WO2002057443A1

WO2002057443A1 - Process for producing zaq ligand

Info

Publication number: WO2002057443A1
Application number: PCT/JP2002/000378
Authority: WO
Inventors: Takao Yamada; Masato Suenaga; Osamu Nishimura
Original assignee: Takeda Chemical Industries, Ltd.
Priority date: 2001-01-22
Filing date: 2002-01-21
Publication date: 2002-07-25

Abstract

A process for obtaining a protein having the same activity as that of a ZAQ ligand isolated from eucaryotic cells which comprises efficiently restoring an inactive ZAQ ligand produced in procaryotic cells by using a gene manipulation technique. Namely, a process for producing an active ZAQ ligand characterized by comprising genetic engineeringly expressing a ZAQ ligand in a procaryotic host and then refolding it in a redox buffer.

Description

Manufacturing method of ZAQ ligand

The present invention has an ability to bind to a protein containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1 or a salt thereof, or to activate the protein or a salt thereof. Or a salt thereof (hereinafter sometimes simply referred to as “ZAQ ligand”. “A protein or a protein containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1) The “peptide capable of binding to the salt or activating the protein or the salt thereof” is sometimes simply referred to as “ZAQ ligand.”) Is expressed in prokaryotic cells using genetic engineering technology. The present invention relates to a method for producing a pharmacologically active ZAQ ligand by performing a refolding operation on the extracted ZAQ ligand. Background art

Proteins or peptides containing a large number of cysteine residues in the molecule and having disulfide bonds can be converted into Chinese hamster cells (eg, CHO), monkey cells (eg, COS-7), etc. by known genetic engineering techniques. Expression of a nuclear cell as a host yields a pharmacologically active protein or peptide. However, the method of expressing the protein or peptide in eukaryotic cells generally has a lower expression level of the protein or peptide of interest than the method of expressing the protein or peptide in prokaryotic cells, and furthermore, the method for eukaryotic cells. The medium is expensive and therefore not suitable for industrial scale production of the protein or peptide.

On the other hand, methods for producing a target protein using a redox buffer are reported in, for example, JP-T-62-502895 and JP-A-10-191989.

The ZAQ ligand has ligand activity for the orphan receptor ZAQ receptor (a protein containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1 or a salt thereof). Digestion with peptides It is a useful peptide that has preventive and therapeutic effects on organ diseases (eg, enteritis, diarrhea, constipation, malabsorption syndrome, etc.). The peptide can be produced by using known eukaryotic cells by a known genetic engineering technique.

However, pharmacologically active ZAQ ligands can be obtained by expressing ZAQ ligands in eukaryotic cells such as Chinese hamster cells (eg, CHO) and monkey cells (eg, COS-7). The medium is expensive, and the expression level of the protein is low, so that production on an industrial scale is not suitable.

On the other hand, the use of prokaryotic cells allows the expression of large amounts of proteins, but forms inclusion bodies with insufficient pharmacological activity. A peptide having an amino acid sequence represented by SEQ ID NO: 21, which is an example of a ZAQ ligand, contains 10 cysteine residues in the molecule and has 5 pairs of disulfide bonds. Therefore, when ZAQ ligands are produced using prokaryotic cells, inclusion bodies are formed, and it is difficult to convert ZAQ ligands present in the inclusion bodies into active ZAQ ligands efficiently by conventional methods. Was. Therefore, there has been a demand for an industrially advantageous method of producing a pharmacologically active ZAQ ligand (such as a mass production method). Disclosure of the invention

In order to solve these problems, the present inventors have made intensive studies to provide an efficient ZAQ ligand activation method (regeneration method) by utilizing the high productivity of prokaryotic cells. As a result, we tried for the first time to refold in a redox buffer in the step of activating and then expressing ZAQ ligand in prokaryotic cells using genetic engineering techniques. As a result, they unexpectedly found that the activation of ZAQ ligand can be performed industrially efficiently, and as a result of further research, the present invention has been completed.

That is, the present invention relates to a method for producing an active ZAQ ligand, comprising refolding a ZAQ ligand expressed in a prokaryotic host by genetic engineering in a redox buffer.

Specifically, the present invention

(1) An amino acid identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1 A peptide or a salt thereof capable of binding to, or activating a protein or a salt thereof containing, a nucleic acid sequence or a salt thereof is genetically engineered and expressed in a prokaryotic cell host; Binds to a protein having an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1 or a salt thereof, or the protein or a salt thereof, wherein For producing an active peptide or a salt thereof having the ability to activate

(2) has the ability to bind to or activate a protein or a salt thereof containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1 The production method according to the above (1), wherein the peptide or a salt thereof is a peptide or a salt thereof containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 21;

(3) has the ability to bind to or activate a protein or a salt thereof containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1 The method according to the above (1), wherein the peptide or a salt thereof is a peptide containing the amino acid sequence represented by SEQ ID NO: 21 or a salt thereof.

(4) an ability to bind to a protein containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1 or a salt thereof, or to activate the protein or a salt thereof; The method according to the above (1), wherein the peptide having the amino acid sequence represented by SEQ ID NO: 19 or a salt thereof has a peptide or a salt thereof.

(5) an ability to bind to a protein containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1 or a salt thereof, or to activate the protein or a salt thereof; The method according to (1), wherein the peptide or the salt thereof is a peptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 30 or a salt thereof,

(6) binds to, or binds to, a protein containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1 or a salt thereof; Or the peptide capable of activating the salt thereof or the salt thereof is a peptide containing the amino acid sequence represented by SEQ ID NO: 30 or a salt thereof,

(7) A peptide containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 21 or SEQ ID NO: 30 or a salt thereof is expressed in a prokaryotic host by genetic engineering. Refolding in a redox buffer, a method for producing the active form of the peptide or a salt thereof,

(8) A peptide containing an amino acid sequence represented by SEQ ID NO: 21, SEQ ID NO: 19 or SEQ ID NO: 30 or a salt thereof is genetically engineered in a prokaryotic host, and is expressed in a redox buffer. A method for producing an active peptide or a salt thereof, which is characterized by refolding;

(9) The method according to the above (1), wherein the redox buffer is a buffer containing reduced daltathione and acid-rich glutathione.

(10) The production method according to the above (9), wherein the concentration of reduced daltathione oxalate daltathione in the redox buffer is about 0.01 to 100 mmol / liter, respectively.

(11) The production method according to the above (8), wherein the buffer is a Tris buffer,

(12) The production method according to the above (1), wherein H of the redox buffer is in the range of 7 to 9.

(13) The production method according to the above (1), wherein the pH of the redox buffer is about 8,

(14) The production method according to (1), wherein the redox buffer further contains an amino acid having no mercapto group.

(15) The production method according to the above (14), wherein the amino acid having no mercapto group is arginine,

(16) The production method according to the above (14), wherein the concentration of the amino acid having no mercapto group in the redox buffer is about 0:! To 1 mol / L,

(17) The production method according to the above (1), wherein the reflowing is performed at 0 to 30 ° C.

(18) binds to a protein containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1 or a salt thereof, or the protein Alternatively, a peptide having the ability to activate a salt thereof or a salt thereof is genetically expressed in a prokaryotic host, and the cells are solubilized and then refolded in a redox buffer. ) Described manufacturing method,

(19) A peptide containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 21 or SEQ ID NO: 30 or a salt thereof is genetically expressed in a prokaryotic host, Is solubilized, and then refolded in a redox buffer, according to the above (7),

(20) The production method according to the above (18) or (19), which is solubilized in the absence of a reducing agent,

(21) a peptide having the ability to bind to a protein or a salt thereof containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, or to activate the protein or a salt thereof; The salt is expressed in a prokaryotic host by genetic engineering, the cells are solubilized with a denaturing agent, and then a redox buffer (pH 7 to 9) further containing an amino acid having no mercapto group is used as a denaturing agent. Is diluted to an inactive concentration, the method according to the above (1),

(22) A peptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by the sequence number: 21 or SEQ ID NO: 30 or a salt thereof is genetically expressed in a prokaryotic host. The cells are solubilized with a denaturing agent, and the denaturing agent is diluted to an inactive concentration with a redox buffer of ρΗ7 to 9 further containing an amino acid having no mercapto group. 7) The manufacturing method described

(23) The production method according to the above (21) or (22), wherein the metamorphosis ^ is guanidine or urea;

(24) The method according to (21) or (22), wherein the denaturant in the diluent is diluted with a redox buffer until the concentration of the denaturant is about 0 to 2 mol / l,

(25) a peptide capable of binding to, or activating a protein or a salt thereof containing, an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1 Or expressing the salt thereof in a prokaryotic host by genetic engineering, and the peptide or its The method according to the above (1), wherein the salt is refolded in a redox buffer,

(26) The method according to the above (25), wherein the peptide is a peptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 21 or SEQ ID NO: 30;

(27) A prokaryotic host which has genetically expressed a peptide or a salt thereof containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 21 or SEQ ID NO: 30, The present invention relates to a method for producing an active peptide or a salt thereof, which is reacted with a buffer solution containing an amino acid having no mercapto group, reduced daltathione and oxidized daltathione, which is soluble with a denaturing agent. BEST MODE FOR CARRYING OUT THE INVENTION

The method of the present invention is a method for producing an active form of a ZAQ ligand, comprising expressing a ZAQ ligand by genetic engineering in a prokaryotic host and refolding it in a redox buffer. Preferably, the ZAQ ligand is expressed in a prokaryotic host by genetic engineering, and the ZAQ ligand inactivated by solubilizing the cell is refolded in a redox buffer to form an active form of the ZAQ ligand. Produce ZAQ ligand.

The ZAQ ligand used in the present invention includes a protein containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1 or a salt thereof (hereinafter, abbreviated as “ZAQ receptor”). Or a salt thereof, or a peptide or a salt thereof capable of activating the ZAQ receptor.

Preferably, the ZAQ ligand comprises (1) an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 21, and having an ability to bind to the ZAQ receptor or to activate the ZAQ receptor. A peptide or a salt thereof, (2) containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 19, and binding to or binding to a ZAQ receptor (2) a peptide or a salt thereof, which has the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 30, and binds to or binds to the ZAQ receptor. Examples thereof include a peptide having the ability to activate and a salt thereof.

The ability of a ZAQ ligand to bind to or activate a ZAQ receptor can be determined by a method for measuring a known ligand 'receptor binding activity or a method analogous thereto, or a known cell stimulating activity (intracellular Ca ion concentration). Change (eg, the method described in Example 1-6 below), cAMP synthesis inhibitory activity, etc.) or a method analogous thereto.

The ZAQ ligand produced by the method of the present invention is a peptide capable of binding to the ZAQ receptor or a peptide capable of activating the ZAQ receptor (hereinafter abbreviated as “active peptide”). Can be) or its salts. Specifically, (1) a peptide containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by the active form SEQ ID NO: 21 or a salt thereof, (2) an active form SEQ ID NO: 30 Or a salt thereof containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by

The ZAQ receptor (G protein-coupled receptor protein) is a receptor protein having an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1 (WO 01/16309).

ZAQ ligands and ZAQ receptors include, for example, human and non-human mammals (eg, guinea pigs, rats, mice, rabbits, pigs, sheep, sheep, monkeys, monkeys, etc.), and all cells (eg, spleen cells, nerve cells, glial cells) 3 cells, bone marrow cells, mesangial cells, Langerhans cells, epidermal cells, epithelial cells, endothelial cells, fibroblasts, fiber cells, muscle cells, fat cells, immune cells (eg, macrophages, T cells, B Cells, natural killer cells, mast cells, neutrophils, basophils, eosinophils, monocytes), megakaryocytes, synovial cells, chondrocytes, bone cells, osteoblasts, osteoclasts, mammary cells, Hepatocytes or stromal cells, or precursors of these cells, stem cells or cancer cells, etc., or blood cells (eg, MEL, Ml, CTLL-2, HT-2, WEH 1-3, HL-6) 0,] OSK-1, K562, ML-1, MOLT- 3, MOLT-4, MOLT-10, CCRF- CEM, TALL-1, Jurkat, CCRT-HSB-2, KE-37, S KW-3, HUT-78, HUT-102, H9, U937 , THP-1, HEL, JK-1, CMK, KO-812, MEG-01) or any tissue where those cells are present, eg, the brain, parts of the brain (eg, olfactory bulb, Head nucleus, basal cerebral sphere, hippocampus, thalamus, hypothalamus, hypothalamic nucleus, cerebral cortex, medulla, cerebellum, occipital lobe, frontal lobe, temporal lobe, putamen, caudate nucleus, brain stain, substantia nigra), spinal cord, Pituitary, stomach, kidney, kidney, liver, gonad, thyroid, gall bladder

, Bone marrow, adrenal gland, skin, muscle, lung, digestive tract (eg, large intestine, small intestine), blood vessels, heart, thymus, spleen, submandibular gland, peripheral blood, peripheral blood cells, prostate, testicle, testis, ovary, placenta, uterus It may be a peptide / protein derived from bones, joints, skeletal muscle, etc. (particularly, brain or various parts of the brain), or may be a synthetic peptide'synthetic protein.

The amino acid sequence substantially the same as the amino acid sequence represented by SEQ ID NO: 21 includes, for example, about 60 ° / ₀ or more (preferably about 70% or more, Further preferred are amino acid sequences having a homology of about 80% or more, more preferably about 85% or more, particularly preferably about 90% or more, and most preferably about 95% or more.

Examples of the peptide having an amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 21 include, for example, a peptide having an amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 21; Peptides having substantially the same properties as the peptide containing the amino acid sequence represented by 21 are preferred. The amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 19 is, for example, about 60% or more (preferably An amino acid sequence having a homology of about 70% or more, more preferably about 80% or more, more preferably about 85% or more, particularly preferably about 90% or more, and most preferably about 95% or more. .

Examples of the peptide having an amino acid sequence substantially the same as the amino acid sequence represented by SEQ ID NO: 19 include, for example, a peptide having an amino acid sequence substantially the same as the amino acid sequence represented by SEQ ID NO: 19; Peptides having substantially the same properties as peptides containing the amino acid sequence represented by 19 are preferred. The amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 30 is, for example, about 60 ° / ₀ or more (preferably, the amino acid sequence represented by SEQ ID NO: 30). Amino acids having a homology of about 70% or more, more preferably about 80% or more, more preferably about 85% or more, particularly preferably about 90% or more, and most preferably about 95% or more. And the like.

Examples of the peptide having an amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 30 include, for example, a peptide having an amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 30; Peptides having substantially the same properties as peptides containing the amino acid sequence represented by No. 30 are preferred.

Preferred specific examples of the ZAQ ligand include a peptide containing the amino acid sequence represented by SEQ ID NO: 19, a peptide containing the amino acid sequence represented by SEQ ID NO: 21 and SEQ ID NO: 30 And peptides containing an amino acid sequence.

Substantially the same activity includes, for example, a binding activity to a ZAQ receptor, a signal transduction activity via a ZAQ receptor, and the like. Substantially the same indicates that their activities are the same in nature. Therefore, it is preferable that the activities such as the binding activity to the ZAQ receptor and the signal transduction via the ZAQ receptor are equivalent (for example, about 0.5 to 2 times). Quantitative factors such as molecular weight may be different.

The activity can be measured by a known method or a method analogous thereto (specifically, a method described in Example 11 to be described later or a method analogous thereto).

Examples of the ZAQ ligand include: (1) one or two or more (preferably about 1 to 30 and more preferably 1 to 20) in the amino acid sequence represented by SEQ ID NO: 19 or SEQ ID NO: 21; Amino acid sequence in which amino acid has been deleted, (2) 1 or 2 or more (preferably, about 1 to 40 amino acids) in the amino acid sequence represented by SEQ ID NO: 19 or SEQ ID NO: 21; More preferably about 1 to 30 amino acids, particularly preferably about 1 to 20 amino acids), and ③ an amino acid sequence represented by SEQ ID NO: 19 or SEQ ID NO: 21. 1 or 2 or more of them (preferably 1 to An amino acid sequence in which about 30 (more preferably about 1 to 20) amino acids have been substituted with another amino acid, or a peptide containing an amino acid sequence obtained by combining them, or the like can also be used. Further, (1) an amino acid sequence in which one or more (preferably about 1 to 30 and more preferably about 1 to 20) amino acids in the amino acid sequence represented by SEQ ID NO: 30 have been deleted (2) one or more amino acid sequences represented by SEQ ID NO: 30 (preferably about 1 to 40, more preferably about 1 to 30, particularly preferably 1 to 20) Amino acid sequence to which an amino acid sequence of about 30 or more (preferably about 1 to 30, more preferably 1 to 20) in the amino acid sequence represented by SEQ ID NO: 30 (About one amino acid) are substituted with another amino acid, or a peptide containing an amino acid sequence obtained by combining them is also used.

Examples of the amino acid sequence substantially the same as the amino acid sequence represented by SEQ ID NO: 1 encoding the ZAQ receptor include, for example, about 90% or more, preferably about 95%, of the amino acid sequence represented by SEQ ID NO: 1. Above, more preferably, an amino acid sequence having about 98% or more homology.

Examples of the protein having an amino acid sequence substantially the same as the amino acid sequence represented by SEQ ID NO: 1 include, for example, an amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 1; A protein having substantially the same properties as the protein having the amino acid sequence represented by No. 1 is preferred. Examples of the protein (ZAQ receptor) having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1 of the present invention include, for example, the same or substantially the same as the amino acid sequence represented by SEQ ID NO: 1 Preferred are proteins which contain the same amino acid sequence and have substantially the same activity as the amino acid sequence represented by SEQ ID NO: 1.

Examples of substantially the same activity include a ligand binding activity and a signal transduction activity. Substantially the same indicates that their activities are the same in nature. Therefore, it is preferable that the activities such as the ligand binding activity and the signal transduction activity are equivalent (eg, about 0.5 to 2 times), but the quantitative factors such as the degree of these activities and the molecular weight of the protein are different. You may. The activities such as ligand binding activity and signal information transduction can be measured according to known methods.

The ZAQ receptor includes: (1) one or more or more amino acids in the amino acid sequence represented by SEQ ID NO: 1 (preferably about 1 to 30, more preferably about 1 to 10, more preferably several ( Amino acid sequence in which 1 or 2 amino acids have been deleted, 2) 1 or 2 or more amino acids in the amino acid sequence represented by SEQ ID NO: 1 (preferably, about 1 to 30, more preferably 1 to 1) An amino acid sequence obtained by adding about 0 amino acids, more preferably several (1 or 2) amino acids; and ③ one or more (preferably, one or more) amino acids in the amino acid sequence represented by SEQ ID NO: 1. About 30 amino acids, more preferably about 1 to 10 amino acids, still more preferably several (one or two) amino acids substituted with another amino acid, or amino acids obtained by combining them. Proteins containing acid sequences, etc. It can be mentioned as a specific example. In the present specification, peptides and proteins have N-terminus (amino terminus) at the left end and C-terminus (carboxyl terminus) at the right end according to the convention of peptide notation. The peptides and proteins of the present invention including ZAQ ligands and ZAQ receptors have carboxyl groups (one COOH), carboxylate (—COO-1), amides (one CONH ₂ ) or esters (one COOR ).

Here, as R in the ester, e.g., methyl, Echiru, n- propyl, alkyl groups such as isopropyl, n- butyl, Shikurobe pentyl, C ₃ _ ₈ cycloalkyl group such as cyclohexyl, for example, phenyl , C such as a one-naphthyl ₆ - ₁₂ Ariru group, e.g., benzyl, full Eniru d_ ₂ alkyl or α- naphthylmethyl etc. α- naphthyl one C ^ ₂ Flip such as an alkyl group ₇ _ ₁₄ Ararukiru group such as phenethyl A piva mouth yloxymethyl group commonly used as an oral ester is used.

When the peptides and proteins in the present specification have a carboxyl group (or carboxylate) other than the C-terminus, those in which the carboxyl group is amidated or esterified are also included in the peptides and proteins in the present specification. It is. As the ester in this case, for example, the above-mentioned C-terminal ester and the like are used. Furthermore, the peptides and proteins in this specification, the peptides • proteins described above, Amino group of the N-terminal amino acid protecting groups (e.g., formyl group, etc. Ashiru groups such as C ₂ _ ₆ Arukanoiru group such Asechiru group) , The daltamyl group formed by cleavage of the N-terminal side in vivo and pyroglutamic acid ligated, substituents on the side chains of amino acids in the molecule (for example, mono-OH, -SH, amino groups , imidazole group, indole group, etc. Guanijino group) appropriate coercive Mamorumoto (e.g., formyl group, C ₂ such Asechiru group - C, such as ₆ Arukanoiru groups - those are protected by like ₆ Ashiru group), or Also included are complex peptides such as so-called glycopeptides and glycoproteins to which sugar chains are bonded, and complex proteins.

Preferred specific examples of the ZAQ ligand include, for example, a peptide derived from human (more preferably from human brain) containing the amino acid sequence represented by SEQ ID NO: 19, SEQ ID NO: 21 or SEQ ID NO: 30 Is raised.

Preferred specific examples of the ZAQ receptor include, for example, human-derived (more preferably, human brain-derived) protein containing the amino acid sequence represented by SEQ ID NO: 1.

As the salt of the ZAQ ligand or the ZAQ receptor, a physiologically acceptable acid addition salt is particularly preferable. Examples of such salts include salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid) or organic acids (eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid) Acids, tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid) and salts and hydrates are used.

The prokaryotic cells used in the present invention include Escherichia coli and other Escherichia bacteria, Bacillus subtilis and other Bacillus bacteria, and Serratia marcescens and other Serratia species. Among them, Escherichia coli and the like are preferable. Transformation and culture of these prokaryotic cells can be carried out by a conventional method (such as the method described in JP-A-3-204879) or a method analogous thereto, in addition to the following methods. it can.

The DNA encoding the ZAQ ligand may be any DNA as long as it contains the DNA encoding the ZAQ ligand described above. Also, It may be any of nome DNA, genomic DNA library, the above-mentioned cDNA derived from cells and tissues, the above-mentioned cDNA library derived from cells and tissues, and synthetic DNA. The vector used for the library may be any of batteriophage, plasmid, cosmid, phagemid and the like. Alternatively, amplification can be performed directly by reverse transcriptase polymerase chain reaction (hereinafter abbreviated as RT-PCR method) using a preparation of a total RNA or mRNA fraction from the above-mentioned cells.

Specifically, the DNA encoding the ZAQ ligand includes, for example, (1) DNA containing the base sequence represented by SEQ ID NO: 20 or DNA containing the base sequence represented by SEQ ID NO: 20 It contains DNA that hybridizes under high stringent conditions and has substantially the same activity as a peptide containing the amino acid sequence represented by SEQ ID NO: 19 (eg, binding activity to ZAQ receptor, ZAQ receptor (2) DNA containing the nucleotide sequence represented by SEQ ID NO: 22, or DNA containing the nucleotide sequence represented by SEQ ID NO: 22 Which has DNA that hybridizes under high stringent conditions with DNA that binds to the DNA and has substantially the same activity as the peptide containing the amino acid sequence represented by SEQ ID NO: 21 (eg, ZAQ (3) DNA containing the nucleotide sequence represented by SEQ ID NO: 31, or DNA represented by SEQ ID NO: 31 Containing DNA that hybridizes under high stringent conditions with DNA containing the base sequence, and having substantially the same activity as a peptide containing the amino acid sequence represented by SEQ ID NO: 30 (eg, ZAQ Any DNA may be used as long as it encodes a peptide having a receptor binding activity, a ZAQ receptor-mediated signal transduction action, and the like.

Examples of the DNA containing the nucleotide sequence represented by SEQ ID NO: 20 include DNA containing the nucleotide sequence represented by SEQ ID NO: 16.

Examples of the DNA containing the base sequence represented by SEQ ID NO: 22 include a DNA containing the base sequence represented by SEQ ID NO: 18. Examples of the DNA containing the nucleotide sequence represented by SEQ ID NO: 31 include DNA containing the nucleotide sequence represented by SEQ ID NO: 41. Examples of the DNA that hybridizes with the DNA having the nucleotide sequence represented by SEQ ID NO: 20, SEQ ID NO: 22 or SEQ ID NO: 31 under stringent conditions include, for example, SEQ ID NO: 20, DNA containing a nucleotide sequence having about 60% or more, preferably about 70% or more, more preferably about 80% or more homology with the nucleotide sequence represented by SEQ ID NO: 22 or SEQ ID NO: 31 Are used.

As a DNA that hybridizes under high stringent conditions with DNA containing the nucleotide sequence represented by SEQ ID NO: 22, specifically, DNA containing the nucleotide sequence represented by SEQ ID NO: 38, Or a DNA containing the DNA having the base sequence represented by SEQ ID NO: 38 and a DNA that hybridizes under high stringency conditions, and is substantially the same as the peptide containing the amino acid sequence represented by SEQ ID NO: 21 (Eg, binding activity to ZAQ receptor, signal transduction via ZAQ receptor, etc.), and DNA encoding a peptide.

As a DNA that hybridizes under high stringent conditions with a DNA containing the base sequence represented by SEQ ID NO: 31, specifically, a DNA containing the base sequence represented by SEQ ID NO: 39 Or a DNA comprising the DNA having the base sequence S sequence represented by SEQ ID NO: 39 and DNA hybridizing under high stringency conditions, and a peptide comprising the amino acid sequence represented by SEQ ID NO: 30 And DNA encoding a peptide having substantially the same activity (eg, binding activity to ZAQ receptor, signal transduction via ZAQ receptor, etc.).

Specifically, (1) As the DNA encoding the peptide containing the amino acid sequence represented by SEQ ID NO: 19, a DNA containing the base sequence represented by SEQ ID NO: 20 is mentioned. (2) The DNA encoding the peptide containing the amino acid sequence represented by SEQ ID NO: 21 is a DNA containing the nucleotide sequence represented by the sequence number: 22 or SEQ ID NO: 38; (3) DNA encoding the peptide containing the amino acid sequence represented by SEQ ID NO: 30 includes SEQ ID NO: 31 or SEQ ID NO: 39. And DNAs containing the base sequence represented by

The DNA encoding the ZAQ ligand may be (1) chemically synthesized by a known method or a method analogous thereto, or (2) DNA of the DNA encoding the ZAQ ligand. The DNA may be amplified and obtained by polymerase chain reaction (hereinafter abbreviated as PCR) with reference to the sequence and the like.

Examples of plasmids for introducing DNA encoding the ZAQ ligand include, for example, PBR 322 derived from Escherichia coli (Gene, Vol. 2, p. 95 (1977)) and pBR 325 [Gene, Vol. 4, p. 121 (1978) )], PUC12 [Gene, 19, 259 (1982)], pUC13 [Gene, 19, 259 (1982)], pUB1 10 derived from Bacillus subtilis [Biochemical biophysical · Resate Communications (Biochemical ana Biophysical Research Communications), Vol. 112, p. 678 (1983)], etc., as long as they can be replicated and propagated in the host. , Can be used. Examples of phage vectors incorporating DNA include: Lgt11 (Young, R. and Davis, R.), Proceedings of the National 'Academy of Ob', Science (Proc. Natl. Acad. Sci., USA), Vol. 80, p. 1194 (1983)], etc. Any substance that can proliferate can be used.

For example, T. Maniatis et al., Molecular Cloning Cold “Spring” Harbor “Laboratory” (Cold Spring Harbor Laboratory), p. 239 (1998) Examples of the method of incorporating DNA into a phage vector include, for example, the method of Hyunh (TV) et al. [DNA Cloning, a Practical 'Approach (DNA Cloning). , A Practical Approach) Vol. 1, p. 49 (1985)], etc. The plasmid obtained in this way can be used in suitable hosts such as Es cherichia sp., Bacillus sp. be introduced. Examples of the above-mentioned Escherichia bacteria include Escherichia coli K12DH1 [Proceding 'ob the national' academy ' _ob science ( _proc . Natl. Acad. Sci. USA) 60 vol. JM103 [Nucleic Acids Research], Vol. 9, 309 (1981)], JA221 [Journal of Molecular Biology], JA221 [Journal of Molecular Biology] ), 120, 517 (1978)], HB 101 (Journal of Molecular Biology 1, 41, 459 (1969)), C600 (Genetics, 39, 440 (1954)], MM 294 [Nature, 217, 111 (1968)], and the like.

Examples of the Bacillus genus include Bacillus subtilis MI114 (Gene, Vol. 24, p. 255 (1983)), 207-21 (Journal of Biochemistry). 95, 87 (1984)].

Methods for transforming a host with a plasmid include, for example, T. Maniatis et al., Molecular Cloning, Co.;, 'Spring', "Cold Spring". Harbor Laboratory), p. 249 (1982), calcium chloride method or calcium chloride Z rubidium chloride method.

When a phage 'vector is used, it can be introduced into, for example, grown Escherichia coli using an in vitro packaging method.

In this way, the cloned ZAQ ligand co one de to DNA is plasmid if necessary, for example, p BR 322, pUC 12, pUC 13, pUC 18, UC 1 9 N pUC 1 18, pUC 1 1 9 Can be used after subcloning.

The nucleotide sequence of the DNA encoding the ZAQ ligand obtained in this manner was used, for example, by the Maxam-Gilbert method (Maxam, AM and Gilbert, W., Proceedings of the National Institute of Technology). Academy of Sciences of the USA (Proc. Natl. Acad. Sci., USA), 74 560 (1977)] or the dideoxy method (Messing, J. et al., Nucleic Acids Research, Vol. 9, 309 (1981)). The comparison of shows that DNA encoding the ZAQ ligand is present.

The DNA encoding the ZAQ ligand cloned as described above can be used as it is or after digestion with a restriction enzyme exonuclease, if desired.

Next, a region to be expressed is cut out from the DNA encoding the cloned ZAQ ligand, and ligated downstream of a promoter in a vehicle (vector) suitable for expression to obtain an expression type vector.

The DNA may have ATG as a translation initiation codon at its 5 'end, and may have TAA, TGA or TAG as a translation termination codon at its 3' end. These translation initiation codon and translation termination codon can also be added using an appropriate synthetic DNA adapter. To express the DNA, a promoter is connected upstream thereof.

Examples of the vector include the above-described plasmid derived from Escherichia coli (eg, pBR322, pBR325, pUC12, pUC13), and Bacillus subtilis-derived plasmid (eg, pUB110, TP5, pC194).

The promoter used in the present invention may be any promoter as long as it is appropriate for the host used for DNA expression.

The T7 promoter, trp promoter, lac promoter, recA promoter, promoter, 1 pp promoter, etc. are used when the host used for the transformation is Escherichia, and SP is used when the host is Bacillus. Ol promoter, SPO2 promoter, pen P promoter and the like are preferable. In particular, it is preferable that the host is a bacterium belonging to the genus Escherichia and the promoter is a T7 promoter, a trp promoter, or a LPL promoter.

It is effective to use Enhansa for expression.

Using the vector containing the DNA encoding the ZAQ ligand thus constructed, a prokaryotic cell transformant is produced. Transformation of the above-mentioned Escherichia bacterium can be performed, for example, by the following procedure: Proc. Natl. Acad. Sci. USA, 69, 2110 (1972). And Gene, vol. 17, p. 107 (1982).

Transformation of Bacillus spp. Is performed, for example, according to the method described in Molecular & General Genetics, Vol. 168, pp. 11 (1979).

In this way, a prokaryotic cell transformant transformed with the expression vector containing the DNA encoding the ZAQ ligand is obtained. When the genus Escherichia is used as a host and the T7 promoter is used as a promoter, a τ7 lysozyme expression plasmid is used in addition to an expression vector containing DNA encoding ZAQ ligand to improve the expression efficiency of the T7 promoter. May be.

When culturing a transformant whose host is a bacterium belonging to the genus Escherichia or Bacillus, a liquid medium is suitable as the medium used for the culturing, and a carbon source necessary for the growth of the transformant is contained therein. , Nitrogen sources, inorganic substances and others. Carbon sources include, for example, glucose, dextrin, soluble starch, sucrose, etc.Nitrogen sources include, for example, ammonium salts, nitrates, cornchip 'liquor, peptone, casein, meat extract, soybean meal, potato extract, etc. Alternatively, examples of the organic substance and the inorganic substance include calcium salt, sodium dihydrogen phosphate, magnesium chloride and the like. Also, yeast extract, vitamins and growth promoting factors may be added. The pH of the medium is preferably about 5-8.

As a medium for culturing Escherichia sp., For example, an M9 medium containing glucose and casamino acid (Miller, Journal 'Ob'Experiment'in'Molecuffe ¹ —Journal of Experiments in Molecular Geometry netics), pp. 431-433, Cold Spring Harbor Laboratory, New York 1972], LB medium and the like. Here, if necessary, a drug such as isopropynole j3-D-thiogalatatopyranoside (IPTG) or 3 / 3-indolyl ataryl acid can be added in order to make the promoter work efficiently.

When the host is Escherichia, cultivation is usually at about 15 to 43 ° C for about 3 to 24 hours. If necessary, ventilation and agitation can be added.

When the host is a bacterium of the genus Batinoles, the cultivation is usually carried out at about 30 to 40 ° C for about 6 to 24 hours, and if necessary, aeration and stirring may be added.

If the ZAQ ligand forms an insoluble component (inclusion body) in the host prokaryotic cells, after culturing, collect cells by centrifugation or other methods, disrupt the cells, and allow the inclusion body to be denatured using a denaturant. Upon solubilization, the ZAQ ligand can be extracted. Cell framing can be carried out in a conventional manner, for example by sonication. It is preferable to use a suitable buffer (for example, a phosphate buffer or the like) adjusted to a neutral pH value (pH 6.5 to 7.5) as a suspension medium. At this time, EDTA may be added to promote cell disruption. After crushing the cells in this way, the insoluble components (encapsulated body) are separated by centrifugation or filtration by any method. In order to remove prokaryotic cell-derived proteins as much as possible, washing with, for example, water or a phosphate buffer is preferable. In some cases, washing with about 4 M urea may be used. As a denaturing agent for solubilizing the obtained precipitate (pellet) using a denaturing agent, a known denaturing agent, in particular, guanidine or urea can be used. The denaturant is usually used as an aqueous solution, and the concentration of the denaturant in the aqueous solution is 4 to 8 mol Z liter, preferably about 6 to 7 mol Z liter for guanidine, and 5 to 9 mol / liter for urea, preferably about 8 mol / l. Guanidine is usually used as an acid addition salt of guanidine such as guanidine hydrochloride.

If the ZAQ ligand does not form an inclusion body in the prokaryotic host cells, the cells are lysed with a denaturing agent after culturing, harvested by centrifugation, etc. The ZAQ ligand can be extracted by crushing and solubilizing with a mutagenic agent.

Examples of denaturing agents used for solubilizing the collected cells include guanidine and urea. The denaturant is usually used as an aqueous solution, and the concentration of the denaturant in the aqueous solution is usually 4 to 8 mol / l, preferably about 6 to 7 mol / l for guanidine. Guanidine is usually used as an acid addition salt of guanidine such as guanidine hydrochloride.

Cell disruption can be performed in a conventional manner, for example, by sonication or by French press. Wear. As a denaturant used for solubilization of the disrupted cells, a known denaturant may be used, and guanidine or urea is preferably used. The denaturant is usually used as an aqueous solution, and the concentration of the denaturant in the aqueous solution is 4 to 8 mol Z liter for guanidine, preferably about 6 to 7 mol Z liter, and 5 to 9 mol / liter for urea, preferably. Is about 8 mol / l. Guanidine is usually used as an acid addition salt of guanidine such as guanidine hydrochloride.

The inclusion body is solubilized as described above, the cells are directly solubilized with a denaturing agent, or the cells are crushed and then solubilized with a denaturing agent. If necessary, subject the supernatant to a purification step, and then refold (activate and regenerate) the ZAQ ligand.

Reforno-reding is performed by adding a redox buffer to the purified ZAQ ligand or diluting the supernatant containing the ZAQ ligand with the redox buffer.

Examples of the redox buffer include a buffer containing oxidized daltathione (GSSG) and reduced daltathione (GSH), a buffer containing cysteine and cystine, and a buffer containing cysteamine and cystamine. Among them, buffers containing GS SG and GSH are preferred. Examples of the buffer include a Tris buffer, a phosphate buffer, an acetate buffer, a citrate buffer and the like, and among them, a Tris buffer and the like are preferable.

The concentrations of the oxidizing agent (oxidized substance) and the reducing agent (reduced substance) in the redox buffer are, for example, 0.01 to 100 mmol Z liter and 0.01 to: L 00 mmol Z liter, respectively. . More specifically, when using 0330 chips & 311, the concentration of GS SG in the redox buffer is 0.01 to 100 millimoles, preferably 0.1 to 10 millimoles / liter, and preferably 0.1 to 10 millimoles / liter. 1-1.0 millimoles are used, the concentration of GSH is 0.01-: 100 millimoles Z liter, preferably 0.1-10 millimoles Z liter, preferably

0.2-2.0 mmol / l are used.

In this case, it is preferable that, for example, an amino acid having no mercapto group is further contained in the redox buffer. Supernatant containing AQ ligand When diluting with a redox buffer, it is preferable to dilute the denaturant to a non-active concentration at a neutral pH suitable for activation. For example, when guanidine is used as a denaturant, the concentration of guanidine in the diluent is 0 to 2.0 monoliters, preferably about 1 mol / liter or less.When urea is used as a denaturant, the diluent is used. It is desirable to dilute the concentration of urea in the solution to 0 to 4.0 mol / l, preferably to about 2 mol liter or less.

As the amino acid having no mercapto group, any amino acid having no mercapto group may be used as long as the object of the present invention is achieved, and arginine, aspartic acid, palin, lysine, and alanine And citrulline. Arginine and the like are preferred in terms of yield in refolding of ZAQ ligands. The concentration of the amino acid added to the redox buffer is 0.1 to 1.0 mol / liter, preferably 0.2 to 0.8 mol / liter.

The temperature for the above reforming is 0 to 30 ° C, preferably 4 to 15 ° C. The pH is 7-9, preferably ρΗ7.5-8.5. The time required for the refolding is usually 0.5 to 7 days, preferably 1 to 3 days, more preferably 1 to 2 days.

Note that, after solubilization and before refolding, known and commonly used purification steps such as extraction, salting-out, dialysis, distribution, crystallization, recrystallization, gel filtration, and chromatography can be introduced. Preferably, it can be purified, for example, by applying to Sephadex G-25 (Amersham Pharmacy Biotech) in a 0.1 mol / liter phosphate buffer solution. Separation of the denaturing agent can also be performed by dialyzing against a 0.1 mol Z liter phosphate buffer in some cases.

The purification step can also be performed following refolding. Generally, such purification includes, for example, extraction, salting-out, dialysis, partitioning, crystallization, recrystallization, gel filtration, chromatography, and the like. Preferred examples include dialysis and, for example, SP-Sepharose (Amersham Pharmacia Biotech (Amersham Pharmacia Biotech)). Ion exchange chromatography via CM-5PW (Tosoh Corporation) or DEAE-5PW (Tosoh Corporation), for example, C4P-50 (Showa Denko Corporation) Reversed phase A purification method by chromatography or the like can be mentioned.

The ZAQ ligand (active ZAQ ligand) obtained in the present invention has the same action as the ZAQ ligand obtained from eukaryotic cells, and is used in the same manner as the method of using the ZAQ ligand obtained from eukaryotic cells. Can be used.

That is, ZAQ ligand has an activity of controlling intestinal contraction and the like, and when DNA encoding ZAQ ligand is deficient or expression level is abnormally decreased, for example, gastrointestinal diseases ( For example, various diseases such as enteritis, diarrhea, constipation, and malabsorption syndrome occur.

Therefore, the ZAQ ligand obtained by the production method of the present invention is useful for treating various diseases such as digestive diseases (eg, enteritis, diarrhea, constipation, malabsorption syndrome, etc.).

• Can be used as a medicine such as a prophylactic agent.

For example, when there is a patient in whom ZAQ receptor expression is insufficient or normal in cells where ZAQ receptor is expressed due to decreased or defective ZAQ ligand in vivo, ZAQ ligand is administered to the patient. By doing so, the role of the ZAQ ligand in the patient can be sufficiently or normally exerted.

When the ZAQ ligand is used as a therapeutic or prophylactic agent as described above, it should be purified to at least 90%, preferably 95% or more, more preferably 98% or more, and even more preferably 99% or more. Is preferred.

ZAQ ligands can be used, for example, as orally as tablets, capsules, elixirs, microcapsules, etc., optionally in sugar coating, or aseptic with water or other pharmaceutically acceptable liquids. It can be used parenterally in the form of injections such as solutions or suspensions. For example, mixing ZAQ ligand with physiologically acceptable carriers, flavoring agents, excipients, vehicles, preservatives, stabilizers, binders, etc. in the unit dosage form generally required for the practice of the formulation It can be manufactured by The amount of the active ingredient in these preparations is such that a suitable dosage in the specified range can be obtained.

Examples of additives that can be incorporated into tablets, capsules, and the like include binders such as gelatin, corn starch, tragacanth, and gum arabic; Excipients such as sesame, leavening agents such as corn starch, gelatin, alginic acid, etc., lubricants such as magnesium stearate, sweeteners such as sucrose, lactose or saccharin, peppermint, cocoa oil or tea. Flavoring agents are used. When the unit dosage form is a capsule, the above type of material may further contain a liquid carrier such as oil and fat. A sterile composition for injection can be formulated according to a conventional pharmaceutical preparation such as dissolving or suspending an active substance in a vehicle such as water for injection, or a naturally occurring vegetable oil such as sesame oil or coconut oil. Examples of aqueous solutions for injection include physiological saline, isotonic solutions containing pudose and other adjuvants (eg, D-sorbitol, D-mannitol, sodium chloride, etc.). In combination with auxiliaries, for example, alcohols (eg, ethanol, etc.), polyalcohols (eg, propylene glycol, polyethylene glycol, etc.), nonionic surfactants (eg, Polysorbate 80 ™, HCO-50, etc.) Is also good. Examples of the oily liquid include sesame oil and soybean oil, and may be used in combination with benzyl benzoate, benzyl alcohol, or the like as a solubilizing agent. In addition, buffers (for example, phosphate buffer, sodium acetate buffer, etc.), soothing agents (for example, Shiridani benzalkonium, proforce hydrochloride, etc.), stabilizers (for example, human serum albumin, polyethylene glycol, etc.) ), A preservative (eg, benzyl alcohol, phenol, etc.), an antioxidant, and the like. The prepared injection solution is usually filled in an appropriate ampoule.

The preparations obtained in this way are safe and have low toxicity, and can be used, for example, in mammals (eg, humans, rats, mice, guinea pigs, egrets, sheep, pigs, pigs, dogs, cats, dogs, monkeys, etc.). ) Can be administered.

The dosage of the ZAQ ligand varies depending on the target disease, the administration target, the administration route, and the like. For example, when the ZAQ ligand is orally administered for the purpose of treating digestive diseases, it is generally required for an adult (60 kg). About 1 mg to 1000 nig, preferably about 10 to 500 mg, more preferably about 10 to 200 mg of ZAQ ligand is administered per day. In the case of parenteral administration, the single dose of the ZAQ ligand peptide varies depending on the administration target, target disease, etc. For example, for the purpose of treating gastrointestinal diseases, ZAQ ligand is administered to adults ( Weighing 60 kg) In this case, it is convenient to administer the ZAQ ligand per day by injecting about 1 to about L00 Omg, preferably about 1 to 20 Omg, more preferably about 10 to 10 Omg to the affected area. is there. In the case of other animals, the dose can be administered in terms of 60 kg.

In the drawings of the present specification, bases, amino acids, and the like are represented by abbreviations based on the abbreviations by the IUPAC-IUB Commission on Biochemical Nomenclature or the abbreviations in the art, and examples thereof are described below. When there is an optical isomer for an amino acid, the L-isomer is indicated unless otherwise specified.

DNA: complementary deoxyribonucleic acid

A: Adenine

T: Thymine

G: Guanin

C: Cytosine

RNA: ribonucleic acid

mRNA: messenger liponucleic acid

EDTA: Ethylenediaminetetraacetic acid

SD S: Sodium dodecyl sulfate

DTT: Dithiothreitol

G 1 y (G): glycine

A 1 a (A): Aranine

V a 1 (V):

Leu (L): Leucine

I 1 e (I): Isoleucine

S e r (s): Serine

Th r (T): Threonine

Cys (C): Sistine

Me t (M): Methionin

G 1 u (E): gnoretamic acid As (D): Aspartic acid

L y s (K): lysine

A r g (R): Anoreginin

H is (H): histidine

P he (F): feniralanin

T y r (Y): Tyrosine

T r p (w): Tribute fan

Pro (P): Proline

A s n (N): Asparagine

G 1 n (Q): Glutamine

A s x: A s + A s n

G 1x: G 1 u + G 1 n The sequence numbers in the rooster s column table in the present specification indicate the following sequences.

[SEQ ID NO: 1]

2 shows the amino acid sequence of the ZAQ receptor.

[SEQ ID NO: 2]

The nucleotide sequence of the DNA encoding the ZAQ receptor is shown (ZAQC).

[SEQ ID NO: 3]

Shows the nucleotide sequence of the DNA encoding the ZAQ receptor (ZAQT).

[SEQ ID NO: 4]

2 shows the nucleotide sequence of the primer ZAQC Sa1 used in Reference Example 1.

[SEQ ID NO: 5]

3 shows the nucleotide sequence of the primer ZAQC Spe used in Reference Example 1.

[SEQ ID NO: 6]

3 shows the amino acid sequence of the N-terminal of the ZAQ-activated peptide purified in Reference Example 2. [SEQ ID NO: 7]

7 shows the nucleotide sequence of primer ZF1 used in Reference Example 3.

[SEQ ID NO: 8] 7 shows the nucleotide sequence of primer ZF2 used in Reference Example 3.

[SEQ ID NO: 9]

7 shows the nucleotide sequence of primer ZF3 used in Reference Example 3.

[SEQ ID NO: 10]

3 shows the base sequence at the 3 'end of DNA encoding the human ZAQ ligand peptide obtained in Reference Example 3.

[SEQ ID NO: 11]

The base sequence of primer ZAQL-CF used in Reference Example 3 is shown.

[SEQ ID NO: 12]

3 shows the nucleotide sequence of primer ZAQL—XR1 used in Reference Example 3.

[SEQ ID NO: 13]

The base sequence of the DNA fragment obtained in Reference 4 is shown.

[SEQ ID NO: 14]

7 shows the nucleotide sequence of the DNA fragment obtained in Reference Example 4.

[SEQ ID NO: 15]

2 shows the amino acid sequence of human ZAQ ligand precursor peptide.

[SEQ ID NO: 16]

This shows the nucleotide sequence of DNA encoding the human ZAQ ligand precursor peptide represented by SEQ ID NO: 15.

[SEQ ID NO: 17]

2 shows the amino acid sequence of human ZAQ ligand precursor peptide.

[SEQ ID NO: 18]

This shows the nucleotide sequence of DNA encoding the human ZAQ ligand precursor peptide represented by SEQ ID NO: 17.

[SEQ ID NO: 19]

2 shows the amino acid sequence of human ZAQ ligand.

[SEQ ID NO: 20]

This shows the base sequence of cDNA encoding the human ZAQ ligand represented by SEQ ID NO: 19. [SEQ ID NO: 21]

2 shows the amino acid sequence of human ZAQ ligand.

[SEQ ID NO: 22]

This shows the base sequence of cDNA encoding the human ZAQ ligand represented by SEQ ID NO: 21.

[SEQ ID NO: 23]

The nucleotide sequence of the DNA fragment used in Reference Example 4 (4-1) is shown.

[SEQ ID NO: 24]

1 shows the nucleotide sequence of DNA fragment # 1 used in Example 1.

[SEQ ID NO: 25]

2 shows the nucleotide sequence of DNA fragment # 2 used in Example 1.

[SEQ ID NO: 26]

2 shows the nucleotide sequence of DNA fragment # 3 used in Example 1.

[SEQ ID NO: 27]

2 shows the nucleotide sequence of DNA fragment # 4 used in Example 1.

[SEQ ID NO: 28]

2 shows the nucleotide sequence of DNA fragment # 5 used in Example 1.

[SEQ ID NO: 29]

2 shows the nucleotide sequence of DNA fragment # 6 used in Example 1.

[SEQ ID NO: 30]

2 shows the amino acid sequence of human BV8.

[SEQ ID NO: 31]

This shows the nucleotide sequence of cDNA encoding human BV8 represented by SEQ ID NO: 30.

[SEQ ID NO: 32]

3 shows the nucleotide sequence of DNA fragment # 1 used in Example 2-1.

[SEQ ID NO: 33]

3 shows the nucleotide sequence of DNA fragment # 2 used in Example 2-1.

[SEQ ID NO: 34] 3 shows the nucleotide sequence of DNA fragment # 3 used in Example 2-1.

[SEQ ID NO: 35]

3 shows the nucleotide sequence of DNA fragment # 4 used in Example 2-1.

[SEQ ID NO: 36]

3 shows the nucleotide sequence of DNA fragment # 5 used in Example 2-1.

[SEQ ID NO: 37]

3 shows the nucleotide sequence of DNA fragment # 6 used in Example 2-1.

[SEQ ID NO: 38]

The nucleotide sequence of a synthetic DNA encoding the human ZAQ ligand represented by SEQ ID NO: 21 is shown.

[SEQ ID NO: 39]

This shows the base sequence of a synthetic DNA encoding human BV8 represented by SEQ ID NO: 30.

[SEQ ID NO: 40]

2 shows the amino acid sequence of human BV8 precursor peptide.

[SEQ ID NO: 41]

The nucleotide sequence of the DNA encoding the human BV8 precursor peptide is shown. The transformant Escherichia coli DH5α / ρCR2.1—ZAQC obtained in Reference Example 1 described below was obtained from Tsukuba, Ibaraki, Japan, on August 23, 1999 by Riki et al. Higashi 1-chome No. 1 1 Chuo No. 6 (Zip code 305-85 66) National Institute of Advanced Industrial Science and Technology (AIST) Patent Organism Depositary Center (formerly Ministry of International Trade and Industry, National Institute of Advanced Industrial Science and Technology (NI BH)) Deposit number FERM BP-6855, August 4, 1999 Riki, et al., 2-17-85, Jusanhoncho, Yodogawa-ku, Osaka-shi, Japan Deposit number with Fermentation Research Institute (IFO) Deposited as IFO 16301.

The transformant Escherichia coli DH5α / CR2.1—ZAQT obtained in Reference Example 1 described below has been used since August 23, 1999, at 1-1-1, Higashi, Tsukuba, Ibaraki, Japan Address 1 Central No. 6 (Postal code 305—85 66) Patent Organism Depositary, National Institute of Advanced Industrial Science and Technology (formerly Ministry of International Trade and Industry) National Institute of Advanced Industrial Science and Technology (NI BH) Deposited with Patent Organism Depositary, National Institute of Advanced Industrial Science and Technology It has been deposited with the 'Fermentation Research Institute (IFO) under the accession number IFO 16302 as F ERM BP-6856 since August 4, 1999.

The transformant Escherichia coli TOP10 / pHMITA obtained in Reference Example 3 described below has been used since July 13, 2000, 1-1, Tsukuba-Higashi, Ibaraki, Japan 1 6 (Zip code 305-8566) National Institute of Advanced Industrial Science and Technology Patent Organism Depositary Center (formerly Ministry of International Trade and Industry, National Institute of Advanced Industrial Science and Technology, National Institute of Advanced Industrial Science and Technology (NI BH)) Patent, National Institute of Advanced Industrial Science and Technology Deposited with the Depositary No. FERM BP-7219 at the Organisms Depositary Center and deposited with the Fermentation Research Institute (IFO) under the deposit number IFO 16440 since May 26, 2000.

The transformant Escherichia coli TOP 10 / pHMI TG obtained in Reference Example 3 described below has been used since July 13, 2000, 1-1-1 Tsukuba-Higashi, Ibaraki, Japan 1 6 (Zip code 305-8566) National Institute of Advanced Industrial Science and Technology Patent Organism Depositary Center (formerly Ministry of International Trade and Industry, National Institute of Advanced Industrial Science and Technology, National Institute of Advanced Industrial Science and Technology (NI BH)) Patent, National Institute of Advanced Industrial Science and Technology Deposited with the Depositary No. FERM BP-7220 under the deposit number IFO 16441 on May 26, 2000, at the Institute of Fermentation (IFO).

Escherichia coli MM 2 94 (DE 3) Zp TC h 1 ZAQ obtained in Example 1 described below was obtained from Tsukuba East 1-chome, Tsukuba, Ibaraki, Japan from April 27, 2001. No. 1 1 Chuo No. 6 (Zip code 305-856 6) National Institute of Advanced Industrial Science and Technology (AIST) Patent Organism Depositary Center (formerly Ministry of International Trade and Industry, National Institute of Advanced Industrial Science and Technology, National Institute of Biotechnology and Industrial Technology (NI BH)) It has been deposited with the Institute of Fermentation Research (IFO) under the deposit number F ERM BP-7571 as the deposit number IFO 16527 since January 16, 2001 at the National Institute of Advanced Industrial Science and Technology. Escherichia coli MM 294 (DE 3) / pTCh 2 ZAQ obtained in Example 2 described below was obtained from April 27, 2001 at 1-1-1 Tsukuba East, Ibaraki, Japan 1 Chuo No. 6 (Zip code 305-8566) National Institute of Advanced Industrial Science and Technology (AIST) Patent Organism Depositary Center (formerly Ministry of International Trade and Industry, National Institute of Advanced Industrial Science and Technology (NI BH)) National Institute of Advanced Industrial Science and Technology It has been deposited with the Institute for Fermentation of Japan (IFO) under the deposit number FERM BP-7572 as the deposit number IFO 16587 on March 15, 2001 as the deposit number IFO 16587. Example

The present invention will be described more specifically with reference to the following Reference Examples and Examples, but the present invention is not limited thereto.

Cloning of cDNA encoding ZAQ receptor and determination of nucleotide sequence

The human pituitary gland cDNA (CLONTECH) was designated as type II, and two primers, primer 1 (5, one GTC GAC ATG GAG ACC ACC ATG GGG TTC ATG G-3 '; SEQ ID NO: 4) and primer 2 (5 PGR reaction was performed using '-ACT AGT TTA TTT TAG TCT GAT GCA GTC CAC CTC TTC-3;; SEQ ID NO: 5). The composition of the reaction solution used in the reaction was 1/10 of the above cDNA as type III, 1/50 amount of Advantage2 Polymerase Mix (CLONTECH), primer 1 and primer 2 were each 0.2 μl, dNTPs 200 The attached buffer was added to μΜ and the enzyme to make a liquid volume of 25 μl. The PCR reaction is performed at 94 ° C for 2 minutes, followed by three cycles of 94 ° C for 20 seconds, 72 ° C for 100 seconds, and three cycles of 94 ° C for 20 seconds and 68 ° C for 100 seconds. The cycle of 94 ° C for 20 seconds, 64 ° C for 20 seconds, and 68 ° C for 100 seconds was repeated 38 times, and the extension reaction was finally performed at 68 ° C for 7 minutes. The reaction product after the PCR reaction was subcloned into a plasmid vector pCR2.1 (Invitrogen) according to the procedure of a TA cloning kit (Invitrogen). This was introduced into Escherichia coli DH5α, and a clone containing cDNA was transformed into LB agar containing ampicillin. After selection in the medium, the sequences of the individual clones were analyzed and two cDNA sequences, ZAQC (SEQ ID NO: 2) and ZAQT (SEQ ID NO: 3), encoding a novel G protein-coupled receptor protein were obtained. Was. Since all the proteins having the amino acid sequence derived from this cDNA had the same sequence (SEQ ID NO: 1), they were named ZAQ, and the transformant containing the DNA represented by SEQ ID NO: 2 was transformed into Escherichia coli (Escherichia). coli) DH5 o; /pCR2.1- ZAQC and SEQ ID NO: transformants containing been Ru DNA that represented by 3 was designated E. coli DH5 _a /pCR2.1- ZAQT. Reference Example 2 Isolation of peptide that activates ZAQ receptor

(2-1) Preparation of milk extract

Using commercially available pasteurized milk, the following operation was performed to prepare an extract. The milk 2 liters were centrifuged at 10,000 rpm for 15 minutes at 4 ° C using a high-speed centrifuge (CR26H, R10A rotor: Hitachi, Ltd.), and the resulting supernatant was filtered with gauze. The lipid pieces were removed. Acetic acid is added to the supernatant to a final concentration of 1 M, and the mixture is stirred at 4 ° C for 30 minutes. Then, using a high-speed centrifuge (CR26H, R10A rotor: Hitachi, Ltd.), 10,000 rpm, 15 minutes After centrifugation, the supernatant was filtered with gauze to remove insolubles. To the supernatant was added 2 volumes of acetone while stirring, and the mixture was stirred at 4 ° C for 3 hours. Next, the mixture was centrifuged at 10,000 rpm for 15 minutes using a high-speed centrifuge (CR26H, R10A type: Hitachi, Ltd.), and the obtained supernatant was filtered with a gauze to remove insolubles. The obtained supernatant was applied to an orchid tarpaulin evaporator to remove acetone, and finally concentrated to 1350 ml. The obtained concentrate was mixed with 338 ml of getyl ether for every 675 ml, and mixed vigorously in a separating funnel to obtain a water phase after separation of two phases. The same operation was repeated once more for the obtained aqueous phase to obtain a clear aqueous phase. The obtained aqueous phase was concentrated to 800 ml using a rotary evaporator to obtain a final extract.

(2-2) Crude fractionation of milk extract by C18 reversed-phase mouth chromatography

10 g of Sep-Pak C18 (Waters) column packed with silica gel having octadecyl groups immobilized thereon was swollen with methanol and then equilibrated with 1 M acetic acid. The extract (2 liters of milk) prepared in (2-1) was attached to this column. Then, in this column, 1 The gel was washed by flowing 00 ml of 1 M acetic acid. Next, 200 ml of 60% acetonitrile / 0.1% trifluoroacetic acid was passed through the column to elute the crude peptide component of interest. The obtained eluate was concentrated using an evaporator, and then freeze-dried with a freeze dryer (12EL; VirTis).

(2-3) Crude fraction of milk extract by sulfopropyl ion exchange chromatography

A polypropylene column was packed with SP Sephadex C-25 (Amersham Pharmacia Biotech) swollen in 100 mM hydrochloric acid to a volume of 2 ml, and washed with distilled water and 2 M ammonium formate (pH 4.0). After that, the mixture was equilibrated with solution I (2 M ammonium formate: acetate: water = 1: 25: 74). The freeze-dried product obtained in the above (2-2) was dissolved in 20 ml of Solution I, and loaded on 252 ml of SP Sephadex C. After washing with 10 ml of solution I, solution II (2 M ammonium formate: acetonitrile: water = 1: 2.5: 6.5), solution III (2 M ammonium formate: acetonitrile: water = 1: 1: 2), solution IV (2 (Ammonium formate: acetonitrile: water = 1: 0.5: 0.5) Elution was performed at 10 ml each. The obtained solution I to solution IV were freeze-dried using a freeze dryer (12EL; VirTis).

(2-4) Fractionation of milk extract by TSKgel 0DS80Ts reversed-phase high-performance liquid chromatography

A TSKgel ODS-80Ts reversed-phase high-performance liquid chromatography column (Tosoichi Co., Ltd., 4.6 mm x 25 cm) was applied at 40 ° C at a flow rate of 1 ml / min to solution A (0.1% trifluoroacetic acid / Distilled water) Volume 81.7% / B solution (0.1% trifluoroacetic acid / 60% acetonitrile) 8.3% volume was flowed and equilibrated. The freeze-dried product of Solution I to Solution IV obtained in (2-3) above was dissolved in 4 ml of 1 M acetic acid, respectively, and subjected to chromatography. That is, after 4 ml of the lyophilized solution was applied to the column, the volume of solution A was increased to 67% / the volume of solution B to 33% over 1 minute at a flow rate of 1 ml / min, and then the solution A over 40 minutes. Solution B concentration was increased in a linear gradient from 33% volume of 33% ZB solution to 100% of solution A volume of 0% ZB solution. The eluate was fractionated by assigning a fraction number to each 1 ml, and 2 μl of each fraction was mixed with 150 βΐ of 0.2% Bovine Serum Albumin (BSA) / distilled water and freeze-dried. The dried product was used as a sample for assay for measuring the activity of increasing the intracellular Ca ion concentration described in (2-5) below.

(2-5) Measurement of intracellular Ca ion concentration increasing activity using FLIPR

The ZAQ stable expression cell line was prepared as follows. That is, one clone of DH5a / pCR2.1-ZAQC obtained in Reference Example 1 was shake-cultured in an LB medium containing ampicillin to obtain a plasmid pCR2.1-ZAQC. This was treated with the restriction enzymes Sal I and Spe I to cut out the insert coding for ZAQC. Similarly, pAKK0_l.11H treated with restriction enzymes Sal I and Spe I and the insert were ligated using a Ligation Express Kit (CL ONTECH Laboratories, Inc. (CA, USA)) and electroporated into E. coli DH10B. Introduced by law. The structure of the plasmid contained in the obtained clone was confirmed by restriction enzyme treatment and sequence analysis, and a correctly constructed plasmid was used as a plasmid pAK-ZAQC for CH0 cell expression.

This plasmid pAK- ZAQC obtained by introducing transformed Te Rere for CH0 / dhfr ^_ cells (American Type Culture Collect ion) ί This CellPhect Transfection kit (Amersham Pharmacia Biotech, Inc.). First, add 120 μΐ of Buffer A (attached to CellPhect Transfection Kit) to plasmid DNA 4 dissolved in distilled water 1201, stir and let stand for 10 minutes, then Buffer B (attached to CellPhect Transfection Kit) 240 μl was added, and the mixture was vigorously stirred to form a DNA-calcium phosphate complex containing the DNA. 5 x 10 ⁵ CH0 / dhfr- cells were seeded on a 60 mm Petri dish and placed in Ham's F-12 medium (Nissui Pharmaceutical Co., Ltd.) containing 10% fetal calf serum (BIO WHITTAKER). After culturing for 1 S in 5% carbon dioxide gas at 5 ° C., 480/1 of the suspension of the DNA-calcium phosphate complex was dropped on the cells in a petri dish. After culturing the cells at 37 ° C in 5% carbon dioxide for 6 hours, the cells were washed twice with serum-free Ham's F-12 medium, and 15% glycerol was added to the cells in a petri dish. buffer (140 mM NaCl, 25 mM HEPES , 1. mM Na 2 P0 4, pH7. 1) comprising 1. the addition of 2ml were treated for 2 minutes. This was again washed twice with serum-free Ham's F-12 medium, then 10% fetal serum Was cultured in Ham's F-12 medium containing 5% CO 2 at 37 ° C. The cells were dispersed by trypsin treatment, collected from a Petri dish, and 2 × 10 ⁴ cells were inoculated in a 6-well plate, dialyzed 10% fetal bovine serum (JRH BIOSCIENCES), 1 mM MEM non-essential amino acid solution (Dainippon Pharmaceutical Co., Ltd.), 100 units / ml Penicillin ゝ 100 μg / m 1 Dulbecco's modified Eagle medium (DMEM) medium containing Streptomycin (Nissui Pharmaceutical Co., Ltd.) at 37 ° C, 5% carbon dioxide Culture was started in gas. Transformed CH0 cells into which the plasmid has been introduced grow in the medium, but non-transfected cells gradually die, so the medium is replaced on the first and second days of culture to remove dead cells. did. Approximately 21 colonies of transformed CH0 cells that had grown 8 to 10 days after the start of culture were selected. RNA is recovered from the selected cells using a commercially available RNA isolation kit, and ZAQ is highly expressed by the known RT-PCR method. ZAQ-expressing CH0 cell B-1 clone (hereinafter ZAQC-B1 cell) Abbreviated).

As a control, ETA (endothelin A receptor) -expressing CH0 cell clone 24 (hereinafter abbreviated as ETA24 cell; see Journal of Pharmacology and Experimental Therapeutics, Vol. 279, pp. 675-685, 1996) was used.

The activity of increasing the intracellular Ca ion concentration in ZAQC-B1 cells and ETA 24 cells was measured using the FLIPR (Molecular Devices) with respect to the samples for atsey obtained in the above (2-4). For both ZAQC-B1 cells and ETA24 cells, those that had been subcultured in DMEM supplemented with 10% dialyzed fetal bovine serum (hereinafter referred to as dFBS) were used. ZAQC-B1 cells and ETA24 cells are each suspended in a medium (10% dFBS-DMEM) at a concentration of 15 × 10 ⁴ cells / ml and dispensed into a 96-well plate for FLIPR (Black plate clear bottom, Coster). implantation by 200 to each Ueru with vessels ^{(3. 0 X 10 4 cells /} 200 il / Ueru) were used after overnight culture at 37 ° C for a 5% Rei_0 ₂ Inkyubeta in one (hereinafter the cell plates ). H / HBSS (Nissy Hanks 2 (Nissui Pharmaceutical Co., Ltd.) 9., sodium hydrogen carbonate 0.35 g, HEPES 4.77 g, pH 7.4 with sodium hydroxide solution, then filter sterilization) 20 ml, 250 mM Probenecid 200 μl, and 200 f / l fetal serum (FBS) were mixed. Also, 2 vials (50 μg) of Fluo 3-AM (Dojindo Laboratories) were dissolved in 40 μl of dimethinoresolefoxide, 20% Pluronic acid (Molecular Probes) 40 / zl. In addition to the above H / HBSS—Probenecid—FBS, mix and mix Dispensed at each Ueru 100 the cell plate except the culture solution using a pet and incubated for 1 hour at 37 ° C for at 5% C0 ₂ incubator in one (dye Rodin grayed). For the atssay sample obtained in (2-4) above, dilute each fraction with 150 μH of H / HBSS containing 2.5 mM Probenecid, 0.2% BSA, and use it in a 96-well plate for FLI PR. (V-Bottom plate, Coster) (hereinafter referred to as sample plate). After dye loading on the cell plate, wash the cell plate 4 times with a washing buffer containing 2.5 mM Proben ecid in ¾ ^ 33 using a plate washer (Molecular Devices), and wash 100 μΐ after washing. The buffer was left. The cell plate and the sample plate were set on the FLIPR and assayed (50 samples were transferred from the sample plate to the cell plate by the FLIPR). As a result, the above (2-3) IV solution was transferred to the (2) — 4) Fraction No. 53 obtained by reversed-phase high-performance liquid chromatography showed an activity to increase intracellular Ca ion concentration specific to ZAQC-B1 cells.

(2-6) Purification by TSKgel Super-Phenyl Reversed-Phase High-Performance Liquid Chromatography (1) A TSKgel Super-Phenyl Reversed-Phase High-Performance Liquid Chromatography column (0.46 cm X 10 era, Tosoichi Co., Ltd.) . At C, at a flow rate of 1 ml / min, solution A (0.1% trifluoroacetic acid / distilled water) capacity 81.7% / solution B (0.1% trifluoroacetic acid / 60% acetonitrile) capacity 8.3 % To equilibrate. Chromatography was performed on the fraction No. 53 obtained in the above (3-4). That is, after applying 1 ml of the solution of fraction No. 53 to the column, the volume of solution A was increased to 75% / the volume of solution B at 25% over 1 minute at a flow rate of 1 ml / min, and then over 75 minutes. hand

The solution concentration was increased in a linear gradient to a solution volume of 33%.

The eluate was fractionated with a fraction number of 500 1 each. From the fractionated fractions, each 25 1 was mixed with 0.2% BSA1501 and freeze-dried with a freeze dryer (12EL; VirTis). To this dried product, 150 μl of H / HBSS containing 2.5 mM Probenecid, 0.2% BSA was added and dissolved, and 50 / l of this solution was used according to the test method of (2-5) above. By measuring the intracellular Ca ion concentration increasing activity, ZAQC-B1 cells Receptor activity was measured. As a result, it was found that the target component having a receptor activating effect on ZAQC-B1 cells, that is, the ZAQ-active component was mainly eluted in fraction No. 103-105. (2-7) ¾ ³ (2/83 ^> 14.6 / 100 Reversed-phase high-performance liquid chromatography)

AiRPC C2 / C18 ST 4.6 / 100 Reversed-phase high-performance liquid chromatography column (Amersham Pharmacia Biotech, 0.46 cm x 10 cm) was applied at 40 ° C at a flow rate of 1 ml / min to liquid A (heptafluorobutyric acid / distilled). (Water) 95% volume / B solution (0.1% heptafluorobutyric acid / 100% acetonitrile) 5% volume was flowed to equilibrate.

Fraction No.103-105 of the TSKgel Super-Phenyl reversed-phase high-performance liquid chromatography fraction obtained from (2-6) above was directly applied to the RPC C2 / C18 ST 4.6 / 100 reversed-phase column. Solution A (0.1% heptafluorobutyric acid / distilled water) volume 95% / B (0.1% heptafluorobutyric acid / 100% cetonitrile) Volume 5% to 65% A volume at 1 ml / min flow rate for 1 minute / B volume rapidly increased to 35%, then eluted at a flow rate of 1 ml / min with a linear gradient to 50% A volume / 50% B volume over 60 min. The liquid was collected. The eluate was detected as a single peak at 210 nm UV absorption.

The eluate was fractionated by assigning a fraction number of 500 μΐ, and each 10 _μ 1 of each fraction was mixed with 150 _μ % of 0.2% BSA and freeze-dried with a freeze dryer (12EL; VirTis). H / HBS S 150 / zl containing 2.5 mM Probenecid and 0.2% BSA was added to the dried product to dissolve the ZAQC-B1 cells using this solution 501 according to the test method described in (3-5) above. The receptor activating effect on was measured. As a result, it was found that the target component having a receptor activating effect on ZAQC-B1 cells, that is, the ZAQ activating component, was eluted in fraction Nos. 82-84. This activity peak completely coincided with the ultraviolet absorption peak at 210 nm, and it was determined that the peptide had been purified to a single peptide.

(2-8) Structural analysis of purified ZAQ-activated peptide The structure of the ZAQ active ingredient obtained in (2-7) above was determined by the following method. The solvent in the purified sample of the ZAQ activating component was removed using a vacuum concentrator (servant), and the obtained dried product was dissolved in the solvent DMS0 (dimethyl sulfoxide). A part of this solution was subjected to amino acid sequence analysis from the N-terminus using a protein sequencer (Perkin Elmer, PE Biosystems Procise 491cLC). As a result, 14 out of 16 amino acid residues from the N-terminal amino acid residue could be identified (Ala Vallie Thr Gly Ala Xaa Glu Arg Asp Val Gin Xaa Arg Ala Gly ( SEQ ID NO: 6; Xaa is an unidentified residue))). Reference Example 3 Cloning of cDNA for human ZAQ ligand peptide

A Blast search of the database using the N-terminal amino acid sequence of the peptide that activates ZAQ purified from the milk obtained in Reference Example 2 (SEQ ID NO: 6) as a query shows that it is SEQ ID NO: 6. Human EST 0W0467) containing a sequence equivalent to the nucleotide sequence of DNA encoding a peptide having an amino acid sequence was found. Since this sequence did not have a full-length open reading frame, the sequence of the undetermined portion was determined by the RACE method, and a cDNA clone having the full-length open reading frame was obtained. did.

Based on the information of EST (X40467), primers ZF1 (SEQ ID NO: 7), ZF2 (SEQ ID NO: 8) and ZF3 (SEQ ID NO: 9) were prepared, and human testis Marathon-Ready cDNA (CLONTECH) was used as type III. The 3 'RACE experiment described in Section 2 was performed.

ZF1: 5'-GGTGCCACGCGAGTCTCAATCATGCTCC-3 '(SEQ ID NO: 7)

ZF2: 5'-GGGGCCTGTGAGCGGGATGTCCAGTGTG-3 '(SEQ ID NO: 8)

ZF3: 5'-CTTCTTCAGGAAACGCAAGCACCACACC-3 '(SEQ ID NO: 9)

3. 1 μl of 50 x Advantage 2 Polymerase Mix (CLONTECH) was used for the PCR reaction solution of RACE, and the attached 10 χ Advantage 2 PCR buffer (400 raM Tricine-K0H, 150 mM KOAc, 35 mM Mg (0Ac) ₂ , 37.5 μg / ml BSA, 0.05% Tween—20, 0.05% Nonidet-P40) at 5 μl, dNTP mixture (2.5 mM each, Takara Shuzo) at 4 μl, 10 μΜ primer 1 μl of ZF1 and 10 juM Primer API (primer API attached to CLONTECH Marathon-Ready cDNA Kit) 1 μl, 、 type cDNA (CLONTECH, human testis Marathon-Ready cD) NA) was mixed with 5 µl of-and distilled water of 33. After initial denaturation reaction conditions 94 ^D O 60 seconds, 94 ° C'30 seconds - 72 ° C'4 minute cycle reaction 5 times, 94 ° Rei'30 seconds -70 ° 04 minutes of cycling reactions 5 times, Cycle reactions were performed 25 times at 94 for '30 seconds -68 ° 0'44 minutes.

Subsequently, a nested PCR was performed using the reaction solution of the PCR reaction as a type III. The reaction solution was 1 μl of 50 X Advantage 2 Polymerase Mix (CL0NTECH) and the attached 10 x Advantage 2 PCR buffer (400 mM Tricine-K0H, 150 mM KOAc, 35 mM Mg (0Ac) ₂ , 37.5 μg / ml 5 μl of BSA, 0.05% Tween-20, 0.05% Nonidet-P40), 4 μl of dNTP mixture (2.5 mM each, Takara Shuzo), 10 primer ZF2 1 ^ 1, 10 _μ Μ primer ΑΡ2 (primer ΑΡ2 1 jl of type III DNA (attached to Marathon-Ready cDNA Kit from CL0NTECH), 5 μl of type I DNA (50-fold dilution of the PCR reaction solution), and 33 / l of distilled water were prepared. The reaction conditions were as follows: after initial denaturation at 94 ° C for 60 seconds, a cycle reaction of 94 ° C for 30 seconds to 72 ° C for 4 minutes was performed 5 times, and a cycle reaction for 94 ° C for 30 seconds to 70 ° C for 4 minutes Were repeated 5 times, and a cycle reaction of 94 ° 030 seconds-68 ° 044 minutes was performed 25 times.

Subsequently, a second nested PCR was performed using the reaction solution of the PCR reaction as a type II. The reaction solution was 1 / xl of 50 Advantage 2 Polymerase Mix (CL0NTECH), and the attached 10 χ Advantage 2 PCR buffer (400 mM Tricine—KOH, 150 mM KOAc, 35 mM Mg (OAc) ₂ , 37.5 // g / ral 5 μl of BSA, 0.05% Tween-20, 0.05% Nonidet-P40), 4 μl of dNTP mixture (2.5 mM each, Takara Shuzo), 10 μm of primer ZF3 1 μl, 10 μm of primer ΑΡ2 (primer ΑΡ2 is CL0NTECH 1 μl), 5 μl of type I DNA (50-fold dilution of the PCR reaction solution), and 33 of distilled water were prepared. The reaction conditions were as follows: after initial denaturation at 94 ° 060 seconds, 5 cycles of 94 ° C-30 seconds-72 ° C'4 minutes, 5 cycles of 94 ° Ο30 seconds-70 ° C'4 minutes, A cycle reaction of 94 ° C. for 30 seconds—68 ° C. for 44 minutes was performed 25 times. The obtained DNA fragment was cloned using a T0P0 TA Cloning Kit (Invitrogen) according to the method described in the attached manual. The nucleotide sequence of the cloned DNA was decoded using ABI377 DNA sequencer to obtain a 3′-end sequence (SEQ ID NO: 10).

Based on the nucleotide sequence represented by SEQ ID NO: 10 and the information of EST (X40467), primers ZAQL-CF (SEQ ID NO: 11) and ZAQL-XR1 (SEQ ID NO: 12) were prepared. Using human testis Marathon-Ready cDNA (CL0NTECH) as primer type ZAQL-CF and ZAQ PCR was performed using L-XR1.

ZAQL-CF: 5 '-CCACCATGAGAGGTGCCACG- 3' (SEQ ID NO: 1 1)

ZAQL-XR1: 5, -CTCGAGCTCAGGAAAAGGATGGTG-3 '(SEQ ID NO: 12)

PCR reaction solution: 1 μl of PfuTurbo DNA polymerase (Stratagene), 5 μl of attached 10x PCR buffer, 4 μl of 2.5 mM dNTP mixture, 10 zM primer ZAQL-CF and ZAQL-XR1 Were prepared by mixing 2.5 μΐ each, 5 μ 1 of type I DNA, and 30 of distilled water. The reaction conditions were: 95 ° C for 1 minute initial denaturation, 95 ° C for 1 minute-60 ° C, 1 minute to 72 ° C, 1 minute cycle 40 times, and final extension at 72 ° 010 minutes And The obtained DNA fragment was cloned using the TOPOΤA Cloning Kit (Invitrogen) according to the method described in the attached manual. As a result of decoding the nucleotide sequence of the cleaved DNA fragment using the ABI377 DNA sequencer, it was revealed that the DNA fragment had the nucleotide sequence of 371 bp represented by SEQ ID NO: 13 and SEQ ID NO: 14, respectively. Was. The plasmid having the DNA fragment having the nucleotide sequence represented by SEQ ID NO: 13 was named pHMITA, and the plasmid having the DNA fragment having the nucleotide sequence represented by SEQ ID NO: 14 was named pHMITG.

Escherichia coli was transformed with plasmids pHMITA and pHMITG, and named Escherichia coli ΤΟΡΙΟ / ρΗΜΙΤΑ and Escherichia coli TOPlO / pHMITG, respectively.

As a result of analyzing the base sequences of these DNA fragments, the DNA fragment represented by SEQ ID NO: 13 was converted to the human ZAQ ligand precursor peptide represented by SEQ ID NO: 15 (A type, 105 amino acid residues). The DNA fragment containing the coding DNA (SEQ ID NO: 16), the DNA fragment represented by SEQ ID NO: 14 is a human ZAQ ligand precursor peptide represented by SEQ ID NO: 17 (G type, 105 amino acid residues) (SEQ ID NO: 18).

The base sequence represented by SEQ ID NO: 16 and SEQ ID NO: 17 has a typical signal sequence, and the DNA having the base sequence represented by SEQ ID NO: 16 is represented by SEQ ID NO: 19 Contains 258 base pairs of DNA (SEQ ID NO: 20) encoding a human ZAQ ligand peptide (A type, 86 amino acid residues) represented by the following: SEQ ID NO: 17 The DNA having the sequence is represented by SEQ ID NO: 21. It was found that the DNA contained 258 base pairs of DNA (SEQ ID NO: 22) encoding the human-type ZAQ ligand mature peptide (G type, 86 amino acid residues). Reference Example 4 Production of human ZAQ ligand peptide in mammalian cells

(4-1) Construction of human ZAQ ligand precursor peptide mammalian cell expression vector The human ZAQ ligand precursor peptide was digested from plasmid pHMITG obtained in Reference Example 3 by digestion with EcoRI and XhoI restriction enzymes. A 382 bp DNA fragment (SEQ ID NO: 23) containing the coding cDNA was cut out.

Plasmid pHMITG was digested with EcoRI and XhoI, and the resulting DNA was electrophoresed on a 1.5% agarose gel. Cut out. DNA fragments were recovered from the gel pieces using a Gene Clean spin DNA extraction kit (BIO 101). The obtained DNA fragment was cloned in accordance with a standard method at a cleavage site for EcoRI and XhoI restriction enzymes with respect to a mammalian cell expression vector PCAN618 using CMV-IE enhancer and chicken beta-actin promoter as expression promoters. As a result of decoding the nucleotide sequence of the cloned DNA fragment by the method described above, it was confirmed that the DNA fragment had the nucleotide sequence represented by SEQ ID NO: 23. The mammalian cell expression vector having the DNA encoding the human ZAQ ligand precursor peptide was named pCANZAQLg2.

(4-2) Introduction of expression vector into C0S7 cells

C0S7 cells used were purchased from ATCC and subcultured using DMEM medium (supplemented with 10% FBS). The C0S7 cells 1. seeded in 10cm Petri dish so as to be 5 X 10 ⁶ cells / dish using DMEM medium and over晚cultured in 37 ° C, 5% C0 ₂ incubator scratch. Human type ZAQ ligand precursor peptide expression plasmid (pCANZAQLg2) 2 μ (2 μl of ΤΕNoffer t 溶 α 角旱旱 ί) ノ N ノ offer EC (Effectene transfection reagent, Q IAGEN) 298 μΐ was added, and Enhancer 16 was added. μ1 was added, mixed for 1 second, and left at room temperature for 3 minutes. Further, 60 μl of Effectene Transfection Reagent was mixed, mixed for 10 seconds, and left at room temperature for 10 minutes. Remove the cell supernatant from the previous day and once with 10 ml of DMEM medium After washing, 9 ml of DMEM medium was added. The plasmid solution was added to DMEM medium lml dropwise to mix after cell were cultured overnight in 37 ° C, 5% C0 ₂ incubator one was mixed whole. Washed twice with DMEM medium 10 ml, added DMEM medium 10 ml, and cultured overnight in 37 ° C, 5% C0 ₂ in Kyubeta scratch. _Two days later, the culture supernatant was collected.

(4-3) Human ZAQ ligand precursor peptide expression Partial purification of ZAQ-activating peptide from C0S7 cell culture supernatant

(4-3-1) Preparation of C0S7 cell culture supernatant extract expressing human ZAQ ligand precursor peptide

The culture supernatant of the C0S7 cell expressing human ZAQ ligand precursor peptide was collected, and the following operation was performed to prepare an extract. First, 1.1 ml of acetic acid was added dropwise to the cell culture supernatant (about 18.5 ml) to a final concentration of 1 M, followed by stirring for 1 hour. Further Aseto down twice that capacity addition, 4 ° C at stirring for 30 min, then a high-speed centrifugal separator (CR26H, 23 type rotor: Hitachi, Ltd.) using a 15, 000 r centrifugal _P m, 30 minutes Then, a supernatant was obtained. The resulting supernatant was applied to an evaporator to remove acetone, and then lyophilized with a freeze dryer (12EL; VirTis).

(4-3-2) Expression of human ZAQ ligand precursor peptide Sephadex G50 gel filtration chromatography of C0S7 cell culture supernatant and SepPak column mouth chromatography Freezing obtained in (4-3-1) above After dissolving the dried powder in 2 ml of 1 M acetic acid, the mixture was absorbed on a Sephadex G15 (diameter 3 cm, 35 ml, Pharmacia Biotech) column equilibrated with 1 M acetic acid, and then 1 M acetic acid was passed through the column. Each fraction was numbered in ml and fractionated, and freeze-dried with a freeze dryer (12EL; VirTis).

The SepPak C18-5 g column (10 ml) was swollen with methanol and then equilibrated by flowing 0.1% trifluoroacetic acid / distilled water. Sephadex G50 gel filtration chromatography Among the fractionated fractions, freeze-dried fractions No. 1-16 were combined and dissolved in 3 ml of 0.1% trifluoroacetic acid / distilled water, and applied to an S-mark Pak C18-5 g column. After washing with 24 ml of% trifluoroacetic acid / distilled water, elution was carried out with 20 ml of 0.1% trifluoroacetic acid / 60% acetonitrile. The obtained eluate was applied to a servant. (4-3-3) Purification by Super ODS reversed-phase high-performance liquid chromatography

Solution A (0.1% trifluoroacetic acid / distilled water) was applied to a TSKgel Super ODS reversed-phase high-performance liquid chromatography column (Tosoichi, 0.46 cm x 10 cm) at 40 ° C at a flow rate of 1 ml / min. ) And allowed to equilibrate. After applying the SepPak C18-5 g force fraction obtained in (4-3-2) to the servant, the mixture was applied to Super ODS reversed-phase high-performance liquid chromatography, and the solution A (0.1%) was applied at a flow rate of 1 ml / min for 60 minutes. % Trifluoroacetic acid / distilled water) Volume 100% ZB solution (0.1% trifluoroacetic acid / 60% acetonitrile) Volume was increased from 0% to 0% solution A volume and 100% solution B volume was increased in a linear gradient, and the eluate was collected. .

The eluate was fractionated by adding fraction No. to each 1 ml, and the entire fraction fraction was freeze-dried with a freeze dryer (12EL; VirTis). H / HBSS plus 2.5mM Probenecid and 0.2% BSA に δθμ1 was added to the dried product and dissolved. Using this solution, ZAQC-B1 cells were tested by the following test method (4-1-3-4). The receptor activating effect was measured.

(4-3-4) Measurement of ZAQ ligand activity (measurement of intracellular Ca ion concentration increasing activity using FLIPR)

Using the sample obtained in (4-1-3-3) above, F LIPR was used to measure the intracellular Ca ion concentration increasing activity of the ZAQ-expressing cells (ZAQC-B1) obtained in Reference Example 2 (2-5). It was performed using. As a control, h0T7T175-expressing cells (h0T7T175-16; described in WO 00/24890) were used.

Both ZAQC-B1 cells and h0T7T175-16 cells that had been subcultured in DMEM supplemented with 10% dialyzed fetal bovine serum (hereinafter referred to as dFBS) were used. ZAQC-B1 cells and MT7T175-16 cells were each suspended in a medium (10% dFBS-DMEM) at a concentration of 15 × 10 ⁴ cells / ml, and distributed in a 96-well plate for FLIPK (Black plate clear bottom. Coster). a device seeded by 200μ1 each Ueru using ^{(3.0Χ10 4 ΟΘ113 / 200 / Ζ1} / Uweru), and 5% C0 ₂ was incubated in a coater 37 ° C De晚culture, using the (hereafter cell plates ). H / HBSSCHAN KS '9.8 g, sodium hydrogen carbonate 0.35 g, HEPES 4.77 g, pH with sodium hydroxide After adjusting to 7.4, filter sterilization treatment) 21 ml, 210 mM Probenecid 210 μl, and 210 μl of mouse fetal serum (FBS) were mixed. In addition, dissolve 2 µl of Fluo3-AM (50 µg) in 42 µl of dimethylsnorreoxide and 20% Pluronic acid 421, add this to the above H / H BSS-Probenecid-FBS, mix, and mix dispensed at each Ueru ΙΟΟμΙ the cells plates except the culture solution with a pipette and incubated for 1 h in 5% C0 ₂ incubator one 37 ° C (dye the loading). With respect to the sample for Atsushi obtained in (4-1-3-3) above, each fraction was dissolved by adding 150 μl of H / HBSS to which 2.5 mM Probenecid and 0.2% BSA were added, and dissolving in a ^96-well plate for FLIPR ( (V-Bottom plate, Coster) (hereinafter referred to as sample plate). After dye loading of the cell plate was completed, the cell plate was washed four times with a washing buffer containing 2.5 mM Probenecid added to H / HBSS using a plate washer (Molecular Devices), and after washing, 100 washing buffers were left. The cell plate and the sample plate were set on the FLIPR and assayed (the FLIPR transfers 0.05 ml of sample from the sample plate to the cell plate). Fractions ^ .48-68 showed 280 C-B1 cell-specific activity to increase intracellular Ca ion concentration. From this, it was found that the target component having a receptor-activating effect on ZAQC-B1 cells, ie, the ZAQ-activating component, was eluted in fractions Nos. 48-68. Example 1 Production of human ZAQ ligand (SEQ ID NO: 21) in E. coli

Example 1-1 Construction of human Z AQ ligand expression plasmid in E. coli

(a) The structural DNA of the ZAQ ligand was prepared using the following six types of DNA fragments # 1 to # 6.

# 1:

5'-TATGGCGGTGATTACCGGTGCGTGCGMCGTGATGTGCAGTGCGGTGCGGGTACCTGCTGCGCGATTAG CCTGTGGCTGCGTGGTCTG-3 '(SEQ ID NO: 24),

# 2:

5 '-CGTATGTGCACCCCGCTGGGTCGTGAAGGTGAAGAATGCCATCCGGGTAGCCATAAAGTGCCGTTCTTC

CGTAAACGTAAACATCATACCTG-3 '(SEQ ID NO: 25),

# 3: 5, -CCCGTGCCTGCCGAACCTGCTGTGCAGCCGTTTCCCGGATGGTCGTTATCGTTGCAGCATGGATCTGAA

AAACATTAACTTTTAGG-3 '(SEQ ID NO: 26),

#Four:

5'-CACATACGCAGACCACGCAGCCACAGGCTAATCGCGCAGCAGGTACCCGCACCGCACTGCACATCACGT TCGCACGCACCGGTMTCACCGCCA-3 '(SEQ ID NO: 27),

#Five:

5'-AGGCACGGGCAGGTATGATGTTTACGTTTACGGAAGAACGGCACTTTATGGCTACCCGGATGGCATTCT

TCACCTTCACGACCCAGCGGGGTG-3 '(SEQ ID NO: 28),

# 6:

5'-GATCCCTAAMGTTMTGTTTTTCAGATCCATGCTGCAACGATAACGACCATCCGGGAAACGGCTGCAC AGCAGGTTCGGC-3 '(SEQ ID NO: 29).

(b) Phosphorylation of DNA oligomer

Each of the four DNA oligomers (# 2 to # 5) except for # 1 and # 6 above, which should be on the 5 'side, was added to 25 phosphate reactions (DNA oligomer 10 / zg, 50 mM Tris-HCl , H 7.6, 1 OmM MgCl ₂ , ImM spermidine, 1 OmM dithiothreitol (hereinafter abbreviated as DTT), 0.1 mg / ml ゥ cyserum albumin (hereinafter abbreviated as BSA), ImM ATP, 10 units T4 polynucleotide kinase (Takara Shuzo)] at 37 ° C for 1 hour, and the 5 'end of each oligomer was phosphorylated. After phenol treatment, 2 volumes of ethanol was added, the mixture was cooled to 170 ° C, and DNA was precipitated by centrifugation.

(c) Ligation of DNA fragments

The DNA7 fragment obtained in (b) above was combined with # 1 and # 6 above to give 1 201. The mixture was kept at 90 ° C. for 10 minutes, gradually cooled to room temperature, annealed, and subjected to a ligation reaction using TaKaRa DNA Ligation Kit ver.2 (Takara Shuzo). To the annealing solution 30 / X1, the II solution 301 included in the kit was added and mixed well, and then 60 μl of the I solution included in the kit was added. The mixture was reacted at 37 ° C. for 1 hour to perform ligation. After that, phenol treatment was carried out, the aqueous layer was collected, twice the volume of ethanol was added, the mixture was cooled to 170 ° C, and then centrifuged. A was precipitated. The thus obtained DNA fragment was subjected to phosphorylation using T4 polynucleotide kinase (Takara Shuzo) and then subjected to the following step (d).

(d) Construction of ZAQ ligand expression vector

As an expression vector, pTCII (described in JP-A-2000-178297) was digested with NdeI and BamHI (Takara Shuzo) at 37 ° C for 2 hours, and then 4.3 kb by 1% agarose gel electrophoresis. Was extracted using a QIAquick Gel Extraction Kit (Qiagen) and dissolved in 25 ju1 of TE buffer. The ligation reaction was carried out using the Ndel and BamHI fragments of pTCII and the structural gene (SEQ ID NO: 38) of the ZAQ ligand prepared as described above using TaKaRa DNA ligation kit ver.2 (Takara Shuzo). Escherichia coli JM109 Combinant Cell (Toyobo) was transformed with 101 of this reaction solution, seeded on LB agar medium containing 10 _μg / m1 of tetracycline, and cultured at 37 ° C for 1 晚. Tetracycline resistant colonies The transformant was over晚cultured in LB medium, plasmids were prepared ptch 1 ZAQ using QIA _P rep8 Miniprep Kit (Qiagen). The base sequence of this ZAQ ligand DNA was confirmed using an Applied Biosystems model 377 DNA sequencer. The plasmid pTCh1ZAQ was transformed into Escherichia coli MM294 (DE3) to obtain a ZAQ ligand expression strain Escherichia coli MM294 (DE3) / pTChlZAQ. Example 1-2 Production of ZAQ ligand

The above Escherichia coli MM294 (DE3) / pTChlZAQ was added to LB medium containing 5.Omg / L tetracycline · 1 L (1% peptone, 0.5% yeast extract, 0.5% sodium salt). The culture was shake-cultured at 37 ° (: 8 hours in a 2 L flask. The obtained culture was mixed with 19 L of the main fermentation medium (1.68% sodium monohydrogen phosphate, 0.3% phosphoric acid 2%). Potassium hydrogen, 0.1% ammonium chloride, 0.05% sodium chloride sodium, 0.05% magnesium sulfate, 0.02% defoamer, 0.00025% ferrous sulfate, 0.0005% hydrochloric acid Thiamine, 1.5% budou sugar, 1.5% high-case amino) were introduced into a 5 L fermenter, and aeration and stirring were started at 30 ° C. When it came to, isopropyl-1-β-D —Tiogalactopyranoside was added to a final concentration of 12 mg / L, and the cells were further cultured for 4 hours. After completion of the culture, the culture was centrifuged to obtain about 200 g of wet cells and stored at 180 ° C.

The transformed E. coli MM294 (DE3) / pTChlZAQ has been deposited with the Fermentation Research Institute (IFO) under the accession number IFO16527. Example 1-3 Activation of ZAQ ligand

To 200 g of the cells obtained in Examples 1-2, 20 OmM Tris ZHC 1, 7 M guanidine hydrochloride (pH 8.0) 40 Om 1 was added to dissolve the cells, and then centrifuged (l OOOO rm, 1 hour). 10 liters of 0.4 M arginine, 50 mM Tris ZHC 1, 0.2 mM GSSG, 1 mM GSH (pH 8.0) was added to the supernatant, and activated at 4 ° C. Example 1-4 Purification of Z AQ Ligand

The regenerating solution after the completion of the activation in Example 1-3 was adjusted to pH 6.0, and the SP-Sepharose column (11.3 cm × 15 cm) equilibrated with 50 mM phosphate buffer (pH 6.0) was used. ), And eluted with 600 mM NaCl / 50 mM phosphate buffer (pH 6.0), and the fractions containing the ZAQ ligand were pooled. This fraction was passed through CM-5 PW (21.5 mm × 15 OmmL) equilibrated with 50 mM phosphate buffer (pH 6.0), adsorbed and washed, and then 0-100% B (B = 5 Elution was performed with a step gradient (60 minutes) of OmM phosphate buffer + 1M NaCl, pH 6.05) to obtain a ZAQ ligand fraction (elution time: about 40 minutes). The fraction was further passed through C 4 P-50 (21.5 mml DX30 OmmL, Showa Denko) equilibrated with 0.1% trifluoroacetic acid, and after adsorption and washing, 25-50% B (B : 80% acetate nitrile / 0.1% trifluoroacetic acid) eluted with a step gradient (60 min), pooled Z AQ ligand fraction (elution time approx. 40 min), freeze-dried, About 8 Orag of the lyophilized ligand powder was obtained. Example 1-5 Characterization of Z AQ ligand (a) Analysis using SDS polyacrylamide gel electrophoresis

Example 14 The ZAQ ligand obtained in 1-4 was suspended in Sam1 ebuffer [Laemmli, Nature, 227, 680 (1979)] supplemented with 100 mM DTT, heated at 95 ° C for 1 minute, and then multi-gel Electrophoresis was performed with 15 25 (Daiichi Kagaku). The gel after electrophoresis was stained with Coomassie 'Brilliant' Benolay (Coomassie brillian t blue), and the same position as the recombinant ZAQ ligand sample derived from COS 7 cells obtained in Reference Example (4-3-3) was obtained. A single protein band was observed. From this, the recombinant ZAQ ligand preparation derived from E. coli obtained in Examples 14 to 14 is extremely high in purity and has the same molecular weight as the recombinant ZAQ ligand prepared from COS 7 cells. I found it.

(b) Amino acid composition analysis

The amino acid composition was determined using an amino acid analyzer (Hitachi L-1 8500A Amino Acid Analyzer). As a result, the amino acid composition was consistent with the amino acid composition deduced from the DNA base sequence of the ZAQ ligand (peptide comprising the amino acid sequence represented by SEQ ID NO: 21) (Table 1).

table 1

Base sequence of Z AQ ligand per mole Value predicted from amino acid residues

A s 5. 7 6

Th r ^υ 3. 3 4

S er ^1} 3. 4 4

G 1 x 5.05

P r o 5.66

G 1 y 7. 7 8

A 1 a 3.94

Cy s ²⁾ ND 0

V a 1 2. 9 3

Me t 1 9 2

I 1 e 2 6 3

L e u 8 8

T y r 0

P he 3 7 4

H is 3 8 4

L y s 3 8 4

A r g 8 5 9

Tr_09 acid hydrolysis (6 N HC 1-1% phenol, 110. C, average of 24 and 48 hours hydrolysis)

1) Value excluded from 0 hours

2) Not detected (c) N-terminal amino acid sequence analysis

The N-terminal amino acid sequence was determined using a gas phase protein sequencer (PE Applied Biosystems model 492). As a result, it was consistent with the N-terminal amino acid sequence of the ZAQ ligand deduced from the nucleotide sequence of the DNA of the obtained ZAQ ligand (Table 2).

Table 2 Base sequence of detected Z AQ ligand. Predicted from residue No PTH—amino acid ¹ )

_ (pmol) amino acid

1 A 1 a (99) A 1 a

2 V a 1 (100) V a 1

3 I 1 e (91) I 1 e

4 T r (57) Th r

5 G 1 y (70) G 1 y

6 A 1 a (89) A 1 a

7 N.D.C y s

8 G 1 u (60) G 1 u

9 A r g (49) A r g

10 As p (54) As p

1 1 V a 1 (79) V a 1

12 G 1 n (67) G 1 n

13 N.D.C ys

14 G 1 y (54) G 1 y

15 A 1 a (65) A 1 a

16 G 1 y (47) G 1 y

1 7 Th r (32) Th r

18 N. D. Cy s

19 N.D.Cys

20 A 1 a (36) A 1 a

1) _c ND of analysis using a phenylene Moltrasio Chio hydantoin 0.99 pmo l denotes the undetected. (d) C-terminal amino acid analysis

The C-terminal amino acid was determined using an amino acid analyzer (Hitachi L-8500A Amino Acid Analyzer). The obtained ZAQ ligand was in agreement with the C-terminal amino acid deduced from the DNA base sequence (Table 3).

C-terminal amino acid recovery (%) Phe 49.8 Gas phase hydrazine decomposition method (100 ° C, 3.5 hours) (e) Mass spectrometry

Mass spectrometry was performed using an LCQ ion trap mass spectrometer (manufactured by ThermoQuest) equipped with a nanoESI ion source. As a result, a molecular weight% of 57.55 ± 0.89 was obtained, and the theoretical molecular weight of the ZAQ ligand of SEQ ID NO: 21 and 10 residues of Cys of SEQ ID NO: 21 in which 5 pairs of disulfide bonds were formed (9657 , 3). Example 11 Measurement of Activity of 6 Z AQ Ligand (Measurement of Cell-Caion Concentration Elevation Activity Using FLIPR)

Example 14 Using the purified recombinant E. coli-derived ZAQ ligand sample obtained in 1-4, the method of Reference Example (4-1-3-4) was used to measure the activity (intracellular Ca ion using FLIPR). Measurement of concentration increasing activity). As a result, it had an activity equivalent to that of the C0S7 cell-derived recombinant sample (purified ZAQ ligand) obtained in Reference Example (4-1-3-3). Example 2 of human Z AQ ligand (SEQ ID NO: 30, human Bv 8) in E. coli Example 2-1 Human ZAQ ligand (human Bv8) expression plasmid in E. coli

(a) A human Bv8 structural gene was prepared using the following six DNA fragments # 1 to # 6.

# 1:

5,-TATGGCGGTGATTACCGGTGCGTGCGATAAAGATAGCCAGTGCGGTGGCGGTATGTGCTGTGCGGTGA

GCATTTGGGTGAAA -3 '(SEQ ID NO: 32),

# 2:

5'-AGCATTCGTATTTGCACCCCGATGGGCAAACTGGGCGATAGCTGCCATCCGCTGACCCGTAAAGTGCC GTTTTTTGGCCGCC-3, (SEQ ID NO: 33),

# 3:

5,-GTATGCATCATACCTGCCCGTGCCTGCCGGGCCTGGCGTGCCTGCGCACCAGCTTTAACCGCTTTATT TGCCTGGCGCAGAAATAGG -3 '(SEQ ID NO: 34),

#Four:

5,-CGAATGCTTTTCACCCAAATGCTCACCGCACAGCACATACCGCCACCGCACTGGCTATCTTTATCGCA

CGCACCGGTAATCACCGCCA-3, (SEQ ID NO: 35),

#Five:

5'-ATGATGCATACGGCGGCCAAAAAACGGCACTTTACGGGTCAGCGGATGGCAGCTATCGCCCAGTTTGC CCATCGGGGTGCAAATA -3 '(SEQ ID NO: 36),

# 6:

5,-GATCCCTATTTCTGCGCCAGGCAAATAAAGCGGTTAAAGCTGGTGCGCAGGCACGCCAGGCCCGGCAG GCACGGGCAGGT -3 '(SEQ ID NO: 37). (b) Phosphorylation of DNA oligomer

Each of the four DNA oligomers (# 2 to # 5) excluding # 1 and # 6 above, which should be on the 5 'side, was added to 25 μl of phosphorylation reaction solution (DNA oligomer 10 μg, 50 mM Tris-HCl , pH 7.6, 10 mM MgCl ₂ , ImM spermidine, 10 mM dithiothreitol (hereinafter abbreviated as DTT), 0.1 mg / m 1 ゥ serum album Min (hereinafter abbreviated as BSA), ImM ATP, 10 units T4 polynucleotide kinase (Takara Shuzo)] at 37 ° C for 1 hour to phosphorylate the 5 'end of each oligomer. After the phenol treatment, 2 volumes of ethanol was added, the mixture was cooled to 170 ° C, and DNA was precipitated by centrifugation.

(c) Concatenation of DNA fragments

The DNA fragment obtained in (b) above was combined with # 1 and # 6 to give 120 μl. The mixture was kept at 90 ° C. for 10 minutes, cooled slowly to room temperature, annealed, and subjected to a ligation reaction using TaKaRa DNA Ligation Kit ver.2 (Takara Shuzo). To 30 µl of the annealing solution, 3 µm of the II solution attached to the kit was added, and the mixture was thoroughly mixed. Then, the solution of 601 included in the kit was added, and reacted at 37 ° C for 1 hour to perform ligation. After that, phenol treatment was performed, the aqueous layer was recovered, twice the amount of ethanol was added, the mixture was cooled to 170 ° C, and DNA was precipitated by centrifugation. The thus obtained DNA fragment was subjected to phosphorylation with T4 polynucleotide kinase (Takara Shuzo) and then subjected to the following step (d). (d) Construction of human BV8 expression vector

As an expression vector, pTCII (described in JP-A-2000-178297) was digested with NdeI and BamHI (Takara Shuzo) at 37 ° C for 2 hours, and then subjected to 1% agarose gel electrophoresis. The 4.3 kb DNA fragment was extracted using the QIAquick Gel Extraction Kit (Qiagen) and dissolved in 25 μl of TE buffer. A ligation reaction was carried out between the Ndel and BamHI fragments of pTC II and the human Bv8 structural gene (SEQ ID NO: 39) prepared above using TaKaRa DNA ligation kit ver.2 (Takara Shuzo). Escherichia coli JM109 competent cells (Toyobo) were transformed with 10 1 of this reaction solution, seeded on LB agar medium containing 10 μg Zm 1 of tetracycline, cultured at 37 ° C for 1 晚, and the resulting tetracycline-resistant colonies were selected. It is. This transformant was cultured once in an LB medium, and plasmid pTCh2ZAQ was prepared using QIAprep8 Miniprep Kit (Qiagen). The nucleotide sequence of this human Bv8 DNA was confirmed using an Applied Biosystems model 377 DNA sequencer. The plasmid pTCh2ZAQ was transformed into Escherichia coli MM294 (DE3), and the human Bv8 expression strain Escherichia coli was transformed. Obtained 294 (DE3) I pTCh2ZAQ. Example 2-2 Production of Human Bv8

Escherichia coli MM294 (DE3) / pTCh2ZAQ was added to LB medium containing 5.0 mg / L tetracycline in 1 L (1% peptone, 0.5% yeast extract, 0.5% sodium chloride). The cells were shake-cultured at 37 ° C for 8 hours in an L-volume flask. The obtained culture solution was added to a 19 L main fermentation medium (1.6% sodium monohydrogen phosphate, 0.3% potassium dihydrogen phosphate, 0.1% ammonium chloride, 0.05% sodium chloride). potassium, 0.05% magnesium sulfate, 0.02% antifoaming agent, 0.0002 5% sulfuric acid ferrous, 0.0005% thiamine hydrochloride, 1.5% Budu sugar, 1.5 ⁰ /. Haike Suamino ) Was transferred to a 50-L fermenter equipped with, and aerated stirring was started at 30 ° C. When the turbidity of the culture broth reached 500 klet units, isopropyl-1-β-D-thiogalatatopyranoside was added so that the final concentration became 12 mg / L, and culturing was further performed for 4 hours. After completion of the culture, the culture was centrifuged to obtain about 500 g of wet cells and stored at 180 ° C. Example 2-3 Activation of human type Bv8

To 400 g of the cells obtained in Example 2-2, 800 ml of 20 OmM Tris ZHC 1, 7 M guanidine hydrochloride (pH 8.0) was added to dissolve the cells, followed by centrifugation (l OOOO rm, 1 hour). 20 liters of 0.4 M arginine, 50 mM Tris / HC1, 0.2 mM GS SG, and 1 mM GSH (pH 8.0) were added to the supernatant, and activated at 4 ° C. Example 2-4 Purification of human Bv8

The regenerated solution that had been activated in Example 2-3 was adjusted to pH 6.0, and SP-Sepharose column (11.3 cm XI) was equilibrated with 50 mM phosphate buffer (pH 6.0). After elution with 60 OmM NaCl-5 OmM phosphate buffer (pH 6.0), the fractions containing human Bv8 were pooled. This fraction was equilibrated with 50 mM phosphate buffer (pH 6.0) and SP-5 PW (21. 5mmX 15 OmmL), adsorbed and washed, and eluted with a step gradient (60 minutes) of 0-100% B (B = 5 OmM phosphate buffer + 1 M NaCl, pH 6.05). A type Bv8 fraction (elution time: about 40 minutes) was obtained. The fraction was further passed through C4P-50 (21.5 mm IDX, 300 mL, Showa Denko) equilibrated with 0.1% trifluoroacetic acid, and adsorbed and washed. B: Elution was performed with a step gradient (60 minutes) of 80% acetonitrile / 0.1% trifluoroacetic acid. After pooling the eight human Bv fractions (elution time: about 30 minutes), lyophilization was performed. Approximately 25 m of lyophilized BV8 lyophilized powder was obtained. Example 2-5 Characterization of human Bv8

(a) Analysis using SDS polyacrylamide gel electrophoresis

Human BV8 obtained in Example 2-4 was suspended in Sampiebuffer [Laemmli, Nature, 227, 680 (1979)] supplemented with 10 OmM DTT, and heated at 95 ° C for 1 minute. Electrophoresis was performed on 15/25 (Daiichi Pure Chemicals). Genole after electrophoresis was stained with Coomassie brilliant blue, and as a result, a single protein band was observed at 9 kDa. From this, it was found that the recombinant human BV8 preparation derived from Escherichia coli obtained in Examples 2 to 4 was extremely high in purity.

(b) Amino acid composition analysis

Amino acid composition was determined using an amino acid analyzer (Hitachi L-8500A Amino Acid Analyzer). As a result, it was consistent with the amino acid composition deduced from the DNA base sequence of human Bv8 (a peptide consisting of the amino acid sequence represented by SEQ ID NO: 30) (Table 4). .

Table 4 Nucleotide sequence of human BV8 per monole Number predicted from amino acid residue number

A s 4.04 4

Th r D 4.65

Ser ^x) 4 3 5

G 1 2 3 2

Pro 5 2 5

G 1 y 7 8 8

A 1 a 5 0 5

Cy s ²⁾ ND 0

V a 1 3. 8 4

Me t 2 8 3

I 1 e 4 2 5

L e u 6 6

T y r 0 0

P he 3 7 4

H is 2 9 3

L y s 4 9 5

A r g 5 8 6

Trp09.1 Acid hydrolysis (6 N HC 1-4% thioglycolic acid, average value of hydrolysis at 110 ° C, 24 and 48 hours)

1) Extrapolated to 0 hours

2) Not detected (c) N-terminal amino acid sequence analysis

The N-terminal amino acid sequence was determined using a gas phase protein sequencer (PE Applied Biosystems model 492). As a result, it was consistent with the N-terminal amino acid sequence of human BV8 deduced from the nucleotide sequence of the obtained human BV8 DNA (Table 5).

Table 5 Detected nucleotide sequence of human BV8

Predicted from residue No PTH-amino acid ¹ )

(pmol) Amino acid ―

A 1 a (103) A 1 a

2 V a 1 (99) V a 1

3 I 1 e (88) I 1 e

4 Th r (54) Th r

5 G 1 y (66) G 1 y

6 A 1 a (79) A 1 a

7 N.D.C y s

8 A s p (47) As

9 Lys (62) Lys

0 A s p (50) As

S e r (36) S e r

12 G 1 n (52) G 1 n

1 3 N.D.C y s

14 G 1 y (44) G 1 y

15 G 1 y (55) G 1 y

16 G 1 y (56) G 1

1 7 Me t (50) Me t

18 N. D. Cys

1 9 N.D.C y s

20 A 1 a (33) One A 1 a

1) It was detected as a PTH (phenylthiohydantoin) derivative. Analysis was performed using 150 pmol of human Bv8.

ND indicates not detected. (d) C-terminal amino acid analysis

The C-terminal amino acid was determined using an amino acid analyzer (Hitachi L-8500A Amino Acid Analyzer). The obtained human BV8 coincided with the C-terminal amino acid deduced from the nucleotide sequence of the DNA (Table 6). Table 6

C-terminal amino acid recovery (%)

Lys 18.9 Gas phase hydrazine decomposition method (100 ° C, 3.5 hours)

(e) Mass spectrometry

Attach mass spectrometry with nanoESI ion source '

The measurement was performed using a total (made by ThermoQuestone clay). As a result, a molecular weight of 879.2 ± 0.5 force S was obtained, and the theory of human BV8 of SEQ ID NO: 30, and in which the 10-residue Cys of SEQ ID NO: 30 formed 5 pairs of disulfide bonds It was in good agreement with the molecular weight (8792.5). Example 2-6 Measurement of human Bv8 activity (measurement of intracellular Ca ion concentration increasing activity using FLIPR)

Using the purified recombinant Escherichia coli-derived Bv8 preparation obtained in Example 2-4, the activity was measured (intracellular Ca using FLIPR) using the method of Reference Example (4-1-3-4). Measurement of ion concentration increasing activity). As a result, it had an activity equivalent to that of the recombinant sample derived from CH0 cells (purified human Bv8). Industrial applicability The production method of the present invention is useful for industrially producing a pharmacologically active ZAQ ligand in a large amount and efficiently as compared with the conventional production method.

Claims

The scope of the claims

1. A peptide having the ability to bind to a protein containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1 or a salt thereof, or to activate the protein or a salt thereof. Alternatively, an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, characterized in that a salt thereof is expressed in a prokaryotic host by genetic engineering and refolded in a redox buffer. A method for producing an active peptide or a salt thereof, which has the ability to bind to a protein or a salt thereof, or to activate the protein or a salt thereof.

2. A peptide having the ability to bind to a protein containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1 or a salt thereof, or to activate the protein or the salt thereof, or 2. The method according to claim 1, wherein the salt is an peptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 21 or a salt thereof.

3. A peptide having the ability to bind to a protein containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1 or a salt thereof, or to activate the protein or a salt thereof, or The method according to claim 1, wherein the salt is a peptide containing the amino acid sequence represented by SEQ ID NO: 21 or a salt thereof.

4. A peptide having the ability to bind to a protein containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1 or a salt thereof, or to activate the protein or a salt thereof, or The method according to claim 1, wherein the salt is a peptide containing the amino acid sequence represented by SEQ ID NO: 19 or a salt thereof.

5. A peptide having the ability to bind to a protein containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1 or a salt thereof, or to activate the protein or a salt thereof, or a peptide thereof. The salt has the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 30. 2. The method according to claim 1, which is a peptide or a salt thereof.

6. A peptide having the ability to bind to a protein containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1 or a salt thereof, or to activate the protein or a salt thereof; 2. The method according to claim 1, wherein the salt is a peptide containing the amino acid sequence represented by SEQ ID NO: 30 or a salt thereof.

7. Genetically engineered peptide or salt thereof containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 21 or SEQ ID NO: 30 in a prokaryotic host And refolding in a redox buffer, the method for producing the active form of the peptide or a salt thereof.

8. A peptide containing an amino acid sequence represented by SEQ ID NO: 21, SEQ ID NO: 19 or SEQ ID NO: 30 or a salt thereof is genetically engineered in a prokaryotic host, and is expressed in a redox buffer. A method for producing an active peptide or a salt thereof, which is characterized by refolding.

9. The method according to claim 1, wherein the redox buffer is a buffer containing reduced glutathione and oxidized glutathione.

10. The production method according to claim 9, wherein the concentration of reduced daltathione and oxidized daltathione in the redox buffer is about 0.01 to 100 mmol / liter, respectively.

9. The method according to claim 8, wherein the 11 buffer is a Tris buffer.

12.The method according to claim 1, wherein the pH of the redox buffer is in the range of 7 to 9.

The method according to claim 1, wherein the pH of the 13 redox buffer is about 8. 14. The production method according to claim 1, wherein the 14 redox buffer further contains an amino acid having no mercapto group.

15. The production method according to claim 14, wherein the amino acid having no mercapto group is arginine.

16. The method according to claim 14, wherein the concentration of the amino acid having no mercapto group in the redox buffer is about 0 liter.

2. The production method according to claim 1, wherein the refolding is performed at 170 to 30 ° C.

18. The ability to bind to a protein containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1 or a salt thereof, or to activate the protein or a salt thereof. The production method according to claim 1, wherein the peptide or the salt thereof is expressed in a prokaryotic host by genetic engineering, the cells are solubilized, and then refolded in a redox buffer.

1 9 · A peptide containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 21 or SEQ ID NO: 30 or a salt thereof is genetically engineered into a prokaryotic host. The method according to claim 7, wherein the cells are solubilized, and the cells are solubilized, and then refolded in a redox buffer.

20. The method according to claim 18 or claim 19, wherein the solubilization is carried out in the absence of a reducing agent.

21. Has the ability to bind to or activate a protein or a salt thereof containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1 The peptide or a salt thereof is expressed in a prokaryotic host by genetic engineering, the cells are solubilized with a denaturing agent, and then the pH 7 to 9 further containing an amino acid having no mercapto group. 2. The method according to claim 1, wherein the denaturing agent is diluted to an inactive concentration with a redox buffer.

22. A peptide containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 21 or SEQ ID NO: 30 or a salt thereof is genetically engineered into a prokaryotic host. And solubilizing the cells with a denaturing agent, and then diluting the denaturing agent to an inactive concentration with a redox buffer having a pH of 7 to 9 further containing an amino acid having no mercapto group. 8. The production method according to claim 7, wherein: 23. The method according to claim 21, wherein the denaturing agent is guanidine or urea.

24. The production method according to claim 21 or 22, wherein the diluent is diluted with a redox buffer until the concentration of the denaturing agent in the diluent is about 0 to 2 mol / l.

25. Binds to, or binds to, a protein containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1 or a salt thereof. Alternatively, a peptide having the ability to activate a salt thereof or a salt thereof is expressed in a prokaryotic host by genetic engineering, and the peptide or a salt thereof present in the formed inclusion body is converted into a redox buffer. 2. The method according to claim 1, wherein the peptide comprises an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 21 or SEQ ID NO: 30. 26. The production method according to claim 25, wherein

27. A prokaryotic host in which a peptide containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 21 or SEQ ID NO: 30 has been genetically engineered to be denatured Amino acid without mercapto group

A method for producing an active form of the peptide or a salt thereof, which is reacted with a buffer containing reduced daltathione and oxidized glutathione.

1/24

[SEQUENCE LISTING]

110> Takeda Chemical Industries, Ltd. K 120> Method of Producing ZAQ l igand

<130> P01-0292PCT K 150> JP 2001-13027

<151> 2001-01-22

<150> JP 2001-147759

<151> 2001-05-17

<160> 41

<210> 1

<211> 393

K 212> PRT

<213> Human Kuyanagi> 1

Met Glu Thr Thr Met Gly Phe Met Asp Asp Asn Ala Thr Asn Thr Ser

5 10 15

Thr Ser Phe Leu Ser Val Leu Asn Pro His Gly Ala His Ala Thr Ser

20 25 30

Phe Pro Phe Asn Phe Ser Tyr Ser Asp Tyr Asp Met Pro Leu Asp Glu

35 40 45 2/24

Asp Glu Asp Val Thr Asn Ser Arg Thr Phe Phe Ala Ala Lys lie Val

50 55 60

lie Gly Met Ala Leu Val Gly lie Met Leu Val Cys Gly He Gly Asn 65 70 75 80

Phe lie Phe lie Ala Ala Leu Val Arg Tyr Lys Lys Leu Arg Asn Leu

85 90 95

Thr Asn Leu Leu He Ala Asn Leu Ala lie Ser Asp Phe Leu Val Ala

100 105 110 lie Val Cys Cys Pro Phe Glu Met Asp Tyr Tyr Val Val Arg Gin Leu

115 120 125

Ser Trp Glu His Gly His Val Leu Cys Thr Ser Val Asn Tyr Leu Arg

130 135 140

Thr Val Ser Leu Tyr Val Ser Thr Asn Ala Leu Leu Ala lie Ala lie 145 150 155 160

Asp Arg Tyr Leu Ala lie Val His Pro Leu Arg Pro Arg Met Lys Cys

165 170 175

Gin Thr Ala Thr Gly Leu lie Ala Leu Val Trp Thr Val Ser lie Leu

180 185 190 l ie Ala lie Pro Ser Ala Tyr Phe Thr Thr Glu Thr Val Leu Val lie

195 200 205

Val Lys Ser Gin Glu Lys lie Phe Cys Gly Gin lie Trp Pro Val Asp

210 215 220

Gin Gin Leu Tyr Tyr Lys Ser Tyr Phe Leu Phe lie Phe Gly lie Glu 225 230 235 240

Phe Val Gly Pro Val Val Thr Met Thr Leu Cys Tyr Ala Arg lie Ser

245 250 255

Arg Glu Leu Trp Phe Lys Ala Val Pro Gly Phe Gin Thr Glu Gin lie 3/24

260 265 270

Arg Lys Arg Leu Arg Cys Arg Arg Lys Thr Val Leu Val Leu Met Cys

275 280 285

lie Leu Thr Ala Tyr Val Leu Cys Trp Ala Pro Phe Tyr Gly Phe Thr

290 295 300

lie Val Arg Asp Phe Phe Pro Thr Val Phe Val Lys Glu Lys His Tyr 305 310 315 320

Leu Thr Ala Phe Tyr lie Val Glu Cys lie Ala Met Ser Asn Ser Met

325 330 335

lie Asn Thr Leu Cys Phe Val Thr Val Lys Asn Asp Thr Val Vals Tyr

340 345 350

Phe Lys Lys lie Met Leu Leu His Trp Lys Ala Ser Tyr Asn Gly Gly

355 360 365

Lys Ser Ser Ala Asp Leu Asp Leu Lys Thr lie Gly Met Pro Ala Thr

370 375 380

Glu Glu Val Asp Cys lie Arg Leu Lys

385 390 ku 210〉 2

C 211> 1179

K 212> DNA

K 213〉 Human K 400〉 2

atggagacca ccatggggtt catggatgac aatgccacca acacttccac cagcttcctt 60 tctgtgctca accctcatgg agcccatgcc acttccttcc cattcaactt cagctacagc 120 gactatgata tgcctttgga tgaagatgag gatgtgaccg attccttggct gtt

＞ <＞ Window 6/24

gtcgacatgg agaccaccat ggggttcatg g 31 ku 210〉 5

<211> 36

K 212> DNA

K 213〉 Artificial Sequence K 220〉

K 223> Primer K shelf> 5

actagtttat tttagtctga tgcagtccac ctcttc 36

<210> 6

C 211> 16

<212> PRT

213〉 Bovine

<400> 6

Ala Val lie Thr Gly Ala Xaa Glu Arg Asp Val Gin Xaa Arg Ala Gly

5 10 15 ku 210〉 7

K 211> 28

K 212> DNA

K 213〉 Artificial Seauence K 220〉 <223> Primer shelf> 7

ggtgccacgc gagtctcaat catgctcc 28

<210> 8

K 211> 28

<212> DNA

K 213〉 Artificial Sequence K 220〉

Ku 223> Primer Kuyanagi> 8

ggggcctgtg agcgggatgt ccagtgtg 28 ku 210〉 9

<211> 28

K 212> DNA

213> Artificial Sequence <220>

K 223> Primer K shelf> 9

cttcttcagg aaacgcaagc accacacc 28 8/24 ku 210〉 10

C 211> 409

K 212> DNA

K 213〉 Human K 400〉 10

cttcttcagg aaacgcaagc accacacctg tccttgcttg cccaacctgc tgtgctccag 60 gttcccggac ggcaggtacc gctgctccat ggacttgaag aacatcaatt tttaggcgct 120 tgcctggtct caggataccc accatccttt tcctgagcac agcctggatt tttatttctg 180 ccatgaaacc cagctcccat gactctccca gtccctacac tgactaccct gatctctctt 240 gtctagtacg cacatatgca cacaggcaga catacctccc atcatgacat ggtccccagg 300 ctggcctgag gatgtcacag cttgaggctg tggtgtgaaa ggtggccagc ctggttctct 360 tccctgctca ggctgccaga gaggtggtaa atggcagaaa ggacattcc 409

<210> 11

<211> 20

<212> DNA

213> Artificial Seauence <220>

K 223> Primer K shelf> 11

ccaccatgag aggtgccacg 20 ku 210〉 12

C 211> 24 9/24

<212> DNA

Ku 213> Artificial Seauence <220>

<223> Primer K 400> 12

ctcgagctca ggaaaaggat ggtg 24

<210> 13

K 211> 371

<212> DNA

213> Human

<400> 13

ccaccatgag aggtgccacg cgagtctcaa tcatgctcct cctagtaact gtgtctgact 60 gtgctgtgat cacaggggcc tgtgagcggg atgtccagtg tggggcaggc acctgctgtg 120 ccatcagcct gtggcttcga gggctgcgga tgtgcacccc gctggggcgg gaaggcgagg 180 agtgccaccc cggcagccac aagatcccct tcttcaggaa acgcaagcac cacacctgtc 240 cttgcttgcc caacctgctg tgctccaggt tcccggacgg caggtaccgc tgctccatgg 300 acttgaagaa catcaatttt taggcgcttg cctggtctca ggatacccac catccttttc 360 ctgagctcga g 371

<210> 14

K 211> 371

<212> DNA

<213> Human 10/24

C 400> 14

ccaccatgag aggtgccacg cgagtctcaa tcatgctcct cctagtaact gtgtctgact 60 gtgctgtgat cacaggggcc tgtgagcggg atgtccagtg tggggcaggc acctgctgtg 120 ccatcagcct gtggcttcga gggctgcgga tgtgcacccc gctggggcgg gaaggcgagg 180 agtgccaccc cggcagccac aaggtcccct tcttcaggaa acgcaagcac cacacctgtc 240 cttgcttgcc caacctgctg tgctccaggt tcccggacgg caggtaccgc tgctccatgg 300 acttgaagaa catcaatttt taggcgcttg cctggtctca ggatacccac catccttttc 360 ctgagctcga g 371

<210> 15

C 211> 105

K 212> PRT

K 213〉 Human K 400〉 15

Met Arg Gly Ala Thr Arg Val Ser lie Met Leu Leu Leu Val Thr Thr Val

5 10 15

Ser Asp Cys Ala Val lie Thr Gly Ala Cys Glu Arg Asp Val Gin Cys

20 25 30

Gly Ala Gly Thr Cys Cys Ala lie Ser Leu Trp Leu Arg Gly Leu Arg

35 40 45

Met Cys Thr Pro Leu Gly Arg Glu Gly Glu Glu Cys His Pro Gly Ser

50. 55 60

His Lys lie Pro Phe Phe Arg Lys Arg Lys His His Thr Cys Pro Cys 65 70 75 80

Leu Pro Asn Leu Leu Cys Ser Arg Phe Pro Asp Gly Arg Tyr Arg Cys

85 90 95 11/24

Ser Met Asp Leu Lys Asn lie Asn Phe

100 105

C 210> 16

<211> 315

K 212> DNA

K 213> Human K 400> 16

atgagaggtg ccacgcgagt ctcaatcatg ctcctcctag taactgtgtc tgactgtgct 60 gtgatcacag gggcctgtga gcgggatgtc cagtgtgggg caggcacctg ctgtgccatc 120 agcctgtggc ttcgagggct gcggatgtgc accccgctgg ggcgggaagg cgaggagtgc 180 caccccggca gccacaagat ccccttcttc aggaaacgca agcaccacac ctgtccttgc 240 ttgcccaacc tgctgtgctc caggttcccg gacggcaggt accgctgctc catggacttg 300 aagaacatca atttt 315

<210> 17

C 211> 105

K 212> PRT

<213> Human Kuyanagi> 17

Met Arg Gly Ala Thr Arg Val Ser lie Met Leu Leu Leu Val Thr Thr Val

5 10 15

Ser Asp Cys Ala Val lie Thr Gly Ala Cys Glu Arg Asp Val Gin Cys

20 25 30

Gly Ala Gly Thr Cys Cys Ala lie Ser Leu Trp Leu Arg Gly Leu Arg

35 40 45 12/24

Met Cys Thr Pro Leu Gly Arg Glu Gly Glu Glu Cys His Pro Gly Ser

50 55 60

His Lys Val Pro Phe Phe Arg Lys Arg Lys His His Thr Cys Pro Cys 65 70 75 80

Leu Pro Asn Leu Leu Cys Ser Arg Phe Pro Asp Gly Arg Tyr Arg Cys

85 90 95

Ser Met Asp Leu Lys Asn lie Asn Phe

100 105

<210> 18

<211> 315

<212> DNA

<213> Human

<400> 18

atgagaggtg ccacgcgagt ctcaatcatg ctcc tcctag taac tgtgtc tgactgtgc t 60 gtgatcacag gggcctgtga gcgggatgtc cagtgtgggg caggcacctg ctgtgccatc 120 agcctgtggc t tcgagggct gcggatgtgc accccgctgg ggcgggaagg cgaggagtgc 180 caccccggca gccacaaggt cccct tct tc aggaaacgca agcaccacac c tgtcct tgc 240 t tgcccaacc tgctgtgctc caggt tcccg gacggcaggt accgctgctc catggact tg 300 aagaacatca at ttt 315 C 210> 19

C 211> 86

K 212> PRT

213> Human 13/24 c 400> 19

Ala Val lie Thr Gly Ala Cys Glu Arg Asp Val Gin Cys Gly Ala Gly

5 10 15

Thr Cys Cys Ala lie Ser Leu Trp Leu Arg Gly Leu Arg Met Cys Thr

20 25 30

Pro Leu Gly Arg Glu Gly Glu Glu Cys His Pro Gly Ser His Lys lie

35 40 45

Pro Phe Phe Arg Lys Arg Lys His His Thr Cys Pro Cys Leu Pro Asn

50 55 60

Leu Leu Cys Ser Arg Phe Pro Asp Gly Arg Tyr Arg Cys Ser Met Asp

65 70 75 80

Leu Lys Asn lie Asn Phe

85

<210> 20

K 211> 258

<212> DNA

K 213〉 Human K 400〉 20

gctgtgatca caggggcctg tgagcgggat gtccagtgtg gggcaggcac ctgctgtgcc 60 atcagcctgt ggcttcgagg gctgcggatg tgcaccccgc tggggcggga aggcgaggag 120 tgccaccccg gcagccacaa gatccccttc ttcaggaaac gcaagcacca cacctgtcct 180. tgcttgccca acctgctgtg ctccaggttc ccggacggca ggtaccgctg ctccatggac 240 ttgaagaaca tcaatttt 258

<210> 21 14/24

<211> 86

<212> PRT

<213> Human Ku shelf> 21

Ala Val lie Thr Gly Al a Cys Glu Arg Asp Val Gin Cys Gly Al a Gly

5 10 15

Thr Cys Cys Al alie Ser Leu Trp Leu Arg Gly Leu Arg Met Cys Thr

20 25 30

Pro Leu Gly Arg Glu Gly Glu Glu Cys His Pro Gly Ser His Lys Val

35 40 45

Pro Phe Phe Arg Lys Arg Lys His His Thr Cys Pro Cys Leu Pro Asn

50 55 60

Leu Leu Cys Ser Arg Phe Pro Asp Gly Arg Tyr Arg Cys Ser Met Asp 65 70 75 80

Leu Lys Asn lie Asn Phe

85 ku 210〉 22

K 211> 258

K 212> DNA

Ku 213〉 Human ku 400〉 22

gctgtgatca caggggcctg tgagcgggat gtccagtgtg gggcaggcac ctgctgtgcc 60 atcagcctgt ggct tcgagg gctgcggatg tgcaccccgc tggggcggga aggcgaggag 120 tgccaccccg gcagcccacca ggtcacctcac tcagccctcagccctcagccctc 15/24 tgcttgccca acctgctgtg ctccaggttc ccggacggca ggtaccgctg ctccatggac 240 ttgaagaaca tcaatttt 258

<210> 23

<211> 382

K 212> DNA

K 213> Human K 400> 23

gaattcgccc ttccaccatg agaggtgcca cgcgagtctc aatcatgctc ctcctagtaa 60 ctgtgtctga ctgtgctgtg atcacagggg cctgtgagcg ggatgtccag tgtggggcag 120 gcacctgctg tgccatcagc ctgtggcttc gagggctgcg gatgtgcacc ccgctggggc 180 gggaaggcga ggagtgccac cccggcagcc acaaggtccc cttcttcagg aaacgcaagc 240 accacacctg tccttgcttg cccaacctgc tgtgctccag gttcccggac ggcaggtacc 300 gctgctccat ggacttgaag aacatcaatt tttaggcgct tgcctggtct caggataccc 360 accatccttt cctgagctcg ag 382

<210> 24

K 211> 88

K 212> DNA

213> Artificial Seauence <220>

Ku 223> Primer Kuyanagi> 4

tatggcggtg attaccggtg cgtgcgaacg tgatgtgcag tgcggtgcgg gtacctgctg 60 16/24 cgcgattagc ctgtggctgc gtggtctg 88

<210> 25

<211> 92

<212> DNA

K 213〉 Artificial Seauence K 220〉

K 223> Primer K shelf> 25

cgtatgtgca ccccgctggg tcgtgaaggt gaagaatgcc atccgggtag ccataaagtg 60 ccgttcttcc gtaaacgtaa acatcatacc tg 92 ku 210〉 26

<211> 86

<212> DNA

K 213> Artificial Seauence K 220>

K 223> Primer K shelf> 26

cccgtgcctg ccgaacctgc tgtgcagccg tttcccggat ggtcgttatc gttgcagcat 60 ggatctgaaa aacattaact tttagg 86 ku 210〉 27 17/24 c 211> 94

K 212> DNA

K 213> Artificial Seauence K 220>

223> Primer <400> 27

cacatacgca gaccacgcag ccacaggcta atcgcgcagc aggtacccgc accgcactgc 60 acatcacgtt cgcacgcacc ggtaatcacc gcca 94

<210> 28

C 211> 93

<212> DNA

213> Artificial Sequence <220>

K 223> Primer K 400> 28

aggcacgggc aggtatgatg tttacgttta cggaagaacg gcactttatg gctacccgga 60 tggcattctt caccttcacg acccagcggg gtg 93 ku 210〉 29

C 211> 81

K 212> DNA

Ku 213〉 Artificial Sequence <220>

<223> Primer K 400> 29

gatccctaaa agt taatgt t t t tcagatcc atgctgcaac gataacgacc atccgggaaa 60 cggctgcaca gcaggt tcgg c 81

<210> 30

C 211> 81

K 212> PRT

K 213〉 Human K shelf> 30

Ala Val lie Thr Gly Ala Cys Asp Lys Asp Ser Gin Cys Gly Gly Gly

5 10 15

Met Cys Cys Ala Val Ser lie Trp Val Lys Ser lie Arg lie Cys Thr

20 25 30

Pro Met Gly Lys Leu Gly Asp Ser Cys His Pro Leu Thr Arg Lys Val

35 40 45

Pro Phe Phe Gly Arg Arg Met His His Thr Cys Pro Cys Leu Pro Gly

50 55 60

Leu Ala Cys Leu Arg Thr Ser Phe Asn Arg Phelie Cys Leu Ala Gin 65 70 75 80

Lys Ku 210〉 31

C 211> 243 19/24 ku 212> DNA

<213> Human Kupo> 31

gccgtgatca ccggggcttg tgacaaggac tcccaatgtg gtggaggcat gtgctgtgct 60 gtcagtatct gggtcaagag cataaggatt tgcacaccta tgggcaaact gggagacagc 120 tgccatccac tgactcgtaa agttccattt tttgggcgga ggatgcatca cacttgccca 180 tgtctgccag gcttggcctg tttacggact tcatttaacc gatttatttg tttagcccaa 240 aag 243

<210> 32

C 211> 82

<212> DNA

<213> Artificial Seauence <220>

K 223〉 Primer K 400〉 32

tatggcggtg attaccggtg cgtgcgataa agatagccag tgcggtggcg gtatgtgctg 60 tgcggtgagc atttgggtga aa 82

<210> 33

C 211> 82

K 212> DNA

Ku 213〉 Artificial Seauence 20/24 c 220>

K 223> Primer K shelf> 33

agcattcgta tttgcacccc gatgggcaaa ctgggcgata gctgccatcc gctgacccgt 60 aaagtgccgt tttttggccg cc 82 ku 210〉 34

<211> 87

<212> DNA

213> Artificial Seauence <220>

K 223〉 Primer K 400〉 34

gtatgcatca tacctgcccg tgcctgccgg gcctggcgtg cctgcgcacc agctttaacc 60 gctttatttg cctggcgcag aaatagg 87

<210> 35

K 211> 88

K 212> DNA

213> Artificial Seauence <220>

<223> Primer 21/24 shelf> 35

cgaatgcttt tcacccaaat gctcaccgca cagcacatac cgccaccgca ctggctatct 60 ttatcgcacg caccggtaat caccgcca 88 ku 210> 36

<211> 85

<212> DNA

K 213> Artificial Seauence K 220>

K 223〉 Primer K 400〉 36

atgatgcata cggcggccaa aaaacggcac tttacgggtc agcggatggc agctatcgcc 60 cagtttgccc atcggggtgc aaata 85 ku 210〉 37

C 211> 80

K 212> DNA

213> Artificial Seauence <220>

K 223> Primer K shelf> 37

gatccctatt tctgcgccag gcaaataaag cggttaaagc tggtgcgcag gcacgccagg 60 cccggcaggc acgggcaggt 80 22/24

<210> 38

K 211> 258

<212> DNA

Ku 213〉 Artificial Seauence

<220>

223>

<400> 38

gcggtgatta ccggtgcgtg cgaacgtgat gtgcagtgcg gtgcgggtac ctgctgcgcg 60 attagcctgt ggctgcgtgg tctgcgtatg tgcaccccgc tgggtcgtga aggtgaagaa 120 tgccatccgg gtagccataa agtgccgttc ttccgtaaac gtaaacatca tacctgcccg 180 tgcctgccga acctgctgtg cagccgtttc ccggatggtc gttatcgttg cagcatggat 240 ctgaaaaaca ttaacttt 258 ° 210> 39

C 211> 243

K 212> DNA

<213> Artificial Seauence K 220>

C 223> c 400> 39

gcggtgatta ccggtgcgtg cgataaagat agccagtgcg gtggcggtat gtgctgtgcg 60 gtgagcattt gggtgaaaag cattcgtatt tgcaccccga tgggcaaact gggcgatagc 120 23/24 tgccatccgc tgacccgtaa agtgccgttt tttggccgcc gtatgcatca tacctgcccg 180 tgcctgccgg gcctggcgtg cctgcgcacc agctttaacc gctttatttg cctggcgcag 240 aaa 243 ku 210> 40

<211> 108

<212> PRT

<213> Human Ku 400> 40

Met Arg Ser Leu Cys Cys Ala Pro Leu Leu Leu Leu Leu Leu Leu Pro

5 10 15

Pro Leu Leu Leu Thr Pro Arg Ala Gly Asp Ala Ala Val lie Thr Gly

20 25 30

Ala Cys Asp Lys Asp Ser Gin Cys Gly Gly Gly Met Cys Cys Ala Val

35 40 45

Ser lie Trp Val Lys Ser lie Arg lie Cys Thr Pro Met Gly Lys Leu

50 55 60

Gly Asp Ser Cys His Pro Leu Thr Arg Lys Val Pro Phe Phe Gly Arg 65 70 75 80

Arg Met His His Thr Cys Pro Cys Leu Pro Gly Leu Ala Cys Leu Arg

85 90 95

Thr Ser Phe Asn Arg Phe lie Cys Leu Ala Gin Lys

100 105

<210> 41

<211> 324 24/24 ku 212> DNA

213> Human

<400> 41

atgaggagcc tgtgctgcgc cccactcctg ctcctcttgc tgctgccgcc gctgctgctc 60 acgccccgcg ctggggacgc cgccgtgatc accggggctt gtgacaagga ctcccaatgt 120 ggtggaggca tgtgctgtgc tgtcagtatc tgggtcaaga gGataaggat ttgcacacct 180 atgggcaaac tgggagacag ctgccatcca ctgactcgta aagttccatt ttttgggcgg 240 aggatgcatc acacttgccc atgtctgcca ggcttggcct gtttacggac ttcatttaac 300 cgatttattt gtttagccca aaag 324