WO2002045659A2

WO2002045659A2 - Novel therapeutics for heart failure and aging

Info

Publication number: WO2002045659A2
Application number: PCT/US2001/051272
Authority: WO
Inventors: Natarajan Sivasubramanian; Pascal Knuefermann; Douglas L. Mann
Original assignee: Baylor College Of Medicine
Priority date: 2000-10-27
Filing date: 2001-10-26
Publication date: 2002-06-13
Also published as: AU2002239777A1; WO2002045659A3; WO2002045659A9

Abstract

Myo/V1 is a cardiac-associated protein which interacts with NFλB, a well known stress-responsive cytoprotective transcription factor. Myo/V1 is upregulated during cardiac hypertrophy and heart failure. The present invention is directed to the function of Myo/V1 disruption of NFλB activity by promoting the formation of NFλB p50-p50 homodimers or p65-p65 homodimers, which results in altered adrenergic singlaing during these events.

Description

NOVEL THERAPEUTICS FOR HEART FAILURE AND AGING

This application claims priority to U.S. Provisional Patent Application Serial No. 60/243,985, filed October 27, 2000.

FIELD OF THE INVENTION

The present invention is related generally to molecular biology, cell biology, and therapeutics for heart failure and aging. More specifically, the invention is directed to Myo/Nl and its interaction with ΝFKB subunits as targets for therapeutics for heart failure and aging.

BACKGROUND OF THE INVENTION

Heart failure - the inability of the heart to pump blood at a rate sufficient to sustain homeostasis - is a major health issue in the world today. This is true not only due to the untimely deaths caused by heart disease, such as from cardiac hypertrophy, but the tremendous expense incurred due to required patient support, including prolonged hospitalization. Thus, there remains a great need to address this costly and debilitating disease.

A growing body of evidence suggests that cardiac hypertrophy and its transition to heart failure results from mechanical wall stress that triggers several paracrine and autocrine signal transduction pathways. These pathways eventually bring increased synthesis of contractile proteins, assembly of myofibrils, fetal bioenergetics and altered adrenergic signaling to the stressed myocardium. Studies indicate that the majority of the compensatory and decompensatory changes affected by these signal transduction pathways finally occur at the transcriptional level of myocardial gene expression. However, the transcriptional control mechanisms responsible for these changes are still unknown. A novel 12 kD protein called Myo/Nl (Sivasubramanian et al, 1996; Anderson et al., 1999; Pennica et al, 1995) (originally called myotrophin (Sen et al, 1990; Sil et al, 1993)) was initially identified at elevated levels in hypertrophied and failing human and rodent hearts (Sen et al, 1990; Sil et al, 1993; Anderson et al, 1999). Although the functional role of this protein was initially postulated to be an exogenously acting myocardial peptide growth (hypertrophy) factor (Sen et al, 1990; Sil et al. (1993), the molecular cloning of the gene and functional characterization of the protein (Sivasubramanian et al, 1996) has shown that Myo/Nl is a ubiquitously expressed intracellular ankyrin-repeat containing protein and that it interacts with a family of transcription factors called ΝFKB (Sivasubramanian et al, 1996; Ghosh et al, 1998) Data provided herein indicates Myo/Vl interacts with another group of transcription factors called ETS (E26 transformation-specific gene) (Crepieux et al, 1994). Among the ETS superfamily, as of yet 5 subfamilies (ELG, PEA3, ELF, TCFs and ETS) of 8 ΕTS' proteins (GABPα/NRF2/E4TFl, ER81/ETV1, ERM, ELF1/NERF2, ELF4, ELK1, ELK3/SAP2/ERP/NET, ETS2) have been reported to be expressed in human and murine hearts. The signature of the ETS family is the ETS domain, a region of approximately 85 amino acids which has been widely conserved during evolution, and through NMR analysis, it has been classified as "winged helix-turn-helix" superfamily of DNA-binding domains.

Recently, DNA binding activities of the two transcription factors NFKB and ETS have been shown to be upregulated (Gupta et al, 1998; Helenius et al, 1996; Meldrum et al, 1997; Kacimi et al, 1997; Morishita et al, 1997; Hattori et al, 1997; Meldrum et al. 1997; Wong et al, 1998; Maulik et al, 1998) in mammalian myocardium in experimental animal models of hemodynamic pressure overload, hypoxia, ischemia/reperfusion, myocardial infarction and hemorrhage. In a specific embodiment, Myo/Vl -stimulated ETS factors regulate the gene expression that confer the growth and fetal energetic phenotypes to the stressed myocardium (Sivasubramanian et al, 1996; Ghosh et al, 1998; Crepieux et al, 1994) and that the NFKB factors regulate genes involved in the adrenergic signaling system that control the contractile function of the heart. While NFκB-mediated transcriptional activation of adrenergic system genes, such as βARKs and Giαs, are in a specific embodiment responsible for the uncoupling of the adrenergic response, it is the aberrant Myo/Nl -mediated ΝFKB transcriptional repression of βl -adrenergic receptor and Gsα genes that is responsible for the myocardial inability to couple or resensitize to adrenergic response, and thus causes the compensated heart to fail.

A 12 kD cytosolic protein that was identical to myotrophin was characterized in rat cerebellum as V-l (Taoka et al, 1992; Taoka et al, 1994; Yamakuni et al, 1998) protein and has been proposed to possess a generic transcription regulatory function similar to the intracellular function provided herein for myotrophin. Because of the dual naming of this protein by others, this protein in a specific embodiment is called Myo/Vl (Sivasubramanian et al, 1996; Anderson et al, 1999). Structural analysis of Myo/Vl (Sivasubramanian et al, 1996) indicates that the entire protein is made of ankyrin-repeats (FIGS. 1, 2 and 3) which are associated with protein-protein interactions in various classes of cellular proteins. An initial BLAST analysis identified that one of the Myo/Vl's ankyrin repeats is highly homologous to two ankyrin-repeats of IκBα, and furthermore with an improved algorithm it has been identified that it is highly homologous to GABPβ's (protein that interacts with ETS factor GABPα; FIGS. 2 and 3) ankyrin repeats. Comparative analysis of the Myo/Vl's ankyrin- repeats with that of IκBα (Yang et al, 1997) indicates that the 'second ankyrin repeat' of Myo/Vl is a putative multi-functional domain possessing three potential functions: 1) p50/p65 interacting domain; 2) a nuclear import signal; and 3) a nuclear export function - a highly leucine-rich (L E IL EF LLL) (SEQ ID NO:4) consensus "Nuclear Export Signal" has also been identified on the Myo/Nl protein. Additionally, putative 'ERK/GSK3/CK-I', 'PKC and Casein Kinase-II phosphorylation sites were also identified on the Myo/Nl protein. These sites reflect the multiple functions of Myo/Vl protein in different physiological scenarios within the mammalian cell.

Utilizing recombinant Myo/Vl, the ΝMR structure of Myo/Vl (FIG. 2b) was deteπnined (Yang et al, 1998; Yang et al, 1997). This and other protein structures (FIGS. 2a and 2c; GABPβ and IκB ) have shown that the ankyrin-repeat consists of pairs of anti- parallel α-helices (cylinders in the figure) stacked side by side and connected by a series of intervening β-hairpin loop motifs (threaded arrows between cylinders). This assembled structure has been likened to a cupped hand (FIG 3): the β-hairpins form the fingers and the concave, inner surface of the ankyrin groove, which is made up of solvent-exposed residues from the α-helical bundle, forms the palm. These "β-loop fingers" have been proposed to interact with the target protein (like ETS protein GABPα) domains to influence its activity. Upon comparison of the Myo/Vl ΝMR to other ankyrin-repeat containing proteins like GABPβ and IκBα, the proposed "DΝA-binding-enhancing" Lysine residue located in the β-hairpin loop is conserved among GABPβ (Lys#69), Myo/Vl (Lys#66) and IκBα (Arg#66) and located adjacent to the multiple phosphorylation sites in Myo/Vl protein (FIG. 1). This and other homologies within the β-hairpin finger loops suggested that Myo/Nl in a specific embodiment is an orthologue (Sachdev et al, 1998) of GABPβ and IκBα.

Thus, the significance of ΝFKB in relation to heart failure in light of the key functions of Myo/Vl provide an important biological role to elucidate and a valuable pathway to exploit for cardiovascular disease therapies.

SUMMARY OF THE INVENTION

In an embodiment of the present invention, there is as a composition of matter a dominant negative mutant sequence of Myo/Vl polypeptide. In a specific embodiment, the sequence is selected from the group consisting of SEQ ID NO:94, SEQ ID NO:95, SEQ ID NO:96, SEQ ID NO:97, SEQ ID NO:108, SEQ ID NO:109, SEQ ID NO:110, SEQ ID NO: 111, SEQ ID NO: 112, and SEQ ID NO: 113. In another specific embodiment, the sequence further comprises a protein transduction domain.

In another embodiment of the present invention there is as a composition of matter a nucleic acid sequence encoding a dominant negative mutant sequence of Myo/Nl polypeptide.

In an additional embodiment of the present invention there is as a composition of matter a nucleic acid sequence encoding a dominant negative mutant sequence of a Myo/Nl polypeptide, wherein the polypeptide is selected from the group consisting of SEQ ID ΝO:94, SEQ ID NO:95, SEQ ID NO:96, SEQ ID NO:97, SEQ ID NO:108, SEQ ID NO:109, SEQ ID NO: 110, SEQ ID NO: 111, SEQ ID NO: 112, and SEQ ID NO:l 13.

In an additional embodiment of the present invention there is as a composition of matter a nucleic acid sequence encoding a dominant negative mutant sequence of a Myo/Vl polypeptide, wherein the nucleic acid sequence is selected from the group consisting of SEQ ID NO: 186, SEQ ID NO: 187, SEQ ID NO: 188, SEQ ID NO: 189, SEQ ID NO: 197, SEQ ID NO: 198, SEQ ID NO: 199, SEQ ID NO:200, SEQ ID NO:201, and SEQ ID NO:202.

In another embodiment of the present invention there is as a composition of matter a constitutively active mutant sequence of Myo/Vl polypeptide. In a specific embodiment, the sequence is selected from the group consisting of SEQ ID NO:90, SEQ ID NO:91, SEQ ID NO:92, SEQ ID NO:93, SEQ ID NO:101, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:105, SEQ ID NO:106; and SEQ ID NO:107. In a specific embodiment, the constitutively active mutant sequence further comprises a protein transduction domain.

In an additional embodiment of the present invention there is as a composition of matter a nucleic acid sequence encoding a constitutively active mutant sequence of Myo/Vl polypeptide.

In another embodiment of the present invention there is as a composition of matter a nucleic acid sequence encoding a constitutively active mutant sequence of Myo/Vl polypeptide, wherein the polypeptide is selected from the group consisting of SEQ ID NO:90, SEQ ID NO:91, SEQ ID NO:92, SEQ ID NO:93, SEQ ID NO:101, SEQ ID NO:102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 106; and SEQ ID NO: 107.

In an additional embodiment of the present invention there is as a composition of matter a nucleic acid sequence encoding a constitutively active mutant sequence of Myo/Vl polypeptide, wherein the nucleic acid sequence is selected from the group consisting of SEQ ID NO: 182, SEQ ID NO: 183, SEQ ID NO: 184, SEQ ID NO: 185, SEQ ID NO: 190, SEQ ID NO-191, SEQ ID NO:192, SEQ ID NO:193, SEQ ID NO:194, SEQ ID NO:195, and SEQ ID NO: 196.

In another embodiment of the present invention there is a method of treating cardiovascular disease in a mammal, comprising the step of introducing into the mammal therapeutically effective levels of a dominant negative mutant sequence of Myo/Vl polypeptide, wherein the introduction results in an improvement of the cardiovascular disease.

In another embodiment of the present invention there is a method of inhibiting formation of NFKB p50 homodimers in a cell of a mammal, comprising the step of introducing into the cell therapeutically effective levels of a dominant negative mutant sequence of Myo/Nl polypeptide, wherein the introduction results in inhibition of formation of the ΝFKB p50 homodimers.

In another embodiment of the present invention there is a method of reducing formation of ΝFKB p50 homodimers in a cell of a mammal, comprising the step of introducing into the cell therapeutically effective levels of a dominant negative mutant sequence of Myo/Nl polypeptide, wherein the introduction results in reduction of formation of the ΝFKB p50 homodimers. In a specific embodiment, the dominant negative mutant sequence is selected from the group consisting of SEQ ID ΝO:l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO: 10.

In another embodiment of the present invention there is a method of treating cardiovascular disease in a mammal, comprising the step of introducing to the mammal therapeutically effective levels of a nucleic acid sequence encoding a dominant negative mutant sequence of Myo/Nl polypeptide, wherein the introduction results in an improvement of the cardiovascular disease.

In another embodiment of the present invention there is a method of inhibiting formation of ΝFKB p50 homodimers in a cell of a mammal, comprising the step of introducing into the cell therapeutically effective levels of a nucleic acid sequence encoding a dominant negative mutant sequence of Myo/Vl polypeptide, wherein the introduction results in inhibition of formation of the ΝFKB p50 homodimers.

In another embodiment of the present invention there is a method of reducing formation of ΝFKB p50 homodimers in a cell of a mammal, comprising the step of introducing into the cell therapeutically effective levels of a nucleic acid sequence encoding a dominant negative mutant sequence of Myo/Vl polypeptide, wherein the introduction results in reduction of formation of the NFKB p50 homodimers.

In an additional embodiment of the present invention there is a method for screening a test compound for the treatment of cardiovascular disease, comprising the steps of combining a labeled nucleic acid sequence with a NFKB p50 subunit polypeptide under conditions to form a nucleic acid sequence- NFKB p50 polypeptide complex; adding a test compound to the complex; and assaying the electrophoretic mobility of the complex in the presence of the test compound; comparing the electrophoretic mobility of the complex with the test compound to the electrophoretic mobility of the complex in the absence of the test compound, wherein a change in the mobility in the presence of the test compound indicates the test compound is an active compound.

In another embodiment of the present invention there is a method for screening a test compound for anti-aging activity, comprising the steps of combining a labeled nucleic acid sequence with a NFKB p50 subunit polypeptide under conditions to form a nucleic acid sequence- NFKB p50 polypeptide complex; adding a test compound to the complex; and assaying the electrophoretic mobility of the complex in the presence of the test compound; comparing the electrophoretic mobility of the complex with the test compound to the electrophoretic mobility of the complex in the absence of the test compound, wherein a change in the mobility in the presence of the test compound indicates the test compound is an active compound.

In another embodiment of the present invention there is a method for screening a test compound for NFKB p50 polypeptide interaction, comprising the steps of combining a labeled nucleic acid sequence with a p50 NFKB subunit polypeptide under conditions to form a nucleic acid sequence-p50 polypeptide complex; adding a test compound to the complex; and assaying the electrophoretic mobility of the complex in the presence of the test compound; comparing the electrophoretic mobility of the complex with the test compound to the electrophoretic mobility of the complex in the absence of the test compound, wherein a change in the mobility in the presence of the test compound indicates the test compound is an active compound. In a specific embodiment, the nucleic acid sequence is a NFKB repressor sequence. In another specific embodiment, the p50 polypeptide is present as a homodimer. In an additional specific embodiment, the complex further comprises a p65 NFKB subunit polypeptide. In another specific embodiment, complex further comprises a p50-p65 heterodimer. In another specific embodiment, the complex further comprises a p65-p65 homodimer.

In an additional embodiment of the present invention, there is a pharmaceutical composition for treating cardiovascular disease comprising an active compound obtained by a method of screening a test compound, wherein the screen comprises the steps of combining a labeled nucleic acid sequence with a p50 NFKB subunit polypeptide under conditions to form a nucleic acid sequence-p50 polypeptide complex; adding a test compound to the complex; and assaying the electrophoretic mobility of the complex in the presence of the test compound; comparing the electrophoretic mobility of the complex with the test compound to the electrophoretic mobility of the complex in the absence of the test compound, wherein a change in the mobility in the presence of the test compound indicates the test compound is an active compound; and a physiologically acceptable carrier.

In another object of the present invention there is a pharmaceutical composition for anti-aging treatment comprising an active compound obtained by screening a test compound for NFKB p50 polypeptide interaction, comprising the steps of combining a labeled nucleic acid sequence with a p50 NFKB subunit polypeptide under conditions to form a nucleic acid sequence-p50 polypeptide complex; adding a test compound to the complex; and assaying the electrophoretic mobility of the complex in the presence of the test compound; comparing the electrophoretic mobility of the complex with the test compound to the electrophoretic mobility of the complex in the absence of the test compound, wherein a change in the mobility in the presence of the test compound indicates the test compound is an active compound; and a physiologically acceptable carrier.

In an embodiment of the present invention there is a method of screening for an active compound for cardiovascular disease, comprising the steps of introducing into a cell a first nucleic acid expressing a fused test peptide/DNA binding domain; and a second nucleic acid expressing a fused Myo/Nl -p50 polypeptide/DΝA activation domain; and assaying for an interaction between the test peptide and the Myo/Vl -p50 polypeptide by measuring binding between the DΝA binding domain and the DΝA activation domain, wherein the interaction between the test peptide and the Myo/Vl-p50 polypeptide indicates the test peptide is the active compound.

In an additional embodiment of the present invention there is a method of screening for an active compound for anti-aging treatment, comprising the steps of introducing into a cell a first nucleic acid expressing a fused test peptide/DΝA binding domain; and a second nucleic acid expressing a fused Myo/Vl-p50 polypeptide/DNA activation domain; and assaying for an interaction between the test peptide and the Myo/Vl-p50 polypeptide by measuring binding between the DNA binding domain and the DNA activation domain, wherein the interaction between the test peptide and the Myo/Vl -p50 polypeptide indicates the test peptide is the active compound. In a specific embodiment, the DNA binding domain and the DNA activation domain are LexA. In a specific embodiment, the DNA binding domain and the DNA activation domain are Gal.

In an additional embodiment of the present invention, there is a pharmaceutical composition for treating cardiovascular disease comprising an active compound obtained by screening a test compound as in a method of screening for an active compound for anti-aging treatment, comprising the steps of introducing into a cell a first nucleic acid expressing a fused test peptide/DNA binding domain; and a second nucleic acid expressing a fused Myo/Nl -p50 polypeptide/DΝA activation domain; and assaying for an interaction between the test peptide and the Myo/Vl-p50 polypeptide by measuring binding between the DΝA binding domain and the DΝA activation domain, wherein the interaction between the test peptide and the Myo/Vl -p50 polypeptide indicates the test peptide is the active compound; and a physiologically acceptable carrier.

In an additional embodiment of the present invention, there is a pharmaceutical composition for anti-aging treatment comprising an active compound obtained by screening a test compound as in a method of screening for an active compound for anti-aging treatment, comprising the steps of introducing into a cell a first nucleic acid expressing a fused test peptide/DΝA binding domain; and a second nucleic acid expressing a fused Myo/Vl -p50 polypeptide/DΝA activation domain; and assaying for an interaction between the test peptide and the Myo/Vl -p50 polypeptide by measuring binding between the DΝA binding domain and the DΝA activation domain, wherein the interaction between the test peptide and the Myo/Vl -p50 polypeptide indicates the test peptide is the active compound; and a physiologically acceptable canier.

In an additional embodiment of the present invention, there is a method of identifying an active compound for the treatment of cardiovascular disease, comprising the steps of forming a Myo/Vl -ΝFKB p50 complex in a cell, wherein the complex formation generates a detectable signal; adding a test compound to the complex in the cell under conditions wherein the compound interacts with the complex; and measuring a change in the visualizable signal, wherein the change indicates the test compound is the active compound. In another embodiment of the present invention there is a method of identifying an active compound for anti-aging treatment, comprising the steps of forming a nucleic acid sequence-NFκB p50 complex in a cell, wherein the complex formation generates a detectable signal; adding a test compound to the complex in the cell under conditions wherein the compound interacts with the complex; and measuring a change in the detectable signal, wherein the change indicates the test compound is the active compound. In a specific embodiment, the detectable signal is selected from the group consisting of light, fluorescence, radioactivity, and color. In another specific embodiment, the detectable signal is fluorescence. In a specific embodiment, the test compound is selected from the group consisting of peptides, nucleic acids, carbohydrates, sugars, and combinations thereof.

In an embodiment of the present invention, there is a pharmaceutical composition for treating cardiovascular disease comprising an active compound obtained by screening a test compound as in a method of identifying an active compound for the treatment of cardiovascular disease, comprising the steps of forming a Myo/Vl-NFκB p50 complex in a cell, wherein the complex formation generates a detectable signal; adding a test compound to the complex in the cell under conditions wherein the compound interacts with the complex; and measuring a change in the visualizable signal, wherein the change indicates the test compound is the active compound; and a physiologically acceptable canier.

A pharmaceutical composition for anti-aging treatment comprising an active compound obtained by screening a test compound as in a method of identifying an active compound for anti-aging treatment, comprising the steps of forming a nucleic acid sequence- NFKB p50 complex in a cell, wherein the complex formation generates a detectable signal; adding a test compound to the complex in the cell under conditions wherein the compound interacts with the complex; and measuring a change in the detectable signal, wherein the change indicates the test compound is the active compound; and a physiologically acceptable carrier.

In another embodiment of the present invention there is a method of treating cardiovascular disease in a mammal, comprising the step of introducing into a cell of the mammal therapeutically effective levels of a NFKB repressor sequence under conditions wherein the repressor sequence binds a NFKB p50 homodimer, wherein the cardiovascular disease is improved following the introduction.

In an additional embodiment of the present invention there is a method of reducing NFKB p50 homodimer levels in a cell of a mammal, comprising the step of introducing into the cell therapeutically effective levels of a NFKB repressor sequence under conditions wherein the repressor sequence binds the NFKB p50 homodimer. In a specific embodiment, the NFKB repressor sequence is SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:l l, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO:122, SEQ ID NO:123, SEQ ID NO:124, SEQ ID NO:131, SEQ ID NO:132, SEQ ID NO: 133, SEQ ID NO: 134, SEQ ID NO: 135, SEQ ID NO: 136, SEQ ID NO: 140, SEQ ID NO:141, SEQ ID NO:142, SEQ ID NO:143, SEQ ID NO:144, SEQ ID NO:145, SEQ ID NO:152, SEQ ID NO:153, SEQ ID NO:154, SEQ ID NO:155, SEQ ID NO:156, SEQ ID NO: 162, SEQ ID NO: 163, SEQ ID NO: 164, SEQ ID NO: 168, SEQ ID NO: 169, SEQ ID NO:170, SEQ ID NO:171, SEQ ID NO:172, SEQ ID NO:173, SEQ ID NO:174, SEQ ID NO: 175, SEQ ID NO:254, SEQ ID NO:255, SEQ ID NO:256, SEQ ID NO:257, SEQ ID NO:258, SEQ ID NO:259, SEQ ID NO:260, SEQ ID NO:269, SEQ ID NO:270, SEQ ID NO:271, SEQ ID NO:272, SEQ ID NO:273, SEQ ID NO:274, SEQ ID NO:279, SEQ ID NO:280, SEQ ID NO:281, SEQ ID NO:282, SEQ ID NO:283, SEQ ID NO:284, SEQ ID NO:285, SEQ ID NO:291, SEQ ID NO:292, SEQ ID NO:293, SEQ ID NO:294, SEQ ID NO:295, SEQ ID NO:296, SEQ ID NO:297, SEQ ID NO:298, SEQ ID NO:305, SEQ ID NO:306, SEQ ID NO:307, SEQ ID NO:308, SEQ ID NO:309, SEQ ID NO:310, SEQ ID NO:311, SEQ ID NO:312, SEQ ID NO:313, SEQ ID NO:314, SEQ ID NO:315, SEQ ID NO:316, SEQ ID NO:317, SEQ ID NO:318, SEQ ID NO:319, SEQ ID NO:320, SEQ ID NO:321, SEQ ID NO:325, SEQ ID NO:326, SEQ ID NO:327, SEQ ID NO:328, SEQ ID NO:329, SEQ ID NO:330, SEQ ID NO:331, SEQ ID NO:332, SEQ ID NO:333, SEQ ID NO:334, SEQ ID NO:335, SEQ ID NO:336, SEQ ID NO:337, SEQ ID NO:338, SEQ ID NO:339, SEQ ID NO:340, SEQ ID NO:341, SEQ ID NO:342, SEQ ID NO:343, SEQ ID NO:344, SEQ ID NO:345, SEQ ID NO:346, SEQ ID NO:347, SEQ ID NO:348, SEQ ID NO:349, SEQ ID NO:350, SEQ ID NO:351, SEQ ID NO:352, SEQ ID NO:353, SEQ ID NO:354, SEQ ID NO:355, SEQ ID NO:356, SEQ ID NO:357, SEQ ID NO:358, SEQ ID NO:359, SEQ ID NO:360, SEQ ID NO:361, SEQ ID NO:362, SEQ ID NO:363, SEQ ID NO:364, SEQ ID NO:365, SEQ ID NO:366, SEQ ID NO:367, SEQ ID NO:368, SEQ ID NO:369, SEQ ID NO:370, SEQ ID NO:371, SEQ ID NO:372, SEQ ID NO:373, SEQ ID NO:374, SEQ ID NO:375, SEQ ID NO:376, SEQ ID NO:377, SEQ ID NO:378, SEQ ID NO:379, SEQ ID NO:380, SEQ ID NO:381, SEQ ID NO:382, SEQ ID NO:383, SEQ ID NO:384, SEQ ID NO:385, SEQ ID NO:386, SEQ ID NO:387, SEQ ID NO:388, SEQ ID NO:389, SEQ ID NO:390, SEQ ID NO:391, SEQ ID NO:392, SEQ ID NO:393, SEQ ID NO:394, SEQ ID NO:395, SEQ ID NO:396, SEQ ID NO:397, SEQ ID NO:398, SEQ ID NO:399, SEQ ID NO:400, SEQ ID NO:401, SEQ ID NO:402, SEQ ID NO:403, SEQ ID NO:404, SEQ ID NO:405, SEQ ID NO:406, SEQ ID NO:407, SEQ ID NO:408, SEQ ID NO:409, SEQ ID NO:410, SEQ ID NO:411, SEQ ID NO:412, SEQ ID NO:413, SEQ ID NO:414, SEQ ID NO:415, SEQ ID NO:416, SEQ ID NO:417, SEQ ID NO:418, SEQ ID NO:419, SEQ ID NO:420, SEQ ID NO:421, SEQ ID NO:422, SEQ ID NO:423, SEQ ID NO:424, SEQ ID NO:425, SEQ ID NO:426, SEQ ID NO:427, SEQ ID NO:428, SEQ ID NO:429, SEQ ID NO:430, SEQ ID NO:431, SEQ ID NO:78, or SEQ ID NO:80. In another specific embodiment, the NFKB repressor sequence is a double-stranded oligonucleotide. In an additional specific embodiment, the NFKB repressor sequence is a peptide nucleic acid.

In an embodiment of the present invention, there is a method of treating cardiovascular disease in a mammal, comprising the step of introducing into the mammal therapeutically effective levels of a dominant negative mutant sequence of a NFKB p50 subunit, wherein the NFKB dominant negative p50 subunit is selected from the group consisting of SEQ ID NO:238, SEQ ID NO:239, SEQ ID NO:240, SEQ ID NO:241, SEQ ID NO:242, SEQ ID NO:243, SEQ ID NO:244, SEQ ID NO:245, SEQ ID NO:246, SEQ ID NO:247, SEQ ID NO:248, SEQ ID NO:249, SEQ ID NO:250, SEQ ID NO:251, SEQ ID NO:252, and SEQ ID NO:253, wherein the cardiovascular disease is improved following the introduction.

In an additional embodiment of the present invention there is a method of inhibiting formation of NFKB p50 homodimers in a cell of a mammal, comprising the step of introducing into the animal therapeutically effective levels of a dominant negative mutant sequence of a NFKB p50 subunit, wherein the NFKB dominant negative p50 is selected from the group consisting of SEQ ID NO:238, SEQ ID NO:239, SEQ ID NO:240, SEQ ID NO:241, SEQ ID NO:242, SEQ ID NO:243, SEQ ID NO:244, SEQ ID NO:245, SEQ ID NO:246, SEQ ID NO:247, SEQ ID NO:248, SEQ ID NO:249, SEQ ID NO:250, SEQ ID NO:251, SEQ ID NO:252, and SEQ ID NO:253, and wherein the NFKB p50 homodimers are inhibited from forming following the introduction. In an additional embodiment of the present invention there is a method of reducing formation of NFKB p50 homodimers in a cell of a mammal, comprising the step of introducing into the cell therapeutically effective levels of a dominant negative mutant sequence of a NFKB p50 subunit, wherein the dominant negative NFKB p50 is selected from the group consisting of SEQ ID NO:238, SEQ ID NO:239, SEQ ID NO:240, SEQ ID NO-241, SEQ ID NO:242, SEQ ID NO:243, SEQ ID NO:244, SEQ ID NO:245, SEQ ID NO:246, SEQ ID NO:247, SEQ ID NO:248, SEQ ID NO:249, SEQ ID NO:250, SEQ ID NO-251, SEQ ID NO:252, and SEQ ID NO:253, and wherein the formation of NFKB p50 homodimers is reduced following the introduction. In a specific embodiment, the NFKB p50 subunit further comprises a protein transduction domain.

In an additional embodiment of the present invention there is a method of treating cardiovascular disease in a mammal, comprising the step of introducing into the mammal therapeutically effective levels of a nucleic acid sequence which encodes a dominant negative mutant sequence of a NFKB p50 subunit, wherein the dominant negative NFKB p50 subunit is selected from the group consisting of SEQ ID NO:238, SEQ ID NO:239, SEQ ID NO:240, SEQ ID NO-241, SEQ ID NO:242, SEQ ID NO:243, SEQ ID NO:244, SEQ ID NO:245, SEQ ID NO:246, SEQ ID NO:247, SEQ ID NO:248, SEQ ID NO:249, SEQ ID NO:250, SEQ ID NO.251, SEQ ID NO:252, and SEQ ID NO:253, and wherein the cardiovascular disease is improved following the introduction.

In an additional embodiment of the present invention there is a method of inhibiting formation of NFKB p50 homodimers in a cell of a mammal, comprising the step of introducing into the cell therapeutically effective levels of a nucleic acid sequence encoding a dominant negative mutant sequence of a NFKB p50 subunit, wherein the NFKB p50 is selected from the group consisting of SEQ ID NO:238, SEQ ID NO:239, SEQ ID NO:240, SEQ ID NO-241, SEQ ID NO:242, SEQ ID NO:243, SEQ ID NO:244, SEQ ID NO:245, SEQ ID NO:246, SEQ ID NO:247, SEQ ID NO:248, SEQ ID NO:249, SEQ ID NO:250, SEQ ID NO-251, SEQ ID NO:252, and SEQ ID NO:253, and wherein the NFKB p50 dimers are inhibited from forming following the introduction.

In another embodiment of the present invention there is a method of reducing formation of NFKB p50 homodimers in a cell of a mammal, comprising the step of introducing into the cell therapeutically effective levels of a nucleic acid sequence encoding a dominant negative mutant sequence of a NFKB ρ50 subunit, wherein the p50 is selected from the group consisting of SEQ ID NO:238, SEQ ID NO:239, SEQ ID NO:240, SEQ ID NO-241, SEQ ID NO:242, SEQ ID NO:243, SEQ ID NO:244, SEQ ID NO:245, SEQ ID NO:246, SEQ ID NO:247, SEQ ID NO:248, SEQ ID NO:249, SEQ ID NO:250, SEQ ID NO:251, SEQ ID NO:252, and SEQ ID NO:253, and wherein the formation of NFKB p50 dimers is reduced following the introduction. In a specific embodiment, the nucleic acid is introduced in a vector. In another specific embodiment, the vector is selected from the group consisting of an adenoviral vector, an adeno-associated viral vector, a retroviral vector, a plasmid, a liposome, a lipid, or a combination thereof. In a further specific embodiment, the nucleic acid is introduced into a myocardium cell.

In an additional embodiment of the present invention there is a method of diagnosing cardiovascular disease in a mammal, comprising the steps of: obtaining a sample from the mammal; and measuring the level of NFKB p50 homodimers in the sample, wherein an increase in the the level is indicative of the cardiovascular disease in the mammal. In a specific embodiment the measuring step comprises an assay selected from the group consisting of electrophoretic mobility shift assay and immunoblot analysis. In a specific embodiment, the measuring step comprises electrophoretic mobility shift assay.

In an additional embodiment of the present invention there is a method of reducing or preventing inhibition of expression of an adrenergic system signaling nucleic acid sequence in a cell of a mammal, comprising the step of reducing the levels of NFKB p50 homodimers in the cell, wherein the reduced levels leads to the inhibition of expression. In a specific embodiment, the adrenergic system signaling nucleic acid sequence is selected from the group consisting of βl -adrenergic receptor, β2-adrenergic receptor, β3-adrenergic receptor, β-adrenergic receptor kinase 1 (β-ARKl), β-adrenergic receptor kinase 2 (β-ARK2), Gi-α-1, Gi-α-1, Gi-α-1, Gsα, and Gsα -XL. In specific embodiment, the NFKB p50 homodimer levels are reduced by introducing into the cell a dominant negative form of a Myo/Vl polypeptide. In another specific embodiment, the polypeptide is selected from the group consisting of SEQ ID NO:l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO: 10. In a further specific embodiment, the p50 homodimer levels are reduced by introducing into the cell therapeutically effective levels of a dominant negative mutant sequence of NFKB p50. In an additional specific embodiment, the dominant negative mutant sequence of NFKB p50 is selected from the group consisting of SEQ ID NO:238, SEQ ID NO:239, SEQ ID NO:240, SEQ ID NO:241, SEQ ID NO:242, SEQ ID NO:243, SEQ ID NO:244, SEQ ID NO:245, SEQ ID NO:246, SEQ ID NO:247, SEQ ID NO:248, SEQ ID NO:249, SEQ ID NO:250, SEQ ID NO-251, SEQ ID NO:252, and SEQ ID NO:253. In another specific embodiment, the NFKB p50 homodimer levels are reduced by inhibiting formation of a Myo/Vl -p50 complex. In a further specific embodiment, the NFKB p50 homodimer levels are reduced by introducing into the cell antisense sequence of the NFKB p50. In another specific embodiment, the NFKB p50 homodimer levels are reduced by introducing into the cell antisense sequence of the Myo/Nl .

In another embodiment of the present invention there is a method of treating cardiovascular disease in a mammal, comprising the step of reducing migration of ΝFKB p50 homodimers from cytoplasm to nucleus in a cell of the mammal.

In another embodiment of the present invention there is a method of reducing ΝFKB p50 homodimers in a cell of a mammal, comprising the step of reducing migration of ΝFKB p50 homodimers from cytoplasm to nucleus of the cell.

In another embodiment of the present invention there is a method of reducing Myo/NI-p50 complex levels in a cell of a mammal comprising the step of introducing ER81 into the cell, wherein the introduction results in reduction of the complex levels. In a specific embodiment, the ER81 is introduced into the cell as a polypeptide, and wherein the ER81 polypeptide further comprises a protein transduction domain. In another specific embodiment, the ER81 is introduced as a nucleic acid sequence. In an additional specific embodiment, the ER81 nucleic acid sequence is introduced in a vector.

In an additional embodiment of the present invention there is a method of reducing Myo/VI-p50 complex levels in a cell of a mammal comprising the step of introducing a ETS factor into the cell, wherein the introduction results in reduction of the complex levels. In a specific embodiment, the ETS factor is introduced as a polypeptide, and wherein the ETS factor polypeptide further comprises a protein transduction domain. In another specific embodiment, the ETS factor is introduced as a nucleic acid sequence. In an additional specific embodiment, the ETS factor nucleic acid sequence is introduced in a vector. In another specific embodiment, the ETS factor is selected from the group consisting of GABPalpha/ΝRF2/E4TFl, ER81/ETV1, ERM, ELF/NERF2, ELF4, ELK1, ELK3/SAP2/ERP/NET, and ETS2.

In another embodiment of the present invention there is a method of treating cardiovascular disease in a mammal, comprising the step of reducing Myo/Nl levels in the mammal, wherein the cardiovascular disease is improved following reduction of the Myo/Nl levels. In a specific embodiment, the reducing step comprises introducing into a cell in the mammal an antisense peptide nucleic acid of the Myo/Vl.

In another embodiment of the present invention there is a method of reducing Myo/Nl levels in a cell of a mammal, comprising the step of introducing into the cell an antisense peptide nucleic acid of the Myo/Vl.

In another embodiment of the present invention there is a method of treating cardiovascular disease in a mammal, comprising the step of reducing ΝFKB p50 subunit levels in the mammal, wherein the cardiovascular disease is improved following reduction of the p50 subunit levels. In a specific embodiment, the reducing step comprises introducing into a cell in the mammal an antisense peptide nucleic acid of the ΝFKB p50 subunit.

In another embodiment of the present invention there is a method of reducing ΝFKB p50 subunit levels in a cell of a mammal, comprising the step of introducing into the cell an antisense PΝA of the NFKB p50 subunit.

In another embodiment of the present invention there is a method of treating cardiovascular disease in a mammal, comprising the step of reducing β-ARKl subunit levels in the mammal, wherein the cardiovascular disease is improved following reduction of the β- ARK1. In a specific embodiment, the reducing step comprises introducing into a cell in the mammal an antisense peptide nucleic acid of the β-ARKl.

In an additional embodiment of the present invention there is a method of reducing β- ARK1 levels in a cell of a mammal, comprising the step of introducing into the cell an antisense peptide nucleic acid of the β-ARKl.

In an additional embodiment of the present invention there is a method of treating cardiovascular disease in a mammal, comprising the step of reducing β-ARK2 subunit levels in the mammal, wherein the cardiovascular disease is improved following reduction of the β- ARK2 levels. In a specific embodiment, the reducing step comprises introducing into a cell in the mammal an antisense peptide nucleic acid of the β-ARK2.

In another embodiment of the present invention there is a method of reducing β- ARK2 levels in a cell of a mammal, comprising the step of introducing into the cell an antisense peptide nucleic acid of the β-ARK2.

In an additional embodiment of the present invention there is a method of treating cardiovascular disease in a mammal comprising the step of administering therapeutically effective levels of antisense sequence of Myo/Vl to the mammal. In another embodiment of the present invention there is a method of treating cardiovascular disease in a mammal comprising the step of administering therapeutically effective levels of antisense sequence of NFKB p50 to the mammal.

In a specific embodiment, cardiovascular disease is selected from the group consisting of myocardial infarction, ischemia/reperfusion injury, heart transplantation, and cardiac hypertrophy. In another specific embodiment, cardiovascular disease is cardiac hypertrophy.

In another embodiment of the present invention there is a method of treating a NFKB- related disease, comprising the step of introducing the active compound, wherein the NFKB- related disease is improved following the introduction.

In a specific embodiment, a NFKB -related disease is selected from the group consisting of sepsis, inflammatory bowel disease, and Incontinentia Pigmenti.

In another embodiment of the present invention there is as a composition of matter an aptamer which binds Myo/Vl polypeptide. In a specific embodiment the aptamer is selected from the group consisting of DNA, RNA and peptide.

In another embodiment of the present invention there is as a composition of matter, an aptamer which binds NFKB p50 polypeptide. In a specific embodiment, the aptamer is selected from the group consisting of DNA, RNA and peptide.

In another embodiment of the present invention there is a method of generating a nucleic acid aptamer for binding Myo/Vl polypeptide comprising the steps of synthesizing a plurality of single-stranded nucleic acid molecules, each having a 5' end and a 3' end, wherein the 5 ' end and the 3 ' end comprise known polymerase chain reaction primer-binding sequences; presenting the plurality of single-stranded nucleic acid molecules to the Myo/Vl polypeptide; and measuring binding of a single-stranded nucleic acid molecule to the Myo/Nl polypeptide, wherein when the single- stranded nucleic acid molecule binds to the Myo/Nl polypeptide, the single-stranded nucleic acid molecule is the aptamer. In a specific embodiment, the nucleic acid molecule is approximately 30-50 nucleotides in length. In another specific embodiment, the nucleic acid molecule is approximately 40 nucleotides in length.

In another embodiment of the present invention there is a method of generating a peptide aptamer for binding Myo/Nl polypeptide comprising the steps of synthesizing a plurality of peptide molecules; presenting the plurality of peptide molecules to the Myo/Nl polypeptide; and measuring binding of a peptide molecule to the Myo/Nl polypeptide, wherein when the peptide molecule binds to the Myo/Nl polypeptide, the peptide molecule is the aptamer.

In another embodiment of the present invention there is a method of generating a nucleic acid aptamer for binding ΝFKB p50 polypeptide comprising the steps of synthesizing a plurality of single-stranded nucleic acid molecules, each single-stranded nucleic acid molecule comprising a 5 ' polymerase chain reaction primer-binding sequence, a test nucleic acid sequence, and a 3 ' polymerase chain reaction primer-binding sequence; presenting said plurality of single- stranded nucleic acid molecules to said ΝFKB p50 polypeptide; and measuring binding of a single-stranded nucleic acid molecule to said ΝFKB p50 polypeptide, wherein when said test nucleic acid sequence binds to said ΝFKB p50 polypeptide, said single-stranded nucleic acid molecule is said aptamer. In a specific embodiment, the nucleic acid molecule is approximately 30-50 nucleotides in length. In another specific embodiment, the nucleic acid molecule is approximately 40 nucleotides in length.

In another embodiment of the present invention there is a method of generating a peptide aptamer for binding ΝFKB p50 polypeptide comprising the steps of synthesizing a plurality of peptide molecules; presenting said plurality of peptide molecules to said ΝFKB p50 polypeptide; and measuring binding of a peptide molecule to said ΝFKB p50 polypeptide, wherein when said peptide molecule binds to said ΝFKB p50 polypeptide, said peptide molecule is said aptamer.

In another embodiment of the present invention there is a method of treating cardiovascular disease in a mammal, comprising the step of inhibiting interaction of Myo Nl polypeptide with an ETS factor. In a specific embodiment, there is an ETS factor is selected from the group consisting of GABPalpha/ΝRF2/E4TFl, ER81/ETV1, ERM, ELF/NERF2, ELF4, ELK1, ELK3/SAP2/ERP/NET, and ETS2. In a specific embodiment, the ETS factor is ER81/ETVl.

In another embodiment of the present invention there is a method of inhibiting fetal carnitine palmitoyltransferase-I (CPT1) nucleic acid expression in a mammal comprising the step of inhibiting interaction of Myo/Vl polypeptide with an ETS factor. In a specific embodiment, the ETS factor is selected from the group consisting of GABPalpha/NRF2/E4TFl, ER81/ETV1, ERM, ELF/NERF2, ELF4, ELK1, ELK3/SAP2/ERP/NET, and ETS2. In another specific embodiment, the ETS factor is ER81/ETV1. In another embodiment of the present invention there is a method of inhibiting fetal 6- phosphofructo-2-kinase/fructose-2,6-bisphosphatase (PFK) nucleic acid expression in a mammal comprising the step of inhibiting interaction of Myo/Vl polypeptide with an ETS factor. In a specific embodiment, the factor is selected from the group consisting of GABPalpha/NRF2/E4TFl, ER81/ETV1, ERM, ELF/NERF2, ELF4, ELK1, ELK3/SAP2/ERP/NET, and ETS2. In a specific embodiment, the ETS factor is ER81/ETV1.

In an additional embodiment of the present invention, there is a method of inhibiting formation of NFKB p65 homodimers in a cell of a mammal, comprising the step of introducing into said cell therapeutically effective levels of a nucleic acid sequence encoding a dominant negative mutant sequence of Myo/Vl polypeptide, wherein said introduction results in inhibition of formation of said NFKB p65 homodimers.

In an additional embodiment of the present invention, there is a method of reducing formation of NFKB p65 homodimers in a cell of a mammal, comprising the step of introducing into said cell therapeutically effective levels of a nucleic acid sequence encoding a dominant negative mutant sequence of Myo/Vl polypeptide, wherein said introduction results in reduction of formation of said NFKB p65 homodimers.

In another embodiment of the present invention, there is a method of treating cardiovascular disease in a mammal, comprising the step of introducing into a cell of said mammal therapeutically effective levels of a NFKB repressor sequence under conditions wherein said repressor sequence binds a NFKB p65 homodimer, wherein said cardiovascular disease is improved following said introduction.

In another embodiment of the present invention, there is a method of reducing NFKB p65 homodimer levels in a cell of a mammal, comprising the step of introducing into said cell therapeutically effective levels of a NFKB repressor sequence under conditions wherein said repressor sequence binds said NFKB p65 homodimer.

Other and further objects, features and advantages would be apparent and eventually more readily understood by reading the following specification and by reference to the company drawing forming a part thereof, or any examples of the presently prefened embodiments of the invention are given for the purpose of the disclosure. BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 compares amino acid sequences of rat, mouse and human Myo/Vl, with putative p50/p65 interacting domains, nuclear import and export signal sequences, phosphorylation sites, putative ETS interacting lysine residues, and ankyrin repeats noted.

FIG. 2 illlustrates X-ray and NMR structures of ankyrin-repeat containing proteins which interact with ETS and NFKB.

FIGS. 3 A and 3B demonstrates the established structure of GABPβ interaction with ETS (3 A) and the hypothesized model for Myo/Vl interaction with ETS.

FIG. 4 shows an embodiment of MyoNl function during cardiac hypertrophy and heart failure.

FIG. 5 demonstrates an embodiment of Myo/Vl function on ETS and NFKB during cardiac hypertrophy and heart failure.

FIG. 6 illustrates an overall model for specific embodiments of Myo/Nl function.

FIG. 7 demonstrates an embodiment of a ΝFKB regulatory mechanism which occurs during heart failure.

FIG. 8 shows an embodiment of Myo/Vl function on a normal heart without any stress.

FIG. 9 shows an embodiment of Myo/Vl function on a normal heart during acute stress.

FIG. 10 demonstrates an embodiment of MyoNl function on a failing heart and during aging.

FIGS.11A-11D show cellular location of Myo/Vl in (11 A) rat neonatal myocytes; (1 IB) non-myocytes; (1 IC) adult feline myocardium; and (1 ID) HeLa cells.

FIGS. 12A and 12B demonstrate in vivo (12A) and in vitro (12B) coimmunoprecipitation of Myo/Vl ΝFKB and IκB.

FIG. 13 demonstrates electrophoretic mobility shift assay with Jurkat T cell nuclear extract. WB-JΝE is western analysis of Myo/Vl Jurkat T cell nuclear extract used in lane 1.

FIG. 14 shows ERK (in vitro) phosphorylation of Myo/Vl.

FIG. 15 demonstrates purification of recombinant Myo/Vl protein.

FIG. 16 demonstrates Myo/Vl effects on ETS-DΝA binding activity.

FIG. 17 shows the effect of Myo/Nl on KB DΝA binding of purified p50 and p65 subunits. Identical copies of an EMSA image are shown. Lines are drawn to highlight the relative positions of p50 homodimers, p50-p65 heterodimers and p65 homodimers. Lane 1, 5 and 10 do not contain Myo/Nl.

FIG. 18 shows Myo/Vl splits p50-p65 heterodimers into p50 and p65 homodimers.

FIG. 19 demonstrates an electrophoretic mobility shift assay from Kursch et al. (1992) showing the inability of p50-p65 heterodimers to bind to p50- or p65-specific oligonucleotides.

FIG. 20 demonstrates p50 homodimers in MHCsTΝF failing mouse hearts; LC is littermate controls.

FIG. 21 is a western analysis of Myo/Vl in HeLa cells.

FIG. 22A and 22B demonstrate the effect of Myo/Vl on ΝFκB-dependent transcription. FIG. 22 A shows neonatal myocytes with p65 and Myo/Vl overexpression. FIG. 22B demonstrates Myo/Nl influence on KB enhancer directed transcription.

FIG. 23 illustrates dominant negative Myo/Vl mutants as specific embodiments of peptide active compounds for heart failure.

FIG. 24 demonstrates an embodiment of Myo/Vl inducing fetal CPT1 through ETS.

FIG. 25 illustrates an embodiment wherein Myo/Vl switches from TATA to ETS box initiation to produce fetal PFK.

FIG. 26 demonstrates an embodiment wherein Myo/Vl inhibits βl-ADR and Gs- alpha expression by generating p50-p50 homodimers.

FIG. 27 shows the effect of Myo/Nl and ΝFKB homodimers on human βl -adrenergic receptor gene expression.

FIG. 28 shows the effect of ρ65, p50, IκBs32s36 and IKBWT on βl -adrenergic receptor gene expression.

FIG. 29 shows an electrophoretic mobility shift assay with a p50-p50 homodimer- specific oligonucleotide with protein extracts from human myocardial nuclei.

FIGS. 30A through 30D show p50 and p65 homodimers in failing human hearts. FIG. 30A shows an electrophoretic mobility shift assay assaying for p50 homodimers in three different diseased hearts. FIG. 30B illustrates the quantified myocardial levels of the p50 homodimers in the patients. FIG. 30C compares the ΝFKB homodimers in normal donor heart biopsy samples with failing heart samples. FIG. 30D shows a comparative analysis of ΝFKB homodimers in multiple dilated cardiomyopathic patients.

FIG. 31 demonstrates a 3-dimensional (3D) comparison of Myo/Nl (blue) and IκBα (red). FIG. 32 demonstrates a 3-dimensional (3D) comparison of Myo/Vl (red) and ga binding protein alpha fragment (blue).

FIG. 33 demonstrates a 3-dimensional (3D) comparison of Myo/Vl (blue) and pl9ink4d cdk46 inhibitor (red).

FIG. 34 demonstrates a 3-dimensional (3D) comparison of Myo/Vl (red) and cyclin- dependent kinase 6 inhibitor (blue).

FIG. 35 demonstrates a 3-dimensional (3D) comparison of Myo/Vl (red) and cyclin- dependent kinase 4 inhibitor a (blue).

FIG. 36 demonstrates a 3-dimensional (3D) comparison of Myo/Vl (blue) and p53bp2 (red).

FIGS. 37A, 37B and 37C demonstrate an embodiment of a Myo/Nl-p50 mammalian cell line for drug screening.

FIGS 38 A, 38B and 38C demonstrate a p50-ADR mammalian cell line for drug screening.

FIG. 39 illustrates a schematic for development of nucleic acid aptamers for Myo/Vl or ΝFκB p50.

FIG. 40 illustrates Myo/Vl changes the ratio of NFKB dimers in vivo in favor of p50- p50 homodimers. FIG. 40A demonstrates a GSA showing the effect of Myo/Vl on in vivo generated NFKB dimers. FIG. 40B shows a quantitative comparison of NFKB dimers between Adβgal and AdMyoNl. The bargraph shows the fold change in the levels of individual ΝFKB dimers in relation toAdβgal infected HeLa cells. FIG. 40C shows relative levels of ΝFKB dimers in Adβgal and AdMyo/Vl infected cells. The bar graph shows the ΝFKB dimer ratio in relation to p50-.31p65 heterodimers in Adβgal and AdMyo/Vl infected HeLa cells. These results are representative of six different experiments, conducted four times at a MOI of 10 and twice at a MOI of 50.

DESCRIPTION OF THE INVENTION

Other objects, features and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating prefened embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description. The term "active compound" as used herein is defined as a compound which provides a desired action for therapy of a disease, such as cardiovascular disease, or for a treatment regimen, such as anti-aging treatment.

The term "anti-aging treatment" as used herein is defined as an action on a cell or organism, such as a human organism or human cell, which reduces or reverses the process of aging. The treatment may affect an aging process of a cell, an organ, or of the entire organism. In a specific embodiment, the aging process of both are treated.

The term "aptamer" as used herein is defined as a macromolecular biological agent which binds a given protein ligand with high affinity and specificity. In a specific embodiment, the ligand binds to the aptamer due to its particular three-dimensional structure, and in another specific embodiment this antagonizes the biological function of the ligand. In a prefened embodiment, the term "antagonizes" as used herein is defined as disrupting or interfering with an activity of the ligand. In another specific embodiment the aptamer is a DNA, an RNA, or a protein.

The term "cardiac hypertrophy" as used herein is defined as an enlargement of the heart.

The term "cardiovascular disease" as used herein is defined as a medical state of having an unhealthy heart, such as is found with myocardial infarction, ischemia/reperfusion injury, heart transplantation, cardiac hypertrophy, and cardiomyopathy (such as dilated or ischemic).

The term "derivative" as used hereinrefers to a chemically modified or altered form of a naturally occurring molecule, while the terms "mimic" or "analog" refers to a molecule that may or may not structurally resemble a naturally occuning molecule, but functions similarly to the naturally occurring molecule.

The term "detectable signal" as used herein is defined as an indication or signal which can be noticed or detected. In a prefened embodiment, the detectable signal is color, light, fluorescence, radioactivity, or movement.

The term "dominant negative" as used herein is defined as a mutant sequence or mutant which is genetically dominant to the wild type sequence and disruptive of the wild type sequence function. In a prefened embodiment, a dominant negative mutant sequence binds to factors which the wild type normally binds to and titrates away those factors from the wild type, generally disrupting wild type normal function. The term "electrophoretic mobility shift assay" as used herein is defined as an experiment wherein a labeled nucleic acid sequence is combined with a protein, and its mobility during gel electrophoresis is measured. The term is used interchangeably in the art with electrophoretic mobility assay, gel shift, or gel shift assay (GSA).

The terms "hybridization", "hybridizes" or "capable of hybridizing" as used herein are understood to mean the forming of a double or triple stranded molecule or a molecule with partial double or triple stranded nature. The term "hybridization", "hybridize(s)" or "capable of hybridizing" encompasses the terms "stringent condition(s)" or "high stringency" and the terms "low stringency" or "low stringency condition(s)."

The term "mutant" as used herein is defined as a change or changes in the sequence of a nucleic acid or its encoded protein, polypeptide or peptide.

The term "moiety" as used herein generally refers to a smaller chemical or molecular component of a larger chemical or molecular structure, and is encompassed by the term "molecule."

The term "NFKB p50 homodimer" as used herein is defined as a complex of two p50 subunits of NFKB. The term is used herein interchangeably with "p50 homodimer."

The term "nucleobase" as used hereinrefers to a naturally occurring heterocyclic base, such as A, T, G, C or U ("naturally occurring nucleobase(s)"), found in at least one naturally occurring nucleic acid (i.e. DNA and RNA), and their naturally or non-naturally occuning derivatives and mimics.

The term "nucleoside" as used hereinrefers to an individual chemical unit comprising a nucleobase covalently attached to a nucleobase linker moiety.

The term "p50" as used herein is defined as the ρ50 subunit of NFKB. The term is used herein interchangeably with "NFKB p50".

The term "polymerase chain reaction primer-binding sequence" as used herein is a nucleic acid sequence to which a polymerase chain reaction primer hybridizes to for facilitating initiation of polymerization of a nucleic acid sequence. There is preferentially a 5' polymerase chain reaction primer-binding sequence and a 3' polymerase chain reaction primer-binding sequence in a nucleic acid aptamer of the present invention.

The term "substantially complementary" as used herein refers to a nucleic acid comprising at least one sequence of consecutive nucleobases, or semiconsecutive nucleobases if one or more nucleobase moieties are not present in the molecule, are capable of hybridizing to at least one nucleic acid strand or duplex even if less than all nucleobases do not base pair with a counterpart nucleobase.

The term "test nucleic acid sequence" as used herein is defined as a nucleic acid sequence of from 30-60 nucleotides in length which is analyzed for binding to a ligand, such as Myo/Vl or NFKB p50. In a specific embodiment, the sequence is from 35-50 nucleotides in length. In another specific embodiment, the sequence is approximately 40 nucleotides in length. In a prefened embodiment, the test nucleic acid sequence is on a nucleic acid aptamer and is flanked by a 5 ' polymerase chain reaction primer binding sequence and a 3 ' polymerase chain reaction binding sequence, both of which facilitate amplification and identification of the test nucleic acid sequence.

The term "wild-type" as used herein refers to the naturally occurring sequence of a nucleic acid at a genetic locus in the genome of an organism, and sequences transcribed or translated from such a nucleic acid. Thus, the term "wild-type" also may refer to the amino acid sequence encoded by the nucleic acid. As a genetic locus may have more than one sequence or alleles in a population of individuals, the term "wild-type" encompasses all such naturally occuning alleles.

As used herein the specification, "a" or "an" may mean one or more. As used herein in the claim(s), when used in conjunction with the word "comprising", the words "a" or "an" may mean one or more than one. As used herein "another" may mean at least a second or more. I. The Present Invention

In an embodiment of the present invention, there is as a composition of matter a dominant negative mutant sequence of Myo/Vl polypeptide. In a specific embodiment, the sequence is selected from the group consisting of SEQ ID NO:94, SEQ ID NO:95, SEQ ID NO:96, SEQ ID NO:97, SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 110, SEQ ID NO:l l l, SEQ ID NO.112, and SEQ ID NO.113. In another specific embodiment, the sequence further comprises a protein transduction domain.

In another embodiment of the present invention there is as a composition of matter a nucleic acid sequence encoding a dominant negative mutant sequence of Myo/Vl polypeptide.

In an additional embodiment of the present invention there is as a composition of matter a nucleic acid sequence encoding a dominant negative mutant sequence of a Myo/Nl polypeptide, wherein the polypeptide is selected from the group consisting of SEQ ID ΝO:94, SEQ ID NO:95, SEQ ID NO:96, SEQ ID NO:97, SEQ ID NO:108, SEQ ID NO:109, SEQ ID NO:l 10, SEQ ID NO:l 11, SEQ ID NO:l 12, and SEQ ID NO:l 13.

In an additional embodiment of the present invention there is as a composition of matter a nucleic acid sequence encoding a dominant negative mutant sequence of a Myo/Nl polypeptide, wherein the nucleic acid sequence is selected from the group consisting of SEQ ID NO: 186, SEQ ID NO: 187, SEQ ID NO: 188, SEQ ID NO: 189, SEQ ID NO: 197, SEQ ID NO:198, SEQ ID NO:199, SEQ ID NO:200, SEQ ID NO:201, and SEQ ID NO:202.

In another embodiment of the present invention there is as a composition of matter a constitutively active mutant sequence of MyoNl polypeptide. In a specific embodiment, the sequence is selected from the group consisting of SEQ ID NO: 90, SEQ ID NO:91, SEQ ID NO:92, SEQ ID NO:93, SEQ ID NO:101, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:105, SEQ ID NO:106; and SEQ ID NO:107. In a specific embodiment, the constitutively active mutant sequence further comprises a protein transduction domain.

In an additional embodiment of the present invention there is as a composition of matter a nucleic acid sequence encoding a constitutively active mutant sequence of Myo/Nl polypeptide.

In another embodiment of the present invention there is as a composition of matter a nucleic acid sequence encoding a constitutively active mutant sequence of Myo/Vl polypeptide, wherein the polypeptide is selected from the group consisting of SEQ ID ΝO:90, SEQ ID NO:91, SEQ ID NO:92, SEQ ID NO:93, SEQ ID NO:101, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:105, SEQ ID NO:106; and SEQ ID NO:107.

In an additional embodiment of the present invention there is as a composition of matter a nucleic acid sequence encoding a constitutively active mutant sequence of Myo/Vl polypeptide, wherein the nucleic acid sequence is selected from the group consisting of SEQ ID NO: 182, SEQ ID NO: 183, SEQ ID NO: 184, SEQ ID NO: 185, SEQ ID NO: 190, SEQ ID NO:191, SEQ ID NO:192, SEQ ID NO:193, SEQ ID NO:194, SEQ ID NO:195, and SEQ ID NO: 196.

In another embodiment of the present invention there is a method of treating cardiovascular disease in a mammal, comprising the step of introducing into the mammal therapeutically effective levels of a dominant negative mutant sequence of Myo/Vl polypeptide, wherein the introduction results in an improvement of the cardiovascular disease. In another embodiment of the present invention there is a method of inhibiting formation of NFKB p50 homodimers in a cell of a mammal, comprising the step of introducing into the cell therapeutically effective levels of a dominant negative mutant sequence of Myo/Vl polypeptide, wherein the introduction results in inhibition of formation of the NFKB p50 homodimers.

In another embodiment of the present invention there is a method of reducing formation of NFKB p50 homodimers in a cell of a mammal, comprising the step of introducing into the cell therapeutically effective levels of a dominant negative mutant sequence of Myo/Vl polypeptide, wherein the introduction results in reduction of formation of the NFKB p50 homodimers. In a specific embodiment, the dominant negative mutant sequence is selected from the group consisting of SEQ ID NO:l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO: 10.

In another embodiment of the present invention there is a method of treating cardiovascular disease in a mammal, comprising the step of introducing to the mammal therapeutically effective levels of a nucleic acid sequence encoding a dominant negative mutant sequence of Myo/Vl polypeptide, wherein the introduction results in an improvement of the cardiovascular disease.

In another embodiment of the present invention there is a method of inhibiting formation of NFKB p50 homodimers in a cell of a mammal, comprising the step of introducing into the cell therapeutically effective levels of a nucleic acid sequence encoding a dominant negative mutant sequence of Myo/Vl polypeptide, wherein the introduction results in inhibition of formation of the NFKB p50 homodimers.

In another embodiment of the present invention there is a method of reducing formation of NFKB p50 homodimers in a cell of a mammal, comprising the step of introducing into the cell therapeutically effective levels of a nucleic acid sequence encoding a dominant negative mutant sequence of Myo/Vl polypeptide, wherein the introduction results in reduction of formation of the NFKB p50 homodimers.

In an additional embodiment of the present invention there is^'a method for screening a test compound for the treatment of cardiovascular disease, comprising the steps of combining a labeled nucleic acid sequence with a NFKB p50 subunit polypeptide under conditions to form a nucleic acid sequence- NFKB p50 polypeptide complex; adding a test compound to the complex; and assaying the electrophoretic mobility of the complex in the presence of the test compound; comparing the electrophoretic mobility of the complex with the test compound to the electrophoretic mobility of the complex in the absence of the test compound, wherein a change in the mobility in the presence of the test compound indicates the test compound is an active compound.

In an additional embodiment of the present invention, there is a pharmaceutical composition for treating cardiovascular disease comprising an active compound obtained by a method of screening a test compound, wherein the screen comprises the steps of combining a labeled nucleic acid sequence with a p50 NFKB subunit polypeptide under conditions to form a nucleic acid sequence-p50 polypeptide complex; adding a test compound to the complex; and assaying the electrophoretic mobility of the complex in the presence of the test compound; comparing the electrophoretic mobility of the complex with the test compound to the electrophoretic mobility of the complex in the absence of the test compound, wherein a change in the mobility in the presence of the test compound indicates the test compound is an active compound; and a physiologically acceptable canier.

In an embodiment of the present invention there is a method of screening for an active compound for cardiovascular disease, comprising the steps of introducing into a cell a first nucleic acid expressing a fused test peptide/DNA binding domain; and a second nucleic acid expressing a fused Myo/Vl -p50 polypeptide/DNA activation domain; and assaying for an interaction between the test peptide and the Myo/Nl -p50 polypeptide by measuring binding between the DΝA binding domain and the DΝA activation domain, wherein the interaction between the test peptide and the Myo Nl -p50 polypeptide indicates the test peptide is the active compound.

In an additional embodiment of the present invention there is a method of screening for an active compound for anti-aging treatment, comprising the steps of introducing into a cell a first nucleic acid expressing a fused test peptide/DΝA binding domain; and a second nucleic acid expressing a fused Myo/Nl-p50 polypeptide/DΝA activation domain; and assaying for an interaction between the test peptide and the Myo/Nl-p50 polypeptide by measuring binding between the DΝA binding domain and the DΝA activation domain, wherein the interaction between the test peptide and the Myo/Nl -p50 polypeptide indicates the test peptide is the active compound. In a specific embodiment, the DΝA binding domain and the DΝA activation domain are LexA. In a specific embodiment, the DΝA binding domain and the DΝA activation domain are Gal. In an additional embodiment of the present invention, there is a pharmaceutical composition for treating cardiovascular disease comprising an active compound obtained by screening a test compound as in a method of screening for an active compound for anti-aging treatment, comprising the steps of introducing into a cell a first nucleic acid expressing a fused test peptide/DNA binding domain; and a second nucleic acid expressing a fused Myo/Vl-p50 polypeptide/DNA activation domain; and assaying for an interaction between the test peptide and the Myo/Nl -p50 polypeptide by measuring binding between the DΝA binding domain and the DΝA activation domain, wherein the interaction between the test peptide and the MyoNl-p50 polypeptide indicates the test peptide is the active compound; and a physiologically acceptable carrier.

In an additional embodiment of the present invention, there is a pharmaceutical composition for anti-aging treatment comprising an active compound obtained by screening a test compound as in a method of screening for an active compound for anti-aging treatment, comprising the steps of introducing into a cell a first nucleic acid expressing a fused test peptide/DΝA binding domain; and a second nucleic acid expressing a fused Myo/Nl -p50 polypeptide/DΝA activation domain; and assaying for an interaction between the test peptide and the Myo/Nl -p50 polypeptide by measuring binding between the DΝA binding domain and the DΝA activation domain, wherein the interaction between the test peptide and the Myo/Nl-p50 polypeptide indicates the test peptide is the active compound; and a physiologically acceptable carrier.

In an additional embodiment of the present invention, there is a method of identifying an active compound for the treatment of cardiovascular disease, comprising the steps of forming a Myo/Nl -ΝFKB p50 complex in a cell, wherein the complex formation generates a detectable signal; adding a test compound to the complex in the cell under conditions wherein the compound interacts with the complex; and measuring a change in the visualizable signal, wherein the change indicates the test compound is the active compound.

In another embodiment of the present invention there is a method of identifying an active compound for anti-aging treatment, comprising the steps of forming a nucleic acid sequence-ΝFκB p50 complex in a cell, wherein the complex formation generates a detectable signal; adding a test compound to the complex in the cell under conditions wherein the compound interacts with the complex; and measuring a change in the detectable signal, wherein the change indicates the test compound is the active compound. In a specific embodiment, the detectable signal is selected from the group consisting of light, fluorescence, radioactivity, and color. In another specific embodiment, the detectable signal is fluorescence. In a specific embodiment, the test compound is selected from the group consisting of peptides, nucleic acids, carbohydrates, sugars, and combinations thereof.

In an embodiment of the present invention, there is a pharmaceutical composition for treating cardiovascular disease comprising an active compound obtained by screening a test compound as in a method of identifying an active compound for the treatment of cardiovascular disease, comprising the steps of forming a Myo/Vl-NFκB p50 complex in a cell, wherein the complex formation generates a detectable signal; adding a test compound to the complex in the cell under conditions wherein the compound interacts with the complex; and measuring a change in the visualizable signal, wherein the change indicates the test compound is the active compound; and a physiologically acceptable carrier.

In an additional embodiment of the present invention there is a method of reducing NFKB p50 homodimer levels in a cell of a mammal, comprising the step of introducing into the cell therapeutically effective levels of a NFKB repressor sequence under conditions wherein the repressor sequence binds the NFKB p50 homodimer. In a specific embodiment, the NFKB repressor sequence is SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:l l, SEQ ID NO:15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:120, SEQ ID NO:121, SEQ ID NO:122, SEQ ID NO:123, SEQ ID NO:124, SEQ ID NO:131, SEQ ID NO:132, SEQ ID NO:133, SEQ ID NO:134, SEQ ID NO:135, SEQ ID NO: 136, SEQ ID NO:140, SEQ ID NO-141, SEQ ID NO:142, SEQ ID NO:143, SEQ ID NO:144, SEQ ID NO:145, SEQ ID NO: 152, SEQ ID NO: 153, SEQ ID NO: 154, SEQ ID NO: 155, SEQ ID NO: 156, SEQ ID NO:162, SEQ ID NO:163, SEQ ID NO:164, SEQ ID NO:168, SEQ ID NO:169, SEQ ID NO: 170, SEQ ID NO: 171, SEQ ID NO: 172, SEQ ID NO: 173, SEQ ID NO: 174, SEQ ID NO: 175, SEQ ID NO:254, SEQ ID NO:255, SEQ ID NO:256, SEQ ID NO:257, SEQ ID NO:258, SEQ ID NO:259, SEQ ID NO:260, SEQ ID NO:269, SEQ ID NO:270, SEQ ID NO-271, SEQ ID NO:272, SEQ ID NO:273, SEQ ID NO:274, SEQ ID NO:279, SEQ ID NO:280, SEQ ID NO-281, SEQ ID NO:282, SEQ ID NO:283, SEQ ID NO:284, SEQ ID NO:285, SEQ ID NO.291, SEQ ID NO:292, SEQ ID NO:293, SEQ ID NO:294, SEQ ID NO:295, SEQ ID NO:296, SEQ ID NO:297, SEQ ID NO:298, SEQ ID NO:305, SEQ ID NO:306, SEQ ID NO:307, SEQ ID NO:308, SEQ ID NO:309, SEQ ID NO:310, SEQ ID NO:311, SEQ ID NO:312, SEQ ID NO:313, SEQ ID NO:314, SEQ ID NO:315, SEQ ID NO:316, SEQ ID NO:317, SEQ ID NO:318, SEQ ID NO:319, SEQ ID NO:320, SEQ ID NO:321, SEQ ID NO:325, SEQ ID NO:326, SEQ ID NO:327, SEQ ID NO:328, SEQ ID NO:329, SEQ ID NO:330, SEQ ID NO-331, SEQ ID NO:332, SEQ ID NO:333, SEQ ID NO:334, SEQ ID NO:335, SEQ ID NO:336, SEQ ID NO:337, SEQ ID NO:338, SEQ ID NO:339, SEQ ID NO:340, SEQ ID NO-341, SEQ ID NO:342, SEQ ID NO:343, SEQ ID NO:344, SEQ ID NO:345, SEQ ID NO:346, SEQ ID NO:347, SEQ ID NO:348, SEQ ID NO:349, SEQ ID NO:350, SEQ ID NO-351, SEQ ID NO:352, SEQ ID NO:353, SEQ ID NO:354, SEQ ID NO:355, SEQ ID NO:356, SEQ ID NO:357, SEQ ID NO:358, SEQ ID NO:359, SEQ ID NO:360, SEQ ID NO.361, SEQ ID NO:362, SEQ ID NO:363, SEQ ID NO:364, SEQ ID NO:365, SEQ ID NO:366, SEQ ID NO:367, SEQ ID NO:368, SEQ ID NO:369, SEQ ID NO:370, SEQ ID NO-371, SEQ ID NO:372, SEQ ID NO:373, SEQ ID NO:374, SEQ ID NO:375, SEQ ID NO:376, SEQ ID NO:377, SEQ ID NO:378, SEQ ID NO:379, SEQ ID NO:380, SEQ ID NO-381, SEQ ID NO:382, SEQ ID NO:383, SEQ ID NO:384, SEQ ID NO:385, SEQ ID NO:386, SEQ ID NO:387, SEQ ID NO:388, SEQ ID NO:389, SEQ ID NO:390, SEQ ID NO:391, SEQ ID NO:392, SEQ ID NO:393, SEQ ID NO:394, SEQ ID NO:395, SEQ ID NO:396, SEQ ID NO:397, SEQ ID NO:398, SEQ ID NO:399, SEQ ID NO:400, SEQ ID NO-401, SEQ ID NO:402, SEQ ID NO:403, SEQ ID NO:404, SEQ ID NO:405, SEQ ID NO:406, SEQ ID NO:407, SEQ ID NO:408, SEQ ID NO:409, SEQ ID NO:410, SEQ ID NO:411, SEQ ID NO:412, SEQ ID NO:413, SEQ ID NO:414, SEQ ID NO:415, SEQ ID NO:416, SEQ ID NO:417, SEQ ID NO:418, SEQ ID NO:419, SEQ ID NO:420, SEQ ID NO:421, SEQ ID NO:422, SEQ ID NO:423, SEQ ID NO:424, SEQ ID NO:425, SEQ ID NO:426, SEQ ID NO:427, SEQ ID NO:428, SEQ ID NO:429, SEQ ID NO:430, SEQ ID NO:431, SEQ ID NO:78, or SEQ ID NO:80. In another specific embodiment, the NFKB repressor sequence is a double-stranded oligonucleotide. In an additional specific embodiment, the NFKB repressor sequence is a peptide nucleic acid.

In an additional embodiment of the present invention there is a method of inhibiting formation of NFKB p50 homodimers in a cell of a mammal, comprising the step of introducing into the animal therapeutically effective levels of a dominant negative mutant sequence of a NFKB p50 subunit, wherein the NFKB dominant negative p50 is selected from the group consisting of SEQ ID NO:238, SEQ ID NO:239, SEQ ID NO:240, SEQ ID NO.241, SEQ ID NO:242, SEQ ID NO:243, SEQ ID NO:244, SEQ ID NO:245, SEQ ID NO:246, SEQ ID NO:247, SEQ ID NO:248, SEQ ID NO:249, SEQ ID NO:250, SEQ ID NO.251, SEQ ID NO:252, and SEQ ID NO:253, and wherein the NFKB p50 homodimers are inhibited from forming following the introduction.

In an additional embodiment of the present invention there is a method of reducing formation of NFKB p50 homodimers in a cell of a mammal, comprising the step of introducing into the cell therapeutically effective levels of a dominant negative mutant sequence of a NFKB p50 subunit, wherein the dominant negative NFKB p50 is selected from the group consisting of SEQ ID NO:238, SEQ ID NO:239, SEQ ID NO:240, SEQ ID NO.241, SEQ ID NO:242, SEQ ID NO:243, SEQ ID NO:244, SEQ ID NO:245, SEQ ID

NO:246, SEQ ID NO:247, SEQ ID NO:248, SEQ ID NO:249, SEQ ID NO:250, SEQ ID NO.251, SEQ ID NO:252, and SEQ ID NO:253, and wherein the formation of NFKB p50 homodimers is reduced following the introduction. In a specific embodiment, the NFKB p50 subunit further comprises a protein transduction domain.

In an additional embodiment of the present invention there is a method of treating cardiovascular disease in a mammal, comprising the step of introducing into the mammal therapeutically effective levels of a nucleic acid sequence which encodes a dominant negative mutant sequence of a NFKB p50 subunit, wherein the dominant negative NFKB p50 subunit is selected from the group consisting of SEQ ID NO:238, SEQ ID NO:239, SEQ ID NO:240, SEQ ID NO.241, SEQ ID NO:242, SEQ ID NO:243, SEQ ID NO:244, SEQ ID NO:245, SEQ ID NO:246, SEQ ID NO:247, SEQ ID NO:248, SEQ ID NO:249, SEQ ID NO:250, SEQ ID NO.251, SEQ ID NO:252, and SEQ ID NO:253, and wherein the cardiovascular disease is improved following the introduction.

In another embodiment of the present invention there is a method of reducing formation of NFKB p50 homodimers in a cell of a mammal, comprising the step of introducing into the cell therapeutically effective levels of a nucleic acid sequence encoding a dominant negative mutant sequence of a NFKB p50 subunit, wherein the p50 is selected from the group consisting of SEQ ID NO:238, SEQ ID NO:239, SEQ ID NO:240, SEQ ID NO.241, SEQ ID NO:242, SEQ ID NO:243, SEQ ID NO:244, SEQ ID NO:245, SEQ ID NO:246, SEQ ID NO:247, SEQ ID NO:248, SEQ ID NO:249, SEQ ID NO:250, SEQ ID NO.251, SEQ ID NO:252, and SEQ ID NO:253, and wherein the formation of NFKB p50 dimers is reduced following the introduction. In a specific embodiment, the nucleic acid is introduced in a vector. In another specific embodiment, the vector is selected from the group consisting of an adenoviral vector, an adeno-associated viral vector, a retroviral vector, a plasmid, a liposome, a lipid, or a combination thereof. In a further specific embodiment, the nucleic acid is introduced into a myocardium cell.

In an additional embodiment of the present invention there is a method of reducing or preventing inhibition of expression of an adrenergic system signaling nucleic acid sequence in a cell of a mammal, comprising the step of reducing the levels of NFKB p50 homodimers in the cell, wherein the reduced levels leads to the inhibition of expression. In a specific embodiment, the adrenergic system signaling nucleic acid sequence is selected from the group consisting of βl-adrenergic receptor, β2-adrenergic receptor, β3-adrenergic receptor, β-adrenergic receptor kinase 1 (β-ARKl), β-adrenergic receptor kinase 2 (β-ARK2), Gi-α-1,

Gi-α-1, Gi-α-1, Gsα, and Gsα -XL. In specific embodiment, the NFKB p50 homodimer levels are reduced by introducing into the cell a dominant negative form of a Myo/Vl polypeptide. In another specific embodiment, the polypeptide is selected from the group consisting of SEQ ID NO:l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5,

SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO: 10. In a further specific embodiment, the p50 homodimer levels are reduced by introducing into the cell therapeutically effective levels of a dominant negative mutant sequence of NFKB p50. In an additional specific embodiment, the dominant negative mutant sequence of NFKB p50 is selected from the group consisting of SEQ ID NO:238, SEQ ID NO:239, SEQ ID NO:240,

SEQ ID NO:241, SEQ ID NO:242, SEQ ID NO:243, SEQ ID NO:244, SEQ ID NO:245,

SEQ ID NO:246, SEQ ID NO:247, SEQ ID NO:248, SEQ ID NO:249, SEQ ID NO:250,

SEQ ID NO:251, SEQ ID NO:252, and SEQ ID NO:253. In another specific embodiment, the NFKB p50 homodimer levels are reduced by inhibiting formation of a Myo/Nl-p50 complex. In a further specific embodiment, the ΝFKB p50 homodimer levels are reduced by introducing into the cell antisense sequence of the ΝFKB p50. In another specific embodiment, the ΝFKB p50 homodimer levels are reduced by introducing into the cell antisense sequence of the Myo/Vl. In another embodiment of the present invention there is a method of treating cardiovascular disease in a mammal, comprising the step of reducing migration of NFKB p50 homodimers from cytoplasm to nucleus in a cell of the mammal.

In another embodiment of the present invention there is a method of reducing NFKB p50 homodimers in a cell of a mammal, comprising the step of reducing migration of NFKB p50 homodimers from cytoplasm to nucleus of the cell.

In an additional embodiment of the present invention there is a method of reducing Myo/NI-p50 complex levels in a cell of a mammal comprising the step of introducing a ETS factor into the cell, wherein the introduction results in reduction of the complex levels. In a specific embodiment, the ETS factor is introduced as a polypeptide, and wherein the ETS factor polypeptide further comprises a protein transduction domain. In another specific embodiment, the ETS factor is introduced as a nucleic acid sequence. In an additional specific embodiment, the ETS factor nucleic acid sequence is introduced in a vector. In another specific embodiment, the ETS factor is selected from the group consisting of GABPalpha ΝRF2/E4TFl, ER81/ETV1, ERM, ELF/NERF2, ELF4, ELK1, ELK3/SAP2/ERP/NET, and ETS2.

In another embodiment of the present invention there is a method of treating cardiovascular disease in a mammal, comprising the step of reducing Myo/Vl levels in the mammal, wherein the cardiovascular disease is improved following reduction of the Myo/Nl levels. In a specific embodiment, the reducing step comprises introducing into a cell in the mammal an antisense peptide nucleic acid of the Myo/Nl.

In another embodiment of the present invention there is a method of reducing Myo/Vl levels in a cell of a mammal, comprising the step of introducing into the cell an antisense peptide nucleic acid of the Myo/Vl.

In another embodiment of the present invention there is a method of treating cardiovascular disease in a mammal, comprising the step of reducing ΝFKB p50 subunit levels in the mammal, wherein the cardiovascular disease is improved following reduction of the p50.subunit levels. In a specific embodiment, the reducing step comprises introducing into a cell in the mammal an antisense peptide nucleic acid of the NFKB p50 subunit.

In another embodiment of the present invention there is a method of reducing NFKB p50 subunit levels in a cell of a mammal, comprising the step of introducing into the cell an antisense PNA of the NFKB p50 subunit.

In an additional embodiment of the present invention there is a method of treating cardiovascular disease in a mammal comprising the step of administering therapeutically effective levels of antisense sequence of Myo/Vl to the mammal.

In another embodiment of the present invention there is a method of treating cardiovascular disease in a mammal comprising the step of administering therapeutically effective levels of antisense sequence of NFKB p50 to the mammal.

In a specific embodiment, cardiovascular disease is selected from the group consisting of myocardial infarction, ischemia/reperfusion injury, heart transplantation, and cardiac hypertrophy. In another specific embodiment, cardiovascular disease is cardiac hypertrophy. In another embodiment of the present invention there is a method of treating a NFKB- related disease, comprising the step of introducing the active compound, wherein the NFKB- related disease is improved following the introduction.

In a specific embodiment, a NFκB-related disease is selected from the group consisting of sepsis, inflammatory bowel disease, and Incontinentia Pigmenti.

In another embodiment of the present invention there is a method of generating a nucleic acid aptamer for binding Myo/Vl polypeptide comprising the steps of synthesizing a plurality of single-stranded nucleic acid molecules, each having a 5' end and a 3' end, wherein the 5 ' end and the 3 ' end comprise known polymerase chain reaction primer-binding sequences; presenting the plurality of single-stranded nucleic acid molecules to the Myo/Vl polypeptide; and measuring binding of a single- stranded nucleic acid molecule to the Myo/Vl polypeptide, wherein when the single-stranded nucleic acid molecule binds to the Myo/Vl polypeptide, the single-stranded nucleic acid molecule is the aptamer. In a specific embodiment, the nucleic acid molecule is approximately 30-50 nucleotides in length. In another specific embodiment, the nucleic acid molecule is approximately 40 nucleotides in length.

In another embodiment of the present invention there is a method of generating a peptide aptamer for binding MyoNl polypeptide comprising the steps of synthesizing a plurality of peptide molecules; presenting the plurality of peptide molecules to the Myo/Vl polypeptide; and measuring binding of a peptide molecule to the Myo/Vl polypeptide, wherein when the peptide molecule binds to the Myo/Vl polypeptide, the peptide molecule is the aptamer.

In another embodiment of the present invention there is a method of generating a nucleic acid aptamer for binding ΝFKB p50 polypeptide comprising the steps of synthesizing a plurality of single-stranded nucleic acid molecules, each single-stranded nucleic acid molecule comprising a 5 ' polymerase chain reaction primer-binding sequence, a test nucleic acid sequence, and a 3 ' polymerase chain reaction primer-binding sequence; presenting said plurality of single-stranded nucleic acid molecules to said NFKB p50 polypeptide; and measuring binding of a single-stranded nucleic acid molecule to said NFKB p50 polypeptide, wherein when said test nucleic acid sequence binds to said NFKB p50 polypeptide, said single-stranded nucleic acid molecule is said aptamer. In a specific embodiment, the nucleic acid molecule is approximately 30-50 nucleotides in length. In another specific embodiment, the nucleic acid molecule is approximately 40 nucleotides in length.

In another embodiment of the present invention there is a method of generating a peptide aptamer for binding NFKB p50 polypeptide comprising the steps of synthesizing a plurality of peptide molecules; presenting said plurality of peptide molecules to said NFKB p50 polypeptide; and measuring binding of a peptide molecule to said NFKB p50 polypeptide, wherein when said peptide molecule binds to said NFKB p50 polypeptide, said peptide molecule is said aptamer.

In another embodiment of the present invention there is a method of treating cardiovascular disease in a mammal, comprising the step of inhibiting interaction of Myo/Nl polypeptide with an ETS factor. In a specific embodiment, there is an ETS factor is selected from the group consisting of GABPalpha/ΝRF2/E4TFl, ER81 ETV1, ERM, ELF/NERF2, ELF4, ELK1, ELK3/SAP2/ERP/NET, and ETS2. In a specific embodiment, the ETS factor is ER81/ETVl.

In another embodiment of the present invention there is a method of inhibiting fetal carnitine palmitoyltransferase-I (CPT1) nucleic acid expression in a mammal comprising the step of inhibiting interaction of Myo/Vl polypeptide with an ETS factor. In a specific embodiment, the ETS factor is selected from the group consisting of GABPalpha/NRF2/E4TFl, ER81/ETV1, ERM, ELF/NERF2, ELF4, ELK1, ELK3/SAP2/ERP/NET, and ETS2. In another specific embodiment, the ETS factor is ER81/ETV1.

In another embodiment of the present invention there is a method of inhibiting fetal 6- phosphofiucto-2-kinase/fructose-2,6-bisphosphatase (PFK) nucleic acid expression in a mammal comprising the step of inhibiting interaction of Myo/Vl polypeptide with an ETS factor. In a specific embodiment, the factor is selected from the group consisting of GABPalpha/NRF2/E4TFl, ER81/ETV1, ERM, ELF/NERF2, ELF4, ELK1, ELK3/SAP2/ERP/NET, and ETS2. In a specific embodiment, the ETS factor is ER81/ETV1.

II. Myo/Vl Promotes Adrenergic Signaling Desensitization by Generating Transcriptionally Repressive p50-p50 NFKB Homodimers

Withdrawal from adrenergic stimulation is one of the hallmark events during heart failure, and among these the most prominent event is βl -adrenergic receptor downregulation (Bristow et al, 1982). Moreover, uncoupling of both βl and β2 receptors occurs during heart failure, causing desensitization to adrenergic signaling (Bristow et al, 1982; Bristow et al, 1993; Bristow et al, 1993; Gilbert et al, 1993). It is well known that downregulation of βl receptor occurs at the transcriptional level, since decreased levels of mRNA were observed in both failing human hearts (Bristow et al, 1993) and in experimental heart failure animal model studies (Bristow et al, 1993). Also, one of the proposed mechanisms for uncoupling of βl and β2 adrenergic receptors from the functional catecholamine response is upregulation of β-ARKl and β-ARK2 kinase levels as well as their activities. The upregulation of these kinases in turn activates inhibitory Giαl proteins thus causing desensitization. The data regarding MyoNl 's interactions with ΝFKB as well as published reports indicating catecholamines influence on ΝFKB begs investigation regarding whether genes involved in adrenergic signaling system are controlled by NFKB. The nucleotide sequences of the promoters of human genes involved in β-adrenergic signaling system were analyzed for both NFKB enhancer and repressor sequences for various dimers of NFKB proteins. For this purpose, TFBIND (software for searching transcription factor binding sites) linked with TRANSFAC-R3.4 database, a website known in the art (this tool uses weight matrix in transcription factor database TRANSFAC R.3.4 developed by Dr. Wingender et al, and the cut-offs originally estimated by Tsunoda and Takagi (1999)) was used to identify the putative NFKB enhancer sites (high affinity binding sites for p50-p65 heterodimers) and p50-p50 specific NFKB repressor (high affinity binding sites towards p50-p50 homodimers) sites. The result of this analysis is shown in Table 1.

TABLE 1

Overall analysis of all of the human promoteres of the adrenergic system strongly indicates that NFKB is a major player in regulating their gene expression. The major finding of this analysis is that while all of the genes which are upregulated during adrenergic uncoupling (β-ARKl, β-ARK2 kinases and Giαl,2,3) possess very strong NFKB enhancer sequences in their promoters, the βl -Adrenergic receptor and Gsα gene promoters possess none. However, in contrast to other adrenergic system genes, numerous p50-p50 homodimer-specific NFKB repressor sites were observed in βl -Adrenergic receptor and Gsα gene promoter. In fact, very strong repressor sites were observed in Gsα gene promoter (see Table 1). Combined analysis of the observation of p50-p50 homodimer abundance in the transgenic mouse model of heart failure (FIG. 20) and in human heart (FIG. 27, 28A and 28B), and the finding of Myo/Vl enhancing p50-p50 homodimer formation, both provided elsewhere herein, indicates MyoNl regulates adrenergic signaling system during heart failure through ΝFKB. In a specific embodiment, during heart failure Myo/Vl, because of abundant activation, stimulates the formation of p50-p50 homodimers (or rearranging the ΝFKB dimers) in the nucleus either by splitting the heterodimers in the nucleus and/or by facilitating the migration of p50-p50 homodimers from the cytoplasm to the nucleus. Continued nuclear accumulation of p50-p50 homodimers eventually results in binding to its high affinity ΝFKB repressor sites in target genes. In addition, the p50 homodimers could attentuate or reduce the activity of transcription occurring through ΝFKB enhancer sites. Among the targets, the βl -adrenergic receptor gene is probably one of the major targets for p50-p50 homodimers and thus causes decreased transcript levels from its basal level of transcription.

Receptor desensitization or uncoupling is a common protective mechanism employed by the cells during exposure to stress or other extracellular hormonal signals. Receptors for androgen, adenosine, interleukin-1, TΝFα, thrombin, CD40 ligand, endotoxin (LPS) and catecholamines all undergo desensitization when exposed to their respective ligands (Bretschneider et al, 1999; Song et al, 1995; Karmann et al, 1996; Supakar et al, 1995; McKean et al, 1994; Zuckerman et al, 1992; Haas et al, 1990). For all of these events except adrenergic system, ΝFKB has been proposed to cause desensitization and, among these, transcriptional repression mediated by abundant p50-p50 homodimers is the only reason desensitization occurs for androgen receptor desensitization (Song et al, 1995) and LPS tolerance (Kastenbauer et al, 1999; Baer et al, 1998; Ziegler-Heitbrock et al, 1997; Ziegler-Heitbrock et al, 1995; Ziegler-Heitbrock et al, 1994). Therefore, transcriptional repression mediated by p50-p50 homodimers of ΝFKB is a global mechanism for receptor desensitization by downregulating receptors or its ligands and its response. In a specific embodiment of the present invention, Myo/Vl mediates this global mechanism by converting transcriptionally active heterodimers to repressive homodimers favoring desensitization.

Published studies show that androgen receptor gene promoter (Song et al, 1995) contains a NFKB enhancer site where heterodimers preferentially bind and a NFKB repressor site where repressive p50-p50 homodimers preferentially bind. Furthermore, there are abundant p50- p50 homodimers in failing transgenic mouse hearts (FIG. 20) and in human hearts (FIG. 27, 28A, 28B) as well as exclusively p50-p50 homodimer-specific putative NFKB repressor sites in the promoter of human βl-adrenergic receptor gene and in Gsα (Table 1). Since no gene expression studies were reported for the human βl-adrenergic receptor gene, the role of NFKB in mediating this gene's expression is still unknown. However, indirect evidence indicates that TNFα (a potent activator of NFKB) downregulates βl-adrenergic receptor in 3T3-F442A adipocytes, indirectly supporting the role of Myo/Vl -NFKB in heart failure (Hadri et al, 1997).

The observation of abundant p50-p50 homodimers in failing transgenic mouse hearts and the finding that Myo/Vl is mediating this homodimer generation indicates that transcriptional repression mediated by abundant p50-p50 homodimers is a global mechanism for not only adrenergic desensitization but also for several other receptor mediated desensitization events. Adrenergic desensitization, in a specific embodiment, occurs by downregulating gene expression.

Thus, during cardiac hypertrophy and heart failure, two major events occur at the transcriptional level (FIGS. 4 and 5). First, there is a global switch to fetal gene expression for energy-generating (CKs, fPFK and fCPTl) as well as for energy-utilizing (ATPases- SERCA, Na⁺K⁺) pathways in the myocardium. MyoNl through its interaction with ETS factors in the nucleus causes this event. Second, during its transition to heart failure, adrenergic desensitization occurs through downregulation of adrenergic receptors and uncoupling of the signaling pathway. In a specific embodiment of the present invention, this event is caused by the MyoNl -mediated accumulation of p50-p50 homodimers in the myocyte cell nuclei resulting in global increase in ΝFKB repression. Since ETS is a resident nuclear protein and ΝFKB is a resident cytoplasmic protein, the Myo/Vl 's function on ETS is a nuclear event and its ΝFKB homodimer generation from p50 subunits is a cytoplasmic event in a normally functioning myocyte. However, in a failing heart where myocytes are already undergoing hypertrophy, Myo/Vl is present at increased levels in the nucleus to perform its ETS functions, in a specific embodiment. During this time, when ΝFKB is activated from the cytoplasm due to sustained catecholamine or cytokine signaling, Myo/Vl which is already present in the nucleus splits the transcriptionally active ΝFKB heterodimers into repressible p50-p50 homodimers, thus tilting the balance more towards ΝFKB repression. Thus, in an object of the present invention, these processes caused by Myo/Vl on ETS and NFKB factors are responsible for the altered myocardial gene expression during cardiac hypertrophy and heart failure.

Myo/Vl differentially interacts with both ETS and NFKB. In a specific embodiment of the present invention, it is shown that the disruption of regulation by Myo/Vl of these two transcription factors causes altered global myocardial gene expression during cardiac hypertrophy and heart failure (FIG. 6). In specific embodiments of the present invention, it is shown that Myo/Vl interacts with ETS factors to regulate fetal gene expression and interacts with NFKB to regulate adrenergic signaling system in adult myocardium.

The present invention is directed to methods and compositions related to novel therapeutics for heart failure based on Myo/Vl-p50 interactions. These novel therapeutics are targeted to influence the expression of beta adrenergic system genes at the transcriptional level. Since all myocardial signaling pathways (alpha-beta- adrenergic signaling, angiotensin- II, endothelin-I, cytokines, etc.) eventually have to converge on regulating NFKB transcription factors (specifically p50-p50 homodimers) controlling the adrenergic system, therapeutics developed by this approach are preferred. In simple terms, the p50-p50 homodimers are detrimental for the failing human heart. Thus, preventing the formation of p50-p50 homodimers or reducing the levels of these dimers in the failing human heart restores the beta-1 adrenergic response in the myocardium and the heart contracts better (FIG. 1, FIG. 8, FIG. 9 and FIG. 10).

FIG. 9 in particular illustrates that while NFKB regulates the desensitization and resensitization of β-adrenergic signaling through its p50-p50 homodimers and p50-p65 heterodimers as a normal cytoprotective mechanism, it is the nuclear Myo/Vl which tilts the balance towards homodimers and thus results in excessive accumulation of p50-p50 homodimers. These homodimers bind to high affinity NFkB repressor sites (Table 1), and this causes permanent downregulation of β 1 -adrenergic receptors and Gs-alpha protein. This results in the failing myocardium being unable to couple back the normal β 1 -adrenergic response.

The in vitro experiments presented in the Examples below indicate that Myo/Nl protein is responsible for this p50-p50 homodimer generation, and thus, therapeutics are developed utilizing this Myo/Vl-p50 interaction.

Although in a specific embodiment the methods and compounds described herein are directed to cardiac hypertrophy, the Myo/Nl- and p50-specific therapeutic drugs are useful for a variety of cardiovascular diseases including myocardial infarction, ischemia/reperfusion injury and during heart transplantation. In addition, the drugs developed by this approach are useful against NFκB-related diseases like sepsis, inflammatory bowel disease, and Incontinentia Pigmenti. Because receptor desensitization occurs in various organs and is a major event in normal human aging process, the therapeutics developed by this novel approach are useful as "anti-aging" drugs.

A skilled artisan is aware that a nucleic acid or protein (or amino acid sequence or peptide) of MyoNl is utilized in the present invention, and further the methods presented herein are not limited to using the human Myo/Vl. U.S. Patent No. 6,153,423 is directed to polynucleotide sequences of human myotrophin and is incorporated by reference herein. A skilled artisan is aware of routine methods to search publicly available databases, such as the National Center for Biotechnology Information's GenBank database, well known in the art, or commercially available databases, such as from Celera Genomics (Rockville, MD), to obtain myotrophin sequences from many organisms. The following sequences are within the scope of the present invention, and GenBank Accession numbers are included: A37902 (SEQ ID NO:73); V1P_CHICK (SEQ ID NO:74); V1P MOUSE (SEQ ID NO:75); AAC52498 (SEQ ID NO:76). Also included are those sequences described in Anderson et al, 1999, incorporated in its entirety by reference herein: human Myo/Vl (SEQ ID NO:77; AAE54776) and rat Myo/Vl (SEQ ID NO:76). Also within the scope of the present invention are amino acid sequences from the following nucleotide sequences: rat myotrophin (U21661; SEQ ID NO:79, which corresponds to AAC52498 amino acid sequence; SEQ ID NO:76); V-l protein from rat (D26179; SEQ ID NO:81, which corresponds to BAA05167 amino acid sequence; SEQ ID NO:82); mouse (U20290; SEQ ID NO:83, which corresponds to amino acid sequence AAA86719; SEQ ID NO:84) and chicken (D26326; SEQ ID NO:85, which corresponds to amino acid sequence BAA05379; SEQ ID NO:86).

Also within the scope of the following invention are the following human nucleic acid sequences: BE676348 (SEQ ID NO:203), AW268717 (SEQ ID NO:204); AW167692 (SEQ ID NO:205); AW082671 (SEQ ID NO:206); AW082193 (SEQ ID NO:207); AW081041 (SEQ ID NO:208); AW024538 (SEQ ID NO:209); AI829571 (SEQ ID NO:210); AI818116 (SEQ ID NO:211); AI694841 (SEQ ID NO:212); AI651321 (SEQ ID NO:213); AI362774 (SEQ ID NO:214); AI282058 (SEQ ID NO:215); AI291390 (SEQ ID NO:216); AI202758 (SEQ ID NO:217); AI141229 (SEQ ID NO:218); AI093827 (SEQ ID NO:219); AA991413 (SEQ ID NO:220); AA883955 (SEQ ID NO:221); AA826286 (SEQ ID NO:222); AA743780 (SEQ ID NO:223); AA723258 (SEQ ID NO:224); AA722709 (SEQ ID NO:225); AA622739 (SEQ ID NO:226); AA521352 (SEQ ID NO:227); AA521331 (SEQ ID NO:228); AA279574 (SEQ ID NO:229); AA463690 (SEQ ID NO:230); AA452954 (SEQ ID NO:231); AA452815 (SEQ ID NO:232); AA055475 (SEQ ID NO:233); AX013739 (SEQ ID NO:235).

In vitro gel shift assays (GSA; also known as electrophoretic mobility shift assays) involving Myo/Vl, p50 and p65 proteins designed and developed to study the function of Myo/Vl protein are used as a screening assay for drug discovery. Compounds which interfere with Myo/Vl -p50 interaction are identified using this assay, and in specific embodiments some compounds inhibit and/or prevent the formation of p50-p50 homodimers. Thus, the compounds identified by this assay are therapeutics for heart failure.

Dominant-negative (DN) p50 mutants in a specific embodiment are utilized as peptide drugs for heart failure. In specific embodiments, these mutants inhibit or reduce the formation of p50-p50 homodimers in vivo. In other embodiments, these mutants also comprise a protein- transducing domain (PTD) to either N-terminus or carboxyl terminus of the DN-p50 protein to facilitate the migration of the protein inside the cell (Schwarze et al, 1999). In additional specific embodiments, these DN-p50 mutants are delivered in vivo to the failing human myocardium through gene therapy approaches, such as by adenovirus.

In a specific embodiment, estimation of the levels of p50-p50 homodimers in a myocardial biopsy sample are used as a diagnostic tool for heart failure. In another specific embodiment, these diagnostics are used for custom designed therapeutics for individual patients, especially for choosing between beta agonist or antagonist therapy. In vitro GSA involving p50 proteins designed and developed by methods provided herein are used as a diagnostic tool.

In another embodiment, factors which interact with Myo/Vl are used as a friendly decoy (or a magnet) to wean Myo/Vl interacting from p50, such as high affinity ER81 or a ETS factor. In a related embodiment, MyoNl -ER81 interaction is a target, such as by increasing the interaction.

In specific embodiments of the present invention, there are methods for therapy against cardiovascular disease and aging, which utilize antisense gene therapy, particularly with Myo/Vl and/or p50 antisense nucleic acid sequences. Alternatively, antisense against B-ARK1, B-ARK2, Glαl, Glα2, or Glα3, such as with nucleic acids or PΝAs may be used as anti-cardiovascular disease compounds. A skilled artisan is aware of methods well known in the art (for examples, see Raizada et al, 2000 and Phillips et al, 2000). In a specific embodiment, small molecule inhibitor is designed for a peptide, such as Myo/Nl or ΝFkB p50. For example, a cell permeable fatty acid moiety, such as (cpm)-1285 is chemically attached to a peptide and demonstrates inhibition of the peptide activity (Wang et al, 2000a; Wang et al., 2000b). In another embodiment, a protein transduction domain (Schwarze et al., 1999) is attached to a protein, polypeptide or peptide to facilitate in vivo protein transduction. III. Transcription Factors and Nuclear Binding Sites

Transcription factors are regulatory proteins that bind to a specific DNA sequence (e.g., promoters and enhancers) and regulate transcription of an encoding DNA region. Typically, a transcription factor comprises a binding domain that binds to DNA (a DNA- binding domain) and a regulatory domain that controls transcription. The regulatory domain is considered an activation domain if it activates transcription. The regulatory domain is considered a repression domain if it inhibits transcription.

Activation domains and repression domains function as independent, modular components of transcription factors. Activation domains are not typified by a single consensus sequence but instead fall into several discrete classes: for example, acidic domains in GAL4 (Ma, et al. 1987), GCN4 (Hope, et al, 1986), VP16 (Sadowski, et al. 1988), and GATA-1 (Martin, et al. 1990); glutamine-rich stretches in Spl (Courey, et al. 1988) and Oct- 2/OTF2 (Muller-Immergluck, et al. 1990; Gerster, et al. 1990); pro line-rich sequences in CTF/NF-1 (Mermod, et al. 1989); and serine/threonine-rich regions in Pit-l/GH-F-1 (Theill, et al. 1989) all function to activate transcription. The activation domains of fos and jun are rich in both acidic and proline residues (Abate, et al. 1991; Bohmann, et al. 1989); for other activators, like the CCAAT/enhancer-binding protein C/EBP (Friedman, et al. 1990), no evident sequence motif has emerged

A. Identification and Characterization

The transcription factor, including subunits and variants thereof, and proteins which interact with it may be isolated and characterized. Techniques to characterize DNA-protein interactions and to isolate DNA-binding proteins are well known to those of skill in the art. These techniques involve, at one level, preparing cell extracts, e.g., crude preparations or pure preparations, from either the nucleus or cytoplasm and incubating the cell extract with a labeled oligonucleotide duplex containing a nucleotide recognition sequence. Bound oligonucleotide duplexes may then be separated from unbound (i.e., free) duplexes generally on the basis of physical, chemical, or biochemical properties, such as differing mobility and/or molecular weight.

A convenient, rapid, and sensitive method for separating DNA-protein complexes is gel electrophoresis. In a polyacrylamide gel, an oligonucleotide duplex with a bound protein has retarded mobility relative to the unbound duplex (gel-shift). Alternative methods can be used that rely on differing properties of DNA-protein complexes and free DNA, such as binding of the complexes to filters (e.g., nitrocellulose filters), HPLC, other sizing chromatography methods, capillary electrophoresis (Xian et al, 1996) or conjugating either the oligonucleotide duplexes or DNA-binding proteins to a solid substrate (e.g., plastic, silica, glass).

B. Electrophoretic Mobility Shift Assay

The electrophoretic mobility shift assay (EMSA) is a useful tool for identifying protein-DNA interactions that may mediate gene expression, DNA repair, or DNA packaging. The assay can also be used to determine the affinity, abundance, binding constants, and binding specificity of DNA-binding proteins.

In the EMSA method, the duplexes are labeled, usually with a radiolabel (e.g., 32 P), biotin, digoxigenin, fluorescent dyes, or any other molecule that can be detected, mixed with the sample containing DNA-binding proteins and electrophoresed through a gel (see, Ausebel et al, 1994). The gel is usually a low-percentage, low-ionic strength polyacrylamide- bisacrylamide gel. For example, a 4% gel with an acrylamide:bisacrylamide ratio of 19:1 is suitable. However, other buffer systems and percentage gels may be used. For example, a Tris-glycine (high ionic strength) buffer can be used, although if the ionic strength is too high, some protein-DNA interactions may be disrupted. When radiolabeled duplexes are used, following electrophoresis, the gel is dried onto a solid substrate (e.g., Whatman 3MM paper) and autoradiographed. Bands corresponding to protein-DNA complexes may be excised and eluted into buffer.

Duplexes are formed from single-stranded oligonucleotides either by annealing complementary single-stranded oligonucleotides that are chemically synthesized or by enzymatic synthesis. For chemical synthesis, the complementary strand is synthesized, deprotected and optionally purified by techniques well known to those of skill in the art. The two oligonucleotide strands are mixed together in a buffered salt solution (e.g., 1 M NaCI, 100 mM Tris-HCl pH 8.0, 10 mM EDTA) or in a buffered solution containing Mg²⁺ (e.g., 10 mM MgCl₂) and annealed by heating to high temperature and slow cooling to room temperature. For enzymatic synthesis, a primer complementary to the 3' end of the single- stranded oligonucleotides is annealed to the oligonucleotides. Buffer, dNTPs, and a DNA polymerase, such as the large fragment of E. coli DNA polymerase I (Klenow fragment), T4 DNA polymerase, or Taq DNA polymerase, is added and the reaction mixture is incubated at a temperature appropriate for the polymerase. Following synthesis, the enzyme is inactivated by heat or phenol-chloroform extraction, and the oligonucleotide duplexes may be purified by well known methods. Enzymatic synthesis of the complementary strand assures that the recognition sequence contains perfectly matched base pairs.

Typically, nucleotide recognition sequence has a minimum length of 4, 5, or 6 base pairs, which is approximately the length of sequence bound by a DNA-binding protein. Although there is no theoretical upper limit on the length of the recognition sequence, typically the length will not be longer than 15, 20, 25, 30, or 35 bp, and preferably the length is 8, 9, 10, 11, or 12 base pairs. By using one of these preferred lengths, generally only one binding site is present per oligonucleotide duplex, decreasing the chance of selecting oligonucleotide duplexes that contain separate binding sites for two different proteins. This avoids confusion about interaction between proteins separately bound to DNA, but increases the likelihood of obtaining a single optimal site for each protein. In turn, this simplifies the analysis of data and cataloging of DNA-binding sites. At times, it may be preferable to use a recognition sequence that has a random sequence of a length sufficient to bind a DNA- binding protein adjacent to a sequence that has a defined sequence that binds a known DNA- binding protein. In such case, a source of the known DNA-binding protein is provided, as part of or in addition to, the sample of DNA-binding proteins.

Oligonucleotides are generally synthesized as single strands by standard chemistry techniques, including automated synthesis. Many methods have been described for synthesizing oligonucleotides containing a randomized base. For example, a randomized position can be achieved by in-line mixing or using pre-mixed phophoramidite precursors during an automated procedure, (see, Ausubel et al, Current Protocols in Molecular Biology, Greene Publishing, N.Y., 1995) Oligonucleotides are subsequently de-protected and may be purified by precipitation with ethanol, chromatographed using a sizing or reversed-phase column, denaturing polyacrylamide gel electrophoresis, high-pressure liquid chromatography (HPLC), or other suitable method. In addition, within certain preferred embodiments, a functional group, such as biotin, is incoφorated in the oligonucleotide duplex, preferably at the 5' and 3' terminal nucleotide. A biotinylated oligonucleotide may be synthesized using pre-coupled nucleotides. Alternatively, biotin may be conjugated to the oligonucleotide using standard chemical reactions. Because the group facilitates removal of the 5' and 3' sequences, the group should be reactive with an antibody or other molecule that will capture the sequences. Other functional groups, such as fluorescent dyes, digoxigenin, and the like, may be incorporated in the duplexes, and particularly at the 5' or 3' end. In other embodiments, functional groups are incorporated into the oligonucleotide internal sequence.

It is also contemplated in the present invention that the sequence specificity of the protein-DNA interaction is assessed using a competition binding assay. Specificity of the DNA-binding protein for the putative binding site is established by competition experiments using DNA fragments or oligonucleotides containing a binding site for the protein of interest or other unrelated DNA sequences.

Competition mobility shift assay is a variation of a mobility shift assay that distinguishes between specific and nonspecific DNA binding proteins (Carthew et al., 1985; Singh et al, 1986). This assay is used because most protein preparations contain both specific and nonspecific DNA bining proteins. In this assay, a specific competitor, such as the same DNA fragment (unlabeled), and a non-specific competitor are also used as probes in the reaction mixture with the labeled probe. A non-specific inhibitor can be essentially any fragment with an unrelated sequence. Also, it may be desirable to synthesize a non-specific competitor probe by mutating the DNA fragment in the binding site, thus disrupting the function and presumably binding. This assay follows the same procedure as the mobility shift with the addition of competitor probes. Typical amounts of competitor probes are 5x, lOx and 50x molar excess relative to the labeled probe.

Another variation of the mobility shift assay is the use of antibodies to identify proteins present in the protein-DNA complex (Kristie and Roizman, 1986). The use of a specific antibody to the binding reaction can result in several effects. For example, if the protein that forms the complex is recognized by the antibody, the antibody can either block complex formation, or it can form an antibody-protein-DNA ternary complex, which results in a further reduction in the mobility of the protein-DNA complex. This ternary complex which results in a complex migrating slower in the gel is referred to as a supershift. It can also be appreciated that results may differ depending upon whether the antibody is added before or after the protein binds DNA, such as if there are epitopes on the DNA-binding surface of the protein. In specific embodiments of the present invention, supershift assays may be used to further identify the putative DNA-binding protein. Antibodies that may be used in the supershift assay may include crude sera, purified polyclonal antibodies, and monoclonal antibodies. Preparation of antibodies are described elsewhere in the present application. Amounts of the antibodies should be the minimum needed to produce an observable effect. It may also be desirable to include a control antibody reaction since the salts and other proteins in the antibody preparation may nonspecifically affect stability or mobility of the protein- DNA complex.

Also contemplated in the present invention is that the putative DNA-binding protein is one component of a multicomponent assembly. It is known that a sequence-specific DNA- binding protein (A) can act as a platform for the association of other proteins (B and C), which themselves do not bind specific sequences. Thus, it is contemplated that the putative DNA-binding protein of the present invention may be a sequence-specific DNA-binding protein or a non-sequence specific binding protein. To determine if the DNA-binding protein is associated with a complex, a multicomponent mobility shift assay may be used. This assay is another variation of a mobility shift assay. The multicomponent complex is observed as a supershift of the primary DNA-protein complex into a new discrete complex that is dependent upon all of the factors.

A skilled artisan is aware that other relevant methods are known in the art, including footprinting, methylation and interference assays, uv crosslinking of proteins to nucleic acids, and other methods. IN. Myo/Vl Nucleic Acids

C. Nucleic Acids and Uses Thereof

Certain aspects of the present invention concern at least one Myo/Vl nucleic acid. In certain aspects, the at least one Myo/Nl nucleic acid comprises a wild-type or mutant Myo/Nl nucleic acid. In particular aspects, the Myo/Vl nucleic acid encodes for at least one transcribed nucleic acid. In certain aspects, the MyoNl nucleic acid comprises at least one transcribed nucleic acid. In particular aspects, the Myo/Vl nucleic acid encodes at least one Myo/Nl protein, polypeptide or peptide, or biologically functional equivalent thereof. In other aspects, the Myo/Vl nucleic acid comprises at least one nucleic acid segment of SEQ ID ΝO:79, SEQ ID NO:81, SEQ ID NO:83, SEQ ID NO:85 or SEQ ID NO:203 through SEQ ID NO:233, and SEQ ID NO:235, or at least one biologically functional equivalent thereof. The present invention also concerns the isolation or creation of at least one recombinant construct or at least one recombinant host cell through the application of recombinant nucleic acid technology known to those of skill in the art or as described herein. The recombinant construct or host cell comprises at least one Myo/Vl nucleic acid, and expresses at least one Myo/Vl protein, polypeptide or peptide, or at least one biologically functional equivalent thereof.

A nucleic acid may be made by any technique known to one of ordinary skill in the art. Non-limiting examples of synthetic nucleic acid, particularly a synthetic oligonucleotide, include a nucleic acid made by in vitro chemical synthesis using phosphotriester, phosphite or phosphoramidite chemistry and solid phase techniques such as described in EP 266,032, incorporated herein by reference, or via deoxynucleoside H-phosphonate intermediates as described by Froehler et al, 1986, and U.S. Patent Serial No. 5,705,629, each incoφorated herein by reference. A non-limiting example of enzymatically produced nucleic acid include one produced by enzymes in amplification reactions such as PCR™ (see for example, U.S. Patent 4,683,202 and U.S. Patent 4,682,195, each incoφorated herein by reference), or the synthesis of oligonucleotides described in U.S. Patent No. 5,645,897, incoφorated herein by reference. A non-limiting example of a biologically produced nucleic acid includes recombinant nucleic acid production in living cells, such as recombinant DNA vector production in bacteria (see for example, Sambrook et al. 1989, incoφorated herein by reference).

A nucleic acid may be purified on polyacrylamide gels, cesium chloride centrifugation gradients, or by any other means known to one of ordinary skill in the art (see for example, Sambrook et al 1989, incoφorated herein by reference).

The term "nucleic acid" will generally refer to at least one molecule or strand of DNA, RNA or a derivative or mimic thereof, comprising at least one nucleobase, such as, for example, a naturally occurring purine or pyrimidine base found in DNA (e.g. adenine "A," guanine "G," thymine "T" and cytosine "C") or RNA (e.g. A, G, uracil "U" and C). The term "nucleic acid" encompass the terms "oligonucleotide" and "polynucleotide." The term "oligonucleotide" refers to at least one molecule of between about 3 and about 100 nucleobases in length. The term "polynucleotide" refers to at least one molecule of greater than about 100 nucleobases in length. These definitions generally refer to at least one single- stranded molecule, but in specific embodiments will also encompass at least one additional strand that is partially, substantially or fully complementary to the at least one single-stranded molecule. Thus, a nucleic acid may encompass at least one double-stranded molecule or at least one triple-stranded molecule that comprises one or more complementary strand(s) or "complement(s)" of a particular sequence comprising a strand of the molecule. As used herein, a single stranded nucleic acid may be denoted by the prefix "ss", a double stranded nucleic acid by the prefix "ds", and a triple stranded nucleic acid by the prefix "ts."

Thus, the present invention also encompasses Myo/Vl and/or at least one nucleic acid that is complementary to a MyoNl nucleic acid. In particular embodiments the invention encompasses at least one nucleic acid or nucleic acid segment complementary to the sequence set forth in SEQ ID ΝO:79, SEQ ID NO:81, SEQ ID NO:83, SEQ ID NO:85 or SEQ ID NO:203 through SEQ ID NO:233, and SEQ ID NO:235. Nucleic acid(s) that are "complementary" or "complement(s)" are those that are capable of base-pairing according to the standard Watson-Crick, Hoogsteen or reverse Hoogsteen binding complementarity rules. As used herein, the term "complementary" or "complement(s)" also refers to nucleic acid(s) that are substantially complementary, as may be assessed by the same nucleotide comparison set forth above. In certain embodiments, a "substantially complementary" nucleic acid contains at least one sequence in which about 70%, about 75%, about 80%, about 85%, about 90%), about 95%), to about 100%>, and any range therein, of the nucleobase sequence is capable of base-pairing with at least one single or double stranded nucleic acid molecule during hybridization. In certain embodiments, the term "substantially complementary" refers to at least one nucleic acid that may hybridize to at least one nucleic acid strand or duplex in stringent conditions. In certain embodiments, a "partly complementary" nucleic acid comprises at least one sequence that may hybridize in low stringency conditions to at least one single or double stranded nucleic acid, or contains at least one sequence in which less than about 70%> of the nucleobase sequence is capable of base-pairing with at least one single or double stranded nucleic acid molecule during hybridization.

As used herein "stringent condition(s)" or "high stringency" are those that allow hybridization between or within one or more nucleic acid strand(s) containing complementary sequence(s), but precludes hybridization of random sequences. Stringent conditions tolerate little, if any, mismatch between a nucleic acid and a target strand. Such conditions are well known to those of ordinary skill in the art, and are preferred for applications requiring high selectivity. Non-limiting applications include isolating at least one nucleic acid, such as a gene or nucleic acid segment thereof, or detecting at least one specific mRNA transcript or nucleic acid segment thereof, and the like. Stringent conditions may comprise low salt and/or high temperature conditions, such as provided by about 0.02 M to about 0.15 M NaCI at temperatures of about 50°C to about 70°C. It is understood that the temperature and ionic strength of a desired stringency are determined in part by the length of the particular nucleic acid(s), the length and nucleobase content of the target sequence(s), the charge composition of the nucleic acid(s), and to the presence of formamide, tetramethylammonium chloride or other solvent(s) in the hybridization mixture. It is generally appreciated that conditions may be rendered more stringent, such as, for example, the addition of increasing amounts of formamide.

It is also understood that these ranges, compositions and conditions for hybridization are mentioned by way of non-limiting example only, and that the desired stringency for a particular hybridization reaction is often determined empirically by comparison to one or more positive or negative controls. Depending on the application envisioned it is preferred to employ varying conditions of hybridization to achieve varying degrees of selectivity of the nucleic acid(s) towards target sequence(s). In a non-limiting example, identification or isolation of related target nucleic acid(s) that do not hybridize to a nucleic acid under stringent conditions may be achieved by hybridization at low temperature and/or high ionic strength. Such conditions are termed "low stringency" or "low stringency conditions", and non-limiting examples of low stringency include hybridization performed at about 0.15 M to about 0.9 M NaCI at a temperature range of about 20°C to about 50°C. Of course, it is within the skill of one in the art to further modify the low or high stringency conditions to suite a particular application.

One or more nucleic acid(s) may comprise, or be composed entirely of, at least one derivative or mimic of at least one nucleobase, a nucleobase linker moiety and/or backbone moiety that may be present in a naturally occurring nucleic acid. Non-limiting examples of nucleobases include purines and pyrimidines, as well as derivatives and mimics thereof, which generally can form one or more hydrogen bonds ("anneal" or "hybridize") with at least one naturally occurring nucleobase in manner that may substitute for naturally occurring nucleobase pairing (e.g. the hydrogen bonding between A and T, G and C, and A and U).

Nucleobase, nucleoside and nucleotide mimics or derivatives are well known in the art, and have been described in exemplary references such as, for example, Scheit, Nucleotide Analogs (John Wiley, New York, 1980), incoφorated herein by reference. "Purine" and "pyrimidine" nucleobases encompass naturally occurring purine and pyrimidine nucleobases and also derivatives and mimics thereof, including but not limited to, those purines and pyrimidines substituted by one or more of alkyl, caboxyalkyl, amino, hydroxyl, halogen (i.e. fluoro, chloro, bromo, or iodo), thiol, or alkylthiol wherein the alkyl group comprises of from about 1, about 2, about 3, about 4, about 5, to about 6 carbon atoms. Non-limiting examples of purines and pyrimidines include deazapurines, 2,6-diaminopurine, 5-fluorouracil, xanthine, hypoxanthine, 8-bromoguanine, 8-chloroguanine, bromothymine, 8-aminoguanine, 8- hydroxyguanine, 8-methylguanine, 8-thioguanine, azaguanines, 2-aminopurine, 5- ethylcytosine, 5-methylcyosine, 5-bromouracil, 5-ethyluracil, 5-iodouracil, 5-chlorouracil, 5- propyluracil, thiouracil, 2-methyladenine, methylthioadenine, N,N-diemethyladenine, azaadenines, 8-bromoadenine, 8-hydroxyadenine, 6-hydroxyaminopurine, 6-thiopurine, 4-(6- aminohexyl/cytosine), and the like.

A non-limiting example of a "nucleobase linker moiety" is a sugar comprising 5- carbon atoms (a "5-carbon sugar"), including but not limited to deoxyribose, ribose or arabinose, and derivatives or mimics of 5-carbon sugars. Non-limiting examples of derivatives or mimics of 5-carbon sugars include 2'-fluoro-2'-deoxyribose or carbocyclic sugars where a carbon is substituted for the oxygen atom in the sugar ring. By way of non- limiting example, nucleosides comprising purine (i.e. A and G) or 7-deazapurine nucleobases typically covalently attach the 9 position of the purine or 7-deazapurine to the l'-position of a 5-carbon sugar. In another non-limiting example, nucleosides comprising pyrimidine nucleobases (i.e.. C, T or U) typically covalently attach the 1 position of the pyrimidine to l'- position of a 5-carbon sugar (Kornberg and Baker, DNA Replication, 2nd Ed. (Freeman, San Francisco, 1992). However, other types of covalent attachments of a nucleobase to a nucleobase linker moiety are known in the art, and non-limiting examples are described herein.

As used herein, a "nucleotide" refers to a nucleoside further comprising a "backbone moiety" generally used for the covalent attachment of one or more nucleotides to another molecule or to each other to form one or more nucleic acids. The "backbone moiety" in naturally occurring nucleotides typically comprises a phosphorus moiety, which is covalently attached to a 5-carbon sugar. The attachment of the backbone moiety typically occurs at either the 3'- or 5 '-position of the 5-carbon sugar. However, other types of attachments are known in the art, particularly when the nucleotide comprises derivatives or mimics of a naturally occurring 5-carbon sugar or phosphorus moiety, and non- limiting examples are described herein. A non-limiting example of a nucleic acid comprising such nucleoside or nucleotide derivatives and mimics is a "polyether nucleic acid", described in U.S. Patent Serial No. 5,908,845, incoφorated herein by reference, wherein one or more nucleobases are linked to chiral carbon atoms in a polyether backbone. Another example of a nucleic acid comprising nucleoside or nucleotide derivatives or mimics is a "peptide nucleic acid", also known as a "PNA", "peptide-based nucleic acid mimics" or "PENAMs", described in U.S. Patent Serial Nos. 5,786,461, 5891,625, 5,773,571, 5,766,855, 5,736,336, 5,719,262, 5,714,331, 5,539,082, and WO 92/20702, each of which is incoφorated herein by reference. A peptide nucleic acid generally comprises at least one nucleobase and at least one nucleobase linker moiety that is either not a 5-carbon sugar and/or at least one backbone moiety that is not a phosphate backbone moiety. Examples of nucleobase linker moieties described for PNAs include aza nitrogen atoms, amido and/or ureido tethers (see for example, U.S. Patent No. 5,539,082). Examples of backbone moieties described for PNAs include an amino ethylgly cine, polyamide, polyethyl, polythioamide, polysulfinamide or polysulfonamide backbone moiety.

Peptide nucleic acids generally have enhanced sequence specificity, binding properties, and resistance to enzymatic degradation in comparison to molecules such as DNA and RNA (Egholm et al., Nature 1993, 365, 566; PCT/EP/01219). In addition, U.S. Patent Nos. 5,766,855, 5,719,262, 5,714,331 and 5,736,336 describe PNAs comprising naturally and non-naturally occurring nucleobases and alkylamine side chains with further improvements in sequence specificity, solubility and binding affinity. These properties promote double or triple helix formation between a target nucleic acid and the PNA.

U.S. Patent No. 5,641,625 describes that the binding of a PNA may to a target sequence has applications the creation of PNA probes to nucleotide sequences, modulating (i.e. enhancing or reducing) gene expression by binding of a PNA to an expressed nucleotide sequence, and cleavage of specific dsDNA molecules. In certain embodiments, nucleic acid analogues such as one or more peptide nucleic acids may be used to inhibit nucleic acid amplification, such as in PCR, to reduce false positives and discriminate between single base mutants, as described in U.S. Patent Serial No. 5891,625.

U.S. Patent 5,786,461 describes PNAs with amino acid side chains attached to the PNA backbone to enhance solubility. The neutrality of the PNA backbone may contribute to the thermal stability of PNA/DNA and PNA RNA duplexes by reducing charge repulsion. The melting temperature of PNA containing duplexes, or temperature at which the strands of the duplex release into single stranded molecules, has been described as less dependent upon salt concentration.

One method for increasing amount of cellular uptake property of PNAs is to attach a lipophilic group. U.S. application Ser. No. 117,363, filed Sep. 3, 1993, describes several alkylamino functionalities and their use in the attachment of such pendant groups to oligonucleosides.

U.S. application Ser. No. 07/943,516, filed Sep. 11, 1992, and its corresponding published PCT application WO 94/06815, describe other novel amine-containing compounds and their incoφoration into oligonucleotides for, inter alia, the puφoses of enhancing cellular uptake, increasing lipophilicity, causing greater cellular retention and increasing the distribution of the compound within the cell.

Additional non-limiting examples of nucleosides, nucleotides or nucleic acids comprising 5-carbon sugar and/or backbone moiety derivatives or mimics.

In certain aspect, the present invention concerns at least one nucleic acid that is an isolated nucleic acid. As used herein, the term "isolated nucleic acid" refers to at least one nucleic acid molecule that has been isolated free of, or is otherwise free of, the bulk of the total genomic and transcribed nucleic acids of one or more cells, particularly mammalian cells, and more particularly human, mouse and rat cells. In certain embodiments, "isolated nucleic acid" refers to a nucleic acid that has been isolated free of, or is otherwise free of, bulk of cellular components and macromolecules such as lipids, proteins, small biological molecules, and the like. As different species may have a RNA or a DNA containing genome, the term "isolated nucleic acid" encompasses both the terms "isolated DNA" and "isolated RNA". Thus, the isolated nucleic acid may comprise a RNA or DNA molecule isolated from, or otherwise free of, the bulk of total RNA, DNA or other nucleic acids of a particular species. As used herein, an isolated nucleic acid isolated from a particular species is referred to as a "species specific nucleic acid." When designating a nucleic acid isolated from a particular species, such as human, such a type of nucleic acid may be identified by the name of the species. For example, a nucleic acid isolated from one or more humans would be an "isolated human nucleic acid", a nucleic acid isolated from human would be an "isolated human nucleic acid", etc.

Of course, more than one copy of an isolated nucleic acid may be isolated from biological material, or produced in vitro, using standard techniques that are known to those of skill in the art. In particular embodiments, the isolated nucleic acid is capable of expressing a protein, polypeptide or peptide that has Myo/Vl activity. In other embodiments, the isolated nucleic acid comprises an isolated MyoNl gene.

Herein certain embodiments, a "gene" refers to a nucleic acid that is transcribed. As used herein, a "gene segment" is a nucleic acid segment of a gene. In certain aspects, the gene includes regulatory sequences involved in transcription, or message production or composition. In particular embodiments, the gene comprises transcribed sequences that encode for a protein, polypeptide or peptide. In other particular aspects, the gene comprises a MyoNl nucleic acid, and/or encodes a MyoNl polypeptide or peptide coding sequences. In keeping with the terminology described herein, an "isolated gene" may comprise transcribed nucleic acid(s), regulatory sequences, coding sequences, or the like, isolated substantially away from other such sequences, such as other naturally occurring genes, regulatory sequences, polypeptide or peptide encoding sequences, etc. In this respect, the term "gene" is used for simplicity to refer to a nucleic acid comprising a nucleotide sequence that is transcribed, and the complement thereof. In particular aspects, the transcribed nucleotide sequence comprises at least one functional protein, polypeptide and/or peptide encoding unit. As will be understood by those in the art, this function term "gene" includes both genomic sequences, RΝA or cDΝA sequences or smaller engineered nucleic acid segments, including nucleic acid segments of a non-transcribed part of a gene, including but not limited to the non-transcribed promoter or enhancer regions of a gene. Smaller engineered gene nucleic acid segments may express, or may be adapted to express using nucleic acid manipulation technology, proteins, polypeptides, domains, peptides, fusion proteins, mutants and/or such like.

In certain embodiments, the nucleic acid is a nucleic acid segment. As used herein, the term "nucleic acid segment", are smaller fragments of a nucleic acid, such as for non- limiting example, those that encode only part of the MyoNl peptide or polypeptide sequence. Thus, a "nucleic acid segment" may comprise any part of the MyoNl gene sequence(s), of from about 2 nucleotides to the full length of the Myo/Vl peptide or polypeptide encoding region. In certain embodiments, the "nucleic acid segment" encompasses the full length Myo/Vl gene(s) sequence. In particular embodiments, the nucleic acid comprises any part of the SEQ ID ΝO:79, SEQ ID NO.81, SEQ ID NO:83, SEQ ID NO:85 or SEQ ID NO:203 through SEQ ID NO:233, and SEQ ID NO:235 sequence(s), of from about 2 nucleotides to the full length of the sequence disclosed in SEQ ID NO:79, SEQ ID NO-81, SEQ ID NO:83, SEQ ID NO:85 or SEQ ID NO:203 through SEQ ID NO:233, and SEQ ID NO:235.

As used herein, a "probe" is a relatively short oligonucleotide which is used to identify complementary sequences. As used herein, a "primer" is a relatively short oligonucleotide which is used to prime, or generate from, polymerization, such as in the presence of dNTPs and a polymerase. A non-limiting example of this would be the creation of nucleic acid segements of various lengths and sequence composition for probes and primers based on the sequences disclosed in SEQ ID NO:79, SEQ ID NO:81, SEQ ID NO:83, SEQ ID NO:85 or SEQ ID NO:203 through SEQ ID NO:233, and SEQ ID NO:235.

The nucleic acid(s) of the present invention, regardless of the length of the sequence itself, may be combined with other nucleic acid sequences, including but not limited to, promoters, enhancers, polyadenylation signals, restriction enzyme sites, multiple cloning sites, coding segments, and the like, to create one or more nucleic acid construct(s). The length overall length may vary considerably between nucleic acid constructs. Thus, a nucleic acid segment of almost any length may be employed, with the total length preferably being limited by the ease of preparation or use in the intended recombinant nucleic acid protocol.

In a non-limiting example, one or more nucleic acid constructs may be prepared that include a contiguous stretch of nucleotides identical to or complementary to SEQ ID NO:79, SEQ ID NO-81, SEQ ID NO:83, SEQ ID NO:85 or SEQ ID NO:203 through SEQ ID NO:233, and SEQ ID NO:235. A nucleic acid construct may be about 3, about 5, about 8, about 10 to about 14, or about 15, about 20, about 30, about 40, about 50, about 100, about 200, about 500, about 1,000, about 2,000, about 3,000, about 5,000, about 10,000, about 15,000, about 20,000, about 30,000, about 50,000, about 100,000, about 250,000, about 500,000, about 750,000, to about 1,000,000 nucleotides in length, as well as constructs of greater size, up to and including chromosomal sizes (including all intermediate lengths and intermediate ranges), given the advent of nucleic acids constructs such as a yeast artificial chromosome are known to those of ordinary skill in the art. It will be readily understood that "intermediate lengths" and "intermediate ranges", as used herein, means any length or range including or between the quoted values (i.e. all integers including and between such values).

In particular embodiments, the invention concerns one or more recombinant vector(s) comprising nucleic acid sequences that encode an MyoNl protein, polypeptide or peptide that includes within its amino acid sequence a contiguous amino acid sequence in accordance with, or essentially as set forth in, SEQ ID ΝO:3, corresponding to human Myo/Vl . In other embodiments, the invention concerns recombinant vector(s) comprising nucleic acid sequences that encode a mouse MyoNl protein, polypeptide or peptide that includes within its amino acid sequence a contiguous amino acid sequence in accordance with, or essentially as set forth in SEQ ID ΝO:2. In other embodiments, the invention concerns recombinant vector(s) comprising nucleic acid sequences that encode a rat Myo/Vl protein, polypeptide or peptide that includes within its amino acid sequence a contiguous amino acid sequence in accordance with, or essentially as set forth in SEQ ID NO: 1. In particular aspects, the recombinant vectors are DNA vectors.

The term "a sequence essentially as set forth in SEQ ID NO:3" or "a sequence essentially as set forth in SEQ ID NO:2" means that the sequence substantially corresponds to a portion of SEQ ID NO:3 and SEQ ID NO:3 and has relatively few amino acids that are not identical to, or a biologically functional equivalent of, the amino acids of SEQ ID NO:3 and/or SEQ ID NO:2. Thus, "a sequence essentially as set forth in SEQ ID NO:3" or "a sequence essentially as set forth in SEQ ID NO:2" encompasses nucleic acids, nucleic acid segments, and genes that comprise part or all of the nucleic acid sequences as set forth in SEQ ID NO:79, SEQ ID NO-81, SEQ ID NO:83, SEQ ID NO:85 or SEQ ID NO:203 through SEQ ID NO:233, and/or SEQ ID NO:235, respectively.

The term "biologically functional equivalent" is well understood in the art and is further defined in detail herein. Accordingly, a sequence that has between about 70%> and about 80%; or more preferably, between about 81%> and about 90%; or even more preferably, between about 91%> and about 99%>; of amino acids that are identical or functionally equivalent to the amino acids of SEQ ID NO: 3 or SEQ ID NO: 2 will be a sequence that is "essentially as set forth in SEQ ID NO:3" or "a sequence essentially as set forth in SEQ ID NO:2", provided the biological activity of the protein, polypeptide or peptide is maintained.

In certain other embodiments, the invention concerns at least one recombinant vector that includes within its sequence a nucleic acid sequence essentially as set forth in SEQ ID NO:79, SEQ ID NO:81, SEQ ID NO:83, SEQ ID NO:85 or SEQ ID NO:203 through SEQ ID NO: 233, and SEQ ID NO: 235. In particular embodiments, the recombinant vector comprises DNA sequences that encode protein(s), polypeptide(s) or peptide(s) exhibiting Myo/Vl activity.

The term "functionally equivalent codon" is used herein to refer to codons that encode the same amino acid, such as the six codons for arginine and serine, and also refers to codons that encode biologically equivalent amino acids. For optimization of expression of Myo/Nl in human cells, the codons are shown in Table 2 in preference of use from left to right. Thus, the most preferred codon for alanine is thus "GCC", and the least is "GCG" (see Table 2, below).

Table 2-Preferred Human DNA Codons

Amino Acids Codons

Tyrosine Tyr TAC TAT

Information on codon usage in a variety of non-human organisms is known in the art (see for example, Bennetzen and Hall, 1982; Ikemura, 1981a, 1981b, 1982; Grantham et al, 1980, 1981; Wada et al, 1990; each of these references are incoφorated herein by reference in their entirety). Thus, it is contemplated that codon usage may be optimized for other animals, as well as other organisms such as fungi, plants, prokaryotes, virus and the like, as well as organelles that contain nucleic acids, such as mitochondria, chloroplasts and the like, based on the preferred codon usage as would be known to those of ordinary skill in the art.

It is understood that amino acid sequences or nucleic acid sequences may include additional residues, such as additional N- or C-terminal amino acids or 5' or 3' sequences, or various combinations thereof, and yet still be essentially as set forth in one of the sequences disclosed herein, so long as the sequence meets the criteria set forth above, including the maintenance of biological protein, polypeptide or peptide activity where expression of a proteinaceous composition is concerned. The addition of terminal sequences particularly applies to nucleic acid sequences that may, for example, include various non-coding sequences flanking either of the 5' and/or 3' portions of the coding region or may include various internal sequences, i.e., introns, which are known to occur within genes.

Excepting intronic and flanking regions, and allowing for the degeneracy of the genetic code, nucleic acid sequences that have between about 70%> and about 79%>; or more preferably, between about 80%> and about 89%o; or even more particularly, between about 90% and about 99%>; of nucleotides that are identical to the nucleotides of SEQ ID NO:79, SEQ ID NO:81, SEQ ID NO:83, SEQ ID NO:85 or SEQ ID NO:203 through SEQ ID NO:235 will be nucleic acid sequences that are "essentially as set forth in SEQ ID NO:79, SEQ ID NO:81, SEQ ID NO:83, SEQ ID NO:85 or SEQ ID NO:203 through SEQ ID NO:233, and SEQ ID NO:235".

It is understood that this invention is not limited to the particular nucleic acid or amino acid sequences encoded by SEQ ID NOJ9, SEQ ID NO:81, SEQ ID NO:83, SEQ ID NO:85 or SEQ ID NO:203 through SEQ ID NO:233, and SEQ ID NO:235. Recombinant vectors and isolated nucleic acid segments may therefore variously include these coding regions themselves, coding regions bearing selected alterations or modifications in the basic coding region, and they may encode larger polypeptides or peptides that nevertheless include such coding regions or may encode biologically functional equivalent proteins, polypeptide or peptides that have variant amino acids sequences.

The nucleic acids of the present invention encompass biologically functional equivalent Myo/Vl proteins, polypeptides, or peptides. Such sequences may arise as a consequence of codon redundancy or functional equivalency that are known to occur naturally within nucleic acid sequences or the proteins, polypeptides or peptides thus encoded. Alternatively, functionally equivalent proteins, polypeptides or peptides may be created via the application of recombinant DNA technology, in which changes in the protein, polypeptide or peptide structure may be engineered, based on considerations of the properties of the amino acids being exchanged. Changes designed by man may be introduced, for example, through the application of site-directed mutagenesis techniques as discussed herein below, e.g., to introduce improvements or alterations to the antigenicity of the protein, polypeptide or peptide, or to test mutants in order to examine Myo/Vl protein, polypeptide or peptide activity at the molecular level.

Fusion proteins, polypeptides or peptides may be prepared, e.g., where the MyoNl coding regions are aligned within the same expression unit with other proteins, polypeptides or peptides having desired functions. Νon-limiting examples of such desired functions of expression sequences include purification or immunodetection puφoses for the added expression sequences, e.g., proteinaceous compositions that may be purified by affinity chromatography or the enzyme labeling of coding regions, respectively.

Encompassed by the invention are nucleic acid sequences encoding relatively small peptides or fusion peptides, such as, for example, peptides of from about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, to about 100 amino acids in length, or more preferably, of from about 15 to about 30 amino acids in length; as set forth in SEQ ID ΝO:3 or SEQ ID NO:2 and also larger polypeptides up to and including proteins corresponding to the full-length sequences set forth in SEQ ID NO:3 and/or SEQ ID NO:2.

As used herein an "organism" may be a prokaryote, eukaryote, virus and the like. As used herein the term "sequence" encompasses both the terms "nucleic acid" and "proteinaceous" or "proteinaceous composition." As used herein, the term "proteinaceous composition" encompasses the terms "protein", "polypeptide" and "peptide." As used herein "artificial sequence" refers to a sequence of a nucleic acid not derived from sequence naturally occurring at a genetic locus, as well as the sequence of any proteins, polypeptides or peptides encoded by such a nucleic acid. A "synthetic sequence", refers to a nucleic acid or proteinaceous composition produced by chemical synthesis in vitro, rather than enzymatic production in vitro (i.e. an "enzymatically produced" sequence) or biological production in vivo (i.e. a "biologically produced" sequence). N. Nucleic Acid-Based Expression Systems

A. Vectors

The term "vector" is used to refer to a carrier nucleic acid molecule into which a nucleic acid sequence can be inserted for introduction into a cell where it can be replicated. A nucleic acid sequence can be "exogenous," which means that it is foreign to the cell into which the vector is being introduced or that the sequence is homologous to a sequence in the cell but in a position within the host cell nucleic acid in which the sequence is ordinarily not found. Vectors include plasmids, cosmids, viruses (bacteriophage, animal viruses, and plant viruses), and artificial chromosomes (e.g., YACs). One of skill in the art would be well equipped to construct a vector through standard recombinant techniques, which are described in Maniatis et al, 1988 and Ausubel et al, 1994, both incoφorated herein by reference.

The term "expression vector" refers to a vector containing a nucleic acid sequence coding for at least part of a gene product capable of being transcribed. In some cases, RNA molecules are then translated into a protein, polypeptide, or peptide. In other cases, these sequences are not translated, for example, in the production of antisense molecules or ribozymes. Expression vectors can contain a variety of "control sequences," which refer to nucleic acid sequences necessary for the transcription and possibly translation of an operably linked coding sequence in a particular host organism. In addition to control sequences that govern transcription and translation, vectors and expression vectors may contain nucleic acid sequences that serve other functions as well and are described infra. 1. Promoters and Enhancers

A "promoter" is a control sequence that is a region of a nucleic acid sequence at which initiation and rate of transcription are controlled. It may contain genetic elements at which regulatory proteins and molecules may bind such as RNA polymerase and other transcription factors. The phrases "operatively positioned," "operatively linked," "under control," and "under transcriptional control" mean that a promoter is in a correct functional location and/or orientation in relation to a nucleic acid sequence to control transcriptional initiation and/or expression of that sequence. A promoter may or may not be used in conjunction with an "enhancer," which refers to a cis-acting regulatory sequence involved in the transcriptional activation of a nucleic acid sequence.

A promoter may be one naturally associated with a gene or sequence, as may be obtained by isolating the 5' non-coding sequences located upstream of the coding segment and/or exon. Such a promoter can be referred to as "endogenous ' Similarly, an enhancer may be one naturally associated with a nucleic acid sequence, located either downstream or upstream of that sequence. Alternatively, certain advantages will be gained by positioning the coding nucleic acid segment under the control of a recombinant or heterologous promoter, which refers to a promoter that is not normally associated with a nucleic acid sequence in its natural environment. A recombinant or heterologous enhancer refers also to an enhancer not normally associated with a nucleic acid sequence in its natural environment. Such promoters or enhancers may include promoters or enhancers of other genes, and promoters or enhancers isolated from any other prokaryotic, viral, or eukaryotic cell, and promoters or enhancers not "naturally occurring," i.e., containing different elements of different transcriptional regulatory regions, and/or mutations that alter expression. In addition to producing nucleic acid sequences of promoters and enhancers synthetically, sequences may be produced using recombinant cloning and/or nucleic acid amplification technology, including PCR™, in connection with the compositions disclosed herein (see U.S. Patent 4,683,202, U.S. Patent 5,928,906, each incoφorated herein by reference). Furthermore, it is contemplated the control sequences that direct transcription and/or expression of sequences within non-nuclear organelles such as mitochondria, chloroplasts, and the like, can be employed as well.

Naturally, it will be important to employ a promoter and/or enhancer that effectively directs the expression of the DNA segment in the cell type, organelle, and organism chosen for expression. Those of skill in the art of molecular biology generally know the use of promoters, enhancers, and cell type combinations for protein expression, for example, see Sambrook et al. (1989), incoφorated herein by reference. The promoters employed may be constitutive, tissue-specific, inducible, and/or useful under the appropriate conditions to direct high level expression of the introduced DNA segment, such as is advantageous in the large-scale production of recombinant proteins and/or peptides. The promoter may be heterologous or endogenous.

The identity of tissue-specific promoters or elements, as well as assays to characterize their activity, is well known to those of skill in the art. Examples of such regions include the human LIMK2 gene (Nomoto et al 1999), the somatostatin receptor 2 gene (Kraus et al, 1998), murine epididymal retinoic acid-binding gene (Lareyre et al, 1999), human CD4 (Zhao-Emonet et al, 1998), mouse alpha2 (XI) collagen (Tsumaki, et al, 1998), D1A dopamine receptor gene (Lee, et al, 1997), insulin-like growth factor II (Wu et al, 1991), human platelet endothelial cell adhesion molecule- 1 (Almendro et al, 1996).

2. Initiation Signals and Internal Ribosome Binding Sites

A specific initiation signal also may be required for efficient translation of coding sequences. These signals include the ATG initiation codon or adjacent sequences. Exogenous translational control signals, including the ATG initiation codon, may need to be provided. One of ordinary skill in the art would readily be capable of determining this and providing the necessary signals. It is well known that the initiation codon must be "in-frame" with the reading frame of the desired coding sequence to ensure translation of the entire insert. The exogenous translational control signals and initiation codons can be either natural or synthetic. The efficiency of expression may be enhanced by the inclusion of appropriate transcription enhancer elements.

In certain embodiments of the invention, the use of internal ribosome entry sites (IRES) elements are used to create multigene, or polycistronic, messages. IRES elements are able to bypass the ribosome scanning model of 5' methylated Cap dependent translation and begin translation at internal sites (Pelletier and Sonenberg, 1988). IRES elements from two members of the picornavirus family (polio and encephalomyocarditis) have been described (Pelletier and Sonenberg, 1988), as well an IRES from a mammalian message (Macejak and Sarnow, 1991). IRES elements can be linked to heterologous open reading frames. Multiple open reading frames can be transcribed together, each separated by an IRES, creating polycistronic messages. By virtue of the IRES element, each open reading frame is accessible to ribosomes for efficient translation. Multiple genes can be efficiently expressed using a single promoter/enhancer to transcribe a single message (see U.S. Patent 5,925,565 and 5,935,819, herein incoφorated by reference).

3. Multiple Cloning Sites

Vectors can include a multiple cloning site (MCS), which is a nucleic acid region that contains multiple restriction enzyme sites, any of which can be used in conjunction with standard recombinant technology to digest the vector. (See Carbonelli et al, 1999, Levenson et al, 1998, and Cocea, 1997, incoφorated herein by reference.) "Restriction enzyme digestion" refers to catalytic cleavage of a nucleic acid molecule with an enzyme that functions only at specific locations in a nucleic acid molecule. Many of these restriction enzymes are commercially available. Use of such enzymes is widely understood by those of skill in the art. Frequently, a vector is linearized or fragmented using a restriction enzyme that cuts within the MCS to enable exogenous sequences to be ligated to the vector. "Ligation" refers to the process of forming phosphodiester bonds between two nucleic acid fragments, which may or may not be contiguous with each other. Techniques involving restriction enzymes and ligation reactions are well known to those of skill in the art of recombinant technology.

4. Splicing Sites

Most transcribed eukaryotic RNA molecules will undergo RNA splicing to remove introns from the primary transcripts. Vectors containing genomic eukaryotic sequences may require donor and/or acceptor splicing sites to ensure proper processing of the transcript for protein expression. (See Chandler et al, 1997, herein incoφorated by reference.)

5. Polyadenylation Signals

In expression, one will typically include a polyadenylation signal to effect proper polyadenylation of the transcript. The nature of the polyadenylation signal is not believed to be crucial to the successful practice of the invention, and/or any such sequence may be employed. Preferred embodiments include the SV40 polyadenylation signal and/or the bovine growth hormone polyadenylation signal, convenient and/or known to function well in various target cells. Also contemplated as an element of the expression cassette is a transcriptional termination site. These elements can serve to enhance message levels and/or to minimize read through from the cassette into other sequences.

6. Origins of Replication

In order to propagate a vector in a host cell, it may contain one or more origins of replication sites (often termed "ori"), which is a specific nucleic acid sequence at which replication is initiated. Altematively an autonomously replicating sequence (ARS) can be employed if the host cell is yeast.

7. Selectable and Screenable Markers

In certain embodiments of the invention, the cells contain nucleic acid construct of the present invention, a cell may be identified in vitro or in vivo by including a marker in the expression vector. Such markers would confer an identifiable change to the cell permitting easy identification of cells containing the expression vector. Generally, a selectable marker is one that confers a property that allows for selection. A positive selectable marker is one in which the presence of the marker allows for its selection, while a negative selectable marker is one in which its presence prevents its selection. An example of a positive selectable marker is a drug resistance marker.

Usually the inclusion of a drug selection marker aids in the cloning and identification of transformants, for example, genes that confer resistance to neomycin, puromycin, hygromycin, DHFR, GPT, zeocin and histidinol are useful selectable markers. In addition to markers conferring a phenotype that allows for the discrimination of transformants based on the implementation of conditions, other types of markers including screenable markers such as GFP, whose basis is colorimetric analysis, are also contemplated. Alternatively, screenable enzymes such as heφes simplex virus thymidine kinase (tk) or chloramphenicol acetyltransferase (CAT) may be utilized. One of skill in the art would also know how to employ immunologic markers, possibly in conjunction with FACS analysis. The marker used is not believed to be important, so long as it is capable of being expressed simultaneously with the nucleic acid encoding a gene product. Further examples of selectable and screenable markers are well known to one of skill in the art.

B. Host Cells

As used herein, the terms "cell," "cell line," and "cell culture" may be used interchangeably. All of these term also include their progeny, which is any and all subsequent generations. It is understood that all progeny may not be identical due to deliberate or inadvertent mutations. In the context of expressing a heterologous nucleic acid sequence, "host cell" refers to a prokaryotic or eukaryotic cell,' and it includes any transformable organisms that is capable of replicating a vector and/or expressing a heterologous gene encoded by a vector. A host cell can, and has been, used as a recipient for vectors. A host cell may be "transfected" or "transformed," which refers to a process by which exogenous nucleic acid is transferred or introduced into the host cell. A transformed cell includes the primary subject cell and its progeny.

Host cells may be derived from prokaryotes or eukaryotes, depending upon whether the desired result is replication of the vector or expression of part or all of the vector-encoded nucleic acid sequences. Numerous cell lines and cultures are available for use as a host cell, and they can be obtained through the American Type Culture Collection (ATCC), which is an organization that serves as an archive for living cultures and genetic materials (www.atcc.org). An appropriate host can be determined by one of skill in the art based on the vector backbone and the desired result. A plasmid or cosmid, for example, can be introduced into a prokaryote host cell for replication of many vectors. Bacterial cells used as host cells for vector replication and/or expression include DH5α, JM109, and KC8, as well as a number of commercially available bacterial hosts such as SURE^® Competent Cells and SOLOPACK™ Gold Cells (STRATAGENE^®, La Jolla). Alternatively, bacterial cells such as E. coli LΕ392 could be used as host cells for phage viruses.

Examples of eukaryotic host cells for replication and/or expression of a vector include HeLa, NIH3T3, Jurkat, 293, Cos, CHO, Saos, and PC12. Many host cells from various cell types and organisms are available and would be known to one of skill in the art. Similarly, a viral vector may be used in conjunction with either a eukaryotic or prokaryotic host cell, particularly one that is permissive for replication or expression of the vector.

Some vectors may employ control sequences that allow it to be replicated and/or expressed in both prokaryotic and eukaryotic cells. One of skill in the art would further understand the conditions under which to incubate all of the above described host cells to maintain them and to permit replication of a vector. Also understood and known are techniques and conditions that would allow large-scale production of vectors, as well as production of the nucleic acids encoded by vectors and their cognate polypeptides, proteins, or peptides.

C. Expression Systems

Numerous expression systems exist that comprise at least a part or all of the compositions discussed above. Prokaryote- and/or eukaryote-based systems can be employed for use with the present invention to produce nucleic acid sequences, or their cognate polypeptides, proteins and peptides. Many such systems are commercially and widely available.

The insect cell/baculovirus system can produce a high level of protein expression of a heterologous nucleic acid segment, such as described in U.S. Patent No. 5,871,986, 4,879,236, both herein incoφorated by reference, and which can be bought, for example, under the name MAXBAC^® 2.0 from INVITROGEN^® and BACPACK™ BACULOVIRUS EXPRESSION SYSTEM FROM CLONTECH^®.

Other examples of expression systems include STRATAGENE^®'S COMPLETE CONTROL™ Inducible Mammalian Expression System, which involves a synthetic ecdysone- inducible receptor, or its pET Expression System, an E. coli expression system. Another example of an inducible expression system is available from INVITROGEN^®, which carries the T-REX™ (tetracycline-regulated expression) System, an inducible mammalian expression system that uses the full-length CMV promoter. INVITROGEN^® also provides a yeast expression system called the Pichia methanolica Expression System, which is designed for high-level production of recombinant proteins in the methylotrophic yeast Pichia methanolica. One of skill in the art would know how to express a vector, such as an expression construct, to produce a nucleic acid sequence or its cognate polypeptide, protein, or peptide.

D. Nucleic Acid Detection

In addition to their use in directing the expression of Myo/Vl proteins, polypeptides and/or peptides, the nucleic acid sequences disclosed herein have a variety of other uses. For example, they have utility as probes or primers for embodiments involving nucleic acid hybridization.

1. Hybridization

The use of a probe or primer of between 13 and 100 nucleotides, preferably between 17 and 100 nucleotides in length, or in some aspects of the invention up to 1-2 kilobases or more in length, allows the formation of a duplex molecule that is both stable and selective. Molecules having complementary sequences over contiguous stretches greater than 20 bases in length are generally preferred, to increase stability and/or selectivity of the hybrid molecules obtained. One will generally prefer to design nucleic acid molecules for hybridization having one or more complementary sequences of 20 to 30 nucleotides, or even longer where desired. Such fragments may be readily prepared, for example, by directly synthesizing the fragment by chemical means or by introducing selected sequences into recombinant vectors for recombinant production.

Accordingly, the nucleotide sequences of the invention may be used for their ability to selectively form duplex molecules with complementary stretches of DNAs and/or RNAs or to provide primers for amplification of DNA or RNA from samples. Depending on the application envisioned, one would desire to employ varying conditions of hybridization to achieve varying degrees of selectivity of the probe or primers for the target sequence.

For applications requiring high selectivity, one typically desires to employ relatively high stringency conditions to form the hybrids. For example, relatively low salt and/or high temperature conditions, such as provided by about 0.02 M to about 0.10 M NaCI at temperatures of about 50°C to about 70°C. Such high stringency conditions tolerate little, if any, mismatch between the probe or primers and the template or target strand and would be particularly suitable for isolating specific genes or for detecting specific mRNA transcripts. It is generally appreciated that conditions can be rendered more stringent by the addition of increasing amounts of formamide.

For certain applications, for example, site-directed mutagenesis, it is appreciated that lower stringency conditions are preferred. Under these conditions, hybridization may occur even though the sequences of the hybridizing strands are not perfectly complementary, but are mismatched at one or more positions. Conditions may be rendered less stringent by increasing salt concentration and/or decreasing temperature. For example, a medium stringency condition could be provided by about 0.1 to 0.25 M NaCI at temperatures of about 37°C to about 55°C, while a low stringency condition could be provided by about 0.15 M to about 0.9 M salt, at temperatures ranging from about 20°C to about 55°C. Hybridization conditions can be readily manipulated depending on the desired results.

In other embodiments, hybridization may be achieved under conditions of, for example, 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl₂, 1.0 mM dithiothreitol, at temperatures between approximately 20°C to about 37°C. Other hybridization conditions utilized could include approximately 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl₂, at temperatures ranging from approximately 40°C to about 72°C.

In certain embodiments, it is advantageous to employ nucleic acids of defined sequences of the present invention in combination with an appropriate means, such as a label, for determining hybridization. A wide variety of appropriate indicator means are known in the art, including fluorescent, radioactive, enzymatic or other ligands, such as avidin/biotin, which are capable of being detected. In preferred embodiments, one may desire to employ a fluorescent label or an enzyme tag such as urease, alkaline phosphatase or peroxidase, instead of radioactive or other environmentally undesirable reagents. In the case of enzyme tags, colorimetric indicator substrates are known that can be employed to provide a detection means that is visibly or spectrophotometrically detectable, to identify specific hybridization with complementary nucleic acid containing samples.

In general, it is envisioned that the probes or primers described herein are useful as reagents in solution hybridization, as in PCR™, for detection of expression of corresponding genes, as well as in embodiments employing a solid phase. In embodiments involving a solid phase, the test DNA (or RNA) is adsorbed or otherwise affixed to a selected matrix or surface. This fixed, single-stranded nucleic acid is then subjected to hybridization with selected probes under desired conditions. The conditions selected depend on the particular circumstances (depending, for example, on the G+C content, type of target nucleic acid, source of nucleic acid, size of hybridization probe, etc.). Optimization of hybridization conditions for the particular application of interest is well known to those of skill in the art. After washing of the hybridized molecules to remove non-specifically bound probe molecules, hybridization is detected, and/or quantified, by determining the amount of bound label. Representative solid phase hybridization methods are disclosed in U.S. Patent Nos. 5,843,663, 5,900,481 and 5,919,626. Other methods of hybridization that may be used in the practice of the present invention are disclosed in U.S. Patent Nos. 5,849,481, 5,849,486 and 5,851,772. The relevant portions of these and other references identified in this section of the Specification are incoφorated herein by reference.

2. Amplification of Nucleic Acids

Nucleic acids used as a template for amplification may be isolated from cells, tissues or other samples according to standard methodologies (Sambrook et al, 1989). In certain embodiments, analysis is performed on whole cell or tissue homogenates or biological fluid samples without substantial purification of the template nucleic acid. The nucleic acid may be genomic DNA or fractionated or whole cell RNA. Where RNA is used, it may be desired to first convert the RNA to a complementary DNA.

The term "primer," as used herein, is meant to encompass any nucleic acid that is capable of priming the synthesis of a nascent nucleic acid in a template-dependent process. Typically, primers are oligonucleotides from ten to twenty and/or thirty base pairs in length, but longer sequences can be employed. Primers may be provided in double-stranded and/or single-stranded form, although the single-stranded form is preferred.

Pairs of primers designed to selectively hybridize to nucleic acids corresponding to Myo/Vl nucleic acids are contacted with the template nucleic acid under conditions that permit selective hybridization. Depending upon the desired application, high stringency hybridization conditions may be selected that only allow hybridization to sequences that are completely complementary to the primers. In other embodiments, hybridization may occur under reduced stringency to allow for amplification of nucleic acids contain one or more mismatches with the primer sequences. Once hybridized, the template-primer complex is contacted with one or more enzymes that facilitate template-dependent nucleic acid synthesis. Multiple rounds of amplification, also referred to as "cycles," are conducted until a sufficient amount of amplification product is produced.

The amplification product may be detected or quantified. In certain applications, the detection may be performed by visual means. Alternatively, the detection may involve indirect identification of the product via chemiluminescence, radioactive scintigraphy of incoφorated radiolabel or fluorescent label or even via a system using electrical and/or thermal impulse signals (Affymax technology; Bellus, 1994).

A number of template dependent processes are available to amplify the oligonucleotide sequences present in a given template sample. One of the best known amplification methods is the polymerase chain reaction (referred to as PCR™) which is described in detail in U.S. Patent Nos. 4,683,195, 4,683,202 and 4,800,159, and in Innis et al, 1990, each of which is incoφorated herein by reference in their entirety.

A reverse transcriptase PCR™ amplification procedure may be performed to quantify the amount of mRNA amplified. Methods of reverse transcribing RNA into cDNA are well known and described in Sambrook et al, 1989. Alternative methods for reverse transcription utilize thermostable DNA polymerases. These methods are described in WO 90/07641. Polymerase chain reaction methodologies are well known in the art. Representative methods of RT-PCR are described in U.S. Patent No. 5,882,864.

Another method for amplification is ligase chain reaction ("LCR"), disclosed in European Application No. 320 308, incoφorated herein by reference in its entirety. U.S. Patent 4,883,750 describes a method similar to LCR for binding probe pairs to a target sequence. A method based on PCR™ and oligonucleotide ligase assy (OLA), disclosed in U.S. Patent 5,912,148, may also be used.

Alternative methods for amplification of target nucleic acid sequences that may be used in the practice of the present invention are disclosed in U.S. Patent Nos. 5,843,650, 5,846,709, 5,846,783, 5,849,546, 5,849,497, 5,849,547, 5,858,652, 5,866,366, 5,916,776, 5,922,574, 5,928,905, 5,928,906, 5,932,451, 5,935,825, 5,939,291 and 5,942,391, GB Application No. 2 202 328, and in PCT Application No. PCT/US89/01025, each of which is incoφorated herein by reference in its entirety.

Qbeta Replicase, described in PCT Application No. PCTJUS87/00880, may also be used as an amplification method in the present invention. In this method, a replicative sequence of RNA that has a region complementary to that of a target is added to a sample in the presence of an RNA polymerase. The polymerase copies the replicative sequence which is then detected.

An isothermal amplification method, in which restriction endonucleases and ligases are used to achieve the amplification of target molecules that contain nucleotide 5'-[alpha- thio] -triphosphates in one strand of a restriction site may also be useful in the amplification of nucleic acids in the present invention (Walker et al, 1992). Strand Displacement Amplification (SDA), disclosed in U.S. Patent No. 5,916,779, is another method of carrying out isothermal amplification of nucleic acids which involves multiple rounds of strand displacement and synthesis, i.e., nick translation.

Other nucleic acid amplification procedures include transcription-based amplification systems (TAS), including nucleic acid sequence based amplification (NASBA) and 3SR (Kwoh et al, 1989; Gingeras et al, PCT Application WO 88/10315, incoφorated herein by reference in their entirety). Davey et al, European Application No. 329 822 disclose a nucleic acid amplification process involving cyclically synthesizing single-stranded RNA ("ssRNA"), ssDNA, and double-stranded DNA (dsDNA), which may be used in accordance with the present invention.

Miller et al, PCT Application WO 89/06700 (incoφorated herein by reference in its entirety) disclose a nucleic acid sequence amplification scheme based on the hybridization of a promoter region/primer sequence to a target single-stranded DNA ("ssDNA") followed by transcription of many RNA copies of the sequence. This scheme is not cyclic, i.e., new templates are not produced from the resultant RNA transcripts. Other amplification methods include "race" and "one-sided PCR" (Frohman, 1990; Ohara et al, 1989). 3. Detection of Nucleic Acids

Following any amplification, it may be desirable to separate the amplification product from the template and/or the excess primer. In one embodiment, amplification products are separated by agarose, agarose-acrylamide or polyacrylamide gel electrophoresis using standard methods (Sambrook et al, 1989). Separated amplification products may be cut out and eluted from the gel for further manipulation. Using low melting point agarose gels, the separated band may be removed by heating the gel, followed by extraction of the nucleic acid.

Separation of nucleic acids may also be effected by chromatographic techniques known in art. There are many kinds of chromatography which may be used in the practice of the present invention, including adsoφtion, partition, ion-exchange, hydroxylapatite, molecular sieve, reverse-phase, column, paper, thin-layer, and gas chromatography as well as HPLC.

In certain embodiments, the amplification products are visualized. A typical visualization method involves staining of a gel with ethidium bromide and visualization of bands under UV light. Alternatively, if the amplification products are integrally labeled with radio- or fluorometrically-labeled nucleotides, the separated amplification products can be exposed to x-ray film or visualized under the appropriate excitatory spectra.

In one embodiment, following separation of amplification products, a labeled nucleic acid probe is brought into contact with the amplified marker sequence. The probe preferably is conjugated to a chromophore but may be radiolabeled. In another embodiment, the probe is conjugated to a binding partner, such as an antibody or biotin, or another binding partner carrying a detectable moiety.

In particular embodiments, detection is by Southern blotting and hybridization with a labeled probe. The techniques involved in Southern blotting are well known to those of skill in the art. See Sambrook et al, 1989. One example of the foregoing is described in U.S. Patent No. 5,279,721, incoφorated by reference herein, which discloses an apparatus and method for the automated electrophoresis and transfer of nucleic acids. The apparatus permits electrophoresis and blotting without external manipulation of the gel and is ideally suited to carrying out methods according to the present invention.

Other methods of nucleic acid detection that may be used in the practice of the instant invention are disclosed in U.S. Patent Nos. 5,840,873, 5,843,640, 5,843,651, 5,846,708, 5,846,717, 5,846,726, 5,846,729, 5,849,487, 5,853,990, 5,853,992, 5,853,993, 5,856,092, 5,861,244, 5,863,732, 5,863,753, 5,866,331, 5,905,024, 5,910,407, 5,912,124, 5,912,145, 5,919,630, 5,925,517, 5,928,862, 5,928,869, 5,929,227, 5,932,413 and 5,935,791, each of which is incoφorated herein by reference. 4. Other Assays

Other methods for genetic screening may be used within the scope of the present invention, for example, to detect mutations in genomic DNA, cDNA and/or RNA samples. Methods used to detect point mutations include denaturing gradient gel electrophoresis ("DGGE"), restriction fragment length polymoφhism analysis ("RFLP"), chemical or enzymatic cleavage methods, direct sequencing of target regions amplified by PCR™ (see above), single-strand conformation polymoφhism analysis ("SSCP") and other methods well known in the art.

One method of screening for point mutations is based on RNase cleavage of base pair mismatches in RNA DNA or RNA/RNA heteroduplexes. As used herein, the term "mismatch" is defined as a region of one or more unpaired or mispaired nucleotides in a double-stranded RNA/RNA, RNA/DNA or DNA/DNA molecule. This definition thus includes mismatches due to insertion/deletion mutations, as well as single or multiple base point mutations.

U.S. Patent No. 4,946,773 describes an RNase A mismatch cleavage assay that involves annealing single-stranded DNA or RNA test samples to an RNA probe, and subsequent treatment of the nucleic acid duplexes with RNase A. For the detection of mismatches, the single-stranded products of the RNase A treatment, electrophoretically separated according to size, are compared to similarly treated control duplexes. Samples containing smaller fragments (cleavage products) not seen in the control duplex are scored as positive.

Other investigators have described the use of RNase I in mismatch assays. The use of RNase I for mismatch detection is described in literature from Promega Biotech. Promega markets a kit containing RNase I that is reported to cleave three out of four known mismatches. Others have described using the MutS protein or other DNA-repair enzymes for detection of single-base mismatches.

Alternative methods for detection of deletion, insertion or substititution mutations that may be used in the practice of the present invention are disclosed in U.S. Patent Nos. 5,849,483, 5,851,770, 5,866,337, 5,925,525 and 5,928,870, each of which is incoφorated herein by reference in its entirety. 5. Kits

All the essential materials and/or reagents required for detecting SEQ ID NO: 79, SEQ ID NO:81, SEQ ID NO:83, SEQ ID NO:85 or SEQ ID NO:203 through SEQ ID NO:235 in a sample may be assembled together in a kit. This generally comprises a probe or primers designed to hybridize specifically to individual nucleic acids of interest in the practice of the present invention, including SEQ ID NO:79, SEQ ID NO.81, SEQ ID NO:83, SEQ ID NO:85 or SEQ ID NO:203 through SEQ ID NO:235. Also included may be enzymes suitable for amplifying nucleic acids, including various polymerases (reverse transcriptase, Taq, etc.), deoxynucleotides and buffers to provide the necessary reaction mixture for amplification. Such kits may also include enzymes and other reagents suitable for detection of specific nucleic acids or amplification products. Such kits generally comprise, in suitable means, distinct containers for each individual reagent or enzyme as well as for each probe or primer pair. VI. Site-Directed Mutagenesis

Structure-guided site-specific mutagenesis represents a powerful tool for the dissection and engineering of protein-ligand interactions (Wells, 1996, Braisted et al, 1996). The technique provides for the preparattion and testing of sequence variants by introducing one or more nucleotide sequence changes into a selected DNA.

Site-specific mutagenesis uses specific oligonucleotide sequences which encode the DNA sequence of the desired mutation, as well as a sufficient number of adjacent, unmodified nucleotides. In this way, a primer sequence is provided with sufficient size and complexity to form a stable duplex on both sides of the deletion junction being traversed. A primer of about 17 to 25 nucleotides in length is preferred, with about 5 to 10 residues on both sides of the junction of the sequence being altered.

The technique typically employs a bacteriophage vector that exists in both a single- stranded and double-stranded form. Vectors useful in site-directed mutagenesis include vectors such as the Ml 3 phage. These phage vectors are commercially available and their use is generally well known to those skilled in the art. Double-stranded plasmids are also routinely employed in site-directed mutagenesis, which eliminates the step of transferring the gene of interest from a phage to a plasmid.

In general, one first obtains a single-stranded vector, or melts two strands of a double- stranded vector, which includes within its sequence a DNA sequence encoding the desired protein or genetic element. An oligonucleotide primer bearing the desired mutated sequence, synthetically prepared, is then annealed with the single-stranded DNA preparation, taking into account the degree of mismatch when selecting hybridization conditions. The hybridized product is subjected to DNA polymerizing enzymes such as E. coli polymerase I (Klenow fragment) in order to complete the synthesis of the mutation-bearing strand. Thus, a heteroduplex is formed, wherein one strand encodes the original non-mutated sequence, and the second strand bears the desired mutation. This heteroduplex vector is then used to transform appropriate host cells, such as E. coli cells, and clones are selected that include recombinant vectors bearing the mutated sequence arrangement.

Comprehensive information on the functional significance and information content of a given residue of protein can best be obtained by saturation mutagenesis in which all 19 amino acid substitutions are examined. The shortcoming of this approach is that the logistics of multiresidue saturation mutagenesis are daunting (Warren et al, 1996, Brown et al, 1996; Zeng et al, 1996; Burton and Barbas, 1994; Yelton et al, 1995; Jackson et al, 1995; Short et al, 1995; Wong et al, 1996; Hilton et al, 1996). Hundreds, and possibly even thousands, of site specific mutants must be studied. However, improved techniques make production and rapid screening of mutants much more straightforward. See also, U.S. Patents 5,798,208 and 5,830,650, for a description of "walk-through" mutagenesis.

Other methods of site-directed mutagenesis are disclosed in U.S. Patents 5,220,007; 5,284,760; 5,354,670; 5,366,878; 5,389,514; 5,635,377; and 5,789,166. VII. Screening For Modulators Of the Protein Function

The present invention further comprises methods for identifying modulators of the function of Myo/Vl. These assays may comprise random screening of large libraries of candidate substances; alternatively, the assays may be used to focus on particular classes of compounds selected with an eye towards structural attributes that are believed to make them more likely to modulate the function of Myo/Vl. By function, it is meant that one may assay for the ability to interact with NFKB, particularly the ability to facilitate formation of p50 homodimers and/or p65 homodimers. In an additional embodiment, one assays for the ability of Myo/Vl to interact with ETS, and particularly for its ability to switch fetal gene expression that occurs during cardiac hypertrophy.

To identify a Myo/Vl modulator, one generally determines the function of Myo/Vl in the presence and absence of the candidate substance, a modulator defined as any substance that alters function. For example, a method generally comprises: providing a candidate modulator; admixing the candidate modulator with an isolated compound or cell, or a suitable experimental animal; measuring one or more characteristics of the compound, cell or animal in step (c); and comparing the characteristic measured in step (c) with the characteristic of the compound, cell or animal in the absence of said candidate modulator, wherein a difference between the measured characteristics indicates that said candidate modulator is, indeed, a modulator of the compound, cell or animal.

Assays may be conducted in cell free systems, in isolated cells, or in organisms including transgenic animals.

It will, of course, be understood that all the screening methods of the present invention are useful in themselves notwithstanding the fact that effective candidates may not be found. The invention provides methods for screening for such candidates, not solely methods of finding them. A. Modulators

As used herein the term "candidate substance" refers to any molecule that may potentially inhibit or enhance MyoNl activity. The candidate substance may be a protein or fragment thereof, a small molecule, or even a nucleic acid molecule. It may prove to be the case that the most useful pharmacological compounds are compounds that are structurally related to ankyrin repeat-containing compounds. Using lead compounds to help develop improved compounds is know as "rational drug design" and includes not only comparisons with know inhibitors and activators, but predictions relating to the structure of target molecules.

The goal of rational drug design is to produce structural analogs of biologically active polypeptides or target compounds. By creating such analogs, it is possible to fashion drugs, which are more active or stable than the natural molecules, which have different susceptibility to alteration or which may affect the function of various other molecules. In one approach, one would generate a three-dimensional structure for a target molecule, or a fragment thereof. This could be accomplished by x-ray crystallography, computer modeling or by a combination of both approaches.

It also is possible to use antibodies to ascertain the structure of a target compound activator or inhibitor. In principle, this approach yields a pharmacore upon which subsequent drug design can be based. It is possible to bypass protein crystallography altogether by generating anti-idiotypic antibodies to a functional, pharmacologically active antibody. As a mirror image of a mirror image, the binding site of anti-idiotype would be expected to be an analog of the original antigen. The anti-idiotype could then be used to identify and isolate peptides from banks of chemically- or biologically-produced peptides. Selected peptides would then serve as the pharmacore. Anti-idiotypes may be generated using the methods described herein for producing antibodies, using an antibody as the antigen.

On the other hand, one may simply acquire, from various commercial sources, small molecule libraries that are believed to meet the basic criteria for useful drugs in an effort to "brute force" the identification of useful compounds. Screening of such libraries, including combinatorially generated libraries (e.g., peptide libraries), is a rapid and efficient way to screen large number of related (and unrelated) compounds for activity. Combinatorial approaches also lend themselves to rapid evolution of potential drugs by the creation of second, third and fourth generation compounds modeled of active, but otherwise undesirable compounds. Candidate compounds may include fragments or parts of naturally-occurring compounds, or may be found as active combinations of known compounds, which are otherwise inactive. It is proposed that compounds isolated from natural sources, such as animals, bacteria, fungi, plant sources, including leaves and bark, and marine samples may be assayed as candidates for the presence of potentially useful pharmaceutical agents. It is be understood that the pharmaceutical agents to be screened could also be derived or synthesized from chemical compositions or man-made compounds. Thus, it is understood that the candidate substance identified by the present invention may be peptide, polypeptide, polynucleotide, small molecule inhibitors or any other compounds that may be designed through rational drug design starting from known inhibitors or stimulators.

Other suitable modulators include antisense molecules, ribozymes, and antibodies (including single chain antibodies), each of which would be specific for the target molecule. Such compounds are described in greater detail elsewhere in this document. For example, an antisense molecule that bound to a translational or transcriptional start site, or splice junctions, would be ideal candidate inhibitors.

In addition to the modulating compounds initially identified, the inventors also contemplate that other sterically similar compounds may be formulated to mimic the key portions of the structure of the modulators. Such compounds, which may include peptidomimetics of peptide modulators, may be used in the same manner as the initial modulators.

An inhibitor according to the present invention may be one which exerts its inhibitory or activating effect upstream, downstream or directly on Myo/Vl. Regardless of the type of inhibitor or activator identified by the present screening methods, the effect of the inhibition or activator by such a compound results in reduction of p50 homodimers as compared to that observed in the absence of the added candidate substance.

B. In vitro Assays

A quick, inexpensive and easy assay to run is an in vitro assay. Such assays generally use isolated molecules, can be run quickly and in large numbers, thereby increasing the amount of information obtainable in a short period of time. A variety of vessels may be used to run the assays, including test tubes, plates, dishes and other surfaces such as dipsticks or beads.

One example of a cell free assay is a binding assay. While not directly addressing function, the ability of a modulator to bind to a target molecule in a specific fashion is strong evidence of a related biological effect. For example, binding of a molecule to a target may, in and of itself, be inhibitory, due to steric, allosteric or charge-charge interactions. The target may be either free in solution, fixed to a support, expressed in or on the surface of a cell. Either the target or the compound may be labeled, thereby permitting determining of binding. Usually, the target is be the labeled species, decreasing the chance that the labeling interferes with or enhances binding. Competitive binding formats can be performed in which one of the agents is labeled, and one may measure the amount of free label versus bound label to determine the effect on binding.

A technique for high throughput screening of compounds is described in WO 84/03564. Large numbers of small peptide test compounds are synthesized on a solid substrate, such as plastic pins or some other surface. Bound polypeptide is detected by various methods.

C. In cyto Assays

The present invention also contemplates the screening of compounds for their ability to modulate MyoNl in cells. Various cell lines can be utilized for such screening assays, including cells specifically engineered for this puφose.

Depending on the assay, culture may be required. The cell is examined using any of a number of different physiologic assays. Alternatively, molecular analysis may be performed, for example, looking at protein expression, mRΝA expression (including differential display of whole cell or polyA RΝA) and others.

D. In vivo Assays

In vivo assays involve the use of various animal models, including transgenic animals that have been engineered to have specific defects, or carry markers that can be used to measure the ability of a candidate substance to reach and effect different cells within the organism. Due to their size, ease of handling, and information on their physiology and genetic make-up, mice are a preferred embodiment, especially for transgenics. However, other animals are suitable as well, including rats, rabbits, hamsters, guinea pigs, gerbils, woodchucks, cats, dogs, sheep, goats, pigs, cows, horses and monkeys (including chimps, gibbons and baboons). Assays for modulators may be conducted using an animal model derived from any of these species.

In such assays, one or more candidate substances are administered to an animal, and the ability of the candidate substance(s) to alter one or more characteristics, as compared to a similar animal not treated with the candidate substance(s), identifies a modulator. The characteristics may be any of those discussed above with regard to the function of a particular compound (e.g., enzyme, receptor, hormone) or cell (e.g., growth, tumorigenicity, survival), or instead a broader indication such as behavior, anemia, immune response, etc.

The present invention provides methods of screening for a candidate substance that interferes with ability of Myo/Vl to promote formation of NFKB p50 homodimers. In these embodiments, the present invention is directed to a method for determining the ability of a candidate substance to titrate or otherwise remove NFKB p50 homodimers from a cell, generally including the steps of: administering a candidate substance to the animal; and determining the ability of the candidate substance to reduce one or more characteristics of NFKB p50 homodimer formation.

Treatment of these animals with test compounds involves the administration of the compound, in an appropriate form, to the animal. Administration is by any route that could be utilized for clinical or non-clinical puφoses, including but not limited to oral, nasal, buccal, or even topical. Alternatively, administration may be by intratracheal instillation, bronchial instillation, intradermal, subcutaneous, intramuscular, intraperitoneal or intravenous injection. Specifically contemplated routes are systemic intravenous injection, regional administration via blood or lymph supply, or directly to an affected site.

Determining the effectiveness of a compound in vivo may involve a variety of different criteria. Also, measuring toxicity and dose response can be performed in animals in a more meaningful fashion than in in vitro or in cyto assays. VIII. Pharmaceutical Compositions

A. Pharmaceutically Acceptable Carriers

Aqueous compositions of the present invention comprise an effective amount of a dominant negative mutant sequence or constitutively active mutant sequence of Myo/Vl, or pharmaceutically acceptable salts thereof or the dominant negative mutant sequence or constitutively active mutant sequence, polypeptide, peptide, epitopic core region, inhibitor, and/or such like, dissolved and/or dispersed in a pharmaceutically acceptable carrier and/or aqueous medium. Aqueous compositions of gene therapy vectors expressing any of the foregoing are also contemplated.

The phrases "pharmaceutically and/or pharmacologically acceptable" refer to molecular entities and/or compositions that do not produce an adverse, allergic and/or other untoward reaction when administered to an animal, as appropriate. As used herein, "pharmaceutically acceptable carrier" includes any and/or all solvents, dispersion media, coatings, antibacterial and/or antifungal agents, isotonic and/or absoφtion delaying agents and/or the like. The use of such media and/or agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional media and/or agent is incompatible with the active ingredient, its use in the therapeutic compositions is contemplated. Supplementary active ingredients can also be incoφorated into the compositions. For human administration, preparations should meet sterility, pyrogenicity, general safety and/or purity standards as required by FDA Office of Biologies standards.

The biological material, should be extensively dialyzed to remove undesired small molecular weight molecules and/or lyophilized for more ready formulation into a desired vehicle, where appropriate. The active compounds may generally be formulated for parenteral administration, e.g., formulated for injection via the intravenous, intramuscular, sub-cutaneous, intralesional, and/or even intraperitoneal routes. The preparation of an aqueous compositions that contain an effective amount of dominant negative mutant sequence or constitutively active mutant sequence of MyoNl or pharmaceutically acceptable salts thereof as an active component and/or ingredient is known to those of skill in the art in light of the present disclosure. Typically, such compositions can be prepared as injectables, either as liquid solutions and/or suspensions; solid forms suitable for using to prepare solutions and/or suspensions upon the addition of a liquid prior to injection can also be prepared; and/or the preparations can also be emulsified.

The pharmaceutical forms suitable for injectable use include sterile aqueous solutions and/or dispersions; formulations including sesame oil, peanut oil and/or aqueous propylene glycol; and/or sterile powders for the extemporaneous preparation of sterile injectable solutions and/or dispersions. In all cases the form must be sterile and/or must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and/or storage and/or must be preserved against the contaminating action of microorganisms, such as bacteria and/or fungi.

Solutions of the active compounds as free base and/or pharmacologically acceptable salts can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and/or mixtures thereof and/or in oils. Under ordinary conditions of storage and/or use, these preparations contain a preservative to prevent the growth of microorganisms. Dominant negative mutant sequence or constitutively active mutant sequence of Myo/Vl protein, polypeptide, peptide, agonist and/or antagonist of the present invention can be formulated into a composition in a neutral and/or salt form. Pharmaceutically acceptable salts, include the acid addition salts (formed with the free amino groups of the protein) and/or which are formed with inorganic acids such as, for example, hydrochloric and/or phosphoric acids, and/or such organic acids as acetic, oxalic, tartaric, mandelic, and/or the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, and/or ferric hydroxides, and/or such organic bases as isopropyl amine, trimethylamine, histidine, procaine and/or the like. In terms of using peptide therapeutics as active ingredients, the technology of U.S. Patents 4,608,251; 4,601,903; 4,599,231; 4,599,230; 4,596,792; and/or 4,578,770, each incoφorated herein by reference, may be used.

The carrier can also be a solvent and/or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and/or liquid polyethylene glycol, and/or the like), suitable mixtures thereof, and/or vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and/or by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and/or antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and/or the like. In many cases, it is preferable to include isotonic agents, for example, sugars and/or sodium chloride. Prolonged absoφtion of the injectable compositions can be brought about by the use in the compositions of agents delaying absoφtion, for example, aluminum monostearate and/or gelatin.

Sterile injectable solutions are prepared by incoφorating the active compounds in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incoφorating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and/or the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum-drying and/or freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof. The preparation of more, and/or highly, concentrated solutions for direct injection is also contemplated, where the use of DMSO as solvent is envisioned to result in extremely rapid penetration, delivering high concentrations of the active agents to a small tumor area.

Upon formulation, solutions are administered in a manner compatible with the dosage formulation and/or in such amount as is therapeutically effective. The formulations are easily administered in a variety of dosage forms, such as the type of injectable solutions described above, but drug release capsules and/or the like can also be employed.

For parenteral administration in an aqueous solution, for example, the solution should be suitably buffered if necessary and/or the liquid diluent first rendered isotonic with sufficient saline and/or glucose. These particular aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous and/or intraperitoneal administration. In this connection, sterile aqueous media which can be employed are known to those of skill in the art in light of the present disclosure. For example, one dosage could be dissolved in 1 ml of isotonic NaCI solution and/or either added to 1000 ml of hypodermoclysis fluid and/or injected at the proposed site of infusion, (see for example, "Remington's Pharmaceutical Sciences" 15th Edition, pages 1035-1038 and/or 1570-1580). Some variation in dosage necessarily occurs depending on the condition of the subject being treated. The person responsible for administration, in any event, determines the appropriate dose for the individual subject.

The dominant negative mutant sequence or constitutively active mutant sequence of Myo/Nl or active Myo/Vl protein-derived peptides and/or agents may be formulated within a therapeutic mixture to comprise about 0.0001 to 1.0 milligrams, and/or about 0.001 to 0.1 milligrams, and/or about 0.1 to 1.0 and/or even about 10 milligrams per dose and/or so. Multiple doses can also be administered.

In addition to the compounds formulated for parenteral administration, such as intravenous and/or intramuscular injection, other pharmaceutically acceptable forms include, e.g., tablets and/or other solids for oral administration; liposomal formulations; time release capsules; and/or any other form currently used, including cremes.

One may also use nasal solutions and/or sprays, aerosols and/or inhalants in the present invention. Nasal solutions are usually aqueous solutions designed to be administered to the nasal passages in drops and/or sprays. Nasal solutions are prepared so that they are similar in many respects to nasal secretions, so that normal ciliary action is maintained. Thus, the aqueous nasal solutions usually are isotonic and/or slightly buffered to maintain a pH of 5.5 to 6.5. In addition, antimicrobial preservatives, similar to those used in ophthalmic preparations, and/or appropriate drug stabilizers, if required, may be included in the formulation. Various commercial nasal preparations are known and or include, for example, antibiotics and/or antihistamines and/or are used for asthma prophylaxis.

Additional formulations which are suitable for other modes of administration include vaginal suppositories and/or pessaries. A rectal pessary and/or suppository may also be used. Suppositories are solid dosage forms of various weights and/or shapes, usually medicated, for insertion into the rectum, vagina and/or the urethra. After insertion, suppositories soften, melt and/or dissolve in the cavity fluids. In general, for suppositories, traditional binders and/or carriers may include, for example, polyalkylene glycols and/or triglycerides; such suppositories may be formed from mixtures containing the active ingredient in the range of 0.5% to 10%, preferably l%-2%.

Oral formulations include such normally employed excipients as, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate and/or the like. These compositions take the form of solutions, suspensions, tablets, pills, capsules, sustained release formulations and/or powders. In certain defined embodiments, oral pharmaceutical compositions comprise an inert diluent and/or assimilable edible carrier, and/or they may be enclosed in hard and/or soft shell gelatin capsule, and/or they may be compressed into tablets, and/or they may be incoφorated directly with the food of the diet. For oral therapeutic administration, the active compounds may be incoφorated with excipients and/or used in the form of ingestible tablets, buccal tables, troches, capsules, elixirs, suspensions, syrups, wafers, and/or the like. Such compositions and/or preparations should contain at least 0.1% of active compound. The percentage of the compositions and/or preparations may, of course, be varied and/or may conveniently be between about 2 to about 75%> of the weight of the unit, and/or preferably between 25-60%. The amount of active compounds in such therapeutically useful compositions is such that a suitable dosage is obtained.

The tablets, troches, pills, capsules and/or the like may also contain the following: a binder, as gum tragacanth, acacia, comstarch, and/or gelatin; excipients, such as dicalcium phosphate; a disintegrating agent, such as com starch, potato starch, alginic acid and/or the like; a lubricant, such as magnesium stearate; and/or a sweetening agent, such as sucrose, lactose and/or saccharin may be added and/or a flavoring agent, such as peppermint, oil of wintergreen, and/or cherry flavoring. When the dosage unit form is a capsule, it may contain, in addition to materials of the above type, a liquid carrier. Various other materials may be present as coatings and/or to otherwise modify the physical form of the dosage unit. For instance, tablets, pills, and/or capsules may be coated with shellac, sugar and/or both. A syrup of elixir may contain the active compounds sucrose as a sweetening agent methyl and/or propylparabens as preservatives, a dye and/or flavoring, such as cherry and/or orange flavor.

B. Therapeutically Effective Level

As used in the present invention, a compound is therapeutically effective if it decreases, delays or eliminates the onset of a cardiovascular disease or if it decreases, delays or improves any symptom associated with a cardiovascular disease or reduces levels of NFkB p50 homodimers. A skilled artisan readily recognizes that in many of these cases the compound may not provide a cure but may only provide partial benefit. A physiological change having some benefit is considered therapeutically beneficial. Thus, an amount of compound which provides a physiological change is considered an "effective amount" or a therapeutically effective amount."

A compound, molecule or composition is said to be "pharmacologically acceptable" if its administration can be tolerated by a recipient mammal. Such an agent is said to be administered in a "therapeutically effective amount" if the amount administered is physiologically significant. An agent is physiologically significant if its presence results in technical change in the physiology of a recipient mammal. For example, in the treatment of cardiovascular disease of the present invention, a compound is therapeutically effective if it (i) decreases NFkB p50 homodimer levels, or (ii) decreases MyoNl levels, or (3) delays onset of symptoms of the cardiovascular disease, or (iv) improves symptoms of the cardiovascular disease. IX. Lipid Formulations and/or Νanocapsules

In certain embodiments, the use of lipid formulations and/or nanocapsules is contemplated for the introduction of dominant negative mutant sequence or constitutively active mutant sequence of Myo/Vl or pharmaceutically acceptable salts or MyoNl protein, polypeptides, peptides and/or agents, and/or gene therapy vectors, including both wild-type and/or antisense vectors, into host cells.

Νanocapsules can generally entrap compounds in a stable and/or reproducible way. To avoid side effects due to intracellular polymeric overloading, such ultrafine particles (sized around 0.1 μm) should be designed using polymers able to be degraded in vivo. Biodegradable polyalkyl-cyanoacrylate nanoparticles that meet these requirements are contemplated for use in the present invention, and/or such particles may be easily made.

In a preferred embodiment of the invention, the dominant negative mutant sequence or constitutively active mutant sequence of Myo/Vl or pharmaceutically acceptable salts may be associated with a lipid. The dominant negative mutant sequence or constitutively active mutant sequence of Myo/Vl or pharmaceutically acceptable salts associated with a lipid may be encapsulated in the aqueous interior of a liposome, interspersed within the lipid bilayer of a liposome, attached to a liposome via a linking molecule that is associated with both the liposome and the oligonucleotide, entrapped in a liposome, complexed with a liposome, dispersed in a solution containing a lipid, mixed with a lipid, combined with a lipid, contained as a suspension in a lipid, contained or complexed with a micelle, or otherwise associated with a lipid. The lipid or lipid/dominant negative mutant sequence or constitutively active mutant sequence of Myo/Vl or pharmaceutically acceptable salts- associated compositions of the present invention are not limited to any particular structure in solution. For example, they may be present in a bilayer structure, as micelles, or with a "collapsed" structure. They may also simply be interspersed in a solution, possibly forming aggregates which are not uniform in either size or shape.

Lipids are fatty substances which may be naturally occurring or synthetic lipids. For example, lipids include the fatty droplets that naturally occur in the cytoplasm as well as the class of compounds which are well known to those of skill in the art which contain long-chain aliphatic hydrocarbons and their derivatives, such as fatty acids, alcohols, amines, amino alcohols, and aldehydes.

Phospholipids may be used for preparing the liposomes according to the present invention and may carry a net positive, negative, or neutral charge. Diacetyl phosphate can be employed to confer a negative charge on the liposomes, and stearylamine can be used to confer a positive charge on the liposomes. The liposomes can be made of one or more phospholipids.

A neutrally charged lipid can comprise a lipid with no charge, a substantially uncharged lipid, or a lipid mixture with equal number of positive and negative charges. Suitable phospholipids include phosphatidyl cholines and others that are well known to those of skill in the art.

Lipids suitable for use according to the present invention can be obtained from commercial sources. For example, dimyristyl phosphatidylcholine ("DMPC") can be obtained from Sigma Chemical Co., dicetyl phosphate ("DCP") is obtained from K & K Laboratories (Plainview, NY); cholesterol ("Choi") is obtained from Calbiochem-Behring; dimyristyl phosphatidylglycerol ("DMPG") and other lipids may be obtained from Avanti Polar Lipids, Inc. (Birmingham, Ala.). Stock solutions of lipids in chloroform or chloroform/methanol can be stored at about -20°C. Preferably, chloroform is used as the only solvent since it is more readily evaporated than methanol.

Phospholipids from natural sources, such as egg or soybean phosphatidylcholine, brain phosphatidic acid, brain or plant phosphatidylinositol, heart cardiohpin and plant or bacterial phosphatidyl ethanolamine are preferably not used as the primary phosphatide, i.e., constituting 50% or more of the total phosphatide composition, because of the instability and leakiness of the resulting liposomes.

"Liposome" is a generic term encompassing a variety of single and multilamellar lipid vehicles formed by the generation of enclosed lipid bilayers or aggregates. Liposomes may be characterized as having vesicular stmctures with a phospholipid bilayer membrane and an inner aqueous medium. Multilamellar liposomes have multiple lipid layers separated by aqueous medium. They form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid components undergo self-rearrangement before the formation of closed stmctures and entrap water and dissolved solutes between the lipid bilayers (Ghosh and Bachhawat, 1991). However, the present invention also encompasses compositions that have different stmctures in solution than the normal vesicular stmcture. For example, the lipids may assume a micellar stmcture or merely exist as nonuniform aggregates of lipid molecules. Also contemplated are lipofectamine-nucleic acid complexes.

Phospholipids can form a variety of stmctures other than liposomes when dispersed in water, depending on the molar ratio of lipid to water. At low ratios the liposome is the preferred stmcture. The physical characteristics of liposomes depend on pH, ionic strength and/or the presence of divalent cations. Liposomes can show low permeability to ionic and/or polar substances, but at elevated temperatures undergo a phase transition which markedly alters their permeability. The phase transition involves a change from a closely packed, ordered stmcture, known as the gel state, to a loosely packed, less-ordered stmcture, known as the fluid state. This occurs at a characteristic phase-transition temperature and/or results in an increase in permeability to ions, sugars and/or dmgs.

Liposomes interact with cells via four different mechanisms: Endocytosis by phagocytic cells of the reticuloendothelial system such as macrophages and/or neutrophils; adsoφtion to the cell surface, either by nonspecific weak hydrophobic and/or electrostatic forces, and/or by specific interactions with cell-surface components; fusion with the plasma cell membrane by insertion of the lipid bilayer of the liposome into the plasma membrane, with simultaneous release of liposomal contents into the cytoplasm; and/or by transfer of liposomal lipids to cellular and or subcellular membranes, and/or vice versa, without any association of the liposome contents. Varying the liposome formulation can alter which mechanism is operative, although more than one may operate at the same time.

Liposome-mediated oligonucleotide delivery and expression of foreign DNA in vitro has been very successful. Wong et al (1980) demonstrated the feasibility of liposome-mediated delivery and expression of foreign DNA in cultured chick embryo, HeLa and hepatoma cells. Nicolau et al (1987) accomplished successful liposome-mediated gene transfer in rats after intravenous injection.

In certain embodiments of the invention, the lipid may be associated with a hemagglutinating vims (HVJ). This has been shown to facilitate fusion with the cell membrane and promote cell entry of liposome-encapsulated DNA (Kaneda et al, 1989). In other embodiments, the lipid may be complexed or employed in conjunction with nuclear non-histone chromosomal proteins (HMG-1) (Kato et al, 1991). In yet further embodiments, the lipid may be complexed or employed in conjunction with both HVJ and HMG-1. In that such expression vectors have been successfully employed in transfer and expression of an oligonucleotide in vitro and in vivo, then they are applicable for the present invention. Where a bacterial promoter is employed in the DNA constmct, it also is desirable to include within the liposome an appropriate bacterial polymerase.

Liposomes used according to the present invention can be made by different methods. The size of the liposomes varies depending on the method of synthesis. A liposome suspended in an aqueous solution is generally in the shape of a spherical vesicle, having one or more concentric layers of lipid bilayer molecules. Each layer consists of a parallel array of molecules represented by the formula XY, wherein X is a hydrophilic moiety and Y is a hydrophobic moiety. In aqueous suspension, the concentric layers are arranged such that the hydrophilic moieties tend to remain in contact with an aqueous phase and the hydrophobic regions tend to self-associate. For example, when aqueous phases are present both within and without the liposome, the lipid molecules may form a bilayer, known as a lamella, of the arrangement XY-YX. Aggregates of lipids may form when the hydrophilic and hydrophobic parts of more than one lipid molecule become associated with each other. The size and shape of these aggregates depends upon many different variables, such as the nature of the solvent and the presence of other compounds in the solution.

Liposomes within the scope of the present invention can be prepared in accordance with known laboratory techniques. In one preferred embodiment, liposomes are prepared by mixing liposomal lipids, in a solvent in a container, e.g., a glass, pear-shaped flask. The container should have a volume ten-times greater than the volume of the expected suspension of liposomes. Using a rotary evaporator, the solvent is removed at approximately 40°C under negative pressure. The solvent normally is removed within about 5 min. to 2 hours, depending on the desired volume of the liposomes. The composition can be dried further in a desiccator under vacuum. The dried lipids generally are discarded after about 1 week because of a tendency to deteriorate with time.

Dried lipids can be hydrated at approximately 25-50 mM phospholipid in sterile, pyrogen-free water by shaking until all the lipid film is resuspended. The aqueous liposomes can be then separated into aliquots, each placed in a vial, lyophilized and sealed under vacuum.

In the alternative, liposomes can be prepared in accordance with other known laboratory procedures: the method of Bangham et al (1965), the contents of which are incoφorated herein by reference; the method of Gregoriadis, as described in DRUG CARRIERS IN BIOLOGY AND MEDICINE, G. Gregoriadis ed. (1979) pp. 287-341, the contents of which are incoφorated herein by reference; the method of Deamer and Uster (1983), the contents of which are incoφorated by reference; and the reverse-phase evaporation method as described by Szoka and Papahadjopoulos (1978). The aforementioned methods differ in their respective abilities to entrap aqueous material and their respective aqueous space-to-lipid ratios.

The dried lipids or lyophilized liposomes prepared as described above may be dehydrated and reconstituted in a solution of inhibitory peptide and diluted to an appropriate concentration with an suitable solvent, e.g., DPBS. The mixture is then vigorously shaken in a vortex mixer. Unencapsulated nucleic acid is removed by centrifugation at 29,000 x g and the liposomal pellets washed. The washed liposomes are resuspended at an appropriate total phospholipid concentration, e.g., about 50-200 mM. The amount of nucleic acid encapsulated can be determined in accordance with standard methods. After determination of the amount of nucleic acid encapsulated in the liposome preparation, the liposomes may be diluted to appropriate concentrations and stored at 4°C until use. A pharmaceutical composition comprising the liposomes usually includes a sterile, pharmaceutically acceptable carrier or diluent, such as water or saline solution. X. Kits

Therapeutic kits of the present invention are kits comprising dominant negative mutant sequence of Myo/Vl or constitutively active mutant sequence of Myo/Vl or any Myo/Vl protein, polypeptide, peptide, inhibitor, gene, vector and/or other Myo/Vl effector. Such kits generally contain, in suitable container means, a pharmaceutically acceptable formulation of dominant negative mutant sequence of Myo/Vl or constitutively active mutant sequence of Myo/Nl or any Myo/Nl protein, polypeptide, peptide, domain, inhibitor, and/or a gene and/or vector expressing any of the foregoing in a pharmaceutically acceptable formulation. The kit may have a single container means, and/or it may have distinct container means for each compound.

When the components of the kit are provided in one and/or more liquid solutions, the liquid solution is an aqueous solution, with a sterile aqueous solution being particularly preferred. The dominant negative mutant sequence of MyoNl or constitutively active mutant sequence of Myo/Vl or any MyoNl protein, polypeptide, peptide, domain, inhibitor, or effector compositions may also be formulated into a syringeable composition. In which case, the container means may itself be a syringe, pipette, and/or other such like apparatus, from which the formulation may be applied to an infected area of the body, injected into an animal, and/or even applied to and/or mixed with the other components of the kit.

However, the components of the kit may be provided as dried powder(s). When reagents and/or components are provided as a dry powder, the powder can be reconstituted by the addition of a suitable solvent. It is envisioned that the solvent may also be provided in another container means.

The container means generally includes at least one vial, test tube, flask, bottle, syringe and/or other container means, into which the dominant negative mutant sequence of Myo/Nl or constitutively active mutant sequence of MyoNl or any Myo/Nl protein, polypeptide, peptide, domain, inhibitor, or effector formulation are placed, preferably, suitably allocated. The kits may also comprise a second container means for containing a sterile, pharmaceutically acceptable buffer and/or other diluent.

The kits of the present invention also typically include a means for containing the vials in close confinement for commercial sale, such as, e.g., injection and/or blow-molded plastic containers into which the desired vials are retained. Irrespective of the number and/or type of containers, the kits of the invention may also comprise, and/or be packaged with, an instmment for assisting with the injection/administration and/or placement of the ultimate dominant negative mutant sequence of Myo/Vl or constitutively active mutant sequence of MyoNl or any Myo/Vl protein, polypeptide, peptide, domain, inhibitor, or effector within the body of an animal. Such an instmment may be a syringe, pipette, forceps, and/or any such medically approved delivery vehicle. XI. Gene Therapy Administration

For gene therapy, a skilled artisan would be cognizant that the vector to be utilized must contain the gene of interest operatively limited to a promoter. For antisense gene therapy, the antisense sequence of the gene of interest would be operatively linked to a promoter. For promoter therapy, specific ΝFKB repressor or enhancer sites are introduced as contiguous DΝA double-stranded molecules with weak promoter properties. This kind of therapy effects native transcription factors in the cell, namely ΝFKB and/or ETS. In this embodiment, there is no gene expression from the repressor or enhancer sites within the vector, but they are effective in titrating endogenous ΝFkB and/or ETS transcription factors away from normal functioning sites. One skilled in the art recognizes that in certain instances other sequences such as a 3' UTR regulatory sequences are useful in expressing the gene of interest. Where appropriate, the gene therapy vectors can be formulated into preparations in solid, semisolid, liquid or gaseous forms in the ways known in the art for their respective route of administration. Means known in the art can be utilized to prevent release and absoφtion of the composition until it reaches the target organ or to ensure timed-release of the composition. A pharmaceutically acceptable form should be employed which does not ineffectuate the compositions of the present invention. In pharmaceutical dosage forms, the compositions can be used alone or in appropriate association, as well as in combination, with other pharmaceutically active compounds. A sufficient amount of vector containing the therapeutic nucleic acid sequence must be administered to provide a pharmacologically effective dose of the gene product.

One skilled in the art recognizes that different methods of delivery may be utilized to administer a vector into a cell. Examples include: (1) methods utilizing physical means, such as electroporation (electricity), a gene gun (physical force) or applying large volumes of a liquid (pressure); and (2) methods wherein said vector is complexed to another entity, such as a liposome or transporter molecule. Accordingly, the present invention provides a method of transferring a therapeutic gene to a host, which comprises administering the vector of the present invention, preferably as part of a composition, using any of the aforementioned routes of administration or alternative routes known to those skilled in the art and appropriate for a particular application. Effective gene transfer of a vector to a host cell in accordance with the present invention to a host cell can be monitored in terms of a therapeutic effect (e.g. alleviation of some symptom associated with the particular disease being treated) or, further, by evidence of the transferred gene or expression of the gene within the host (e.g., using the polymerase chain reaction in conjunction with sequencing, Northern or Southern hybridizations, or transcription assays to detect the nucleic acid in host cells, or using immunoblot analysis, antibody-mediated detection, mRNA or protein half-life studies, or particularized assays to detect protein or polypeptide encoded by the transferred nucleic acid, or impacted in level or function due to such transfer).

These methods described herein are by no means all-inclusive, and further methods to suit the specific application are apparent to the ordinary skilled artisan. Moreover, the effective amount of the compositions can be further approximated through analogy to compounds known to exert the desired effect.

Furthermore, the actual dose and schedule can vary depending on whether the compositions are administered in combination with other pharmaceutical compositions, or depending on interindividual differences in pharmacokinetics, dmg disposition, and metabolism. Similarly, amounts can vary in in vitro applications depending on the particular cell line utilized (e.g. , based on the number of vector receptors present on the cell surface, or the ability of the particular vector employed for gene transfer to replicate in that cell line). Furthermore, the amount of vector to be added per cell likely vary with the length and stability of the therapeutic gene inserted in the vector, as well as also the nature of the sequence, and is particularly a parameter which needs to be determined empirically, and can be altered due to factors not inherent to the methods of the present invention (for instance, the cost associated with synthesis). One skilled in the art can easily make any necessary adjustments in accordance with the exigencies- of the particular situation.

It is possible that cells containing the therapeutic gene may also contain a suicide gene (i.e., a gene which encodes a product that can be used to destroy the cell, such as heφes simplex vims thymidine kinase). In many gene therapy situations, it is desirable to be able to express a gene for therapeutic puφoses in a host cell but also to have the capacity to destroy the host cell once the therapy is completed, becomes uncontrollable, or does not lead to a predictable or desirable result. Thus, expression of the therapeutic gene in a host cell can be driven by a promoter although the product of said suicide gene remains harmless in the absence of a prodmg. Once the therapy is complete or no longer desired or needed, administration of a prodmg causes the suicide gene product to become lethal to the cell. Examples of suicide gene/prodrug combinations which may be used are Heφes Simplex Virus-thymidine kinase (HSV-tk) and ganciclovir, acyclovir or FIAU; oxidoreductase and cycloheximide; cytosine deaminase and 5-fluorocytosine; thymidine kinase thymidilate kinase (Tdk::Tmk) and AZT; and deoxycytidine kinase and cytosine arabinoside.

The method of cell therapy may be employed by methods known in the art wherein a cultured cell containing a copy of a nucleic acid sequence or amino acid sequence of a sequence of interest is introduced.

EXAMPLES

The following examples are offered by way of example, and are not intended to limit the scope of the invention in any manner.

EXAMPLE 1 INTRACELLULAR LOCALIZATION OF MYO V1

Indirect immunofluorescence studies by known methods in the art with a polyclonal antibody raised against the full-length recombinant MyoNl protein. Under basal conditions,

Myo/Vl protein is primarily localized in the cytoplasm (cytoskeleton) of rat cardiac myocytes (FIG. 11 A), non-myocytes (FIG. 11B) and in adult feline myocardium (FIG. 11C).

However, in human HeLa cells (FIG. 11D) Myo/Vl showed extensive perinuclear and

"spotted" nuclear localization even under basal conditions.

EXAMPLE 2

IN VIVO AND IN VITRO INTERACTION OF MYO/V1

WITH IκB AND NFKB PROTEINS

Myo/Vl was shown to directly interact with NFKB proteins in vivo. Phorbol ester treated HeLa cell extracts were first immunoprecipitated individually with p50, p65 and c-rel antibodies by standard methods in the art. The precipitated proteins were separated on a SDS- PAGE and an immunowestem blot analysis was performed using Myo/Vl specific antibodies. The results (FIG. 12A) showed that while a dimeric form of Myo/Vl (24 kD) coimmunoprecipitated with all NFκB/rel antibodies, a 12 kD monomeric form of Myo/Vl was co-immunoprecipitated with c-rel. Since ankyrin repeats can dimerize, the observation of 24 kD MyoNl dimer in the coprecipitation experiments was not unexpected. To further confirm that Myo/Vl is directly interacting with ΝFKB and IκB proteins in vitro, the GST- fusion proteins of p50, c-rel and IκB were incubated (Santa Cruz-4094; 70 kD) separately with Histidine-Tagged-Myo/Vl bound nickel resin and the nickel resin, bound protein complexes were extensively washed several times with 1M ΝaCl. The MyoNl-bound proteins were eluted and then examined using immunowestem blot analysis with specific pooled antibodies directed against c-rel, IκB and p50 antibodies. The results (FIG. 12B) clearly show that all of the ΝFKB and IκBα proteins tested were co-purifying with Myo/Vl protein.

EXAMPLE 3 MYO/V1 INTERACTION WITH NFKB IN JURKAT T CELLS

It was previously shown (FIG.13) (Sivasubramanian et al, 1996) that the addition of recombinant MyoNl to nuclear extracts of Jurkat T lymphocyte cells leads to the dismption of the native ΝFKB complex into a slower migrating complex (SC) which could be supershifted mostly by p50 specific antibodies and not by p65 antibodies. Since these 'SC complexes were observed even in phorbal-ester induced Jurkat T cell nuclear extracts where recombinant MyoNl was not added (lane 1 in FIG. 13), an immunowestem analysis with

Myo/Nl specific antibodies was conducted (lane WB-JΝE). The Jurkat T cell nuclear extract obtained from Santa Cmz Biotech already contained low levels of MyoNl (lane WB-JΝΕ ) which further supports the nuclear function for Myo/Vl protein.

EXAMPLE 4 RECOMBINANT MYO/V1 IS PHOSPHORYLATED IN VITRO BY ERK

A potential phosphorylation site 'TP' (proline directed Threonine) is located very near to the putative ETS-interacting Lysine residue at position #66. This site was characterized for phosphorylation capabilities in vitro by a MAPK enzyme like ERK. Highly active ERK was captured from ras activated cellular extract (positive control extract in a ERK kinase assay kit) using agarose conjugated ERK antibodies and cold recombinant MyoNl protein was added as a substrate to the ERK reaction along with γ-ATP. After incubation, a MyoNl antibody was added, immunoprecipitated and the complexes were fractionated on a SDS- PAGE (FIG. 14). The results indicate that this site is phosphorylated in vitro by ERK. Using an expression vector carrying Constitutively-Active ERK kinase, in vivo experiments are conducted to demonstrate the in vivo phosphorylation of this site. Moreover, further analysis of this site by a 'neural network phosphorylation site prediction program' indicates that a serine residue (TPLLS) which is located 4 residues from the threonine residue can also be phosphorylated. Thus, it appears that the site TPLLS is a dually phosphorylated site and phosphorylation occurs by a combination of GSK3 (Glycogen Synthase Kinase-3) and Casein kinase-I in vivo in addition to MAPK enzymes.

EXAMPLE 5 MYO/V1 MODULATES ETS-DNA BINDING ACTIVITY IN VITRO

The analysis of published NMR and X-ray stmctural data (FIG. 1 through 3) indicated that MyoNl is an orthologue of GABPβ and IκBα family of ankyrin repeat-containing proteins. Thus, a direct interaction of Myo/Vl with ETS family of factors was performed in vitro similar to the ΝFKB interaction observed elsewhere. For this puφose, purified recombinant MyoNl isolated from E. coli was utilized. (FIG. 15). Phorbol-ester treated

Jurkat T cell cellular extracts were obtained from Santa Cruz Biotech Inc., and ETS-GSA assays were conducted using radiolabelled ETS oligo (FIG. 16). With increasing concentrations of MyoNl, a stimulation in ETS-DΝA binding was observed. At high concentrations, MyoNl inhibited ETS-DΝA binding activity. ETS can bind to its target sequences as monomers. This stimulatory effect was also observed both in the monomers as well as in the multimers.

EXAMPLE 6

MYO/V1 CONVERTS TRANSCRIPTIONALLY ACTIVE NFKB P50-P65

HETERODIMERS TO REPRESSIVE P50-P50 HOMODIMERS IN VITRO

Unlike IκB family proteins which exhibits complete inhibition of κB-DNA binding activity, Myo/Vl rearranged the NFKB complexes in Jurkat T cell nuclear extracts. This finding indicated that one of the main function for this protein is to influence oligomerization of NFKB transcription factors. This was further demonstrated with NFKB dimerization studies. A highly purified truncated pΔ65/RelA protein was obtained, which contains only the 'rel' DNA binding domain (l-325aa) and is used along with the purified p50 protein for the in vitro gel-shift assays (GSA). Because of the truncation, the pΔ65 protein dimers migrate faster in the GSA gels.

Briefly, the different NFKB dimers were pre-formed in vitro using highly purified p50 and pΔ65 NFKB subunits. After generating the dimers, highly purified recombinant Myo/Vl (see FIG. 15) protein was added to the pre-formed dimers (p50-p50 homodimers, p50-pΔ65 heterodimers and pΔ65-pΔ65 heterodimers) at indicated concentrations, and gel-shift assays (GSA) were conducted to study the effects of MyoNl on ΝFKB dimers (FIG. 17 and 18). For FIG. 17, lanes 10-12 show mostly p50-p65 heterodimers and 13-14 show mostly p50 homodimers. The NFkB dimmer mobility shifts are similar to the NFkB EMSA shown in

FIG. 19. Super-shift experiments with NFkB antibodies are also performed by methods well known in the art.

Myo/Vl exhibited three functional activities on NFKB dimers: (1) MyoNl accelerated the formation of p50-p50 homodimers when only p50 was present in the GSA reaction (lanes 2-4 in FIG. 17). This indicates that Myo/Vl could potentially act as a catalyst in vivo in the cytoplasm to generate the p50-p50 homodimers either from the pi 05 precursor protein or from the already processed p50 proteins; (2) Secondly, a subtle upward-shift in the mobility of the dimers occurred when Myo/Vl was added to the p50-p65 heterodimers

(lanes 11-14 in FIG. 17). This subtle shift was not observed when Myo/Vl was incubated with p50 or p65 proteins alone (lanes 6-9 in FIG. 17). This subtle upward-shift of dimers strongly indicates that p50-p65 heterodimers are being converted to p50-p50 homodimers.

The observed subtle upward-shift in the mobility of ΝFKB p50-p65 heterodimer to p50-p50 homodimer in FIG. 19 is consistent with previously published data for ΝFKB (Pan and

McEver, 1995; Marks-Konczalik et al, 1998). More elaborate studies were conducted after the initial observation of Myo/Nl splitting the heterodimers. The same experiment was repeated with wide ranges of concentration of Myo/Nl (FIG. 18) protein. Again, the conversion of heterodimers to homodimers with 50-150 ng of MyoNl was observed.

Interestingly, at very high concentrations of Myo/Vl (500ng to 800ng), the freed pΔ65 subunits from the splitting of the heterodimers (three arrows in FIG. 18) started to appear in the GSA. The function of the heterodimers is to enhance the transcription of target genes, and the homodimers are known for its repressive functions, thus, MyoNl splitting of the heterodimers is a significant target for facilitating generation of p50 homodimers. Finally, when Myo/Nl was added to pΔ65 alone (lanes 6-9 in FIG. 17), p65-p65 homodimers did not exhibit any effect. These observations indicate that MyoNl regulates ΝFKB through dimer reorganization.

EXAMPLE 7 P50-P50 HOMODIMERS IN MOUSE MODEL WITH HEART FAILURE

The significance of p50-p50 homodimers was investigated in an animal model of heart failure. The high-affinity binding sites for the different NFKB dimers and is shown below: KB 5'-GTAGGGGCTTTTCCGAGCT-3' (SEQ ID NO:87) for p50-p65 heterodimers

50-14 5'-GTAGGGGGCCTCCCCGGC-3' (SEQ ID NO:88) for p50 homodimers

65-2 5'-GTACCGGAAATTCCGGGC-3' (SEQ ID NO: 89) for p65 homodimers

Kunsch and his colleagues (1992) showed that "GC" rich KB enhancer sequences, especially in the central four nucleotides of the KB site showed strong affinity towards p50- p50 homodimers compared to other NFKB dimers. Heterodimers showed strong affinity towards "AT" rich KB sites. A skilled artisan is thus aware that an NFkB repressor sequence is one which is GC-rich and, therefore, binds NFkB p50 homodimers preferentially, compared to NFkB p50-p65 heterodimers. This is illustrated by the highlighted portions of SEQ ID NO:87, SEQ ID NO:88 and SEQ ID NO:89 which have a GC-rich region for p50 homodimer binding. It is preferential to have no more than 2 A's, 2 T's, or an A/T combination in the GC-rich sequence. A skilled artisan is also aware that the sequences on these oligonucleotides which flank the GC-rich NFkB p50 homodimer binding site are present for, for example, the puφose of stability of the protein binding and may be any sequence, although it is preferential to have approximately 3-10 of these nucleotides and more preferential to have approximately 3-5 of these nucleotides.

This evidence facilitated investigation of the significance of the p50-p50 homodimers. Elevation of Myo/Nl in failing human hearts, in addition to the splitting of the ΝFKB heterodimers and enhancing the p50 homodimer generation by Myo/Vl, suggests p50-p50 homodimers may be more abundant in failing hearts. Therefore, this possibility was examined in a transgenic mouse model for heart failure. The myocardial TΝFγ overexpressing transgenic mice were utilized. Briefly, nuclear extracts were isolated from the hearts of 12 week old MHCsTΝF transgenic mice with appropriate littermate controls and used in a ΝFKB gel-shift assay. Dimer-specific double-stranded KB oligos (sequences shown above) were utilized in the ΝFKB GSA to identify the relative levels of different ΝFKB dimers (FIG. 20). These data strongly indicate that p50-p50 homodimers are more abundant (lane 3 in FIG. 20) in failing mouse hearts compared to littermate controls (lane 1 in FIG. 20). Since p50-p50 homodimers are known for NFKB repressive activity, in failing hearts overall,

NFKB transcriptional repression dominates the transcriptional activation mediated by NFKB.

EXAMPLE 8 MYO/V1 MODULATES NFKB DEPENDENT TRANSCRIPTION

To characterize the functional significance of the Myo/Vl interaction with NFKB,

MyoNl was overexpressed in HeLa cells and in rat neonatal cardiac myocytes, and its influence on the native ΝFKB transcription process using luciferase reporter gene assay was determined. Soluble MyoNl is abundant in the nucleus of superinduced HeLa cells (FIG.

21). Two types of experiments were conducted. FIG. 22B (myocytes) shows that Myo/Vl influences the kappa-B enhancer directed transcription (kappa B enhancer containing- thymidine kinase promoter directed luciferase reporter gene) in a concentration dependent manner. Myo/Vl inhibited (four to five fold) the ΝFKB dependent transcription. The data shown here are from a single representative experiment (and hence there are no error bars) for each cell line, normalized for transfection efficiency and protein concentration. Myo/Vl was also overexpressed along with p65 subunit of ΝFKB using a p65 expression vector (obtained from ΝIH AIDS reagent distribution center) in HeLa cells (FIG. 22A). With increasing concentrations of Myo/Vl , decreased luciferase reporter activity was consistently observed.

EXAMPLE 9 ΝOΝ-SUSCEPTIBILITY OF P50 KNOCKOUT MICE TO EMCV

Strong evidence for the novel therapeutics described herein comes from the fact that 100%) of the p50^{" "} knockout mice are resistant to a vims (encephalomyocarditis - EMCV) which specifically infects heart (Schwarz et al, 1998; Sha et al., 1995). While pathogens infecting other organs are in fact infectious and cause mortality in these p50^_/"knockout mice, the EMCV which specifically infects the heart cannot multiply in these mice (Schwarz et al., 1998; Sha et al, 1995). In a specific embodiment, in the absence of p50, the EMCV could not compromise the contractile function of the heart in the pSO^^'knockout mice and thus could not multiply. This inteφretation is alternative in this regard to the published literature on p50^"/_ knockout mice. It is well known in the literature that during viral infection, NFKB is activated in mammalian cells. Therefore, in normal wild-type mice, NFKB would have been activated in the heart during EMCV infection in order to compromise the contractile function of the heart probably by generating p50-p50 homodimers. However, in p50^"A knockout mice since the vims could not compromise the contractile function of the heart because of the absence of p50, the EMCV could not multiply in the hearts of p50-/- knockout mice. Compromising the (contractile) function of any organ (heart) is a necessary event in order for any vims (EMCV) to multiply.

EXAMPLE 10 MYO/V1 DOMINANT-NEGATIVE MUTANTS AS PEPTIDE DRUGS

In a specific embodiment, dominant-negative (DN) Myo/Vl mutants (see Tables 3 and 5 and FIG. 23) are peptide dmgs for heart failure. In specific embodiments, these

Myo/Vl mutant peptides are screened against MyoNl-p50 or p50-ADR cell lines to identify the potential heart failure peptide dmgs. Once identified, these peptide drags are delivered as transducing therapeutic peptides or through gene therapy, such as adenoviral gene therapy. It is known in the art that if ser/thr residues in MyoNl are mutated to alanine residues, they behave as constitutively-active mutants. If the same residues are mutated to aspartic or glutamic residues, they behave as dominant-negative mutants.

TABLE 3: DESCRIPTION OF PROPOSED CONSTITUTIVELY-ACTIVE (CA) AND DOMINANT NEGATIVE (DN) MYO V1 MUTANTS.

These mutants inhibit or reduce the formation of p50-p50 homodimers in vivo. In another embodiment, these mutants also have a protein-transducing domains (PTD) to either N-terminus or carboxyl terminus of MyoNl protein to facilitate the migration of the protein inside the cell (Schwarze et al, 1999). Alternatively, these DΝ-Myo/Vl mutants are delivered in vivo to the failing human myocardium through gene therapy (adenoviral) approaches.

A skilled artisan is aware that, given that only a few amino acids are altered in the dominant negative mutant proteins, a skilled artisan is informed of the identity of the nucleic acid sequences, and these are within the scope of the present invention. That is, one amino acid residue is encoded by a triplet of nucleotides (called a codon), and the third nucleotide of the codon, called the "wobble position," is often interchangeable with any of the four nucleotides without changing the identity of the amino acid which the triplet codon encodes. This makes a very few number of nucleic acid sequences which can encode one corresponding amino acid residue. For example, with the DΝ-ERK dominant negative mutant sequence, an AP (alanine-proline) is made from a TP (threonine-proline) as present in wild type. A skilled artisan is aware from standard biochemistry or molecular biology texts (such as Biochemistry; Stryer, 1988; W.H. Freeman and Co.; New York) that proline is encoded by the following four codons: CCU, CCC, CCA and CCG; alanine is encoded by the following four codons: GCU, GCC, GCA and GCG; and threonine is encoded by the following four codons ACU, ACC, ACA and ACG. Thus, a skilled artisan is made aware from the few changes in the dominant negative mutant proteins of the relatively small number of nucleic acids that may generate those changes. The following specific nucleic acid sequences are within the scope of the present invention: CA-ERK (SEQ ID NO: 182), CA-

GSK3+CK-I (SEQ ID NO: 183); CA-CKII (SEQ ID NO: 184); CA-PKC (SEQ ID NO: 185);

DN-ERK (SEQ ID NO: 186); DN-GSK3+CK-I (SEQ ID NO: 187); DN-CKII (SEQ ID

NO: 188); DN-PKC (SEQ ID NO: 189).

EXAMPLE 11 P50-P50 DSDNA-SPECIFIC OLIGOS AS A ANTI-CARDIOVASCULAR

DISEASE COMPOUND

High affinity NFKB repressor sequences (p50-p50 homodimer specific) from specific adrenergic system genes (see Table 1) are utilized in the form of double-stranded DNA oligos or as PNAs (peptide nucleic acids) as competitive substrate inhibitors for p50-p50 homodimers in the failing human myocardium. Similar type of PNAs have already been shown to cross blood-brain barriers (Boado et al, 1998; Pardridge et al, 1995; Tyler et al, 1999).

Peptide Nucleic acids (PNAs) are designed (Tyler et al 1999) using the p50-p50 homodimer specific target repressor sites (Table 1, 8, 9) from βl-adrenergic receptor gene and Gsalpha gene promoters. These sites are synthesized as double stranded PNAs with one strand being the DNA backbone (that is, a phosphodiester bond) and the other strand being the peptide bond backbone. These chimeric PNAs are tested against the propriety (ρ50) cell lines for its p50-p50 homodimer-reducing biological activity.

Alternatively, recombinant non-infectious Adeno Associated Vimses (AAV) (Dutheil et al 2000) are generated using the following approach. Briefly, p50-p50 homodimer-specific high-affinity target repressor sites identified in various genes (such as are present in Table 1, 8, 9) are chosen and synthesized as 300-400 contiguous repressor sites (400 X 10 = 4000 bp + 1000 bp spacer sequences) of approximately 5 kb length and are introduced into the AAV particles. Such a recombinant AAV vims when introduced into the mammalian cell integrate into the human chromosome 19 into a muscle-specific DNA region 19ql3.3-qter. This event creates 400 high- affinity binding sites for the p50-p50 homodimers for the targeted myocardial cell. Using this gene therapy approach, abundant p50-p50 homodimers are titrated out from the failing myocardial cell. This therapy revives the gene expression from βl-adrenergic receptor and Gsalpha promoters. A skilled artisan is aware that other vectors for gene therapy may be used which are well known in the art, including adenovirus vectors retrovims vectors, and liposomes. EXAMPLE 12

STRUCTURE-FUNCTION RELATIONSHIP OF MYO/Vl'S DOMAINS IN

RELATION TO ETS AND NFKB MEDIATED TRANSCRIPTION PROCESSES.

In a specific embodiment, Myo/Vl possesses dual functions regulating both ETS and NFKB mediated transcription processes in vivo in neonatal and adult cardiac myocytes, and these functions can be separated through site-specific mutations on potential phosphorylation sites (TPLLS, TVK, TALE and DYVK) and through ETS-DNA-binding influencing Lysine residue at position #66.

Based on the three dimensional structure of Myo/Vl, GABPλ and IλBλ proteins, an ETS-interacting Lysine residue on Myo/Vl at position #66 was identified. Moreover, using a neural network algorithm which predicts potential phosphorylation sites with 69 to 96% accuracy (Blom et al, 1999; Kreegipuu et al, 1999; Kreegipuu et al, 1998), multiple potential phosphorylation sites on Myo/Vl very near to this Lysine residue were identified (FIG. 1). These sites reflect the multiple functions of the Myo/Vl protein in different physiological scenarios within the mammalian cell. Additionally, recombinant MyoNl could be phosphorylated by ERK kinase in vitro (see FIG. 14). To show that Myo/Nl 's ETS influencing actvities are abolished or altered, the Lysine residue at position #66 is mutated to an opposite charge (Aspartic or Glutamic) or a Alanine residue. Additionally, mutating the serine/threonine phosphorylation sites to Aspartic or Alanine residues, one creates simulated forms of phosphorylated or non-phosphorylated MyoNl proteins that could exhibit constitutively active (CA) or dominant-negative (DΝ) phenotypic in vivo properties against ETS and ΝFKB transcriptional acitvities, respectively. Utilizing these mutants, the phosphorylation events associated with ETS and ΝFKB functions of Myo/Vl protein are identified and these functions are separated. Moreover, the Myo/Vl mutants generated in this Example are important therapeutically.

Separation of Myo Vl functions for ETS and ΝFKB Transcription Factors.

In order to successfully identify the exact molecular function of Myo/Vl, constitutively active (Threonine to Aspartic or Glutamic acid residue) and/or dominant negative mutants (Threonine to Alanine residue) of Myo/Vl are generated to mimic the in vivo phosphorylated and dephosphorylated forms. In addition to the wild type Myo/Vl, these mutants are valuable tools to identify the multiple roles of MyoNl on ETS and ΝFKB mediated transcription processes. The details of these mutations are given in Table 1. Since these phosphorylation sites occur near the carboxyl terminus, oligonucleotide antisense PCR primers (50mer to 160mers) spanning the entire carboxyl terminus with mutational alterations (Tables 3 and 5) have been designed and are used to generate the various mutants through PCR-mediated in vitro mutagenesis methods known in the art. The PCR-generated mutant MyoNl products are subcloned into CMV promoter-based mammalian expression vector pCDΝA3 and is used to express Myo/Vl in neonatal myocytes and in HeLa cells. These mutants are then screened against influence on ETS-Luciferase and NFκB-Luciferase reporter activity. In a specific embodiment, constitutively active mutants exhibit increased reporter activity in relation to ETS and decreased activity in relation to NFKB. In another specific embodiment, dominant-negative MyoNl mutants exhibit inhibitory functions on Wild-type Myo/Vl protein influence on respective reporters. In another specific embodiment, these mutants exhibit different functional effects in vivo because of its multiple effects (activation, repression, enhancer site selection, etc.) on two large families of transcription factors (ETS and ΝFKB). Initial screening of these mutants against reporter vectors is conducted in HeLa cells and later is confirmed in neonatal myocytes. Neonatal myocytes and HeLa cells exhibit similar Myo/Vl 's functions in relation to NFKB reporters.

Myo/Vl Functions on ETS and NFKB Factors: in vivo Exhibition in Adult Rat Cardiac Myocytes.

The ability of Myo/Vl to enhance in vivo ETS-DNA binding activity, which was observed in vitro, or increase p50-p50 NFKB homodimer generation in vivo is determined.

For this puφose, a respective constitutively-active and dominant-negative Myo/Nl mutant is selected and incoφorated by standard molecular biology means into recombinant adenovimses. Recombinant adenovims-carrying wild-type MyoNl is included in the experiments. Adenovims-carrying beta-galactosidase is used as negative control to determine any background influence on the ETS and ΝFKB DΝA binding activities. Dominant-Negative

Myo/Vl mutant vimses are used to determine whether wild-type MyoNl 's effects on ETS and ΝFKB DΝA binding activities are altered or attenuated. The strategy for these experiments is shown in Table 4.

TABLE 4: EXPECTED PROPERTIES OF CONSTITUTIVELY-ACTIVE (CA) AND DOMINANT NEGATIVE (DN) MYO/VI MUTANTS.

Briefly, the dominant-negative and wild type MyoNl adenovimses are mixed at 1 :1 ratio and are used to infect adult cardiac myocytes. Wild-type MyoNl adenovims with the same exact MOI is used as control. In summary, adult rat cardiac myocytes are isolated and are infected with recombinant MyoNl adenovimses. Forty-eight hours after infection, nuclear extracts are isolated and ETS-EMSAs and ΝFKB-EMSAS are conducted. In the case of ETS-EMSA, commercially available ETS/PEA3 oligo (Santa Cmz Biotech Inc.) are used. In the case of ΝFKB-EMSA, three different custom-synthesized double-stranded oligos specific for p50-p50 homodimers, p50-p65 heterodimers and p65-p65 homodimers are used to determine the effect of Myo/Vl on ΝFKB dimerization. The sequences of the oligos are:

KB 5'-GTAGGGGCTTTTCCGAGCTCGAGATCCTATG-3' (SEQ ID

ΝO:98; for p50-p65 heterodimers)

seqB 5'-GGAAGGGGGTGACCCCTTGCCT-3' (SEQ ID NO:99; only for p50 homodimers)

UiNOS 5'-CCCTGGGGAACTCCTGCA-3' (SEQ ID NO: 100; only for p65 homodimers

These oligos were used to obtain the data on NFkB dimers in MHCsTNFk transgenic mouse failing hearts (see FIG. 20). The KB enhancer sequences mentioned above possess high-affinity for specific NFKB dimers, but they display low or no affinity for other NFKB dimers (Kursch et al., 1992). From these studies, it is determined whether the observed in vitro effects of Myo/Vl on ETS and NFKB are indeed occuring in vivo. An example of results which are obtained are in Table 9, which in specific embodiments are similar to ETS- luciferase and NFKB luciferase reporter experiments. Alternative Embodiments.

In a specific embodiment, single-site phosphorylation mutations do not separate the

ETS and NFKB functions, and Myo/Nl protein, double and triple site mutants are generated, as shown in Table 5.

TABLE 5: DESCRIPTION OF DOUBLE AND TRIPLE CONSTITUTIVELY- ACTIVE (CA) AND DOMINANT NEGATIVE (DN) MYO/V1 MUTANTS

Additionally, the potential tyrosine phosphorylation site (DYVK) near the amino terminus is mutated to determine its effects on ETS and NFKB functions. As discussed in Example 9, a skilled artisan is aware of the relatively small number of nucleic acids which can generate the few changes in the dominant negative proteins over wild type. The following specific nucleic. acid sequences are within the scope of the present invention: CA- ERK+GSK3+CK-I (SEQ ID NO:190); CA-GSK3+CK-I +CKII (SEQ ID NO:191); CA- PKC+GSK3+CK-I (SEQ ID NO:192); CA-ERK+CKII (SEQ ID NO: 193); CA-ERK+PKC (SEQ ID NO: 194); CA-PKC +CKII (SEQ ID NO: 195); CA-ERK+PKC+CKII+GSK3+CKI (SEQ ID NO: 196); DN-ERK+GSK3+CK-I (SEQ ID NO: 197); DN-GSK3+CK-I+CKII (SEQ ID NO: 198); DN-ERK+ CKII (SEQ ID NO: 199); DN-ERK+ PKC (SEQ ID NO:200); DN- PKC+CKII (SEQ ID NO:201); DN-ERK+PKC+CKII +GSK3+CKI (SEQ ID NO:202).

In a specific embodiment wherein no constitutively active or dominant negative Myo/Vl mutants, or both, are obtained for either transcription factors, a Glutamic acid residue is introduced instead of a Aspartic Acid residue to mutate the Serine/Threonine phosphorylation sites.

In a specific embodiment wherein a low amount of ETS and/or NFKB signals in adult cardiac myocyte nuclear extracts infected with recombinant adenovimses occurs, a large number of cells are used to alleviate the problem. Alternatively, recombinant adenovims carrying ER81-ETS factor at a very low MOI along with Myo/Vl adenovimses is utilized. ER81 is the most abundant ETS factor expressed both in the fetal and adult mammalian myocardium. For NFKB, adenovims carrying pi 05 (precursor of p50) gene along with Myo/Vl is used to determine the p50 homodimer generation. pl05 is a cytoplasmic precursor protein for p50 subunit of NFKB. Alternatively, HeLa cells are used to demonstrate the effects of Myo/Vl on ETS and NFKB DNA binding activity. In alternative embodiments, adenovirus-based expression systems are used to demonstrate the effects of Myo/Vl in vivo even in HeLa cells.

EXAMPLE 13 ROLE OF MYO/V1 IN REGULATING FETAL GENE EXPRESSION

IN ADULT MYOCYTES

During cardiac hypertrophy and its transition to failure, several fetal genes (ANF,

CPT1-L, CK-B, F-PFK, Troponins etc.) are upregulated, and the mechanism for this global switch in fetal gene expression is not known. The data (FIG. 16) suggest that Myo/Vl enhances the DNA binding activity of ETS family of transcription factors in vitro. This observed Myo/Vl -stimulated increase in ETS-DNA binding activity is inteφreted as Myo/Vl enhancing the affinity of ETS factors to recognize the low affinity ETS initiation boxes and start new transcriptional initiation on their target genes. This inteφretation, previously unrecognized in the art, is based on the analysis of the literature on ETS factors which strongly suggests that ETS (Genuario et al, 1996; Yu et al, 1997; Yoo et al, 1991) factors have a unique role in the transcription initiation which other transcription factors do not have.

In several instances, ETS factors forced transcriptional initiation from an "ETS BOX" in both

TATA and TATA-less promoter containing genes. Also, other studies have concluded that a global switch from conventional 'TATA BOX" initiation to TATA-less initiation occurs during embryonic development. Furthermore, for several ribosomal protein genes and nuclear-coded mitochondrial genes which possess TATA-less promoters, 'ETS box'-directed transcriptional initiation is known to occur. Hence, the ability of MyoNl, by interacting with

ETS factors, causes this switch from TATA BOX initiation to ETS BOX initiation to be determined. For this puφose, two genes which are very well characterized for their transcription start points for both adult and fetal forms are chosen. The first gene exclusively codes for fetal carnitine palmitoyltransferase-I enzyme (CPTI) and the second gene codes for

6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase enzymes (Adult-Muscle-PFK and

Fetal-Muscle-PFK). The PFK gene is expressed in fetal muscle and liver from the fetal ETS promoter box.

Does Myo/Vl Influence on ETS to Initiate Fetal CPTI Gene Expression In Vivo in Adult Rat Cardiac Myocytes.

Two genes (FIG. 24) code for the adult and fetal forms of carnitine palmitoyltransferase-I enzymes (CPTI), the adult form (muscle form) contains the TATA box in their promoter and in the fetal form (liver form GenBank Acct. No: AF020776; SEQ ID NO: 114) does not have a TATA box. Instead an ETS box (CGGAAT in the antisense direction) is located at '+1' position of its mRNA. The fetal form of CPTI, which is the normal adult liver form, is not expressed in adult heart. However, it is expressed in the adult heart and in myocytes when exposed to hypertrophic stimuli. By overexpressing Myo/Vl in the adult myocytes, it is determined whether the fetal gene of CPTI is transcribed, and, if so, whether transcriptional initiation occurrs at the ETS box of the fetal form. Since the rat gene is cloned and very well characterized for transcription start points, the PCR primers are designed against this mRNA with the sense primer near the ETS box (5' - ATTCCGCCGCCGCCGTCCACA -3'; SEQ ID NO:115) and the antisense primer (5' TCCTCCGCACCACAGTCCTCTGCTT 3'; SEQ ID NO:116) in the middle of the mRNA. The PCR product size is around l l lbp. Briefly, MyoNl -Adenovimses as discussed above are used in this experiment. Adult rat cardiac myocytes are infected with the MyoNl adenovimses at very low MOI and 48 hours post-infection total RΝA is isolated and subjected to real-time quantitative RT-PCR using Roche's Lightcycler. β-gal adenovimses are used as negative control. Dominant-Negative Myo/Vl vimses are used along with wild- type MyoNl to demonstrate that Myo/Vl is responsible for the. ETS directed fetal-gene expression. (GenBank Ace. No: AF020776 - Rattus norvegicus carnitine palmitoyltransferase I (CPTI) gene, promoter region, exon 1 and exon 2.).

Myo Vl Influence on ETS to Switch From Adult to Fetal-PFK Gene Expression In Vivo in Adult Rat Cardiac Myocytes.

Given that Myo/Vl and ETS activity are found at elevated levels in hypertrophied as well as in failing mammalian hearts and also at high levels in prenatal organs, it is determined whether Myo/Vl provokes fetal gene expression by switching the TATA box initiation to ETS box (or alternatively starting new initiation at ETS box) and thus globally switch the adult bioenergetics of the myocardium to a fetal mechanism (FIG. 25). To further confirm this mechanism, a single-copy housekeeping gene M-PFK, whose gene product is involved in myocardial bioenergetics, is used. This gene codes for multiple forms of the enzyme 6- phosphofracto-2-kinase/fructose-2,6-bisphosphatase (Adult-Muscle-PFK and Fetal-Muscle- PFK) from dual promoters. The adult form is initiated from a TATA BOX-containing promoter, and the fetal form is initiated from the upstream ETS box promoter (Dupriez et al, 1993). A very well characterized study indicates that while the adult mRNA is initiated near the distal TATA box, the fetal mRNA is initiated from the upstream ETS box. In contrast to CPTI, in the case of PFK a single gene codes for both adult and fetal forms of the protein. Experiments are conducted as mentioned previously for CPTI. The sense Primer is 5' CTAGCCTGGACGCCAGAAT 3'; SEQ ID NO: 117 and the antisense primer is 5' CCTGGTTTATCCTAAGAATG 3'; SEQ ID NO: 118. The Product size is around 317bp and this exon-laF is absent in adult PFK form. (Gen Bank Acct. No: M26215 - Rat (lambda 20B0.5; SEQ ID NO: 119) M-type 6-phosphofructo-2-kinase/fructose-2, 6 bisphosphatase (PFK2/FBPase2) gene, and exon 1 and 5'end eds.) First, copy-number standards for respective mRNAs are established using cDNA clones. Using these standards, copy number of the respective fetal mRNAs is determined by Real-Time quantitative PCR. Induction of fetal gene expression means higher copy numbers. Alternative Embodiments.

In a specific embodiment wherein dead cells, injured adult cardiac myoctes, or adenoviral infection themselves induce background levels of fetal mRNA, quiescent conditions with semm containing medium are employed to minimize the injury to cells.

Appropriate negative controls, such as β-gal adenoviruses, and repeating the experiment several times to get reproducible results, solves the background problems.

EXAMPLE 14

ROLE OF MYO V1 IN REGULATING ADRENERGIC SIGNALING

SYSTEM GENES' EXPRESSION

The potential interaction of Myo/Vl with NFKB factors to regulate the expression of genes involved in the beta-adrenergic signaling system in cardiac myocytes is determined. Data to support this includes: (1) Myo/Vl enhancing the p50-p50 homodimer generation in vitro only with p50 subunits (lanes 1-4 in FIG. 17); (2) Myo/Nl splitting the p50-p65 heterodimers in vitro and generating p50-p50 homodimers with the resultant release of p65 subunits (last 4 lanes in FIG. 18); (3) the observation of enhanced amount p50-p50 homodimers in MHCsTΝFγ transgenic failing mouse hearts (FIG. 20); and (4) Finally, analysis of the promoter sequences of adrenergic system genes (Table 1) for ΝFKB repressor and enhancer sites led to the conclusion that ΝFKB regulation of adrenergic system genes is, at least in part, responsible for the adrenergic system desensitization during heart failure. Additionally, indirect evidence from the literature supporting the data includes: (1) 100%) of the p50 knockout mice exhibited resistance to a vims (encephalomyocarditis) which specifically infects the heart; and (2) In two other models of desensitization (androgen receptor and LPS tolerance), p50-p50 homodimers have been proposed as the main reason for receptor desensitization. Thus, in a specific embodiment regarding ΝFKB regulation of adrenergic genes, while p50-p65 heterodimers-mediated transcriptional activation of adrenergic system genes - βARKs and Giγs - is responsible for the uncoupling of the adrenergic response, it is the aberrant MyoNl enhanced p50-p50-homodimers-mediated transcriptional repression of βl-adrenergic receptor and Gsγ genes (FIG. 26) that are responsible for the myocardial inability to couple or resensitize to adrenergic response and thus causing the compensated heart to fail. Specifically, while γl-ADR uses cAMP -mediated pathway for its basal upregulation, it uses a ΝFKB repressor pathway to downregulate itself.

Examination of the promoters of adrenergic system genes revealed that ΝFKB is a major player in during heart failure. The identification of strong p50-p50 specific ΝFKB repressor sites together with the lack of the identification of strong ΝFKB enhancer sites in human βl-adrenergic receptor (βl ADR) gene promoter suggests that ΝFKB may be involved only in downregulating its expression. On the other hand, β2-ADR β3-ADR, β-ARKl and β- ARK2 kinases as well as Giγ 1,2,3 might use both ΝFKB enhancer and repressor pathways for its regulation. Interestingly, while Gsγ might use ΝFKB repression pathway, the Gsγ-XL (which is expressed in heart but not very well characterized) might use ΝFKB enhancer pathways for its regulation. Based on all these observations, it is an object of the present invention that ΝFKB dysregulation of β-adrenergic signaling genes is the main reason that the adrenergic response is uncoupled and unable to couple back during heart failure. However, in specific embodiments focus is on Myo/Nl-ΝFκB studies only regarding βl-ADR, β-ARKl and Gsγ genes. Also, studies directed at mapping the NFKB binding regions are carried out only on the β 1 -ADR promoter.

Briefly, promoters for human βl-ADR, β-ARKl and Gsγ genes are cloned by PCR using human genomic DNA as template. These promoters are cloned upstream of luciferase reporter gene using pGL3 -basic Luciferase reporter vectors. Detailed studies focus on βl- ADR, β-ARKl and Gsγ genes. Initially, reporter studies (Table 6) are conducted to establish that Myo/Nl and ΝFKB regulate adrenergic system genes' expression.

TABLE 6. EXPERIMENTAL STRATEGY AND EXPECTED RESULTS TO

DEMONSTRATE MYO/Vl-NFκB REGULATION OF βl-ADR GENE EXPRESSION.

SIMILAR STRATEGY IS EMPLOYED FOR β-ARKl AND GSα GENE PROMOTER.

After cloning the entire promoter fragment into the basic reporter vector, the above transfection experiments are conducted in rat neonatal myocytes. All of the MyoNl, ΝFKB expression plasmids (pRSV-pl05 - gene coding the protein precursor of p50; pRSV-p50 - the tmncated pi 05 coding mature p50, p-RSV-p65 - gene coding for the transactivation RelA subunit of ΝFKB) are utilized, in a specific embodiment. Briefly, these plasmids are co- transfected together as shown in Table 6 in rat neonatal myocytes and 48 hours post- transfection cellular lysates are prepared and luciferase reporter activity are measured. The puφose of using pi 05 expression plasmid in the studies is that Myo/Vl might generate p50- p50 homodimers in the cytoplasm by enhancing the processing of the carboxyl terminus of pi 05 which is named as IκBγ in the literature. Thus, overexpression of pi 05 precursors alone would not affect the βl-ADR promoter activity.

After establishing its Myo/Vl -ΝFKB regulation, the βl-ADR promoter DΝA fragment (3.1 kb) is subcloned by into multiple 500 bp overlapping DΝA fragments. After end-labeling these DΝA fragments to generate probes and with the purified recombinant NFKB p50 and p65 proteins, NFKB EMSAs are conducted to identify the binding regions.

First, p50-p50 homodimers, p50-p65 heterodimers and p65-p65 homodimers are generated in vitro seperately and then later added to multiple βl-ADR DNA fragments to identify the

NFKB dimer binding regions. Later, DNAse footprinting experiments are done on those positively identified DNA fragments to precisely map the dimer specific NFKB binding regions on βl-ADR promoter. Once identified, EMSA's are conducted again with individual subunits of NFKB to characterize its relative affinity toward different dimers. Strong, weak or absence of signals on GSA experiments with the identical quantities of pure NFKB proteins and probe are used as a criterion to determine the affinity of NFKB binding sites on βl-ADR promoter. HIV-κB oligo from Santa Cruz and "50-14" and "65-2" oligos (Kunsch et al,

1992) which are utilized for characterizing different NFKB complexes in MHCsTNF transgenic mice as a 'gold standard' for specific NFKB dimers. Antibody supershift experiments are conducted to confirm the respective NFKB subunit binding. After the NFKB

GSA experiments using specific NFKB proteins, studies are carried out using rat myocardial and myocyte nuclear extracts to further confirm the NFKB binding to βl-ADR promoter.

DNAse footprinting techniques are performed to map the NFKB binding regions in βl-ADR promoter. In a specific embodiment, most of the predicted sites exhibit p50-p50 homodimer binding ability. Following this, site-specific mutations are introduced into the site, and this essentiality is demonstrated using p50 and MyoNl expression plasmids. This mutational analysis shows the resistance p50 and Myo/Vl inhibition of βl-ADR expression.

EXAMPLE 15 DOWNREGULATION OF Bl ADRENERGIC RECEPTOR EXPRESSION

Myo/Vl and NFKB homodimers can downregulate one of the important genes during human heart failure. It is already well known that βl-adrenergic receptor protein is downregulated during human heart failure and that catecholamine directed contractile response is signaled through β2-adrenergic receptor in the failing heart. Currently, therapeutics involving beta adrenergic receptor antagonists are widely used in treating human heart failure patients. Since it was earlier observed that there were several high affinity binding sites for p50-p50 homodimers on the promoter of βl-adrenergic receptor gene, this indicated that Myo/Vl directed excess NFKB homodimers are responsible for the downregulation of βl-adrenergic receptor gene expression. As shown below, Myo/Nl and ΝFKB homodimers downregulate βl-adrenergic receptor gene expression. First, the promoter (~3kb) of human βl-adrenergic receptor (βl-ADR) gene was cloned from a BAC clone using a standard PCR method. The luciferase reporter gene was placed adjacent to the βl-adrenergic receptor promoter (βl-ADR-luc) through recombinant DNA methods. Using this 'βl-ADR-luc' expression plasmid, experiments were conducted to determine how Myo/Vl and NFKB homodimers can regulate βl-ADR gene expression. Myo/Vl, ρ50 (NFKB), p65 (NFKB), IKB-WT and IκB-S32S36 expression plasmids were cotransfected individually with 'βl-ADR-luc' plasmid in human HeLa cells, and luciferase enzyme activity was measured after 48 hours. FIG. 27 shows the effect of Myo/Vl and NFKB homodimers on βl-ADR-luc expression. As the data indicates, when p50 and p65 proteins are overexpressed individually to generate the respective NFKB homodimers, both the homodimers inhibited βl-ADR-luc expression in vivo. In fact, p65-p65 homodimers showed extreme transcriptional repression (~ 85%>) compared to p50-p50 homodimers (40%). Myo/Vl, when overexpressed abundantly, inhibited the βl-ADR-luc expression by -50%, presumably due to the generation of both NFKB homodimers. Additionally, IκB-WT and IκB-S32S36 proteins (which are known for their cytoplasmic retention of inactive p50-p65 heterodimers) were overexpressed, and it was found that IκB-WT and IκB-S32S36 proteins relieved the transcriptional inhibition of βl-ADR-luc expression (FIG. 28) caused by the basal level p50-p50 homodimers. It is already well known that under basal conditions, low levels of p50-p50 homodimers are present in the nucleus of unstimulated mammalian cells. Therefore, when IκB-WT and IκB-S32S36 proteins are expressed abundantly in unstimulated cells, it depletes the basal levels of p50 proteins to generate the inactive p50-p65 heterodimers in the cytoplasm. This caused further reduced levels of basal level p50-p50 homodimers in the nucleus resulting in enhanced gene expression of βl-ADR-luc. These data indicate that by reducing the level of p50-p50 homodimers in the nucleus one can enhance the βl-ADR-luc expression. However, in chronic human heart failure, where all NFKB dimers are already activated, in order to relieve the transcriptional inhibition of βl-adrenergic receptor gene expression one has to use an inhibitor of Myo/Vl to reduce the levels of p50- p50 and p65-p65 homodimers. Thus, inhibitors of Myo/Vl and NFKB homodimers (p50-p50 and p65-p65) are useful as a therapeutic drug for human heart failure and aging, as feasibly demonstrated herein. EXAMPLE 16

ROLE OF MYO/V1 IN INDUCING MYOCARDIAL HYPERTROPHY

AND HEART FAILURE IN VIVO

In another object of the present invention, myocardial-restricted in vivo overexpression of Myo/Vl is responsible for provoking cardiac hypertrophy and heart failure with resultant changes in myocardial fetal and adrenergic system gene expression through global alteration in ETS and NFKB mediated transcription processes.

Earlier studies have shown that Myo/Vl and ETS-DNA binding activity is found at elevated levels in hypertrophied rat and human hearts. Data presented elsewhere herein strongly suggest that MyoNl possesses dual opposing activities on ETS-mediated transcription processes. Given that ETS factors are involved in regulating the expression of genes coding for mitochondrial biogenesis, ribosomes, muscle contractile proteins and fetal gene expression, it is determined whether Myo/Vl -induced myocardial hypertrophy is compensatory with resultant improvement in contractile function. Also, it is determined whether ETS-mediated transcription process is involved in generating compensatory cardiac hypertrophy. Additionally, since Myo/Vl enhancement of ΝFKB p50-p50 homodimer generation is observed, in a specific embodiment myocardial overexpression of Myo/Vl in the transgenic animals uncouples the myocardium from adrenergic response, thus transitioning the hypertrophied heart to failure.

Overexpression of wild type MyoNl in mouse myocardium using alpha Myosin Heavy Chain Promoter in FNB strain of mice is performed. Since wild-type MyoNl is a non-phosphorylated form, several constitutively-active Myo/Vl mutants are generated which exhibit increased ETS transcription activity as well as p50-p50 homodimer or ΝFKB inhibition activity in a specific embodiment. These mutants are used to generate transgenic animals with myocardial-restricted overexpression. In another specific embodiment, wild type Myo/Vl and CA-Myo/Vl mutant specific for ETS and ΝFKB are used to generate 'three" mouse transgenic lines overexpressing the Myo/Vl protein from the mouse myocardium. Construction of γMHC-MyoNl transgene, screening of the founders with transgene specific PCR and southern analysis are performed as described in Sivasubramanian et al. (2000) and are by methods well known in the art.

Following development of γMHC-Myo/Vl transgenic founders, the animals are bred and basic physiological studies are conducted. One founder each from low-copy, medium- copy and high-copy MyoNl is chosen and myocardial function and basic histopathology are studied. Survival index is studied throughout the life of the animal for a year. Heart weight to body weight ratios and hemotoxylin and eosin staining of heart muscle tissue are studied at 4, 8 and 12 weeks of age. If, in a specific embodiment, within this age the animals do not develop a phenotype, they are studied up to a year. M-Mode and doppler echocardiography are performed to determine left ventricular (LV) function of transgenic animals. LV mass, LV wall thickness, Fractional Shortening, and Ejection fraction are also measured.

In a specific embodiment, the phenotypes of Myo/Vl transgenic mice are observed. TABLE 7: PHENOTYPES OF MYO/V1 TRANSGENIC MICE.

WT-Myo/Vl and/or CA-Myo/Vl Induction of Cardiac Hypertrophy and Heart Failure Phenotype In Vivo.

First, a high-copy founder from wt-Myo/Vl, CA-ETS-MyoNl, and CA-ΝFκB- MyoNl transgenic animals are chosen and analyzed. Once LV contractile function is studied by Echocardiography, hearts from these animals are explanted and used for biochemical studies. Total RΝA is isolated and is used to determine the expression of fetal genes and adrenergic genes as mentioned in the above table. Two Ribonuclease Protection Assay Panel Templates are generated for probes. Myocardial nuclear extracts are isolated from individual hearts and are used for ETS and NFKB GSA assays. In the case of NFKB, dimer specific NFKB oligos are used. Activation of ETS and NFKB are studied by Gel-shift assay experiments with appropriate enhancer probe oligos.

After initial characterization of high copy founders, low and medium copy founder animals are studied for determining the phenotype. M-mode and Doppler Echocardiography.

Left Ventricular Stmcture Analysis. Left ventricular stmcture is characterized using 2-D directed M-mode echocardiography and light microscopy. Mice from each group is imaged using a 7.5-MHz transducer (Interspec, Ambler, PA). Images are captured and stored using Computer Eyes software (Video Digitizer, Dedham, MA) and analyzed using OPTIMAS image analysis software (Silver Spring, MD). Measurements of the LV end- diastolic and end-systolic dimension and LV septal and posterior wall thickness are obtained from the parastemal long axis view from > 3 beats, using the leading-edge-to-leading edge technique adopted by the American Society of Echocardiography. Heart tissues are perfusion- fixed and the paraffin-sections are stained with hematoxylin and eosin for routine histological examination. M-mode and Transthoracic Doppler Echocardiography.

M-mode echocardiographs of the left ventricle are recorded at the tip of mitral valve apparatus using a 5 -7.5 -MHz transducer. To control the influence of heart rate variability, Doppler indices are measured from tracings that have equal cycle lengths. To minimize the influence of preload on Doppler indices, only cardiac cycles that had equal preceding cycle lengths are analyzed. Left ventricular diameters, areas, and wall thickness obtained from cross-sectional short-axis views. Diastolic and systolic LV dimensions are measured from six consecutive cardiac cycles. To account for the low frame rates and lack of synchronization of image acquisition with the cardiac cycle, LV diastolic diameter (LVDD) are calculated from the mean of the three maximal diastolic measurements; LV systolic diameter (LVSD) are calculated from the mean of the three minimal systolic measurements. The coefficient of variation for each set of measurements is expressed as the SD/mean. Left ventricular fractional shortening (LVFS) is expressed as a percentage, using the formula (LVDD - LVSD) / LVDD x 100. Heart rates are calculated using the time interval between successive waveforms on CW Doppler tracings. Measurements are made without prior knowledge of genotype.

Light microscopic examination is performed on the perfusion fixed LV myocardium in order to determine the percent area occupied by fibrillar collagen. For the examination of the extracellular matrix, LV sections are stained using the picrosirius histochemical technique. The stained LV sections are then digitized at a final magnification of 320X and analyzed using an image analysis system (Sigma Scan Image, Jandel, San Rafael, CA). The percent area of extracellular staining is computed from 15 random fields within the mid- myocardium in order to exclude large epicardial arteries and veins and any cutting or compression artifact.

EXAMPLE 17 P50 HOMODIMERS IN HUMAN MYOCARDIAL TISSUE

To identify p50 homodimers in a human heart, protein extracts from human myocardial nuclei were isolated and gel-shift assay was conducted using p50-p50 homodimer specific oligo (FIG. 29), as described above. p50 homodimers were observed (lane 1) and the identity of these dimers was further confirmed in a super-shift assay (lane 2) using an antibody against p50 (NFkB) protein.

EXAMPLE 18 P50 HOMODIMERS IN FAILING HUMAN HEARTS

An experiment analogous to that of Example 7 is repeated with end-stage failing human hearts (FIGS. 30A and 30B). In the figures, CN* = Control Normal human heart. Explanted (Donor) heart from a normal patient. This donor human heart was unable to be transplanted because of the clinical conditions of the recipient. During transplantation procedures, the donor heart is kept in cardioplegic solution for several hours, and during this time the heart might experience ischemic injury. When the decision was made not to transplant this normal donor heart after several hours, the donor heart was frozen in liquid nitrogen. Therefore, this donor heart came from a normal patient, however, it might have experienced ischemic injury by the time it was preserved. The TNFα mRNA levels in this tissue sample were also measured, and the levels were unexpectedly higher. Ideally, it is expected normal human hearts should not contain any p50-p50 homodimers or, at the maximum, very low levels similar to the mouse control heart in FIG. 20 .

In FIGS. 30 A and 3 OB, DCM #20 is explanted (recipient) heart from a heart failure patient. The patient was clinically diagnosed as Dilated Cardiomyopathic (DCM) and classified as (New York Heart Association) NYHA-Class IV heart failure patient . The patient is a 71 year old Hispanic male. ICM #26 is an explanted (recipient) heart from a heart failure patient. The patient was clinically diagnosed as Ischemic Cardiomyopathic (ICM) and classified as NYHA-Class IV heart failure patient . The patient is a 68 year old Caucasian male. ICM #32 is an explanted (recipient) heart from a heart failure patient. The patient was clinically diagnosed as Ischemic Cardiomyopathic (ICM) and classified as NYHA-Class IV heart failure patient. The patient is a 68 year old Hispanic male.

Briefly, the frozen ventricular tissue samples were pulverized in an ultra-cold (dry ice cooled) mortar and pestle, and the nuclear extracts were isolated using NE-PER Nuclear and cytoplasmic Extraction Reagents (cat #78833) from Pierce, Inc., (Rockford, IL). Gel-shift assay reagents, including p50 antibody, are from Geneka Inc. The p50-p50 homodimer specific double-stranded DNA oligo was custom designed (#50-14: 5' AGTTGAGGGGCCTCCCCGAGGC - 3'; SEQ ID NO.181) and used in this gel-shift assay. Protein concentration of the nuclear extracts was measured using BCA assay, and approximately 25 μg of protein from each sample was used in this experiment. The images of the gel were captured in Storm Phosphorimager (Molecular Dynamics, Inc.,) and quantitated using Imagequant software.

The data show that p50-p50 homodimers are observed at abundant levels (at least 2 fold) in dilated cardiomyopathic (DCM) failing human heart compared to control normal heart (CN*). Failing ischemic cardiomyopathic (ICM) hearts showed low levels of p50-p50 homodimers compared to DCM heart. It should be noted that control normal heart (CN*) also showed significant levels of p50-p50 homodimers because of the ex vivo ischemic injury it experienced while in cardioplegic solution. Failing hearts never experienced this injury since it was explanted from the 'recipient' patient and immediately frozen in liquid nitrogen. Ideally, it is expected normal human hearts should not contain any p50-p50 homodimers in the nucleus or at the maximum very low levels similar to the mouse control heart in FIG. 20. Therefore, the levels of p50-p50 homodimers observed in failing human DCM (#20) and ICM hearts (#26 and #32) might still be significantly higher compared to a normal naive human heart. In a preferred embodiment, a human heart having no cardiovascular disease is excised from a patient, immediately frozen in liquid nitrogen, assayed as described in this example, and shows no significant or detectable levels of p50 homodimers.

FIG. 30C compares the NFKB homodimers in normal donor heart biopsy samples with failing heart samples. The normal human heart samples are difficult to obtain for research puφoses. Therefore, it was compared with one dilated cardiomyopathic patient and one ischemic cardiomyopathic patient. Normal control (CN*) mentioned in FIG. 30A is not a tme normal control human heart. FIG. 30D shows a comparative analysis of NFKB homodimers in multiple dilated cardiomyopathic patients (DCM patients). Each lane represents an individual human heart failure DCM patient. Briefly, the recipient's (DCM patients) explanted failing heart biopsy samples were used to isolate the nuclear extracts. Gel shift assays were performed to quantify the level of NFKB homodimers using SeqB and

UiNOS oligos which are specific for respective NFKB homodimers.

EXAMPLE 19 INHIBITION OF P50 HOMODIMERS

In a preferred embodiment of the present invention, Myo/Vl is responsible for generating or increasing the p50 homodimers in heart and in other organs as well. However, in other embodiments, such as in certain tissues and in certain scenarios, in addition to the

MyoNl, other proteins play a role in generating p50 homodimers. Because of the 3D stmctural homologies with Myo/Vl protein, proteins like gabpα, pl9ink4d cdk46 inhibitor, pl8-ink4c cdk6 inhibitor, pl6ink4a cdk4 inhibitor, and p53bp2 proteins, in specific embodiments, possess the same function as Myo/Vl protein, especially in generating p50 homodimers. In addition, IκB and IkB-like proteins, such as bcl3 and CARP (cardiac ankyrin repeat protein), might also possess this function. Thus, in a preferred embodiment of the present invention, dominant negative Myo/Vl inhibits p50 homodimer generation regardless of their mechanism of generation, such as being generated by other proteins. The determination of whether or not these proteins are responsible for p50 homodimer generation would be routine in the art, particularly given the direction of the Examples provided herein.

EXAMPLE 20 P50 DOMINANT NEGATIVE MUTANTS

In specific embodiments of the present invention, p50 dominant negative mutants are generated by standard site-directed mutagenesis methods well known in the art and are used in methods described herein. Specific examples of known p50 dominant negative mutants, discussed in Bressler et al. (1993), Toledano et al. (1993), and Logeat et al. (1991), all incoφorated by reference herein, are also within the methods of the present invention. Specific p50 dominant negative mutants described by Bressler et a (1993) include 56-57 (SEQ ID NO.238), 111 (SEQ ID NO.239); 114-115 (SEQ ID NO:240); 136-137 (SEQ ID NO:241); 137-138 (SEQ ID NO.242); 149-150 (SEQ ID NO.243); 153-154 (SEQ ID NO.244); 193-194 (SEQ ID NO:245); 197-198 (SEQ ID NO.246); 274-275 (SEQ ID

NO.247); 276-277 (SEQ ID NO:248); 320 (SEQ ID NO:249); and 326-327 (SEQ ID

NO.250). Specific p50 dominant negative mutants described by Toledano et al. (1993) include E63I (SEQ ID NO:251) and Y60A (SEQ ID NO.252). A specific p50 dominant negative mutant described by Logeat et al. (1991) is ΔSP (SEQ ID NO:253).

EXAMPLE 21 PROMOTERS SUBJECT TO P50 REPRESSION

The promoters of G-protein coupled Receptors (GPCR) relevant to human cardiovascular diseases were analyzed for the presence of p50 homodimer repressor sites and p50-p65 heterodimer enhancer sites. Specifically, the Angiotensin-II, Endothelin-I, Atrial Natriuretic Factor receptor, and Bradykinin receptor promoters were analyzed, and blockers to these receptors are currently used as therapeutics for various cardiovascular diseases. Interestingly, all of these GPCR promoters except AT2 and ETIB have p50 homodimer specific repressor sites, suggesting they all utilize this p50-directed global repression mechanism to cause desensitization. Since there are ~ 1500 to ~ 2000 human GPCRs reported in the literature and since these receptors are expected to be involved in a variety of human diseases, the methods described herein, in a specific embodiment, are used to develop therapeutics for a variety of diseases. Although the ANF receptors are not G-protein coupled receptors, they are relevant to cardiovascular disease.

TABLE 8: TFBIND AN JLYSIS OF HUMAN GPCR GENE PROMOTERS

GPCR GenBank NFKB Repressor sites NFKB Enhancer

Genes' Ace. (p50-p50 specific) sites Promoters Number (p50-p65 specific)

ATI (Angiotensin II) U07144 GGGGAGCGGC 2661 GGGAGGGTCTCC 2443

Receptor (SEQ ID NO: 120) (SEQ ID NO:125)

(2720bp) GCAACGCCCC 2516 TGGCATATCC 1631

(SEQ ID NO:121) (SEQ ID NO:126) CGAACTCCCG 2275 AGAAAGTCCT 820

(SEQ ID NO:122) (SEQ ID NO:127) AGGAAGTTCC 1307

(SEQ ID NO: 123) CGGCCTCCCA 498

(SEQ ID O:124)

AT2 (Angiotensin II) U27478 None TGAGAATTTCAG 1533

Receptor (SEQ ID NO:128)

(1679 bp) GTGGAAACTTCATT 1472 (SEQ ID NO:129)

TAAAATTCC 1239

(SEQ ID NO:130)

ET1-A (Endothelin-I)

Receptor S55772 None None

(1003 bp)

AGAACGCCCC 951

ET1-B (Endothelin-I) (SEQ ID NO:131) GCGGGTTTCC 653

Receptor D13162 GGCACACCCC 937 (SEQ ID NO: 137)

(1001 bp) (SEQ ID NO:132) GAGAAGTCTC 642 TGGGACCCCCA 913 (SEQ ID NO:138)

(SEQ ID NO:133) GGGATTTTAA 515 GAGGTTCCCC 773 (SEQ ID NO:139)

(SEQ ID NO:134) GGGGCTTCGG 489

(SEQ ID NO:135) GGACTGCCCC 96

(SEQ ID NO:136)

Analysis of the promoters of alpha adrenergic genes (Table 14; alpha la, alpha lb, alpha 2a, alpha 2b and alpha 2c4) which are also G-protein coupled receptors involved in cardiac hypertrophy and heart failure, is presented in Table 9 below.

TABLE 9

Alpha Adrenergic GenBank NFKB Repressor sites NFKB Enhancer

Receptor Ace. (p50-p50 specific) sites Genes' Promoters Number (p50-p65 specific)

Alpha- la Adrenergic GGACCTCGCC 6230 GGTTGTTTCC 6093

Receptor U72653 (SEQ ID NO:254) (SEQ ID NO:261)

(#4021 to #6195) GAGGTGGCCC 6211 GAGGGTTCCC 6071

(SEQ ID NO:255) (SEQ ID NO:262) AGGGCTCCCT 6145 GGGGATTTGT 5326

(SEQ ID NO:256) (SEQ ID NO:263) CGGCAGCCCC 6011 AGAATTCCCC 5198

(SEQ ID NO:257) (SEQ ID NO:264) GAGGGTCCCC 6002 GCAAAATCCG 4750

(SEQ ID NO:258) (SEQ ID NO:265) GCGAATTCCA 4997 GGAAACCCAG 4656

(SEQ ID NO:259) (SEQ ID NO:266) GGGACGTCCT 4794 GGGCACTTCC 4601

(SEQ ID NO:260) (SEQ ID NO:267) CGGAACCCCC 4327

(SEQ ID NO:268)

GGGGCGCCTC 810 TGGGCTGCCC 777

Alpha- lb Adrenergic (SEQ ID NO:269) (SEQ ID NO:275)

Receptor M99589 GGCGCGCTCC 659 CGGGCTCCCC 475

(#1 to #927) (SEQ ID NO:270) (SEQ ID NO:276) CCGCCTCCCC 613 CTGGCTTCCC 381

(SEQ ID NO:271) (SEQ DD NO:277) CGGGCGCCCC 604 AGGAATTCTC 5

(SEQ ID NO:272) (SEQ ID NO:278) GAGGAGCCGC 560

(SEQ ID NO:273) GGGAGCCCCC 73

(SEQ ID NO:274)

TGGGCTCCCT 2080 GGGAAGCCAG 1481

Alpha-2a Adrenergic (SEQ ID NO:279) (SEQ ID NO:286)

Receptor M23533 GGCGGGCCCC 1579 GGAGAACCCC 1231

( #1 to #2078) (SEQ ID NO:280) (SEQ ID NO:287)

GCGGCGCTCC 1409 GGGGATTCCC 693

(SEQ ID NO:281) (SEQ ID NO:288)

GGGGGTGCCT 1300 GGTTACTTCCCT 671

The presence of multiple p50 repressor sites in the promoters in Tables 8 and 9 further indicates that p50 homodimers are generated in response to a myocardial injury to transcriptionally repress the expression of various GPCR genes and, thus, effectively cause desensitization. Continued accumulation of the p50 homodimers due to MyoNl prevents the myocardium from resensitizing to GPCR signaling. Thus, reduction of the levels of p50 homodimers within the myocardial cell would not only restore the expression of these GPCRs but also maintain the normal stoichiometric distribution of appropriate GPCRs. Subsequently, the failing myocardium would behave normally, especially for its cardiac pump function. That is why p50 knock out mice is resistant to the heart-specific virus (encephalomyocarditis EMCV).

High affinity ΝFkB repressor sites and low affinity ΝFkB repressor sites are shown in Table 10. In a specific embodiment, high affinity repressor sites are used as double-stranded DNA decoys to titrate the endogenous p50-p50 homodimers. This is achieved either through naked double stranded DNA oligo decoys or through promoter therapy using AAV vectors as contiguous sites. In another embodiment low affinity sites are used to titrate out both p50- p50 homodimers as well as some p50-p65 heterodimers under certain disease conditions. This is also achieved either through naked double stranded DNA oligo decoys or through promoter therapy using AAV vectors as contiguous sites.

TABLE 10

High affinity Low affinity

NFKB Repressor sites NFKB Repressor sites

(p50-p50 specific) (p50-p50 specific)

(0-1 ' A' or 'T») (>1 'A' or 'T')

GGCACGCCCC (SEQ ID N0.325) GGGGAGCCAG (SEQ ID NO.360)

GGGCAGCCGC (SEQ ID N0.326) GAGAACCCCG (SEQ ID NO:3βl)

GCGAGGCCCC (SEQ ID N0.327) GGGCAGTGCC (SEQ ID N0.362)

GGGCCAGCCC (SEQ ID NO:328) GGGGAGGCCA (SEQ ID N0.363)

GCGGCGCCCC (SEQ ID NO:329) GGGGCTCCTG (SEQ ID N0.364)

GGGGCGGCGC (SEQ ID NO:330) GGGGAGGCTG (SEQ ID N0.365)

GGGGCCACCC (SEQ ID NO:331) GGAGACCCCC (SEQ ID NO:3ββ)

GGGCTGCCCC (SEQ ID NO:332) GGTGGGTCCC (SEQ ID N0.367)

GGGCGGCCCC SEQ ID NO:333) GAGGAGTCCC (SEQ ID N0.368)

GGCGCGCCCC SEQ ID NO:334) CCGGATCCCC (SEQ ID N0.369)

GCGGAGGCCG SEQ ID NO:335) GGGAAGGCGC (SEQ ID NO.370)

GGCGTGGCCC SEQ ID NO:33β) CCAGCTCCCC (SEQ ID NO:371)

GGGGAGCGGC SEQ ID NO:337) GGGGCGTCGC (SEQ ID NO:372)

GGGACGCGCC SEQ ID NO:338) GAGACGCCCC (SEQ ID NO:373)

CGGCAGCCCC SEQ ID NO:339) GCGTCTCCCC (SEQ ID NO:374)

GGGGCGCCTC SEQ ID NO:340) GGGACCCCCT (SEQ ID NO:375)

GGCGCGCTCC SEQ ID N0.341) CGGGCTCCCG (SEQ ID NO:376)

CCGCCTCCCC ( SEQ ID N0.342) GGGCCGCCTC (SEQ ID NO:377)

CGGGCGCCCC ( SEQ ID N0.343) GTGGACCCCC (SEQ ID NO:378)

GGCGGGCCCC ( SEQ ID NO:344) . GCAACGCCCC (SEQ ID N0.379)

GCGGCGCTCC ( SEQ ID N0.345) CGAACTCCCG (SEQ ID NO.380)

GCGGACGCCC ( SEQ ID N0.346) AGGAAGTTCC (SEQ ID NO:381) High affinity Low affinity

NFKB Repressor sites NFKB Repressor sites

(p50-p50 specific) (p50-p50 specific)

(0-1 'A' or *T') (>!' A' or 'T')

GGGCCGCTCC (SEQ ID NO:347) CGGCCTCCCA (SEQ ID NO:382)

CGGGCTCCCG (SEQ ID NO:348) AGAACGCCCC (SEQ ID NO:383)

GGGCAGCGCC (SEQ ID NO:349) GGCACACCCC (SEQ ID NO:384)

GGGGAGCCCC (SEQ ID NO:350) TGGGACCCCCA (SEQ ID NO: 385)

GGGGAGGCGC (SEQ ID NO:351) GAGGTTCCCC (SEQ ID NO:386)

GGGGGCGCCC (SEQ ID NO:352) GGGGCTTCGG (SEQ ID NO:387)

GGGGAGCCCG (SEQ ID NO:353) GGACTGCCCC (SEQ ID NO:388)

GGGGCGCTCC (SEQ ID NO:354) GAGCGTCCCC (SEQ ID NO:389)

GGGGGCGCCC (SEQ ID NO:355) GGGGAAGCGCG (SEQ ID NO:390)

GCGGCGCCCC (SEQ ID NO:356) TGGGCTCACC (SEQ ID NO:391)

GGGGCGCCCT (SEQ ID NO:357) GGGCGTCCCT (SEQ ID NO:392)

GGGGAGCGCC (SEQ ID NO:358) GGAGCTCCTC SEQ ID NO:393)

GGGGTCCCCG (SEQ ID NO:359) GAGCAGCCCC SEQ ID NO:394)

GGGCCTCCCC "50-14" (SEQ GCGTCTCCCC SEQ ID NO:395)

ID NO:69) GGGGTGCTCG SEQ ID NO:396)

CCAGATCCCC SEQ ID NO:397)

GGGCAGCGCC SEQ ID NO:398)

TCGACTCCCC SEQ ID NO: 399)

GGGGCTGCTC SEQ ID NO:400)

CGGGCTTCCC SEQ ID NO: 401)

GGGAAGTGCCC (SEQ ID NO:402)

GGAAATCTTC SEQ ID NO:403)

GGGGCTTCCC SEQ ID NO: 404)

GGGGAGCGCA SEQ ID NO:405)

TGAAAGTCCC SEQ ID NO: 406)

GGGGACGTCC ( SEQ ID NO:407)

GGGCCTTCAC ( SEQ ID NO: 408)

AAGGAGCCCC ( SEQ ID NO: 409)

GGACCTCGCC ( SEQ ID NO:410)

EXAMPLE 22 3D STRUCTURAL ANALYSIS OF MYO/VI-RELATED PROTEINS

The 3D images (FIGS. 31-36) were obtained by "3D superimposition analysis" using FSSP database containing the Protein Data Bank (PDB) structure files. The analysis was done on 'The Dali server (Holm and Sander, 1996).

The 3D structural homologies with Myo/Vlprotein were obtained for these proteins. This suggests these proteins have common structural motifs, particularly in the ankyrin repeats, which translates into functional motifs, such as are important in p50 homodimer generation.

The PDB file in FSSP database contains the co-ordinates data from NMR and X-ray analysis of the respective protein crystals. Using this data, the web-based software (in the

Dali server) draws the three-dimentional structure and superimposes with the other selected protein 3D structure. This analysis is better than the primary structure homology analysis since it compares the 3D structures. The figures show that the anti-parallel alpha-helices and the beta turn structures which are observed in MyoNl protein is similar in length. These proteins are all ankyrin-repeat containing proteins and some of them (cdk inhibitors) have been shown to inhibit ΝFKB dependent transcription activity. In a specific embodiment,

Myo/Vl is a generic p50-p50 homodimer-generating intermediary protein, whereas the others which have similar domains to Myo/Vl. They might also generate p50 homodimers, but in response to the function of other functional domains (such as the kinase inhibitor region in cdk inhibitors or the SH2 domain in p53bp2) they possess. Color-coded text at the bottom of each figure identifies the 3D structure of respective proteins within the superimposed picture.

EXAMPLE 23 MYO/V1-P50 INTERACTION AS A DRUG TARGET-ZN VIVO METHOD

In a specific embodiment, a MyoNl -p50-rel-GFP interaction trap screening assay system is performed in a mammalian cell. Using this in vivo screening assay system, compounds that inhibit or reduce the formation of p50-p50 homodimers are identified.

In an interaction trap, also referred to as an interactor hunt, a yeast strain contains two LexA operator-responsive reporters: a chromosomally integrated LEU2 gene and a plasmid- borne GAL 1 promo ter-lacZ fusion gene. Additionally, the strain contains a constitutively expressed chimeric protein comprising the LexA DΝA-binding domain and the protein of interest, which is unable to independently activate the reporter genes. An inducible yeast GAL1 promoter drives expression of an activation domain- fused cDΝA library, which is introduced into the yeast. Plating the transformed yeast on galactose containing media that also lacks leucine induces expression of the library. If interaction of the bait protein with a candidate target protein occurs, LEU2 is expressed and colony growth is permitted. Expression of the reporter gene is confirmed with plating on medium containing X-gal.

An interaction trap screening assay using propriety stable mammalian cell lines for identifying the following anticardiovascular disease or anti-aging compounds: 1) Myo/Nl - DΝ (MyoNl dominant-negative) mutants (see Examples 11 and 18) which inhibit the generation of p50 homodimers within the cell; 2) p50-DΝ (dominant-negative) mutants which inhibit the generation of 'active' p50 homodimers within the cell (see Example 25); 3) small peptide inhibitors which disrupt the interaction between Myo/Vl and p50 proteins; 4) small molecular weight chemical inhibitors which disrupt the interaction between Myo/Nl and p50 proteins; 50 small peptide inhibitors which disrupt the interaction between p50 and its target KB repressor DΝA sites on human βl-adrenergic receptor promoter; 6) small molecular weight chemical inhibitors which disrupt the interaction between p50 and its target KB repressor DΝA sites on human βl-adrenergic receptor promoter.

Mammalian cell lines stably expressing MyoNl and p50 target genes are developed using the strategy mentioned in FIG. 37A and FIG. 38A. These stable cell lines are developed using the cDΝA reagents (pcDΝA AM1.1 (SEQ ID ΝO:236)and p50 (SEQ ID NO:237)) as well as commercially available recombinant DNA reagents (pFRT/lacZeo, pBudCe4 and pcDNA5/FRT from Invitrogen Inc.; Carlsbad, CA).

"Myo/Vl -p50" stable cell line screening strategy is based on the principle of "Two- hybrid Protein Interaction Screening". As illustrated in FIG. 37B, in this cell line under basal conditions, because of the interaction between Myo/Vl and p50 proteins, the GFP protein expression is higher and, hence, high levels of green fluorescence are emitted at 488nm. However, when the cells were exposed to a specific inhibitor which disrupts the interaction between Myo/Vl and p50 proteins, the GFP expression is reduced and, hence, green fluorescence is lower (FIG. 37C). This stable cell line is used both for screening against a "Retroviral Peptide Library" (Library of recombinant retroviral particles expressing small peptides with extreme heterogeneity, well known in the art) as well as against a whole library of small molecular weight chemical compounds to identify the inhibitors of interaction between Myo/Vl and p50. Peptide(s) or chemical compound(s) which reduce the green fluorescence of the "Myo/Vl-p50 " cell line from its basal levels are active compounds for heart failure and aging treatment. "p50" overexpressing cell line carrying the blADRpromoter+GFP reporter gene is developed according to FIG. 38 A. In a specific embodiment, the GFP protein expression is lower under basal conditions (FIG. 38B) because of the overexpression of p50 proteins. In another specific embodiment, the abundant levels of p50-p50 homodimers inhibit the expression of human βl-adrenergic receptor gene by interacting with its specific p50-κB repressor sites. This stable cell line is used both for screening against a "Retroviral Peptide Library" (Library of recombinant retroviral particles expressing small peptides with extreme heterogeneity, well known in the art) as well as against a whole library of small molecular weight chemical compounds to identify the inhibitors of interaction between p50 and its target κB-DNA repressor sites. Peptide(s) or chemical compound(s) which increase the green fluorescence of the "p50" cell line from its basal levels are active compounds for heart failure and aging (FIG. 38C).

In a specific embodiment, the cell lines described above are utilized in a screening method wherein test compounds are presented to a Myo/Vl -p50 complex in a cell, and a detectable signal is measured. The following description concerns the test compounds utilized.

The three dimensional NMR/X-ray structural co-ordinates for Myo/Vl and p50 (KBF1) are already available (see Example 26). Using the three-dimensional structural data, two different approaches are followed to obtain 'Myo/Vl' and 'p50-homodimer' inhibitors.

First macromolecular (DNA, RNA or protein) aptamers are generated by methods well known in the art. Aptamers (derived from the latin word "aptus" = fitting) are short DNA, RNA or Peptide oligomers which can bind to a given protein ligand with high affinity and specificity due to their particular three-dimensional structure and which may thereby, for example, antagonize the biological function of the ligand. In a specific embodiment, "high affinity and specificity" aptamers (DNA, RNA, peptides, or proteins) are those which bind to the target proteins at low concentrations of salt (such as 137mM NaCI (IX PBS)) and elutes at high salt concentratons (such as 300mM NaCI and above). In an additional embodiment, nucleic acid macromolecular apatmers (DNA and RNA) are those that bind to the target protein, or ligand, at low concentrations of salt (such as 137mM NaCI (1 X PBS without formamide)) and elutes at high concentartions of formamide 50% and above. In another additional embodiment, apatmers (peptides or proteins) are those which bind to the target protein, or ligand, at low concentrations of salt (such as 137mM NaCI and at neutral pH (IX PBS at neutral pH 7.0)) and elute at low pH (pH 2.5 with 2.5mM glycine) or at high pH (pH 11.0 with lOOmM triethylamine). This high affinity binding specific aptamer (ssDNA and ssRNA) is obtained by repeatedly eluting the bound aptamers at the above concentrations of salt or formamide, or both, amplifying the eluted aptamers by PCR, and rebinding and eluting the amplified aptamers repeatedly (up to 25 times) to obtain the specific high affinity aptamer.

For nucleic acid macromolecular aptamers, single stranded nucleic acid molecules of approximately 30-60, or preferentially approximately 40, random bases with known 5' and 3' flanking polymerase chain reaction primer-binding sequences. The aptamers are screened for their high affinity binding towards immobilized MyoNl or ΝFKB p50 proteins using systematic evolution of ligand by exponential enrichment (SELEX) and deconvolution- SELEX (Tuerk and Gold, 1990; Morris et al, 1998) processes (FIG. 39). In another embodiment, a PhotoSELEX process is utilized in which more aggressive washings with denaturants are permitted to improve signal to noise ratio (Golden et al., 2000). Postselection aptamer optimization is conducted using backbone modification processes. Peptide aptamers are generated using in vivo phage-display, retroviral technologies (Brown, 2000; Colas, 2000), and the resulting specific lead aptamers are enriched and characterized for their high affinity binding to target Myo/Vl and p50 proteins. Finally, the resulting final population of macromolecular aptamers are synthesized in large quantities and are further screened for biological activity, i.e. reducing the p50-p50 homodimer generation and Myo/Vl inhibition using the propriety cell lines described above.

Secondly non-macromolecular aptamers, such as small molecular weight organic molecules like diketopiperazine derivatives, nucleoside or purine analogues and compounds similar to PFTalpha or Pfifthrin-alpha, Olomoucin, Flavopiridol, Purvalanol A & B, Paullone,. Kenpaullone, Indirubin, Tryprostatin,A & B, Pironetin, Monastrol, DHP2, Taxol family Paclitaxel, Νonataxel, Eleuthrobin, Discodermolide, SB-TE-1120, Fumagillin, TΝP-470, HA 14-1 alias ethyl 2-amino-6bromo-4-(l-cyano-2-ethoxy-2-oxoethyl)4H-chromene-3- carboxylate and non-nucleoside PETT series compunds using combinatorial chemistry, are screened for similarity to MyoNl and p50 three-dimensional structures in specific embodiments. This initial computer screening (Li et al, 1997) is done using the Available Chemicals Directory and CrossFire Belitsen database (ACD, ACD-SC and CrossFire2000) from Molecular Design Limited (San Leandro, CA). As of the time of filing of this application, the Available Chemicals Directory contains over 270,000 unique chemicals, the vast majority of which have 3D models available. Later, DOCK 3.5 screening (Briem and Kuntz, 1996) is conducted to narrow the most-specific (new chemical entity) NCE-leads against the target Myo/Vl and p50 proteins. The resulting small molecular weight compunds which possess the cell-permeable non-toxic properties are further screened against the biological assay of reducing the p50-p50 homodimer generation and MyoNl inhibition using the propriety cell lines described above. Since the small molecular weight compounds described above are developed against target proteins (ρ53, bcl2, etc.) similar to Myo/Nl and p50 proteins, in a specific embodiment the derivatives of similar compunds possess the p50- p50 homodimer-inhibiting biological activity.

EXAMPLE 24

MYO/V1 CHANGES THE RATIO OF NFKB DIMERS

IN VIVO IN FAVOR OF P50-P50 HOMODIMERS

In order to further confirm the in vitro results, in vivo studies were conducted to identify the role of Myo/Nl in ΝFKB homodimer generation. For this purpose, a strategy of adeno viral-mediated overexpression of Myo/Vl was chosen to exploit the inherent activation of ΝFKB heterodimers by recombinant adenoviral vectors. Thus, Myo/Vl overexpressing recombinant adenovirus might alter the composition of ΝFKB dimers induced by its viral vector backbone. HeLa cells were infected with recombinant adenoviruses expressing MyoNl (AdMyoNl) and β -galactosidase (Adβgal) and nuclear extracts were prepared 12 hours after infection. KB DΝA binding reactions (FIG. 40A) were conducted with three high- affinity ΝFKB dimer specific oligos and the levels ofmdividual ΝFKB dimers were quantified (FIG. 40B, C).

HeLa cells were infected with AdMyoNl or Adβgal recombinant adenoviruses at a MOI of 10. Twelve hours after infection nuclear extracts were prepared and GSAs were conducted with three high-affinity ΝFKB dimer specific oligonucleotides (#SeqB for p50-p50 homodimers; #UiΝOS for p65-p65 homodimers; IgGκB oligo for p50-p65 heterodimers) (lanes 1-6). Supershift experiments with NFKB p50 and p65 antibodies were conducted to confirm the nature of the NFKB dimers (lanes 7-15). p50 supershift complexes are indicated by *, p65 supershift complexes are indicated by arrows.

Results show that overexpression of AdMyo/Vl enhanced the generation of p50-p50

(lane 2 in FIG. 40A) and p65-p65 (lane 4 in FIG. 40A) homodimers compared to the control

Adβgal (lanes 1 and 3 in FIG. 40A). Interestingly, p50-p65 heterodimers are less abundant in

AdMyo/Vl compared to the Adβgal overexpressing cells (lanes 5 and 6 in.17 FIG. 40A). Thus, the observation of a simultaneous decrease in the levels of p50-p65 heterodimers and an increase in p5O-p50 and p65-p65 homodimers suggests a conversion from heterodimers to homodimers (FIG. 40B). Moreover, an unequal quantitative shift (FIG. 40B) occurred between p50-p50 homodimers and p50-p65 heterodimers in Myo/Vl overexpressing cells. While the levels of p50-p50 homodimers were elevated by 70%, the p50-p65 heterodimers declined by 26% (FIG. 40B). This observation suggests that Myo/Vl, in addition to generating the p50-p50 homodimers from the p50-p65 heterodimeric substrates might directly generate nascent p50-p50 homodimers from other in vivo substrates, further confirming the previous in vitro results. Furthermore, analysis of the relative levels of NFKB dimers (FIG. 40C) in AdMyo/Vl infected cells (p50-ρ65:p50-p50:p65-p65; 1.0:1.3:0.5) revealed that the levels of p50-p50 homodimers exceeded the levels of p50-p65 heterodimers compared to Adβgal (1.0:0.55:0.2). Since p50-p50 homodimers possess transcriptionally repressive activity (17-22), the observed shifts in the NFKB dimer ratio in MyoNl overexpressing cells might have repressive effects on the ΝFKB mediated transcription process.

Supershift experiments with ΝFKB antibodies confirmed the nature of ΝFKB dimers (lanes 7-15 in FIG. 40A) binding to the KB oligos '#SeqB' and .κB-Igκ'. p50 antibody supershifting the ΝFKB complexes bound to '#UiΝOS kB oligo' (lane 11 in FIG. 40A) was unexpected. Hence, chase experiments (#UiNOS bound complexes chased with 100X cold #SeqB and κB-Igκ oligos) were done and the results revealed that MyoNl.18 overexpressing HeLa cells still produced higher levels of p65-p65 homodimers compared to Adβgal. The results further revealed that ΝFKB dimers bound to the p50 antibody have slightly higher affinity towards the #UiΝOS oligo than the non-bound naked NFKB p65-p65 homodimers. However, without the p50 antibody, #UiNOS oligo retains high affinity and exclusive specificity towards p65-p65 homodimers. Additional chase experiments (#SeqB complexes chased with 100X cold #UiNOS and κB-Igκ oligos; κB-Igκ complexes chased with 100X cold #SeqB and #UiNOS oligos) were done, and the results were exactly the same as in FIG. 40A. EXAMPLE 25 P50 -'- CARDIAC PERFORMANCE

Two experiments wherein NFKB homodimers (p50-p50) are produced less or not at all have indicated that preventing excess NFkB homodimer formation during heart failure or myocardial injury improves the cardiac contractile function:

First, there is evidence (using a IκB-wt and IκB-S32S36 inhibitor which reduces the p50-p50 homodimer levels indirectly) that by preventing the formation of NFkB homodimers in mammalian HeLa cells one can reverse the downregulated expression of βl-adrenergic receptor even at the basal state. This experiement clearly indicates that reduction of p50-p50 homodimers would actually enhance the expression of βl-adrenergic receptor. Since p50-p50 homodimers target numerous genes during heart failure, reduction in the level of p50-p50 homodimers would actually reverse the expression of several genes during heart failure.

Second, analysis of the two dimensional M mode and Doppler echocardiographic data (see Table 11, below) for 'Resting' and Tsoproternol challenged' wild type and p50^"A (knockout) mice indicate a more effective diastolic function for p50^_/" mice similar to the endurance human atheletes (Pavlik et al, 2001).

Table 11: Two Dimensional M Mode and Doppler Echocardiographic Measurements

Wild Type Mice

Column Size Missing Mean Std Dev Std. Error CI. of Mean

E/A ratio baseline 3 0 2.557 0.393 0.227 0.976

E/A ratio acute-Isoproternol 3 0 1.650 0.617 0.356 . 1.532

LVMass Baseline 3 0 0.0693 0.00101 0.000581 0.00250

LVMass-acute-Isoproternol 3 0 0.0641 0.00736 0.00425 0.0183 r/h ratio baseline 3 0 3.020 0.346 0.200 0.859 r/h ratio acute-Isoproternol 3 0 2.422 0.305 0.176 0.759

Ao-VTI-baseline 3 0 0.0447 0.00404 0.00233 0.0100

Ao-VTI-acute-Isoproternol 3 0 0.0410 0.0101 0.00586 0.0252 p50-/- Mice

Column Size Missing Mean Std Dev Std. Error CI. of Mean

E/A ratio baseline 3 0 4.913 1.172 0.677 2.912

E/A acute-Isoproternol 3 0 1.923 0.409 0.236 1.015

LVMass Baseline 3 0 0.0845 0.0147 0.00851 0.0366

LVMass-acute-Isoproternol 3 0 0.0681 0.0127 0.00734 0.0316 r/h ratio baseline 3 0 2.714 0.124 0.0717 0.308 r/h ratio acute-Isoproternol 3 0 2.691 0.0826 0.0477 0.205

Ao-VTI-baseline 3 0 0.0400 0.000 0.000 0.000

Ao-VTI-acute-Isoproternol 3 0 0.0467 0.0146 0.00841 0.0362

Thus, the absence of p50-p50 homodimers makes the heart a more effective pumping organ even at the resting state similar to the human athelete's heart.

Briefly, Isoproternol (0.04 μg/kg/min) was administered to Wild-type and p50^{" "} mice for 5 minutes, and cardiac function was measured before and after isoproternol challenge using echocardiographic techniques. Isoproternol challenge (acute) experiment in mice is a simulatory experiment for assessing the cardiac contractile function during myocardial injury when catecholamine levels are elevated. An enhanced cardiac LV function (enhanced E/A ratio, Ao-VTI and LV Mass) is observed in p50^"Λ mice before and after administration of isoproternol compared to the wild-type mice (see Table 11). This cardiac performance is similar to the performance of a human athelete's heart (Pavlik et al, 2001). This experiment indirectly suggests that in the absence of p50-p50 homodimers (as is the case in p50^7" mice), cardiac function is enhanced even at the resting state as well as during myocarial injury.

In summary, evidence is provided herein that Myo/Vl is directly responsible for the generation of NFKB homodimers (p50-p50, p65-p65) in mammalian cells. Additionally, evidence is demonstrated that these NFKB homodimers are found abundant in hearts of several human heart failure patients. Moreover, we have presented evidence that these NFKB dimers can downregulate βl-adrenergic receptor gene expression in vivo in human cells, (βl- adrenergic receptor gene is a key gene downregulated during human heart failure.) Furthermore, evidentiary bioinformatics data is presented that all genes which are downregulated during human heart failure possess numerous high affinity binding sites for the NFKB homodimers in their respective promoters. Additionally, there is evidence (using a IκB-wt and IκB-S32S36 inhibitor) that by preventing the formation of NFkB homodimers in mammalian cells one can reverse the downregulated expression of βl-adrenergic receptor at the basal state. Finally, the hearts of p50^{" "} mice behaving like an endurance athelete's heart with a better diastolic function strongly suggests that reduction of p50-p50 homodimers is a key therapeutic target for improved cardiac performance in heart failure patients. Therefore, a therapeutic drug (inhibitor drug against MyoNl, p50 and p65 proteins) which would prevent the excess formation of ΝFKB homodimers (p50-p50, p65-p65) in the failing myocardium would improve the cardiac LV function. Since all injury initiated signal transduction pathways mediated by catecholamines, angiotensin II, endothelins and cytokines eventually converge on the generation of ΝFKB dimers, therapeutics against the ΝFKB homodimer generation would be successful. EXAMPLE 26 MATERIAL AND METHODS

Reagents.

Dulbecco's Modified Eagle Medium Ham's Nutrient Mixture F-12 (#11330-032) and Dulbecco's Phospate Buffered Saline (#14190-144) were obtained from Gibco (Gaithersburg, MD). Collagenase and DNAse were obtained from Worthington Biochemical Corp. (Freehold, NJ). Phenol was obtained from Sigma. Falcon Multiwell™ Primaria™ 6 well plates were obtained from Becton Dickinson Labware. Fugene 6 Transfection Reagent was obtained from Boehringer Mannheim. Poly (dl-dC) was obtained from Pharmacia Biotech Inc. Luciferase Assay Substrate was obtained from Promega Corp. (Madison, WI).

Secondary antibodies, namely sheep anti-rabbit immunoglobins FITC were obtained from 'The Binding Site Limited' (Birmingham, England) and Texas-red ITC conjugated goat anti-rabbit IgG antibody from Sigma (St. Louis, Missouri)

NF-KB Gel Shift Oligonucleotides (5 -AGT TGA GGG GAC TTT CCC AGG C-3'; SEQ ID NO: 179), p50 and p65 supershift antibodies and Jurkat-phorbol nuclear extracts (#sc-2133) were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Incorporation of ³H-phenylalanine.

As previously described (Sen, 1990; Mukherjee, 1993) the rate of ³H-phenylalanine uptake was used as an index of protein synthesis. Neonatale rat cardiac myocytes were stimulated with rat recombinant Myo/Vl for 24 hours in the presence of ³H-phenylalanine. Myocytes were incubated with 5μCi/ml H-phenylalanine in the cardiac myocyte culture medium, which contained 0.36 mM unlabelled phenylalanine, then stimulated with Myo/Vl (lOng, 20ng, 500ng) for 24 hours. Cells were rinsed three times with PBS and treated with 1 ml of 10%) (w/v) trichloracetic acid for 60 minutes at 4°C to precipitate proteins. The precipitate was washed three times with 95% (v/v) ethanol and resuspended in 0.15 M NaOH. Trichloroacetic acid-precipitable radioactivity was determined by liquid-scintillation counter. The results are mean ± SEM of relative increase in tritiated reagent (phenylalanine) incorporation compared to unstimulated control cells in each experiment. Phenylalanine was used as a positive control. Primary culture of neonatal rat ventricular myocytes.

Ventricles of 50 hearts of 2-day-old Sprague-Dawley rats (Charles River Laboratories) were removed and digested four times, 15 min each, in 20 ml of phosphate- buffered saline without Ca²⁺ and Mg²⁺, 0.1% collagenase (CL2, 250 units/mg) and 0.05% deoxyribonuclease I (D, 3200 units/mg). Cardiac myocytes and cardiac fibroblasts were first purified using a Percoll step gradient comprising (Pharmacia; Uppsala, Sweden) in Ads buffer (116.4 mM NaCI, 5.4 mM KCl, 5.6 mM dextrose, 10.9 mM NaH₂PO₄, 405.7 μM MgSO₄, 20 mM HEPES, pH 7.3), adjusted to final densities of 1.082, 1.061, and 1.051 g/ml. The enriched myocytes (banding between the 1.082 and 1.061 g/ml layers) were washed with medium D-MEM/F-12 (Dulbecco's modified Eagle's Medium/Ham's nutrient medium F-12, 15 mM HEPES, pH 7.4, 2 mML-glutamine, 50 μg/ml gentamicin) containing 5%> horse serum (Hyclone; Logan, UT). Ventricular myocytes were further purified by preplating to remove residual non-myocytes by differential adhesiveness, then were plated at a density of 0.5xl0⁶ cells/35-mm dish (Primaria, Falcon) and cultured 24 h in D-MEM/F-12 containing 5% horse serum. Medium was exchanged the next day. Approximately 95% of the cells displayed spontaneous contractile activity in culture.

Animals were cared for and euthanized in accordance with AAALAC guidelines. Immunofluorescence microscopy and cell staining.

Indirect immunofluoescence studies were performed in neonatal rat myocytes, in neonatale rat non-myocytes, adult rat cardiac myocytes and in cardiac feline myocytes. Neonatale as well as adult rat cardiac myocytes grown on glass coverslips were pretreated with Leptomycin B (LMB) overnight, subsequently treated with different reagents known to induce NF-κB (TNF-α, Interleukin 10), washed with lx PBS and fixed in formaldehyde and acetone (1:1) for 30 minutes. Cells treated with LMB alone were used as control.

Myo/Vl was detected by anti -Myo/Vl -antibody (polyclonal antibody against the full- length recombinant MyoNl protein) (1:500 dilution) followed by FITC-conjugated anti- rabbit IgG antibody (1 :100 dilution). Western blotting analysis

Western blotting analysis was performed for MyoNl on myocardial mitochondrial and cytosolic extracts from MHCsTΝF and wild type hearts prepared according to the method of Yang et al. (1980), except that the cytosolic extract was centrifuged at 30,000g for one hour. Equivalent amounts (20 μg) of mitochondrial and cytosolic myocardial protein lysates were then loaded onto 14% SDS-polyacrilamide gels, electrophoretically separated, and transferred to nitrocellulose membranes as described (Knowlton et al, 1998; Νakano et al, 1996). Western blotting analysis was performed as above using a polyclonal antibody against the full-length recombinant Myo/Nl protein. To confirm the nuclear localization of Myo/Vl western blotting analysis was performed on nuclear extracts from Jurkat-T cells as well. Expression of Myo/Vl in E. coli.

Myo/Vl was expressed in E. coli using the T7 promoter-based vector, pET3a (Novagen Inc.). The MyoNl recombinant pET3a-51 vector was introduced into BL21(DE3) LysS strain, which harbors a T7 RΝA polymerase coding gene. The recombinant Myo/Nl was expressed by growing the E. coli cells to early log phase and was later induced with 0.1 mM isopropyl- 1-thio-β-D-galactopyranoside for 16 h. Overnight induced cells were harvested and lysed in 50 mM Tris-HCl, pH 8.0, 75 mM ΝaCl by freeze thawing three times. The lysed E. coli cell debris was removed by centrifugation at 10,000 g, and the soluble supernatant was used to purify the recombinant MyoNl. The soluble form of recombinant myotrophin was highly abundant in the supernatant and was separated from the rest of the E. coli proteins using a Ultrafree®-15 Centrifugal Filter Device Biomax-30K ΝMWL Membrane 15ml Nol (Millipore Coφoration). Later, the purified recombinant myotrophin was concentrated using a Ultrafree®-15 Centrifugal Filter Device Biomax-30K ΝMWL Membrane 15ml Vol (Millipore Coφoration). On a 12% Tris-Tricine SDS-PAGE (Νovax), the purified recombinant MyoNl migrated as a single band at the 12-kDa region. Protein concentration was estimated using Bio-Rad protein assay reagent, and appropriate quantities of recombinant MyoNl were used in gel shift assays. The recombinant MyoNl was further tested for its immunoreactivity using native MyoNl -specific antibodies. Native Myo/Vl - specific antibodies were generated against a synthetic peptide containing the 17 amino acid residues of the T26 tryptic peptide of native Myo/Vl. Spectra/Por DispoDialysers were obtained from Spectrumlabs. Nuclear extracts and Electrophoretic Mobility Shift Assay.

Nuclear extracts were prepared with NE-PER (Product# 78833) manufacturer's

(Pierce Inc., IL, USA) protocol for nuclear extract isolation., and aliquots were frozen at -

80°C. After washing the cells once with lxPBS without Ca²⁺ and Mg²⁺ (Gibco), cells were scraped off the 100mm dish in lm of fresh PBS, transfered into eppendorf tube and centrifuged for 1 min at 14000 RPM at 4°C. The cell pellet was resuspended by gentle pipetting in 0.5ml buffer A (lOmM Hepes (pH 7.9 at 4°C), 1.5mM MgCl₂, lOmM KCl,

0.5mM DTT, 0.5mM PMSF). The cells were incubated on ice for 15 minutes and centrifuged for 1 min at 14000 RPM at 4°C. The cell pellets were resuspended in 35 μl of Buffer C

(20mM Hepes (pH 7.9 at 4°C), 25% (v/v) Glycerol, 0.42 mM NaCI, l,5mM MgCl₂, 0.2 mM EDTA, 0.5mM DTT, 0.5mM PMSF), incubated for 30 min at 4°C and centrifuged for 15 min at 14000 RPM at 4°C. The supernatant was used as NE and the protein concentration was determined by BCA.

The NF-κB consensus double-stranded oligonucleotide substrate (5 '-AGT TGA GGG GAC TTT CCC AGG C-3'; SEQ ID NO: 180), and p50 and p65 supershift antibodies were purchased from Santa Cruz Biotechnology Inc.

Partially purified recombinant Myo/Vl and native peptide Myo/Nl -specific antibody were used in the gel shift assays. DΝA-protein binding reactions were carried out in 12 mM HEPES-ΝaOH (pH 7.9), 4 mM Tris (pH 7.9), 60 mM KCl, 1 mM EDTA, and 1 mM dithiothreitol, 2 μg of poly(dl-dC) and 10%> glycerol in a final volume of 25 μl. The reactions contained 20 μg of neonatale rat cardiac myocyte nuclear extract, varying amounts (1-10 μl, containing 100 ng/μl) of bacterially expressed recombinant myotrophin, and 25,000 cpm of end-labeled ΝF-κB binding site probe. After incubating at room temperature for 30 min, the reactions were run on a 4% PAGE using 0.5 TBE as the gel buffer and 0.5TBE as the running buffer. The gel was electrophoresed at 100 volts for 30 minutes and at 160 volts for 150 minutes. Later, the gel was dried and autoradiographed overnight at -70 °C.

Purified MyoNl -specific antibodies (IgG) and preimmune antibodies (IgG) were preincubated with Myo/Nl for 1 hour in ice before the binding reactions were carried out. Transfection and Luciferase- Assay.

Cells were plated at a density of 0.5x10⁶ and transfected on the day after cell isolation. Fugene 6 was used according to the manufacturer's protocoll. Briefly, 3μl of Fugene 6 were added into 97μl of serum-free medium and incubated for 5 minutes. The diluted Fugene 6 Transfection Reagent was than added dropwise to the tubes containing the DΝA. After 15 min incubation at room temperature the mixture was added to the cells.

Fourty-eight hours later, cells were harvested and after one freeze-thaw cycle assayed for luciferase activity and for protein content using the Bradford assay (Pierce). Luciferase activity for each promoter was corrected for protein content of each extract.

Microtiter Plate Luminometer (Dynex Technologies) used a flash assay with lOOμl of Luciferase Assay Substrate per reaction. Transfection experiments were repeated at least three times.

Co-transfection with a constitutive lacZ gene was omitted for three reasons. The brief half-life of luciferase compared to other reporter proteins can lead to misleading inteφretation, especially for transcriptional repression (Abdellatif et al, 1994); commonly used viral promoters contain functional AP-1 or SRF sites (Imbra and Karin, 1986; Zachow and Conklin, 1992; Wade et al., 1992) and are up-regulated by expression vectors used here; neutral core promoters that are unaffected by Fos/Jun, such as the c-fos -57/+109 core promoter, are insufficiently active in cardiac myocytes for accurate quantitation of lacZ activity, but can be utilized to drive luciferase in parallel cultures, as an ostensibly constitutive control. Protein content was not significantly altered by any of the inteventions, compared to the corresponding vehicle-treated, vector-transfected cells. Statistics.

Results are given as mean ± S.E.M if not indicated otherwise. Statistical analyses were performed by using ANONA (analysis of variance). Significance was accepted at P < 0.05.

REFERENCES

All patents and publications mentioned in the specification are indicative of the level of those skilled in the art to which the invention pertains. All patents and publications are herein incoφorated by reference to the same extent as if each individual publication was specifically and individually indicated to be incoφorated by reference.

PATENTS

U.S. Patent No. 4,608,251; issued August 26, 1986

U.S. Patent No. 4,601,903; issued July 22, 1986

U.S. Patent No. 4,599,231; issued July 8, 1986

U.S. Patent No. 4,599,230; issued July 8, 1986

U.S. Patent No. 4,596,792; issued June 24, 1986

U.S. Patent No. 5,840,873, issued Nov. 24, 1998

U.S. Patent No. 5,843, 640, issued Dec. 1, 1998

U.S. Patent No. 5,843,650, issued Dec. 1. 1998

U.S. Patent No. 5,843,651, issued Dec. 1, 1998

U.S. Patent No. 5,843,663, issued Dec. 1, 1998

U.S. Patent No. 5,846,708, issued Dec. 8, 1998

U.S. Patent No. 5,846,709, issued Dec. 8, 1998

U.S. Patent No. 5,846,717, issued Dec. 8, 1998

U.S. Patent No. 5,846,726, issued Dec. 8, 1998

U.S. Patent No. 5,846,729, issued Dec. 8, 1998

U.S. Patent No. 5,846,783, issued Dec. 8, 1998 U.S. Patent No. 5,849,481, issued Dec. 15, 1998 U.S. Patent No. 5,849,483, issued Dec. 15, 1998 U.S. Patent No. 5,849,486, issued Dec. 15, 1998 U.S. Patent No. 5,849,487, issued Dec. 15, 1998 U.S. Patent No. 5,849,497, issued Dec. 15, 1998 U.S. Patent No. 5,849,546, issued Dec. 15, 1998 U.S. Patent No. 5,849,547, issued Dec. 15, 1998 U.S. Patent No. 5,851,770, issued Dec. 22, 1998 U.S. Patent No. 5,851,772, issued Dec. 22, 1988 U.S. Patent No. 5,853,990, issued Dec. 29, 1998 U.S. Patent No. 5,853, 993, issued Dec. 29, 1998 U.S. Patent No. 5,853,992, issued Dec. 29, 1998 U.S. Patent No. 5,856,092, issued Jan. 5, 1999 U.S. Patent No. 5,858,652, issued Jan. 12, 1999 U.S. Patent No. 5,861,244, issued Jan. 19, 1999 U.S. Patent No. 5,863,732, issued Jan. 26, 1999 U.S. Patent No. 5,863,753, issued Jan. 26, 1999 U.S. Patent No. 5,866,331, issued Feb. 2, 1999 U.S. Patent No. 5,866,336, issued Feb. 2, 1999 U.S. Patent No. 5,866,337, issued Feb. 2, 1999 U.S. Patent No. 5,900,481, issued May 4, 1999 U.S. Patent No. 5,905,024, issued May 18, 1999 U.S. Patent No. 5,910,407, issued June 8, 1999 U.S. Patent No. 5,912,124, issued June 15, 1999 U.S. Patent No. 5,912,145, issued June 15, 1999 U.S. Patent No. 5,912,148, issued June 15, 1999 U.S. Patent No. 5,916,776, issued June 29, 1999 U.S. Patent No. 5,916,779, issued June 29, 1999 U.S. Patent No. 5,919,626, issued July 6, 1999 U.S. Patent No. 5,919,630, issued July 6, 1999 U.S. Patent No. 5,922, 574, issued July 13, 1999 U.S. Patent No. 5,925,517, issued July 20, 1999 U.S. Patent No. 5,925,525, issued Jul. 20, 1999 U.S. Patent No. 5,928,862, issued July 27, 1999

U.S. Patent No. 5,928,869, issued July 27, 1999

U.S. Patent No. 5,928,870, issued, Jul. 27, 1999

U.S. Patent No. 5,928,905, issued July 27, 1999

U.S. Patent No. 5,928,906, issued July 27, 1999

U.S. Patent No. 5,929,227, issued July 27, 1999

U.S. Patent No. 5,932,413, issued Aug. 3, 1999

U.S. Patent No. 5,932,451, issued Aug. 3, 1999

U.S. Patent No. 5,935,791, issued Aug. 10, 1999

U.S. Patent No. 5,935,825, issued Aug. 10, 1999

U.S. Patent No. 5,939,291, issued Aug. 17, 1999

U.S. Patent No. 5,942,391, issued Aug. 24, 1999

European Application No. 320 308 '

European Application No. 329 822

GB Application No. 2 202 328

PCT Application No. PCT/US87/00880

PCT Application No. PCT/US89/01025

PCT Application WO 88/10315

PCT Application WO 89/06700

PCT Application WO 90/07641

PUBLICATIONS

Abdellatif, M., MacLellan, W. R., and Schneider, M. D. (1994) J. Biol. Chem. 269, 15423-15426.

Adderley SR, Fitzgerald DJ. Oxidative damage of cardiomyocytes is limited by extracellular regulated kinases 1/2 -mediated induction of cyclooxygenase-2. J Biol Chem. 1999 Feb 19;274(8):5038-46.

Ahgren C, Backro K, Bell FW, Cantrell AS, Clemens M, Colacino JM, Deeter JB,Engelhardt JA, Hogberg M, Jaskunas SR, et al White RR, Sullenger BA, Rusconi CP. The PETT series, a new class of potent nonnucleoside inhibitors of human immunodeficiency virus type 1 reverse transcriptase. Antimicrob Agents Chemother 1995 Jun;39(6): 1329-35

Anderson, K.M., I. Berrebi-Bertrand, R.B. Kirkpatrick, M. S. McQueney, D.C. Underwood, S. Rouanet and M. Chabot-Fletcher. 1999. CDNA sequence and characterization of the gene that encodes human Myotrophin Vl protein, a mediator of Cardiac hypertrophy. J. Mol. Cell. Cardiol. 31, 705-719. Baer M, Dillner A, Schwartz RC, Sedon C, Nedospasov S, Johnson PF. Tumor necrosis factor alpha transcription in macrophages is attenuated by an autocrine factor that preferentially induces NF-kappaB p50. Mol Cell Biol. 1998 Oct;18(10):5678-89.

Bangham et al, J. Mol. Biol, 13:238, 1965.

Batchelor AH, Piper DE, de la Brousse FC, McKnight SL, Wolberger C. The structure of GABPalpha/beta: an ETS domain- ankyrin repeat heterodimer bound to DNA. Science. 1998 Feb 13;279(5353):1037-41.

Blom N, Gammeltoft S, Brunak S. Sequence and structure-based prediction of eukaryotic protein phosphorylation sites. J Mol Biol. 1999 Dec 17;294(5): 1351-62.

Blum JH, Dove SL, Hochschild A, Mekalanos JJ. Isolation of peptide aptamers that inhibit intracellular processes. Proc Natl Acad Sci U S A. 2000 Feb 29;97(5):2241-6.

Boado, RJ, Tsukamoto, H, Pardridge, WM. Drug delivery of antisense molecules to the brain for the treatment of Alzheimer's and cerebral AIDS. J. Pharm. Sci. 1998 Nov; 87(11): 1308-15.

Bressler P, Brown K, Timmer W, Bours N, Siebenlist U, Fauci AS. Mutational analysis of the p50 subunit of ΝF-kappa B and inhibition of ΝF-kappa B activity by trans- dominant p50 mutants. JVirol 1993 Jan;67(l):288-93.

Bretschneider E, Kaufrnann R, Braun M, Wittpoth M, Glusa E, Νowak G, Schror K. Evidence for proteinase-activated receptor-2 (PAR-2)-mediated mitogenesis in coronary artery smooth muscle cells. Br J Pharmacol. 1999 Apr;126(8): 1735-40.

Bretschneider E, Kaufrnann R, Braun M, Wittpoth M, Glusa E, Νowak G, Schror K. Evidence for proteinase-activated receptor-2 (PAR-2)-mediated mitogenesis in coronary artery smooth muscle cells. Br J Pharmacol. 1999 Aρr;126(8): 1735-40.

Bristow MR, Ginsburg R, Minobe W, Cubicciotti RS, Sageman WS, Lurie K, Billingham ME, Harrison DC, Stinson EB. Decreased catecholamine sensitivity and beta- adrenergic-receptor density in failing human hearts. Ν Engl J Med. 1982 Jul 22;307(4):205- 11.

Bristow MR, Minobe WA, Raynolds MV, Port JD, Rasmussen R, Ray PE, Feldman AM. Reduced beta 1 receptor messenger RΝA abundance in the failing human heart. J Clin Invest. 1993 Dec;92(6):2737-45.

Bristow MR. Changes in myocardial and vascular receptors in heart failure. J Am Coll Cardiol. 1993 Oct;22(4 Suppl A):61A-71A. Review.

Brody EΝ, Gold L. Aptamers as therapeutic and diagnostic agents. J Biotechnol. 2000 Mar;74(l):5-13.

Briem H, Kuntz ID. Molecular similarity based on DOCK-generated fingeφrints. J Med Chem 1996 Aug 16;39(17):3401-8. Brown, KC. New approaches for cell-specific targeting: identification of cell- selective peptides from combinatorial libraries. Curr. Opin. Chem. Biol. 2000 Feb; 4(1): 16- 21.

Brown NF, Weis BC, Husti JE, Foster DW, McGarry JD. Mitochondrial carnitine palmitoyltransferase I isoform switching in the developing rat heart. J Biol Chem. 1995 Apr 14;270(15):8952-7.

Carter RS, Avadhani NG. Cooperative binding of GA-binding protein transcription factors to duplicated transcription initiation region repeats of the cytochrome c oxidase subunit IV gene. J Biol Chem. 1994 Feb 11;269(6):4381-7.

Carter RS, Avadhani NG. Cooperative binding of GA-binding protein transcription factors to duplicated transcription initiation region repeats of the cytochrome c oxidase subunit IV gene. J Biol Chem. 1994 Feb l l;269(6):4381-7.

Colas P. Combinatorial protein reagents to manipulate protein function. Curr Opin Chem Biol 2000 Feb;4(l):54-9

Crepieux P, Coll J, Stehelin D. The Ets family of proteins: weak modulators of gene expression in quest for transcriptional partners. Crit Rev Oncog. 1994;5(6):615-38. Review.

Crews CM, Mohan R. Small-molecule inhibitors of the cell cycle. Curr Opin Chem Biol. 2000 Feb;4(l):47-53.

Deamer and Uster, "Liposome Preparation: Methods and Mechanisms," LIPOSOMES, M. Ostro ed. (1983).

Dupriez VJ, Darville MI, Antoine IV, Gegonne A, Ghysdael J, Rousseau GG. Characterization of a hepatoma mRNA transcribed from a third promoter of a 6- phosphofructo-2-kinase/fructose-2,6-bisphosphatase-encoding gene and controlled by ets oncogene-related products. Proc Natl Acad Sci U S A. 1993 Sep l;90(17):8224-8.

Dutheil N, Shi F, Dupressoir T, Linden RM. Adeno-associated virus site-specifically integrates into a muscle-specific DNA region. Proc Natl Acad Sci U S A. 2000 Apr 25;97(9):4862-6.

Esser V, Brown NF, Cowan AT, Foster DW, McGarry JD. Expression of a cDNA isolated from rat brown adipose tissue and heart identifies the product as the muscle isoform of carnitine palmitoyltransferase I (M-CPT I). M-CPT I is the predominant CPT I isoform expressed in both white (epididymal) and brown adipocytes. J Biol Chem. 1996 Mar 22;271(12):6972-7.

Genuario RR, Perry RP. The GA-binding protein can serve as both an activator and repressor of ribosomal protein gene transcription. J Biol Chem. 1996 Feb 3;271(8):4388-95.

Ghosh S, May MJ, Kopp EB. NF -kappa B and Rel proteins: evolutionarily conserved mediators of immune responses. Annu Rev Immunol 1998;16:225-60 Ghosh and Bachhawat, "Targeting of liposomes to hepatocytes," In: Wu G. Wu C ed., Liver diseases, targeted diagnosis and therapy using specific receptors and ligands, New York: Marel Dekker, pp. 87-104, 1991.

Gilbert EM, Olsen SL, Renlund DG, Bristow MR. beta-adrenergic receptor regulation and left ventricular function in idiopathic dilated cardiomyopathy. Am J Cardiol. 1993 Mar 25;71(9):23C-29C.

Golden MC, Collins BD, Willis MC, Koch TH. Diagnostic potential of PhotoSELEX- evolved ssDNA aptamers.J Biotechnol. 2000 Aug 25;81(2-3):167-78.

Graves BJ. Inner workings of a transcription factor partnership. Science. 1998 Feb 13;279(5353):1000-2.

Gregoriadis, DRUG CARRIERS IN BIOLOGY AND MEDICINE, G. Gregoriadis (ed.), 1979, pp. 287-341.

Gupta M, Zak R, Libermann TA, Gupta MP. 1998. Tissue-restricted expression of the cardiac alpha-myosin heavy chain gene is controlled by a downstream repressor element containing a palindrome of two ets-binding sites.Mol Cell Biol. 1998 Dec;18(12):7243-58.

Haas JG, Baeuerle PA, Riethmuller G, Ziegler-Heitbrock HW. Molecular mechanisms in down-regulation of tumor necrosis factor expression. Proc Natl Acad Sci U S A. 1990 Dec;87(24):9563-7.

Hadri KE, Courtalon A, Gauthereau X, Chambaut-Guerin AM, Pairault J, Feve B. Differential regulation by tumor necrosis factor-alpha of betal-, beta2-, and beta3- adrenoreceptor gene expression in 3T3-F442A adipocytes. J Biol Chem. 1997 Sep 26;272(39):24514-21.

Hamm J, Fornerod M. Anti-idiotype RNAs that mimic the leucine-rich nuclear export signal and specifically bind to CRMl/exportinl. Chem Biol 2000 May;7(5):345-54

Hattori Y, Akimoto K, Murakami Y, Kasai K. Pyrrolidine dithiocarbamate inhibits cytokine-induced VCAM-1 gene expression in rat cardiac myocytes. Mol Cell Biochem. 1997 Dec;177(l-2):177-81.

Hattori Y, Nakanishi N, Kasai K. Role of nuclear factor kappa B in cytokine-induced nitric oxide and tetrahydrobiopterin synthesis in rat neonatal cardiac myocytes. J Mol Cell Cardiol. 1997 Jun;29(6): 1585-92.

Helenius M, Hanninen M, Lehtinen SK, Salminen A. Aging-induced up-regulation of nuclear binding activities of oxidative stress responsive NF-κB transcription factor in mouse cardiac muscle. J Mol Cell Cardiol. 1996 Mar;28(3):487-98.

Holm, L and Sander, C. Mapping the protein universe. Science 1996; 273(5275):595- 60. Imbra, R. J., and Karin, M. (1986) Nature 323, 555-558

Janknecht R. 1996. Analysis of the ERK-stimulated ETS transcription factor ER81. Mol Cell Biol. Apr;16(4):1550-6.

Kacimi R, Karliner JS, Koudssi F, Long CS. Expression and regulation of adhesion molecules in cardiac cells by cytokines: response to acute hypoxia. Circ Res. 1998 Mar 23;82(5):576-86.

Kaneda et al, "Increased expression of DNA cointroduced with nuclear protein in adult rat liver," Science, 243:375-378, 1989.

Karmann K, Min W, Fanslow WC, Pober JS. Activation and homologous desensitization of human endothelial cells by CD40 ligand, tumor necrosis factor, and interleukin 1. J Exp Med. 1996 Jul l;184(l):173-82.

Kastenbauer S, Ziegler-Heitbrock HW. NF-kappaBl (p50) is upregulated in lipopolysaccharide tolerance and can block tumor necrosis factor gene expression. Infect Immun. 1999 Apr;67(4): 1553-9.

Kato et al, "Expression of hepatitis B virus surface antigen in adult rat liver," J. Biol. Chem., 266:3361-3364, 1991.

Knowlton AA, Kapadia S, Torre-Amione G, Durand JB, Bies R, Young J, Mann DL. Differential expression of heat shock proteins in normal and failing human hearts. J Mol Cell Cardiol. 1998 Apr;30(4):811-8.

Kreegipuu A, Blom N, Brunak S, Jarv J. Statistical analysis of protein kinase specificity determinants. FEBS Lett. 1998 Jun 23;430(l-2):45-50. Review.

Kreegipuu A, Blom N, Brunak S. PhosphoBase, a database of phosphorylation sites: release 2.0. Nucleic Acids Res. 1999 Jan l;27(l):237-9.

Kunsch C, Ruben SM, Rosen CA. Selection of optimal kappa B/Rel DNA-binding motifs: interaction of both subunits of NF -kappa B with DNA is required for transcriptional activation. Mol Cell Biol 1992 Oct;12(10):4412-21

Lenka N, Vijayasarathy C, Mullick J, Avadhani NG. Structural organization and transcription regulation of nuclear genes encoding the mammalian cytochrome c oxidase complex. Prog Nucleic Acid Res Mol Biol. 1998;61 :309-44. Review.

Li S, Gao J, Satoh T, Friedman TM, Edling AE, Koch U, Choksi S, Han X, Korngold R, Huang Z. A computer screening approach to immunoglobulin superfamily structures and interactions: discovery of small non-peptidic CD4 inhibitors as novel immuno-therapeutics. Proc Natl Acad Sci U S A. 1997 Jan 7;94(l):73-8. Logeat F, Israel N, Ten R, Blank V, Le Bail O, Kourilsky P, Israel A. Inhibition of transcription factors belonging to the rel/NF-kappa B family by a transdominant negative mutant.EMBO J 1991 Jul;10(7):1827-32.

McKean DJ, Huntoon C, Bell M. Ligand-induced desensitization of interleukin 1 receptor-initiated intracellular signaling events in T helper lymphocytes. J Exp Med. 1994 Oct l;180(4):1321-8.

McKean DJ, Huntoon C, Bell M. Ligand-induced desensitization of interleukin 1 receptor- initiated intracellular signaling events in T helper lymphocytes. J Exp Med. 1994 Oct l;180(4):1321-8.

Meldrum DR, Cleveland JC Jr, Sheridan BC, Rowland RT, Selzman CH, Banerjee A, Harken AH. Alpha-adrenergic activation of myocardial NF kappa B during hemorrhage. J Surg Res. 1997 May;69(2):268-76.

Meldrum DR, Shenkar R, Sheridan BC, Cain BS, Abraham E, Harken AH. Hemorrhage activates myocardial NFkappaB and increases TNF-alpha in the heart. J Mol Cell Cardiol. 1997 Oct;29(10):2849-54.

Monte D, Coutte L, Baert JL, Angeli I, Stehelin D, de Launoit Y. 1995 Molecular characterization of the ets-related human transcription factor ER81. Oncogene. Aug 17;l l(4):771-9.

Morishita R, Sugimoto T, Aoki M, Kida I, Tomita N, Moriguchi A, Maeda K, Sawa Y, Kaneda Y, Higaki J, Ogihara T. In vivo transfection of cis element "decoy" against nuclear factor-kappaB binding site prevents myocardial infarction. Nat Med. 1997 Aug;3(8):894-9.

Morris KN, Jensen KB, Julin CM, Weil M, Gold L. High affinity ligands from in vitro selection: complex targets. Proc Natl Acad Sci U S A. 1998 Mar 17;95(6):2902-7.

Nakano M, Knowlton AA, Yokoyama T, Lesslauer W, Mann DL. Tumor necrosis factor-alpha-induced expression of heat shock protein 72 in adult feline cardiac myocytes. Am J Physiol. 1996 Apr;270(4 Pt 2):H1231-9.

Nicolau et al, "Liposomes as carriers for in vivo gene transfer and expression," Methods Enzymol, 149:157-176, 1987.

Pardridge, WM, Boado, RJ, Kang, YS. Vector-mediated delivery of a polyamide ("peptide") nucleic acid analogue through the blood-brain barrier in vivo. Proc. Natl. Acad. Sci. USA 1995 Jun 6; 92(12): 5592-6.

Pavlik, G., Olexo, Z., Osvath, P., Sido, Z., and R. Frenkl. (2001) Echocardiographic characteristics of male atheletes of different age. Br. J. Sports Med. 35, 95-99.

Pennica, D., K. J. Shaw, S. M. Luoh, and W. I. Wood. 1995. Isolation of cDNA Clones encoding the mouse protein V-l. Gene. 158:305-6.

Phillips MI, Galli SM, Mehta JL. The potential role of antisense oligodeoxynucleotide therapy for cardiovascular disease. Drugs. 2000 Aug;60(2):239-48. Plaksin D, Baeuerle PA, Eisenbach L. KBF1 (p50 NF-kappa B homodimer) acts as a repressor of H-2Kb gene expression in metastatic tumor cells. J Exp Med 1993 Jun 1;177(6): 1651-62.

Raizada MK, Francis SC, Wang H, Gelband CH, Reaves PY, Katovich MJ. Targeting of the renin-angiotensin system by antisense gene therapy: a possible strategy for the long-term control of hypertension. J Hypertens. 2000 Apr;18(4):353-62.

"Remington's Pharmaceutical Sciences" 15th Edition, pages 1035-1038, 1570-1580.

Sachdev, S., A. Hoffmann, and M. Hannink. 1998. Nuclear localization of IkappaB alpha is mediated by the second ankyrin repeat: the IkappaB alpha ankyrin repeats define a novel class of cis- acting nuclear import sequences. Mol Cell Biol. 18:2524-34.

Safrany G, Perry RP. The relative contributions of various transcription factors to the overall promoter strength of the mouse ribosomal protein L30 gene. Eur J Biochem. 1995 Jun 15;230(3):1066-72.

Sambrook, Fritsch, Maniatis, In: Molecular Cloning: A Laboratory Manual, Vol. 1, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, Ch. 7,7.19-17.29, 1989.

Schwarz EM, Badorff C, Hiura TS, Wessely R, Badorff A, Verma IM, Knowlton KU. NF-kappaB-mediated inhibition of apoptosis is required for encephalomyocarditis virus virulence: a mechanism of resistance in p50 knockout mice. J Virol. 1998 Jul;72(7):5654-60.

Sedgwick SG, Smerdon SJ. 1999. The ankyrin repeat: a diversity of interactions on a common structural framework. Trends Biochem Sci. Aug;24(8):311-6. Review.

Sen, S., G. Kundu, N. Mekhail, J. Castel, K. Misono, and B. Healy. 1990. Myotrophin: purification of a novel peptide from spontaneously hypertensive rat heart that influences myocardial growth. J Biol Chem. 265:16635-43.

Sha WC, Liou HC, Tuomanen El, Baltimore D. Targeted disruption of the p50 subunit of NF-kappa B leads to multifocal defects in immune responses. Cell. 1995 Jan 27;80(2):321-30.

Sil, P., K Misono, & S. Sen. 1993. Myotrophin in human cardiomyopathic heart.Circ Res.73:98-108.

Sivasubramanian, N., G. Adhikary, P. C. Sil, and S. Sen. 1996. Cardiac myotrophin exhibits rel/NF-kappa B interacting activity in vitro. J Biol Chem. 271 :2812-2816.

Song CS, Jung MH, Supakar PC, Chen S, Vellanoweth RL, Chatterjee B, Roy AK. Regulation of androgen action by receptor gene inhibition. Ann N Y Acad Sci. 1995 Jun 12;761:97-108. Review.

Supakar PC, Jung MH, Song CS, Chatterjee B, Roy AK. Nuclear factor kappa B functions as a negative regulator for the rat androgen receptor gene and NF-kappa B activity increases during the age-dependent desensitization of the liver. J Biol Chem. 1995 Jan 13;270(2):837-42. Szoka and Papahadjopoulos, Proc. Nat'l Acad. Sci. U.S.A. 75:4194-98 (1978).

Taoka, M., T. Isobe, T. Okuyama, M. Watanabe, H. Kondo, Y. Yamakawa, F. Ozawa, F. Hishinuma, M. Kubota, A. Minegishi, et al. 1994. Murine cerebellar neurons express a novel gene encoding a protein related to cell cycle control and cell fate determination proteins. J Biol Chem. 269:9946-51.

Taoka, M., T. Yamakuni, S. Y. Song, Y. Yamakawa, K. Seta, T. Okuyama, and T. Isobe. 1992. A rat cerebellar protein containing the cdclO/SW16 motif. Eur J Biochem. 207:615-20.

Thoφe DS. Forecasting Roles of Combinatorial Chemistry in the Age of Genomically Derived Drug Discovery Targets. Comb Chem High Throughput Screen 2000 Oct l;3(5):421-436.

Toledano MB, Ghosh D, Trinh F, Leonard WJ. N-terminal DNA-binding domains contribute to differential DNA-binding specificities of NF-kappa B p50 and p65. Mol Cell Biol 1993 Feb;13(2):852-60.

Tuerk C, Gold L. Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science. Aug 3;249(4968):505-10, 1990

Tyler, BM, Jansen, K., McCormick, DJ, Douglas, CL, Boules, M, Stewart, JA, Zhao, L, Lacy, B, Cusack, B, Faug, A, Richelson, E. Peptide nucleic acids targeted to the neurotensin receptor and administered i.p. cross the blood-brain barrier and specifically reduce gene expression. Proc. Natl. Acad. Sci. USA 1999 Jun8; 96(12):7053-8.

Wade, E. J., Klucher, K. M., and Spector, D. H. (1992) J. Virol. 66, 2407-2417.

Wang JL, Liu D, Zhang ZJ, Shan S, Han X, Srinivasula SM, Croce CM, Alnemri ES,Huang Z. Structure-based discovery of an organic compound that binds Bcl-2 protein and induces apoptosis of tumor cells. Proc Natl Acad Sci U S A 2000 Jun 20;97(13):7124-9.

Wang JL, Zhang ZJ, Choksi S, Shan S, Lu Z, Croce CM, Alnemri ES, Korngold R, Huang Z. Cell permeable Bcl-2 binding peptides: a chemical approach to apoptosis induction in tumor cells. Cancer Res. 2000 Mar 15;60(6):1498-502.

Weis BC, Cowan AT, Brown N, Foster DW, McGarry JD. Use of a selective inhibitor of liver carnitine palmitoyltransferase I (CPT I) allows quantification of its contribution to total CPT I activity in rat heart. Evidence that the dominant cardiac CPT I isoform is identical to the skeletal muscle enzyme. J Biol Chem. 1994 Oct 21;269(42):26443-8.

White RR, Sullenger BA, Rusconi CP. Developing aptamers into therapeutics. J Clin Invest. 2000 Oct 15;106(8):929-934.

Wong SC, Fukuchi M, Melnyk P, Rodger I, Giaid A. Induction of cyclooxygenase-2 and activation of nuclear factor-kappaB in myocardium of patients with congestive heart failure. Circulation. 1998 Jul 14;98(2):100-3.

Wong et al, "Appearance of β-lactamase activity in animal cells upon liposome mediated gene transfer," Gene, 10:87-94, 1980. Xia, Y., Buja, L. M., McMillin, J. B. (1996). Change in Expression of Heart Carnitine Palmitoyltransferase I Isoforms with Electrical Stimulation of Cultured Rat Neonatal Cardiac Myocytes. J. Biol. Chem. 271 : 12082-12087

Yamakuni,T., T. Yamamoto, M. Hoshino, S-Y. Song, H. Yamamoto, M.K. Sumitomo, A. Minegishi, M. Kubota, M. Ito, and S. Konishi. 1998. A novel protein containing cdcl0/swl6 motifs regulates expression of mRNA encoding catecholamine biosynthesizing enzymes. J. Biol. Chem. 273, 42:27051-27054.

Yang Y, Nanduri S, Sen S, Qin J. The structural basis of ankyrin-like repeat function as revealed by the solution structure of myotrophin. Structure. 1998 May 15;6(5):619-26.

Yang Y, Rao NS, Walker E, Sen S, Qin J. Nuclear magnetic resonance assignment and secondary structure of an ankyrin-like repeat-bearing protein: myotrophin.Protein Sci. 1997 Jun;6(6): 1347-51.

Yang J, Liu X, Bhalla K, Kim CN, Ibrado AM, Cai J, Peng TI, Jones DP, Wang X. Prevention of apoptosis by Bcl-2: release of cytochrome c from mitochondria blocked. Science. 1997 Feb 21;275(5303):1129-32.

Yoo W, Martin ME, Folk WR. PEA1 and PEA3 enhancer elements are primary components of the polyomavirus late transcription initiator element. J Virol. 1991 Oct;65(10):5391-400.

Yu M, Yang XY, Schmidt T, Chinenov Y, Wang R, Martin ME. GA-binding protein- dependent transcription initiator elements. Effect of helical spacing between polyomavirus enhancer a factor 3(PEA3)/Ets-binding sites on initiator activity. J Biol Chem. 1997 Nov 14;272(46):29060-7.

Zachow, K. R., and Conklin, K. F. (1992) J. Virol. 66, 1959-1970.

Zhu, H., Joliot, V., and Prywes, R. (1994) J. Biol. Chem. 269, 3489-3497.

Ziegler-Heitbrock HW, Frankenberger M, Wedel A. Tolerance to lipopolysaccharide in human blood monocytes. Immunobiology. 1995 Jul;193(2-4):217-23.

Ziegler-Heitbrock HW, Petersmann I, Frankenberger M. p50 (NF-kappa Bl) is upregulated in LPS tolerant P388D1 murine macrophages. Immunobiology. 1997 Dec;198(l- 3):73-80.

Ziegler-Heitbrock HW, Wedel A, Schraut W, Strobel M, Wendelgass P, Sternsdorf T, Bauerle PA, Haas JG, Riethmuller G Tolerance to lipopolysaccharide involves mobilization of nuclear factor kappa B with predominance of p50 homodimers. J Biol Chem 1994 Jun 24;269(25):17001-4.

Ziegler-Heitbrock HW. Molecular mechanism in tolerance to lipopolysaccharide. J Inflamm. 1995;45(1): 13-26. Review.

Zuckerman SH, Evans GF. Endotoxin tolerance: in vivo regulation of tumor necrosis factor and interleukin- 1 synthesis is at the transcriptional level. Cell Immunol. 1992 Apr;140(2):513-9. One skilled in the art readily appreciates that the patent invention is well adapted to carry out the objectives and obtain the ends and advantages mentioned as well as those inherent therein. Myo/Vl, dominant negative mutant sequences of MyoNl, constitutively active sequences of Myo/Vl, pharmaceutical compositions, methods, treatments, procedures and techniques described herein are presently representative of the preferred embodiments and are intended to be exemplary and are not intended as limitations of the scope. Changes therein and other uses will occur to those skilled in the art which are encompassed within the spirit of the invention or defined by the scope of the pending claims.

Claims

We claim:

1. As a composition of matter, a dominant negative mutant sequence of Myo/Vl polypeptide.

2. The dominant negative mutant sequence of Claim 1, wherein said sequence is selected from the group consisting of SEQ ID NO:94, SEQ ID NO:95, SEQ ID NO:96, SEQ ID NO:97, SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 110, SEQ ID NO: 111, SEQ ID NO:l 12, and SEQ ID NO:113.

3. The composition of claim 1 or 2, wherein said dominant negative mutant sequence further comprises a protein transduction domain.

4. As a composition of matter, a nucleic acid sequence encoding a dominant negative mutant sequence of Myo/Vl polypeptide.

5. As a composition of matter, a nucleic acid sequence encoding a dominant negative mutant sequence of a Myo/Vl polypeptide, wherein said polypeptide is selected from the group consisting of SEQ ID NO:94, SEQ ID NO:95, SEQ ID NO:96, SEQ ID NO:97, SEQ ID NO:108, SEQ ID NO:109, SEQ ID NO:110, SEQ ID NO:l l l, SEQ ID NO: 112, and SEQ ID NO: 113.

6. As a composition of matter, a nucleic acid sequence encoding a dominant negative mutant sequence of a MyoNl polypeptide, wherein said nucleic acid sequence is selected from the group consisting of SEQ ID NO: 186, SEQ ID NO: 187, SEQ ID NO: 188, SEQ ID NO:189, SEQ ID NO:197, SEQ ID NO:198, SEQ ID NO:199, SEQ ID NO:200, SEQ ID NO-201, and SEQ ID NO:202.

7. As a composition of matter, a constitutively active mutant sequence of Myo/Vl polypeptide.

8. The constitutively active mutant sequence of Claim 7, wherein said sequence is selected from the group consisting of SEQ ID NO:90, SEQ ID NO:91, SEQ ID NO:92, SEQ ID NO:93, SEQ ID NO:101, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO: 105, SEQ ID NO: 106; and SEQ ID NO: 107.

9. The composition of claim 7 or 8, wherein said constitutively active mutant sequence further comprises a protein transduction domain.

10. As a composition of matter, a nucleic acid sequence encoding a constitutively active mutant sequence of MyoNl polypeptide.

11. As a composition of matter, a nucleic acid sequence encoding a constitutively active mutant sequence of Myo/Vl polypeptide, wherein said polypeptide is selected from the group consisting of SEQ ID NO:90, SEQ ID NO-91, SEQ ID NO:92, SEQ ID NO:93, SEQ ID NO-101, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:105, SEQ ID NO: 106; and SEQ ID NO: 107.

12. As a composition of matter, a nucleic acid sequence encoding a constitutively active mutant sequence of Myo/Vl polypeptide, wherein said nucleic acid sequence is selected from the group consisting of SEQ ID NO: 182, SEQ ID NO: 183, SEQ ID NO: 184, SEQ ID NO:185, SEQ ID NO:190, SEQ ID NO-191, SEQ ID NO:192, SEQ ID NO:193, SEQ ID NO:194, SEQ ID NO:195, and SEQ ID NO:196.

13. A method of treating cardiovascular disease in a mammal, comprising the step of introducing into said mammal therapeutically effective levels of a dominant negative mutant sequence of MyoNl polypeptide, wherein said introduction results in an improvement of said cardiovascular disease.

14. A method of inhibiting formation of ΝFKB p50 homodimers in a cell of a mammal, comprising the step of introducing into said cell therapeutically effective levels of a dominant negative mutant sequence of MyoNl polypeptide, wherein said introduction results in inhibition of formation of said ΝFKB p50 homodimers.

15. A method of reducing formation of ΝFKB p50 homodimers in a cell of a mammal, comprising the step of introducing into said cell therapeutically effective levels of a dominant negative mutant sequence of Myo/Vl polypeptide, wherein said introduction results in reduction of formation of said ΝFKB p50 homodimers.

16. The method of Claim 13, 14 or 15, wherein said dominant negative mutant sequence is selected from the group consisting of SEQ ID ΝO:l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO: 10.

17. A method of treating cardiovascular disease in a mammal, comprising the step of introducing to said mammal therapeutically effective levels of a nucleic acid sequence encoding a dominant negative mutant sequence of MyoNl polypeptide, wherein said introduction results in an improvement of said cardiovascular disease.

18. A method of inhibiting formation of ΝFKB p50 homodimers in a cell of a mammal, comprising the step of introducing into said cell therapeutically effective levels of a nucleic acid sequence encoding a dominant negative mutant sequence of Myo/Nl polypeptide, wherein said introduction results in inhibition of formation of said ΝFKB p50 homodimers.

19. A method of reducing formation of NFKB p50 homodimers in a cell of a mammal, comprising the step of introducing into said cell therapeutically effective levels of a nucleic acid sequence encoding a dominant negative mutant sequence of Myo/Nl polypeptide, wherein said introduction results in reduction of formation of said ΝFKB p50 homodimers.

20. A method for screening a test compound for the treatment of cardiovascular disease, comprising the steps of: combining a labeled nucleic acid sequence with a ΝFKB p50 subunit polypeptide under conditions to form a nucleic acid sequence- ΝFKB p50 polypeptide complex; adding a test compound to said complex; and assaying the electrophoretic mobility of said complex in the presence of said test compound; comparing said electrophoretic mobility of the complex with the test compound to the electrophoretic mobility of the complex in the absence of said test compound, wherein a change in the mobility in the presence of said test compound indicates said test compound is an active compound.

21. A method for screening a test compound for anti-aging activity, comprising the steps of: combining a labeled nucleic acid sequence with a ΝFKB p50 subunit polypeptide under conditions to form a nucleic acid sequence- ΝFKB p50 polypeptide complex; adding a test compound to said complex; and assaying the electrophoretic mobility of said complex in the presence of said test compound; comparing said electrophoretic mobility of the complex with the test compound to the electrophoretic mobility of the complex in the absence of said test compound, wherein a change in the mobility in the presence of said test compound indicates said test compound is an active compound.

22. A method for screening a test compound for ΝFKB p50 polypeptide interaction, comprising the steps of: combining a labeled nucleic acid sequence with a p50 ΝFKB subunit polypeptide under conditions to form a nucleic acid sequence-p50 polypeptide complex; adding a test compound to said complex; and assaying the electrophoretic mobility of said complex in the presence of said test compound; comparing said electrophoretic mobility of the complex with the test compound to the electrophoretic mobility of the complex in the absence of said test compound, wherein a change in the mobility in the presence of said test compound indicates said test compound is an active compound.

23. The method of Claim 20, 21 or 22, wherein said nucleic acid sequence is a NFKB repressor sequence.

24. The method of Claim 20, 21, or 22, wherein said p50 polypeptide is present as a homodimer.

25. The method of Claim 20, 21, or 22, wherein said complex further comprises a p65 NFKB subunit polypeptide.

26. The method of Claim 25, wherein said complex further comprises a p50-p65 heterodimer.

27. The method of Claim 25, wherein said complex further comprises a p65-p65 homodimer.

28. A pharmaceutical composition for treating cardiovascular disease comprising an active compound obtained by screening a test compound as in Claim 20 or Claim 22 and a physiologically acceptable carrier.

29. A pharmaceutical composition for anti-aging treatment comprising an active compound obtained by screening a test compound as in Claim 21 and a physiologically acceptable carrier.

30. A method of screening for an active compound for cardiovascular disease, comprising the steps of: introducing into a cell a first nucleic acid expressing a fused test peptide/DNA binding domain; and

a second nucleic acid expressing a fused MyoNl -p50 polypeptide/DΝA activation domain; and

assaying for an interaction between said test peptide and said Myo/Nl -p50 polypeptide by measuring binding between said DΝA binding domain and said DΝA activation domain, wherein said interaction between said test peptide and said Myo/Vl -p50 polypeptide indicates said test peptide is said active compound.

31. A method of screening for an active compound for anti-aging treatment, comprising the steps of: introducing into a cell a first nucleic acid expressing a fused test peptide/DΝA binding domain; and a second nucleic acid expressing a fused Myo/Vl -p50 polypeptide/DNA activation domain; and

assaying for an interaction between said test peptide and said Myo/Vl -p50 polypeptide by measuring binding between said DNA binding domain and said DNA activation domain, wherein said interaction between said test peptide and said MyoNl -p50 polypeptide indicates said test peptide is said active compound.

32. The method of Claim 30 or 31, wherein said DΝA binding domain and said DΝA activation domain are LexA.

33. The method of Claim 30 or 31, wherein said DΝA binding domain and said DΝA activation domain are Gal.

34. A pharmaceutical composition for treating cardiovascular disease comprising an active compound obtained by screening a test compound as in Claim 30 and a physiologically acceptable carrier.

35. A pharmaceutical composition for anti-aging treatment comprising an active compound obtained by screening a test compound as in Claim 31 and a physiologically acceptable carrier.

36. A method of identifying an active compound for the treatment of cardiovascular disease, comprising the steps of: forming a Myo/Vl -ΝFKB p50 complex in a cell, wherein said complex formation generates a detectable signal; adding a test compound to said complex in the cell under conditions wherein said compound interacts with said complex; and measuring a change in said visualizable signal, wherein said change indicates said test compound is said active compound.

37. A method of identifying an active compound for anti-aging treatment, comprising the steps of : forming a nucleic acid sequence-ΝFκB p50 complex in a cell, wherein said complex formation generates a detectable signal; adding a test compound to said complex in the cell under conditions wherein said compound interacts with said complex; and measuring a change in said detectable signal, wherein said change indicates said test compound is said active compound.

38. The method of Claim 36 or 37, wherein said detectable signal is selected from the group consisting of light, fluorescence, radioactivity, and color.

39. The method of Claim 36 or 37, wherein said detectable signal is fluorescence.

40. The method of Claim 36 or 37, wherein said test compound is selected from the group consisting of peptides, nucleic acids, carbohydrates, sugars, and combinations thereof

41." A pharmaceutical composition for treating cardiovascular disease comprising an active compound obtained by screening a test compound as in Claim 36 and a physiologically acceptable carrier.

42. A pharmaceutical composition for anti-aging treatment comprising an active compound obtained by screening a test compound as in Claim 37 and a physiologically acceptable carrier.

43. A method of treating cardiovascular disease in a mammal, comprising the step of introducing into a cell of said mammal therapeutically effective levels of a NFKB repressor sequence under conditions wherein said repressor sequence binds a NFKB p50 homodimer, wherein said cardiovascular disease is improved following said introduction.

44. A method of reducing NFKB p50 homodimer levels in a cell of a mammal, comprising the step of introducing into said cell therapeutically effective levels of a NFKB repressor sequence under conditions wherein said repressor sequence binds said NFKB p50 homodimer.

45. The method of Claim 43 or 44, wherein said NFKB repressor sequence is SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO.l l, SEQ ID NO.15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:30, SEQ ID NO.31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:120, SEQ ID NO:121, SEQ ID NO:122, SEQ ID NO:123, SEQ ID NO:124, SEQ ID NO:131, SEQ ID NO:132, SEQ ID NO:133, SEQ ID NO:134, SEQ ID NO:135, SEQ ID NO:136, SEQ ID NO:140, SEQ ID NO:141, SEQ ID NO:142, SEQ ID NO:143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 152, SEQ ID NO: 153, SEQ ID NO: 154, SEQ ID NO: 155, SEQ ID NO: 156, SEQ ID NO: 162, SEQ ID NO: 163, SEQ ID NO: 164, SEQ ID NO:168, SEQ ID NO:169, SEQ ID NO:170, SEQ ID NO:171, SEQ ID NO:172, SEQ ID NO: 173, SEQ ID NO:174, SEQ ID NO:175, SEQ ID NO:254, SEQ ID NO:255 SEQ ID NO:256, SEQ ID NO:257, SEQ ID NO:258, SEQ ID NO:259, SEQ ID NO:260 SEQ ID NO:269, SEQ ID NO:270, SEQ ID NO.271, SEQ ID NO:272, SEQ ID NO:273 SEQ ID NO:274, SEQ ID NO:279, SEQ ID NO:280, SEQ ID NO:281, SEQ ID NO:282 SEQ ID NO:283, SEQ ID NO:284, SEQ ID NO:285, SEQ ID NO:291, SEQ ID NO:292 SEQ ID NO:293, SEQ ID NO:294, SEQ ID NO:295, SEQ ID NO:296, SEQ ID NO:297 SEQ ID NO:298, SEQ ID NO:305, SEQ ID NO:306, SEQ ID NO:307, SEQ ID NO:308 SEQ ID NO:309, SEQ ID NO:310, SEQ ID NO-311, SEQ ID NO:312, SEQ ID NO:313 SEQ ID NO:314, SEQ ID NO:315, SEQ ID NO:316, SEQ ID NO:317, SEQ ID NO:318 SEQ ID NO:319, SEQ ID NO:320, SEQ ID NO-321, SEQ ID NO:325, SEQ ID NO:326 SEQ ID NO:327, SEQ ID NO:328, SEQ ID NO:329, SEQ ID NO:330, SEQ ID NO:331 SEQ ID NO:332, SEQ ID NO:333, SEQ ID NO:334, SEQ ID NO:335, SEQ ID NO:336 SEQ ID NO:337, SEQ ID NO:338, SEQ ID NO:339, SEQ ID NO:340, SEQ ID NO:341 SEQ ID NO:342, SEQ ID NO:343, SEQ ID NO:344, SEQ ID NO:345, SEQ ID NO:346 SEQ ID NO:347, SEQ ID NO:348, SEQ ID NO:349, SEQ ID NO:350, SEQ ID NO:351 SEQ ID NO:352, SEQ ID NO:353, SEQ ID NO:354, SEQ ID NO:355, SEQ ID NO:356 SEQ ID NO:357, SEQ ID NO:358, SEQ ID NO:359, SEQ ID NO:360, SEQ ID NO:361 SEQ ID NO:362, SEQ ID NO:363, SEQ ID NO:364, SEQ ID NO:365, SEQ ID NO:366 SEQ ID NO:367, SEQ ID NO:368, SEQ ID NO:369, SEQ ID NO:370, SEQ ID NO:371 SEQ ID NO:372, SEQ ID NO:373, SEQ ID NO:374, SEQ ID NO:375, SEQ ID NO:376 SEQ ID NO:377, SEQ ID NO:378, SEQ ID NO:379, SEQ ID NO:380, SEQ ID NO:381 SEQ ID NO:382, SEQ ID NO:383, SEQ ID NO:384, SEQ ID NO:385, SEQ ID NO:386 SEQ ID NO:387, SEQ ID NO:388, SEQ ID NO:389, SEQ ID NO:390, SEQ ID NO:391 SEQ ID NO:392, SEQ ID NO:393, SEQ ID NO:394, SEQ ID NO:395, SEQ ID NO:396 SEQ ID NO:397, SEQ ID NO:398, SEQ ID NO:399, SEQ ID NO:400, SEQ ID NO:401 SEQ ID NO:402, SEQ ID NO:403, SEQ ID NO:404, SEQ ID NO:405, SEQ ID NO:406 SEQ ID NO:407, SEQ ID NO:408, SEQ ID NO:409, SEQ ID NO:410, SEQ ID NO-411 SEQ ID NO:412, SEQ ID NO:413, SEQ ID NO:414, SEQ ID NO:415, SEQ ID NO:416 SEQ ID NO:417, SEQ ID NO:418, SEQ ID NO:419, SEQ ID NO:420, SEQ ID NO:421 SEQ ID NO:422, SEQ ID NO:423, SEQ ID NO:424, SEQ ID NO:425, SEQ ID NO:426 SEQ ID NO:427, SEQ ID NO:428, SEQ ID NO:429, SEQ ID NO:430, SEQ ID NO:431 SEQ ID NO:78, or SEQ ID NO:80.

46. The method of Claim 43 or 44, wherein said NFKB repressor sequence is a double-stranded oligonucleotide.

47. The method of Claim 43 or 44, wherein said NFKB repressor sequence is a peptide nucleic acid.

48. A method of treating cardiovascular disease in a mammal, comprising the step of introducing into said mammal therapeutically effective levels of a dominant negative mutant sequence of a NFKB p50 subunit, wherein said NFKB dominant negative p50 subunit is selected from the group consisting of SEQ ID NO:238, SEQ ID NO:239, SEQ ID NO:240, SEQ ID NO:241, SEQ ID NO:242, SEQ ID NO:243, SEQ ID NO:244, SEQ ID NO:245, SEQ ID NO:246, SEQ ID NO:247, SEQ ID NO:248, SEQ ID NO:249, SEQ ID NO:250, SEQ ID NO.251, SEQ ID NO:252, and SEQ ID NO:253, wherein said cardiovascular disease is improved following said introduction.

49. A method of inhibiting formation of NFKB p50 homodimers in a cell of a mammal, comprising the step of introducing into said animal therapeutically effective levels of a dominant negative mutant sequence of a NFKB p50 subunit, wherein said NFKB dominant negative p50 is selected from the group consisting of SEQ ID NO:238, SEQ ID NO:239, SEQ ID NO:240, SEQ ID NO:241, SEQ ID NO:242, SEQ ID NO:243, SEQ ID NO:244, SEQ ID NO:245, SEQ ID NO:246, SEQ ID NO:247, SEQ ID NO:248, SEQ ID NO:249, SEQ ID NO:250, SEQ ID NO:251, SEQ ID NO:252, and SEQ ID NO:253, and wherein said NFKB p50 homodimers are inhibited from forming following said introduction.

50. A method of reducing formation of NFKB p50 homodimers in a cell of a mammal, comprising the step of introducing into said cell therapeutically effective levels of a dominant negative mutant sequence of a NFKB p50 subunit, wherein said dominant negative NFKB p50 is selected from the group consisting of SEQ ID NO:238, SEQ ID NO:239, SEQ ID NO:240, SEQ ID NO:241, SEQ ID NO:242, SEQ ID NO:243, SEQ ID NO:244, SEQ ID NO:245, SEQ ID NO:246, SEQ ID NO:247, SEQ ID NO:248, SEQ ID NO:249, SEQ ID NO:250, SEQ ID NO.251, SEQ ID NO:252, and SEQ ID NO:253, and wherein said formation of NFKB p50 homodimers is reduced following said introduction.

51. The method of Claim 48, 49 or 50, wherein said NFKB p50 subunit further comprises a protein transduction domain.

52. A method of treating cardiovascular disease in a mammal, comprising the step of introducing into said mammal therapeutically effective levels of a nucleic acid sequence which encodes a dominant negative mutant sequence of a NFKB p50 subunit, wherein said dominant negative NFKB p50 subunit is selected from the group consisting of SEQ ID NO:238, SEQ ID NO:239, SEQ ID NO:240, SEQ ID NO:241, SEQ ID NO:242, SEQ ID NO:243, SEQ ID NO:244, SEQ ID NO:245, SEQ ID NO:246, SEQ ID NO:247, SEQ ID NO:248, SEQ ID NO:249, SEQ ID NO:250, SEQ ID NO:251, SEQ ID NO:252, and SEQ ID NO:253, and wherein said cardiovascular disease is improved following said introduction.

53. A method of inhibiting formation of NFKB p50 homodimers in a cell of a mammal, comprising the step of introducing into said cell therapeutically effective levels of a nucleic acid sequence encoding a dominant negative mutant sequence of a NFKB p50 subunit, wherein said NFKB p50 is selected from the group consisting of SEQ ID NO:238, SEQ ID NO:239, SEQ ID NO:240, SEQ ID NO:241, SEQ ID NO:242, SEQ ID NO:243, SEQ ID NO:244, SEQ ID NO:245, SEQ ID NQ-246, SEQ ID NO:247, SEQ ID NO:248, SEQ ID NO:249, SEQ ID NO:250, SEQ ID NO:251, SEQ ID NO:252, and SEQ ID NO:253, and wherein said NFKB p50 dimers are inhibited from forming following said introduction.

54. A method of reducing formation of NFKB p50 homodimers in a cell of a mammal, comprising the step of introducing into said cell therapeutically effective levels of a nucleic acid sequence encoding a dominant negative mutant sequence of a NFKB p50 subunit, wherein said p50 is selected from the group consisting of SEQ ID NO:238, SEQ ID NO:239, SEQ ID NO:240, SEQ ID NO:241, SEQ ID NO:242, SEQ ID NO:243, SEQ ID NO:244, SEQ ID NO:245, SEQ ID NO:246, SEQ ID NO:247, SEQ ID NO:248, SEQ ID NO:249, SEQ ID NO:250, SEQ ID NO:251, SEQ ID NO:252, and SEQ ID NO:253, and wherein said formation of NFKB p50 dimers is reduced following said introduction.

55. The method of Claim 17, 18, 19, 52, 53 or 54, wherein said nucleic acid is introduced in a vector.

56. The method of Claim 55, wherein said vector is selected from the group consisting of an adenoviral vector, an adeno-associated viral vector, a retroviral vector, a plasmid, a liposome, a lipid, or a combination thereof.

57. The method of Claim 17, 18, 19, 52, 53 or 54, wherein said nucleic acid is introduced into a myocardium cell.

58. A method of diagnosing cardiovascular disease in a mammal, comprising the steps of: obtaining a sample from said mammal; and measuring the level of NFKB p50 homodimers in said sample, wherein an increase in the said level is indicative of said cardiovascular disease in said mammal.

59. The method of Claim 58, wherein said measuring step comprises an assay selected from the group consisting of electrophoretic mobility shift assay and immunoblot analysis.

60. The method of Claim 58, wherein said measuring step comprises electrophoretic mobility shift assay.

61. A method of reducing or preventing inhibition of expression of an adrenergic system signaling nucleic acid sequence in a cell of a mammal, comprising the step of reducing the levels of NFKB p50 homodimers in said cell, wherein said reduced levels leads to said inhibition of expression.

62. The method of claim 61, wherein said adrenergic system signaling nucleic acid sequence is selected from the group consisting of βl-adrenergic receptor, β2-adrenergic receptor, β3-adrenergic receptor, β-adrenergic receptor kinase 1 (β-ARKl), β-adrenergic receptor kinase 2 (β-ARK2), Gi-α-1, Gi-α-1, Gi-α-1, Gsα, and Gsα -XL.

63. The method of Claim 61, wherein said NFKB p50 homodimer levels are reduced by introducing into said cell a dominant negative form of a MyoNl polypeptide.

64. The method of Claim 63, wherein said polypeptide is selected from the group consisting of SEQ ID ΝO:l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NOJ, SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO:10.

65. The method of Claim 61, wherein said p50 homodimer levels are reduced by introducing into said cell therapeutically effective levels of a dominant negative mutant sequence of NFKB p50.

66. The method of Claim 65, wherein said dominant negative mutant sequence of NFKB p50 is selected from the group consisting of SEQ ID NO:238, SEQ ID NO:239, SEQ ID NO:240, SEQ ID NO:241, SEQ ID NO:242, SEQ ID NO:243, SEQ ID NO:244, SEQ ID NO:245, SEQ ID NO:246, SEQ ID NO:247, SEQ ID NO:248, SEQ ID NO:249, SEQ ID NO:250, SEQ ID NO:251, SEQ ID NO:252, and SEQ ID NO:253.

67. The method of Claim 61, wherein said NFKB p50 homodimer levels are reduced by inhibiting formation of a MyoNl-p50 complex.

68. The method of Claim 61, wherein said ΝFKB p50 homodimer levels are reduced by introducing into said cell antisense sequence of said ΝFKB p50.

69. The method of Claim 61, wherein said ΝFKB p50 homodimer levels are reduced by introducing into said cell antisense sequence of said Myo Vl.

70. A method of treating cardiovascular disease in a mammal, comprising the step of reducing migration of NFKB p50 homodimers from cytoplasm to nucleus in a cell of said mammal.

71. A method of reducing NFKB p50 homodimers in a cell of a mammal, comprising the step of reducing migration of NFKB p50 homodimers from cytoplasm to nucleus of said cell.

72. A method of reducing Myo/VI-p50 complex levels in a cell of a mammal comprising the step of introducing ER81 into said cell, wherein said introduction results in reduction of said complex levels.

73. The method of Claim 72, wherein said ER81 is introduced into said cell as a polypeptide, and wherein said ER81 polypeptide further comprises a protein transduction domain.

74. The method of Claim 72, wherein said ER81 is introduced as a nucleic acid sequence.

75. The method of Claim 74, wherein said ER81 nucleic acid sequence is introduced in a vector.

76. A method of reducing MyoNI-p50 complex levels in a cell of a mammal comprising the step of introducing a ETS factor into said cell, wherein said introduction results in reduction of said complex levels..

77. The method of Claim 76, wherein said ETS factor is introduced as a polypeptide, and wherein said ETS factor polypeptide further comprises a protein transduction domain.

78. The method of Claim 76, wherein said ETS factor is introduced as a nucleic acid sequence.

79. The method of Claim 78, wherein said ETS factor nucleic acid sequence is introduced in a vector.

80. The method of Claim 76, wherein said ETS factor is selected from the group consisting of GABPalpha/ΝRF2/E4TFl, ER81/ETV1, ERM, ELF/NERF2, ELF4, ELK1, ELK3/SAP2/ERP/NET, and ETS2.

81. A method of treating cardiovascular disease in a mammal, comprising the step of reducing Myo/Vl levels in said mammal, wherein said cardiovascular disease is improved following reduction of said MyoNl levels.

82. The method of Claim 81, wherein said reducing step comprises introducing into a cell in said mammal an antisense peptide nucleic acid of said Myo/Vl.

83. A method of reducing MyoNl levels in a cell of a mammal, comprising the step of introducing into said cell an antisense peptide nucleic acid of said Myo/Vl.

84. A method of treating cardiovascular disease in a mammal, comprising the step of reducing ΝFKB p50 subunit levels in said mammal, wherein said cardiovascular disease is improved following reduction of said p50 subunit levels.

85. The method of Claim 84, wherein said reducing step comprises introducing into a cell in said mammal an antisense peptide nucleic acid of said ΝFKB p50 subunit.

86. A method of reducing ΝFKB p50 subunit levels in a cell of a mammal, comprising the step of introducing into said cell an antisense PNA of said NFKB p50 subunit.

87. A method of treating cardiovascular disease in a mammal, comprising the step of reducing β-ARKl subunit levels in said mammal, wherein said cardiovascular disease is improved following reduction of said β-ARKl.

88. The method of Claim 87, wherein said reducing step comprises introducing into a cell in said mammal an antisense peptide nucleic acid of said β-ARKl.

89. A method of reducing β-ARKl levels in a cell of a mammal, comprising the step of introducing into said cell an antisense peptide nucleic acid of said β-ARKl.

90. A method of treating cardiovascular disease in a mammal, comprising the step of reducing β-ARK2 subunit levels in said mammal, wherein said cardiovascular disease is improved following reduction of said β-ARK2 levels.

91. The method of Claim 90, wherein said reducing step comprises introducing into a cell in said mammal an antisense peptide nucleic acid of said β-ARK2.

92. A method of reducing β-ARK2 levels in a cell of a mammal, comprising the step of introducing into said cell an antisense peptide nucleic acid of said β-ARK2.

93. A method of treating cardiovascular disease in a mammal comprising the step of administering therapeutically effective levels of antisense sequence of MyoNl to said mammal.

94. A method of treating cardiovascular disease in a mammal comprising the step of administering therapeutically effective levels of antisense sequence of ΝFKB p50 to said mammal.

95. The method of Claim 13, 17, 20, 28, 30, 34, 36, 41, 43, 48, 52, 58, 70, 81, 84, 87, 90, 93 or 94, wherein said cardiovascular disease is selected from the group consisting of myocardial infarction, ischemia/reperfusion injury, heart transplantation, and cardiac hypertrophy.

96. The method of Claim 13, 17, 20, 28, 30, 34, 36, 41, 43, 48, 52, 58, 70, 81, 84, 87, 90, 93 or 94, wherein said cardiovascular disease is cardiac hypertrophy.

97. A method of treating a NFκB-related disease, comprising the step of introducing the active compound of Claim 20, 22, 30, or 36, wherein said NFκB-related disease is improved following said introduction.

98. The method of Claim 96, wherein said NFκB-related disease is selected from the group consisting of sepsis, inflammatory bowel disease, and Incontinentia Pigmenti.

99. As a composition of matter, an aptamer which binds MyoNl polypeptide.

100. The aptamer of claim 99, wherein said aptamer is selected from the group consisting of DΝA, RΝA and peptide.

101. As a composition of matter, an aptamer which binds ΝFKB p50 polypeptide.

102. The aptamer of claim 101, wherein said aptamer is selected from the group consisting of DΝA, RΝA and peptide.

103. A method of generating a nucleic acid aptamer for binding Myo/Vl polypeptide comprising the steps of: synthesizing a plurality of single-stranded nucleic acid molecules, each single- stranded nucleic acid molecule comprising: a 5 ' polymerase chain reaction primer-binding sequence, a test nucleic acid sequence, and a 3 ' polymerase chain reaction primer-binding sequence;

presenting said plurality of single-stranded nucleic acid molecules to said Myo/Vl polypeptide; and measuring binding of a single-stranded nucleic acid molecule to said Myo/Vl polypeptide, wherein when said test nucleic acid sequence binds to said Myo/Vl polypeptide, said single-stranded nucleic acid molecule is said aptamer.

104. The method of claim 103, wherein said test nucleic acid sequence is approximately 30-60 nucleotides in length.

105. The method of claim 103, wherein said test nucleic acid sequence is approximately 35-50 nucleotides in length.

106. The method of claim 103, wherein said nucleic acid molecule is approximately 40 nucleotides in length.

107. A method of generating a peptide aptamer for binding Myo/Vl polypeptide comprising the steps of: synthesizing a plurality of peptide molecules; presenting said plurality of peptide molecules to said Myo/Vl polypeptide; and measuring binding of a peptide molecule to said Myo/Vl polypeptide, wherein when said peptide molecule binds to said Myo/Vl polypeptide, said peptide molecule is said aptamer.

108. A method of generating a nucleic acid aptamer for binding NFKB p50 polypeptide comprising the steps of: synthesizing a plurality of single-stranded nucleic acid molecules, each single- stranded nucleic acid molecule comprising: a 5' polymerase chain reaction primer-binding sequence, a test nucleic acid sequence, and a 3 ' polymerase chain reaction primer-binding sequence;

presenting said plurality of single-stranded nucleic acid molecules to said NFKB p50 polypeptide; and measuring binding of a single-stranded nucleic acid molecule to said NFKB p50 polypeptide, wherein when said test nucleic acid sequence binds to said NFKB p50 polypeptide, said single-stranded nucleic acid molecule is said aptamer.

109. The method of claim 108, wherein said nucleic acid molecule is approximately 30-60 nucleotides in length.

110. The method of claim 108, wherein said test nucleic acid sequence is approximately 35-50 nucleotides in length.

111. The method of claim 108, wherein said nucleic acid molecule is approximately 40 nucleotides in length.

112. A method of generating a peptide aptamer for binding NFKB p50 polypeptide comprising the steps of: synthesizing a plurality of peptide molecules; presenting said plurality of peptide molecules to said NFKB p50 polypeptide; and measuring binding of a peptide molecule to said NFKB p50 polypeptide, wherein when said peptide molecule binds to said NFKB p50 polypeptide, said peptide molecule is said aptamer.

113. A method of treating cardiovascular disease in a mammal, comprising the step of inhibiting interaction of Myo/Vl polypeptide with an ETS factor.

114. The method of claim 113, wherein said ETS factor is selected from the group consisting of GABPalpha/NRF2/E4TFl, ER81/ETV1, ERM, ELF/NERF2, ELF4, ELK1, ELK3/SAP2/ERP/NET, and ETS2.

115. The method of claim 113, wherein said ETS factor is ER81/ETV1.

116. A method of inhibiting fetal carnitine palmitoyltransferase-I (CPTI) nucleic acid expression in a mammal comprising the step of inhibiting interaction of Myo/Vl polypeptide with an ETS factor.

117. The method of claim 116, wherein said ETS factor is selected from the group consisting of GABPalpha NRF2/E4TFl, ER81/ETV1, ERM, ELF/NERF2, ELF4, ELK1, ELK3/SAP2/ERP/NET, and ETS2.

118. The method of claim 116, wherein said ETS factor is ER81/ETV1.

119. A method of inhibiting fetal 6-phosphofructo-2-kinase/fructose-2,6- bisphosphatase (PFK) nucleic acid expression in a mammal comprising the step of inhibiting interaction of MyoNl polypeptide with an ETS factor.

120. The method of claim 119, wherein said ETS factor is selected from the group consisting of GABPalpha/ΝRF2/E4TFl, ER81/ETV1, ERM, ELF/NERF2, ELF4, ELK1, ELK3/SAP2/ERP/NET, and ETS2.

121. The method of claim 119, wherein said ETS factor is ER81/ETV1.

122. A method of inhibiting formation of NFKB p65 homodimers in a cell of a mammal, comprising the step of introducing into said cell therapeutically effective levels of a nucleic acid sequence encoding a dominant negative mutant sequence of Myo/Vl polypeptide, wherein said introduction results in inhibition of formation of said NFKB p65 homodimers.

123. A method of reducing formation of NFKB p65 homodimers in a cell of a mammal, comprising the step of introducing into said cell therapeutically effective levels of a nucleic acid sequence encoding a dominant negative mutant sequence of Myo/Vl polypeptide, wherein said introduction results in reduction of formation of said NFKB p65 homodimers.

124. A method of treating cardiovascular disease in a mammal, comprising the step of introducing into a cell of said mammal therapeutically effective levels of a NFKB repressor sequence under conditions wherein said repressor sequence binds a NFKB p65 homodimer, wherein said cardiovascular disease is improved following said introduction.

125. A method of reducing NFKB p65 homodimer levels in a cell of a mammal, comprising the step of introducing into said cell therapeutically effective levels of a NFKB repressor sequence under conditions wherein said repressor sequence binds said NFKB p65 homodimer.