WO2002048188A1

WO2002048188A1 - Plasmodium aldolase polypeptides and nucleic acids

Info

Publication number: WO2002048188A1
Application number: PCT/AU2001/001626
Authority: WO
Inventors: Allan Saul; Nicole Cloonan; Laura B. Martin
Original assignee: The Council Of The Queensland Institute Of Medical Research
Priority date: 2000-12-14
Filing date: 2001-12-14
Publication date: 2002-06-20
Also published as: AUPR209500A0; AU2002221343A1

Abstract

The present invention provides isolated fructose 1,6-bisphosphate aldolase proteins and isolated nucleic acids encoding said proteins from Plasmodium species other than P. falciparum and P. berghei. In particular, isolated 1,6-bisphosphate aldolase proteins and isolated nucleic acids respectively isolated from P. vivax, P. yoelii, P. chabaudi or P. vinckei. Also described are methods and kits using the isolated proteins, antibodies that bind said isolated proteins and nucleic acids for detection of malaria parasites and/or prevention of malaria.

Description

TITLE "PLASMODIUM ALDOLASE POLYPEPTIDES AND NUCLEIC ACIDS" FIELD OF THE INVENTION THIS INVENTION relates to isolated fructose 1 ,6-bisphosphate aldolase proteins, antibodies which bind said proteins and isolated nucleic acids encoding said proteins from Plasmodium species other than P. falciparum and P. berghei and use of said proteins, antibodies and nucleic acids for detection of malaria parasites and/or prevention of malaria. BACKGROUND OF THE INVENTION

Malaria is a disease caused by protozoan parasites of the genus Plasmodium. Four species affect humans, P. falciparum, P. vivax, P. malariae and P. ovale. The malaria parasite has a complex life cycle which includes "blood stages" where asexual reproduction occurs within erythrocytes of a vertebrate host, for example humans. Free parasites (merozoites) recognise, attach to and invade the erythrocytes. Once internalised, the parasite replicates, forms schizonts and newly developed merozoites are released from the infected erythrocyte into the plasma where they may infect other erythrocytes. Malaria is a major cause of morbidity and mortality, especially in underdeveloped countries. Malaria affects 400-500 million people world wide and is responsible for over two million deaths per year (Murray et al., 1995, Manual of Clinical Microbiology (6th ed.) ASM Press, Washington D.C.). Early diagnosis of specific malaria parasite infection may assist in providing appropriate medical treatment to reduce mortality rates. Simple and reliable malaria diagnostic kits may therefore become increasingly important in detecting and monitoring specific malaria infections.

Existing prevention or treatment methods, including drugs for application to humans to kill parasites and insecticides to kill mosquito vectors, are increasingly problematic due to increased drug and insecticide resistance.

A malaria vaccine may be an important addition to existing malaria control programs in endemic regions and for travellers with short term exposure to malaria. Vaccines are among the most cost effective public health measure available and have an advantage of requiring much less active participation by both health-care workers and community members than typical drug or insecticide treatment regimens.

Attempts to develop a malaria vaccine have focussed on identifying suitable malaria parasite proteins to initiate an appropriate host immune response. The complex life cycle of the malaria parasite, however, has made identification of such proteins a difficult task.

Malaria parasites lack a citric acid cycle and depend upon glycolysis for ATP synthesis (Momen H, 1979, Ann Trap Med Parasitol 73 109). Fructose 1 ,6-bisphosphate aldolase ("aldolase"), also known as p41 , is an important and well-characterized enzyme of this pathway, catalysing cleavage of fructose- 1 ,6-bisphosphate into glyceraldehyde-3-phosphate and dihydroacetone phosphate (Srivastava et al, 1990, J Immunol 144 1497; Meier et al, 1992, Mol Biochem Parasitol 52 15). Plasmodium aldolase is known to be expressed at high levels in infected erythrocytes during Plasmodium blood stage infection (Wanidworanum et al, 1999, Molec. Biochem. Parasitol. 102 91 ) to accommodate high glucose consumption of Plasmodium multiplication in erythrocytes. In higher vertebrates, three tissue specific aldolase isoenzymes have been identified, with different substrate specificities and kinetic properties (Penhoet etal, 1966, Proc Natl Acad Sci USA 56 1275). Oniyone aldolase enzyme has been identified in Trypanosoma brucei (Clayton, 1985, EMBO J, 4 2997), Giardia lamblia (Henze et al, 1998, Gene, 222 163), and Plasmodium falciparum (Knapp et al, 1990, Mol Biochem Parasitol, 40 1), suggesting that multiple isoenzymes are not required for the completion of protozoan parasite life cycles. In contrast, evidence of two genes (aldo-1 and aldo-2) coding for distinct enzymes in P. berghei has been reported (Meier et al, 1992, Mol Biochem Parasitol, 52 15). Recombinant aldolase protein, referred to as a 41 KDa protein, and encoding nucleic acids from P. falciparum are disclosed in US Patent Nos. 5,225,534 and 5,061 ,788 (Certa) and 5,585,268 and 5,194,587 (Knapp et al).

At present, nucleic acids encoding Plasmodium aldolase proteins are know for P. falciparum and P. berghei. The P. falicparum nucleic acid has GenBank accession number M28881 and P. berghei ANKA ALDO-2 nucleic acid has GenBank accession number M81793. The P. j erg/?e/ ALDO-1 amino acid sequence is identical to P. falciparum aldolase. SUMMARY OF THE INVENTION In a first aspect, the invention provides an isolated fructose 1 ,6- bisphosphate aldolase protein, or fragment thereof, from Plasmodium wherein said protein is not any one of SEQ ID NOS. 9-11. Preferably, the isolated fructose 1 ,6-bisphosphate aldolase protein of the first aspect is isolated from Plasmodium vivax, Plasmodium yoelii, Plasmodium chabaudi or Plasmodium vinckei.

In one embodiment of the first aspect, the invention provides an isolated protein comprising an amino acid sequence selected from the group consisting of SEQ ID NOS. 1-4.

In another embodiment of the first aspect, the invention provides a protein homolog, fragment, variant or derivative of the isolated protein selected from the group consisting of SEQ ID NOS. 1 -4, wherein said protein is not any one of SEQ ID NOS. 9-11. In yet another embodiment, the isolated protein of the first aspect when administered to an animal, is capable of eliciting an immune response in said animal.

Preferably, the immune response provides protection against one or more species of Plasmodium in said animal. More preferably, the species of Plasmodium is P. vivax.

Preferably, the animal is a mammal. More preferably, the mammal is a human. In a second aspect, the invention provides an isolated nucleic acid encoding a protein according to the first aspect. In one embodiment of the second aspect, the invention provides an isolated nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOS. 5-8.

In another embodiment of the second aspect, the invention provides an isolated nucleic acid homolog, fragment or variant of an isolated nucleic acid selected from the group consisting of SEQ ID NOS.5-8, wherein said nucleic acid is neither SEQ ID NO. 12 or 13.

In yet another embodiment of the second aspect, the invention provides an isolated nucleic acid primer or probe derived from any one of SEQ ID NOS: 5-8.

Preferably, the isolated nucleic acid is selected from the group consisting of SEQ ID NOS. 14-22.

In a third embodiment, the invention provides an expression construct comprising an expression vector and an isolated nucleic acid according to the second aspect, wherein said nucleic acid is operably linked to one or more regulatory nucleic acids in said expression vector.

In a fourth aspect, the invention provides a host cell comprising an expression construct according to the third aspect.

Preferably, the host cell is a bacterium or yeast. In a fifth aspect, the invention provides a method of producing a recombinant protein according to the first aspect, the method including the steps of:

(i) culturing a host cell according to the fourth aspect such that said recombinant protein is expressed in said host cell; and (ii) isolating said recombinant protein. In a sixth aspect, the invention provides an antibody or antibody fragment that binds to a protein of the first aspect. In a seventh aspect, the invention provides a method of detecting a Plasmodium species in a sample including the step of:

(a) isolating the sample;

(b) detecting a nucleic acid comprising a nucleotide sequence according to the second aspect in said sample which indicates the presence of said Plasmodium species.

In an eighth aspect, the invention provides a method of detecting a Plasmodium species in a sample including the step of:

(1 ) isolating the sample;

(2) combining the antibody or antibody fragment of the sixth aspect with the sample; and

(3) detecting specifically bound antibody or antibody fragment which indicates the presence of said Plasmodium species.

Preferably, at least one of the Plasmodium species detected by either the seventh or eighth aspect is P. vivax, P. yoelii, P. chabaudi or P.

vinckei.

Preferably, the sample of either the seventh or eighth aspect is a blood sample from an animal.

Preferably, the animal is a mammal. More preferably, the mammal is a human.

Preferably, the sample of either the seventh or eighth aspect comprises one or more Plasmodium species.

In a ninth aspect, the invention provides a method of detecting a Plasmodium species in a sample including the steps of:

(I) combining a protein extract with a first and second antibody which are respectively capable of respectively binding Plasmodium species specific antigens, other than HRP-2 from P. falciparum or pLDH from P. falciparum or P. vivax, to thereby form an antibody-antigen complex; (II) immobilising on a matrix a third and fourth antibody which specifically bind the Plasmodium species specific antigen bound by respective first and second antibodies of step (I);

(III) migrating respective complexes comprising the first and second antibodies bound to the respective Plasmodium species specific antigens through the matrix of step (II), such that the complexes migrate at least to the immobilised third and fourth antibodies;

(IV) binding the antibody-antigen complexes of step (I) to the third and fourth immobilised antibodies respectively of step (II); and

(V) detecting the complexes which have bound the third or fourth immobilised antibody respectively of step (IV).

Preferably, the first and second antibodies of step (I) and third and fourth antibodies of step (II) respectively bind antigens that are homologous proteins.

More preferably, the first and second antibodies of step (I) and third and fourth antibodies of step (II) respectively bind orthologous proteins.

Even more preferably, the first and second antibodies of step (I) and third and fourth antibodies of step (II) respectively bind fructose 1 ,6- bisphosphate aldolase of P. vivax and a Plasmodium species other than P. vivax.

Preferably, the first, second, third and fourth antibodies are monoclonal antibodies.

Preferably, the detection of the complexes of step (V) is by visual means. More preferably, the detection is by visualising colloidal gold attached to the first and second antibodies respectively of step (I).

In a tenth aspect, the invention provides a method of detecting a Plasmodium species in a sample including the steps of:

(A) combining a protein extract with a first antibody capable of binding a Plasmodium antigen other than HRP-2 from P. falciparum or pLDH from P. falciparum or P. vivax to thereby form an antibody-antigen complex;

(B) immobilising on a matrix a second and third antibody which respectively bind Plasmodium species specific antigens that are bound

by the first antibody of step (A);

(C) migrating the antibody-antigen complex formed by the first antibody bound to the Plasmodium antigen through the matrix of step (B), such that the complex migrates at least to the immobilised second and third antibodies; (D) binding the antibody-antigen complex of step (A) to respective second and third immobilised antibodies of step (B); and

(E) detecting the complexes which have respectively bound the second and third immobilised antibodies in step (D). Preferably, the first antibody of step (A) binds fructose 1 ,6- bisphosphate aldolase.

More preferably, the second and third antibodies of step (B) respectively bind fructose 1 ,6-bisphosphate aldolase of P. vivax and a Plasmodium species other than P. vivax. In an eleventh aspect, the invention provides a detection kit for detecting Plasmodium in a sample or diagnosing Plasmodium infection in an individual, wherein said kit comprises one or more isolated proteins accordingly to the first aspect.

In a twelfth aspect, the invention provides a detection kit for detecting Plasmodium in a sample or diagnosing Plasmodium infection in an individual, wherein said kit comprises one or more isolated nucleic acids accordingly to the second aspect.

In one embodiment of the twelfth aspect, the detection kit further comprises a thermostable polymerase. In a thirteenth aspect, the invention provides a detection kit for detecting Plasmodium in a sample or diagnosing Plasmodium infection in an individual, wherein said kit comprises one or more antibody or antibody fragment of the sixth aspect.

In a fourteenth aspect, the invention provides a pharmaceutical composition comprising at least one isolated protein according to the first aspect in combination with a pharmaceutically acceptable carrier or diluent.

In a fifteenth aspect, the invention provides a pharmaceutical composition comprising at least one isolated nucleic acid according to the second aspect in combination with a pharmaceutically acceptable carrier or diluent.

Preferably, the pharmaceutical composition of the fourteenth and fifteenth aspects is a vaccine.

Preferably, the isolated nucleic acid of the fifteenth aspect regulates expression of an endogenous nucleic acid.

More preferably, the isolated nucleic acid is an isolated antisense nucleic acid complementary to at least one isolated nucleic acid of the second aspect.

Even more preferably, the isolated antisense nucleic acid is an antisense oligonucleotide.

Preferably, the isolated antisense oligonucleotide is unique to a specific Plasmodium species.

More preferably, the isolated antisense oligonucleotide is specific for P. vivax. In a sixteenth aspect, the invention provides a method of treating malaria including the step of administering the pharmaceutical composition of the fourteenth or fifteenth aspect to a mammal.

Preferably, the mammal is a human.

In a seventeenth aspect, the invention provides a method of diagnosing infection of an individual by Plasmodium, said method including the steps of:-

(A') contacting a biological sample from said individual with a protein of the first aspect; and

(B') determining the presence or absence of a complex between said protein and P/asmod/ϊ/m-specific antibodies in said sample, wherein the presence of said complex is indicative of said infection.

In an eighteenth aspect, the invention provides a method of immunizing an individual against Plasmodium infection, including the step of administering a pharmaceutically effective amount of the vaccine described above to an individual.

In an nineteenth aspect, the invention provides a method of identifying an immunogenic fragment of a protein of the first aspect, including the steps of :-

(a') producing a fragment of said protein;

(b') administering said fragment to an animal; and

(c') detecting an immune response in said animal, which response includes production of elements which specifically bind said protein and/or a protective effect against Plasmodium infection.

Preferably, the animal is a mammal.

More preferably, the mammal is a mouse, rabbit, sheep or goat. Isolation of aldolase from P. vivax enables detection of this specific malaria parasite in a sample which may be useful in selecting an appropriate course of treatment of a patient. Antibodies that specifically bind to P. vivax aldolase may enable detection of P. vivax infection when an individual is infected by multiple species of Plasmodium. No rapid detection kits are currently available that are capable of determining P. vivax infection when an individual is co-infected with P. falciparum and alternative methods including the step of microscopic morphology assessment are not efficient or practical for routine use, for example in clinics or medical facilities in underdeveloped countries. The present invention has advantages of being able to rapidly detect P. vivax specifically in a sample, which is particularly useful if an individual is co-infected with more than one Plasmodium species. Also provided is a novel pharmaceutical composition for use as a vaccine against malaria and use to regulate endogenous Plasmodium expressed aldolase.

BRIEF DESCRIPTION OF THE FIGURES FIG. 1 is an alignment of respective amino acid sequences of

P. vivax [SEQ ID NO. 1], P. yoe//ϊ[SEQ ID NO. 2], P. chabaudi [SEQ ID NO. 3] and P. vinckei [SEQ ID NO. 4] aldolase proteins;

FIG.2 is a nucleotide sequence alignment corresponding to the amino acid sequence of FIG. 1 , wherein P. vivax sequence is set forth in SEQ ID NO. 5, P. yoe//7 sequence is set forth in SEQ ID NO. 6, P. chabaudi sequence is set forth in SEQ ID NO. 7 and P. vinckei sequence is set forth in SEQ ID NO. 8;

FIG. 3 is an alignment of amino acid sequences of P. vivax [SEQ ID NO. 1], P. falciparum [SEQ ID NO.9], P. j erg ?e (berg_ANKAJ [SEQ ID NO.10], P. berghei (berg_QIMRJ [SEQ ID NO. 11], P. yoelii [SEQ ID NO. 2], P. chabaudi [SEQ ID NO. 3] and P. vinckei [SEQ ID NO. 4] aldolase;

FIG.4 is a nucleotide sequence alignment corresponding to the amino acid sequence of FIG. 3, wherein P. vivax sequence is set forth in SEQ ID NO. 5, P. falciparum sequence is set forth in SEQ ID NO. 12, P. berghei ( erg_QIMR) sequence is set forth in SEQ ID NO. 13, P. yoelii sequence is set forth in SEQ ID NO. 6, P. chabaudi sequence is set forth in SEQ ID NO. 7 and P. vinckei sequence is set forth in SEQ ID NO. 8;

FIG. 5 is an alignment of amino acid sequences as shown in FIG. 3 for P. vivax [SEQ ID NO. 1], P. falciparum [SEQ ID NO.9], P. berghei

(berg_ANKAJ [SEQ ID NO.10], P. berghei (berg_QIMRJ [SEQ ID NO. 11], P. yoelii [SEQ ID NO. 2], P. chabaudi [SEQ ID NO. 3] and P. vinckei [SEQ ID

NO. 4] aldolase with common amino acids indicated;

FIG. 6 is a nucleotide sequence alignment as shown in FIG. 4 corresponding to the amino acid sequence of FIGS. 3 and 5 with common nucleotides indicated;

FIG. 7 is a Southern blot of P. falciparum (A and B), P. berghei (C and D), P. yoelii (E and F), P. vinckei (G and H) and P. chabaudi (I and J) genomic DNA digested respectively with Sspl and sal restriction enzymes and probed with a P. berghei aldolase (aldo-2) nucleic acid fragment; and

FIG. 8 is a Western blot of solubilized proteins from transformed E. co/ expressing recombinant P. vivax aldolase of the invention and controls. The blot is probed with a monoclonal antibody to MRGS-His (Qiagen) and protein bands were visualised using anti-mouse IgG monoclonal antibody coupled to HRP and ECL detection reagents. Lane 1 : pre-stain MW markers (BioRad); lanes 2 and 3: bacterial cell culture supernatant and solubilized protein pellet respectively from non-transformed bacterial cells; lanes 4 and 5: bacterial cell culture supernatant and solubilized protein pellet respectively from bacterial cells transformed with recombinant P. vivax aldolase; and lane 6: His-ladder (Qiagen).

DETAILED DESCRIPTION OF THE INVENTION Definitions

Unless defined otherwise, all technical and scientific terms used herein have the meaning as commonly understood by those of ordinary skill in the art to which the invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, preferred methods and materials are described. For the purpose of the present invention, the following terms are defined below.

For the purposes of this invention, by 'Isolated" is meant material that has been removed from its natural state or otherwise been subjected to human manipulation. Isolated material may be substantially or essentially free from components that normally accompany it in its natural state, or may be manipulated so as to be in an artificial state together with components that normally accompany it in its natural state. Isolated material can be either from native (isolated from a natural state) or recombinant (non-native, e.g. cloned) origin. For example, the fructose 1 ,6- bisphosphate aldolase nucleic acid of P. vivax, P. yoelii, P. chabaudi or P. vinckei shown in FIG. 2 and as herein described have been isolated. Proteins

By "protein" is also meant "polypeptide" and "peptide", either term referring to an amino acid polymer, comprising natural and/or non- natural amino acids as are well understood in the art.

A "peptide" is a protein having no more than fifty (50) amino acids.

In one embodiment, a "fragment" includes an amino acid sequence which constitutes less than 100%, but at least 5%, preferably at least 50%, more preferably at least 80% or even more preferably at least 90% of said protein.

The fragment may also include a "biologically active fragment" which retains biological activity of a given protein or peptide. For example, the biological activity of the aldolase protein is catalysing cleavage of fructose-1 ,6-bisphosphate into glyceraldehyde-3-phosphate and dihydroacetone phosphate. It is understood that the fragment may be derived from either a native or a recombinant protein. The biologically active fragment constitutes at least greater than 1% of the biological activity of the entire protein, preferably at least greater than 10% biological activity, more preferably at least greater than 25% biological activity and even more preferably at least greater than 50% biological activity.

In another embodiment, a fragment" is a small peptide, for example of at least 6, preferably at least 10 and more preferably at least 20 amino acids in length, which comprises one or more antigenic determinants or epitopes. Larger fragments comprising more than one peptide are also contemplated, and may be obtained through the application of standard recombinant nucleic acid techniques or synthesized using conventional liquid or solid phase synthesis techniques. For example, reference may be made to solution synthesis or solid phase synthesis as described, for example, in Chapter 9 entitled "Peptide Synthesis" by Atherton and Shephard which is included in a publication entitled "Synthetic Vaccines" edited by Nicholson and published by Blackwell Scientific Publications. Alternatively, peptides can be produced by fragmenting a protein, for example using chemicals or proteolytic enzymes including chymotrypsin, CnBr, NH₂OH, NTCB, pH2.5, ProEn, Staphylococcins, and Trypsin. The digested fragments can be purified by, for example, high performance liquid chromatographic (HPLC) techniques.

As used herein, "variant" proteins are proteins of the invention in which one or more amino acids have been replaced by different amino acids. Excluded from the invention are variants which encode known aldolase proteins of P. falciparum and P. berghei. Variant proteins may be produced by using molecular biological techniques such as site directed mutagenesis or random PCR mutagenesis to modify or mutate a nucleic acid encoding the protein. It is well understood in the art that some amino acids may be changed to others with broadly similar properties without changing the nature of the activity of the protein (conservative substitutions). Substantial changes in protein function may be made by selecting an amino acid substitution that is less conservative as will be understood by a person skilled in the art.

Generally, the substitutions which are likely to produce the greatest changes in a protein's properties are those in which (a) a hydrophilic residue (e.g., Ser or Thr) is substituted for, or by, a hydrophobic residue (e.g. Leu, He, Phe or Val); (b) a cysteine or proline is substituted for, or by, any other residue; (c) a residue having an electropositive side chain (e.g., Arg, His or Lys) is substituted for, or by, an electronegative residue (e.g., Giu or Asp) or (d) a residue having a bulky side chain (e.g., Phe or Trp) is substituted for, or by, one having a smaller side chain (e.g., Ala, Ser) or no side chain (e.g., Gly).

Protein and Nucleic Acid Sequence Comparison

Terms used herein to describe sequence relationships between respective nucleic acids and proteins include "comparison window", "sequence identity", "percentage of sequence identity" and "substantial identity". Because respective nucleic acids/proteins may each comprise (1 ) only one or more portions of a complete nucleic acid/protein sequence that are shared by the nucleic acids/proteins, and (2) one or more portions which are divergent between the nucleic acids/proteins, sequence comparisons are typically performed by comparing sequences over a "comparison window" to identify and compare local regions of sequence similarity. A "comparison window" refers to a conceptual segment of typically at least 6 contiguous residues that is compared to a reference sequence. The comparison window may comprise additions or deletions (i.e., gaps) of about 20% or less as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the respective sequences. Optimal alignment of sequences for aligning a comparison window may be conducted by computerised implementations of algorithms (for example WebAngis, 2D Angis, GCG and GeneDoc programs, incorporated herein by reference) or by inspection and the best alignment (i.e., resulting in the highest percentage homology over the comparison window) generated by any of the various methods selected. Reference also may be made to the BLAST family of programs as for example disclosed by Altschul et al., 1997, Nucl. Acids Res. 25 3389, which is incorporated herein by reference. A detailed discussion of sequence analysis can be found in

Chapter 19.3 of Ausubel et al. supra.

The term "sequence identity" is used herein in its broadest sense to include the number of exact nucleotide or amino acid matches having regard to an appropriate alignment using a standard algorithm, having regard to the extent that sequences are identical over a window of comparison. Thus, a "percentage of sequence identity" is calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g., A, T, C, G, U) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity. For example, "sequence identity" may be understood to mean the "match percentage" calculated by the DNASIS computer program (Version 2.5 for windows; available from Hitachi Software engineering Co., Ltd., South San Francisco, California, USA).

"Protein homologs" share at least 70%, preferably at least 80% and more preferably at least 90% sequence identity with the amino acid sequences of proteins of the invention as hereinbefore described.

As generally used herein, a "homolog" shares a definable nucleotide or ammo acid sequence relationship with a nucleic acid or protein of the invention as the case may be.

Included within the scope of homologs are "orthologs", which are functionally-related proteins and their encoding nucleic acids, isolated from other organisms. Preferably orthologs are from Plasmodium species which have similar aldolase biological activity. Examples of aldolase orthologs include aldolase proteins from P. vivax, P. yoelii, P. chabaudi and

P. vinckei as herein described. Aldolase from P. falciparum and P. berghei as described by Knapp et al, 1996, supra and Meier et al, 1992, supra respectively are known and are not included in the scope of the invention.

It is well within the capabilities of the skilled person to prepare protein homologs of the invention, such as variants as hereinbefore defined, by recombinant DNA technology. For example, nucleic acids of the invention can be mutated using either random mutagenesis, for example using random

PCR mutagenesis. The resultant DNA fragments are then cloned into suitable expression hosts such as yeast or E. coli using conventional technology and clones that express a desired activity are detected. Where the clones have been derived using random mutagenesis techniques, positive clones would have to be sequenced to detect the mutation.

As used herein, "derivative" proteins are proteins of the invention which have been altered, for example by conjugation orcomplexing with other chemical moieties or by post-translational modification techniques as would be understood in the art. Such derivatives include amino acid deletions and/or additions to proteins of the invention, or variants thereof, wherein said derivatives elicit an immune response. This may have particular relevance in relation to use of the invention as a malaria vaccine, described in more detail hereinafter. "Additions" of amino acids may include fusion of the peptide or proteins or variants thereof with other peptides or proteins. Particular examples of such peptides include amino (N) and carboxyl (C) terminal amino acids added for use as "tags".

N- and C-terminal tags include known amino acid sequences which bind known antibodies, preferably monoclonal antibodies or bind a specific substrate. pQE His-tag vectors (Qiagen) are examples of vectors comprising N- or C-terminal tags which bind Ni-NTA chelating resin.

Other derivatives contemplated by the invention include, but are not limited to, modification to side chains, incorporation of unnatural amino acids and/or their derivatives during peptide or protein synthesis and the use of crosslinkers and other methods which impose conformational constraints on the proteins, fragments and variants of the invention. Examples of side chain modifications contemplated by the present invention include modifications of amino groups such as by acyiation with acetic anhydride; acyiation of amino groups with succinic anhydride and tetrahydrophthalic anhydride; amidination with methylacetimidate; carbamoylation of amino groups with cyanate; pyridoxylation of lysine with pyridoxal-5-phosphate followed by reduction with NaBH ; reductive alkylation by reaction with an aldehyde followed by reduction with NaBH₄; and trinitrobenzylation of amino groups with 2, 4, 6-trinitrobenzene sulphonic acid (TNBS).

The carboxyl group may be modified by carbodiimide activation via O-acylisourea formation followed by subsequent derivitization, byway of example, to a corresponding amide.

The guanidine group of arginine residues may be modified by formation of heterocyclic condensation products with reagents such as 2,3- butanedione, phenylglyoxal and glyoxal.

Sulphydryl groups may be modified by methods such as performic acid oxidation to cysteic acid; formation of mercurial derivatives using 4-chloromercuriphenylsulphonic acid, 4-chloromercuribenzoate; 2- chloromercuri-4-nitrophenol, phenylmercury chloride, and other mercurials; formation of a mixed disulphides with other thiol compounds; reaction with maleimide, maleic anhydride or other substituted maleimide; carboxymethylation with iodoacetic acid or iodoacetamide; and carbamoylation with cyanate at alkaline pH.

Tryptophan residues may be modified, for example, by alkylation of the indole ring with 2-hydroxy-5-nitrobenzyl bromide or sulphonyl halides or by oxidation with N-bromosuccinimide. Tyrosine residues may be modified by nitration with tetranitromethane to form a 3-nitrotyrosine derivative.

The imidazole ring of a histidine residue may be modified by N- carbethoxylation with diethylpyrocarbonate or by alkylation with iodoacetic acid derivatives.

Examples of incorporating unnatural amino acids and derivatives during peptide synthesis include, but are not limited to, use of 4- amino butyric acid, 6-aminohexanoic acid, 4-amino-3-hydroxy-5- phenylpentanoic acid, 4-amino-3-hydroxy-6-methylheptanoic acid, t- butylglycine, norleucine, norvaline, phenylglycine, omithine, sarcosine, 2- thienyl alanine and/or D-isomers of amino acids.

The invention also contemplates covalently modifying a protein, fragment or variant of the invention with dinitrophenol, in order to render it immunogenic in humans. Proteins of the invention such as those exemplified in FIG. 1 ,

(inclusive of fragments, variants, derivatives and homologs in general) may be prepared by any suitable procedure known to those of skill in the art.

For example, the protein may be prepared by a procedure including the steps of: (1) preparing an expression construct which comprises a recombinant nucleic acid of the invention, operably linked to one or more regulatory nucleotide sequences; (ii) transfecting or transforming a suitable host cell with the expression construct; and (iii) expressing the protein in said host cell.

Preferably, the recombinant nucleic acid of the invention encodes a fructose-1 ,6-bisphosphate aldolase protein as set forth in SEQ ID NOS. 1-4 as shown in FIG. 1. More preferably, the recombinant nucleic acid of the invention is selected from the group consisting of SEQ ID NOS. 5-8 as shown in FIG. 2. Nucleic Acids

The term "nucleic acid" as used herein designates single or double stranded mRNA, RNA, cRNA and DNA, said DNA inclusive of cDNA and genomic DNA. A nucleic acid comprises two or more nucleotides bonded together and includes polynucleotides and oligonucleotides as defined herein.

The term 'Isolated nucleic acid" as used herein refers to a nucleic acid subjected to in vitro manipulation into a form not normally found in nature. Isolated nucleic acid include both native and recombinant (non- native) nucleic acids. For example, P. vivax, P. yoelii, P. chabaudi and P. vinckei aldolase have been isolated from the respective species.

A "polynucleotide" is a nucleic acid having eighty (80) or more contiguous nucleotides, while an "oligonucleotide" has less than eighty (80) contiguous nucleotides.

In one embodiment, a nucleic acid "fragment' comprises a nucleotide sequence that constitutes less than 100% of a nucleic acid of the invention. A fragment includes a polynucleotide, oligonucleotide, probe, primer and an amplification product, eg. a PCR product. Examples of fragments are primers set forth in SEQ ID NOS: 14-22.

A "probe" may be a single or double-stranded oligonucleotide or polynucleotide, suitably labeled for the purpose of detecting complementary sequences in Northern or Southern blotting, for example. An example of a Southern blot probed with a P. berghei aldolase nucleic acid fragment is provided in FIG. 7. A nucleotide sequence of a probe may be of any useful length and may be derived from a longer sequence, for example a probe may be derived from any one of SEQ ID NOS. 5-8. A "primer" is usually a single-stranded oligonucleotide, preferably having 20-50 contiguous nucleotides, which is capable of annealing to a complementary nucleic acid "template" and being extended in a template-dependent fashion by the action of a DNA polymerase such as Taq polymerase, RNA-dependent DNA polymerase or Sequenase™. The invention in a preferred embodiment uses primers shown in Table 1 (SEQ ID NOS. 14-20; and SEQ ID NOS. 21-22) which hybridise with nucleic acid templates located on Plasmodium species, to amplify nucleotides therebetween. Additional primers may be derived from any one of SEQ ID NOS. 5-8. Primers derived from the nucleic acids of the invention may further comprise at their respective 5' end a nucleotide sequence that may be useful for cloning, for example primers set forth in SEQ ID NOS. 14-16 and 21. Additional sequence may, for example, code for a recognition site for a restriction enzyme or provide an appropriate number of nucleotide bases for in frame cloning into a vector as will be appreciated by one skilled in the art. Use of these primers is provided in more detail hereinafter.

As used herein, the term nucleic acid "variant' means a nucleic acid of the invention, the nucleotide sequence of which has been mutagenized or otherwise altered so as to encode substantially the same, or a modified protein. Such changes may be trivial, for example in cases where more convenient restriction endonuclease cleavage and/or recognition sites are introduced without substantially affecting biological activity of an encoded protein when compared to a non-variant form. Other nucleotide sequence alterations may be introduced so as to modify biological activity of an encoded protein. These alterations may include deletion or addition of one or more nucleotide bases, or involve non-conservative substitution of one base for another. Such alterations can have profound effects upon biological activity of an encoded protein, possibly increasing or decreasing biological activity. In this regard, mutagenesis may be performed in a random fashion or by site-directed mutagenesis in a more "rational" manner. Standard mutagenesis techniques are well known in the art, and examples are provided in Chapter 9 of CURRENT PROTOCOLS IN MOLECULAR BIOLOGY Eds Ausubel et al. (John Wiley & Sons NY, 1995) which is incorporated herein by reference. For the purposes of host cell expression, the recombinant nucleic acid is operably linked to one or more regulatory sequences in an expression vector.

An "expression vector" may be either a self-replicating extra- chromosomal vector such as a plasmid, or a vector that integrates into a host genome. Examples of expression vectors used herein are pET-His tag vectors (Invitrogen), pQE His tag vectors(Qiagen) and derivations thereof , as described in more detail hereinafter.

By "operably linked " is meant that said regulatory nucleotide sequence(s) is/are positioned relative to the recombinant nucleic acid of the invention to initiate, regulate or otherwise control transcription.

Regulatory nucleotide sequences will generally be appropriate for the host cell used for expression. Numerous types of appropriate expression vectors and suitable regulatory sequences are known in the art for a variety of host cells.

Typically, said one or more regulatory nucleotide sequences may include, but are not limited to, promoter sequences, leader or signal sequences, ribosomal binding sites, transcriptional start and termination sequences, translational start and termination sequences, and enhancer or activator sequences.

Constitutive or inducible promoters as known in the art are contemplated by the invention. The promoters may be either naturally occurring promoters, or hybrid promoters that combine elements of more than one promoter. In a preferred embodiment, the expression vector further comprises a selectable marker gene to allow the selection of transformed host cells. Selectable marker genes are well known in the art and will vary with the host cell used. In preferred embodiments of the invention, the expression vector is either pET (Invitrogen) which comprises a kanamycin resistance gene for selection of positively transformed host cells when grown in a medium comprising kanamycin or pQE His tag vector (Qiagen) which comprises an ampicillin resistance gene for selection using ampicillin.

The expression vector may also include a fusion partner (typically provided by the expression vector) so that the recombinant protein of the invention is expressed as a fusion protein with the fusion partner. The main advantage of fusion partners is that they assist identification and/or purification of the fusion protein. Identification and/or purification may include using a monoclonal antibody or substrate specific for the fusion partner. A fusion partner may also comprise a leader sequence for directing secretion of a recombinant protein, for example an alpha-factor leader sequence.

In order to express the fusion protein, it is necessary to ligate a nucleotide sequence according to the invention into the expression vector so that the translational reading frames of the fusion partner and the nucleotide sequence of the invention coincide.

The fusion partners may also have protease cleavage sites, such as for Factor X_a or Thrombin, which allow the relevant protease to digest the fusion protein of the invention and thereby liberate the recombinant protein of the invention therefrom. The liberated protein can then be isolated from the fusion partner by subsequent chromatographic separation.

Fusion partners according to the invention also include within their scope "epitope tags", which are usually short peptide sequences for which a specific antibody is available. Well known examples of fusion partners include, but are not limited to, hexahistidine (HIS₆)-tag, N-Flag, Fc portion of human IgG, glutathione-S-transferase (GST) and maltose binding protein (MBP), which are particularly useful for isolation of the fusion protein by affinity chromatography. For the purposes of fusion protein purification by affinity chromatography, relevant matrices for affinity chromatography may include nickel- or cobalt-conjugated resins, anti-tag antibodies, glutathione- conjugated resins, and amylose-conjugated resins respectively. Many such matrices are available in "kit" form, such as the QIAexpress™ system (Qiagen) useful with (HIS₆) fusion partners and the Pharmacia GST purification system.

As hereinbefore, proteins of the invention may be produced by culturing a host cell transformed with an expression construct comprising a nucleic acid encoding a protein, or protein homolog, of the invention. The conditions appropriate for protein expression will vary with the choice of expression vector and the host cell. This is easily ascertained by one skilled in the art through routine experimentation.

Suitable host cells for expression may be prokaryotic or eukaryotic. Suitable prokaryotic host cells are bacteria.

Preferably, the bacteria host cell is a strain of E. coll. More preferably the £. co// strain is selected from the group consisting of M15(pREP4), SG13009, BL21-CodonPlus (Stratagene) and BL21 (DE3) (Novogen). Suitable eukaryotic host cells are mammalian cells, insect cells, plant cells and yeast.

In one embodiment the host cell is a yeast cell.

The recombinant protein may be conveniently prepared by a person skilled in the art using standard protocols as for example described in Sambrook, et al., MOLECULAR CLONING. A Laboratory Manual (Cold Spring Harbor Press, 1989), incorporated herein by reference, in particular Sections 16 and 17; CURRENT PROTOCOLS IN MOLECULAR BIOLOGY Eds. Ausubel et al., (John Wiley & Sons, Inc. 1995-1999), incorporated herein by reference, in particular Chapters 10 and 16; and CURRENT PROTOCOLS IN PROTEIN SCIENCE Eds. Coligan ef al., (John Wiley & Sons, Inc. 1995-1999) which is incorporated by reference herein, in particular Chapters 1 , 5 and 6.

The invention provides an isolated nucleic acid that encodes a protein of the invention for a fructose-1 ,6-bisphophate aldolase protein.

Preferably, said isolated nucleic acid has a nucleotide sequence selected from the group consisting of the sequences set forth in SEQ ID NOS. 5-8 as shown in FIG. 2.

The present invention also contemplates homologues of nucleic acids of the invention as hereinbefore defined.

In one embodiment, nucleic acid homologs encode protein homologs of the invention, inclusive of variants, fragments and derivatives thereof other than homologs from P. falciparum or P. berghei previously disclosed. In another embodiment, nucleic acid homologs share at least 60%, preferably at least 70%, more preferably at least 80%, and even more preferably at least 90% sequence identity with the nucleic acids of the invention. In yet another embodiment, nucleic acid homologs hybridize to nucleic acids of the invention under at least low stringency conditions, preferably under at least medium stringency conditions and more preferably under high stringency conditions. Such homologs specifically exclude aldolase from P. falciparum and P. berghei as described by Knapp et al, 1996, supra and Meier et al, 1992, supra respectively.

As used herein, "endogenous nucleic acid" refers to a nucleic acid which is usually expressed or present in a cell, tissue, animal or sample. An example of an endogenous nucleic acid is an endogenous gene which is expressed in the cell, tissue, animal or sample. "Hybridize and Hybridization" is used herein to denote the pairing of at least partly complementary nucleotide sequences to produce a DNA-DNA, RNA-RNA or DNA-RNA hybrid. Hybrid sequences comprising complementary nucleotide sequences occur through base-pairing.

In DNA, complementary bases are: (i) A and T; and

(ii) C and G.

In RNA, complementary bases are:

(i) A and U; and

(ii) C and G. In RNA-DNA hybrids, complementary bases are: (i) A and U; (ii) A and T; and (iii) G and C. Modified purines (for example, inosine, methylinosine and methyladenosine) and modified pyrimidines (thiouridine and methylcytosine) may also engage in base pairing.

"Stringency" as used herein, refers to temperature and ionic strength conditions, and presence or absence of certain organic solvents and/or detergents during hybridisation. The higher the stringency, the higher will be the required level of complementarity between hybridizing nucleotide sequences.

"Stringent conditions "designates those conditions under which only nucleic acid having a high frequency of complementary bases will hybridize.

Reference herein to low stringency conditions includes and encompasses:-

(i) from at least about 1 % v/v to at least about 15% v/v formamide and from at least about 1 M to at least about

2 M salt for hybridisation at 42°C, and at least about 1

M to at least about 2 M salt for washing at 42°C; and

(ii) 1 % Bovine Serum Albumin (BSA), 1 mM EDTA, 0.5 M NaHP0₄ (pH 7.2), 7% SDS for hybridization at 65°C,

and (i) 2xSSC, 0.1% SDS; or (ii) 0.5% BSA, 1 mM EDTA, 40 mM NaHP0₄ (pH 7.2), 5% SDS for washing at room temperature.

Medium stringency conditions include and encompass:-

(i) from at least about 16% v/v to at least about 30% v/v formamide and from at least about 0.5 M to at least

about 0.9 M salt for hybridisation at 42°C, and at least

about 0.5 M to at least about 0.9 M salt for washing at

42°C; and

(ii) 1 % Bovine Serum Albumin (BSA), 1 mM EDTA, 0.5 M

NaHP0₄ (pH 7.2), 7% SDS for hybridization at 65°C and (a) 2 x SSC, 0.1% SDS; or (b) 0.5% BSA, 1 mM EDTA, 40 mM NaHP0₄ (pH 7.2), 5% SDS for washing

at 42°C.

High stringency conditions include and encompass:- (i) from at least about 31% v/v to at least about 50% v/v formamide and from at least about 0.01 M to at least

about 0.15 M salt for hybridisation at 42°C, and at least

about 0.01 M to at least about 0.15 M salt for washing

at 42°C; (ii) 1 % BSA, 1 mM EDTA, 0.5 M NaHP0₄ (pH 7.2), 7%

SDS for hybridization at 65°C, and (a) 0.1 x SSC, 0.1%

SDS; or (b) 0.5% BSA, 1 mM EDTA, 40 mM NaHP0₄ (pH 7.2), 1 % SDS for washing at a temperature in excess of 65°C for about one hour; and

(iii) 0.2 x SSC, 0.1 % SDS for washing at or above 68°C for

about 20 minutes.

In general, the T_m of a duplex DNA decreases by about 1°C

with every increase of 1 % in the number of mismatched bases.

Notwithstanding the above, stringent conditions are well known in the art, such as described in Chapters 2.9 and 2.10 of Ausubel et al., supra, which are herein incorporated be reference. A skilled addressee will also recognize that various factors can be manipulated to optimize the specificity of the hybridization. Optimization of the stringency of the final washes can serve to ensure a high degree of hybridization.

Typically, complementary nucleotide sequences are identified by blotting techniques that include a step whereby nucleotides are immobilized on a matrix (preferably a synthetic membrane such as nitrocellulose), a hybridization step, and a detection step. Southern blotting is used to identify a complementary DNA sequence; northern blotting is used to identify a complementary RNA sequence. Dot blotting and slot blotting can be used to identify complementary DNA/DNA, DNA/RNA or RNA/RNA polynucleotide sequences. Such techniques are well known by those skilled in the art, and have been described in Ausubel et al., supra, at pages 2.9.1 through 2.9.20.

According to such methods, Southern blotting involves separating DNA molecules according to size by gel electrophoresis, transferring the size-separated DNA to a synthetic membrane, and hybridizing the membrane bound DNA to a complementary nucleotide sequence. An example of a Southern blot is shown in FIG. 7.

In dot blotting and slot blotting, DNA samples are directly applied to a synthetic membrane prior to hybridization as above. An alternative blotting step is used when identifying complementary nucleic acids in a cDNA or genomic DNA library, such as through the process of plaque or colony hybridization. Other typical examples of this procedure is described in Chapters 8-12 of Sambrook etal., supra which are herein incorporated by reference. Typically, the following general procedure can be used to determine hybridization conditions. Nucleic acids are blotted/transferred to a synthetic membrane, as described above. A nucleotide sequence of the invention is labeled as described above, and the ability of this labeled nucleic acid to hybridize with an immobilized nucleotide sequence analysed. A microarray also uses hybridization-based technology that, for example, may allow detection and/or isolation of a nucleic acid by way of hybridization of complementary nucleic acids. A microarray provides a method of high throughput screening for a nucleic acid in a sample that may be tested against several nucleic acids attached to a surface of a matrix or chip. In this regard, a skilled person is referred to Chapter 22 of CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (Eds. Ausubel et al. John Wiley & Sons NY, 2000).

A skilled addressee will recognize that a number of factors influence hybridization. The specific activity of radioactively labeled polynucleotide sequence should typically be greater than or equal to about

10⁸ dpm/μg to provide a detectable signal. A radiolabeled nucleotide

sequence of specific activity 10⁸ to 10⁹ dpm/μg can detect approximately 0.5

pg of DNA. It is well known in the art that sufficient DNA must be immobilized on the membrane to permit detection. It is desirable to have

excess immobilized DNA, usually 10 μg. Adding an inert polymer such as

10% (w/v) dextran sulfate (MW 500,000) or polyethylene glycol 6000 during hybridization can also increase the sensitivity of hybridization (see Ausubel et al., supra at 2.10.10). To achieve meaningful results from hybridization between a nucleic acid immobilized on a membrane and a labeled nucleic acid, a sufficient amount of the labeled nucleic acid must be hybridized to the immobilized nucleic acid following washing. Washing ensures that the labeled nucleic acid is hybridized only to the immobilized nucleic acid with a desired degree of complementarity to the labeled nucleic acid.

Methods for detecting labeled nucleic acids hybridized to an immobilized nucleic acid are well known to practitioners in the art. Such methods include autoradiography, chemiluminescent, fluorescent and colourimetric detection. Alternatively, or in addition to, nucleic acid homologs of the invention may be prepared according to the following procedure:

(i) obtaining a nucleic acid extract from a suitable host, preferably Plasmodium spp; (ii) creating primers which are optionally degenerate wherein each comprises a portion of a nucleotide sequence of the invention; and (iii) using said primers to amplify, via nucleic acid amplification techniques, one or more amplification products from said nucleic acid extract.

As used herein, an "amplification product" refers to a nucleic acid product generated by nucleic acid amplification techniques.

Suitable nucleic acid amplification techniques are well known to the skilled addressee, and include PCR as for example described in Chapter 15 of Ausubel et al. supra, which is incorporated herein by reference; strand displacement amplification (SDA) as for example described in U.S. Patent No 5,422,252 which is incorporated herein by reference; rolling circle replication (RCR) as for example described in Liu etal., 1996, J. Am. Chem. Soc. 118 1587 and International application WO 92/01813; and Lizardi and Caplan, International Application WO 97/19193, which are incorporated herein by reference; nucleic acid sequence-based amplification (NASBA) as for example described by Sooknanan et a/., 1994, Biotechniques 17 1077, which is incorporated herein by reference; ligase chain reaction (LCR) as for example described in International Application WO89/09385 which is

incorporated herein by reference; and Q-β-replicase amplification as for

example described byTyagi etal., 1996, Proc. Natl. Acad. Sci. USA 935395 which is incorporated herein by reference. Antibodies

The invention also contemplates antibodies against P. vivax, P. yoe//7, P. chabaudi or P. vinckei aldolase proteins as set forth in SEQ ID NOS. 1-4 (shown in FIG. 1 ), inclusive of fragments, variants and derivatives thereof. Antibodies of the invention may be polyclonal or monoclonal. Well- known protocols applicable to antibody production, purification and use may be found, for example, in Chapter 2 of Coligan et al., CURRENT PROTOCOLS IN IMMUNOLOGY (John Wiley & Sons NY, 1991-1994) and Harlow, E. & Lane, D. Antibodies: A Laboratory Manual, Cold Spring Harbor, Cold Spring Harbor Laboratory, 1988, which are both herein incorporated by reference. Generally, antibodies of the invention bind to or conjugate with a protein, fragment, variant or derivative of the invention. Antibodies of the invention may respectively bind an aldolase protein, fragment, variant or derivative thereof for a specific Plasmodium species and thereby may be useful for distinguishing between Plasmodium species (eg. specifically binding P. v/Vax). Alternatively, or in addition, another antibody may bind aldolase protein from all Plasmodium species, for example an antibody that binds to amino acid sequence common to all Plasmodium species. For example, the antibodies may comprise polyclonal antibodies. Such antibodies may be prepared for example by injecting a protein, fragment, variant or derivative of the invention into a production species, which may include mice, rabbits, goats and sheep, to obtain polyclonal antisera. Methods of producing polyclonal antibodies are well known to those skilled in the art. Exemplary protocols which may be used are described for example in Coligan et al., supra, and in Harlow & Lane, 1988, supra. Monoclonal antibodies may be produced using the standard method as for example, described in an article by Kohler & Milstein, 1975, Nature 256, 495, which is herein incorporated by reference, or by more recent modifications thereof as for example, described in Coligan et al., supra by immortalizing spleen or other antibody producing cells derived from a production species which has been inoculated with one or more of the proteins, fragments, variants or derivatives of the invention.

The invention also includes within its scope antibodies which comprise Fc or Fab fragments of the polyclonal or monoclonal antibodies referred to above. Alternatively, the antibodies may comprise single chain Fv antibodies (scFvs) against the peptides of the invention. Such scFvs may be prepared, for example, in accordance with the methods described respectively in United States Patent No 5,091 ,513, European Patent No 239,400 or the article by Winter & Milstein, 1991 , Nature 349293, which are incorporated herein by reference.

The antibodies of the invention may be used for affinity chromatography in isolating natural or recombinant aldolase or proteins comprising a region which is recognised by the antibodies. For example reference may be made to immunoaffinity chromatographic procedures described in Chapter 9.5 of Coligan et al., supra.

Any suitable technique for determining formation of antibody- antigen complex may be used. For example, an antibody or antibody fragment according to the invention having a label associated therewith may be utilized in immunoassays. Such immunoassays may include, but are not limited to, radioimmunoassays (RIAs), enzyme-linked immunosorbent assays (ELISAs) and immunochromatographic techniques (ICTs) which are well known those of skill in the art.

For example, reference may be made to Chapter 7 of Coligan et al., supra which discloses a variety of immunoassays that may be used in accordance with the present invention. Immunoassays may include immuno- blots, Western blots, ELISA and other assays as understood in the art.

The label associated with the antibody or antibody fragment may include the following: (A) direct attachment of the label to the antibody or antibody fragment;

(B) indirect attachment of the label to the antibody or antibody fragment; i.e., attachment of the label to another assay reagent which subsequently binds to the antibody or antibody fragment; and

(C) attachment to a subsequent reaction product of the antibody or antibody fragment.

The label may be selected from a group including, but not limited to, a chromogen, a catalyst, an enzyme, a fluorophore, a chemiluminescent molecule, a lanthanide ion such as Europium (Eu³⁴), a radioisotope and a directly visual label. In the case of a directly visual label, a colloidal metallic or non-metallic particle, a dye particle, an enzyme or a substrate, an organic polymer, a latex particle, a liposome, or other vesicle containing a signal producing substance and the like may be used. In a preferred embodiment of the invention, an antibody is labelled with colloidal gold.

A large number of enzymes suitable for use as labels is disclosed in United States Patent Specifications U.S. 4,366,241, U.S. 4,843,000, and U.S. 4,849,338, all of which are herein incorporated by reference. Enzyme labels useful in the present invention include, but are not

limited to, alkaline phosphatase, horseradish peroxidase, luciferase, _-

galactosidase, glucose oxidase, lysozyme, malate dehydrogenase and the like. The enzyme label may be used alone or in combination with a second enzyme in solution.

The fluorophore may be selected from a group including, but not limited to, fluorescein isothiocyanate (FITC), tetramethylrhodamine isothiocyanate (TRITL) or R-Phycoerythrin (RPE). Pharmaceutical compositions A further feature of the invention is the use of the aldolase protein and/or nucleic acid, fragment, variant or derivative of the invention ("immunogenic agents') as actives in a pharmaceutical composition such as a composition suitable for immuno-therapy or vaccination of humans. An immunogenic agent when administered to an animal, for example a human, is capable of eliciting an immune response in said animal against the immunogenic agent.

Yet another feature of the invention is the use of the nucleic acid of the invention, or fragments thereof, for regulating levels of an endogenous nucleic acid in a host cell. Preferably, regulation is down regulation such that an amount of a nucleic acid and/or protein encoded by the endogenous nucleic acid in the host cell is reduced. More preferably, the nucleic acid of the invention used down regulates a specific endogenous nucleic acid and/or protein of Plasmodium, in particular a nucleic acid and/or protein encoding aldolase. Preferably, the nucleic acid of the invention, or fragment thereof, is an antisense nucleic acid complementary to the endogenous nucleic acid. More preferably, the nucleic acid of the invention, or fragment thereof, is sufficiently homologous or identical to the endogenous nucleic acid to allow hybridization of complementary nucleic acids respectively under suitable conditions. Complementary nucleic acids may be determined as described above under the heading "Hybridize and hybridization" which describes complementary bases for DNA and RNA. The nucleic acid of the invention may be used to treat malaria. Antisense oligonucleotides targeting P. falciparum aldolase has been described by Wanidworanum et al, 1999, Mol Biochem Parasitol 102 91 , herein incorporated by reference. The oligonucleotides were tested on asexual blood stages of P. falciparum and results showed that aldolase expression of this species of Plasmodium was inhibited, which, resulted in decreased malarial g-ycolysis and energy production. Suitably, the pharmaceutical composition comprises a pharmaceutically-acceptable carrier or diluent.

By "pharmaceutically-acceptable carrier or diluent "is meant a solid or liquid filler, diluent or encapsulating substance that may be safely used in systemic administration. Depending upon the particular route of administration, a variety of carriers, well known in the art may be used. These carriers may be selected from a group including sugars, starches, cellulose and its derivatives, malt, gelatine, talc, calcium sulfate, vegetable oils, synthetic oils, polyols, alginic acid, phosphate buffered solutions, emulsifiers, isotonic saline, and pyrogen-free water.

Any suitable route of administration may be employed for providing a patient with the composition of the invention. For example, oral, rectal, parenteral, sublingual, buccal, intravenous, intra-articular, intramuscular, intra-dermal, subcutaneous, inhalational, intraocular, intraperitoneal, intracerebroventricular, transdermal and the like may be employed. Intra-muscular and subcutaneous injection is appropriate for administration of immunogenic agents of the present invention.

Dosage forms include tablets, dispersions, suspensions, injections, solutions, syrups, troches, capsules, suppositories, aerosols, transdermal patches and the like. These dosage forms may also include injecting or implanting controlled releasing devices designed specifically for this purpose or other forms of implants modified to act additionally in this fashion. Controlled release of the therapeutic agent may be effected by coating the same, for example, with hydrophobic polymers including acrylic resins, waxes, higher aliphatic alcohols, polylactic and polyglycolic acids and certain cellulose derivatives such as hydroxypropylmethyl cellulose. In addition, the controlled release may be effected by using other polymer matrices, liposomes and/or microspheres.

Pharmaceutical compositions of the present invention suitable for oral or parenteral administration may be presented as discrete units such as capsules, sachets or tablets each containing a pre-determined amount of one or more immunogenic agent of the invention, as a powder or granules or as a solution or a suspension in an aqueous liquid, a non-aqueous liquid, an oil-in-water emulsion or a water-in-oil liquid emulsion. Such compositions may be prepared by any of the methods of pharmacy but all methods include the step of bringing into association one or more immunogenic agents as described above with the carrier which constitutes one or more necessary ingredients. In general, the compositions are prepared by uniformly and intimately admixing the agents of the invention with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product into the desired presentation.

A pharmaceutical composition includes an immuno-therapeutic composition. An immuno-therapeutic composition includes a vaccine. Vaccines

The above compositions may be used as therapeutic or prophylactic vaccines against malaria. Accordingly, the invention extends to the production of vaccines containing as actives one or more of the immunogenic agents of the invention. Any suitable procedure is contemplated for producing such vaccines. Exemplary procedures include, for example, those described in NEW GENERATION VACCINES (1997, Levine et al., Marcel Dekker, Inc. New York, Basel Hong Kong) which is incorporated herein by reference.

An immunogenic agent according to the invention can be mixed, conjugated or fused with other antigens, including B or T cell epitopes of other antigens. In addition, it can be conjugated to a carrier as described below.

When an haptenic peptide of the invention is used (i.e., a peptide which reacts with cognate antibodies, but cannot itself elicit an immune response), it can be conjugated with an immunogenic carrier.

Useful carriers are well known in the art and include for example: thyroglobulin; albumins such as human serum albumin; toxins, toxoids or any mutant cross reactive material (CRM) of the toxin from tetanus, diptheria, pertussis, Pseudomonas, E. coli, Staphylococcus, and Streptococcus; polyamino acids such as poly(lysine:glutamic acid); influenza; Rotavirus VP6,

Parvovirus VP1 and VP2; hepatitis B virus core protein; hepatitis B virus recombinant vaccine and the like. Alternatively, a fragment or epitope of a carrier protein or other immnogenic protein may be used. For example, a haptenic peptide of the invention can be coupled to a T cell epitope of a bacterial toxin, toxoid or CRM. In this regard, reference may be made to

U.S. Patent No 5,785,973 which is incorporated herein by reference.

The immunogenic agents of the invention may be administered as multivalent subunit vaccines in combination with antigens of the malaria parasite.

The vaccines can also contain a physiologically-acceptable diluent or excipient such as water, phosphate buffered saline and saline.

The vaccines and immunogenic agents may include an adjuvant as is well known in the art. Useful adjuvants include, but are not limited to, adjuvants approved for use in humans for example SBAS2, SBAS4, QS21 , alum, MF59, Montanide ISA720, Montanide ISA50, PCPP or DNA CpGs.

The immunogenic agents of the invention may be expressed by attenuated viral hosts. By "attenuated viral hosts "is meant viral vectors that are either naturally, or have been rendered, substantially avirulent. A virus may be rendered substantially avirulent by any suitable physical (e.g., heat treatment) or chemical means (e.g., formaldehyde treatment). By "substantially avirulent" is meant a virus whose infectivity has been destroyed. Ideally, the infectivity of the virus is destroyed without affecting the proteins that carry the immunogenicity of the virus. From the foregoing, it will be appreciated that attenuated viral hosts may comprise live viruses or inactivated viruses.

Attenuated viral hosts which may be useful in a vaccine according to the invention may comprise viral vectors inclusive of adenovirus, cytomegalovirus and preferably pox viruses such as vaccinia (see for example Paoletti and Panicali, U.S. Patent No. 4,603,112 which is incorporated herein by reference) and attenuated Salmonella strains (see for example Stacker, U.S. Patent No.4,550,081 which is herein incorporated by reference). Live vaccines are particularly advantageous because they lead to a prolonged stimulus that can confer substantially long-lasting immunity.

Multivalent vaccines can be prepared from one or more microorganisms that express different epitopes of the malaria parasite. In addition, epitopes of other pathogenic microorganisms can be incorporated into the vaccine.

A recombinant vaccinia virus may be prepared to express a nucleic acid according to the invention. Upon introduction into a host, the recombinant vaccinia virus expresses the immunogenic agent, and thereby elicits a host CTL response. For example, reference may be made to U.S. Patent No 4,722,848, incorporated herein by reference, which describes vaccinia vectors and methods useful in immunization protocols.

A wide variety of other vectors useful for therapeutic administration or immunization with the immunogenic agents of the invention will be apparent to those skilled in the art from the present disclosure.

The nucleic acid of the invention may be used as a vaccine in the form of a "naked DNA" vaccine as is known in the art. For example, an expression vector of the invention may be introduced into a mammal, where it causes production of a protein in vivo, against which the host mounts an immune response as for example described in Barry, M. et al., (1995, Nature, 377:632-635) which is hereby incorporated herein by reference. Detection kits and methods thereof

The present invention also provides a kit and methods and agents thereof for detecting the malaria parasite in a sample. A particularly useful detection kit incorporates P. vivax specific agents for distinguishing P. vivax infection from infection by other Plasmodium species. These will contain one or more particular agents described above depending upon the nature of the test method employed. In this regard, the kit may include one or more of a protein, fragment, variant, derivative, antibody, antibody fragment or nucleic acid according to the invention. The kits may also optionally include appropriate reagents for detection of labels, positive and negative controls, washing solutions, dilution buffers and the like. For example, an antibody based kit may comprise (a) an aldolase protein or fragment thereof according to the invention as a positive control, (b) at least one antibody which binds to the protein or fragment thereof from (a), (c) buffers including a sample lysis buffer, (d) a matrix which may immobilise an antigen-antibody complex and (e) a means for detecting an antigen-antibody complex. A nucleic acid based detection kit may comprise (i) a nucleic acid according to the invention (which may be used as a positive control), (ii) an oligonucleotide primer according to the invention, and optionally a DNA polymerase, DNA ligase or other suitable enzyme depending on the nucleic acid amplification technique employed.

There are commercially available rapid test kits for malaria. These test kits for P. falciparum or P. vivax are based on antibody detection

of histone-rich protein (HRP-2; Parasight™-F, ICT Malaria P.f.™, ICT Malaria

Pf/Pv™ (AMRAD-ICT) and NOW^®ICT Malaria P.f./P.v. (Binax, USA)) and or

lactose dehydrogenase (pLDH; OptiMAL™) proteins. Presently, kits based

on antibody detection of HRP-2 may give false positive results because HRP-2 may be detected in an individual's blood sample for weeks after an infection has been successfully treated and the individual cured of malaria (Hanscheid, 1999, Clin. Lab. Haem. 21 235). False positive results for both HRP-2 and pLDH based test kits have also been associated with a presence of rheumatoid factor (RF); as many as 60% of individuals tested positive for malaria patients did not in fact have malaria, but were RF-positive when

tested using the Parasight™-F and OptiMAL™ test kits respectively (Laferi et

al, 1997, New England Journal of Medicine 337 1635; Grobusch et al, 1999, Lancet 353 297). A false positive result may unnecessarily extend the malaria treatment which may prolong uncomfortable side effects from medication to treat malaria and needlessly waste money and resources involved in treatment which could otherwise be put to better use. There are also documented cases of false negative results from HRP-2 based detection kits which resulted from a lack of the HRP-2 gene (Hanscheid, 1999, supra). A false negative result may delay proper medical treatment of an individual.

The present invention provides an alternative to using HRP-2 or pLDH which may be more efficient and accurate than existing test kits. Aldolase expression is known to be high in infected erythrocytes (Wanidworanum et al, 1999, supra) which may improve sensitivity of a detection kit; aldolase is an important enzyme in the pathway providing needed energy to the parasite, thus it is unlikely that the aldolase gene would be missing from an infecting parasite which would minimise false negative results as mentioned above in relation to HRP-2 based detections kits; and Plasmodium aldolase protein levels rapidly decline following successful treatment of malaria and thus may reduce the number of false positive results following treatment or cure of malaria. In light of the aforementioned, a diagnostic kit based on Plasmodium aldolase expression would provide an improved means for detecting and monitoring malaria infection in an individual. In particular, an antibody which specifically binds the P. vivax aldolase protein could be used to improve the specificity of current test kits for detecting this Plasmodium species. The sequence differences between P. falciparum and P. vivax aldolase as determined herein could be exploited to generate species specific agents (eg. monoclonal antibodies) which could be used in rapid diagnostic kits to determine P. vivax infection even when an individual has a mixed infection with other Plasmodium species.

A rapid diagnostic kit may comprise an immunochromatographic test or a dipstick assay. An example of an immunochromatographic test kit is ICT Malaria-Pf/Pv (AMRAD ICT) which uses two opposable faces of a small, card-like device, joined by a hinge. This allows a sample to be pretreated before it is brought into contact with a membrane that will capture and display the presence of essentially any analyte of interest. The device allows the detection of antigens or antibodies in concentrations equal to or lower than most conventional tests such as ELISA formats, as well as detection of low molecular weight analytes.

The NOW^®ICT Malaria P.f./P.v. (Binax, USA) and ICT Malaria-

Pf/Pv tests to detect P. falciparum and P. vivax uses two pairs of antibodies; one pair of antibodies specific for P. falciparum HRP-2 antigen and a second pair of antibodies directed to a pan-malaria antigen. By definition, the pan- malaria antigen is not specific to a single Plasmodium species, but is an antigen common to malaria parasites in general. Accordingly, an antibody which binds a pan-malaria antigen may be expressed by several Plasmodium species, for example the pan-malaria antigen detected by the ICT Malaria-Pf/Pv kit which is expressed by blood stages of P. falciparum and P. vivax and P. ovale (Win et al, 2001 , Acta Tropica 80 283). One

antibody of each pair of antibodies is attached to visible colloidal gold respectively and impregnated into a sample pad, while the second antibody of each pair of antibodies respectively is immobilized in a line across the test strip. A sample of 10ul of whole blood is added to the sample pad where lysis occurs and the P. falciparum HRP-2 antigen and pan-malaria antigen present in the lysed sample bind to the respective colloidal gold labeled antibody. When running buffer is added to the sample pad, blood and labeled antibody migrate up the test strip crossing the line comprising the immobilised second antibody of each pair of antibodies respectively. This test kit does not use a P. vivax specific antibody and relies on non-binding of P. falciparum specific antibodies to HRP-2 of P. vivax. This is an indirect means for detecting P. wVax infection and this kit is not suitable for co- infection by P. falciparum and P. wVax. The occurrence of false positive and false negative results using HRP-2 based test kits mentioned above may be avoided by using the P. vivax aldolase protein and antibodies of the present invention. The present invention may include a diagnostic kit similar to those mentioned above; however, a kit relating to the present invention may incorporate a P. vivax aldolase protein or fragment thereof and antibodies which bind said proteins or fragments.

Dipstick assays currently available are OptiMAL™ (Flow Inc.)

and ParaSight™ F+V (Becton Dickinson Diagnostics). The OptiMAL™ assay

is based on detection of the Plasmodium produced enzyme lactate dehydrogenase (pLDH) which is detected by a series of monoclonal antibodies. Differentiation between malarial species is based on antigenic

differences between pLDH isoforms. ParaSight™ F+V use HRP-2 and pLDH

monoclonal antibodies. Both assays employ similar methodologies. A dipstick, a preparation of nitrocellulose and glass fibre, is pretreated with monoclonal antibodies against the test proteins which are applied in parallel lines. Lysis buffer is added to a tube and whole blood collected from a finger prick is added. A single drop of lysed blood is added to the test strip. This is followed by addition of a detector antibody and a final wash step. The present invention may use a modified dipstick to test for P. vivax infection by using P. vivax aldolase specific agents (eg. aldolase protein as a positive control and P. vivax aldolase specific antibodies). Unique aldolase sequences could also be used to design primers for use in diagnostic PCR on material extracted from red blood cells from a finger prick. Preparation of immunoreactive fragments

The invention also extends to a method of identifying an immunoreactive fragment of a protein, variant or derivatives according to the invention. This method essentially comprises generating a fragment of the protein, variant or derivative, administering the fragment to a mammal; and detecting an immune response in the mammal. Such response may include production of elements which specifically bind aldolase and/or variant or derivative thereof and/or provide a protective effect against malaria parasite infection. Prior to testing a particular fragment for immunoreactivity in the above method, a variety of predictive methods may be used to deduce whether a particular fragment can be used to obtain an antibody that cross- reacts with the native antigen. These predictive methods may be based on amino-terminal or carboxy-terminal sequence as for example described in Chapter 11.14 of Ausubel et al., supra. Alternatively, or in addition, these predictive methods may be based on predictions of hydrophilicity as for example described by Kyte & Doolittle 1982, J. Mol. Biol. 157 105 and Hopp & Woods, 1983, Mol. Immunol. 20 483) which are incorporated herein by reference, or predictions of secondary structure as for example described by Choo & Fasman,1978, Ann. Rev. Biochem. 47 251 ), which is incorporated herein by reference.

In addition, "epitope mapping" uses monoclonal antibodies which bind to and thus identify specific epitopes of a protein. In particular, use of epitope specific antibodies may provide information in relation to protein folding or protein conformation. An exemplary method of epitope mapping is provided in Coligan et al., supra.

Generally, peptide fragments consisting of 10 to 15 residues provide optimal results. Peptides as small as 6 or as large as 20 residues have worked successfully. Such peptide fragments may then be chemically coupled to a carrier molecule such as keyhole limpet hemocyanin (KLH) or bovine serum albumin (BSA) as for example described in Sections 11.14 and 11.15 of Ausubel et al., supra). The peptides may be used to immunize an animal as for example discussed above. Antibody titers against the native or parent protein from which the peptide was selected may then be determined by, for example, radioimmunoassay or ELISA as for instance described in Sections 11.16 and 11.14 of Ausubel et al., supra.

Antibodies may be purified from a suitable biological fluid of the animal by ammonium sulfate fractionation, affinity purification or by other methods well known in the art. Exemplary protocols for antibody purification are given in Sections 10.11 and 11.13 of Ausubel et al., supra, which are herein incorporated by reference.

Immunoreactivity of the antibody against the native or parent protein may be determined by any suitable procedure such as, for example, Western blot.

Throughout this specification, unless the context requires otherwise, the words "comprise", "comprises" and "comprising" will be understood to imply the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers.

In order that the invention may be readily understood and put into practical effect, particular preferred embodiments will now be described by way of the following non-limiting examples.

Example 1 Cloning of P. vivax, P. yoelii, P. chabaudi or P. vinckei Aldolase Nucleic Acid The rodent malaria lines P. chabaudi AS and P. yoe///YM were provided by David Walliker (The University of Edinburgh, Edinburgh, UK), and the P. vinckei line was provided by W.P. Weidanz (Hahneman Medical College, Philedelphia, USA). P. vivax isolate PvlJ-1 was collected in Brisbane from a soldier returning from Irian Jaya. The history of P. berghei QIMR is not known, but this line has a different genotype to commonly used laboratory P. berghei lines (Saul et al, 1997, Mol Biochem Parasitol 84 143), including the ANKA line used for the original cloning of P. berghei aldolase genes (Meier et al, 1992, supra). Infected blood was either diluted in 6M guanidine-TE solution (6M guanidine in 10mM Tris pH 8.0/1 mM EDTA) and DNA extracted using the Promega Magic Miniprep kit (Promega, USA) (Cheng et al, 1993, Parasitology 106 335), or lysed in 0.1 % saponin-TKM1 solution (10mM Tris pH 7.6, 10mM KCI, 10mM MgCI_2l 2mM EDTA) and extracted using the salting out method previously described (Cheng et al, 1997, Am J Trap Med Hyg 57495). PCR Amplification of Plasmodium Aldolase Details of the primers used are provided in Table 1. Initially,

1120 base pair (bp) fragments were amplified and sequenced from the four rodent malarias (P. berghei, P. chabaudi, P. vinckei, and P. yoelii) using primer sets Aldo-1 F (specific for aldo-1)IA\do-R, and Aldo-2F (specific for a/c/o-2)/Aldo-R. The nucleotide sequences from these primer combinations were identical within each species and homologous to aldo-2. No evidence of mixed sequences was detected. This data was used to design two additional sets of primers, based on conserved regions between the rodent malaria parasites and P. falciparum. The 5' and 3' ends of exon 2 of the rodent malaria parasites were confirmed by sequencing the PCR products of Aldo-2F/Aldo-4R (589bp) and Aldo-4F/Aldo-R (683bp), respectively.

P. vivax aldolase was amplified and sequenced from genomic DNA using a Aldo-3F/Aldo-3R (770bp) primer combination. The 5' end of exon 2 was sequenced using the PCR product of the Aldo-2F/Aldo-4R primer combination. A P. wVax cDNA library with inserts ranging from 0.5 kilobase (kb) to 3.0 kb in λ ZAP Express™ (Stratagene, Heidelberg) and a titre of 10⁸ -

10⁹ pfu/mL was constructed using parasites obtained from human patients in Brazil. This library was screened with the P. vivax Aldo-3F/Aldo-3R amplicon, and positive clones were sequenced. This data provided a 3' gene fragment, a 5' fragment covering the primer and start codon, and confirmed the sequence obtained from genomic DNA. Table 1

^aLower case bases do not form part of the aldolase sequence. ^bBases are numbered using the Plasmodium falciparum sequence (GenBank accession #M28881) Example 2

Cloning and Expression of P. vivax Aldolase in a HexaHis pQE Vector

Cloning of nucleic acid fragments comprising coding information, or a translated region, for P. vivax aldolase was obtained from genomic P. vivax DNA. A P. wVax cDNA clone or nucleic acid comprising the P. wVax aldolase nucleotide sequence may also be used. PCR was used to amplify an aldolase nucleic acid fragment encoding a protein comprising an ATG start codon to a stop codon. Forward primer (gATGGCCACTGGATCCGAATATAAAAAC) [SEQ ID NO. 21] and reverse primer (TCAATAGACGTACTTCTTTTCGTAAAGGG) [SEQ ID NO. 22] are designed to amplify a 1110 bp fragment of Plasmodium nucleic acid. Lower case "g" of the forward primer indicates a nucleic acid which is not part of the aldolase coding sequence and is included for in frame cloning of the resulting amplified nucleic acid. PCR products of appropriate length were isolated by gel electrophoresis and blunt-end ligated into a smal digested hexaHis pQE30 expression vector (Qiagen). This construct, comprising the expression vector and isolated PCR product which theoretically encodes an entire mature form of P. vivax aldolase, was transformed into BL21 [pREP4] E. coli; however other strains of bacteria may be used, for example SG13009[pREP4] E. coli. Positive transformants comprising the construct were selected on the basis of antibiotic resistance (kanamycin and ampicillin) and constructs isolated from the positive transformants were sequenced to assure validity and orientation of the aldolase coding nucleic acid. Individual transformed E. coli colonies were induced with IPTG to express the nucleic acid ligated into the expression vector and proteins translated therefrom were examined by SDS-PAGE for expression of His-tagged protein of 388 amino acids (370 amino acids corresponding to the Plasmodium protein, 9 amino acids corresponding to the tag (RGS-His6) and 9 amino acids corresponding to the linker).

Example 3 Growth of Transformed E. coli and Purification of Aldolase

Five liter cultures of transformed bacteria were grown in LB media comprising kanamycin (25 μg/ml) and Ampicillin (200 μg/ml) under

controlled oxygen, pH and temperature. IPTG (1 mM final concentration) was added when the culture reached an optical density between 0.5 and 0.7 OD₆oo- The culture was incubated for an additional 4-5hours. Intact bacteria were isolated by centrifugation, resuspended in PBS and disrupted mechanically.

FIG. 8 shows a Western blot of bacterially expressed

recombinant P. vivax aldolase. After boiling in the presence of 5 % β- mercaptoethanol, SDS-solublized proteins from IPTG induced bacterial cells transformed with recombinant P. vivax aldolase (lanes 4 and 5) or from non- transformed control bacterial cells (lanes 2 and 3) were separated by SDS- PAGE on 10% a polyacrylamide gel. Bacteria culture supematants (lanes 2 and 4) or SDS solublized pellet proteins (lanes 3 and 5) were separated by SDS-PAGE, transferred to nitrocellulose and probed with mAb MRGS-His (Qiagen). Protein bands were visualized utilizing anti-mouse IgG mAb coupled to HRP and ECL detection reagents. Pre-stain molecular weight markers (BioRad) were run in lane 1 and His-ladder (Qiagen) in lane 6.

Position of P. wVax aldolase is indicated in FIG. 8 by " -" at an apparent size

of 44 kDa.

Purification of the hexaHis protein is performed using Ni-NTA chelating resin and procedures provided by Qiagen. Purification of the recombinant P. vivax aldolase protein is verified by electrophoresis, HPLC and western blotting with anti-His tagged and anti-E. coli antibodies.

Example 4 Alignment of Identified Plasmodium Aldolase Nucleotide and Amino Acid Seguences with Known Plasmodium Aldolase Sequences

As expected, nucleotide and amino acid sequence conservation between species is high, 86.9±7.4% and 96.0±1.9%

respectively, and highlights the structural selection pressure on this enzyme.

However, when the sequence of the P. berghei QIMR aldolase was compared with the P. berghei ANKA (aldo-2) sequence, there were seven nucleotide differences corresponding to five amino acid changes in the protein (FIGS. 3-6) and results from a higher nonsynonymous substitution frequency (0.0075) than the synonymous substitution frequency (0.0040), calculated using the method of Nei and Gojobori (Nei et al, 1986, Mol Biol Evol 3 418) with the Jukes Cantor correction (Jukes et al, 1969, In: Munro HN, editors. Mammalian protein metabolism. Academic Press) with the MEGA v1.01 software package (http://evolgen.biol.metro-u.ac.ip/MEGA/; Kumar et al (1993) MEGA: Molecular Evolutionary Genetic Analysis, Versions 1 , 1.01 , 1.02. Pennsylvania State University, University Park, Pennsylvania). This is a surprising result, as all codons could potentially undergo synonymous substitutions, but most codons are prevented from undergoing nonsynonymous substitutions due to functional constraints for enzymic function. This observation adds to other evidence that synonymous substitutions in malaria are under significant negative selection pressure (Figtree et al, 2000, Mol Biochem Parasitol 108 53).

Example 5

Aldolase Gene Copy Number

Nucleotide sequences of aldolase genes from four rodent malaria parasites: P. berghei, P. chabaudi, P. vinckei, and P. yoelii; and from human malaria parasite P. vivax provide evidence that only a single aldolase gene occurs in malaria Plasmodium species.

A major discrepancy exists between the present examples and earlier findings of Meier et al (Meier et al 1992, supra). Meier et al reported two aldolase genes from P. berghei, obtained Southern blotting patterns consistent with two genes and with antisera specific for both forms showed that sporozoites bound antibody recognizing the P. berghei ALDO-1 while asexual blood stages were recognized by P. berghei ALDO-2 specific antisera. An unusual finding of that study was the very close similarity between P. berghei aldo-1 gene and the P. falciparum aldolase gene that differed at only two bases.

In repeated attempts the present inventors were unable to amplify an aldo-1 gene from P. berghei under conditions that readily amplified the P. falciparum homolog. The inventors were also unable to Southern blot a P. berghei aldo-1 gene, again under conditions where the P. falciparum gene was recognized by the more distantly related P. berghei aldo-2 probe (FIG. 7). In each case, the banding pattern obtained was consistent with the determined nucleotide sequence and no trace of a second gene was found for any of the rodent malarias examined.

The Southern blot of FIG. 7 is Sspl and Rsa digested Plasmodium genomic DNA probed with P. berghei aldo-2 (Aldo-3F/Aldo-3R amplicon): P. falciparum digested with Sspl (A) and Rsal (B); P. berghei digested with Sspl (C) and Rsal (D); P. yoelii digested with Sspl (E) and Rsal (F); P. vinckei digested with Sspl (G) and Rsal (H); and P. chabaudi digested with Sspl (I) and Rsal (J). The discrepancy between the present results and previously published result of the P. berghei aldo-1 gene by Meier et al, supra may result from contamination of the P. berghei DNA with P. falciparum aldolase DNA. This would be consistent with the very close sequence similarity between P. berghei aldo-1 and P. falciparum aldolase genes. However, if this were the case, then it represents a remarkable series of co-incidences, since the level of contamination gave similar intensities of bands for the P. berghei gene and the P. falciparum contamination in a series of independent P. berghei DNA samples, and the P. falciparum aldolase specific antisera must, by chance, cross-react with an unknown component of P. berghei sporozoites (Meier et al 1992, supra).

Example 6 Preparation of Anti-Aldolase Antibodies

Purified recombinant P. wVax aldolase protein is used to immunize small animals to generate poly-clonal and mono-clonal antibodies.

Polyclonal antibodies can be generated in rabbit, sheep or goat immunized at monthly intervals and bled 2 weeks following either a third or fourth immunization. Antibody specificity is determined by screening sera for the ability of antibodies contained therein to recognize native and recombinant aldolase antigen. Antibody is then purified using chromatography. Monoclonal antibodies are generated by fusion of spleen cells of P. vivax aldolase immunized mice and a myeloma cell line with polyethylene glycol. Successful fusions are selected under hypozanthine/amethopterin/thymidine selection pressure. Following limiting dilution in hypozanthine/thymidine media, clones generating appropriate antibody specificity are selected for an ability to bind native and recombinant P. vivax aldolase antigen. Cells producing anti-aldolase antibodies are subcloned twice. Monoclonal antibodies are purified by ammonium sulfate precipitation and chromatography. Example 7

P. wVax Detection Kit

A diagnostic kit for detecting P. vivax infection in a human blood sample in one embodiment may use a combination of purified recombinant protein and poly-clonal and/or mono-clonal antibodies. A diagnostic kit may be ELISA, immunohistological/microscopy or immunochromatographic based.

Another embodiment of a detection kit is a nucleic acid based kit. Such a kit may comprise (i) an aldolase oligonucleotide primer or primers, preferably selected from the nucleotide sequences of the invention as provided in FIGS. 2A and 2B; (ii) a nucleic acid of the invention which may be used as a positive control and (iii) an enzyme which may amplify a target nucleic acid in a test sample and control. A preferred embodiment comprises a thermostable DNA polymerase such as Taq polymerase which may be used in PCR amplification of material extracted from red blood cells from a finger prick.

ELISA based: In one embodiment, an ELISA base kit comprises a pair of monoclonal antibodies which recognize distinct, non- overlapping regions of the aldolase protein. Preferably, the protein or fragment thereof is as shown in FIG. 1. Since aldolase is a tetramer (i.e. has four identical sites per molecule) two unique antibodies are not required for an ELISA based kit. Accordingly, in another embodiment, a single monoclonal antibody may be used. Preferably, the antibodies do not compete for binding to the aldolase protein. A dilution of the or one of the antibodies in phosphate buffer pH 8 (approx 0.5μg/200μl) is used to coat wells of a 96 well polystyrene culture plate. Aldolase standards are prepared in the same manner as was the protein used for production of antibodies. Standards are lyophilized or stored at -70°C. In some wells, dilutions of the standard in phosphate buffer comprising 3% human sera may be added. In the remainder of the wells, dilutions are made of the blood sample. The plates are incubated over night at 4°C. Plates are then washed in Tris buffer with 0.05% Tween 20. A detection solution comprising the second monoclonal antibody conjugated to alkaline phosphatase is added. The concentration of the mouse anti- aldolase antibody is 2μg/ml. After incubation for 1 hour at room temperature the plate is washed and a solution containing 1 mg/ml of sodium p- nitrophenyl phosphate in Tris is added. The appearance of p-nitrophenyl is quantitatively measured by monitoring 405 nm wavelength light transmitted with a conventional micro ELISA plate reader. Concentrations of aldolase in the sample sera are calculated by comparison with the known concentrations of aldolase in the dilutions of the standard.

Immunohistological/microscopy based: Indirect immunofluorescence (I FA) may be used to identify parasite infected red blood cells. IFA may be performed on air-dried blood films. The films are fixed at -20°C in methanol and acetone (1 :9). Monoclonal anti-P. vivax aldolase antibodies are serially diluted and 5 μl of each dilution dotted onto slides and incubated at 4°C overnight. Slides are washed in PBS/Tween 20 and air dried. FITC-labeled goat-anti-mouse sera diluted 1 :100 is added and the slides incubated for 2 hours at 37°C. Sides are washed and mounted with 85% glycerol, 10% 2M Tris, 5 % n-proply gallate (pH 8.0). Fluorescence is visualized with UV light with a 100x oil immersion objective.

Immunochromatographic based: An example of an immunochromatographic based diagnostic kit is described above under the heading of "Detection Kits and Methods thereof".

It will be understood that the invention described in detail herein is susceptible to modification and variation, such that embodiments other than those described herein are contemplated which nevertheless falls within the broad scope of the invention. The disclosure of each patent and scientific document, computer program and algorithm referred to in this specification is incorporated by reference in its entirety.

Claims

CLAIMS 1. An isolated fructose 1 ,6-bisphosphate aldolase protein, or fragment thereof, from Plasmodium wherein said protein is not any one of SEQ ID NOS. 9-11.

2. The isolated fructose 1 ,6-bisphosphate aldolase protein of claim 1 wherein said protein is isolated from Plasmodium vivax, Plasmodium yoelii, Plasmodium chabaudi or Plasmodium vinckei.

3. An isolated protein comprising an amino acid sequence selected from the group consisting of SEQ ID NOS. 1-4.

4. A protein homolog, fragment, variant or derivative of the isolated protein selected from the group consisting of SEQ ID NOS. 1-4, wherein said protein is not any one of SEQ ID NOS. 9-11.

5. The isolated protein of any one of claims 1 to 4, which when administered to an animal, is capable of eliciting an immune response in said animal.

6. The isolated protein of claim 5, wherein said immune response provides protection against one or more species of Plasmodium in said

animal.

7. The isolated protein of claim 6 wherein said species of Plasmodium is P. vivax.

8. The isolated protein of claim 6, wherein said animal is a mammal.

9. The isolated protein of claim 8, wherein said mammal is a human.

10. An isolated nucleic acid encoding a protein according to any one of claims 1 to 4.

11. An isolated nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOS. 5-8. 12. An isolated nucleic acid homolog, fragment or variant of an isolated nucleic acid selected from the group consisting of SEQ ID NOS. 5-8, wherein said nucleic acid is neither SEQ ID NO.

12 nor 13.

13. An isolated nucleic acid primer or probe derived from any one of SEQ ID NOS: 5-8. 14. The isolated nucleic acid according to claim 13 wherein said isolated nucleic acid is selected from the group consisting of SEQ ID NOS.

14-22.

15. An expression construct comprising an expression vector and an isolated nucleic acid according to any one of claims 10 to 12, wherein said nucleic acid is operably linked to one or more regulatory nucleic acids in said expression vector.

16. A host cell comprising an expression construct according to claim 15.

17. The host cell of claim 16 wherein said host cell is a bacterium or yeast.

18. A method of producing a recombinant protein according to any one of claims 1 to 4, said method including the steps of:

(i) culturing a host cell according to claim 16 such that said recombinant protein is expressed in said host cell; and (ii) isolating said recombinant protein.

19. An antibody or antibody fragment that binds to a protein of any one of claims 1 to 4.

20. A method of detecting a Plasmodium species in a sample including the step of:

(a) isolating the sample;

(b) detecting a nucleic acid comprising a nucleotide sequence according to any one of claims 10 to 12 in said sample which indicates the presence of said Plasmodium species.

21. A method of detecting a Plasmodium species in a sample including the step of:

(1 ) isolating the sample;

(2) combining the antibody or antibody fragment of claim 19 with the sample; and (3) detecting specifically bound antibody or antibody fragment which indicates the presence of said Plasmodium species.

22. The method of claim 20 or claim 21 wherein at least one of the

Plasmodium species is P. wVax, P. yoe//7, P. chabaudi or P. vinckei.

23. The method of claim 20 or claim 21 wherein said sample is a blood sample from an animal.

24. The method of claim 23 wherein said animal is a mammal.

25. The method of claim 24 wherein said mammal is a human.

26. The method of claim 20 or claim 21 wherein said sample comprises one or more Plasmodium species.

27. A method of detecting a Plasmodium species in a sample including the steps of:

(I) combining a protein extract with a first and second antibody which are respectively capable of respectively binding Plasmodium species specific antigens, other than HRP-2 from P. falciparum or pLDH from P. falciparum or P. vivax, to thereby form an antibody-antigen complex;

(II) immobilising on a matrix a third and fourth antibody which specifically bind the Plasmodium species specific antigen bound by respective first and second antibodies of step (I);

(III) migrating respective complexes comprising the first and second antibodies bound to the respective Plasmodium species specific antigens through the matrix of step (II), such that the complexes migrate at least to the immobilised third and fourth antibodies; (IV) binding the antibody-antigen complexes of step (I) to the third and fourth immobilised antibodies respectively of step (II); and

28. The method of claim 27 wherein said first and second antibodies of step (I) and third and fourth antibodies of step (II) respectively bind antigens that are homologous proteins.

29. The method of claim 28 wherein said first and second antibodies of step (I) and third and fourth antibodies of step (II) respectively bind orthologous proteins.

30. The method of claim 29 wherein said first and second antibodies of step (I) and said third and fourth antibodies of step (II) respectively bind fructose 1 ,6-bisphosphate aldolase of P. vivax and a Plasmodium species other than P. vivax.

31. The method of claim 27 wherein said first, second, third and fourth antibodies are monoclonal antibodies.

32. The method of claim 27 wherein said detection of the complexes of step (V) is by visual means.

33. The method of claim 32 wherein said detection is by visualising colloidal gold attached to the first and second antibodies respectively of step

(I).

34. A method of detecting a Plasmodium species in a sample including the steps of:

(B) immobilising on a matrix a second and third antibody which respectively bind Plasmodium species specific antigens that are bound by the first antibody of step (A);

(E) detecting the complexes which have respectively bound the second and third immobilised antibodies in step (D).

35. The method of claim 34 wherein said first antibody of step (A) binds fructose 1 ,6-bisphosphate aldolase.

36. The method of claim 34 wherein said second and third antibodies of step (B) respectively bind fructose 1 ,6-bisphosphate aldolase of P. vivax and a Plasmodium species other than P. wVax.

37. A detection kit for detecting Plasmodium in a sample or diagnosing Plasmodium infection in an individual, wherein said kit comprises one or more isolated proteins accordingly to any one of claims 1 to 4.

38. A detection kit for detecting Plasmodium in a sample or diagnosing Plasmodium infection in an individual, wherein said kit comprises one or more isolated nucleic acids accordingly to any one of claims 10 to 14.

39. The detection kit according to claim 38 further comprising a thermostable polymerase.

40. A detection kit for detecting Plasmodium in a sample or diagnosing Plasmodium infection in an individual, wherein said kit comprises one or more antibody or antibody fragment of claim 19.

41. A pharmaceutical composition comprising at least one isolated protein according to any one of claims 1 to 4 in combination with a pharmaceutically acceptable carrier or diluent.

42. A pharmaceutical composition comprising at least one isolated nucleic acid according to any one of claims 10 to 14 in combination with a pharmaceutically acceptable carrier or diluent.

43. The pharmaceutical composition of claim 41 or claim 42 wherein said pharmaceutical composition is a vaccine.

44. The pharmaceutical composition of claim 42 wherein said isolated nucleic acid regulates expression of an endogenous nucleic acid.

45. The pharmaceutical composition of claim 44 wherein said isolated nucleic acid is an isolated antisense nucleic acid complementary to at least one isolated nucleic acid of any one of claims 10 to 14.

46. The pharmaceutical composition of claim 45 wherein said isolated antisense nucleic acid is an antisense oligonucleotide.

47. The pharmaceutical composition of claim 46 wherein said isolated antisense oligonucleotide is unique to a specific Plasmodium species.

48. The pharmaceutical composition of claim 47 wherein said isolated antisense oligonucleotide is specific for P. wVax.

49. A method of treating malaria including the step of administering the pharmaceutical composition of claim 41 or claim 42 to a mammal.

50. The method of claim 49 wherein said mammal is a human.

51. A method of diagnosing infection of an individual by

Plasmodium, said method including the steps of:-

(A') contacting a biological sample from said individual with a protein of any one of claims 1 to 4; and (B') determining the presence or absence of a complex between said protein and Plasmodium-specific antibodies in said sample, wherein the presence of said complex is indicative of said infection.

52. A method of immunizing an individual against Plasmodium infection, including the step of administering a pharmaceutically effective amount of the vaccine of claim 43 to said individual.

53. A method of identifying an immunogenic fragment of a protein of any one of claims 1 to 4, including the steps of:-

(a') producing a fragment of said protein; (b') administering said fragment to an animal; and

54. The method of claim 53 wherein said animal is a mammal.

55. The method of claim 54 wherein said mammal is a mouse, rabbit, sheep or goat.