WO2002057301A2 - Gene silencing suppressor - Google Patents

Abstract

A plant virus protein, displaying PTGS suppressor activity, and the use thereof as a suppressor of the gene silencing mechanism in a non-plant host cell (i.e. an animal cell) is provided. Examples of the plant virus protein include cysteine-rich proteins, such as the 16K CRP of tobacco rattle virus or the 12K CRP of pea early browning virus. Also described is a method of suppressing or inhibiting a gene silencing mechanism in a non-plant orgnism or cell through the use of a plant virus protein, exhibiting post transcriptional gene silencing suppressing functions.

Description

GENE SILENCING SUPPRESSOR

The present invention relates to the suppression of post-transcription gene silencing due to the presence of a cysteine-rich plant virus protein in the host.

Plants employ post transcriptional gene silencing (PTGS) as a mechanism to defend themselves against infection by viruses. In response, some plant viruses encode proteins that suppress PTGS and, thus, increase virus pathogenicity. Here we show that the Tobacco rattle virus (TRV) 16K cysteine-rich protein (CRP) is a silencing suppressor that is required for efficient virus multiplication, both in protoplasts and plants. The 16K protein can be substituted by the 12K CRP from the related virus, Pea early- browning virus and by the 2b protein, a known silencing suppressor, from the unrelated virus, Cucumber mosaic virus.

Expression^""of^"the 16K CRP and other PTGS suppressors^" in a Drosophila cell system prevents silencing of a lacZ gene, demonstrating directly that the 16K CRP is a suppressor of post-transcriptional gene silencing. These results identify the tobravirus CRPs as a new class of PTGS-suppressors and suggest that the CRPs encoded by other, unrelated, plant viruses may also be silencing suppressors.

Plant viruses vary considerably in their ability to infect different plant species so that, for example, Cucumber mosaic virus (CMV) is known to infect more than 775 species from at least 85 different families (Palukaitis et al . , 1992), whereas, Potato leafroll virus infects only about 20 species, most of which are from the family Solanaceae (Harrison, 1984) . A particular virus might be unable to infect a plant species because the plant lacks a protein that is required for efficient replication of the virus, for example, Arabidopsis TOMl (Yamanaka et al . , 2000).

Alternatively the plant may actively resist infection by the virus, for example, tobacco plants carrying the N gene are resistant to strains of Tobacco mosaic virus (TMV) but are not resistant to other tobamoviruses ( hitham et al . , 1994) . A more general resistance mechanism, referred to as systemic acquired resistance (SAR) , also exists in tobacco and other plants (Sticher et al . , 1997). In this process, challenge to the lower leaves of a plant with ^'TMV (or other unrelated pathogens) induces partial resistance to TMV (or other viruses) in uppe-rr-'Uninoculated leaves. SAR- is—dependent on the 1 synthesis of salicylic acid (SA) and exogenous

2 application of SA can induce resistance to viruses.

3 However, SA-mediated resistance appears to act by

4 several mechanisms, as TMV is inhibited at the stage

5 of virus replication, whereas CMV is blocked in

6 systemic movement (Chivasa efc al . , 1997; Naylor et

7 al . , 1998) . 8

9 More recently it has been discovered that plants also

10 may employ a cytoplasmic, sequence-specific, RNA

11 degradation system known as post transcriptional gene

12 silencing (PTGS) to combat virus infection. PTGS in

13 plants was first identified as the cause of

14 cosuppression, in which transformation of plants with

15 an additional copy of a host gene could abolish

16 expression of both the transgene and host homologue

17 by degradation of cytoplasmic mRNA (Napoli et al . ,

18 1990) . This system was shown to act on viruses,

19 firstly by the demonstration that transformation of

20 plants with non-translatable viral sequences often

21 resulted in either extreme resistance or in a

22 "recovery" phenotype where plants developed

23 resistance following an initial, virus-susceptible

24 phase (Lindbo et al . , 1993). In other studies it was

25 shown that plants in which expression of a β-

26 glucuronidase (GUS) transgene had been silenced by

27 PTGS were protected against infection by a plant 28 virus that carried part of the same (GUS) gene

29 (English et al . , 1996). Furthermore, it was shown

30 that host gene or transgene expression could be ^•3i-^~ silenced following infection w±ttra virus^' carrying part (or all) of the same gene (Kumagai et al . , 1995; Ruiz et al . , 1998) .

Several approaches have been taken to examine in detail the interaction of plant viruses with the gene silencing process. Infection with CMV of plants that carried post-transcriptionally silenced transgenes (GUS and nitrate reductase) led to the reversal of PTGS and resumption of transgene expression in newly emerging leaves (Beclin et al . , 1998). Earlier work had identified the CMV 2b protein as a pathogenicity determinant that is required for symptom formation and systemic invasion of particular hosts (Ding et al . , 1995). Silencing of a green fluorescent protein (GFP) transgene in Nicotiana benthamiana plants was reversed following infection with Potato virus X (PVX) that had been modified to express the CMV 2b gene, demonstrating that the 2b protein is a silencing suppressor (Brigneti et al . , 1998). This and other studies showed that the HC-Pro proteins of Potato virus Y and Tobacco etch virus can also function as silencing suppressors (Anandalakshmi et al . , 1998; Kasschau et al . , 1998). Evidence that PTGS is a defensive system that can target viruses comes from studies of Arabidopsis mutants ( sgs2 and sgs3 ) that originally were isolated in a screen for plants impaired in the silencing of a GUS transgene (Elmayan et al . , 1998) . These plants have an increased susceptibility to CMV, showing that the PTGS system does provide some protection against this virus (Mourra-i et a-i.-,—2-000) . Interestingly, the sgs mutants do not have increased susceptibility to two other viruses, Turnip mosai c virus and Turnip vein clearing virus. Plant virus-encoded silencing suppressors may target different components of the PTGS system. For example, the CMV 2b protein prevents initiation of silencing in newly emerging tissues but has no effect on already established silencing. In contrast the potyvirus HC-Pro protein suppresses silencing in all tissues (Brigneti et al . , 1998).

A survey of a small number of other plant viruses showed that the comovirus Cowpea mosaic virus, the geminivirus African cassava mosaic virus, the potexvirus Narcissus mosaic virus, the tobamovirus TMV, the sobemovirus Rice yellow mottle virus (RYMV) , the tombusvirus Tomato bushy stunt virus (TBSV) and the tobravirus Tobacco rattle virus (TRV) also were able to suppress GFP silencing (Voinnet et al . , 1999) . Although in this study the potexvirus PVX did not suppress silencing, using a different assay these authors showed that PVX is in fact able to prevent systemic silencing (Voinnet et al . , 2000). Thus, it seems probable that many plant viruses encode proteins that allow them to evade or inhibit PTGS in certain plant species, and that different suppressors target different parts of the PTGS pathway.

Inhibiting gene silencing in a host organism allows an increase and/or in certain cases renders possible the -expres-si-on—ef a transgene which ca-n-be--in-t-rΘdue-ed 1 within the organism either through a foreign vector

2 or through the genetic modification of the host

3 organism itself. 4

5 Thus suppression or inhibition of the gene silencing

6 mechanism may have many therapeutical implications,

7 especially in gene therapy for humans, when a foreign

8 gene expressing, for example, a therapeutic substance

9 needs to be introduced and expressed in a host cell. 0 1 Statement of the invention 2 3 According to the present invention there is provided 4 a method of suppressing or inhibiting gene silencing 5 mechanisms in a non-plant host cell through the use 6 of a plant virus protein exhibiting post- 7 transcriptional gene silencing (PTGS) suppressing 8 functions. Preferably the non-plant cells are animal 9 cells or insect cells and more particularly may be 0 mammalian cells. 1 2 The invention further provides a vector which 3 comprises a polynucleotide sequence which encodes the 4 above PTGS suppressor protein, and which 5 advantageously expresses said polynucleotide sequence 6 in a non-plant cell. 7 8 Typically, the PTGS suppressor protein is, or is 9 derived from, the HC-Pro protein of tobacco etch 0 virus (TEV) , the 2b protein of cucumber mosaic virus -1- . —(-G-MV-)-,—the ORF0 protein of pota-t-o- - ea-f-ro-1-1— -virus 1 (PLRV) , the 16K CRP protein of the tobacco rattle

2 virus, the 12K CRP protein of Pea early browning

3 virus and functional equivalents thereof. The term

4 "functional equivalent" refers to modifications of

5 the proteins, wherein the modifications do not

6 adversely affect the ability of the protein (relative

7 to the wild-type form) to suppress gene silencing.

8 Also included are related proteins having, for

9 instance 60% or more homology, preferably 75% or more

10 homology, especially 80% or 90% or more homology with

11 the protein in question. Desirably the related

12 protein will show 95% or more (even 98% or 99%)

13 homology with the protein in question. Amongst

14 functional equivalents of the PTGS suppressor

15 protein, HC-Pro, 2b, ORF0 and 16K CRP or

16 corresponding proteins of other related plant viruses

17 are particularly preferred. 18

19 A further object of the invention is a method to

20 increase the expression and/or replication of a virus

21 in a host cell, said method comprising reduction of

22 post-transcriptional gene silencing by said host cell

23 by expression of a plant virus protein in said non- 24 plant host cell.

25

26 Another object of the invention is a method for

27 protecting a heterologous viral vector or transgene

28 from post-transcriptional gene silencing in a non- 29 plant host cell, the heterologous viral vector or 30 transgene expressing at least one heterologous -31— protein of interest -in the- ost cell, said method comprising the expression of a plant virus protein in said host cell.

A further object of the invention is a method to increase the yield of expression of a heterologous protein expressed by a viral vector or transgene in a non-plant host cell, said method comprising the expression of a plant virus protein in said host cell.

The method of the present invention finds particular utility in the production of a protein of interest (for example a therapeutic protein) in a biofactory, such as an animal organism.

Any heterologous protein (which term is deemed to include small protein molecules or peptides) may be used in the present invention and there is no particular limitation as to size (which in any event would depend only upon the viral vector, if used) . Mention may be made of antibodies (including antibody-type molecules such as ScFv, for example) , protein hormones such as GnRH, insulin or the like, cellular receptors or other biologically active proteins as being exemplary of heterologous proteins of interest. The heterologous protein will in general be a pre-determined molecule which is specifically selected for expression.

The invention further relates to a vector which comprises a -pel-ynue-l-eet-i-de sequence which encodes -the above PTGS suppressor protein, and which expresses said polynucleotide sequence in the non-plant host cell.

The reference to "plant virus protein" refers not only to the full-length wild type version of the protein, but also to variations of such proteins to include minor modifications thereto (for example amino acid deletions, insertions or substitutions) which do not adversely affect its ability to protect heterologous vectors or transgenes from gene silencing by the host cell.

More particularly in one embodiment the plant virus protein is a cysteine-rich protein. Examples of such cysteine-rich protein include the 16K CRP protein, in particular the 16K CRP protein of the tobacco rattle virus, or its functional equivalent. In another embodiment the cysteine-rich protein is the 12K CRP of Pea early browning virus or its functional equivalent.

Whilst protection of nucleic acid, and particularly RNA, from silencing machinery is exemplified in plant cells and insect cells, protection in other types of host organisms, such as animals, fungi etc. using the cysteine-rich plant virus protein expressed transgenically, from viral vectors or by other ways, in medical therapy/gene, therapy/over-expression systems, for example in yeast/fungi (fermentation) -falls-within- -the scope of the present invention-- 1

2 Although the previous study showed that TRV was able

3 to suppress transgene silencing, the specific viral

4 protein responsible for this activity was not

5 identified. TRV, like the other tobraviruses Pea

6 early- browning virus (PEBV) and Pepper ringspot

7 virus, has a bipartite, positive strand RNA genome

8 (MacFarlane, 1999). The larger RNA (RNAl) encodes

9 the 134K and 194K proteins that comprise the viral

10 replicase, a 29 cell-to-cell movement protein, and a

11 16K cysteine-rich protein (CRP) . The smaller RNA

12 (RNA2) varies considerably between isolates, but

13 always encodes the coat protein (CP) and may encode

14 other (2b and 2c) proteins involved in virus

15 transmission by nematodes. A characteristic of the

16 tobraviruses is that RNAl can infect plants

17 systemically in the absence of RNA2 ; i.e. without CP

18 expression and virion formation. This type of

19 infection, referred to as NM-infection, occurs

20 frequently in vegetatively propagated crop plants

21 such as potato and bulbous ornamentals, and is often

22 associated with increased symptom severity. Clearly,

23 therefore, RNAl encodes all the functions necessary

24 for virus multiplication including, possibly,

25 suppression of PTGS/host defence. As the TRV 16K

26 protein is the one protein encoded by RNAl without an

27 assigned function we investigated whether it played a

28 role in viral replication and pathogenicity. 29

30 We have found that the 16K CRP acts to suppress gene

-3-1- silencing in plant and animal cells— 1

2 Thus the invention also relates to the use of a

3 cysteine-rich plant virus protein displaying PTGS

4 suppressor activity as a suppressor of the gene

5 silencing mechanism of a host cell.

6 Preferred host cells are plant cells, for example

7 tobacco plants. Whilst the present invention will

8 normally contemplate the use of whole plants or

9 plantlets as the host cells, limited infection of

10 certain parts of the plant may also be utilised, as

11 of course may be the use of protoplasts or other in

12 vi tro cell cultures. Other host cells include insect

13 cells, especially cell cultures thereof. 14

15 The present invention will now be further described

16 with reference to the following, non-limiting,

17 examples and figures in which: 18

19 Figure Legends 20

21 Figure 1. Deletion of the 16K gene prevents virus

22 infection. (A) Northern blot of RNA extracted from N.

23 tabacum leaves 7 days post inoculation (dpi) . Lanes

24 1-6, inoculated with wild type RΝA1 (transcript from

25 pTRVl) and RΝA2-GFP (transcript from pK20-GFPc) .

26 Lanes 7-12, inoculated with transcripts of pTRVl-

27 IβSand pK20-GFPc. M is RNA from uninoculated plants.

28 C is RNA of N. benthamiana infected with wild type

29 TRV. Blot hybridised with probes specific for TRV

30 RΝA1 and RΝA2. Location of RNAs 1 and 2 is

-3-1 indicated. (B) GFP expression/ v-iewed under UV light, in tobacco leaves inoculated with transcripts of pK20-GFPc and pTRVl (bottom, left ) , pTRVlNB (top , left) , pTRVl-12 (top, right) or pTRVl -16Δ (bottom, right) .

Figure 2. Comparison of 16K and 12K CRPs. (A) Alignment of amino acid sequences of tobravirus CRPs generated by the Clustal programme. Asterisks identify residues that are identical between the 16K and 12K proteins. Hyphens indicate spaces inserted to maximise alignment. Residues forming the CRP motif identified by Diao et al . , 1999 are in solid boxes. C-terminal basic domain is boxed in dashed lines. (B) Schematic drawing of constructs used in this work. Asterisk in pTRVl represents the leaky terminator present in the TRV replicase protein. la/MP denotes the cell-to-cell-movement protein. The single and double terminators inserted into the 16K genes of pTRVl-16stop and pTRVl-lδdstop appear as asterisks below the 16K gene.

Figure 3. Multiplication of 16K mutants. (A) Northern blot of RNA extracted from N. benthamiana plants at 6dpi (inoculated leaf) and 11dpi (systemic leaf) . Lanes 1-3, wild type RNAl (pTRVl) and RNA2- GFP (pK20-GFPc) . Lanes 4-6, pTRVlNB and pK20-GFPc. Lanes 7-9, pTRVl-16Δ and pK20-GFPc. Lanes 10-12, pTRVl-12 and pK20-GFPc. M is RNA from an uninoculated plant. Blot hybridised with probes specific for TRV RNAl and RNA2. (B) GFP-fluorescence indicating systemic movement of TRV derived from pTRVl-12 and pK20-GFPc. (C) Northern blot of RNA extracted from N. benthamiana protoplasts 48 hours after inoculation with transcripts of wild type RΝA2 (pK20-RNA2) and (1) pTRVl, (2) pTRVlNB, (3) pTRVl-16β, (4) pTRVl-12. M is from protoplasts electroporated without transcript. C is RNA from plants infected with TRV. Blot hybridised with probes specific for TRV RNAl and RNA2. RNAl can be seen in lanes 3 and 4 after very long exposure of the blot, and in other protoplast experiments. rRNA denotes ribosomal RNAs in these samples, labelled by ethidium bromide staining. (D) Northern blot of RNA extracted from leaves of N. benthamiana inoculated with transcript RNA2 from pK20-GFPc and transcript RNAl from pTRVlNB (lanes 1 and 2) or pTRVl-16stop (lanes 3-7) . Blot hybridised with probes specific for TRV RNAl and RNA2.

Figure 4. The 16K gene is a pathogenicity determinant. (A) Symptoms on N. tabacum var. Samsun ΝΝ following infection by TRV RΝA1 (top, left) , TRV RΝA1 and RΝA2 (top, right) or TRV RNAl and RNA2-16K. Expression of an additional copy of the 16K gene from RNA2 (RNA2-16K) results in severe stunting and necrosis of the plants. (B) Northern blot of RNA extracted from systemically-infected leaves of plants photographed in (A). Lanes 1-3, RNAl-only infection. Lanes 4-6, infection with RNAl and RNA2. Lanes 7-9, infection with RNAl and RNA2-16K. Position of viral RNAs is indicated by arrows. 1 is RNAl, 2a is wild type RNA2 , 2b is RNA2-16K. rRNA denotes ribosomal RNAs in these samples, labelled by ethidium bromide staining. Blot hybridised with probes specific for TRV RNAl and RNA2.

Figure 5. Heterologous expression of the 16K gene. (A) Upper, uninoculated leaves of tobacco inoculated with transcripts of PVX (left) and PVX-lβK (right) . (B) N. benthamiana plants 20 days after inoculation with transcripts of PVX (left) and PVX-16K (right) . The plants infected with PVX continued to grow after this time, whereas, the severe tip necrosis of the plants infected with PVX-16K was fatal.

Figure 6. Complementation of a 16K mutation in trans . (A) Northern blot of RNA samples of N. benthamiana inoculated with transcripts of (lanes 1- 4) pTRVlNB and pK20-GFPc, (lanes 5-8) pTRVlNB and pK20-16K, (lanes 9-12) pTRVl-lβdstop and pK20-GFPc, (lanes 13-16) pTRVl-lβdstop and pK20-16K. Expression of the 16K gene from RNA2 complements the early termination mutations in the 16 gene on RNAl. M is RNA from uninoculated plants. Blot hybridised with probes specific for TRV RNAl and RNA2. The position of viral RNA 1 and 2 indicated by arrows. (B) Northern blot of RNA samples of N. benthamiana ' inoculated with transcripts of (lanes 1-4) pTRVl- lβdstop and pK20-GFPc, (lanes 5-8) pTRVl-16dstop and pK20-CMV2b, (lanes 9-12) pTRVl-lβdstop and p 20-16K. Expression of the CMV 2b gene from RΝA2 complements the early termination mutations in the 16K gene on RNAl. Blot hybridised with probes specific for TRV RNAi- and RNA2. Figure 7. Suppression of gene silencing in Drosophila cells by the TRV 16K protein. (A) Representative field of view of cells transfected with a plasmid expressing the lacZ gene alone, or (B) with this plasmid and dsRNA to induce silencing, or (C) with this plasmid, dsRNA and a second plasmid expressing the 16K protein. (D) The percentage of cells in a culture expressing the lacZ gene in a transient assay. Cells were transfected with a plasmid expressing the lacZ gene alone [ lacZ) ; or with the plasmid and dsRNA to induce silencing [ lacZ + dsRNA) ; or with the plasmid, dsRNA and a second plasmid expressing the 16K protein ( lacZ + dsRNA + 16K) . A minimum of 100 cells in each of 5 representative fields of view (i.e. >500 cells) was counted and the percentage staining positive for lacZ expression was determined.

EXAMPLE 1: TRV 16K CRP IN PLANTS

Materials and methods

Construction of full-length clone of TRV RNAl

Single-stranded cDNA was synthesised from total RNA extracted from Nicotiana benthamiana plants infected with TRV isolate PpK20 as described previously (MacFarlane et al . , 1991). A full-length clone of RNAl was amplified using a proof-reading polymerase with primers designed to include a T7 RNA polymerase promoter sequence and-Sinai restriction site at the 5' and 3' ends, respectively, of the virus sequence, and ligated into plasmid pCR-TOPO-XL according to the manufacturer's instructions (Invitrogen) . The full- length clone, pTRVl, was linearised with Smal , and transcribed using T7 RNA polymerase (Ambion Inc.) . Transcripts were capped by addition of diguanosine triphosphate to the transcription reaction (MacFarlane et al . , 1991).

Mutation of the 16K gene to produce pTRVlNB, pTRVl- 16Δ, pTRVl-12 and pTRVl-16stop

-Inverse PCR was used to introduce a Ndel site immediately upstream of the 16K initiation codon and a -3 III site immediately after the 16K termination codon. A fragment carrying these mutations was moved into the full-length cDNA clone to produce plasmid pTRVlNB. Subsequently, the 16K gene was deleted by digestion with Ndel and Bglll , blunting with Klenow polymerase and religation to produce plasmid pTRVl- 16Δ.

The 12K gene from RΝA1 of PEBV isolate SP5 was PCR amplified to include an upstream Ndel site and a downstream --.grill site. This fragment was inserted into pTRVlNB in place of the 16K gene to produce plasmid pTRVl-12.

The Νdel-Bglil fragment carrying the 16K gene was reamplified using a mutagenic primer CTCCATATGACGTGTGTACTCTAGGGTTGTGTGAATGAAGTCACTGT ) (SEQ ID No: 1) to introduce an early terminator (bold) at position 6126, 16 nucleotides downstream of the 16K initiation codon (underlined) . The fragment was moved into the full-length clone pTRVlNB to produce plasmid pTRVl-lδstop.

Inverse PCR was used to introduce two early terminators at positions 6120 and 6126 (bold) , 10 and 16 nucleotides downstream of the 16K initiation codon (underlined) to produce the sequence ATGACGTGTTAACTCTAG... ( SEQ ID No : 2) A fragment incorporating these changes but lacking the Ndel and Bglll 16K-flanking sites was moved into the full- length clone pTRVl to produce plasmid pTRVl-lδdstop.

Expression of heterologous viral genes from TRV RNA2

The CMV 2b gene was amplified from a full-length cDNA clone of RNA2 of CMV isolate Fny to incorporate Ncol and Kpnl sites at the 5' and 3' ends of the gene, respectively. The Ncol-.Kpnl fragment was used to replace the GFP gene carried on a similar fragment in the TRV virus vector plasmid pK20-GFPc (MacFarlane and Popovich, 2000) . This new construct, pK 0-CMV2b, expresses the CMV 2b protein from a duplicated tobravirus CP subgenomic promoter in TRV RΝA2. Similar strategies were used to clone the PEBV 12K gene, as a Rcal-EcoRI fragment, and the TRV 16K gene, as a Rcal-Kpnl fragment, into TRV RNA2 to produce, respectively, plasmids pK20-12K and.pK20-16K. Inoculation and analysis of plants

Leaves of small N. benthamiana or N. tabacum cv. Samsun ΝΝ plants were dusted with carborundum and mechanically inoculated with capped transcripts of TRV RΝA1 and RΝA2. RNA was isolated from samples of inoculated and systemically infected leaves at 5-7 dpi and 10-12 dpi, respectively, and analysed by northern blotting as described before (MacFarlane et al . , 1991) except that complementary-strand, RNA probes were prepared using a non-radioactive system (AlkPhos, Amersham Pharmacia) .

Protoplasts were isolated from N. benthamiana plants as described before (Power and Chapman, 1985) and inoculated with transcript RNA by electroporation. RNA was extracted after 48 hours and analysed by northern blotting.

Results

The 16K gene is required for virus multiplication

The initial step in this work was the construction of a full-length cDNA clone of RNAl of TRV isolate PpK20. Transcripts derived from this clone, pTRVl, were infectious when inoculated to plants either alone or in combination with transcripts of TRV PpK20 RNA2 (Mueller et al . , 1997). Unlike the previously described clone of TRV RNAl (Hamilton and Baulcombe, 1-98-9), transcripts from pTRVl were-eneaps-idated into virus particles, and could be transmitted by the natural nematode vector of TRV (data not shown) . A modified clone of TRV RNAl was created in which the 16 gene was flanked by novel restriction sites.

Transcripts from this clone, pTRVlNB, behaved in an identical way to those derived from the wild type clone pTRVl. A second clone, pTRVl-16Δ, was created in which the entire 16K gene was deleted. Transcripts derived from clones pTRVlNB or pTRVl-16Δ were mixed with RNA2 transcripts from clone pK20-GFPc and inoculated to Nicotiana tabacum (var. Samsun NN) . Fluorescent lesions were visible by three days post inoculation (dpi) on four of six plants inoculated with wild type (pTRVlNB) RNAl and RNA2-GFP, however, no fluorescent lesions were visible on any plant inoculated with RNAl carrying the 16K gene deletion even at 6dpi or later. Northern blot analysis showed that, although both TRV RNAs were clearly evident in plants inoculated with wild type transcripts, neither RNAl nor RNA2 could be detected in plants inoculated with transcripts from the 16K deletion mutant (Fig. 1A) .

The 3' proximal open reading frame of RNAl of all three tobraviruses encodes a small, cysteine-rich protein (CRP) . The CRP from PEBV is smaller (12K) than the TRV 16K protein, however, both proteins contain cysteine/histidine motifs reminiscent of zinc-binding domains present in some regulatory proteins and bothTliave C-terminal regions rich in basic amino acid residues (Fig. 2A) . Amino acid sequence identity between the 16K and 12K proteins is low (31%) , however, there is a striking conservation in the arrangement of the cysteines and their flanking residues in these proteins. Thus, clone pTRVl-12 was constructed to determine whether the similarities in the cysteine-rich domains would enable the PEBV 12K protein to function in place of the TRV 16K protein (Fig. 2B) . Inoculation of N. tabacum with transcripts of pTRVl-12 and pK20-GFPc produced isolated, very small fluorescent lesions on only two of five plants at 5 dpi, whereas, in the same experiment all five plants inoculated with wild type transcripts carried many, large fluorescent lesions by this time (Fig. IB) . As before, transcripts from pTRVl-16Δ were apparently not infectious.

Inoculation of N. benthamiana with transcripts from these clones gave slightly different results. Although mutant TRVl-12 was not as infectious as wild type TRVl or TRV1ΝB, viral RΝAs were clearly detectable in both inoculated and systemically infected leaves (Fig. 3A) and GFP fluorescence was apparent in systemic leaves (Fig. 3B) . Viral RΝAs were barely detectable in leaves inoculated with mutant TRV1-16Δ, and were not detected in upper, uninoculated leaves samples at 11dpi. Lack of systemic movement of mutant TRV-16Δ was confirmed by RT-PCR analysis of these samples (data not shown) . In N. benthamiana protoplasts, mutants TRV1-16Δ and TRVl-12 both accumulated to much lower levels than did the wild type viruses, suggesting that the 16K gene is required for efficient replication of TRV and that, in these conditions, the PEBV 12K gene is not an adequate replacement ^' (Fig. 3C) .

The requirement of the 16K protein for efficient TRV replication was further examined by the creation of two mutants carrying premature translation termination codons in the 16K gene. In mutant TRV- lδstop, the sixth codon of the 16K gene is replaced by a UAG terminator and the 16K gene is flanked by Ndel and BgllAl sites. This mutant multiplied very poorly compared to wild type virus both in whole plants (Fig. 3D) and in protoplasts (data not shown) , confirming that the 16K protein rather than the 16K RΝA sequence is required for efficient virus replication. In mutant TRV-16dstop, the fourth codon is UAA and the sixth codon is UAG, however, the 16K gene is not flanked by artificial Ndel and Bglll restriction sites. This mutant also replicated poorly confirming that the non-viral restriction sites introduced into all of the previous mutants were not the cause of reduced replication efficiency.

The 16K protein is a pathogenicity determinant

TRV RΝA2 can be used as a vector from which heterologous sequences are expressed at high levels ^" using^{" "}a^~duplicated coat protein promoter—(^"MacFarlane 1 and Popovich, 2000) . Clone pK20-16K was constructed

2 to examine the effects of over-expression of the 16K

3 protein on symptom production by TRV. Infection of

4 tobacco plants with TRV RNAl only (NM infection)

5 resulted in stem/mid-vein necrosis and slight

6 stunting but on most systemic leaf blades no symptom

7 formed. Infection with wild type (RNAl and RNA2 ) TRV

8 (isolate PpK20) resulted in infrequent, small

9 necrotic patches on systemic leaves together with

10 some leaf distortion and chlorotic mottle. Infection

11 with TRV RNAl and RNA2-16K caused severe stunting and

12 distortion of systemic leaves together with

13 widespread necrosis (Fig. 4A) . Northern blot

14 analysis of these plants showed that NM-infected

15 plants had little or no virus RNA in systemic leaf

16 blades. Both viral RNAs were easily detectable in

17 wild type virus-infected tissue. However, infection

18 with TRV RNAl and RNA2-16K led to an increase in the

19 level of virus RNAs, particularly RNA2 (Fig. 4B) .

20 Thus, over-expression of the 16K protein leads to .

21 increased pathogenicity of TRV.

22

23 Eaqpression of the 16K gene from a PVX vector

24

25 To examine whether enhancement of symptom expression

26 by the 16K protein was specific for TRV, the 16K gene

27 was cloned into the PVX vector (Chapman et al . ,

28 1992). Inoculation of tobacco plants with PVX

29 lacking any insert resulted in a systemic, chlorotic

30 mottle (Fig. 5A, left) . Systemic infection with PVX-

-3-1- —1-6-K was slower by 1 to 2 -days -tha-n-wit ■ PVX and produced severe, chlorotic lesions rather than mottling (Fig. 5B, right) . There was an even greater contrast in symptomatology of the two viruses following inoculation to N. benthamiana . Both PVX and PVX-16K initially induced severe systemic leaf curling and vein chlorosis. However, by 20dpi, whereas PVX-infected plants were highly stunted, plants infected with PVX-16K were killed (Fig. 5B) . Thus, the TRV 16K protein is a pathogenicity determinant that can function when expressed from a different virus.

Complementation of 16K mutation by the gene encoding the CMV 2b silencing suppressor

As expression of the 16K gene from TRV RΝA2 enhanced the replication (and symptom production) of wild type TRV RNAl, experiments were carried out to test the effect of this RNA2 on the replication of the lδdstop RNAl mutant. Virus could not be detected by northern blotting of plants inoculated with lδdstop RNAl and RNA2-GFP, either in inoculated or systemic leaves (Fig. 6A, lanes 9-12). However, inoculation with lδdstop RNAl and RNA2-16K produced a readily detectable infection (Fig. 6A, lanes 13-16) . Thus, expression of the 16K protein in trans completely rescued the very poorly replicating lδdstop RNAl mutant. Likewise, other experiments showed that expression of the PEBV 12K CRP from TRV RNA2 was able to complement the lδdstop mutation (data not shown) . The results from experiments described above showed that the TRV 16K protein is a pathogenicity determinant that is required for efficient viral replication and, thereafter, systemic infection of plants. These properties are consistent with the 16K protein acting as a PTGS suppressor. We hypothesized that the absence of suppressor function resulting from the lδdstop RNAl mutation could be overcome by co-expression of a host defense suppressor protein derived from another virus. Thus, lδdstop RNAl was inoculated to plants together with transcripts of pK20-CMV2b, in which the CMV2b gene is expressed from TRV RNA2. Northern blotting showed that, indeed, the CMV 2b gene was able to rescue TRV carrying a mutation in the 16K gene, resulting in high levels of viral RNAs bpth in inoculated and systemic infected leaves (Fig. 6B, lanes 5-8) . RT-PCR and sequencing confirmed that the lδdstop mutation was retained in RNAl and that the CMV 2b gene was retained in RNA2

Discussion

In this study, we examined the role of the 16K protein in the replication and pathogenesis of TRV. An earlier report suggested that the 16K gene was dispensable for TRV multiplication (Guilford et al . , 1991) . Our results conflict with those of this previous study, as we show that mutation of the 16K gene leads to a significant decrease in the accumulation of virus RNA in infected plants. Protoplas-t—-s-tud-ies—confirmed that the 16K protein- is- required for efficient virus replication, and over- expression of the 16K protein, whether from TRV or from PVX, led to an increase in the severity of symptoms. Expression of the 16K protein from TRV RNA2 functions in trans to complement a mutation in the RNAl-encoded 16K gene. Also, mutation of the 16K gene was overcome by incorporation of the gene encoding the CMV 2b silencing suppressor protein into TRV RNA2, suggesting that the 16K protein itself might be a silencing suppressor. We have used a novel, insect cell expression system to confirm that the TRV 16K protein is a suppressor of gene silencing which may explain how alteration in the level of 16K expression has such a significant effect on virus pathogenicity.

Mutation of some of the other virus genes recently identified as encoding silencing suppressors results in a wide range of effects. The CMV 2b protein was shown not to be required for systemic infection of N. glutinosa , although RΝAs 1 and 2 accumulated to lower levels and symptoms produced by a 2b mutant were much reduced and delayed in appearance compared to those of the wild type virus (Ding et al . , 1995) . In inoculated leaves of cucumber, the 2b mutant accumulated to much lower levels (<5%) than did the wild type virus, and did not move systemically. Whether these phenotypes resulted from reduction in virus replication or from specific failures in virus movement is not known. The potyvirus HC-Pro protein -is—mul-t-i-f-unctional, being involved in- virus- 1 transmission by aphids, autoproteolytic cleavage

2 between itself and the downstream P3 protein, genome

3 amplification and long-distance virus movement

4 (Govier et al . , 1977; Carrington et al . , 1989; Cronin

5 et al . , 1995; Kasschau et al . , 1997). A number of

6 insertion mutations that were introduced into the

7 Tobacco etch virus (TEV) HC-Pro gene did not affect

8 autoproteolytic function but did suppress virus

9 replication in protoplasts (Cronin et al . , 1995). 0 One mutant (IGN) which accumulated to levels less 1 than 1% of the wild type virus was, however, able to 2 move systemically and induce mild, systemic symptoms. 3 In contrast, another mutant (CCCE) accumulated in 4 protoplasts to 25% of the level of wild type virus 5 but was incapable of moving into upper leaves. These 6 results suggested that HC-Pro has separate functions 7 associated with virus replication and movement. The 8 TBSV silencing suppressor has been identified as the 9 pl9 protein that is nested within the p22 cell-to- 0 cell movement protein gene near the 3' terminus of 1 the virus RNA (Voinnet et al . , 1999) . Expression of 2 the pl9 protein is required for systemic spread of 3 the virus in spinach, induction of a hypersensitive 4 response in N. tabacum and induction of systemic 5 lethal collapse in N. benthamiana (Scholthof et al . , 6 1995a; 1995b) . However, in N. benthamiana 7 protoplasts mutation of the pl9 gene had no effect on 8 virus replication (Chu et al . , 2000). Perhaps the 9 results obtained following mutation of the gene 0 encoding the RYMV PI silencing suppressor are most -1- -similar to our -findings with the-TRV—1-6K gene. The RYMV Pi protein is encoded by the 5 ' terminal open reading frame of the viral RNA. Deletion of the entire gene or insertion of a premature termination codon into the gene abolished replication of viral RNA in protoplasts. A mutant in which the Pi initiation codon was removed was able to replicate at reduced levels (c. 50% of wild type) in protoplast but did not accumulate either in inoculated, or in upper uninoculated leaves of whole plants (Bonneau et al . , 1998). As with some of the silencing suppressors discussed above, it is possible that in some plant species, mutation of the TRV 16K gene may not be deleterious. Deletion or frameshift mutation of the PEBV 12K gene produced similar results in Nicotiana species to those obtained here for the TRV 16K gene, with a c. 60-fold reduction in accumulation of virus RNAs (S. MacFarlane, unpublished). In contrast, in pea the PEBV 16K deletion mutant accumulated to wild type levels, although the 16K frameshift mutant could not be detected (Wang et al . , 1997).

A premature termination mutation of the 16K gene was overcome by co-expression of the CMV 2b gene from TRV RNA2. The 2b protein is known to intervene at the stage of PTGS initiation (Brigneti et al . , 1998) and could, thus, be able to prevent a silencing-based defence reaction being initiated against the TRV 16K mutant. As yet, there are no data to explain whether the TRV 16K protein acts against PTGS initiation, or during the later main-feenane-e- phase (as is the case for the potyvirus HC-Pro protein) . There are a few other examples where the pathogenicity of one virus has been modified by co-expression of a silencing suppressor derived from a different virus. Expression of the potyvirus HC-Pro protein in fransgenic plants showed it to be the determinant that mediates increases in PVX multiplication and pathogenicity during PVX/potyvirus synergism (Vance et al . , 1995) . When the 16K gene was expressed from the PVX vector, there was an increase in the severity of disease symptoms in a similar way to when other silencing suppressors were expressed from PVX (Scholthof, et al . , 1995b; Brigneti, et al . , 1998; Voinnet, et al . , 1999; Lucy et al . , 2000). Only one other example has been reported in which a silencing suppressor from one virus has been completely replaced with that of another virus (Ding et al . , 1996) . In this experiment the 2b gene of CMV was replaced with the homologous gene from another cucumovirus Tomato aspermy virus (TAV) . Unexpectedly, the hybrid virus had a significantly increased pathogenicity compared to either of the parental viruses (Ding et al . , 1996). TRV and CMV are taxonomically very distinct, and there is no significant amino acid sequence similarity between the 16K and 2b proteins. Nevertheless, these proteins are functionally equivalent in the protection of TRV against host defence mechanisms.

The TRV 16K protein was detected by western blotting in ext-rachs-o^-infected tobacco protoplasts—(Angenent et al., 1989). The 16K protein accumulated to high levels, equivalent to that of the coat protein (CP) , but continued to be expressed even after CP synthesis had declined. Cell fractionation experiments, combined with sedimentation analysis, showed that the ^• 16K protein accumulated in a high-molecular weight complex, either as a multimer or in association with host proteins (/Angenent et al . , 1989). It is tempting to speculate that the 16K protein may associate with proteins of the host silencing system, thus, inhibiting their action against TRV. In whole plants the 16K protein was only detected when infected leaves were extracted using highly denaturing reagents, although, even in these conditions some of the protein still accumulated in higher molecular weight aggregations (Liu et al . , 1991) . Immunogold labelling of ultrathin sections showed that the 16K protein was located both in the cytoplasm but mostly in the nucleus (Liu et al . , 1991) . Interestingly, the CMV 2b protein also localises to the nucleus, and removal of an arginine- rich domain at the N-terminus of the protein abolished both transport into the nucleus and silencing suppressor activity (Lucy et al . , 2000). The TRV 16K and PEBV 12K proteins also possess an arginine-rich domain, at the C-terminus of the proteins, which might function as a nuclear localisation signal (Fig. 2A) . Computer alignment suggested that there might be significant amino acid sequence homology between the C-terminal basic domain -Θ-f—the--TRV 16K protein and mammalian high -mobility- 1 group chromatin (HMG) proteins (Koonin et al . , 1991).

2 HMG proteins are nuclear proteins that bind DNA in a

3 non-sequence-specific fashion to promote chromatin

4 function and gene regulation (Grasser, 1998) . 5

6 Viruses belonging to the genera Tobravirus (TRV,

7 PEBV), Hordeivirus (e.g. Barley stripe mosaic virus,

8 BSMV) , Carlavirus (e.g. Potato virus M) , Pecluvirus

9 (e.g. Peanut clump virus, PCV) , Furovirus (e.g. Soil-

10 borne wheat mosaic virus) and Benyvirus (Beet

11 necrotic yellow vein virus, BNYW) all encode a small

12 (<20 kDa molecular weight) protein with an N-terminal

13 or central cysteine-rich domain. Amino acid sequence

14 alignment studies suggested that the tobravirus,

15 pecluvirus, hordeivirus and furovirus proteins, in

16 particular, share a region of seven cysteines, with a

17 highly conserved central motif of Cys-Gly...Cys-Gly-X-

18 X-His (Diao et al . , 1999). BSMV is the only one of

19 these viruses for which a detailed study of the

20 function of the CRP has been carried out. Virus in

21 which the gene encoding the BSMV γb CRP had been

22 deleted was able to infect barley plants systemically

23 but virus RNAs accumulated to only 10-20% of wild

24 type levels and virus CP expression was reduced by

25 three orders of magnitude (Petty et al . , 1990). Site 26 directed mutation of each of the individual cysteine 27 and histidine residues identified above as part of

28 the conserved CRP motif, caused the same phenotype as

29 the complete deletion mutation, emphasising the

30 importance of these residues in CRP function (Donald -3ir ^"and Jackson, 1994) . Other -prop^'ertie^"S^' associated with the BSMV γb protein are seed transmission of the virus (Edwards, 1995) and RNA-binding (Donald and Jackson, 1996) . Similarly, the PEBV 12K CRP also is involved in seed transmission (Wang efc al . , 1997) and can bind RNA (D. Wang and J. Davies, personal communication) . The roles of the CRPs in furovirus and carlavirus biology are not known. However, mutation of the BNYW P14 CRP greatly reduced the accumulation of virus RNA and had the additional effect of decreasing expression of CP (Hehn et al . , 1995) . Also, frameshift mutation of the P15 CRP of PCV had a severe effect, reducing replication of the virus in protoplasts to very low levels (Herzog et al . , 1998) . We suggest that, based on our findings on the function of the tobravirus 16K and 12K proteins, the CRPs from this diverse group of viruses may all act as suppressors of the plant PTGS system.

EXAMPLE 2: Drosophila cell gene silencing assay ^{■ ■} Suppression of PTGS by the 16K protein

A system for studying gene silencing in cultured Drosophila cells was described recently in which transient expression of a lacZ gene can be prevented by co-transfection of the cells with double-stranded lacZ-specific RNA (Hammond et al . , 2000). We have shown that induction of lacZ silencing can be prevented by simultaneous expression of certain plant virus genes demonstrating that some plant viral silencing s p :nas"SO s—function in this heterologous"" system (B. Reavy and S.A. MacFarlane, submitted). Expression of the TRV 16K protein in Drosophila cells also was found to prevent dsRNA-mediated silencing of lacZ, confirming our hypothesis that it is a silencing suppressor protein. When cells were transfected only with a plasmid (pMT/V5-His/lacZ) encoding the lacZ gene, ~ 50% of the cells stained blue after 48hr indicating the production of β- galactosidase . Co-transfection of cells with pMT/V5- His/lacZ and dsRNA corresponding to ~500nts at the 5' end of the lacZ gene resulted in only -6% of cells staining blue, indicating that efficient silencing of lacZ had occurred. However, co-transfection of pMT/V5-His/lacZ with lacZ-specific, dsRNA and a plasmid carrying the 16K gene increased the number of cells staining blue to ~ 26%, demonstrating that the 16K protein inhibits RNA-mediated gene silencing (Fig. 7) .

Results and Discussion

Analysis of gene silencing in Drosophila S2 cells was performed by transient expression using a variation of the assay described by Hammond et al . (2000) . DS2 cells were transfected with a plasmid expressing β- galactosidase along with dsRNA corresponding to approximately the first 500 nts of the lacZ gene to induce silencing. Co-transfection of these two molecules along with a second plasmid expressing the TRV 16K protein was used to assay suppression of gene silencing. Post-transcriptional gene silencing (PTGS) , also known as RNA interference or RNA silencing, has been observed in a variety of organisms including plants, fungus (Ding, 2000), etc. The silencing involves sequence-specific degradation of a target RNA molecule and can be initiated by dsRNA homologous to the target RNA. PTGS has been used to generate resistance to viruses in fransgenic plants (Waterhouse et al . , 1998) but also appears to be an inherent virus resistance mechanism in plants (Covey et al, 1997; Ratcliff et al 1997; Elmayan et al . , 1998; Ratcliff et al . , 1999 Mourrain et al . , 2000). A number of plant viruses have proteins that act as suppressors of PTGS and these can act at different stages of the suppression mechanism (Anandalakshmi et al, 1998; Brigneti et al, 1998; Kasschau & Carrington 1998; Voinnet et al, 1999; Lucy et al, 2000; Llave et al, 2000) . PTGS has recently been demonstrated in cultured Drosophila cells and a sequence-specific nuclease involved in the process partially purified (Hammond et al, 2000) . Here we show that a plant virus protein previously described as a suppressor of gene silencing also suppress gene silencing in Drosophila cells and also detect gene silencing suppression with a second plant virus protein. The HCPRO protein of tobacco etch virus (TEV) is able to reverse gene silencing in plants after it has been established and appears to affect a step involved in maintenance of PTGS (.Anandalakshmi et al, 1998; Llave at al, 2000) . Transient expression was used to -de-te-r-mine if expression of this -p-rotein--had—a-ny - suppressive effect on gene silencing in Drosophila cells, β-galactosidase activity could be detected by staining in up to approximately 70% of Drosophila cells when they were transfected with a lacZ expression plasmid alone (Fig 8A) . The number of cells staining for β-galactosidase was only approximately 12% when dsRNA corresponding to approximately the first 500nts of the lacZ gene was co-transfected with the lacZ expression vector (Fig 8B) . Co-transfection of Drosophila cells with dsRNA and lacZ and an HCPRO expression vectors resulted in staining of approximately 50% of the cells in the culture (Fig 8C) . The number of cells staining when transfected with the lacZ expression vector alone varied somewhat between experiments presumably due to variation in the quality of plasmid DNA and the condition of the cells but there was little variation between replicate plates within an experiment.

The percentage of cells that stained for β- galactosidase when transfected with the lacZ expression vector alone was normalised to 100 and the ratio of the number of cells staining with the other treatments was expressed as a percentage of this for quantitation purposes in Fig IE. The TEV HCPRO protein was effective in suppressing gene silencing in transient assays.

A stable cell line (DS2 -HCPRO) expressing the HC-Pro protein was produced to attempt to improve the efficiency of the suppression assay by reducing the number of co-transfected nucleic acid molecules from 3 to 2. An unrelated cell line (DS2-VCL) expressing a recombinant antibody was used as a control for silencing in order to eliminate the possibility that stable transformation of the cells could interfere with silencing. Co-transfection the lacZ expression vector and dsRNA produced a slight reduction in the number of DS2 -HCPRO cells cells staining for β- galactosidase activity compared to the lacZ expression vector alone. A significantly greater silencing effect was seen in the DS2-VCL cells (Fig 9) . Quantitation of the numbers of cells staining showed that significantly more cells stained for β- galactosidase activity after transfection with the lacZ expression vector and dsRNA in the DS2 -HCPRO cells than in the DS2-VCL cells (Fig 10) . The numbers of cells that stained for β-galactosidase activity in the DS2 -HCPRO cells in the presence of the lacZ expression vector and dsRNA was slightly higher than when DS2 cells were transiently transfected with pMT/V5-His/lacZ along with pMT-HCPRO and lacZ dsRNA indicating that suppression of silencing was somewhat more efficient in the DS2- HCPRO cells.

Transient transfection with mutant HC-Pro

We were interested to determine if this Drosophila cell system could be used as a screen for gene silencing suppression effects caused by other virus proteins. It has been suggested that the ORF0 1 protein of potato leafroll virus (PLRV) may act as a

2 suppressor of gene silencing (REF) . Drosophila cells

3 transfected an ORFO expression plasmid along with the

4 lacZ expression plasmid and dsRNA demonstrated

5 suppression of gene silencing compared to cells

6 transfected with the lacZ expression plasmid and

7 dsRNA alone (Fig 11) . This identification of gene

8 silencing suppression with the PLRV ORF 0 suggests

9 that this system will be a useful screening tool to 10 identify other proteins that have similar functions. 11

12 The observations here that plant virus proteins can

13 suppress gene silencing in Drosophila cells indicates

14 that at least part of the pathway of PTGS is

15 conserved between plants and Drosophila . The

16 Drosophila cell system has been useful for

17 elucidating some of the biochemical detail of PTGS

18 and a nuclease activity apparently deriving sequence-

19 specificity from essential -25 nucleotide RNA species

20 has been identified (Hammond et al, 2000) . 21

22 Suppressors of PTGS that function in Drosophila cells

23 will be useful for further dissection of the

24 mechanisms of PTGS in Drosophila cells as well as

25 being an amenable system for study of the mode of

26 action of the plant virus proteins themselves. The

27 Drosophila system will also be a good starting point

28 for the identification of proteins with which the

29 suppressor proteins interact. 30

•31 Plasmid constructions .

A region (nts 1055-2449) of the TEV genome containing the HCPRO sequence was amplified by Polymerase chain reaction (PCR) using primers HCPRO-1 (5'- CCGGTACCATGAGCGACAAATCAATCTCTGAGGC-3 ' ) (SEQ ID No: 3) and HCPRO-2 (5 ' - GGCTCGAGCTACACATCTCGGTTCATCCCTCC-3 ' ) (SEQ ID No: 4) . Primer HCPRO-1 contains a Kpnl site (shown in bold in the sequence) and an ATG initiation codon (shown underlined) in addition to the TEV sequence. Primer HCPRO-2 contains an Xhol site (shown in bold) and the complement of a TAG termination codon (shown underlined) in addition to the TEV sequence. The PCR product was cloned into pGEM-Teasy (Promega) and then subcloned as a Kpnl-XhoI fragment into pMT/V5-HisA (Invitrogen) cut with Kpnl and Xhol to give plasmid pMT-HCPRO.

PLRV ORFO construction The PLRV ORFO sequence was amplified by PCR using cloned cDNA as a template and primers 499 (5'- ATAGCCCATGGTTGTATTGACCC-3 ' ) (SEQ ID No : 5) and 500 (5'-TTCCAGGTACCTCTCATTCTTGTAATTCC-3' ) (SEQ ID No: 6) to introduce flanking Ncol and Kpnl sites into the PCR product. The PCR product was cloned into pMT/V5- HisA to produce plasmid pMT-ORFO .

RNA synthesis. cDNA corresponding to ~500bp of the 5' end of the LacZ gene was amplified using pcDNA3.1/HisB/lacZ as a template and primers LacZ-1 (-§ ^>—TAAT-ACGACTCACTATAGGGAGACCCAAGCTGGG-TAGC---3-*--) (SEQ ID No : 7 ) and LacZ-2 ( 5 ' - TAATACGACTCACTATAGGGCAAACGGCGGATTGACCG-3 ' ) (SEQ ID No: 8) . Both primers contained T7 RNA polymerase initiation sequences (shown underlined) . The PCR product was used to direct synthesis of dsRNA using T7 RNA polymerase (Invitrogen) after which the DNA template was removed by DNase digestion.

Cell culture and Transfection. DS2 cells and DES expression medium were part of the Drosophila Expression System (Invitrogen) and cells were grown according to the manufacturer's instructions. Cells were grown in 60mm dishes and transfected with lOμg plasmid DNA either alone or with 5 μg dsRNA by calcium phosphate co-precipitation. After transfection the cells were washed twice in DES medium and grown for eight hours before expression of proteins was induced by addition of CuS0₄. A stably transformed line expressing the HCPRO gene was established by co-transfection of cells with the relevant plasmid and pCo-Hygro (Invitrogen) followed by selection of transformed cells in medium containing hygromycin. Cells were stained to detect lacZ gene expression using a β-Gal Staining Kit (Invitrogen) 48hrs after transfection.

EXAMPLE 3: Groundnut Rosette Virus (GRV) ORF3 Suppresses RNA Interference in Drosophilla Cells

The GRV ORF3 sequence was amplified by PCR using cloned cDNA as a template and two sets of primers. The first set of primers, GRV3HTFOR (5'- CGATGGTACCACAATGGACACCACCC-3' ) (SEQ ID No : 9) and GRV3MTHREV (5'- CGATCTCGAGTCAATGGTGATGGTGATGATGCCACTTATTGGCAGCGG-3' ) (SEQ ID No: 10), introduce a polyhistidine tag at the carboxy-terminal end of the ORF3 protein and flanking Kpnl and Xhol sites. This PCR product was cloned into _pMT/V5-HisC (Invitrogen) to produce plasmid pMT- ORF3/His. The second set of primers, GRV3MTHFOR (5'- CGATGGTACCACAATGGGACATCATCACCATCACCATGACACCACCCCGG- 3') (SEQ ID No: 11) and GRF3HTREV (5'- CGATCTCGAGTCACCACTTATTGGCAGCGG-3') (SEQ ID No : 12), introduce a polyhistidine tag at the amino-terminal end of the ORF3 protein and flanking Kpnl and Xhol sites. This PCR product was cloned into pMT/V5-HisC to produce plasmid pMT-His/ORF3.

Drosophila (DS2) cells were grown in Schneider's Drosophila medium (Life Technologies) . Stably transformed Drosophila (DS2) cell lines expressing the modified ORF3 proteins were produced by co- transfection of cells with either pMT-ORF3/His or pMT-His/0RF3 along with pCo-Hygro (Invitrogen) using calcium phosphate co-precipitation, followed by selection of transformed cells in medium containing 300 μg/ml hygromycin. Expression of the modified 0RF3 proteins was confirmed by immunoblotting using an anti-6His antibody (Sigma) . The cell lines were called DS2-ORF3/His (expressing pMT-0RF3/His) and DS2-His/ORF3 (expressing pMT-His/ORF3) . ' Cultures of control DS2 cells and of both transformed cell lines expressing the modified ORF3 proteins were transfected by calcium phosphate co-precipitation in 60mm tissue culture dishes with either 10 μg of pMT/V5-His/lacZ (Invitrogen) or 10 μg of pMT/V5- His/lacZ and 5 μg of double-stranded (ds) RNA corresponding to the 5' -terminal 500 nucleotides of the lacZ gene to induce gene silencing. Cells were stained to detect lacZ gene expression using a β-gal staining kit (Invitrogen) 48 hours after transfection. The results are shown in Table 1.

Transfection efficiencies were determined in the cultures transfected with pMT/V5-His/lacZ and were approximately 55% for all three cell types. Only 10.25% of control DS2 cells transfected with pMT/V5- His/lacZ + dsRNA stained for lacZ expression, representing 19.2% of the cells staining when the cells were transfected with pMT/V5-His/2acZ alone, and indicating that RNA interference (gene silencing) was occurring. In contrast, 30.75% of DS2-ORF3/His cells and 33% of DS2-His/ORF3 cells transfected with pMT/V5-His/lacZ + dsRNA stained for lacZ expression representing 54.9% and 63% of the cells staining when the cells were transfected with pMT/V5-His/2acZ alone respectively. This indicates that RNA interference (gene silencing) was suppressed in the Drosophila cell lines expressing the modified versions of the ORF3 protein and shows that the 0RF3 protein can suppress RNA interference (gene silencing) in heterologous systems.

Table 1. Effects of GRV ORF3 on RNA interference in Drosophila cells. *Four randomly selected fields of view each containing ~100 cells were selected in each of duplicate plates and the number of cells staining blue was counted for each experiment .

References

Anandalakshmi, R. , Pruss, G.J., Ge, X., Marathe, R. , Mallory, A.C., Smith, T.H. and Vance, V.B. 1988. A viral suppressor of gene silencing in plants. Proc. Natl . Acad. Sci . USA. , 95, 13079-13084.

Angenent, G.C., Verbeek, H.B.M. and Bol, J.F. 1989. Expression of the 16K cistron of tobacco rattle virus in protoplasts. Virology, 169, 305-311.

Beclin, C, Berthome, R. , Palauqui, J.C., Tepfer, M. and Vaucheret, H. 1998. Infection of tobacco or Arabidopsis plants by CMV counteracts systemic post- transcriptional silencing of nonviral (trans) genes . Virology, 252, 313-317.

Bonneau, C, Brugidou, C, Chen, L., Beachy, R.Ν. and Fauquet, C. 1998. Expression of the rice yellow mottle virus Pi protein in vi tro and in vivo and its involvement in virus spread. Virology, 244, 79-86.

Brigneti, G., Voinnet, 0., Li, W.X., Ji, L.H., Ding, S.W. and Baulcombe, D.C. 1998. Viral ^' pathogenicity determinants are suppressors of transgene silencing in Nicotiana benthamiana . EMBO J. , 17, 6739-6746.

Carrington, J.C., Cary, S.M., Parks, T.D. and Dougherty, W.G. 1989. A second proteinase encoded by a plant potyvirus genome. EMBO J. , 8, 365-370. Chapman, S., Kavanagh, T. and Baulcombe, D.C. 1992. Potato virus X as a vector for gene expression in plants. Plant J. , 2, 549-557.

Chivasa, S., Murphy, A.M., Naylor, M. and Carr, J.P. 1997. Salicylic acid interferes with tobacco mosaic virus replication via a novel salicylhydroxamic acid- sensitive mechanism. Plant Cell . 9, 547-557.

Chu, M. , Desvoyes, B., Turina, M. , Noad, R. and Scholthof, H.B. 2000. Genetic dissection of tomato bushy stunt virus pl9-protein-mediated host-dependent symptom induction and systemic invasion. Virology, 266, 79-87.

Covey S.N. et al . Plants combat infections by gene silencing. Nature, vol 387, pages 781-782.

Cronin, S., Verchot, J., Haldeman-Cahill, R. , Schaad, M.C. and Carrington, J.C. 1995. Long-distance movement factor: A transport function of the potyvirus helper component proteinase. Plant Cell , 7, 549-559.

Diao, A., Chen, J. , Ye, R. , Zheng, T., Shanquan, Y. , Antoniw, J.F. and Adams, M.J. 1999. Complete sequence and genome properties of Chinese wheat mosaic virus, a new furovirus from China. J. Gen . Virol . , 80, 1141- 1145.) Ding, S.W., Shi, B.J., Li, W.X. and Symons, R.H. 1995. A novel naturally occurring hybrid gene encoded by a plant RNA virus facilitates long distance virus movement. EMBO J. , 14, 5762-5772 Ding, S.W., Shi, B.J., Li, W.X. and Symons, R.H. 1996. An interspecies hybrid RNA virus is significantly more virulent than either parental virus. Proc . Natl . Acad. Sci . USA, 93, 7470-7474.

Ding, S.W. RNA silencing. Curr. Opinion in Biotech . 11, 152-156 (2000) .

Donald, R.G.K. and Jackson, A.O. 1994. The barley stripe mosaic virus γb gene encodes a multifunctional cysteine-rich protein that affects pathogenesis. Plant Cell , 6, 1593-1606.

Donald, R.K.G. and Jackson, A.O. 1996. RNA-binding activities of barley stripe mosaic virus gamma b fusion proteins. J. Gen . Virol . , 77, 879-888.

Edwards, M.C. 1995. Mapping of the seed transmission determinants of barley stripe mosaic virus. Mol. Plant Microbe Interact., 8, 906-915.

Elmayan, T., Balzergue, S., Beon, F., Bourdon, V., Daubremet, J., Guenet, Y., Mourrain, P., Palauqui, J.C., Vernhettes, S., Vialle, T., Wostrikoff, K. and Vaucheret, H. 1998. Arabidopsis mutants impaired in cosuppression. Plant Cell , 10, 1747-1757. 1 English, J.J., Mueller, E. and Baulcombe, D.C. 1996.

2 Suppression of virus accumulation in transgenic

3 plants exhibiting silencing of nuclear genes. Plant

4 Cell , 8, 179-188.

5 Govier, D.A. , Kassanis, B. and Pirone, T.P. 1977.

6 Partial purification and characterization of the

7 potato virus Y helper component. Virology, 78, 306-

8 314. 9

10 Grasser, K.D. 1998. HMG1 and HU proteins:

11 architectural elements in plant chromatin. Trends

12 Plant Sci . , 3, 260-265. 13

14 Guilford, P.J. , Ziegler-Graff , V. and Baulcombe, D.C.

15 1991. Mutation and replacement of the 16-kDa protein

16 gene in RNA-lof tobacco rattle virus. Virology, 182,

17 607-614. 18

19 Hamilton, W.D.O. and Baulcombe, D.C. 1989. Infectious

20 RNA produced by in vi tro transcription of a full-

21 length tobacco rattle virus RNA-1 cDNA. J. Gen .

22 Virol . , 70, 963-968. 23

24 Hammond, S.M., Bernstein, E., Beach, D. and Hannon,

25 G.J. 2000. An RNA-directed nuclease mediates post- 26 transcriptional gene silencing in Drosophila cells . 27 Nature, 404, 293-296.

28

29 Harrison, B.D. 1984. Potato Leafroll Virus. CMI/AAB

30 Descriptions of Plant Viruses, no. 291. -3-1 1 Hehn, A., Bouzoubaa, S., Twell, D., Marbach, J.,

2 Richards, K. , Guilly, H. and Jonard, G. 1995. The

3 small cysteine-rich protein P14 of beet necrotic

4 yellow vein virus regulates accumulation of RNA2 in

5 cis and coat protein in trans . Virology, 210, 73-81. 6

7 Herzog, E., Hemmer, 0., Hauser, S., Meyer, G.

8 Bouzoubaa, S. and Fritsch, C. 1998. Identification of

9 genes involved in replication and movement of peanut 10 clump virus. Virology, 248, 312-322.

11

12 Kasschau, K.D., Cronin, S. and Carrington, J.C. 1997.

13 Genome amplification and long-distance movement

14 functions associated with the central domain of

15 Tobacco etch virus helper component-proteinase.

16 Virology, 228, 251-262. 17

18 Kasschau, K.D. and Carrington, J.C. 1998. A

19 counterdefensive strategy of plant viruses:

20 Suppression of posttranscriptional gene silencing.

21 Cell , 95, 461-470. 22

23 Koonin, E.V., Boyko, V.P. and Dolja, V.V. 1991. Small

24 cysteine-rich proteins of different groups of plant

25 RNA viruses are related to different families of

26 nucleic acid-binding proteins. Virology, 181, 395-

27 398. 28

29 Kumagai, M.H., Donson, J. , Della-Cioppa, G., Harvey,

30 D., Hanley, K. and Grill, L.K. 1995. Cytoplasmic -3-1 inhibition of carofee oid biosynthesis with virus- derived RNA. Proc. Natl . Acad. Sci . USA, 92, 1679- 1683.

Lindbo, J.A., Silva-Rosales, L., Proebsting, W.M. and Dougherty, W. G. 1993. Induction of a highly specific anti-viral state in fransgenic plants : Implications for gene regulation and virus resistance. Plant Cell , 5, 1749-1759.

Liu, D.H., Robinson, D.J., Duncan, G.H. and Harrison, B.D. 1991. Nuclear location of the 16K non-structural protein of tobacco rattle virus. J. Gen . Virol . , 72, 1811-1817.

Llave, C, Kasschau, K.D. & Carrington, J.C. Virus- encoded suppressor of posttranscriptional gene silencing targets a maintenance step in the silencing pathway. Proc . Natl Acad. Sci . USA 97, 13401-13406 (2000).

Lucy, A. P., Guo, H.S., Li, W.X. and Ding, S.W. 2000. Suppression of post-transcriptional gene silencing by a plant viral protein localized in the nucleus. EMBO J. , 19, 1672-1680.

MacFarlane, S.A., Wallis, C.V., Taylor, S.C., Goulden, M.G., Wood, K.R. and Davies, J.W. 1991. Construction and analysis of infectious transcripts synthesized from full-length cDNA clones of both genomic RNAs of pea early-browning virus. Virology, 182, 124-1-29. MacFarlane, S.A. 1999. The molecular biology of the tobraviruses. J. Gen . Virol . , 80, 2799-2807. MacFarlane, S.A. and Popovich, A.H. (2000) . Efficient expression of foreign proteins in roots from tobravirus vectors. Virology, 267, 29-35.

Mourrain, P., Beclin, C, Elmayan, T., Feuerbach, F., Godon, C, Morel, J.B., Jouette, D., Lacombe, A.M., Nikic, S., Picault, N. , Remoue, K. , Sanial, M. , Vo, T.A. and Vaucheret, H. 2000. Arabidopsis SGS2 and SGS3 genes are required for posttranscriptional gene silencing and natural virus resistance. Cell , 101, 533-542.

Mueller, A.M., Mooney, A.L. and MacFarlane, S.A. 1997. Replication of in vi tro tobravirus recombinants shows that the specificity of template recognition is determined by 5 ' non-coding but not 3 ' non-coding sequences. J. Gen . Virol . , 78, 2085-2088.

Napoli, C, Lemieux, C. and Jorgensen, R. 1990. Introduction of a chimeric chalcone synthase gene into petunia results in reversible co-suppression of homologous genes in trans . Plant Cell , 2, 279-289.

Naylor, M. , Murphy, A.M., Berry, J.O. and Carr, J.P. 1998. Salicylic acid can induce resistance in plant virus movement. Mol . Plant Microbe Interact . , 11, 860-868. Palukaitis, P., Roosinck, M.J., Dietzgen, R.G. and Francki, R.I. 1992. Cucumber mosaic virus. Adv. Virus Res . , 41, 281-348.

Petty, I.T.D., French, R. , Jones, R.W. and Jackson, A.O. 1990. Identification of barley stripe mosaic virus genes involved in viral RNA replication and systemic movement. EMBO J. , 9, 3453-3457.

Power, J.B. and Chapman, J.V. 1985. Isolation, culture and genetic manipulation of plant protoplasts. In Plant Cell Cul ture, pp. 37-66. Edited by R.A. Dixon. Oxford: ICR Press.

Ratcliff S., MacFarlane S.A., Baulcombe D.C. (1999) Gene Silencing without DNA: RNA-mediated cross protection between viruses. The Plant Cell, Vol 11, pages 1207-1215.

Ruiz, M.T., Voinnet, 0. and Baulcombe, D.C. 1998. Initiation and maintenance of virus-induced gene silencing. Plant Cell , 10, 937-946.

Scholthof, H.B. , Scholthof, K.B.G., Kikkert, M. and Jackson, A.O. 1995a. Tomato bushy stunt virus spread is regulated by two nested genes that function in cell-to-cell movement and host-dependent systemic invasion. Virology, 213, 425-438.

Scholthof, H.B., Morris, T.J. and Jackson, A.O. 19-95b. Identification of tomato bu-shy—stunt virus host-specific symptom determinants by expression of individual genes from a potato virus X vector. Plant Cell , 7, 1157-1172.

Sticher, L., Mauch-Mani, B. and Metraux, J.P. 1997. Systemic acquired resistance. Annu . Rev. Phytopathol . , 35, 235-270.

Vance, V.B., Berger, P.H., Carrington, J.C, Hunt, A.G. and Shi, X.M. 1995. 5' proximal potyviral sequences mediate potato virus X/potyviral synergistic disease in fransgenic tobacco. Virology, 206, 583-590.

Voinnet, O., Pinto, Y.M. and Baulcombe, D.C. 1999. Suppression of gene silencing: A general strategy used by diverse DNA and RNA viruses of plants. Proc . Natl . Acad. Sci . USA, 96, 14147-14152.

Voinnet, 0., Lederer, C. and Baulcombe, D.C. 2000. A viral movement protein. prevents spread of the gene silencing signal in Nicotiana benthamiana . Cell , 103, 157-167.

Wang, D., MacFarlane, S.A. and Maule, A.J. 1997. Viral determinants of pea early-browning virus seed . transmission in pea. Virology, 234, 112-117.

Waterhouse, P.M., Graham, M.W. & Wang, M.-B. Virus resistance and gene silencing in plants can be induced by simultaneous -expression of sense and antisense RNA. Proc. Natl Acad. Sci . USA 95, 13959- 13964 (1998) .

Whitham, S., Dinesh-Kumar, S.P., Choi, D., Hehl, R. , Corr, C. and Baker, B. 1994. The product of the tobacco mosaic virus resistance gene N: Similarity to Toll and the Interleukin-1 receptor. Cell , 78, 1101- 1115. Yamanaka, T., Ohta, T., Takahashi, M. , Meshi, T. , Schmidt, R. , Dean, C, Naito, S and Ishikawa, M. 2000. TOMl, an Arabidopsis gene required for efficient multiplication of a tobamovirus, encodes a putative transmembrane protein. Proc. Natl . Acad. Sci . USA, 97, 10107-10112.

Claims

1. A method of suppressing or inhibiting one or more gene silencing mechanisms in a non-plant host cell through the use of a plant virus protein exhibiting post-transcriptional gene silencing suppressing functions.

2. A method as claimed in Claim 1 wherein the expression of a heterologous protein encoded by a virus vector or transgene in the non- plant host cell is increased.

3. A method as claimed in Claim 1 wherein expression of a heterologous protein encoded by a virus vector or transgene in the non- plant host cell is protected from post- transcriptional gene silencing effected by the host cell.

4. A method as claimed in any one of Claims 1 to 3 wherein the non-plant cell is an animal cell.

5. A method as claimed in any one of Claims 1 to 4 wherein the non-plant cell is a mammalian cell.

6. A method as claimed in any one of Claims 1 to 4 wherein the non-plant cell is an insect cell.

7. The method as claimed in Claim 5 wherein said host cell is a Drosophila cell.

8. The method as claimed in any one of Claims 1 and 7 wherein said viral vector encoding said heterologous protein is based on PVX, PVY, or TMV.

9. The method as claimed in any one of Claims 2 and 8, wherein a fransgenic host cell expressing said plant virus protein is inoculated with a viral vector encoding the heterologous protein of interest.

10. The method as claimed in any one of Claims 2 and 9, wherein a fransgenic host cell expressing a heterologous protein of interest is inoculated with a viral vector encoding the plant virus protein.

11. The method as claimed in any one of Claims 2 to 10 wherein said plant virus protein and said heterologous protein of interest are encoded by a single viral vector.

12. The method as claimed in any one of Claims 1 to 11 wherein said plant virus protein is a cysteine-rich plant virus protein.

13. The method as claimed in any one of Claims 1 to 11 wherein said plant virus protein is the HC-Pro protein of tobacco etch virus (TEV) , the 2b protein of cucumber mosaic virus (CMV) , the ORFO protein of potato leaf roll virus (PLRV) , the 16K CRP protein of the tobacco rattle virus, the 12K CRP of Pea early browning virus or is a functional equivalent of these proteins.

14. The use of a plant virus protein as a suppressor of the gene silencing mechanism of a non-plant host cell.

15. The use as claimed in Claim 14 wherein said plant virus protein is a cysteine-rich plant virus protein.

16. The use as claimed in Claim 14 wherein said plant virus protein is the HC-Pro protein of tobacco etch virus (TEV) , the 2b protein of cucumber mosaic virus (CMV) , the ORFO protein of potato leafroll virus (PLRV) , the 16K CRP protein of the tobacco rattle virus, the 12K CRP of Pea early browning virus or is a functional equivalent of these proteins.

17. A vector comprising a polynucleotide sequence which encodes at least one plant virus protein displaying post-transcriptional gene suppressor activity and which is capable of expressing said polynucleotide sequence in a non-plant host cell.

18. A vector as claimed in Claim 17 wherein the post-transcriptional gene suppressor protein is derived from the HC-Pro protein of tobacco etch virus (TEV) , the 2b protein of cucumber mosaic virus (CMV), the ORFO protein of potato leafroll virus (PLRV) , the 16K CRP protein of the to-bacco rattle virus, the 12K CRP of Pea early browning virus or is a functional equivalent of these proteins .

19. The use of a cysteine-rich plant virus protein displaying post-transcriptional gene silencing as a suppressor of the gene silencing mechanism of a host cell.

20. The use as claimed in Claim 19 wherein said plant virus protein is the 16K CRP of tobacco rattle virus or the 12K CRP of pea early browning virus .

21. A method of suppressing or inhibiting one or more gene silencing mechanisms in a host cell through the use of a cysteine-rich plant virus protein exhibiting post-transcriptional gene silencing suppressing functions.

22. The method as claimed in Claim 19 wherein said plant virus protein is the 16K CRP of tobacco rattle virus or the 12K CRP of pea early browning virus.