WO2002042490A1

WO2002042490A1 - Method of optimising the sequences of synthetic nucleic acids

Info

Publication number: WO2002042490A1
Application number: PCT/EE2000/000003
Authority: WO
Inventors: Hendrik Pavel; Neeme TÕNISSON; Jana Zernant
Original assignee: Asper OÜ
Priority date: 2000-11-24
Filing date: 2000-11-24
Publication date: 2002-05-30
Also published as: AU2001216942A1

Abstract

The invention tackles the problem of oligonucleotides forming complexes between or within themselves. Firstly, the sequences of oligonucleotides are tested for potential secondary structures. Then, when designing the sequences of the oligonucleotides, the nucleotides responsible for forming hydrogen bonds in the secondary structures, are swapped. They are replaced by universal or specifically binding nucleotides. In the current proof of principle, pairs of 2-amino-dA and 2-thio-dT are used to demonstrate that the balance between probe-probe and probe-target hybridization becomes shifted in the more favoured direction. This results in stronger signals and lesser false signals.

Description

Method of optimising the sequences of synthetic nucleic acids

THE TECHNICAL FIELD

The present invention falls in the fields of molecular biology and molecular diagnostics. More specifically it concerns a method of optimizing the sequences of synthetic nucleic acids, used in methods based on hybridization of target DNA (DNA chips etc). The optimization involves swapping natural nucleotides for modified ones.

BACKGROUND OF THE INVENTION

One application of the method in the present invention, (included in the description of the subject matter of the invention) is nucleic acid sequence analysis on solid support, for reference, see patent EP 0705349 "Parallel Extension Approach to Nucleic Acid Sequence Analysis."

In the said method, oligonucleotide primers are bound to a solid support in a two- dimensional array, each primer for identifying one base in the examined sequence. The array may be designed in a manner where consecutive primers correspond to consecutive nucleotides in the target nucleic acid. Also, the primers may correspond to nucleotides in various (parts of) genes or nucleotides scattered over the whole genome. The target nucleic acid is added on the array under hybridizing conditions together with the enzyme DNA polymerase and labelled terminator nucleotides. The hybridization of the target with the complementary primer will be followed by the incorporation by the polymerase of one labelled nucleotide in the end of the primer, which is complementary to the first overextending nucleotide of the target. In the experiment demonstrated in the proof of principle, a dideoxynucleotide becomes incorporated, however, different methods may use deoxynucleotides or oligonucleotides for the elongation. This enzymatic reaction will be followed by rinsing away everything that is not covalently bound to the support. The label- carrying primers remain on the support. The different characteristics of the labels refer to different nucleotides. Thus the presence or absence of a nucleotide in a certain position in the target sequence will be validated. The problem with the said method is that the oligonucleotide primers, covalently bound to the support, may under hybridizing conditions hybridize between themselves. Theoretically, the formation of both "hairpin" structures and dimers or "bridges" is allowed, see Fig. 1. The change in the free energy of the latter is essentially larger, so in practice those should be considered. The formation of dimers will decrease the number of primer-target hybridization events. Thus the quantity of the incorporated labelled nucleotide may remain under detectable level. Another problem is self-elongation, if the hybridization along the two primer molecules reaches their 3' ends. In the present system the primers are bound to the support by the 5' end and the 3' end is in the solution. If the 3' end is involved in a dimer, it will be a target for the polymerase, which will incorporate a labelled nucleotide in its end. Usually the latter is not the same, what would be expected from the reaction involving both primer and target (Fig. lb). Thus false positive and false negative results will be obtained.

SUBJECT MATTER OF THE INVENTION

As a solution to the problems mentioned above and also as an improvement of other methods, comprising hybridization of synthetic oligonucleotides, the present invention provides a method, where the oligonucleotide primers are modified. This is done during the synthesis of the primers. Modified or universal nucleotides are incorporated in the primers. This has to be done in a way that will prevent the formation of the predicted dimers or, if they do form, to prevent the incorporation of nucleotides due to self-priming (see Fig. 1). At the same time, the specific hybridization with the target must not be lost. Such a situation is obtainable if the nucleotides, participating in secondary structures, can be predicted. During the synthesis, in these positions, universal nucleotides, e.g. inosin, or specifically binding nucleotides, will be incorporated. The latter are ho ologues of natural nucleotides. The specifically binding nucleotides are described in the patent US 512340. In the present invention, in the proof of principle, 2-amino-dA and 2-thio-dT are used in pairs. Those two nucleotides bind to their natural counterpart a little stronger than the natural dA and dT. At the same time, 2-amino-dA and 2-thio-dT bond between themselves significantly weaker than natural dA and dT. This is because only one hydrogen bond forms instead of two. The same goes for the modified dG and dC, which give weak bonding between these two, but strong with natural dG or dC nucleotide. The described feature has been taken advantage of in the proof of principle. Modified nucleotides have been incorporated in the oligonucleotides to be hybridized with the target. In conclusion the specificity and credibility of the reaction results are improved.

THE PROOF OF PRINCIPLE

The hybridization between oligonucleotides (the formation of dimers) can be predicted using widespread software, written for polymerase chain reaction (PCR) primer synthesis. The dimers can be formed if some fragment within the primer is complementary to its own mirror image. Such fragments may occur as various strings and in various positions. Mostly these fragments contain dA and dT. Their positions can easily be determined (see Fig. 1).

If now, in the primer, one swaps dA and dT for 2-amino-dA and 2-thio-dT modified nucleotides, the hybridization in the forming dimers will be essentially weaker. At the same time, the primer-target hybridization will not be impaired; in the present situation it will be stronger instead. In the example drawn hereunder, the hybridization is carried out on a solid carrier. In addition to this condition, primer-target hybridization may also be carried out in a solution or in a gel.

Thus the balance of hybridization is shifted from primer-primer to primer-target. There will be more labels incorporated during primer-target hybridization and less false signals from primer-primer hybridization. The results of the experiment providing the proof of principle are shown on Figure 2.

BRIEF DESCRIPTION OF THE DRAWINGS

Hereunder the invention is described with the help of figures, where:

Fig. la depicts the formation of dimers between oligonucleotides and how the modified nucleotides disrupt the dimers, due to a smaller number of hydrogen bonds. 12088s and 14040s are oligonucleotides' designations. The 12088s hairpin structure:

5' CCGGACGATATTGAACAA IIIII ) 3' ACTTGGT

12088s dimer:

5' CCGGACGATATTGAACAATGGTTCA 3' IIIII-II-IIIII 3' ACTTGGTAACAAGTTATAGCAGGCC 5'

12088sXY:

5' CCGGACGATATTGXACAATGGTYCA 3' II-II-II-II-II 3' ACYTGGTAACAXGTTATAGCAGGCC 5'

12088sXXYY:

5' CCGGACGATATTGXXCAATGGYYCA 3' II--I-II-I — II 3' ACYYGGTAACXXGTTATAGCAGGCC 5' ,

where X = 2-amino-A and Y = 2-thio-T

14040s dimer: 5' ACCACCATCCACTACAACTACATGT 3'

3' TGTACATCAACATCACCTACCACCA 5'

14040sXY: 5' ACCACCATCCACTACAACTACXYGT 3'

II — II 3' TGYXCATCAACATCACCTACCACCA 5' "I" designates complementarity between the nucleotides

Figure lb Incorporating a false signal into the oligonucleotide during self-extension If the reaction conditions favour the formation of the said dimers of 12088s and 14040s, they will also give self-extension This means that in the present case the polymerase would add to the 3' ends of both 12088s and 14040s an A nucleotide, according to complementarity with the successive T

To the 3' end of the 12088s dimer an A (marked A*) will be added, in a complementary manner A is not the same as would be incorporated following oligonucleotide-target hybridization (C)

CCGGACGATATTGAACAATGGTTCAA* 3 ' I I I I I-II-II I I I 3 ' ACTTGGTAACAAGTTATAGCAGGCC 5'

To the dimer of 14040s an A is added by the complementarity principle (marked A*), which is not the expected signal (G) from the DNA target

5' ACCACCATCCACTACAACTACATGTA* 3 '

Him

3' TGTACATCAACATCACCTACCACCA 5'

"I" designates complementarity between the nucleotides

Hereunder, the APEX reaction results are depicted when carried out at 50°C The T channel was left out as no signals were detected

The figure demonstrates that under these conditions, self-extension may be comparable or even stronger than the expected signal

Figure 2 depicts images of APEX reaction results on an array The experiments have been made with the same sa'mple of DNA but at varying temperatures (upper and lower pane) The oligonucleotides 12088s and 14040s serve as probes that hybridize to target DNA fragments A fluorescently marked A, C or G dideoxynucleotide becomes incorporated by the polymerase The T image is not shown as no signals were detected there The markers are self-elongating oligonucleotides giving signals in both A, C and G channels X = 2- amino-A, Y = 2-thio-T

The two panes for different temperatures look essentially the same

The superiority of the oligonucleotides carrying modified bases can be seen from the following

12088s that should give a C signal does not readily do so at 58°C. This must be due to the secondary structures between the oligonucleotide itself, which does not allow for the hybridization and elongation. 12088sXXYY gives a visible signal of C and 12088sXY the strongest one. All the oligonucleotides give some dimer structure followed by the self- extensive incorporation of A, but the latter is weak in comparison to the signal from the oligonucleotide-target DNA hybridization.

In the case of 14040s, the XY modification gives a clearly stronger signal of oligonucleotide-target DNA hybridization over the unmodified 14040s (channel G).

Claims

1. A method of modifying oligonucleotides, used in nucleotide sequence analysis with the primer extension or any other method or used in any other molecular method, comprising a step of probe-target nucleic acid hybridization, wherein the step of probe-target nucleic acid hybridization may be carried out in either solution, gel or on a solid carrier.

2. A method according to the claim 1, comprising a step of the enzymatic elongation of the probe with the marked or non marked nucleotides, wherein it may be carried out in either solution, gel or on a solid carrier.

3. A method according to the claim 2, characterized in that the fluorescently marked nucleotides are used for the enzymatic elongation of the probe.

4. A method according to the claim 3, characterized in that the nucleotides used for the enzymatic elongation are deoxynucleotides, dideoxy nucleotides or oligonucleotides.

5. A method according to the claims 2 to 4, characterized in that the enzymatic elongation of the probe occurs complementary with the target nucleotide acid.

6. A method according to the claim 1, characterized in that the sequence of the oligonucleotides with the known sequence is such that they may form secondary structures between or within the identical molecules, impairing their ability to hybridize with the target nucleotide acid.

7. A method according any of the preceding claims, characterized in that the secondary structures may be predicted from the sequence of the nucleotides used as target.

8. A method according to the claims 1 to 7, characterized in that the probes of the oligonucleotides are synthesized in such a manner that the pairs of nucleotides predicted to participate in secondary structures are swapped for pairs of modified nucleotides, comprising either universal bases or homologues of the natural bases.

9. A method according to the claim 8, characterized in that the modifications being such that they substantially weaken the bond between the complementary pair of modified (universal) nucleotides in the secondary structure, but do not significantly weaken the bond between the modified nucleotides and their complementary nucleotides in the target nucleotide acid, thus shifting the direction of hybridization from probe-probe to probe- target nucleotide acid.

10. A method according to any of the claims 1 to 9, characterized in that the analyzed positions may be dispersed over the gene, genes or genome.

11. A method according to any of the preceding claims, characterized in that the analyzed position may be consecutive.