WO2002042323A2 - Fluorescent proteins - Google Patents

Abstract

There is disclosed an isolated nucleic acid molecule encoding a new florescent protein which is capable of emitting fluorescence upon irradiation by incident light, wherein said maximal absorbance of incident light is in the range of 440-480mm, and maximal fluorescence emission is in the range of 470-510mm.

Description

FLUORESCENT PROTEINS

The present invention is concerned with fluorescent proteins and, in particular, with nucleic acid sequences encoding novel fluorescing proteins which have been isolated from coral species.

Fluorescent proteins, such as, green fluorescent protein from the luminescent jelly fish Aequorea ^victoria are extremely- useful molecules by virtue of their ability to function as markers for gene expression and protein localisation within living cells. Fluorescent proteins can be produced in vivo by biological systems and can therefore be used to monitor and trace the progress of intracellular events .

In the present invention, the inventors have surprisingly identified completely novel fluorescing proteins from the coral species Anthozoa which have been sequenced and which can be used for in vivo labelling studies.

Therefore, according to a first aspect of the invention there is provided an isolated nucleic acid molecule encoding a fluorescent protein comprising an amino acid sequence illustrated in any of the polypeptide sequences of figures 3(a) to 3(d). The present inventors have advantageously identified 4 distinct nucleic acid molecules encoding fluorescing proteins which heretofore have not yet been described. In a further aspect, the invention comprises an isolated nucleic acid molecule encoding a protein capable of emitting fluorescence upon irradiation by incident light, wherein said maximal absorbance of said incident light is in the range 440-480 nm, in particular 450-475 (maximum of excitation) and maximal fluorescence emission is in the range 470-510 nm, in particular 480-500 nm (maximum of emission) .

According to the invention, at least 4 different fluorescent proteins (and nucleic acid sequences encoding said proteins) were obtained from species of coral, and in particular from species of coral belonging to the genus Discosoma and the genus Polythoa .

In addition^ as can be seen from the data given hereinbelow, hybrids of fluorescent proteins derived from two or more different species from the genus Polythoa and/or Discosoma may also be used. Such hybrid fluorescent proteins of the invention may be obtained by suitable expression of hybrid (e. g. chimeric) nucleic acid sequences encoding such hybrid proteins, which in turn may for instance be obtained by suitably combining (two or more parts of) two or more naturally occurring nucleic acids (i.e. cDNAs and/or genes) encoding (native) fluorescent proteins, at least one of which has been obtained from a coral of the species Polythoa and/or Discosoma (and/or from another coral) . This can be carried out by techniques known per se and/or as further described below, including but not limited to "gene shuffling" techniques .

A listing of the clones used in the invention is given in Figure 2. Also, an alignment of some of the clones used herein is given in Figure 8B.

The excitation- and emission-spectra for some of these proteins are given in the Figures, and are also summarized below: Clone Source Mutations Exitation Emission max (nm) max (nm)

pGR7 Polythoa spec. Q135R 469 (452) 490 pGR3 Polythoa spec. N41D, 3'end 469 (452,489) 496 pGR13 Polythoa spec none 469 (452) 490 pGR15 Hybrid none 451 (440) 484

Accordingly, in one embodiment, the invention relates to a fluorescent protein with an emission spectrum which has:

- a maximum of emission (fluorescence - measured following exitation at 469 nm) at between 491 and 501 nm, and in particular at about 496 nm; and preferably one, and more preferably both, of the following:

^r- an emission at 480 nm (fluorescence - measured following exitation at 469 nm) of between 30 and 40 % of the emission at the maximum of emission;

- an emission at 525 nm (fluorescence - measured following exitation at 469 nm) of between 35 and 45 of the emission at the maximum of emission; and with an exitation spectrum which has:

- a maximum of absorbance (measured at emission at 490 nm) at between 464 and 474 nm, and in particular at about 469 nm; and at least any one, preferably at least any two, more preferably at least any three, and most preferably all four of the following:

- an absorbance at 452 nm (measured at emission at 490 nm) of between 59 and 69 % of the absorbance at the maximum of absorbance; an absorbance at 456 nm (measured at emission at 490 nm) of between 54 and 64 % of the absorbance at the maximum of absorbance;

- an absorbance at 486 nm (measured at emission at 490 nm) of between 42 and 52 % of the absorbance at the maximum of absorbance;

an absorbance at 489 nm (measured at emission at ,490 nm) of between 63 and 73 % of the absorbance at the maximum of absorbance.

In another embodiment, the invention relates to a fluorescent protein with an emission spectrum which has:

a maximum of emission (fluorescence - measured ^"following exitation at 469 nm) at between 485 and 495 nm, and in particular at about 490 nm, and preferably one, and more preferably both, of the following:

an emission at 480 nm (fluorescence - measured following exitation at 469 nm) of between 46 and 56 % of the emission at the maximum of emission;

an emission at 525 nm (fluorescence - measured following exitation at 469 nm) of between 33 and 43 % of the emission at the maximum of emission; and with an exitation spectrum which has:

a maximum of absorbance (measured at emission at 490 nm) at between 464 and 474 nm, and in particular at about 469 nm; and at least any one, preferably at least any two, more preferably at least any three, and most preferably all four of the following: an absorbance at 440 nm (measured at emission at 490 nm) of between 48 and 58 % of the absorbance at the maximum of absorbance;

- an absorbance at 452 nm (measured at emission at

490 nm) of between 55 and 65 % of the absorbance at the maximum of absorbance; an absorbance at 456 nm (measured at emission at

490 nm) of between 52 and 62 % of the absorbance at the maximum of absorbance;

an absorbance at 480 nm (measured at emission at 490 nm) of between 48 and 58 % of the absorbance at the maximum of absorbance.

In yet another embodiment, the invention relates to a fluorescent protein with an emission spectrum which ^"has :

- a maximum of emission (fluorescence - measured following exitation at 451 nm) at between 479 and 489 nm, and in particular at about 484 nm, and preferably one, and more preferably both, of the following:

- an emission at 470 nm (fluorescence - measured following exitation at 451 nm) of between 39 and 49 % of the emission at the maximum of emission;

an emission at 525 nm (fluorescence - measured following exitation at 451 nm) of between 31 and 41 % of the emission at the maximum of emission; and with an exitation spectrum which has:

a maximum of absorbance (measured at emission at 484 nm) at between 446 and 456 nm, and in particular at about 451 nm; and at least any one, preferably at least any two, more preferably at least any three, and most preferably all four of the following:

an absorbance at 420 nm (measured at emission at 484 nm) of between 61 and 71 % of the absorbance at the maximum of absorbance; an absorbance at 440 nm (measured at emission at 484 nm) of between 86 and 96 % of the absorbance at the maximum of absorbance;

- an absorbance at 447 nm (measured at emission at 484 nm) of between 84 and 94 % of the absorbance at the maximum of absorbance;

an absorbance at 470 nm (measured at emission at 484 nm) of between 61 and 71 % of the absorbance at the maximum of absorbance.

Also, any protein with an emission and/or exitation spectrum as indicated above preferably has a degree of sequence identity with at least one of the proteins encoded by the nucleic acid sequences shown in Figure 1, of at least 70%, preferably at least 80%, more preferably at least 90% and even more preferably at least 95% sequence identity with at least one of the proteins encoded by at least one of the nucleotide sequences depicted in Figure 1, in which the percentage sequence homology is determined as described hereinbelow.

For the some of the clones described hereinbelow, pertinent values are given in Figure 28.

Preferably, the nucleic acid molecule is a DNA and more preferably a cDNA molecule. The cDNA molecules are preferably isolated from the Discosoma or Polythoa genus of coral although they may also be synthetically prepared using techniques which would be well known to practitioners skilled in the art. Preferably, the nucleic acid sequences encoding the novel proteins are as set forth in Figure 1.

Preferably, the nucleic acid molecule is substantially homologous to the nucleic acid sequences depicted in Figure 1. Even more preferably the nucleic acid molecule has at least 70, preferably at least 80,. imore preferably at least 90 and even more preferably at least 95% sequence identity to at least one of the nucleic acid sequences depicted in Figures 1 and even more preferably comprises any of the nucleic acid sequences of Figure 1.

The fluorescent proteins of the invention can be used for any application known per se for fluorescent proteins described in the art, such as for the green fluorescent protein from Aequorea victoria mentioned above. Such applications will be clear to the skilled person, and may include, but are not limited to, the applications of such "GFPs" mentioned in the relevant prior art, such as WO 95/07463, WO 97/11094, WO 97/42320, WO 98/06737 and WO 97/41228.

As such, the fluorescent proteins of the invention (and/or the nucleic acid sequences encoding these proteins) may be used as a label and/or marker, and in particular as a genetic marker and/or an expression marker, for instance in the fields of (micro-) biology, biochemistry and/or molecular biology.

For example, the fluorescent proteins of the inventions (and/or the nucleic acid sequences encoding these proteins) may be used in in vi tro applications, such as hybrisation assays and/or immunological assays (e.g. ELISA' s) .

However, fluorescent proteins of the invention are particularly suited for applications in vivo, including but not limited to expression and/or use in bacteria, protozoa, fungi, algi, yeast cells or other micro-organisms; in (cells or tissues of) plants and/or animals; and/or in cells or cell lines derived from plant cells or animal cells.

One particularly preferred application involves the expression and use in species of nematode, such as

C. elegans, e.g. for screens or assays involving the use of such nematodes.

Some other possible applications include, but are not limited to:

follow up of a protein tagged with a fluorescent protein during the purification of said protein ( e.g. using chromatography techniques) ;

in vivo expression analysis;

investigation of the transport of proteins etc. across biological membranes; and/or (other) qualitative and/or quantitative detection techniques and/or analytical techniques.

The nucleic acid molecules of the present invention are particularly useful in processes for labelling polypeptides of interest, e.g., by the construction of genes encoding fluorescent fusion proteins. Fluorescence labelling via gene fusion is site- specific and eliminates the present need to purify the labelled proteins in vitro and icroinject them into cells. Sequences encoding the fluorescing proteins of the present invention may be used for a wide variety of purposes as are well known to those working in the field. For example, the sequences may be employed as reporter genes for monitoring the expression of the sequence fused thereto; unlike other reporter genes, the sequences require neither substrates nor cell disruption to evaluate whether expression has been achieved. Similarly, the sequences of the present invention may be used as a means to trace lineage of a gene fused thereto during the development of a cell or organism. Further, the sequences of the present invention may be used as a genetic marker; cells or organisms labelled in this manner can be selected by e.g. fluorescence-activated cell sorting. The sequences of the present invention may also be used as a fluorescent tag to monitor protein expression in vivo and/or in vi tro or to encode donors or acceptors for fluorescence resonance energy transfer. Other uses for the sequences of the present invention would be readily apparent to those working in the field, as would appropriate techniques for fusing a gene of interest to an oligonucleotide sequence of the present invention in the proper reading frame and in a suitable expression vector so as to achieve expression of the combined sequence.

Similarly fusion proteins including an antibody fused to the fluorescing protein may also be generated for in vivo labelling, for example. In such an embodiment the nucleic acid molecule of the invention encoding the fluorescing protein will be operably linked to the sequence encoding the antibody. As would be well known in the art only a small portion of an antibody molecule, the paratope, is involved in binding to the epitope of a protein and a nucleic acid molecule encoding the paratope may be used to generate a labelled molecule specific for the paratope of interest. _^--

A fusion protein of the 3' sequence of Discosoma coupled to the 5' sequence of Polythoa 2 was also generated using the nucleic acid sequences encoding the Polythoa 2 and Discosoma 1 protein, for expression in a prokaryotic and eukaryotic expression system, which protein sequences are illustrated in Figure 7. The plasmid pGR15 encoding the sequence of the Polythoa 2-Discosoma 1 hybrid was the vector used for expression of the fusion protein in E . coli , whereas plasmid pGR18 was utilised for eukaryotic expression in COS cells. Plasmid pGR20 was used for expression in C. elegans and transformation of the relevant cells or organism using these vectors resulted in expression of a fluorescing protein.

As outlined in more detail in the examples below, mutant or hybrid proteins were also developed to investigate their absorbance and emission spectra compared to the wild type Polythoa and Discosoma proteins. The proteins and polypeptides encoded by plasmids pGR3 and pGR7 described herein contain a 109 thioredoxin associated fragment in fusion with the Polythoa 2 fluorescing protein. Furthermore, plasmid pGR7 encodes a protein with the mutation Q136R while a further plasmid pGRlO expresses a I106T mutant.

An antisense molecule capable of hybridising to the nucleic acid molecules of the invention under conditions of high stringency also forms part of the invention.

Stringency of hybridisation as used herein refers to conditions under which polynucleic acids axe stahle.. The stability of hybrids is reflected in the melting temperature (Tm) of the hybrids. Tm can be approximated by the formula:

81.5°C+16.6(log₁₀[Na⁺]+0.41 (%G&C) -600/1

wherein 1 is the length of the hybrids in nucleotides. Tm decreases approximately by 1-1.5°C with every 1% decrease in sequence homology.

The term "stringency" refers to the hybridisation conditions wherein a single-stranded nucleic acid joins with a complementary strand when the purine or pyrimidine bases therein pair with their corresponding base by hydrogen bonding. High stringency conditions favour homologous base pairing whereas low stringency conditions favour non-homologous base pairing.

"Low stringency" conditions comprise, for example, a temperature of about 37°C or less, a formamide concentration of less than about 50%, and a moderate to low salt (SSC) concentration; or, alternatively, a temperature of about 50°C or less, and a moderate to high salt (SSPE) concentration, for example 1M NaCl. "High stringency" conditions comprise, for example, a temperature of about 42°C or less, a formamide concentration of less than about 20%, and a low salt (SSC) concentration; or, alternatively, a temperature of about 65°C, or less, and a low salt (SSPE) concentration. For example, high stringency conditions comprise hybridization in 0.5 M NaHP0₄, 7% sodium dodecyl sulfate (SDS) , 1 mM EDTA at 65°C (Ausubel, F.M. et al . Current Protocols in Molecular ^" Biology, Vol. I, 1989; Green Inc. New York, at ,-— 2.10.3) .

"SSC" comprises a hybridization and wash solution. A stock 20X SSC solution contains 3M sodium chloride, 0.3M sodium citrate, pH 7.0.

"SSPE" comprises a hybridization and wash solution. A IX SSPE solution contains 180 mM NaCl, 9mM Na₂HP0₄ and 1 mM EDTA, pH 7.4.

However, other conditions and reagents also result in stringent hybridisation conditions and these are generally well known to the skilled practitioner (Molecular Cloning A Laboratory Manual, J. Sambrook et al . , Cold Spring Harbour Press, 1989, or Current

Protocols in Molecular Biology, F.M. Ansubel, et al . , eds . , John Wiley & Sons Inc., New York.

As would be appreciated by those skilled in the art, the presence of introns in a nucleic acid sequence can lead to enhanced expression levels. One of the preferred nucleic acid molecules of the invention, the sequence of which is depicted in Figure 2 (b) , includes a synthetic intron in addition to a 5 ' UTR including a Kozak site .

Fluorescent proteins or functional equivalents, fragments or variants thereof encoded by the nucleic acid molecules of the invention also form part of the invention. Furthermore, according to an even further aspect, the invention comprises an isolated fluorescent protein capable of emitting fluorescence upon irradiation by incident light wherein the maximal absorbance of said incident light is in the range--440- 480 nm, in particular 450-475 nm (maximum of excitation) and maximal fluorescence emission is in the range 470-510 nm, in particular 480-500 nm (maximum of emission) . The invention also comprises an isolated fluorescent protein comprising an amino acid sequence which has at least 70, preferably at least 80, more preferably at least 90 and even more preferably at least 95% sequence identity to the amino acid sequence depicted in any of Figures 3 to 8.

Functional equivalents, fragments or variants of the polypeptide of the invention are those molecules that retain the distinct fluorescing capability of the polypeptides of the invention.

The DNA molecules according to the invention may, advantageously, be included in a suitable expression vector to express the fluorescent protein encoded therefrom in a suitable host. Incorporation of cloned DNA into a suitable expression vector for subsequent transformation of said cell and subsequent seϊection of the transformed cells is well known to those skilled in the art as provided in Sambrook et al . (1989) , Molecular Cloning, A Laboratory Manual, Cold Spring Harbour Laboratory Press.

An expression vector according to the invention includes a vector comprising a nucleic acid according to the invention operably linked to regulatory sequences, such as promoter regions, that are capable of effecting expression of said DNA fragments. The term "operably linked" refers to a juxta position wherein the components described are in a relationship ^' permitting them to function in their intended manner . Such vectors may be transformed into a suitable host cell to provide for expression of a polypeptide according to the invention. Thus, in a further aspect, the invention provides a process for preparing polypeptides according to the invention which comprises cultivating a host cell, transformed or transfected with an expression vector as described above under conditions to provide for expression by the vector of a coding sequence encoding the polypeptides, and recovering the expressed polypeptides .

The vectors may be, for example, plasmid, virus or phage vectors provided with an origin of replication, and optionally a promoter for the expression of said nucleotide sequence and optionally a regulator of the promoter. The vectors may contain one or more selectable markers, such as, for example, ampicillin resistance .

The precise nature of the regulatory sequences needed for expression of the fluorescing protein can vary between species or cell types. They will, however, generally include 5' non-transcribing and 5' non- translating sequences involved in initiation or regulation of transcription and translation respectively. Regulatory elements required for expression generally include promoter sequences to bind RNA polymerase and transcription initiation sequences for ribosome binding. For example, a bacterial expression vector may include a promoter such as the lac promoter and for translation initiation the Shine-Dalgarno sequence and the start codon AUG. Similarly, a eukaryotic expression vert.or may include a heterologous or homologous promoter for RNA polymerase II, a downstream polyadenylation signal, the start codon AUG, and a termination codon for detachment of the ribosome. Such vectors may be obtained commercially or assembled from the sequences described by methods well known in the art.

Nucleic acid molecules according to the invention may be inserted into the vectors described in an antisense orientation in order to provide for the production of antisense RNA. Antisense RNA or other antisense nucleic acids may be produced by synthetic means.

As discussed in the examples provided it is desirable to enhance the performance or expression levels of the fluorescent proteins in organisms or cells other than those from the coral species from which the proteins or polypeptides of the invention are derived. Every organism adopts a preferred codon usage which is related to the presence and expression of tRNA genes and which involves post-transcriptional expression regulation. Such optimal codon usage has been determined for a number of organisms. In the present embodiment a vector was generated for optimal expression in the nematode C. elegans . Therefore, when the host to be transfected with a vector including the nucleic acid molecules of the invention is C. elegans, the vector may comprise the plasmid pGRlO, described in the example below, which includes the nucleotide sequence depicted in Figure 2(a).

Similarly, the introduction of synthetic introns can result in enhancements of expression levels. A ^" preferred nucleic acid molecule including such a „-. - synthetic intron for increased expression levels in C. elegans is particularly preferred, which molecule is described in Figure 2 (b) .

Preferred vectors according to the invention comprise the plamsids designated pGR3, pGR4, pGR5, pGR6, pGR7 and pDW2700, the sequences of which are illustrated in Figures 9 to 14 respectively. Other preferred plasmids according to the invention comprise plasmids designated pGRl, pGR8, pGR13, pGRl4, pGR15, pGRl6,

GR17, pGR18, pGR19, pGR20 and pGRlO identified in the example provided, and which would be readily producible by the skilled practitioner using the method steps described.

In accordance with the present invention, a defined nucleic acid includes not only the identical nucleic acid but also any minor base variations including in particular, substitutions in cases which result in a synonymous codon (a different codon specifying the same amino acid residue) due to the degenerate code in conservative amino acid substitutions. The term "nucleic acid sequence" also includes the complementary sequence to any single stranded sequence given regarding base variations.

The present invention also advantageously provides nucleic acid sequences of at least approximately 10 contiguous nucleotides of a nucleic acid according to the invention and preferably from 10 to 50 nucleotides of the nucleic acid sequences set forth in Figures 1 and 2. These sequences may, advantageously bei used as probes or primers to initiate replication, or the ■ like. Such nucleic acid sequences may be produced- according to techniques well known in the art, such as by recombinant or synthetic means. They may also be used in diagnostic kits or the like for detecting the presence of a nucleic acid according to the invention. These tests generally comprise contacting the probe with the sample under hybridising conditions and detecting for the presence of any duplex or triplex formation between the probe and any nucleic acid in the sample.

Letters utilised in the sequences according to the invention which are not recognisable as letters of the genetic code signify a position in the nucleic acid sequence where one or more of bases A, G, C or T can occupy the nucleotide position. Representative letters used to identify the range of bases which can be used are as follows:

M A or C

R A or G

W A or T

S C or G

Y C or T

K ■ G or T A or C or G A or C or T A or G or T C or G or T G or A or T or C

According to the present invention, degenerate primers were utilised to fully identify the sequence of the nucleic acid encoding the proteins of the invention. Those novel molecules as described in the example,. ~ provided also form part of the present invention.

According to the present invention these probes may be anchored to a solid support. Preferably, they are present on an array so that multiple probes can simultaneously hybridize to a single biological sample. The probes can be spotted onto the array or synthesised in situ on the array. (See Lockhart et al . , Nature Biotechnology, vol. 14, December 1996 "Expression monitoring by hybridisation to high density oligonucleotide arrays". A single array can contain more than 100, 500 or even 1,000 different probes in discrete locations.

The nucleic acid sequences, according to the invention may be produced using such recombinant or synthetic means, such as for example using PCR cloning mechanisms which generally involve making a pair of primers, which may be from approximately 10 to 50 nucleotides to a region of the gene which is desired to be cloned, bringing the primers into contact with iriRNA, cDNA, or genomic DNA from a suitable biological source, and in particular from (a cell of) a species of coral, more particularly from (a cell of) a species of coral from the genus Polythoa and/or the genus Discosoma, performing a polymerase chain reaction under conditions which brings about amplification of the desired region, isolating the amplified region or fragment and recovering the amplified DNA. Some of the primers suitable for the aforementioned method include, but are not limited to, the individual primers mentioned in Table 1 as well as the combinations thereof mentioned in Table 2. Generally, such techniques are well known in the art, such as ~ described in Sambrook et al . (Molecular Cloning: a Laboratory Manual, 1989) . Another suitable technique involves "gene shuffling" (DNA shuffling by random fragmentation and reassembly: In vi tro recombination for molecular evolution: Proc. Natl. Acad. Sci. Vol 91, pp 10747-10751, October 1994.

Therefore, it is also envisaged that - based upon the disclosure herein and (for instance) using one or more of the primers listed in Table 1 or a suitable combination thereof (including but not limited to the combinations mentioned in Table 2 - the skilled person will be able to isolate (nucleic acids encoding) additional fluorescent proteins of the invention from other suitable biological sources, and in particular from other species of coral such as (other) species from the genus Polythoa and/or the genus Discosoma ; and such (nucleic acids encoding such) additional fluorescent proteins are also within the scope of the present invention.

In one preferred embodiment, such any nucleic acids will have at least 70%, preferably at least 80%, more preferably at least 90% and even more preferably at least 95% sequence identity with at least one of the nucleotide sequences depicted in Figure 1, in which the percentage sequence homology is determined as described above; and/or is capable of hybridizing with at least one of the nucleotide sequences depicted in

Figure 1 under conditions of high stringency, again as described above.

The term "homologous" describes the relationship between different nucleic acid molecules or aminα_^acid sequences wherein said sequences or molecules are related by partial identity or similarity at one or more blocks or regions within said molecules or sequences. Homology may be determined by means of computer programs known in the art.

Substantial homology preferably carries with it that the nucleotide and amino acid sequences of the fluorescent proteins of the invention comprise a nucleotide and amino acid sequence fragment, respectively, corresponding and displaying a certain degree of sequence identity to the sequences set forth in Figures 1 and 2 for the nucleotide sequences and 3 to 8 for the polypeptide sequences. Preferably they share an identity of at least 30 %, preferably 40 %, more preferably 50 %, still more preferably 60 %, most preferably 70%, and particularly an identity of at least 80 %, preferably more than 90 % and still more preferably more than 95 % is desired with respect to the nucleotide or amino acid sequences depicted in Figures 1 to 8 respectively. A preferred method for determining the best overall match between a query sequence (a sequence of the present invention) and a subject sequence, also referred to as a global sequence alignment, can be determined using, for example, the FASTDB computer program based on the algorithm of Brutlag et al . (Comp. App. Biosci. 6 (1990), 237-245.) In a sequence alignment the query and subject sequences are both DNA sequences. An RNA sequence can be compared by converting U's to T's. The result of said global sequence alignment is in percent identity. Further programs that can be used in order to determine homology/identity are described below and in the examples. The sequences that are- homologous-to the sequences described above are, for example, variations of said sequences which represent modifications having the same biological function, in particular encoding proteins with the same or substantially the same receptor specificity, e.g. binding specificity. They may be naturally occurring variations, such as sequences from other mammals, or mutations. These mutations may occur naturally or may be obtained by mutagenesis techniques. The allelic variations may be naturally occurring allelic variants as well as synthetically produced or genetically engineered variants. In a preferred embodiment the sequences are derived from a human.

A further aspect of the invention provides host cells transformed or transfected with a vector according to the invention. Such cells can be of prokaryotic or eukaryotic origin. Suitable prokaryotes include gram positive or negative organisms including E. coli, Bacillus spp, Pseudomonas spp, or salmonella typhimurium. The expression vector used to transform the prokaryotic cells, and particularly E. coli , preferably comprises plasmids designated pGR3 and pGR7, the sequences of which are illustrated in Figure 9 and 13 respectively. Eukaryotic organisms include yeasts or fungi and plant cells which utilise a transfection system based on infection by Agrobacterium tumefaciens.

The vectors can also be used to transform cells in tissue culture in addition to non-human organisms and these also form part of the invention. Typical mammalian tissue culture cells include COS-7, HEK-293, ^■ BHK, CHD, HELA cells and the like. Suitable organisms which may be useful to monitor expression of proteins using the novel fluorescing proteins of the invention include C. elegans, which is particularly advantageous as the fluorescing protein can be viewed in vivo .

When the organism to be transformed with the appropriate vector is C. elegans, the vector preferably comprises the sequence of the plasmid illustrated in Figure 12 or a vector adapted for expression of heterologous -proteins in the C. elegans including the nucleotide sequences illustrated in Figure 2.

Transformation of a host cell with recombinant DNA may be carried out by conventional techniques as are well known to those skilled in the art. Where the host is prokaryotic, such as E. coli , competent cells which are capable of- DNA uptake can be prepared from cells harvested after exponential growth phase and subsequently treated by the CaCl₂ method by procedures well known in the art. Alternatively, MgCl₂ or RbCl can be used. Transformation can also be performed after forming a protoplast of the host cell or by electroporation . When the host is a eukaryote, such methods of transfection of DNA as calcium phosphate co- precipitates, conventional mechanical procedures such as microinjection, electroporation, insertion of a plasmid encased in lipsosomes, or virus vectors may be used. Eukaryotic cells can also be cotransfected with DNA sequences encoding the fusion polypeptide, such as the herpes simplex thymidine kinase gene. Another method is to use a eukaryotic viral vector, such as simian virus 40(SV40) or bovine papilloma virus, -© transiently infect or transform eukaryotic cells and express the proteins { Eukaryotic Viral Vectors , Cold Spring Harbour Labora tory, Gluznan ed. , 1982.

Also encompassed within the scope of the present invention is a method of producing a polypeptide according to the invention comprising cultivating a host cell or tissue transformed or transfected with the appropriate vector of the invention under conditions suitable for expression of the flourescent protein and optionally recovering the expressed protein. The protein may be recovered and purified from the recombinant cell cultures by methods known in the art, including ammonium sulfate or ethanol precipitation acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxyapatite chromatography and lectin chromatography.

In a further aspect, the invention also comprises an oligonucleotide probe or primer, and which comprises a sequence that selectively hybridises to a nucleic acid molecule according to the invention. The oligonucleotide preferably comprises a sequence of at least 10 contiguous nucleotides and is preferably between 10 and 50 nucleotides in length.

Advantageously, the novel proteins of the invention, as aforementioned, are particularly useful for monitoring expression of proteins within biological systems and the subcellular localisation or ^' trafficking of proteins. To determine the expression pattern of a particular protein of interest it suffices in principle to make a fusion between the promoter of the gene of interest and the sequence encoding the fluorescing protein. Upon introduction of a vector with the promoter-fluorescent protein of the invention fusion into a cell or organism, any expression induced by the promoter can easily be monitored by following the expression of the protein of the invention. To monitor the subcellular expression of a protein it generally suffices to make a fusion between the protein of interest and the GFP protein, which can be done at either the N or C terminals of the protein.

Therefore, in a further aspect the present invention comprises a method for selecting cells capable of expressing a protein of interest, comprising introducing into said cells a vector comprising the nucleotide sequence of a fluorescent protein according to the invention operatively linked to a promoter or regulatory region of the protein of interest, cultivating the cell under conditions necessary for expressing the protein of interest and monitoring for any fluorescent following expression of said fluorescent protein.

In accordance with the present invention, a protein of interest includes any protein to be monitored or labelled by virtue of being attached or expressed together with the proteins of the invention. The techniques for generating fusion proteins using the proteins of the invention are well known to those in the art.

A particular use of fluorescent proteins consists of the construction of a synthetic protein harboring a donor fluorescent protein and an acceptor fluorescent protein, connected with a binding protein moiety. The two fluorescent proteins change conformation upon binding of an analyte to the binding protein moiety. The binding protein moiety has an analyte-binding region which binds an analyte and causes the indicator to change conformation upon exposure to the analyte. The donor fluorescent protein is covalently coupled to the binding moiety. The acceptor fluorescent protein moiety is also covalently coupled to the binding protein moiety. In the fluorescent indicator the donor moiety and the acceptor moiety change position relative to each other when the analyte binds to the analyte binding region, altering fluorescence resonance energy transfer between the donor moiety and the acceptor moiety when the donor moiety is excited. Such a system has been described previously by Tsien et al. WO 98/40477 and Garman WO 94/28166. These molecules are very efficient in measuring internal concentrations of analytes such as cAMP, Ca²⁺, etc. as for measurement of internal enzymatic activities of enzymes such as proteases, esterases, etc. The novel fluorescent proteins according to the present invention and functional equivalents, derivatives or fragments thereof can be used to develop new FRET molecules .

Therefore, in a further aspect the present invention comprises a method for producing fluorescence resonance energy transfer comprising; providing an acceptor molecule comprising a fluorescent protein according to the invention providing an appropria-te- donor molecule for the fluorescent protein; arid bringing the donor molecule and acceptor molecule into sufficiently close contact to allow fluorescence resonance energy transfer. Alternatively, the donor molecule can be the fluorescent protein of the invention in which case an appropriate acceptor molecule for the fluorescent protein is provided.

The invention may be more clearly understood from the following description of an exemplary embodiment with reference to the accompanying Figures wherein:

Figure 1 is an illustration of the nucleotide sequences encoding for fluorescent proteins from the Polythoa and ^•

Discosoma species of coral.

Figure 2 (a) is an illustration of the sequence of the DNA fragment encoding Polythoa 2 protein with optimal codon usage for expression in C. elegans . (b) is an illustration of the sequence from (a) further including introns and a 5' untranslated region containing a Kozak sequence .

Figure 3 (a-d) is an illustration of the polypeptide sequences of Polythoa 1 and 2 and Discosoma 1 and 2 encoded by the nucleic acid molecules of the invention.

Figure 4 is an illustration of the sequence of a Polythoa fusion protein encoded by—-- plasmid pGR3 and which includes a 109 amino acid thioredoxin fragment fused to the Polythoa 2 polypeptide sequence.

Figure 5 is an illustration of the sequence of a

Polythoa 2 fluorescent fusion protein in pGR7 which also incorporates the 109 thioredoxin amino acid fragment.

Figure 6 is an alignment of the proteins encoded by the plasmids indicated A-J therein.

Figure 7 is a further alignment of the protein sequences of the Polythoa 2, Discosoma 1 hybrid and the proteins encoded by the plasmids indicated therein.

Figure 8 (a) is a further alignment of the translation products from the DNA fragments indicated therein.

Figure 8 (b) is an alignment of some of the clones used in the present invention. Figure 9 is an illustration of the nucleotide sequence of plasmid pGR3.

Figure 10 is an illustration of the nucleotide sequence of plasmid pGR4.

Figure 11 is an illustration of the nucleotide sequence of plasmid pGR5.

Figure 12 is an illustration of the nucleotide sequence of plasmid pGR6.

Figure 13 is an illustration of the nucleotide sequence of plasmid pGR7.

Figure 14 is an illustration of the nucleotide sequence of plasmid pDW2700.

Figure 15 is a graphic representation of the emission spectrum of the thioredoxin- FP-fusion protein from pGR3 at (a) 452 nm and (b) 489 nm excitation.

Figure 16 is a graphic representation of the emission spectrum of thioredoxin-FP- fusion protein from pGR3 at 469 nm excitation.

Figure 17 is a graphic representation of the pGR3 excitation spectrum at an emission of 490 nm.

Figure 18 is a graphic representation of the excitation spectrum of thioredoxin-FP- fusion protein from pGR7 at 490 nm emission.

Figure 19 is a graphic representation of the emission spectrum of thioredoxin-FP- fusion protein from pGR7 at 452 nm excitation.

Figure 20 illustrates combined emission and excitation spectra of thioredoxin-JFP-- fusion protein from pGR7.

Figure 21 is a graphic representation of the emission spectrum of thioredoxin-FP- fusion protein from pGR13 at 452 nm excitation.

Figure 22 is a graphic representation of the emission spectrum of thioredoxin-FP- fusion protein of pGRl3 at 469 nm excitation.

Figure 23 is a graphic representation of the excitation spectrum of the thioredoxin- FP-Fusion proteins from pGR13 at 490 nm emission.

Figure 24 is a graphic representation of the emission spectrum of thioredoxin-FP- fusion protein pGR15 at (a) 489 nm excitation and (b) 451 nm excitation.

Figure 25 is a graphic representation of the emission spectrum of thioredoxin-FP- fusion protein pGR15 at 440 nm excitation.

Figure 26 is a graphic representation of the emission spectrum of thioredoxin-FP- fusion protein pGF15 at 440 n excitation.

Figure 27 is a list of the clones used in accordance with the invention. _*.---

Figure 28 is a list of pertinent absorbance and emission values for some of the clones used.

Examples :

1) Isolation of cDNA encoding for new fluorescent proteins

a) Isolation of RNA

Two brightly fluorescent Anthozoa species (Polythoa and Discosoma species) were used to isolate fluorescent proteins. This type of coral 'can be obtained from aquarium supply outlets, but such corals can be obtained from various coral reefs. The corals, and more particularly the polyps expressing high levels of fluorescent protein were flash-frozen in liquid nitrogen. Methods to isolate material samples are common in molecular biology techniques, and have been described in "Current Protocols in Molecular Biology", ed. by Ausubel et al., John Wiley & Sons, Inc. Total RNA was isolated using TRIzol™ Reagent (Cat. NO. 15596; Life Technologies), according to the manufacturers procedure, from the frozen specimens and the total RNA was finally re-suspended in DEPC water (Current protocols in Molecular biology, ibid) .

b) First strand cDNA synthesis

First strand cDNA was prepared using the total RNA isolations as described above from the Polyth©a or the Discosoma species. Random primers were provided by Life Technologies (Cat. NO. 48190-11) and cDNA was synthesized using the Superscript II kit (Cat. NO. 18064-022; Life Technologies) . The protocol to generate cDNA, by RT-PCR was performed according the instructions of the manufacturers. c) PCR with degenerate primers:

To isolate full cDNA sequences encoding for new fluorescent proteins, a series of PCR procedures were performed using the cDNA isolated as described above.

For these experiments, the following synthetic degenerate primers were used: oGRl: CACCACATGGAAGGAWRYKTNRAYGG; oGR2: ACCACATGGAAGGATGCKTNRAYGGNCA; oGR3 : AATTTGTGATCAAGGGCRARGGNRWNGG;

OGR4 : GTGATCAAAGGTGGACCNYTNCCNTT; oGR5 : GACATATTGTCAACAGAGTTYMANTAYG; oGR6 : CATATTGTCAACAGAGTTYMANTAYGG; OGR7 :ATCCTGACGACATACCAGAYTAYHWNAA; oGR8 : GACTATTTCAAGCAGTCGTKYCCNGMNGG; oGR9 : CATGGGAAAGGTCCTTGCAYTWYGARGA;

OGR10 : GGTGACATCTCCTTTCARNAYNCC; oGRll : CATATTCTCAGTGGANGSNTCCCA; OGR12 : CACAGGTCCATCGSNAGGRAARTT; OGR13 : CCATCGGCAGGAAARTTNANNCC; OGR14: TGAATACCCTGTTTCCRTANTKRAA

The first strand cDNAs as isolated above were subjected to PCR amplification using the set of degenerate primers (oGRl till OGR14) and Amplitaq Gold (Perkin Elmer) as Polymerase. Concentrations, buffers were as provided by the manufacture or minor modifications were applied as known in the art. _*-.■.-« The PCR conditions were as followed:

An initial denaturation step at 95°C for 10', followed by 25 cycles of touch down PCR (30" at 95°C, 1' at 55°C (-0.2°C/cycle) and V at 72°C) and followed by 15 cycles of PCR (95°C for 30", at 50°C for 1' and 72°C for 1' ) . The resulting PCR products were analyzed on standard agarose gel and the DNA fragments of interest were isolated and cloned into vector pCR-XL-TOPO vector (Cat. NO. K4700-20; Invitrogen) . Following primer combinations resulted in the isolation of appropriate DNA fragments On Polythoa first strand cDNA:

OGR1/OGR14, 0GR6/0GRH, oGR2/oGRll, oGR3/oGRll, oGR4/oGRll, oGR5/oGRll, 0GRI/0GRII, on Discosoma first strand cDNA:

0GRI/0GRIO, 0GRI/0GRII, 0GR6/0GRIO, 0GR6/0GRII, oGR2/oGRll oGRl/oGR12, OGR1/OGR14, 0GR6/0GRI2, oGR6/oGR13, oGR3/ oGRll, oGR4/oGRll, oGR5/oGRll, 0GR8/0GRH, oGR9/oGRll

It would be apparent to a person skilled in the art that other primer combinations will also result in the isolation of DNA fragments encoding for fluorescent proteins, such as the primer combinations. oGRl/oGRl3, oGR2/oGRlO, oGR2/oGRl2, oGR2/oGR13, oGR2/oGR14, oGR3/oGRlO, oGR3/oGR12, oGR3/oGR13, oGR3/oGR14, oGR4/oGRl0, oGR4/oGR12, oGR4/oGR13, oGR4/oGR14, oGR5/oGRlO, oGR5/oGRl2, oGR5/oGRl3, oGR5/oGR14, oGR7/oGRlO, oGR7/oGRll, oGR7/oGR12, oGR7/oGR13, .

0GR8/0GRIO, oGR8/oGR12, oGR8/oGR13, oGR9/oGR10, oGR9/oGRl2, oGR9/oGR13.

c) establishing bona fide sequences,

After initial sequencing of the cloned DNA fragments, more specific primers were designed to isolate the relevant cDNA from the two species.

For the Polythoa species: OGR21 :AAAGGCGTGCCCCTTCCTTTCGCTTTCGA;

OGR22 : TGTCAACAGCATTCCAGTATGGCAACAGGGTA;

OGR23 : TGAAGAGGGCGTTTGCACCACAAAGAGTG;

OGR24 : AAGGGGAGAAGCTTGACCCCAACGGCC;

OGR25 : TTGAAAGCAGTCTGGTTGGCCTTTCTTGA; oGR26:TGTGGTGCAAACGCCCTCTTCATATTTGAA; oGR27 : CCCTGTTGCCATACTGGAATGCTGTTGAC; oGR28 :AAGGAAGGGGCACGCCTTTAGTGACTGTAAG

OGR29 : CTTGCCTTGTCCCTCTCCCGTGATCGTGA;

For the Discosoma species: oGR39 : GGAGAAGGAGAAGGAAAACCATACGAGGG; oGR40 : CCAGTACGGCAACAGGGCATTCACCAAAT;

OGR41 : GGGAAAGAACCATGAATTTTGAAGACGGG;

OGR42 : CCCCCCATTGGCCCAGTTATGCAGAAGAA;

OGR43 : GCCAATGGGGGGAAAGTTCGCACCATCAA; OGR44 : CGCCCCCGTCTTCAAAATTCATGGTTCTT :

OGR45 : CCTGTTGCCGTACTGGAACGCTGTTGTCA; oGR46 : GGGAAGTCTTATGATGGCACCAATACCG;

OGR47 : TTCAGGTAACCAAGGGTGGACCTCTGCCA;

OGR48 : TGTCAGGCATCCCGAAGACATCGCTGATT : oGR49 : CATGCACTTTGAAGACGGTGGCGTGTGT ; OGR50 : TCATTGGTGATACAACACACGCCACCGTC; OGR51 : CATGACCCTTTCCCATGTAAATCCTTCGGGA; OGR52 : TTGTGGTGACAAAATAGGCCAAGCAAATGGC; oGR53 : GAAATAAAAGGCGACGGTCACGGGAAGCC; OGR54 : CATGGTAACCAAGGGTGGACCCCTGCCAT; oGR55 : AAANCTGTCGTTTCCCGAGGGATTTACAT; OGR56 : TGGCGTGATTTGCAGCNCCAATGATATCA; OGR57 : CGCCACCGNCTTCAAAGTGCATGACCCTT; ^""~^"oGR58:ANCGGCTATGTCTTCAGGGTGCTTGACAA

OGR59 : GGTCCACCCTTGGTTACCATGAGCTTGACGTT .

Following primer combinations are to be envisaged: oGR21/oGR20, oGR22/oGR20, oGR23/oGR20, oGR24/oGR20, oGR25/oGR30/OGR31, oGR26/oGR30/OGR31, oGR27/oGR30/OGR31, oGR28 /oGR30/OGR31, oGR29/oGR30/OGR31, oGR25/oGR16, oGR25/oGR18, oGR26/oGRl6, OGR26/OGR18, oGR27/oGR16, oGR27/oGR18, oGR28/oGRl6, oGR28/oGR18, oGR29/oGR16, oGR29/oGR18, oGR39/oGR20, oGR40/oGR20, oGR41/oGR20, oGR42/oGR20, oGR43/oGR30/OGR31, oGR44/oGR30/OGR31, oGR45/oGR30/OGR31, oGR43/oGR16, oGR43/oGRl8, oGR44/oGRl6, oGR44/oGRl8, oGR45/oGR16, oGR45 qGRl8 oGR46/oGR20, oGR47/oGR20, oGR48/oGR20, oGR49/oGR20, oGR50/oGR30/OGR31, oGR51/oGR30/OGR31, oGR52/oGR30/OGR31, oGR50/oGR16, oGR50/oGR18, oGR51/oGRl6, OGR51/OGR18, oGR52/oGR16, oGR52/oGR18, oGR53/oGR20, oGR54/oGR20, oGR55/oGR20, oGR56/oGR20, oGR57/oGR30/OGR31, oGR58/oGR30/OGR31, oGR59/oGR30/OGR31, oGR57/oGR16, oGR57/oGRl8,

OGR58/OGR16, oGR58/oGRl8, oGR59/oGR16, oGR59/oGR18

d) 3' and 5' RACE experiments To clone the full length cDNA encoding for the fluorescent proteins of the Polythoa species and the Discosoma species, 3' and 5' RACE experiments were performed. To facilitate these experiments additional cDNA was prepared. Starting from the RNA isolations as described above, new first strand cDNA synthesis was performed using the SMART PCR cDNA Synthesis Kit (Cat. NO. K1052-1; Clontech) . 3' RACE PCR, was performed according to the manufacturers instructions of the ^"""""SMART PCR cDNA Synthesis Kit. The 5' RACE ends of-t-he cDNA fragments were amplified using a step-out RACE strategy (Matz, M. et al . Amplification of cDNA ends based on template-switching effect and step-out PCR. Nucleic Acids Res. 27, 1558-1560 (1990)), or according to the manufacturers instructions of the SMART PCR cDNA Synthesis Kit.

The 3' ends of the Polythoa species were amplified in primary PCR reactions with the primer combinations oGRl-oGR20 and oGR2-oGR20. A sample of the primary PCR reaction was used as a template in nested PCR reactions using primer combinations oGR2- oGR20and oGR3-oGR20 respectively

The 3' ends of the Discosoma species were amplified in primary PCR reactions with the specific primer combination oGR39/oGR20 after which a nested

PCR was performed with primer combinations oGR40/oGR20 or oGR41/oGR20 or oGR42/oGR20. Primary PCR with primers combination oGR41/oGR20 was nested with oGR42/oGR20, and primary PCR reaction with primer combination oGR47/oGR20 was nested with primer combination oGR49/oGR20. Finally PCR reaction with primer combination oGR41/oGR20 was nested with oGR 2/oGR20 The primary PCR conditions were: 1' at 94 °C, 30 PCR cycles (30" at 94°C, V at 55°C and 5' at 68°C) followed by 5' at 68 °C

The PCR conditions of this nested PCR were as followed: 1' at 94°C followed by 35 cycles (30" at 94°C, 1' at 55°C and 5' at 72°C) and 5' at 72°C.

The 5' ends of the Polythoa species were amplified in primary PCRs with the specific 5' RACE primers combinations: oGR16/oGR28, oGRl6/oGR25, ^""^oGR16/oGR26, oGR16/oGR27, oGR16/oGR28 and oGR16/oGR29. The following PCR conditions were used: 1' at 94 °C, 20 PCR cycles (30" at 94°C, 1'30" at 72°C (- 0.2°C/cycle) ) , 20 PCR cycles (30" at 94°C and 1'30" at 68°C) followed by 5' at 68°C.

The 5' ends encoding for the Discosoma species fluorescent proteins were amplified according to the Step-Out PCR protocol as mentioned above. Primary PCRs with 5' RACE primers combinations oGR10/oGR30/oGR31 and nested with primers combinations oGRll/oGR30/oGR31 was performed.

Other primary PCR/ nested PCR combinations were: oGRll/oGR30/oGR31, nested with oGR12/oGR30/oGR31, oGR12/oGR30/oGR31, nested with oGRl3/oGR30/oGR31, oGR13/oGR30/oGR31, nested with oGR14/oGR30/oGR31, oGR43/oGR30/oGR31, nested with oGR44/oGR31 or oGR45/oGR31, oGR44/oGR30/oGR31, nested with oGR45/oGR31, oGR50/oGR30/oGR31, nested with oGR51/oGR31 or oGR52/oGR31, oGR51/oGR30/oGR31, nested with oGR52/oGR31, oGR52/oGR30/oGR31 oGR59/oGR30/oGR31 The primary and nested PCR conditions were: 1' at 94°C, 35 cycles of PCR (30" at 94°C, 1' at 55°C and 2 ' at 72°C) followed by 5' at 72°C. The 5' ends of the Discosoma species were also amplified using specific 5' RACE primers combinations oGR43/oGR16, oGR43/oGRl8, oGR44/oGR16, oGR44/oGR18, oGR45/oGR16, oGR45/oGRl8, oGR50/oGR16, oGR50/oGR18, oGR51/oGR16, oGR51/oGRl8, oGR52/oGR16, oGR52/oGR18 and oGR59/oGR16, oGR59/oGRl8. ^' The PCR conditions were an initial denaturatidn o,f-l' at 94°C, followed by 20 cycles of touch down PCR (30" at 94°C, 1' at 72°C (-0.2 °C/cycle) ) , followed by 20 cycles of PCR (30" at 94°C and 1' at 68°C) and 5' at 68°C.

All the resulting PCR products of the 3' and 5' RACE PCRs were analyzed on agarose gel and the appropriate DNA bands of interest were isolated and cloned into the pCR-XL-TOPO vector (Cat. NO. K4700-20; Invitrogen) and further analyzed by sequence analysis.

Primers oGR20, 0GRI6, 0GRI8, oGR30, oGR31 were provided by the manufacturers and encode for : OGR20 : GTAATACGACTCACTATAGGGCCGCAGTCGACCGTTTTTTTTTTTTT

0GRI6 AAGCAGTGGTATCAACGCAGAGT

0GRI8 :AAGCAGTGGTAACAACGCAGAGT

OGR30 : GTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT

OGR31: GTAATACGACTCACTATAGGGC

e) Cloning of full size cDNA encoding for fluorescent proteins from Anthozoa species. All cloning experiments were performed using standard protocols as provided by the manufacturers or as described by Ausubel et al. in Current Protocols in Molecular biology, ibid. Isolation of full length cDNA' s was also performed using the Titan One tube RT PCR System (Boeringer Mannheim) The reactions were performed according to the manufacturers instructions.

i) Cloning of full size Polythoa 1 GFP cDNA

PCR was performed using specific primer combinations oGR32/oGR34, oGR32/oGR35, oGR33/oGR34 and oGR33/oGR35, and other primer combinations as described above. The resulting fragments were isolated and cloned in appropriate vectors, mainly the pCR-XL- TOPO vector.

The resulting plasmid was designated pGR22 (using primer combination oGR33: CTTGGTGATTTGGGAGAAGGCAGATCGAG and oGR3 : CGTCTTGGCTTTTCGTTAAGCCTTTACTGGGG) .

Polythoa 1 GFP cDNA was amplified by PCR using plasmid DNA pGR22 as template and the primers: 0GR68 : CTGGAATTCTATTACTTTGAGTCTACCATCATGAGTGCAATT and oGR72: CGTATCTCGAGCGTCTTGGCTTTTCGTTAAGCCTTTACTGGGG. The resulting PCR products were analyzed by agarose gel electrophoresis and the DNA of interest was isolated and cloned into the pCR-XL-TOPO vector. The resulting plasmid was designated pGR26.

ii) Cloning of full size Polythoa 2 GFP cDNA:

To isolate the full size cDNA clone of the Polythoa species (here designated Polythoa 2) , the Titan One Tube RT-PCR System (Cat. NO. 1888382, Boehringer Mannheim) was used. The reactions were performed according to the manufacturers procedure, using specific primers OGR32 till oGR38. More particularly the following primer combinations were successful: oGR32/oGR34, oGR32/oGR35, oGR33/oGR34, oGR33/oGR35, oGR36/oGR37 and oGR36/oGR38.

^"r"oGR32: ACCTTGGTGATTTGGGAGAAGGCAGATCGAGAG; »*-

OGR33 : CTTGGTGATTTGGGAGAAGGCAGATCGAG;

OGR34 : CGTCTTGGCTTTTCGTTAAGCCTTTACTGGGG;

OGR35 : GAGAAACTTCTTTTTCACTTTGTTGTCGTCTTG; oGR36 : GACACTGGTGATTTGGGAGAAGGCAGATC; OGR37: ATTGCGAGCCACGGCAACTTCATACAGC;

OGR38: GCCATAATCTGAAGAGGAGAATTGCGAGCCAC) .

The resulting PCR products were analyzed by agarose gel electrophoresis and the DNA of interest was isolated and cloned into the pCR-XL-TOPO vector. The resulting plasmids were designated pGRl (using primers combination oGR32/oGR34) and pGR8 (using primers combination oGR36/oGR38)

iii) Cloning of full size Discosoma 1 GFP cDNA

As in the previous experiments, specific primers were designed based upon the available sequence information resulting from earlier PCR reactions and 3' and 5 ^Λ RACE PCR experiments. The isolation of a full length cDNA is analogous as described above.

iv) Cloning of full size Discosoma 2 GFP cDNA As in the previous experiments, specific primers were designed based upon the available sequence information resulting from earlier PCR reactions and 3' and 5 ^Λ RACE PCR experiments. The isolation of a full length cDNA is analogous as described above.

2) Cloning of new fluorescent proteins cDNA in expression vectors

a) Cloning of Polytho2 GFP cDNA in prokaryσtic expression vector:

Polythoa 2 GFP cDNA was amplified by PCR using plasmid DNA pGRl as template and the primers: oGR69:CTGGAATTCTCTACCGTCATGAGTGCAATTAAACCAGTCA and oGR70 : CGTATCTCGAGATTGCGAGCCACGGCAACTTCATACAGC . or by using plasmid DNA pGR8 as template and the primers 0GR68:

CTGGAATTCTATTACTTTGAGTCTACCATCATGAGTGCAATT and oGR72: CGTATCTCGAGCGTCTTGGCTTTTCGTTAAGCCTTTACTGGGG .

The PCR product was purified and digested with the restriction enzymes EcoRI and Xhol and cloned in EcoRI/XhoI cloning sites of the expression vector pET32A (Cat. NO. 69015-3; Novagen) , the resulting vectors were designated pGR3, and pGR7 respectively. The resulting expression in E. coli resulted in visual observation of the fluorescent protein, without induction or UV treatment indicating high expression levels or a fluorescent protein with a high emission amplitude .

b) Cloning of Polytho2 in eukaryotic expression vector: Polythoa 2 cDNA was amplified by PCR using plasmid DNA pGR8 as template, and the primers . combinations oGR69/oGR70 or oGR69/oGR71: OGR69 : CTGGAATTCTCTACCGTCATGAGTGCAATTAAACCAGTCA oGR70 : CGTATCTCGAGATTGCGAGCCACGGCAACTTCATACAGC . oGR71 : CGTATCTCGAGGCCATAATCTGAAGAGGAGAATTGCGAGCCAC The PCR product was purified and digested with the restriction enzymes EcoRI and Xhol and cloned in EcoRI/XhoI cloning sites of the expression vector pCDNA3 (Invitrogen), the resulting vectors were .,•-.«-- designated pGR4 and pGR5 respectively.

c) Cloning of Polytho2 in C. elegans expression vector:

Polythoa 2 cDNA was amplified by PCR using plasmid DNA pGRl as template, and the primers: OGR74 : CGTCGGCGCGCCACCACCATGAGTGCAATTAAGCCAGTTATGAA and oGR72: CGTATCTCGAGCGTCTTGGCTTTTCGTTAAGCCTTTACTGGGG .

The PCR product was purified and digested with the restriction enzymes EcoRI and Xhol and cloned in EcoRI/XhoI cloning sites of the expression vector pDW2700, the resulting vector was designated pGR6 .

d) Cloning of Polythoa 1 GFP cDNA in prokaryotic expression vector:

An 752bp EcoRI/XhoI fragment of pGR26 was isolated, purified and ligated into the EcoRI/XhoI cloning sites of the expression vector pCDNA3 (Invitrogen) . The resulting vector was designated pGR24. The resulting expression in COSI cells resulted in visual observation of the flurescent protein, after UV treatment. e) Cloning of Polythoa 1 GFP cDNA in eukaryotic expression vector:

An 752bp EcoRI/XhoI fragment of pGR26 was isolated, purified and ligated into the EcoRI/XhoI cloning sites of the expression vector pET32A (Cat. NO. 69015-3;

Novagen) . The resulting vector was designated pGR25.

3) Expression of new fluorescent proteins .

a) expression of Polythoa 2 GFP in E. coli— -

Expression in E.coli was performed according the instructions of the pET32A provider (Novagen) . Both the plasmids pGR3 and pGR7 resulted in clear expression in E. coli.

b) expression of Polythoa 2 GFP in Mammalian cells

COS I :African green monkey kidney cell line, standardly cultured in DMEM with Na-pyruvate supplemented with 10% fetal calf serum (Life Technologies) and antibiotics (Pen/Strep; Life Technologies), was transfected with pGR . The cells were seeded at a concentration of 1.5 x 10 cells/well in 24-well plate and 7.5 x 10⁴ cells/well in 1 well coverglass and trandsfected the day after with Lipofectamine Plus reagent (GibcoBRL 10964-013) , according to the manufacturers instructions. The following day, the cells where washed twice with PBS (Life Technologies) , and complete medium (1ml for 24-well, 3ml for coverglass) was added. Fluorescence of the cells after 24 hours was observed by using UV- light of the microscoop with filter 450-490 (FT510 ;LP520) . Both the plasmids pGR4 and pGR5 resulted in clear expression in Cos I cells

c) Expression of Polythoa 2 GFP in C. elegans.

C. elegans wild-type strain was transformed with pGR6 using microinjection techniques known in the art, and described in Methods in Cell Biology, Vol48: C. elegans, Modern biological analysis off an organism, ^""^~'"ed. by Epstein and Shakes. pGR6 resulted in clear _^ ,. expression of GFP in C. elegans .

4) Mutant fluorescent proteins

To further improve the characteristics of the isolated mutant fluorescent proteins, mutagenesis experiments were performed. Improvements of the fluorescent proteins can be of different nature, such as improved absorption spectra, improved emissions spectra, enhancement of the chromophore, etc.

Site directed mutagenesis can be performed as described in Current protocols in Molecular Biology, ed by Ausubel et al, or as provided in the by the QuickChange Site-Directed Mutagenesis Kit (Stratagene, CA, USA) or by related methods as known in the art. Random mutagenesis, and more particularly molecular evolution techniques can be performed as described by Kunchner and Arnold, 1997, tibtech 15:523-530; Stemmer, 1994, Nature 370:389-391; Stemmer, 1994, Proc. Natl. Acad. Sci. USA 91:10747-10751, or by related methods as known in the art. During the cloning of the full length cDNA' s in the vectors using PCR technology, mutant fluorescent proteins were created. More particularly the plasmids pGR3, pGR4, pGR5, and pGR8 contain a mutant Polythoa 2 N41D GFP, while plasmid pGR7 expresses a Polythoa 2 Q136R GFP mutant and pGRlO is expresses a I106T mutant. The expression experiments described above clearly indicate that mutations introduced in the newly isolated fluorescent proteins, conserves the basic fluorescence property of the protein. w

Back mutating towards natural occurring GFP

The mutation Q136R in pGR7 was remutagenised towards the natural occurring Polythoa 2 FP using the

QuikChange Site Directed Mutagenesis Kit and the primers

OGR90 : GACCCCAACGGCCCAATTATGCAGAAGAAGACCCTGAAATGGGAG and OGR91: CTCCCATTTCAGGGTCTTCTTCTGCATAATTGGGCCGTTGGGGTC. The resulting vector was designated pGRl3

5) Construction of a Polythoa 2-discosoma 1 hybrid GFP

a) Cloning of a Polythoa 2-discosoma 1 hybrid GFP cDNA in prokaryotic expression vector:

The 3 ' end of the Discosoma species was amplified in primary PCR reaction with the specific primer combination oGR39/oGR20 as mentioned above (see l)d). The resulting PCR products were analyzed on agarose gel and the appropriate DNA band of interest was isolated and cloned into the pCR-XL-TOPO vector (Cat. NO. K4700-20; Invitrogen) . The resulting vector was designated pGR17. Plasmid DNA of pGR17 was digested with the restriction enzymes EcoRV and Stul and analyzed on agarose gel. The appropriate band of 525bp was isolated and cloned into the 3736 bp EcoRV fragment of pGRl . The resulting vector was designated pGR14. The resulting expression in E.coli resulted in visual observation of the fluorescent protein,, after UV treatment. An 124bp EcoRI-Hindlll fragment of pCDNA3.1/hisA ( Invitrogen) was isolated, purifiad-and ligated into the 4212bp EcoRI-Hindlll fragment of pGRl4. The resulting vector was designated pGR15. The resulting expression in E.coli resulted in visual observation of the fluorescent protein, after UV treatment.

b) Cloning of a Polythoa 2-Discosoma 1 hybrid GFP cDNA in eukaryotic expression vector:

Polythoa 2 - Discosoma 1 hybrid cDNA was amplified by PCR using plasmid DNA pGRl4 as a template and the primers: oGR69:

CTGGAATTCTCTACCGTCATGAGTGCAATTAAACCAGTCA and OGR96: CGTACCTCGAGCCTTTACTTGGTCAGCCGGCTCGGCAGCTTGG. The PCR product was purified and cloned in the cloning vector pCR-XL-TOPO. ) . The resulting vector was designated pGR19. The 705 bp EcoRI/XhoI fragment of pGRl9 was isolated, purified and cloned in EcoRI/XhoI cloning sites of the expression vector pCDNA3 (Invitrogen) ) . The resulting vector was designated pGR18. The resulting expression in COSI cells resulted in visual observation of the fluorescent protein, after UV treatment . c) Cloning of a Polythoa 2-discosoma 1 hybrid GFP cDNA in C. elegans expression vector:

Polythoa 2 - Discosoma 1 hybrid cDNA was amplified by PCR using plasmid DNA pGRl4 as template, and the primer combination oGR75:

CGTCGGCGCGCCATCATGAGTGCAATTAAACCAGTCATGAAGAT and oGR96 : CGTACCTCGAGCCTTTACTTGGTCAGCCGGCTCGGCAGCTTGG . The PCR product was purified and cloned in the cloning vector pCR-XL-TOPO. The resulting vector was w- designated pGR21. The 700 bp Ascl/Xhol fragment of pGR21 was isolated, purified and cloned in the Ascl/Xhol cloning site of the expression vector pDW2700. The resulting vector was designated pGR20. The resulting expression in C. elegans resulted in visual observation of the fluorescent protein, after UV treatment .

6) Establishing the excitation and emission spectra of the new green fluorescent proteins

Isolation of protein from Polythoa 2 GFP, Polythoa2 N41D GFP and Polythoa 2-discosoma 2 fusion GFP.

The fluorescent proteins were expressed in E. coli from vector pGR3 (N41D) , pGR7 (Q136R) , pGR13 (back- mutation, natural occurring Polythoa 2 FP) , pGRl5 (Polythoa-discosoma hybrid protein) and purified using the BugBuster Protein Extraction Reagent (Cat. NO.: 70584-3; Novagen) and the His-Bind Buffer Kit (Cat. NO.: 69755-3; Novagen) according to the manufacturers instructions .

The excitation and emission spectra of the samples were then determined. All samples were excited at 490nm. The spectra were corrected for photomultiplierresponse and monochromator transmittance, transformed to wave number and integrated. All experiments were performed in a Amico Bowman Series 2 Luminescence spectrometer (SLM-Amico Spectronic instruments)

1) Synthetic Polythoa 2 Fluorescent protein with optimal codon usage for C . elegans .

To enhance the performance of the fluorescent proteins in organisms other than the Cnidaria species from which these fluorescent proteins were isolated, the codon usage was altered. Although the genetic code is considered to be universal, every organism has its preferred codon usage, which is related to the presence and the expression of tRNA genes, and hence is involved in post-transcriptional expression regulation. Such optimal codon usage has been ' determined for many organisms, including E. coli (Dong et al., 1996, J. Mol. Biol. 260:649-663), B. subtilis (Kanaya et al., 1999, Gene 238:143-155), Drosophila (Moriyama et al . , 1997, J. Mol. Evol. 45:514-523) Saccharomyces ( Percudani et al., 1997, J. Mol Biol.268:322-330) , C. elegans (Stenico, et al . , 1994, NAR 22:2437-2446). An overview of codon usage in these and other organisms can be found in Duret et al., 1999, Proc. Natl. Acad. Sci. U.S.A. 96: 4482-4487 and in Ikemura, 1985, Mol. Biol. Evol. 2:13-43.

The synthetic 922 bp gene was amplified using herculase-polymerase at Entechelon, Germany and was delivered as a ligation product. This product was cloned into pCR-XL-TOPO (pGRlδ) . The 888bp Fsel-Nhel fragment of pGRl6 was cloned into the Fsel/Nhel cloning sites of the expression vector pDW2721 and the resulting vector was designated pGRlO. This plasmid was injected in C. elegans, and clearly resulted in fluorescence

2) Synthetic introns in worm construct

In many organisms, such as in C.elegans, the introduction of synthetic introns results in enhancements of expression levels (Fire et al. , 1990, Gene 93:189-98, end references therein). An example is hereby included of a Polythoa 2 fluorescent protein improved for optimal codon usage for C. elegans and with synthetic C.elegans introns. Such synthetic genes can be made easily by a person skilled in the art, or be ordered by companies such as Entelechon, Rgensburg, Germany.

Fusion proteins

GFP proteins have been used for many purposes in biological research. The main use nevertheless has been the expression pattern of proteins in cells and multi-cellular organisms, and the subcellular localization or trafficking of proteins. To determine the expression pattern of a protein using GFP's it suffices in principle to make a fusion between the promoter of the gene of interest and the GFP. Upon introducing a vector with this promoter GFP fusion into the studied cell or organism, the expression induced by the promoter can easily be monitored by following the GFP expression. To monitor the subcellular expression of a protein, it suffices to make a fusion between the protein of interest and the GFP protein, this can be done at the N-terminal site or at the C-terminal site of the GFP protein, and even internal fusions are possible . Plasmids pGR3, pGR7 and pGR13 are good examples of such fusion proteins as they contain a 109 throredoxin Aminoacid fragment in fusion with the Polythoa 2 GFP. This fusion protein shows clear fluorescence.

TABLE 1

OGR50 TCATTGGTGATACAACACACGCCACCGTC

OGR51 CATGACCCTTTCCCATGTAAATCCTTCGGGA

OGR52 TTGTGGTGACAAAATAGGCCAAGCAAATGGC

0GR53 GAAATAAAAGGCGACGGTCACGGGAAGCC

OGR54 CATGGTAACCAAGGGTGGACCCCTGCCAT

OGR55 AAAN CTGTCGTTTCCCGAGGGATTTAC AT

OGR56 TGGCGTGATTTGCAGCNCCAATGATATCA

OGR57 CGCCACCGNCTTCAAAGTGCATGACCCTT

OGR58 ANCGGCTATGTCTTCAGGGTGCTTGACAA

OGR59 GGTCCACCCTTGGTTACCATGAGCTTGACGTT

0GR68 CTGGAATTCTATTACTTTGAGTCTACCATCATGAGTGCAATT

OGR69 CTGGAATTCTCTACCGTCATGAGTGCAATTAAACCAGTCA

OGR70 CGTATCTCGAGATTGCGAGCCACGGCAACTTCATACAGC

OGR71 CGTATCTCGAGGCCATAATCTGAAGAGGAGAATTGCGAGCCAC

OGR72 CGTATCTCGAGCGTCTTGGCTTTTCGTTAAGCCTTTACTGGGG

OGR74 CGTCGGCGCGCCACCACCATGAGTGCAATTAAGCCAGTTATGAA

OGR75 CGTCGGCGCGCCATCATGAGTGCAATTAAACCAGTCATGAAGAT

OGR90 GACCCCAACGGCCCAATTATGCAGAAGAAGACCCTGAAATGGGAG

0GR91 CTCCCATTTCAGGGTCTTCTTCTGCATAATTGGGCCGTTGGGGTC

OGR96 CGTACCTCGAGCCTTTACTTGGTCAGCCGGCTCGGCAGCTTGG

OGR97 CGTACCTCGAGGATGGATCCTTTACTTGGTCAGCCG

Tabe 2 Primer combinations

Claims

CLAIMS :

1. An isolated nucleic acid molecule encoding a fluorescent protein comprising an amino acid sequence illustrated in any of the polypeptide sequences of figures, 3(a) to 3(d) or functional equivalents, fragments or variants thereof.

2. An isolated nucleic acid molecule encoding a protein capable of emitting fluorescence upon *^■■<^• -^■ irradiation by incident light, wherein said maximal absorbance of said incident light is in the range 440- 480 nm, and maximal fluorescence emission is in the range 470-510 nm.

3. An isolated nucleic acid molecule according to claim 2, wherein said molecule encodes ^'a protein having an amino acid sequence as depicted in any of the polypeptide sequences of Figures 3 (a) to 3 (d) .

4. An isolated nucleic acid molecule according to claim 1 wherein said fluorescent protein comprises an amino acid sequence having combined polypeptide sequences from at least 2 of the polypeptide sequences depicted in Figures 3(a) to 3(d).

5. An isolated nucleic acid molecule according to claim 4 wherein said protein comprises a Polythoa 2-Discosoma 1 hybrid having the sequence illustrated in Figure 7.

6. An isolated nucleic acid molecule encoding a fusion protein comprising an amino acid sequence depicted in any of Figures 3(a) to 3(d) together with a nucleotide sequence encoding a protein of interest.

7. An isolated nucleic acid molecule according to claim 6 wherein said fusion protein comprises the amino acid sequences depicted in Figures 4 and 5.

8. An isolated nucleic acid molecule according to claim 5 wherein said protein of interest is an antibody. «•^•*--

9. An isolated nucleic acid molecule according to any of claims 1 to 8, which is a DNA molecule.

10. An isolated nucleic acid molecule according to claim 9, wherein said DNA molecule is cDNA.

11. An isolated nucleic acid molecule according to any of claims 1 to 10, which is derived from an Anthozoa species.

12. An isolated nucleic acid molecule according to claim 11, wherein said Anthozoa species is any of a Polythoa or Discosoma species.

13. An isolated nucleic acid molecule according to any preceding claim, wherein said molecule comprises a nucleotide sequence which has at least 70, preferably at least 80, more preferably at least 90 and even more preferably at least 95% sequence identity to the nucleic acid sequences depicted in Figure 1.

14. An isolated nucleic acid molecule according to any preceding claim, wherein said nucleic acid molecule comprises any of the nucleic acid sequences depicted in Figure 1.

15. An isolated nucleic acid molecule according to claim 13 comprising any of the nucleotide sequences depicted in Figure 2(a) or 2(b).

16. An antisense molecule capable of ■*-^■•— hybridising to a nucleic acid molecule according to any of claims 1 to 13, under conditions of high stringency.

17. An isolated fluorescent protein or functional equivalent, derivative or variant thereof encoded by a nucleic acid molecule according to any of claims 1 to 13.

18. An isolated fluorescent protein capable of emitting fluorescence upon irradiation by incident light wherein the maximal absorbance of said incident light is in the range 440-480 nm, and maximal fluorescence emission is in the range 470-510 nm.

19. An isolated fluorescent protein comprising an amino acid sequence which has at least 70, preferably at least 80, more preferably at least 90 and even more preferably at least 95% sequence identifying to the amino acid sequence depicted in Figures 3 to 8.

20. An isolated fluorescent protein comprising an amino acid sequence corresponding substantially the polypeptide sequences depicted in any of Figures 3 to

21. An isolated fusion fluorescent protein comprising a fluorescent protein according to any of claims 16 to 20 together with the amino acid sequence of a protein or polypeptide of interest.

22. A fluorescently labelled antibody or a paratope thereof coupled to a fluorescent protein— ~ according to any of claims 16 to 20.

23. An expression vector comprising any of the nucleic acid molecules according to claims 1 to 15.

24. An expression vector comprising any of the plasmid sequences depicted in Figures 9 to 14.

25. An expression vector comprising the sequences of any of plasmids pGR8 to pGR20.

26. A host cell transformed or transfected with an expression vector according to any of claims 23 to 25.

27. A prokaryotic cell transformed or transfected with any of expression vectors pGR3, pGR7 depicted in Figures 9 and 13 or pGR13.

28. A prokaryotic cell according to claim 25 which is E . coli .

29. A eukaryotic cell transformed or transfected with an expression vector corresponding substantially to the plasmids designated pGR4 or PGR5 in Figures 10 or 11.

30. A transgenic cell tissue or non-human organism comprising a transgene capable of expressing a fluorescent protein according to any of claims 17 to 21 or an antibody according to claim 22.

31. A transgenic cell, tissue or non-human organism according to claim 30, wherein said tran-sg-ene is included in an expression vector.

32. A transgenic cell, tissue or non-human organism according to claim 31, wherein said vector is one according to claim 23.

33. A transgenic cell, tissue or non-human organism wherein said non-human organism is C-elegans and said transgene substantially corresponds to a nucleotide sequence as depicted in Figure 12.

34. A fluorescent protein, or a functional equivalent, derivative or bioprecursor thereof, expressed by a cell, tissue or organism according to any of claims 27 to 33.

35. A process for producing the protein of any one of claims 17 to 21, comprising the steps of cultivating a cell tissue or organism according to any of claims 24 to 33 under conditions suitable for expression of the protein and optionally recovering the expressed protein.

36. An oligonucleotide probe comprising at least about 10 nucleotides of a nucleotide sequence that is capable of selectively hybridising to a nucleic acid molecule according to any of claims 1 to 15.

37. A method for selecting cells capable of expressing a protein of interest, comprising introducing into said cells a vector comprising the nucleotide sequence of a fluorescent protein acco-rding to any of claims 17 to 22 operatively linked to a promoter or regulatory region of the protein of interest, cultivating the cell under conditions necessary for expressing the protein of interest and monitoring for any fluorescence following expression of said fluorescent protein.

38. A method for producing fluorescence resonance energy transfer comprising; providing a donor molecule comprising a fluorescent protein according to any of claims 17 to

21; providing an appropriate acceptor molecule for the fluorescent protein; and bringing the donor molecule and acceptor molecule into sufficiently close contact to allow fluorescent resonance energy transfer.

39. A method for producing fluorescence resonance energy transfer comprising; providing an acceptor molecule comprising a fluorescent protein according to any of claims 17 to 21; providing an appropriate donor molecule for the fluorescent protein; and bringing the donor molecule and acceptor molecule into sufficiently close contact to allow fluorescence resonance energy transfer.

40. A microscopic nematode comprising a transgene capable of expressing a fluorescent protein according to any of claims 17 to 20.

41. A nematode according to claim 40 which is C. elgans .

42. A fluorescent protein obtainable from the coral species Anthozoa.

43. A fluorescent protein according to claim 41 which is obtainable from Discosoma or Polythoa.

44. A fluorescent protein according to claim 42 or 43 which is capable of emitting fluorescence upon irradiation by incident light wherein the maximal absorbance of said incident light is in the range 440- 480 nm, and maximal fluorescence emission is in the range 470-510 nm.

45. A fluorescent protein according to claim 42 or 43 comprising an amino acid sequence which has at least 70, preferably at least 80, more preferably at least 90 and even more preferably at least 95% sequence identifying to the amino acid sequence depicted in Figures 3 to 8