCR gene or the activity of a 5-HT-like GPCR polypeptide can be assessed using methods well known in the art, such as hybridization of nucleotide probes to 5- HT-like GPCR-specific mRNA, quantitative RT-PCR, immunologic detection of a 5- HT-like GPCR polypeptide, or measurement of 5 -HT-like GPCR activity.
  • any of the pharmaceutical compositions of the invention can be administered in combination with other appropriate therapeutic agents.
  • Selection ofthe appropriate agents for use in combination therapy can be made by one of ordinary skill in the art, according to conventional pharmaceutical principles.
  • the combination of therapeutic agents can act synergistically to effect the treatment or prevention of the various disorders described above. Using this approach, one may be able to achieve therapeutic efficacy with lower dosages of each agent, thus reducing the potential for adverse side effects.
  • any of the therapeutic methods described above can be applied to any subject in need of such therapy, including, for example, mammals such as dogs, cats, cows, horses, rabbits, monkeys, and most preferably, humans.
  • GPCRs also can be used in diagnostic assays for detecting diseases and abnormalities or susceptibility to diseases and abnormalities related to the presence of mutations in the nucleic acid sequences which encode a GPCR.
  • diseases by way of ex- ample, are related to cell transformation, such as tumors and cancers, and various cardiovascular disorders, including hypertension and hypotension, as well as diseases arising from abnormal blood flow, abnormal angiotensin-induced aldosterone secretion, and other abnormal control of fluid and electrolyte homeostasis.
  • Differences can be determined between the cDNA or genomic sequence encoding a
  • GPCR in individuals afflicted with a disease and in normal individuals. If a mutation is observed in some or all of the afflicted individuals but not in normal individuals, then the mutation is likely to be the causative agent ofthe disease. Sequence differences between a reference gene and a gene having mutations can be revealed by the direct DNA sequencing method. In addition, cloned DNA segments can be employed as probes to detect specific DNA segments. The sensitivity of this method is greatly enhanced when combined with PCR. For example, a sequencing primer can be used with a double-stranded PCR product or a single-stranded template molecule generated by a modified PCR. The sequence determination is performed by conventional procedures using radiolabeled nucleotides or by automatic sequencing procedures using fluorescent tags.
  • DNA sequence differences can be carried out by detection of alteration in electrophoretic mobility of DNA fragments in gels with or without denaturing agents. Small sequence deletions and insertions can be visualized, for example, by high resolution gel electrophoresis. DNA fragments of different sequences can be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific melting or partial melting temperatures (see, e.g., Myers et al, Science 230, 1242, 1985). Sequence changes at specific locations can also be revealed by nuclease protection assays, such as RNase and S 1 protection or the chemical cleavage method (e.g., Cotton et al, Proc. Natl.
  • the detection of a specific DNA sequence can be performed by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes and Southern blotting of genomic DNA.
  • direct methods such as gel-electrophoresis and DNA sequencing, mutations can also be detected by in situ analysis.
  • Altered levels of a GPCR also can be detected in various tissues.
  • Assays used to detect levels of the receptor polypeptides in a body sample, such as blood or a tissue biopsy, derived from a host are well known to those of skill in the art and include radioimmunoassays, competitive binding assays, Western blot analysis, and ELISA assays. All patents and patent applications cited in this disclosure are expressly inco ⁇ orated herein by reference. The above disclosure generally describes the present invention. A more complete understanding can be obtained by reference to the following specific examples which are provided for pu ⁇ oses of illustration only and are not intended to limit the scope ofthe invention.
  • the polynucleotide of SEQ ID NO: 1 is inserted into the expression vector pCEV4 and the expression vector pCEV4-5-HT-GPCR polypeptide obtained is transfected into human embryonic kidney 293 cells.
  • the cells are scraped from a culture flask into 5 ml of Tris HCI, 5 mM EDTA, pH 7.5, and lysed by sonication. Cell lysates are centrifuged at 1000 ⁇ m for 5 minutes at 4 °C. The supernatant is centrifuged at 30,000 x g for 20 minutes at 4 °C.
  • the pellet is suspended in binding buffer containing 50 mM Tris HCI, 5 mM MgSO 4 , 1 mM EDTA, 100 mM NaCl, pH 7.5, supplemented with 0.1 % BSA, 2 ⁇ g/ml aprotinin, 0.5 mg/ml leupeptin, and 10 ⁇ g/ml phosphoramidon.
  • Optimal membrane suspension dilutions defined as the protein concentration required to bind less than 10 % of an added radioligand, i.e. 125 I-labeled serotonin, are added to 96-well polypropylene microtiter plates containing ligand, non-labeled peptides, and binding buffer to a final volume of 250 ⁇ l.
  • membrane preparations are incubated in the presence of increasing concentrations (0.1 nM to 4 nM) of 125 I ligand.
  • Binding reaction mixtures are incubated for one hour at 30 °C. The reaction is stopped by filtration through GF/B filters treated with 0.5% polyethyleneimine, using a cell harvester. Radioactivity is measured by scintillation counting, and data are analyzed by a computerized non-linear regression program. Non-specific binding is defined as the amount of radioactivity remaining after incubation of membrane protein in the presence of 100 nM of unlabeled peptide. Protein concentration is measured by the Bradford method using Bio-Rad Reagent, with bovine serum albumin as a standard. The 5-HT-GPCR activity of the polypeptide comprising the amino acid sequence of SEQ ID NO: 2 is demonstrated. EXAMPLE 2
  • HCI HCI, 5 mM EDTA, pH 7.5, and lysed by sonication.
  • Cell lysates are centrifuged at 1000 ⁇ m for 5 minutes at 4 °C.
  • the supernatant is centrifuged at 30,000 x g for 20 minutes at 4 °C.
  • the pellet is suspended in binding buffer containing 50 mM Tris HCI, 5 mM MgSO 4 , 1 mM EDTA, 100 mM NaCl, pH 7.5, supplemented with 0.1 % BSA, 2 ⁇ g /ml aprotinin, 0.5 mg/ml leupeptin, and 10 ⁇ g /ml phosphoramidon.
  • Optimal membrane suspension dilutions defined as the protein concentration required to bind less than 10 % of the added radioligand, are added to 96-well polypropylene microtiter plates containing 12 T-labeled ligand or test compound, non- labeled peptides, and binding buffer to a final volume of 250 ⁇ l.
  • Binding reaction mixtures are incubated for one hour at 30 °C.
  • the reaction is stopped by filtration through GF/B filters treated with 0.5% polyethyleneimine, using a cell harvester. Radioactivity is measured by scintillation counting, and data are analyzed by a computerized non-linear regression program.
  • Non-specific binding is defined as the amount of radioactivity remaining after incubation of membrane protein in the presence of 100 nM of unlabeled peptide.
  • test compound which increases the radioactivity of membrane protein by at least 15% relative to radioactivity of membrane protein which was not incubated with a test compound is identified as a compound which binds to a human 5-HT-like GPCR polypeptide.
  • Receptor-mediated inhibition of cAMP formation can be assayed in host cells which express human 5-HT-like GPCR. Cells are plated in 96-well plates and incubated in
  • a test compound is added and incubated for an additional 10 minutes at 37 °C.
  • the medium is aspirated, and the reaction is stopped by the addition of 100 mM HCI.
  • the plates are stored at 4 °C for 15 minutes.
  • cAMP content in the stopping solution is measured by radioimmunoassay.
  • Radioactivity is quantified using a gamma counter equipped with data reduction software.
  • a test compound which decreases radioactivity of the contents of a well relative to radioactivity of the contents of a well in the absence of the test compound is identified as a potential inhibitor of cAMP formation.
  • a test compound which increases radioactivity of the contents of a well relative to radioactivity of the contents of a well in the absence of the test compound is identified as a potential enhancer of cAMP formation.
  • Intracellular free calcium concentration can be measured by microspectrofluorometry using the fluorescent indicator dye Fura-2/AM (Bush et al, J. Neurochem. 57, 562- 74, 1991).
  • Stably transfected cells are seeded onto a 35 mm culture dish containing a glass coverslip insert. Cells are washed with HBS , incubated with a test compound, and loaded with 100 ⁇ l of Fura-2/AM (10 ⁇ M) for 20-40 minutes. After washing with HBS to remove the Fura-2/AM solution, cells are equilibrated in HBS for 10-20 minutes. Cells are then visualized under the 40X objective of a Leitz Fluovert FS microscope.
  • Fluorescence emission is determined at 510 nM, with excitation wavelengths alternating between 340 nM and 380 nM.
  • Raw fluorescence data are converted to calcium concentrations using standard calcium concentration curves and software analysis techniques.
  • a test compound which increases the fluorescence by at least 15% relative to fluorescence in the absence of a test compound is identified as a compound which mobilizes intracellular calcium.
  • Cells which stably express human 5-HT-like GPCR cDNA are plated in 96-well plates and grown to confluence. The day before the assay, the growth medium is changed to 100 ⁇ l of medium containing 1% serum and 0.5 ⁇ Ci 3 H-myinositol. The plates are incubated overnight in a CO 2 incubator (5%> CO 2 at 37 °C). Immediately before the assay, the medium is removed and replaced by 200 ⁇ l of PBS containing 10 mM LiCl, and the cells are equilibrated with the new medium for 20 minutes. During this interval, cells also are equilibrated with antagonist, added as a 10 ⁇ l aliquot of a 20-fold concentrated solution in PBS.
  • the 3 H-inositol phosphate accumulation from inositol phospholipid metabolism is started by adding 10 ⁇ l of a solution containing a test compound. To the first well 10 ⁇ l are added to measure basal accumulation. Eleven different concentrations of test compound are assayed in the following 11 wells of each plate row. All assays are performed in duplicate by repeating the same additions in two consecutive plate rows.
  • the plates are incubated in a CO 2 incubator for one hour. The reaction is terminated by adding 15 ⁇ l of 50% v/v trichloroacetic acid (TCA), followed by a 40 minute incubation at 4 °C. After neutralizing TCA with 40 ⁇ l of 1 M Tris, the content of the wells is transferred to a Multiscreen HV filter plate (Millipore) containing Dowex AG1-X8 (200-400 mesh, formate form). The filter plates are prepared by adding 200 ⁇ l of Dowex AG1-X8 suspension (50% v/v, wate ⁇ resin) to each well. The filter plates are placed on a vacuum manifold to wash or elute the resin bed. Each well is washed 2 times with 200 ⁇ l of water, followed by 2 x 200 ⁇ l of 5 mM sodium tetraborate/60 mM ammonium formate.
  • TCA 50% v/v trichloroacetic acid
  • the 3 H-IPs are eluted into empty 96-well plates with 200 ⁇ l of 1.2 M ammonium formate/0.1 formic acid.
  • the content of the wells is added to 3 ml of scintillation cocktail, and radioactivity is determined by liquid scintillation counting.
  • Binding assays are carried out in a binding buffer containing 50 mM HEPES, pH 7.4, 0.5% BSA, and 5 mM MgCl 2 .
  • the standard assay for radioligand binding to membrane fragments comprising 5-HT-like GPCR polypeptides is carried out as follows in 96 well microtiter plates (e.g., Dynatech Immulon II Removawell plates). Radioligand is diluted in binding buffer+
  • Binding is initiated by adding 150 ⁇ l per well of membrane diluted to the desired concentration (10-30 ⁇ g membrane protein/well) in binding buffer)- PMSF/Baci. Plates are then covered with Linbro mylar plate sealers (Flow Labs) and placed on a Dynatech Microshaker II. Binding is allowed to proceed at room temperature for 1-2 hours and is stopped by centrifuging the plate for 15 minutes at 2,000 x g.
  • the supematants are decanted, and the membrane pellets are washed once by addition of 200 ⁇ l of ice cold binding buffer, brief shaking, and recentrifugation.
  • the individual wells are placed in 12 x 75 mm tubes and counted in an LKB Gammamaster counter
  • binding assays to obtain membrane pellets for studies on solubilization of receptor igand complex and for receptor purification are also carried out. These are identical to the standard assays except that (a) binding is carried out in polypropylene tubes in volumes from 1-250 ml, (b) concentration of membrane protein is always 0.5 mg/ml, and (c) for receptor purification, BSA concentration in the binding buffer is reduced to 0.25%, and the wash step is done with binding buffer without BSA, which reduces BSA contamination of the purified receptor.
  • membrane pellets are re- suspended in 200 ⁇ l per microtiter plate well of ice-cold binding buffer without BSA. Then 5 ⁇ l per well of 4 mM N-5-azido-2-nitrobenzoyloxysuccinimide (ANB-NOS, Pierce) in DMSO is added and mixed. The samples are held on ice and
  • Radiolabeled proteins are visualized by autoradiography ofthe dried gels with Kodak XAR film and Dupont image intensifier screens.
  • Membrane solubilization is carried out in buffer containing 25 mM Tris , pH 8, 10%> glycerol (w/v) and 0.2 mM CaCl 2 (solubilization buffer).
  • the highly soluble detergents including Triton X-100, deoxycholate, deoxycholatedysolecithin, CHAPS, and zwittergent are made up in solubilization buffer at 10%) concentrations and stored as frozen aliquots. Lysolecithin is made up fresh because of insolubility upon freeze-thawing and digitonin is made fresh at lower concentrations due to its more limited solubility.
  • washed pellets after the binding step are resuspended free of visible particles by pipetting and vortexing in solubilization buffer at 100,000 x g for 30 minutes.
  • solubilization buffer at 100,000 x g for 30 minutes.
  • the supematants are removed and held on ice and the pellets are discarded.
  • the intact R:L complex can be assayed by four different methods. All are carried out on ice or in a cold room at 4-10 °C).
  • the samples are rapidly (1-3 seconds) filtered over Whatman GF/B glass fiber filters and washed with 4 ml ofthe phosphate buffer.
  • PEG-precipitated receptor : 125 1-ligand complex is determined by gamma counting ofthe filters.
  • Receptor 125 I-ligand complexes remain in the supernatant and are determined by gamma counting.
  • Binding of biotinyl -receptor to GH 4 Cl membranes is carried out as described above. Incubations are for 1 hour at room temperature. In the standard purification protocol, the binding incubations contain 10 nM Bio-S29. 125 I ligand is added as a tracer at levels of 5,000-100,000 cpm per mg of membrane protein. Control incubations contain 10 ⁇ M cold ligand to saturate the receptor with non-biotinylated ligand.
  • Solubilization of recepto ⁇ ligand complex also is carried out as described above, with 0.15% deoxycholate:lysolecithin in solubilization buffer containing 0.2 mM MgCl 2 , to obtain 100,000 x g supematants containing solubilized R:L complex.
  • Immobilized streptavidin (streptavidin cross-linked to 6% beaded agarose, Pierce Chemical Co.; "SA-agarose”) is washed in solubilization buffer and added to the solubilized membranes as 1/30 of the final volume. This mixture is incubated with constant stirring by end-over-end rotation for 4-5 hours at 4-10 °C. Then the mixture is applied to a column and the non-bound material is washed through. Binding of radioligand to SA-agarose is determined by comparing cpm in the 100,000 x g supernatant with that in the column effluent after adso ⁇ tion to SA-agarose. Finally, the column is washed with 12-15 column volumes of solubilization buffer+0.15% deoxycholate:lysolecithin +1/500 (vol/vol) 100 x 4pase.
  • the streptavidin column is eluted with solubilization buffer+0.1 mM EDTA+0.1 mM EGTA+0.1 mM GTP-gamma-S (Sigma)+0.15% (wt/vol) deoxycholate ysolecithin +1/1000 (vol/vol) 100.times.4pase.
  • solubilization buffer +0.1 mM EDTA+0.1 mM EGTA+0.1 mM GTP-gamma-S (Sigma)+0.15% (wt/vol) deoxycholate ysolecithin +1/1000 (vol/vol) 100.times.4pase.
  • Eluates from the streptavidin column are incubated overnight (12-15 hours) with im- mobilized wheat germ agglutinin (WGA agarose, Vector Labs) to adsorb the receptor via interaction of covalently bound carbohydrate with the WGA lectin.
  • the ratio (vol/vol) of WGA-agarose to streptavidin column eluate is generally 1 :400. A range from 1 :1000 to 1 :200 also can be used.
  • the resin is pelleted by centrifugation, the supernatant is removed and saved, and the resin is washed 3 times (about 2 minutes each) in buffer containing 50 mM HEPES, pH 8, 5 mM MgCl 2 and 0.15% deoxycholate:lysolecithin.
  • buffer containing 50 mM HEPES, pH 8, 5 mM MgCl 2 and 0.15% deoxycholate:lysolecithin To elute the WGA-bound receptor, the resin is extracted three times by repeated mixing (vortex mixer on low speed) over a 15-30 minute period on ice, with 3 resin columns each time, of 10 mM N-N'-N"-triacetylchitotriose in the same HEPES buffer used to wash the resin.
  • the resin After each elution step, the resin is centrifuged down and the supernatant is carefully removed, free of WGA-agarose pellets.
  • the three, pooled eluates contain the final, purified receptor.
  • the material non-bound to WGA contain G protein subunits specifically eluted from the streptavidin column, as well as non-specific contaminants. All these fractions are stored frozen at -90 °C.
  • 5-HT-like GPCR polypeptides comprising a glutathione-S-transferase protein and absorbed onto glutathione-derivatized wells of 96-well microtiter plates are contacted with test compounds from a small molecule library at pH 7.0 in a physiological buffer solution.
  • 5-HT-like GPCR polypeptides comprise an amino acid sequence shown in SEQ ID NO:2.
  • the test compounds comprise a fluorescent tag.
  • the samples are incubated for 5 minutes to one hour. Control samples are incu- bated in the absence of a test compound.
  • the buffer solution containing the test compounds is washed from the wells. Binding of a test compound to a 5-HT-like GPCR polypeptide is detected by fluorescence measurements of the contents of the wells. A test compound which increases the fluorescence in a well by at least 15% relative to fluorescence of a well in which a test compound is not incubated is identified as a compound which binds to a 5-HT-like GPCR polypeptide.
  • test compound is administered to a culture of human gastric cells and incubated at 37 °C for 10 to 45 minutes.
  • a culture of the same type of cells incubated for the same time without the test compound provides a negative control.
  • RNA is isolated from the two cultures as described in Chirgwin et al, Biochem. 18, 5294-99, 1979).
  • Northern blots are prepared using 20 to 30 ⁇ g total RNA and hybridized with a 32 P-labeled 5-HT-like GPCR-specific probe at 65 ° C in Express- hyb (CLONTECH).
  • the probe comprises at least 11 contiguous nucleotides selected from the complement of SEQ ID NO: 1.
  • a test compound which decreases the 5-HT- like GPCR-specific signal relative to the signal obtained in the absence of the test compound is identified as an inhibitor of 5-HT-like GPCR gene expression.
  • the Pichia pastoris expression vector pPICZB (Invitrogen, San Diego, CA) is used to produce large quantities of recombinant human 5-HT-like GPCR polypeptides in yeast.
  • the 5-HT-like GPCR-encoding DNA sequence is derived from SEQ ID NO:l.
  • the DNA sequence is modified by well known methods in such a way that it contains at its 5 '-end an initiation codon and at its
  • the yeast is cultivated under usual conditions in 5 liter shake flasks and the recombinantly produced protein isolated from the culture by affinity chromatography (Ni-NTA-Resin) in the presence of 8 M urea.
  • the bound polypeptide is eluted with buffer, pH 3.5, and neutralized. Separation of the polypeptide from the His6 reporter tag is accomplished by site-specific proteolysis using enterokinase (Invitrogen, San Diego, CA) according to manufacturer's instructions. Purified human 5-HT-like GPCR polypeptide is obtained.
  • RT-PCR Reverse Transcription-Polymerase Chain Reaction
  • fetal and adult brain muscle, heart, lung, kidney, liver, thymus, testis, colon, placenta, trachea, pancreas, kidney, gastric mucosa, colon, liver, cerebellum, skin, cortex (Alzheimer's and normal), hypothalamus, cortex, amygdala, cerebellum, hippocampus, choroid, plexus, thalamus, and spinal cord.
  • adipose tissue subcutaneous adipose tissue, mesenteric adipose tissue, adrenal gland, bone marrow, brain (cerebellum, spinal cord, cerebral cortex, caudate, medulla, substantia nigra, and putamen), colon, fetal brain, heart, kidney, liver, lung, mammary gland, pancreas, placenta, prostate, salivary gland, skeletal muscle small intestine, spleen, stomach, testes, thymus, thyroid trachea, and uterus.
  • the initial expression panel consists of RNA samples from respiratory tissues and inflammatory cells relevant to COPD: lung (adult and fetal), trachea, freshly isolated alveolar type II cells, cultured human bronchial epithelial cells, cultured small airway epithelial cells, cultured bronchial sooth muscle cells, cultured H441 cells (Claralike), freshly isolated neutrophils and monocytes, and cultured m ⁇ nocytes (macro- phage-like).
  • Body map profiling also is carried out, using total RNA panels purchased from Clontech.
  • the tissues are adrenal gland, bone marrow, brain, colon, heart, kidney, liver, lung, mammary gland, pancreas, prostate, salivary gland, skeletal muscle, small intestine, spleen, stomach, testis, thymus, trachea, thyroid, and uterus.
  • 5-HT-like GPCR is involved in cancer
  • expression is determined in the following tissues: adrenal gland, bone marrow, brain, cerebellum, colon, fetal brain, fetal liver, heart, kidney, liver, lung, mammary gland, pancreas, placenta, prostate, salivary gland, skeletal muscle, small intestine, spinal cord, spleen, stomach, testis, thymus, thyroid, trachea, utems, and peripheral blood lymphocytes.
  • Expression in the following cancer cell lines also is determined: DU-145 (prostate), NCI-H125 (lung), HT-29 (colon), COLO-205 (colon), A-549 (lung), NCI-H460 (lung), HT-116 (colon), DLD-1 (colon), MDA-MD-231 (breast), LS174T (colon), ZF-75 (breast), MDA-MN-435 (breast), HT-1080, MCF-7 (breast), and U87.
  • 5-HT-like GPCR is involved in the disease process of diabetes
  • the following whole body panel is screened to show predominant or relatively high expression: subcutaneous and mesenteric adipose tissue, adrenal gland, bone marrow, brain, colon, fetal brain, heart, hypothalamus, kidney, liver, lung, mammary gland, pancreas, placenta, prostate, salivary gland, skeletal muscle, small intestine, spleen, stomach, testis, thymus, thyroid, trachea, and uterus.
  • Human islet cells and an islet cell library also are tested.
  • the expression of 5-HT-like GPCR in cells derived from normal individuals with the expression of cells derived from diabetic individuals is compared.
  • the following whole body panel is screened to show predominant or relatively high expression in lung or immune tissues: brain, heart, kidney, liver, lung, trachea, bone marrow, colon, small intestine, spleen, stomach, thymus, mammary gland, skeletal muscle, prostate, testis, uterus, cerebellum, fetal brain, fetal liver, spinal cord, placenta, adrenal gland, pancreas, salivary gland, thyroid, peripheral blood leukocytes, lymph node, and tonsil.
  • lung or immune tissues brain, heart, kidney, liver, lung, trachea, bone marrow, colon, small intestine, spleen, stomach, thymus, mammary gland, skeletal muscle, prostate, testis, uterus, cerebellum, fetal brain, fetal liver, spinal cord, placenta, adrenal gland, pancreas, salivary gland, thyroid, peripheral blood leukocytes, lymph node, and tonsil.
  • lung and immune system cells are screened to localize expression to particular cell subsets: lung microvascular endothelial cells, bronchial/tracheal epithelial cells, bronchial/tracheal smooth muscle cells, lung fibroblasts, T cells (T helper 1 subset, T helper 2 subset, NKT cell subset, and cytotoxic T lymphocytes), B cells, mono- nuclear cells (monocytes and macrophages), mast cells, eosinophils, neutrophils, and dendritic cells.
  • T cells T helper 1 subset, T helper 2 subset, NKT cell subset, and cytotoxic T lymphocytes
  • B cells mono- nuclear cells (monocytes and macrophages)
  • mast cells eosinophils, neutrophils, and dendritic cells.
  • Quantitative expression profiling is performed by the form of quantitative PCR analysis called "kinetic analysis" firstly described in
  • the exponential growth phase of PCR product can be detected and used to determine the initial template concentration (Heid et al, Genome Res. 6, 986-94, 1996, and Gibson et al, Genome Res. (5, 995-1001, 1996).
  • the amplification of an endogenous control can be performed to standardize the amount of sample RNA added to a reaction.
  • the control of choice is the 18S ribosomal RNA. Because reporter dyes with differing emission spectra are available, the target and the endogenous control can be independently quantified in the same tube if probes labeled with different dyes are used.
  • RNA extraction and cDNA preparation Total RNA from the tissues listed above are used for expression quantification. RNAs labeled “from autopsy” are extracted from autoptic tissues with the TRIzol reagent (Life Technologies, MD) according to the manufacturer's protocol.
  • RNA Fifty ⁇ g of each RNA are treated with DNase I for 1 hour at 37°C in the following reaction mix: 0.2 U/ ⁇ l RNase-free DNase I (Roche Diagnostics, Germany); 0.4 U/ ⁇ l
  • RNase inhibitor PE Applied Biosystems, CA
  • RNA is extracted once with 1 volume of phenol:chloroform:isoamyl alcohol (24:24:1) and once with chloroform, and precipitated with 1/10 volume of 3 M sodium acetate, pH5.2, and 2 volumes of ethanol.
  • RNA from the autoptic tissues Fifty ⁇ g of each RNA from the autoptic tissues are DNase treated with the DNA-free kit purchased from Ambion (Ambion, TX). After resuspension and spectrophoto- metric quantification, each sample is reverse transcribed with the TaqMan Reverse Transcription Reagents (PE Applied Biosystems, CA) according to the manufacturer's protocol. The final concentration of RNA in the reaction mix is 200ng/ ⁇ L. Reverse transcription is carried out with 2.5 ⁇ M of random hexamer primers.
  • Total cDNA content is normalized with the simultaneous quantification (multiplex PCR) of the 18S ribosomal RNA using the Pre-Developed TaqMan Assay Reagents (PDAR) Control Kit (PE Applied Biosystems, CA).
  • PDAR Pre-Developed TaqMan Assay Reagents
  • the assay reaction mix is as follows: IX final TaqMan Universal PCR Master Mix (from 2X stock) (PE Applied Biosystems, CA); IX PDAR control - 18S RNA (from 20X stock); 300 nM forward primer; 900 nM reverse primer; 200 nM probe; 10 ng cDNA; and water to 25 ml.
  • Acute pain is measured on a hot plate mainly in rats.
  • Two variants of hot plate testing are used: In the classical variant animals are put on a hot surface (52 to 56 °C) and the latency time is measured until the animals show nocifensive behavior, such as stepping or foot licking.
  • the other variant is an increasing temperature hot plate where the experimental animals are put on a surface of neutral temperature. Subsequently this surface is slowly but constantly heated until the animals begin to lick a hind paw. The temperature which is reached when hind paw licking begins is a measure for pain threshold.
  • Compounds are tested against a vehicle treated control group. Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t, i.c.v., s.c, intradermal, transdermal) prior to pain testing.
  • application routes i.v., i.p., p.o., i.t, i.c.v., s.c, intradermal, transdermal
  • Persistent pain is measured with the formalin or capsaicin test, mainly in rats.
  • a solution of 1 to 5% formalin or 10 to 100 ⁇ g capsaicin is injected into one hind paw ofthe experimental animal.
  • the animals show nocifensive reactions like flinching, licking and biting of the affected paw.
  • the number of nocifensive reactions within a time frame of up to 90 minutes is a measure for intensity of pain.
  • Compounds are tested against a vehicle treated control group. Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t, i.c.v., s.c, intradermal, transdermal) prior to formalin or capsaicin administration.
  • application routes i.v., i.p., p.o., i.t, i.c.v., s.c, intradermal, transdermal
  • Neuropathic pain is induced by different variants of unilateral sciatic nerve injury mainly in rats.
  • the operation is performed under anesthesia.
  • the first variant of sciatic nerve injury is produced by placing loosely constrictive ligatures around the common sciatic nerve.
  • the second variant is the tight ligation of about the half of the diameter ofthe common sciatic nerve.
  • a group of models is used in which tight ligations or transections are made of either the L5 and L6 spinal nerves, or the L% spinal nerve only.
  • the fourth variant involves an axotomy of two of the three terminal branches of the sciatic nerve (tibial and common peroneal nerves) leaving the remaining sural nerve intact whereas the last variant comprises the axotomy of only the tibial branch leaving the sural and common nerves uninjured. Control animals are treated with a sham operation.
  • the nerve injured animals develop a chronic mechanical allodynia, cold allodynioa, as well as a thermal hyperalgesia.
  • Mechanical allodynia is measured by means of a pressure transducer (electronic von Frey Anesthesiometer, IITC
  • Thermal hyperalgesia is measured by means of a radiant heat source (Plantar Test, Ugo Basile, Comerio, Italy), or by means of a cold plate of 5 to 10 °C where the nocifensive reactions of the affected hind paw are counted as a measure of pain intensity.
  • a further test for cold induced pain is the counting of nocifensive reactions, or duration of nocifensive responses after plantar administration of acetone to the affected hind limb.
  • Chronic pain in general is assessed by registering the circadian rhythms in activity (Surjo and Arndt, Universitat zu K ⁇ ln, Cologne, Germany), and by scoring differences in gait (foot print patterns; FOOTPRINTS program, Klapdor et al., 1997. A low cost method to analyze footprint patterns. J. Neurosci. Methods 75, 49-54).
  • Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t, i.c.v., s.c, intradermal, transdermal) prior to pain testing.
  • application routes i.v., i.p., p.o., i.t, i.c.v., s.c, intradermal, transdermal
  • Inflammatory pain is induced mainly in rats by injection of 0.75 mg carrageenan or complete Freund's adjuvant into one hind paw.
  • the animals develop an edema with mechanical allodynia as well as thermal hyperalgesia.
  • Mechanical allodynia is measured by means of a pressure transducer (electronic von Frey Anesthesiometer, IITC Inc. -Life Science Instruments, Woodland Hills, SA, USA).
  • Thermal hyperalgesia is measured by means of a radiant heat source (Plantar Test, Ugo Basile, Comerio, Italy, Paw thermal stimulator, G. Ozaki, University of California, USA).
  • the animals are sacrificed and the affected hindpaws sectioned and weighed.
  • the second method comprises differences in paw volume by measuring water displacement in a plethysmometer (Ugo Basile, Comerio, Italy).
  • Mechanical allodynia is measured by means of a pressure transducer (electronic von
  • Compounds are tested against diabetic and non-diabetic vehicle treated control groups. Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t., i.c.v., s.c, intradermal, transdermal) prior to pain testing.
  • application routes i.v., i.p., p.o., i.t., i.c.v., s.c, intradermal, transdermal
  • Degeneration of the dopaminergic nigrostriatal and striatopallidal pathways is the central pathological event in Parkinson's disease. This disorder has been mimicked experimentally in rats using single/sequential unilateral stereotaxic injections of 6-OH-DA into the medium forebrain bundle (MFB).
  • MFB medium forebrain bundle
  • mice Male Wistar rats (Harlan Winkelmann, Germany), weighing 200+250 g at the beginning of the experiment, are used. The rats are maintained in a temperature- and humidity-controlled environment under a 12 h light/dark cycle with free access to food and water when not in experimental sessions. The following in vivo protocols are approved by the governmental authorities. All efforts are made to minimize animal suffering, to reduce the number of animals used, and to utilize alternatives to in vivo techniques. Animals are administered pargyline on the day of surgery (Sigma, St.
  • DA nigrostriatal pathway 4 ⁇ l of 0.01% ascorbic acid-saline containing 8 ⁇ g of 6-OHDA HBr (Sigma) are injected into the left medial fore-brain bundle at a rate of 1 ⁇ l/min (2.4 mm anterior, 1.49 mm lateral, -2.7 mm ventral to Bregma and the skull surface). The needle is left in place an additional 5 min to allow diffusion to occur.
  • Forelimb akinesia is assessed three weeks following lesion placement using a modi-led stepping test protocol.
  • the animals are held by the experimenter with one hand fixing the hindlimbs and slightly raising the hind part above the surface.
  • Balance adjustments following postural challenge are also measured during the stepping test sessions.
  • the rats are held in the same position as described in the stepping test and, instead of being moved sideways, tilted by the experimenter towards the side of the paw touching the table. This maneuver results in loss of balance and the ability ofthe rats to regain balance by forelimb movements is scored on a scale ranging from 0 to 3. Score 0 is given for a normal forelimb placement. When the forelimb movement is delayed but recovery of postural balance detected, score 1 is given. Score 2 represents a clear, yet insufficient, forelimb reaction, as evidenced by muscle contraction, but lack of success in recovering balance, and score 3 is given for no reaction of movement. The test is repeated three times a day on each side for three consecutive days after an initial training period of three days prior to the first testing.
  • a modified version of the staircase test is used for evaluation of paw reaching be- havior three weeks following primary and secondary lesion placement.
  • Plexiglass test boxes with a central platform and a removable staircase on each side are used.
  • the apparatus is designed such that only the paw on the same side at each staircase can be used, thus providing a measure of independent forelimb use.
  • For each test the animals are left in the test boxes for 15 min.
  • the double staircase is filled with 7 x 3 chow pellets (Precision food pellets, formula: P, purified rodent diet, size 45 mg;
  • the neurotoxin l-methyl-4-phenyl-l,2,3,6-tetrahydro-pyridine causes de- generation of mesencephalic dopaminergic (DAergic) neurons in rodents, non-human primates, and humans and, in so doing, reproduces many of the symptoms of Parkinson's disease.
  • MPTP leads to a marked decrease in the levels of dopamine and its metabolites, and in the number of dopaminergic terminals in the striatum as well as severe loss of the tyrosine hydroxylase (TH)-immunoreactive cell bodies in the substantia nigra, pars compacta.
  • TH tyrosine hydroxylase
  • mice are perfused transcardially with 0.01 M PBS (pH 7.4) for 2 min, followed by 4% paraformaldehyde (Merck) in PBS for 15 min.
  • PBS pH 7.4
  • 4% paraformaldehyde Merck
  • the brains are removed and placed in 4% paraformaldehyde for 24 h at 4 °C. For dehydration they are then transferred to a 20% sucrose (Merck) solution in
  • TH free-floating tyrosine hydroxylase
  • the system logs the fall as the end of the experiment for that mouse, and the total time on the rotarod, as well as the time ofthe fall and all the set-up parameters, are recorded.
  • the system also allows a weak current to be passed through the base grid, to aid training.
  • the object recognition task has been designed to assess the effects of experimental manipulations on the cognitive performance of rodents.
  • a rat is placed in an open field, in which two identical objects are present.
  • the rats inspects both objects during the first trial ofthe object recognition task.
  • a second trial after a retention interval of for example 24 hours, one of the two objects used in the first trial, the 'familiar' object, and a novel object are placed in the open field.
  • the inspection time at each of the objects is registered.
  • the basic measures in the OR task is the time spent by a rat exploring the two object the second trial. Good retention is reflected by higher exploration times towards the novel than the 'familiar' object.
  • Administration of the putative cognition enhancer prior to the first trial predominantly allows assessment of the effects on acquisition, and eventually on consolidation processes.
  • Administration of the testing compound after the first trial allows to assess the effects on consolidation processes, whereas administration before the second trial allows to measure effects on retrieval processes.
  • the passive avoidance task assesses memory performance in rats and mice.
  • the inhibitory avoidance apparatus consists of a two-compartment box with a light compartment and a dark compartment. The two compartments are separated by a guillotine door that can be operated by the experimenter. A threshold of 2 cm separates the two compartments when the guillotine door is raised. When the door is open, the illumination in the dark compartment is about 2 lux. The light intensity is about 500 lux at the center ofthe floor ofthe light compartment.
  • Two habituation sessions, one shock session, and a retention session are given, separated by inter-session intervals of 24 hours. In the habituation sessions and the retention session the rat is allowed to explore the apparatus for 300 sec.
  • the rat is placed in the light compartment, facing the wall opposite to the guillotine door. After an accommodation period of 15 sec. the guillotine door is opened so that all parts of the apparatus can be visited freely. Rats normally avoid brightly lit areas and will enter the dark compartment within a few seconds.
  • the guillotine door between the compartments is lowered as soon as the rat has entered the dark compartment with its four paws, and a scrambled 1 mA footshock is administered for 2 sec.
  • the rat is removed from the apparatus and put back into its home cage.
  • the procedure during the retention session is identical to that ofthe habituation sessions.
  • the step-through latency that is the first latency of entering the dark compartment
  • the Morris water escape task measures spatial orientation learning in rodents. It is a test system that has extensively been used to investigate the effects of putative therapeutic on the cognitive functions of rats and mice.
  • the performance of an animal is assessed in a circular water tank with an escape platform that is submerged about 1 cm below the surface of the water. The escape platform is not visible for an animal swimming in the water tank.
  • Abundant extra-maze cues are provided by the furniture in the room, including desks, computer equipment, a second water tank, the presence ofthe experimenter, and by a radio on a shelf that is playing softly.
  • the animals receive four trials during five daily acquisition sessions.
  • a trial is started by placing an animal into the pool, facing the wall of the tank. Each of four starting positions in the quadrants north, east, south, and west is used once in a series of four trials; their order is randomized.
  • the escape platform is always in the same position.
  • a trial is terminated as soon as the animal had climbs onto the escape platform or when 90 seconds have elapsed, whichever event occurs first. The animal is allowed to stay on the platform for 30 seconds. Then it is taken from the platform and the next trial is started. If an animal did not find the platform within 90 seconds it is put on the platform by the experimenter and is allowed to stay there for 30 seconds.
  • an additional trial is given as a probe trial: the platform is removed, and the time the animal spends in the four quadrants is measured for 30 or 60 seconds.
  • the probe trial all animals start from the same start position, opposite to the quadrant where the escape platform had been positioned during acquisition.
  • rats or mice with specific brain lesions which impair cognitive functions, or animals treated with compounds such as scopolamine or MK-801, which interfere with normal learning, or aged animals which suffer from cognitive deficits, are used.
  • the T-maze spontaneous alternation task assesses the spatial memory performance in mice.
  • the start arm and the two goal arms of the T-maze are provided with guillotine doors which can be operated manually by the experimenter.
  • a mouse is put into the start arm at the beginning of training.
  • the guillotine door is closed.
  • the 'forced trial' either the left or right goal arm is blocked by lowering the guillotine door.
  • the mouse After the mouse has been released from the start arm, it will negotiate the maze, eventually enter the open goal arm, and return to the start position, where it will be confined for 5 seconds, by lowering the guillotine door.
  • the animal can choose freely between the left and right goal arm (all guillotine-doors opened) during 14 'free choice' trials. As soon a the mouse has entered one goal arm, the other one is closed. The mouse eventually returns to the start arm and is free to visit whichever go alarm it wants after having been confined to the start arm for 5 seconds. After completion of 14 free choice trials in one session, the animal is removed from the maze. During training, the animal is never handled.
  • the per : cent alternations out of 14 trials is calculated. This percentage and the total time needed to complete the first forced trial and the subsequent 14 free choice trials (in s) is analyzed.
  • Cognitive deficits are usually induced by an injection of scopolamine, 30 min before the start ofthe training session. Scopolamine reduced the per-cent alternations to chance level, or below.
  • a cognition enhancer which is always administered before the training session, will at least partially, antagonize the scopolamine-induced reduction in the spontaneous alternation rate.
  • Overnight fasted normal rats or mice have elevated rates of gluconeogenesis as do streptozotocin-induced diabetic rats br mice fed ad libitum.
  • Rats are made diabetic with a single intravenous injection of 40 mg/kg of streptozotocin while C57BL/KsJ mice are given 40- 60 mg/kg i.p. for 5 consecutive days.
  • Blood glucose is measured from tail-tip blood and then compounds are administered via different routes (p.o., i.p., i.v., s.c). Blood is collected at various times thereafter and glucose measured. Alternatively, compounds are administered for several days, then the animals are fasted overnight, blood is collected and plasma glucose measured. Compounds that inhibit glucose production will decrease plasma glucose levels compared to the vehicle-treated control group.
  • Both ob/ob and db/db mice as well as diabetic Zucker rats are hyperglycemic, hyperinsulinemic and insulin resistant.
  • the animals are pre-bled, their glucose levels measured, and then they are grouped so that the mean glucose level is the same for each group.
  • Compounds are administered daily either q.d. or b.i.d. by different routes (p.o., i.p., s.c.) for 7-28 days. Blood is collected at various times and plasma glucose and insulin levels determined. Compounds that improve insulin sensitivity in these models will decrease both plasma glucose and insulin levels when compared to the vehicle-treated control group. 3. Insulin Secretion:
  • Compounds that enhance insulin secretion from the pancreas will increase plasma insulin levels and improve the disappearance of plasma glucose following the administration of a glucose load.
  • compounds are administered by different routes (p.o., i.p., s.c. or i.v.) to overnight fasted normal rats or mice.
  • an intravenous glucose load (0.4g/kg) is given, blood is collected one minute later.
  • Plasma insulin levels are determined.
  • Compounds that enhance insulin secretion will increase plasma insulin levels compared to animals given only glucose.
  • animals are bled at the appropriate time after compound administration, then given either an oral or intraperitoneal glucose load (lg/kg), bled again after 15, 30, 60 and 90 minutes and plasma glucose levels determined.
  • Compounds that increase insulin levels will decrease glucose levels and the area-under-the glucose curve when compared to the vehicle-treated group given only glucose.
  • test compounds which regulate 5-HT-like GPCR are administered by different routes (p.o., i.p., s.c, or i.v.) to overnight fasted normal rats or mice. At the appropriate time an intravenous glucose load (0.4g/kg) is given, blood is collected one minute later. Plasma insulin levels are determined. Test compounds that enhance insulin secretion will increase plasma insulin levels compared to animals given only glucose.
  • mice When measuring glucose disappearance, animals are bled at the appropriate time after compound administration, then given either an oral or intraperitoneal glucose load (lg/kg), bled again after 15, 30, 60, and 90 minutes and plasma glucose levels determined. Test compounds that increase insulin levels will decrease glucose levels and the area-under-the glucose curve when compared to the vehicle-treated group given only glucose. 4. Glucose Production:
  • Overnight fasted normal rats or mice have elevated rates of gluconeogenesis as do streptozotocin-induced diabetic rats or mice fed ad libitum.
  • Rats are made diabetic with a single intravenous injection of 40 mg/kg of streptozotocin while C57BL/KsJ mice are given 40-60 mg/kg i.p. for 5 consecutive days.
  • Blood glucose is measured from tail-tip blood and then compounds are administered via different routes (p.o., i.p., i.v., s.c). Blood is collected at various times thereafter and glucose measured. Alternatively, compounds are administered for several days, then the animals are fasted overnight, blood is collected and plasma glucose measured. Compounds that inhibit glucose production will decrease plasma glucose levels compared to the vehicle-treated control group.
  • Both ob/ob and db/db mice as well as diabetic Zucker rats are hyperglycemic, hyper- insulinemic and insulin resistant.
  • the animals are pre-bled, their glucose levels measured, and then they are grouped so that the mean glucose level is the same for each group.
  • Compounds are administered daily either q.d. or b.i.d. by -different routes (p.o., i.p., s.c.) for 7-28 days. Blood is collected at various times and plasma glucose and insulin levels determined. Compounds that improve insulin sensitivity in these models will decrease both plasma glucose and insulin levels when compared to the vehicle-treated control group. 6. Insulin Secretion:
  • Compounds that enhance insulin secretion from the pancreas will increase plasma insulin levels and improve the disappearance of plasma glucose following the administration of a glucose load.
  • compounds are administered by different routes (p.o., i.p., s.c. or i.v.) to overnight fasted normal rats or mice.
  • an intravenous glucose load (0.4g/kg) is given, blood is collected one minute later.
  • Plasma insulin levels are determined.
  • Compounds that enhance insulin secretion will increase plasma insulin levels compared to animals given only glucose.
  • animals are bled at the appropriate time after compound administration, then given either an oral or intraperitoneal glucose load (lg/kg), bled again after 15, 30, 60 and 90 minutes and plasma glucose levels determined.
  • Compounds that increase insulin levels will decrease glucose levels and the area-under-the glucose curve when compared to the vehicle-treated group given only glucose.
  • the cell line used for testing is the human colon cancer cell line HCT116.
  • Cells are cultured in RPMI-1640 with 10-15%) fetal calf serum at a concentration of 10,000 cells per milliliter in a volume of 0.5 ml and kept at 37 °C in a 95% air/5%>CO 2 atmosphere.
  • Phosphorothioate oligoribonucleotides are synthesized on an Applied Biosystems Model 380B DNA synthesizer using phosphoroamidite chemistry. A sequence of 24 bases complementary to the nucleotides at position 1 to 24 of SEQ ID NO:l is used as the test oligonucleotide. As a control, another (random) sequence is used: 5'-TCA ACT GAC TAG ATG TAG ATG GAC-3'. Following assembly and deprotection, oligonucleotides are ethanol-precipitated twice, dried, and suspended in phosphate buffered saline at the desired concentration.
  • oligonucleotides Purity of the oligonucleotides is tested by capillary gel electrophoresis and ion exchange HPLC. The purified oligonucleotides are added to the culture medium at a concentration of 10 ⁇ M once per day for seven days.
  • test oligonucleotide for seven days results in significantly reduced expression of human 5-HT-like GPCR as determined by Western blotting. This effect is not observed with the control oligonucleotide.
  • the number of cells in the cultures is counted using an automatic cell counter. The number of cells in cultures treated with the test oligonucleotide (expressed as 100%) is compared with the number of cells in cultures treated with the control oligonucleotide. The number of cells in cultures treated with the test oligonucleotide is not more than 30% of control, indicating that the inhibition of human 5-HT-like GPCR has an anti-proliferative effect on cancer cells.
  • This non-tumor assay measures the ability of a compound to reduce either the endogenous level of a circulating hormone or the level of hormone produced in response to a biologic stimulus.
  • Rodents are administered test compound (p.o., i.p., i.v., i.m., or s.c).
  • test compound p.o., i.p., i.v., i.m., or s.c
  • Plasma is assayed for levels ofthe hormone of interest. If the normal circulating levels of the hormone are too low and/or variable to provide consistent results, the level ofthe hormone may be elevated by a pre-treatment with a biologic stimulus (i.e., LHRH may be injected i.m.
  • a biologic stimulus i.e., LHRH may be injected i.m.
  • Hollow fibers are prepared with desired cell line(s) and implanted intraperitoneally and/or subcutaneously in rodents. Compounds are administered p.o., i.p., i.v., i.m., or s.c. Fibers are harvested in accordance with specific readout assay protocol, these may include assays for gene expression (bDNA, PCR, or Taqman), or a specific biochemical activity (i.e., cAMP levels. Results are analyzed by Student's t-test or Rank Sum test after the variance between groups is compared by an F-test, with significance at p ⁇ 0.05 as compared to the vehicle control group.
  • specific readout assay protocol these may include assays for gene expression (bDNA, PCR, or Taqman), or a specific biochemical activity (i.e., cAMP levels. Results are analyzed by Student's t-test or Rank Sum test after the variance between groups is compared by an F-test, with significance at p ⁇
  • Rodents are administered test compound (p.o., i.p., i.v., i.m., or s.c.) according to a predetermined schedule and for a predetermined duration (i.e., 1 week).
  • animals are weighed, the target organ is excised, any fluid is expressed, and the weight of the organ is recorded.
  • Blood plasma may also be collected. Plasma may be assayed for levels of a hormone of interest or for levels of test agent.
  • Organ weights may be directly compared or they may be normalized for the body weight of the animal. Compound effects are compared to a vehicle-treated control group. An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-test. Significance is p value ⁇ 0.05 compared to the vehicle control group.
  • Hollow fibers are prepared with desired cell line(s) and implanted intraperitoneally and/or subcutaneously in rodents. Compounds are administered p.o., i.p., i.v., i.m., or s.c. Fibers are harvested in accordance with specific readout assay protocol.
  • Cell proliferation is determined by measuring a marker of cell number (i.e., MTT or LDH). The cell number and change in cell number from the starting inoculum are analyzed by Student's t-test or Rank Sum test after the variance between groups is compared by an F-test, with significance at p ⁇ 0.05 as compared to the vehicle control group.
  • Hydron pellets with or without growth factors or cells are implanted into a micropocket surgically created in the rodent cornea.
  • Compound administration may be systemic or local (compound mixed with growth factors in the hydron pellet).
  • Corneas are harvested at 7 days post implantation immediately following intracardiac infusion of colloidal carbon and are fixed in 10% formalin. Readout is qualitative scoring and/or image analysis. Qualitative scores are compared by Rank Sum test. Image analysis data is evaluated by measuring the area of neovascularization (in pixels) and group averages are compared by Student's t-test (2 tail). Significance is p
  • Matrigel containing cells or growth factors, is injected subcutaneously. Compounds are administered p.o., i.p., i.v., i.m., or s.c. Matrigel plugs are harvested at predetermined time point(s) and prepared for readout. Readout is an ELISA-based assay for hemoglobin concentration and/or histological examination (i.e. vessel count, special staining for endothelial surface markers: CD31, factor-8). Readouts are analyzed by Student's t-test, after the variance between groups is compared by an F-test, with significance determined at p ⁇ 0.05 as compared to the vehicle control group.
  • Tumor cells or fragments are implanted subcutaneously on Day 0.
  • Vehicle and/or compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule starting at a time, usually on Day 1 , prior to the ability to measure the tumor burden.
  • Body weights and tumor measurements are recorded 2-3 times weekly. Mean net body and tumor weights are calculated for each data collection day.
  • Anti- tumor efficacy may be initially determined by comparing the size of treated (T) and control (C) tumors on a given day by a Student's t-test, after the variance between groups is compared by an F-test, with significance determined at p ⁇ 0.05.
  • Tumor growth delays are expressed as the difference in the median time for the treated and control groups to attain a predetermined size divided by the median time for the control group to attain that size. Growth delays are compared by generating Kaplan- Meier curves from the times for individual tumors to attain the evaluation size. Significance is p ⁇ 0.05. 3.1.2. Intraperitoneal/Intracranial Tumor Models
  • Tumor cells are injected intraperitoneally or intracranially on Day 0.
  • Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule starting on Day 1. Observations of morbidity and/or mortality are recorded twice daily. Body weights are measured and recorded twice weekly. Morbidity/mortality data is expressed in terms of the median time of survival and the number of long- term survivors is indicated separately. Survival times are used to generate Kaplan- Meier curves. Significance is p ⁇ 0.05 by a log-rank test compared to the control group in the experiment.
  • Tumor cells or fragments are implanted subcutaneously and grown to the desired size for treatment to begin. Once at the predetermined size range, mice are randomized into treatment groups. Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule. Tumor and body weights are measured and recorded 2-3 times weekly. Mean tumor weights of all groups over days post inoculation are graphed for comparison. An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-test to compare tumor sizes in the treated and control groups at the end of treatment. Significance is p ⁇ 0.05 as compared to the control group.
  • Tumor measurements may be recorded after dosing has stopped to monitor tumor growth delay.
  • Tumor growth delays are expressed as the difference in the median time for the treated and control groups to attain a predetermined size divided by the median time for the control group to attain that size. Growth delays are compared by generating Kaplan-Meier curves from the times for individual tumors to attain the evaluation size. Significance is p value ⁇ 0.05 compared to the vehicle control group.
  • Tumor cells or fragments, of mammary adenocarcinoma origin are implanted directly into a surgically exposed and reflected mammary fat pad in rodents. The fat pad is placed back in its original position and the surgical site is closed. Hormones may also be administered to the rodents to support the growth of the tumors. Compounds are administered p.o., i.p., i.v., i.m., or s.c according to a predetermined schedule. Tumor and body weights are measured and recorded 2-3 times weekly. Mean tumor weights of all groups over days post inoculation are graphed for comparison.
  • An F-test is preformed to determine if the variance is ' equal or unequal followed by a Student's t-test to compare tumor sizes in the treated and control groups at the end of treatment. Significance is p ⁇ 0.05 as compared to the control group.
  • Tumor measurements may be recorded after dosing has stopped to monitor tumor growth delay.
  • Tumor growth delays are expressed as the difference in the median time for the treated and control groups to attain a predetermined size divided by the median time for the control group to attain that size. Growth delays are compared by generating Kaplan-Meier curves from the times for individual tumors to attain the evaluation size. Significance is p value ⁇ 0.05 compared to the vehicle control group.
  • this model provides an opportunity to increase the rate of spontaneous metastasis of this type of tumor. Metastasis can be assessed at termination of the study by counting the number of visible foci per target organ, or measuring the target organ weight. The means of these endpoints are compared by Student's t-test after conducting an F-test, with significance determined at p ⁇ 0.05 compared to the control group in the experiment. 3.3.2. Intraprostatic Assay
  • Tumor cells or fragments, of prostatic adenocarcinoma origin are implanted directly into a surgically exposed dorsal lobe of the prostate in rodents.
  • the prostate is externalized through an abdominal incision so that the tumor can be implanted specifically in the dorsal lobe while verifying that the implant does not enter the seminal vesicles.
  • the successfully inoculated prostate is replaced in the abdomen and the incisions through the abdomen and skin are closed.
  • Hormones may also be administered to the rodents to support the growth of the tumors.
  • Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule.
  • Body weights are measured and recorded 2-3 times weekly. At a predetermined time, the experiment is terminated and the animal is dissected.
  • the size of the primary tumor is measured in three dimensions using either a caliper or an ocular micrometer attached to a dissecting scope.
  • An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-test to compare tumor sizes in the treated and control groups at the end of treatment. Significance is p ⁇ 0.05 as compared to the control group. This model provides an opportunity to increase the rate of spontaneous metastasis of this type of tumor.
  • Metastasis can be assessed at termination ofthe study by counting the number of visible foci per target organ (i.e., the lungs), or measuring the target organ weight (i.e., the regional lymph nodes). The means of these endpoints are compared by Student's t-test after conducting an F-test, with significance determined at p ⁇ 0.05 compared to the control group in the experiment.
  • Tumor cells of pulmonary origin may be implanted intrabronchially by making an incision through the skin and exposing the trachea.
  • the trachea is pierced with the beveled end of a 25 gauge needle and the tumor cells are inoculated into the main bronchus using a flat-ended 27 gauge needle with a 90° bend.
  • Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule. Body weights are measured and recorded 2-3 times weekly. At a predetermined time, the experiment is terminated and the animal is dissected.
  • the size of the primary tumor is measured in three dimensions using either a caliper or an ocular micrometer attached to a dissecting scope.
  • An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-test to compare tumor sizes in the treated and control groups at the end of treatment. Significance is p ⁇ 0.05 as compared to the control group.
  • This model provides an opportunity to increase the rate of spontaneous metastasis of this type of tumor. Metastasis can be assessed at termination ofthe study by counting the number of visible foci per target organ (i.e., the contralateral lung), or measuring the target organ weight. The ' means of these endpoints are compared by Student's t-test after conducting an F-test, with significance determined at p ⁇ 0.05 compared to the control group in the experiment. 3.3.4. Intracecal Assay
  • Tumor cells of gastrointestinal origin may be implanted intracecally by making an abdominal incision through the skin and externalizing the intestine. Tumor cells are inoculated into the cecal wall without penetrating the lumen of the intestine using a 27 or 30 gauge needle. Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule. Body weights are measured and recorded 2-3 times weekly. At a predetermined time, the experiment is terminated and the animal is dissected. The size of the primary tumor is measured in three dimensions using either a caliper or an ocular micrometer attached to a dissecting scope. An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t- test to compare tumor sizes in the treated and control groups at the end of treatment.
  • Significance is p ⁇ 0.05 as compared to the control group.
  • This model provides an opportunity to increase the rate of spontaneous metastasis of this type of tumor.
  • Metastasis can be assessed at termination of the study by counting the number of visible foci per target organ (i.e., the liver), or measuring the target organ weight. The means of these endpoints are compared by Student's t-test after conducting an F-test, with significance determined at p ⁇ 0.05 compared to the control group in the experiment.
  • Tumor cells are inoculated s.c. and the tumors allowed to grow to a predetermined range for spontaneous metastasis studies to the lung or liver. These primary tumors are then excised. Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule which may include the period leading up to the excision of the primary tumor to evaluate therapies directed at inhibiting the early stages of tumor metastasis. Observations of morbidity and/or mortality are recorded daily. Body weights are measured and recorded twice weekly. Potential endpoints include survival time, numbers of visible foci per target organ, or target organ weight. When survival time is used as the endpoint the other values are not determined.
  • Survival data is used to generate Kaplan-Meier curves. Significance is p ⁇ 0.05 by a log-rank test compared to the control group in the experiment. The mean number of visible tumor foci, as determined under a dissecting microscope, and the mean target organ weights are compared by Student's t-test after conducting an F-test, with significance determined at p ⁇ 0.05 compared to the control group in the experiment for both of these endpoints.
  • Tumor cells are injected into the tail vein, portal vein, or the left ventricle ofthe heart in experimental (forced) lung, liver, and bone metastasis studies, respectively.
  • Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule. Observations of morbidity and/or mortality are recorded daily. Body weights are measured and recorded twice weekly. Potential endpoints include survival time, numbers of visible foci per target organ, or target organ weight. When survival time is used as the endpoint the other values are not determined. Survival data is used to generate Kaplan-Meier curves. Significance is p ⁇ 0.05 by a log-rank test compared to the control group in the experiment.
  • the mean number of visible tumor foci, as determined under a dissecting microscope, and the mean target organ weights are compared by Student's t-test after conducting an F-test, with significance at p ⁇ 0.05 compared to the vehicle control group in the experiment for both endpoints.
  • Cells are stably transfected with the relevant receptor and with an inducible CRE-luciferase construct.
  • Cells are grown in 50% Dulbecco's modified Eagle medium / 50% F12 (DMEM/F12) supplemented with 10% FBS, at 37°C in a humidified atmosphere with 10%) CO 2 and are routinely split at a ratio of 1:10 every
  • Test cultures are seeded into 384 - well plates at an appropriate density (e.g. 2000 cells / well in 35 ⁇ l cell culture medium) in DMEM/F12 with FBS, and are grown for 48 hours (range: - 24 - 60 hours, depending on cell line). Growth medium is then exchanged against serum free medium (SFM; e.g. Ultra-CHO), containing 0.1% BSA.
  • SFM serum free medium
  • Test compounds dissolved in DMSO are diluted in SFM and transferred to the test cultures (maximal final concentration 10 ⁇ molar), followed by addition of forskolin ( ⁇ 1 ⁇ molar, final cone) in SFM + 0,1% BSA 10 minutes later.
  • forskolin ⁇ 1 ⁇ molar, final cone
  • BSA BSA 10 minutes later.
  • an appropriate concentration of agonist, and forskolin are added.
  • the plates are incubated at 37°C in 10% CO 2 for 3 hours. Then the supernatant is removed, cells are lysed with lysis reagent (25 mmolar phosphate-buffer, pH 7,8 , containing 2 mmolar DDT, 10% glycerol and 3% Triton XI 00).
  • the luciferase reaction is started by addition of substrate-buffer (e.g. luciferase assay reagent, Promega) and luminescence is immediately determined (e.g. Berthold luminometer or Hamamatzu camera
  • G- -coupled receptors Cells are stably transfected with the relevant receptor and with an inducible CRE-luciferase construct. Cells are grown in 50% Dulbecco's modified Eagle medium / 50% F12 (DMEM/F12) supplemented with 10% FBS, at 37°C in a humidified atmosphere with 10% CO 2 and are routinely split at a ratio of 1:10 every 2 or 3 days. Test cultures are seeded into 384 - well plates at an appropriate density (e.g. 1000 or 2000 cells / well in 35 ⁇ l cell culture medium) in
  • DMEM/F12 with FBS, and are grown for 48 hours (range: ⁇ ' 24 - 60 hours, depending on cell line).
  • the assay is started by addition of test-compounds in serum free medium (SFM; e.g. Ultra-CHO) containing 0.1% BSA.
  • SFM serum free medium
  • Test compounds are dissolved in DMSO, diluted in SFM and transferred to the test cultures (maximal final concentration 10 ⁇ molar, DMSO cone ⁇ 0,6 %). In case of antagonist screening an appropriate concentration of agonist is added 5 - 10 minutes later. The plates are incubated at 37°C in 10% CO 2 for 3 hours. Then the cells are lysed with 10 ⁇ l lysis reagent per well (25 mmolar phosphate-buffer, pH 7,8 , containing 2 mmolar DDT, 10% glycerol and 3% Triton XI 00).
  • the luciferase reaction is started by addition of 20 ⁇ l substrate-buffer per well (e.g. luciferase assay reagent, Promega). Measurement of luminescence is started immediately (e.g. Berthold luminometer or Hamamatzu camera system).
  • substrate-buffer e.g. luciferase assay reagent, Promega.
  • Measurement of luminescence is started immediately (e.g. Berthold luminometer or Hamamatzu camera system).
  • G q -coupled receptors Cells are stably transfected with the relevant receptor.
  • Cells expressing functional receptor protein are grown in 50%) Dulbecco's modified Eagle medium / 50% F12 (DMEM/F12) supplemented with 10% FBS, at 37°C in a humidified atmosphere with 5% CO 2 and are routinely split at a cell line dependent ratio every 3 or 4 days.
  • Test cultures are seeded into 384 - well plates at an appropriate density (e.g. 2000 cells / well in 35 ⁇ l cell culture medium) in DMEM/F12 with FBS, and are grown for 48 hours (range: - 24 - 60 hours, depending on cell line). Growth medium is then exchanged against physiological salt solution (e.g. Tyrode solution).
  • physiological salt solution e.g. Tyrode solution
  • Test compounds dissolved in DMSO are diluted in Tyrode solution containing 0.1% BSA and transferred to the test cultures (maximal final concentration 10 ⁇ molar). After addition of the receptor specific agonist the resulting Gq-mediated intracellular calcium increase is measured using appropriate read-out systems (e.g. calcium- sensitive dyes).
  • a promoter assay is set up with a human hepatocellular carcinoma cell HepG2 that was stably transfected with a luciferase gene under the control of a serotonin- regulated promoter.
  • the vector 2xIROluc which is used for transfection, carries a serotonin responsive element of two 12 bp inverted palindromes separated by an 8 bp spacer in front of a tk minimal promoter and the luciferase gene.
  • Test cultures are seeded in 96 well plates in serum - free Eagle's Minimal Essential Medium supplemented with glutamine, tricine, sodium pyravate, non - essential amino acids, insulin, selen, transferrin, and are cultivated in a humidified atmosphere at 10 % CO 2 at 37°C. After 48 hours of incubation, serial dilutions of test compounds or reference compounds and costimulator if appropriate (final concentration 1 nM) are added to the cell cultures and incubation is continued for the optimal time (e.g. another 4-72 hours).
  • the cells are then lysed by addition of buffer containing Triton XI 00 and luciferin and the luminescence of luciferase induced by test or reference compounds is measured in a luminometer. For each concentration of a test compound replicates of 4 are tested. EC 50 - values for each test compound are calculated by use ofthe Graph Pad Prism Scientific software.
  • Total cellular RNA was isolated from cells by one of two standard methods: (1) guanidine isothiocyanate/Cesium chloride density gradient centrifugation or (2) the Tri-Reagent protocol according to the manufacturer's specifications (Molecular Research Center, Inc., Cincinatti, Ohio). Total RNA prepared by the Tri-reagent protocol was treated with DNAse I to remove genomic DNA contamination.
  • RNA was prepared from the following sources: coronary smooth muscle cells, brain, testis, pancreas, stomach, cerebellum, trachea, adrenal gland, skeletal muscle, salivary gland, small intestine, prostate, fetal liver, placenta, fetal brain, uterus, mammary gland, heart, spleen, lung, HeLa cells, liver, kidney, thymus, bone marrow, thyroid, colon, bladder, spinal cord, peripheral blood, liver cirrhosis, pancreas liver cirrhosis, spleen liver cirrhosis, total Alzheimer brain, fetal lung, breast tumor, colon tumor, lung tumor, HEK 293 cells, adipose, pericardium, fetal heart, thyroid tumor, MDA MB 231 cells, HEP G2 cells, HUVEC cells, fetal kidney, breast, Jurkat T- cells, Alzheimer brain cortex, cervix, esophagus, thalamus, precentral gyras,
  • RNA from each cell or tissue source was first reverse transcribed. Eighty-five ⁇ g of total RNA was reverse transcribed using 1 ⁇ mole random hexamer primers, 0.5 mM each of dATP, dCTP, dGTP, and dTTP (Qiagen, Hilden, Germany), 3000 U RnaseQut (Invitrogen, Groningen, Netherlands) in a final volume of 680 ⁇ l.
  • the first strand synthesis buffer and Omniscript (2 u/ ⁇ l) reverse transcriptase were from (Qiagen, Hilden, Germany). The reaction was incubated at 37 °C for 90 minutes and cooled on ice. The volume was adjusted to 6800 ⁇ l with water, yielding a final concentration of 12.5 ng/ ⁇ l of starting RNA.
  • Biorad iCycler was used according to the manufacturer's specifications and protocols. PCR reactions were set up to quantitate X and the housekeeping genes HPRT, GAPDH, beta-actin, and others. Forward and reverse primers and probe for the serotonin-like GPCR were designed using the Perkin Elmer ABI Primer ExpressTM. software and were synthesized by TibMolBiol (Berlin, Germany).
  • the X forward primer sequence was: GTCCTTCACCGCCATTGTG (SEQ ID NO: 5).
  • the X reverse primer sequence was TGCACACCTACCTGGCAGTCATCCA (SEQ ID NO: 6).
  • the fluorogenic probe, labeled with FAM as the reporter dye and TAMRA as the quencher, is AAGGAGAGGTAGCGCAGTGG (SEQ ID NO: 7).
  • the CT-value is calculated as described above.
  • the CF-value is calculated as followed :
  • PCR reactions were set up to quantitate the housekeeping genes (HKG) for each cDNA sample.
  • CT pannel -mean value - CT cDNA . x -mean value CF cDNA . x
  • Relative Expression 2e(CT cor . cDNA . x [high] - CT cor . cDNA . Y )
  • Figs. 11-13 The results are shown in Figs. 11-13.
  • the human serotonin-like GPCR is expressed in different human tissues. Serotonin-like GPCR mRNA is highly expressed in cerebellum, postcentral gyrus, dorsal root ganglia, erythrocyte, lung COPD, esophagus, ileum chronic inflammation, prostate BPH, and penis.
  • Serotonin-like GPCR mRNA is highly expressed in different brain tissues as cerebellum, postcentral gyrus and dorsal root ganglia. The expression in the above mentioned tissues suggests an association between the human serotonin-like GPCR and peripheral and central nervous system diseases.
  • Serotonin-like GPCR mRNA is highly expressed in prostate BPH and penis. The ex- pression in the above mentioned tissues suggests an association the human serotoninlike GPCR and genito-urinary diseases.
  • Serotonin-like GPCR mRNA is highly expressed in lung COPD.
  • the expression in the above mentioned tissues suggests an association between the human serotonin- like GPCR and respiratory diseases.
  • Serotonin-like GPCR mRNA is highly expressed in erythrocytes. The expression in the above mentioned tissues suggests an association between the human serotoninlike GPCR and hematological diseases.
  • Rats are anesthetized by intraperitoneal administration of urethane (Sigma) at 1.25 g/kg.
  • the abdomen is opened through a midline incision, and a polyethylene catheter (BECTON DICKINSON, PE50) is implanted into the bladder through the dome.
  • a polyethylene catheter BECTON DICKINSON, PE50
  • DICKINSON, PE50 filled with saline (Otsuka) is inserted into a femoral vein.
  • the bladder is filled via the catheter by incremental volume of saline until spontaneous bladder contractions occurred.
  • the intravesical pressure is measured a pressure transducer and displayed continuously on a chart recorder.
  • the activity of test compounds is assessed after intraveneous administration through a polyethylene carmula inserted into the femoral vein.
  • mice Female Sprague-Dawley rats (200-250 g / Charles River Japan) are used.
  • Rats are anesthetized by intramuscular administration of ketamine (75 mg/kg) and xylazine (15 mg/kg).
  • the abdomen is opened through a midline incision, and a polyethylene catheter (BECTON DICKINSON, PE50) is implanted into the bladder through the dome.
  • the catheter is tunneled through subcutis of the animal by needle (14G) to neck.
  • the inguinal region is incised, and a polyethylene catheter (BECTON DICKINSON, PE50) filled with saline (Otsuka) is inserted into a femoral vein.
  • the catheter is tunneled through subcutis ofthe animal by needle to neck.
  • the bladder catheter is connected via T-tube to a pressure transducer (Viggo- Spectramed Pte Ltd, DT-XXAD) and a microinjection pump (TERUMO). Saline is infused at room temperature into the bladder at a rate of 10 ml/hr. Intravesical pressure is recorded continuously on a chart pen recorder (Yokogawa). At least three reproducible micturition cycles are recorded before a test compound administration.
  • a testing compound dissolved in the mixture of ethanol, Tween 80 (ICN Biomedicals Inc.) and saline (1 : 1 : 8, v/v/v) is administered intraveneously through the catheter.
  • Human serotonin ID receptor is encoded by a subfamily of two distinct genes: 5- HT1D alpha and 5-HT1D beta. Proc Natl Acad Sci U S A 1992 Apr 15;89(8):3630-4

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biomedical Technology (AREA)
  • Pulmonology (AREA)
  • Neurology (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Diabetes (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Hematology (AREA)
  • Biophysics (AREA)
  • Urology & Nephrology (AREA)
  • Cell Biology (AREA)
  • Immunology (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Neurosurgery (AREA)
  • Obesity (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Cardiology (AREA)
  • Vascular Medicine (AREA)
  • Child & Adolescent Psychology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
PCT/EP2002/000540 2001-01-26 2002-01-21 Regulation of human serotonin-like g protein-coupled receptor Ceased WO2002059302A2 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
US10/470,150 US20050064404A1 (en) 2001-01-26 2002-01-21 Regulation of human serotonin-like g protein-coupled receptor
JP2002559589A JP2004531226A (ja) 2001-01-26 2002-01-21 ヒトセロトニン様gタンパク質共役レセプターの調節
AU2002225030A AU2002225030A1 (en) 2001-01-26 2002-01-21 Regulation of human serotonin-like g protein-coupled receptor
EP02715460A EP1358328A2 (en) 2001-01-26 2002-01-21 Regulation of human serotonin-like g protein-coupled recepter

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US26407101P 2001-01-26 2001-01-26
US60/264,071 2001-01-26
US32405401P 2001-09-24 2001-09-24
US60/324,054 2001-09-24

Publications (2)

Publication Number Publication Date
WO2002059302A2 true WO2002059302A2 (en) 2002-08-01
WO2002059302A3 WO2002059302A3 (en) 2003-03-06

Family

ID=26950230

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2002/000540 Ceased WO2002059302A2 (en) 2001-01-26 2002-01-21 Regulation of human serotonin-like g protein-coupled receptor

Country Status (5)

Country Link
US (1) US20050064404A1 (https=)
EP (1) EP1358328A2 (https=)
JP (1) JP2004531226A (https=)
AU (1) AU2002225030A1 (https=)
WO (1) WO2002059302A2 (https=)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1437595A1 (en) * 2002-12-23 2004-07-14 F. Hoffmann-La Roche Ag Orphan GPCR gene 115 for obesity indication

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130184636A1 (en) * 2012-01-13 2013-07-18 Graham Creasey System and Method for Controlling Neural and Muscular Function

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2671559B1 (fr) * 1991-01-14 2002-09-27 Ct Nal Rech Scient Sequences codant pour le recepteur beta3-adrenergique murin, leur utilisation comme sondes et pour l'expression de peptides, vecteurs, hotes cellulaires contenant ledit vecteur, et applications desdits peptides.
CN1310945C (zh) * 1999-11-17 2007-04-18 阿瑞那制药公司 人g蛋白偶联受体的内源形式和非内源形式

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1437595A1 (en) * 2002-12-23 2004-07-14 F. Hoffmann-La Roche Ag Orphan GPCR gene 115 for obesity indication

Also Published As

Publication number Publication date
US20050064404A1 (en) 2005-03-24
WO2002059302A3 (en) 2003-03-06
EP1358328A2 (en) 2003-11-05
JP2004531226A (ja) 2004-10-14
AU2002225030A1 (en) 2002-08-06

Similar Documents

Publication Publication Date Title
EP1364026B1 (en) Human g protein-coupled receptor
US20040030100A1 (en) Regulation of human extracellular calcium- sensing g protein-coupled receptor
US20050148014A1 (en) Regulation of human P2Y1-like G protein-coupled receptor
US20030166600A1 (en) Regulation of human isotocin-like g protein-coupled receptor
US20050064404A1 (en) Regulation of human serotonin-like g protein-coupled receptor
US20040136981A1 (en) Regulation of human histamine h2-like g protein-coupled receptor
US20010041355A1 (en) Regulation of human nerve growth factor-related G protein-coupled receptor
WO2004031235A1 (en) Regulation of human calcium-independent alpha-latrotoxin receptor
WO2001070967A2 (en) Regulation of human serotonin-like g protein-coupled receptor
US20040143092A1 (en) Regulation of human dorsal root receptor-like g protein-coupled receptor
WO2001068842A2 (en) Regulation of human p2y-like gpcr protein
WO2002099107A2 (en) Regulation of human trace amine receptor ta5
WO2003051925A1 (en) Human secretin-type gpcr (latrophilin)
US20030114643A1 (en) Regulation of human serotonin-like g protein-coupled receptor
WO2002101043A2 (en) Regulation of human ta4 receptor
US20030073115A1 (en) Regulation of human galanin receptor-like g protein coupled receptor
EP1268779A1 (en) Regulation of human galanin receptor-like g protein coupled receptor
WO2004009630A1 (en) Regulation of human serotonin receptor
WO2004000883A1 (en) Regulation of human growth hormone-releasing hormone receptor
EP1282705A2 (en) Endothelial differentiation gene 6-like g protein coupled receptor
US20040101871A1 (en) Regulation of human gpcr-like protein
US20030166142A1 (en) Regulation of human P2Y - like G protein-coupled receptor
WO2003004531A2 (en) Regulation of human somatostatin receptor-like protein
US20060121554A1 (en) Regulation of human RTA-like GPCR
US20030109482A1 (en) Regulation of human p2y8-like g protein-coupled receptor

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SD SE SG SI SK SL TJ TM TN TR TT TZ UA UG US UZ VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
AK Designated states

Kind code of ref document: A3

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SD SE SG SI SK SL TJ TM TN TR TT TZ UA UG US UZ VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

WWE Wipo information: entry into national phase

Ref document number: 2002715460

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2002559589

Country of ref document: JP

WWP Wipo information: published in national office

Ref document number: 2002715460

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWE Wipo information: entry into national phase

Ref document number: 10470150

Country of ref document: US

WWR Wipo information: refused in national office

Ref document number: 2002715460

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 2002715460

Country of ref document: EP