WO2002036623A2 - Ghep, a gene highly expressed in normal and neoplastic prostate, and uses therefor - Google Patents

Abstract

The invention provides a Gene Highly Expressed in Prostate ('GHEP'). The gene is found in normal and neoplastic prostate, and encodes two short proteins, one 34 amino acids ('ghep34') in length and one 35 amino acids in length ('ghep35'). Detection of the transcript or of the proteins in tissues other than the prostate, liver, or salivary gland is indicative of prostate cancer. The nucleic acids, proteins, and immunogenic fragments thereof can be used to raise an immune response to prostate cancer. The invention further provides methods of detecting the proteins or the gene transcript in a biological sample. If the biological sample is from a tissue other than the prostate, liver or salivary gland, detection of either of the protein or of the gene transcript is indicative of the presence of prostate cancer in the subject from whom the sample was taken. The invention further provides antibodies which specifically recognize ghep34 and antibodies which specifically recognize ghep35, as well as kits for the detection of one or both of the proteins in a sample.

Description

GHEP, A GENE HIGHLY EXPRESSED IN NORMAL AND NEOPLASTIC PROSTATE, AND USES THEREFOR

CROSS-REFERENCES TO RELATED APPLICATIONS

This application claims priority from U.S. Provisional Patent Application 60/239,413, filed October 10, 2000, the contents of which are hereby incorporated by reference.

STATEMENT AS TO RIGHTS TO INVENTIONS MADE UNDER

FEDERALLY SPONSORED RESEARCH AND DEVELOPMENT

Not applicable.

BACKGROUND OF THE INVENTION

Two types of immunotherapy are currently being intensively pursued for the treatment of cancer. One is the development of antibodies that recognize cell surface antigens. These antibodies can be useful by themselves or can be armed with radioisotopes, drugs or toxins to kill cancer cells. The second approach is to develop vaccines that target intracellular proteins presented as peptides on the cell surface bound to the major histo-compatability complex. For these therapies to be effective it is important that the antigen is present on tumor cells and is not expressed on essential normal cells such as liver, heart, brain or kidney. Recent work has focused on the identification of new differentiation antigens that are present in normal prostate and continue to be expressed in prostate cancer. One approach has been to use the EST database to identify genes which appear to be specifically expressed in the prostate See, Vasmatzis, G., et al., Proc. Natl. Acad. Sci. USA., 95:300-304 (1998). Not all of the clusters of ESTs identified by Vasmatzis et al. appeared to identify proteins.

SUMMARY OF THE INVENTION

The invention relates to the discovery of a Gene Highly Expressed in Prostate, or "GHEP," that encodes two short proteins, one of which is 34 amino acids in length ("ghep34") (SEQ ID NO:3) and one of which is 35 amino acids in length ("ghep35") (SEQ ID NO:5). The two proteins are expressed from the same reading frame, but start from two different start codons. Since the gene is highly expressed in the prostate, and very slightly in the liver and the salivary gland, detection of the gene transcript or of ghep34 or ghep35 in a sample from a tissue other than the prostate, liver or salivary gland is indicative of a GHEP-expressing cancer.

Accordingly, the invention provides an isolated polypeptide comprising an amino acid sequence selected from the group consisting of a ghep34 protein ("ghep34," SEQ ID NO: 3), an immunogenic fragment thereof, a polypeptide with at least 90% sequence identity to ghep34 and which is specifically recognized by an antibody which specifically recognizes gheρ34, and a polypeptide which has at least 90 % sequence identity with ghep34 and which, when processed and presented in the context of Major Histocompatibility Complex molecules, activates T lymphocytes against cells which express ghep34. In a preferred embodiment, the isolated polypeptide comprises the sequence of ghep34. The polypeptide can also comprise the sequence of an immunogenic fragment of ghep34. In some embodiments, the isolated polypeptide has at least 90% sequence identity to ghep34 and is specifically recognized by an antibody which specifically recognizes ghep34. In another group of embodiments, the polypeptide has at least 90 % sequence identity with ghep34 and, when processed and presented in the context of Major Histocompatibility Complex molecules, activates T lymphocytes against cells which express ghep34. Any of these polypeptides can be in a pharmaceutically acceptable carrier.

In another large group of embodiments, the invention provides an isolated polypeptide comprising an amino acid sequence selected from the group consisting of a ghep35 protein ("ghep35," SEQ ID NO:5), an immunogenic fragment thereof, a polypeptide with at least 90% sequence identity to ghep35 and which is specifically recognized by an antibody which specifically recognizes ghep35, and a polypeptide which has at least 90 % sequence identity with ghep35 and which, when processed and presented in the context of Major Histocompatibility Complex molecules, activates T lymphocytes against cells which express ghep35. In preferred embodiments, the polypeptide comprises the sequence of ghep35 or the sequence of an immunogenic fragment of ghep35. Further, in some embodiments, the polypeptide can have at least 90% sequence identity to ghep35 and be specifically recognized by an antibody which specifically recognizes ghep35, and in others can have at least 90 % sequence identity with ghep35 and, when processed and presented in the context of Major Histocompatibility Complex molecules, can activate T lymphocytes against cells which express ghep35. Any of these polypeptides can be in a pharmaceutically acceptable carrier.

In another set of embodiments, the invention provides an isolated, recombinant nucleic acid molecule comprising a promoter from a gene other than GHEP operatively linked to a nucleotide sequence selected from the group consisting of: a nucleotide sequence encoding a polypeptide having the amino acid sequence of a ghep34 protein ("ghep34") (SEQ ID NO:3), an immunogenic fragment thereof, a polypeptide with at least 90% sequence identity to ghep34 and which is specifically recognized by an antibody which specifically recognizes ghep34, and a polypeptide which has at least 90 % sequence identity with ghep34 and which, when processed and presented in the context of Major Histocompatibility Complex molecules, activates T lymphocytes against cells which express ghep34.

In yet another set of embodiments, the invention provides an isolated, recombinant nucleic acid molecule comprising a promoter from a gene other than GHEP operatively linked to a nucleotide sequence selected from the group consisting of: a nucleotide sequence encoding encoding a polypeptide having the amino acid sequence of a ghep35 protein ("ghep35") (SEQ ID NO:5), a nucleotide sequence encoding an immunogenic fragment of ghep35, a nucleotide sequence encoding a polypeptide with at least 90%) sequence identity to ghep35 and which is specifically recognized by an antibody which specifically recognizes ghep35, and a nucleotide sequence encoding a polypeptide which has at least 90 % sequence identity with ghep35 and which, when processed and presented in the context of Major Histocompatibility Complex molecules, activates T lymphocytes against cells which express ghep35.

The invention further provides host cells comprising an expression vector comprising a promoter other than a promoter from a GHEP gene operatively linked to a nucleotide sequence encoding a protein or peptide selected from the group consisting of: ghep34 (SEQ ID NO:3), an immunogenic fragment thereof, a polypeptide with at least 90% sequence identity to ghep34 and which is specifically recognized by an antibody which specifically recognizes ghep34, an immunogenic fragment of ghep34, and a polypeptide with at least 90% sequence identity to ghep34 and which is specifically recognized by an antibody which specifically recognizes ghep34.

In addition, the invention provides host cells comprising an expression vector comprising a promoter, other than a promoter from a GHEP gene, operatively linked to a nucleotide sequence encoding a protein or peptide selected from the group consisting of: ghep35 (SEQ ID NO: 5), an immunogenic fragment thereof, a polypeptide with at least 90% sequence identity to ghep35 and which is specifically recognized by an antibody which specifically recognizes ghep35, an immunogenic fragment of ghep35, and a polypeptide with at least 90% sequence identity to ghep35 and which is specifically recognized by an antibody which specifically recognizes ghep35.

In yet another group of embodiments, the invention provides the use of a composition for the manufacture of a medicament for activating T lymphocytes against cells expressing ghep 34 (SEQ ID NO:3), which composition is selected from the group consisting of: an isolated polypeptide having the amino acid sequence of ghep34, an immunogenic fragment thereof, a polypeptide with at least 90% sequence identity to ghep34 and which is specifically recognized by an antibody which specifically recognizes ghep34, a polypeptide which has at least 90 % sequence identity with ghep34 and which, when processed and presented in the context of Major Histocompatibility Complex molecules, activates T lymphocytes against cells which express ghep34, an isolated nucleic acid encoding one of these polypeptides, an antigen presenting cell pulsed with a polypeptide comprising an epitope of ghep34, an antigen presenting cell sensitized in vitro to ghep34, an antigen presenting cell sensitized in vitro to an immunogenic fragment of ghep34, an antigen presenting cell sensitized in vitro to a polypeptide with at least 90% sequence identity to ghep34 which is specifically recognized by an antibody which specifically recognizes ghep34, and an antigen presenting cell sensitized in vitro to polypeptide which has at least 90 % sequence identity with ghep34 which, when processed and presented in the context of Major Histocompatibility Complex molecules, activates T lymphocytes against cells which express ghep34.

In another important group of embodiments, the invention provides a method of activating T lymphocytes against cells expressing ghep34 (SEQ ID NO:3), the method comprising administering to a subject a composition, which composition is selected from the group consisting of: an isolated polypeptide having the amino acid sequence of ghep34, an immunogenic fragment thereof, a polypeptide with at least 90% sequence identity to ghep34 and which is specifically recognized by an antibody which specifically recognizes ghep34, a polypeptide which has at least 90 % sequence identity with ghep34 and which, when processed and presented in the context of Major Histocompatibility Complex molecules, activates T lymphocytes against cells which express ghep34, an isolated nucleic acid encoding one of these polypeptides, an antigen presenting cell pulsed with a polypeptide comprising an epitope of ghep34, an antigen presenting cell sensitized in vitro to ghep34, an antigen presenting cell sensitized in vitro to an immunogenic fragment of ghep34, an antigen presenting cell sensitized in vitro to a polypeptide with at least 90% sequence identity to ghep34 which is specifically recognized by an antibody which specifically recognizes ghep34, and an antigen presenting cell sensitized in vitro to polypeptide which has at least 90 % sequence identity with ghep34 which, when processed and presented in the context of Major Histocompatibility Complex molecules, activates T lymphocytes against cells which express ghep34. In preferred embodiments, the method comprises administering the polypeptide, immunogenic fragment, or sensitized T lymphocyte to a subject who suffers from prostate cancer. The T lymphocytes can be CD8+ cells sensitized in vitro to an epitope of a ghep34 protein. The method can include co-administering to the subject an immune adjuvant selected from a non-specific immune adjuvant, subcellular microbial product and fraction, a hapten, an immunogenic protein, an immunomodulator, an interferon, a thymic hormone and a colony stimulating factor. The method can comprise comprising admimstering an expression vector that expresses a polypeptide comprising an epitope of a ghep34 protein, which expression vector is in a recombinant bacterial cell, or which is in an autologous recombinant cell. The CD8+ cells can be Tc cells, and specifically can be tumor infiltrating lymphocytes.

In yet another group of embodiments, the invention provides the use of a composition for the manufacture of a medicament for activating T lymphocytes against cells expressing ghep 35 (SEQ ID NO:5), which composition is selected from the group consisting of: an isolated polypeptide having the amino acid sequence of ghep35, an immunogenic fragment thereof, a polypeptide with at least 90% sequence identity to ghep35 and which is specifically recognized by an antibody which specifically recognizes ghep35, a polypeptide which has at least 90 % sequence identity with ghep35 and which, when processed and presented in the context of Major Histocompatibility Complex molecules, activates T lymphocytes against cells which express ghep35, an isolated nucleic acid encoding one of these polypeptides, an antigen presenting cell pulsed with a polypeptide comprising an epitope of ghep35, an antigen presenting cell sensitized in vitro to ghep35, an antigen presenting cell sensitized in vitro to an immunogenic fragment of ghep35, an antigen presenting cell sensitized in vitro to a polypeptide with at least 90% sequence identity to ghep35 which is specifically recognized by an antibody which specifically recognizes ghep35, and an antigen presenting cell sensitized in vitro to polypeptide which has at least 90 % sequence identity with ghep35 which, when processed and presented in the context of Major Histocompatibility Complex molecules, activates T lymphocytes against cells which express ghep35.

In another aspect, the invention provides a method of activating T lymphocytes against cells expressing ghep35 (SEQ ID NO:5), the method comprising administering to a subject a composition, which composition is selected from the group consisting of: an isolated polypeptide having the amino acid sequence of ghep35, an immunogenic fragment thereof, a polypeptide with at least 90% sequence identity to ghep35 and which is specifically recognized by an antibody which specifically recognizes ghep35, a polypeptide which has at least 90 % sequence identity with ghep35 and which, when processed and presented in the context of Major Histocompatibility Complex molecules, activates T lymphocytes against cells which express ghep35, an isolated nucleic acid encoding one of these polypeptides, an antigen presenting cell pulsed with a polypeptide comprising an epitope of ghep35, an antigen presenting cell sensitized in vitro to ghep35, an antigen presenting cell sensitized in vitro to an immunogenic fragment of ghep35, an antigen presenting cell sensitized in vitro to a polypeptide with at least 90% sequence identity to ghep35 which is specifically recognized by an antibody which specifically recognizes ghep35, and an antigen presenting cell sensitized in vitro to polypeptide which has at least 90 % sequence identity with ghep35 which, when processed and presented in the context of Major Histocompatibility Complex molecules, activates T lymphocytes against cells which express ghep35. In some preferred embodiments, the method comprises administering to the subject gheρ35 or an immunogenic fragment thereof. In preferred embodiments, the composition is administered to a subject who suffers from prostate cancer. The administration can comprise sensitizing CD8+ cells in vitro to an epitope of a ghep35 protein and administering the sensitized cells to the subject. The method can further comprise co- administering to the subject an immune adjuvant selected from a non-specific immune adjuvant, a subcellular microbial product or fraction, a hapten, an immunogenic protein, an immunomodulator, an interferon, a thymic hormone, and a colony stimulating factor. The method can comprise administering an antigen presenting cell pulsed with a polypeptide comprising an epitope of ghep35. The method can comprise administering a nucleic acid sequence encoding a polypeptide comprising an epitope of ghep35, which nucleic acid is in a recombinant virus. The method can also comprise administering a nucleic acid sequence encoding a polypeptide comprising an epitope of a ghep35 protein. In other forms, the method can comprise administering an expression vector that expresses a polypeptide comprising an epitope of a ghep35 protein, which expression vector is in a recombinant bacterial cell or which is in an autologous recombinant cell. The CD8+ cells can be Tc cells, and specifically can be tumor infiltrating lymphocytes.

The invention further provides a method for determining whether a subject has a ghep35-expressing cancer, comprising taking a cell sample from said subject from a site other than the prostate, and determining whether a cell in said sample contains a nucleic acid transcript encoding ghep35 (SEQ ID NO: 5), or detecting ghep35 produced by translation of the transcript, whereby detection of the transcript or of the protein in said sample indicates that the subject has a ghep35-expressing cancer. The method can involve, for example, contacting RNA from the cell with a nucleic acid probe that specifically hybridizes to the transcript under hybridization conditions, and detecting hybridization, or disrupting the cell and contacting some or all of the cell contents with a chimeric molecule comprising a targeting moiety and a detectable label, wherein the targeting moiety specifically binds to ghep35, and detecting the label bound to the ghep35. In preferred embodiments, the sample is a serum sample.

The invention also provides antibodies to ghep34 (SEQ ID NO:3) and ghep35 (SEQ ID NO:5). The antibodies can specifically binds to an epitope of a protein selected from the group consisting of ghep34, an immunogenic fragment thereof, a polypeptide with at least 90% sequence identity to ghep34 and which is specifically recognized by an antibody which specifically recognizes ghep34, and a polypeptide which has at least 90 % sequence identity with ghep34 and which, when processed and presented in the context of Major Histocompatibility Complex molecules, activates T lymphocytes against cells which express ghep34. The antibody can bear a detectable label. The invention also provides antibodies that specifically bind to an epitope of a protein selected from the group consisting of ghep35, an immunogenic fragment thereof, a polypeptide with at least 90% sequence identity to ghep35 and which is specifically recognized by an antibody which specifically recognizes ghep35, and a polypeptide which has at least 90 % sequence identity with ghep35 and which, when processed and presented in the context of Major Histocompatibility Complex molecules, activates T lymphocytes against cells which express ghep35. These antibodies, too, can bear a detectable label. In preferred embodiments, the detectable label is a radiolabel.

The invention also provides kits for the detection of one or more cells expressing ghep34 (SEQ ID NO:3) in a sample. The kit can comprise a container and an antibody which specifically recognizes ghep34. Further, the invention provides kits for the detection of one or more cells which express ghep35 (SEQ ID NO: 5) in a sample. These kits comprise a container and an antibody which specifically recognizes ghep35.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1. The GHEP composite cluster of EST sequences. The main cluster of 19 ESTs is about 520 nucleotides in length. Two diverting EST sequences are shown at the bottom of the schematic picture.

Figure 2. Sequence of the GHEP transcript. The sequence of the transcript (SEQ ID NO: 1) is 511 nucleotides long. Indicated are the two longest possible open reading frames, ORF1 and ORF2. Also indicated, in the lower case letters starting from the position designated as "-10" are the 10 extra base pairs found by 5'RACE (the 10 extra bases are SEQ ID NO:23). The ATGs are underlined. Also underlined is the polyadenylation signal at the end of the sequence.

Figure 3. In vitro translation of the GHEP transcript (TNT wheat germ translation system, Promega). SDS-PAGE analysis 16.5% gels (Tris-Tricine, BioRad). Figure 3 A. Overview of the deletions and mutations that were made. ORF1 was destroyed by conversion of ATG to ATA. ORF2 was destroyed by conversion to ATG to ACG. Figure 3B. 4kDa band is present when constructs 1, 2 and mutant 2 are used as templates but not with construct 3 or mutant 2. The lane for construct 3 is from the same gel as the four lanes on the left. The two lanes on the right (Mut 1 and Mut 2) are from a separate gel run in parallel. Figure 4. Results of RT-PCR on total RNA from 9 different normal and cancer prostate samples. The expected size of the GHEP PCR product is 375 bp. GHEP was present in 5 of 5 cancer samples and in 4 of 4 normal prostate samples. The amount of loaded actin PCR product was 10 times less than the amount of GHEP product. Lanes 1 - 4 are normal samples and 5 - 9 cancer samples, M indicates DNA ladder.

DETAILED DESCRIPTION

INTRODUCTION

A. GHEP, ghep proteins, and their uses

EST database analysis previously revealed a cluster of ESTs that appeared to be specific to prostate (Vasmatzis, G., et al., Proc. Natl. Acad. Sci. USA., 95:300-304 (1998)). Cluster 1 of the apparent ESTs was assumed not to possess a functional reading frame because all the putative open reading frames were very small. It was considered possible that the ESTs represented a regulatory or a structural RNA.

Surprisingly, it has now been discovered that although the open reading frames are very small, the gene represented by EST cluster 1 identified in Vasmatzis et al. encodes two proteins, one 34 amino acids in length (SEQ ID NO:3) and the other 35 amino acids (SEQ ID NO:5) in length. Since the gene is highly and specifically expressed in normal prostate cells and prostate cancer cells, it has been named "GHEP," for "Gene Highly Expressed in Prostate." The gene also has extremely low expression in salivary gland and liver; the expression of the gene in the prostate is estimated to be more than 100 times the expression in the salivary gland and about 1000 times more than expression in the liver. GHEP is located on chromosome 4 at 4q21. There is no evidence in the literature that this locus is abnormal in prostate cancer.

For convenience, the 34 amino acid and the 35 amino acid proteins encoded by GHEP are referred to herein as "ghep34" and "ghep35," respectively. The amino acid sequences of ghep34 (SEQ ID NO:3) and ghep35 (SEQ ID NO:5) are shown in Figure 2. The ORF (SEQ ID NO:2) encoding ghep34 starts at nucleotide +23 (first underlined "ATG"), with the amino acid sequence shown in IUPAC-IUB single letter code immediately below the nucleotide sequence. The ORF (SEQ ID NO:4) encoding ghep35 starts at nucleotide +96 (second underlined "ATG"), with the amino acid sequence of ghep35 shown on the second line below. GHEP expression was detected in RNA expressed from both normal prostate, benign prostate hyperplasia (BPH) and non-metastatic prostate cancer samples, and it is also expressed in metastatic cancer. Ghep34 and ghep35 are generally found intracellularly, although they are also sometimes secreted by the cell. The prostate specificity of GHEP (SEQ ID NO: 1) creates a number of opportunities for in vitro and in vivo uses. First, antibodies raised against the proteins can be used in in vitro assays to detect the presence of cells expressing GHEP in a sample. For example, detection of GHEP or of ghep34 or ghep35 in cells taken from tissues other than the prostate, salivary gland or liver would be indicative of the presence of a GHEP- expressing cancer in the subject. The diagnosis can be confirmed by knowledge of the site from which the sample was taken, histologic and morphologic features of the cells, and other routine diagnostic criteria. Further, the prostate is often removed in the course of standard prostate cancer treatment. Detection of cells expressing significant levels of GHEP in a biological sample from a patient whose prostate has been removed (typically, such samples are not taken from the liver or the salivary gland) would indicate either that the cancer has spread or that the treatments administered to the patient up to the point in time at which the sample was taken had not succeeded in eradicating the cancer.

Further, a heterologous promoter can be operatively linked to a nucleotide sequence encoding ghep34, ghep35, or both, to express quantities of ghep34, ghep35 or both. Such constructs can, for example, be placed into host cells. Ghep34 or ghep35, immunogenic fragments of those proteins, nucleic acids encoding ghep34 or ghep35, or immunogenic fragments thereof can also be used in vitro to activate cytotoxic T lymphocytes ("CTLs") derived from a subject to attack cells of GHEP-expressing cancers when infused into the subject. Exemplary heterologous promoters which may be linked to nucleic acids encoding ghep34, ghep35 or immunogenic fragments thereof are set forth in the section on expression vectors below.

Ghep34 or ghep35, immunogenic fragments of these proteins, nucleic acids encoding these proteins, or immunogenic fragments thereof, can be administered to a subject, typically in a pharmaceutically acceptable carrier, to raise or to heighten an immune response to an GHEP-expressing cancer. Such compositions can be administered therapeutically to individuals who have been diagnosed as suffering from an GHEP expressing cancer.

Additionally, because of the specificity of the expression of GHEP. the promoter can be used to target gene therapy to the prostate. (Nettelbeck, D. M., et al, Trends Genet, 16:174-181 (2000)). Conveniently, the first 200 nucleotides upstream of the start of the coding region can be used, although larger or smaller sections of the sequence upstream of the start site can be used. Preferably at least about the first 25 nucleotides upstream of the start codon are present and more preferably at least about the first 50 nucleotides upstream of the start site are present. Use of the promoter region of GHEP is particularly useful for targeting gene therapy to inhibit the growth of prostate cancer cells. In preferred embodiments, the GHEP promoter is operatively linked to a nucleic acid sequence encoding a protein toxin, such as a Pseudomonas exotoxin ("PE") modified to delete non-specific binding. Such constructs can, for example, be injected into prostate cancer tumors which cannot be removed surgically, allowing cells expressing the construct to be be killed by the toxin, thereby slowing or stopping progression of the disease. A considerable literature exists on the construction and use of constructs of regulatory genes linked to protein toxins and other molecules intended to have an effector function.

B. Studies on GHEP expression and structure

When in vitro transcription and translation studies were performed, a strong band around 4 kDa in size was discovered. The first ATG in the sequence is the preferred start site for synthesis, but there is not a perfect Kozak sequence (Kozak, M., Cell, 44:283-292 (1986)) associated with this ATG. This is the ATG used for translation initiation because when it was deleted or contained a point mutation, the 4 kDa peptide was not produced. This results in the expression of the 34 amino acid protein. Some cells, however, express the 35 amino acid protein which is synthesized from the second ATG. The proteins are usually found intracellularly, but can also be secreted.

Analysis of the amino acid sequence of ghep34 reveals that it contains a CCXXY motif (SEQ ID NO:6) and an unusually large number of amino acid repeats. The conotoxin family of proteins has similar sequence characteristics (Safo, P., et al., J. Neurosci., 20:76-80 (2000)). The results from the northern blot experiment and the subsequent finding that the sequence of the 3' extending EST (ncl6a06) corresponds perfectly with the 3' sequence obtained from the genomic PAC clone, prove that the two larger bands in the northern blot (the 1500 and 2300 base bands) contain alternative polyadenylations of the GHEP transcript. Alternative polyadenylations have been found in many other genes (Liu, et al., Biochem. Biophys. Res. Commun., 264:833-839 (1999); Bussemakers, M. J., et al., Cancer Res., 59:5975-5979 (1999)). The function of the extended 3' end has yet to be determined.

DEFINITIONS

Unless defined otherwise, all technical and scientific terms used herein have the meaning commonly understood by a person skilled in the art to which this invention belongs. The following references provide a general definition of many of the terms used in this invention: Singleton et al. , DICTIONARY OF MICROBIOLOGY AND

MOLECULAR BIOLOGY (2d ed. 1994); THE CAMBRIDGE DICTIONARY OF SCIENCE AND

TECHNOLOGY (Walker ed., 1988); THE GLOSSARY OF GENETICS, 5TH ED., R. Rieger et al. (eds.), Springer Verlag (1991); and Hale & Marham, THE HARPER COLLINS DICTIONARY OF BIOLOGY (1991). As used herein, the following terms have the meanings ascribed to them unless specified otherwise.

Reference to "GHEP" (that is, when printed in capital letters) refers to the GHEP gene and "ghep34" and ghep35" (that is, when printed in lower case) refer to the proteins encoded by the GHEP gene. The entire sequence of the GHEP transcript (SEQ ID NO:l) is set forth in Figure 2. "Gheρ34" refers to a 34-amino acid protein (SEQ ID NO:3) expressed from the GHEP gene. The nucleic acid sequence (SEQ ID NO:2) encoding the protein and the amino acid sequence (SEQ ID NO:3) of the protein, are shown in Figure 2. The nucleic acid sequence encoding ghep34 starts with nucleotide +23 of the GHEP transcript shown in Figure 2; the amino acid sequence starts at the methionine encoded by the codon commencing at base +23 of that sequence.

"Ghep35" refers to a 35-amino acid protein (SEQ ID NO:5) expressed from the GHEP gene. The nucleic acid sequence (SEQ ID NO:4) encoding the protein and the amino acid sequence of the protein (SEQ ID NO:5), are set forth in Figure 2. The nucleic acid sequence encoding ghep35 starts with nucleotide +96 of the GHEP transcript shown in Figure 2; the amino acid sequence starts at the methionine encoded by the codon commencing at base +96 of that sequence.

As used herein, an "immunogenic fragment" of ghep34 or of ghep35 refers to a portion of ghep34 or of ghep35, respectively, which, when presented by a cell in the context of a molecule of the Major Histocompatibility Complex in a T-cell activation assay, can activate a T-lymphocyte against a cell expressing GHEP. Typically, such fragments are 7 to 30 amino acids in length, more commonly are 8 to 20 amino acids in length, and typically are 8 to 12 contiguous amino acids of ghep34 or ghep35 in length.

In the context of comparing one polypeptide to another, "sequence identity is determined by comparing the sequence of ghep34 or ghep35, respectively, as the reference sequence, to a test sequence. Typically, the two sequences are aligned for maximal or optimal alignment. Alignment and sequence comparisons are discussed further below.

A "ligand" is a compound that specifically binds to a target molecule. A "receptor" is compound that specifically binds to a ligand.

"Cytotoxic T lymphocytes" ("CTLs") are important in the immune response to tumor cells. CTLs recognize peptide epitopes in the context of HLA class I molecules that are expressed on the surface of almost all nucleated cells.

Tumor-specific helper T lymphocytes ("HTLs") are also known to be important for maintaining effective antitumor immunity. Their role in antitumor immunity has been demonstrated in animal models in which these cells not only serve to provide help for induction of CTL and antibody responses, but also provide effector functions, which are mediated by direct cell contact and also by secretion of lymphokines (e.g., IFNγ and TNF-α). "Antibody" refers to a polypeptide ligand comprising at least a light chain or heavy chain immunoglobulin variable region which specifically recognizes and binds an epitope (e.g., an antigen). This includes intact immunoglobulins and the variants and portions of them well known in the art such as, Fab' fragments, F(ab)'₂ fragments, single chain Fv proteins ("scFv"), and disulfide stabilized Fv proteins ("dsFv"). An scFv protein is a fusion protein in which a light chain variable region of an immunoglobulin and a heavy chain variable region of an immunoglobulin are bound by a linker. The term also includes genetically engineered forms such as chimeric antibodies (e.g., humanized murine antibodies), heteroconjugate antibodies (e.g., bispecific antibodies). See also, Pierce Catalog and Handbook, 1994-1995 (Pierce Chemical Co., Rockford, IL); Kuby, J., Immunology, 3^rd Ed., W.H. Freeman & Co., New York (1997).

An antibody immunologically reactive with a particular antigen can be generated by recombinant methods such as selection of libraries of recombinant antibodies inphage or similar vectors, see, e.g., Huse, et al, Science 246:1275-1281 (1989); Ward, et al., Nature 341:544-546 (1989); and Vaughan, et al., Nature Biotech. 14:309-314 (1996), or by immunizing an animal with the antigen or with DNA encoding the antigen.

"Epitope" or "antigenic determinant" refers to a site on an antigen to which B and/or T cells respond. Epitopes can be formed both from contiguous amino acids or noncontiguous amino acids juxtaposed by tertiary folding of a protein. Epitopes formed from contiguous amino acids are typically retained on exposure to denaturing solvents whereas epitopes formed by tertiary folding are typically lost on treatment with denaturing solvents. An epitope typically includes at least 3, and more usually, at least 5 or 8-10 amino acids in a unique spatial conformation. Methods of determining spatial conformation of epitopes include, for example, x-ray crystallography and 2-dimensional nuclear magnetic resonance. See, e.g., Epitope Mapping Protocols in METHODS IN MOLECULAR BIOLOGY, Vol. 66, Glenn E. Morris, Ed (1996).

A ligand or a receptor "specifically binds to" a compound analyte when the ligand or receptor functions in a binding reaction which is determinative of the presence of the analyte in a sample of heterogeneous compounds. Thus, the ligand or receptor binds preferentially to a particular analyte and does not bind in a significant amount to other compounds present in the sample. For example, a polynucleotide specifically binds to an analyte polynucleotide comprising a complementary sequence and an antibody specifically binds under immunoassay conditions to an antigen analyte bearing an epitope against which the antibody was raised.

"Immunoassay" refers to a method of detecting an analyte in a sample in which specificity for the analyte is conferred by the specific binding between an antibody and a ligand. This includes detecting an antibody analyte through specific binding between the antibody and a ligand. See Harlow and Lane (1988) ANTIBODIES, A

LABORATORY MANUAL, Cold Spring Harbor Publications, New York, for a description of immunoassay formats and conditions that can be used to determine specific immunoreactivity.

"Vaccine" refers to an agent or composition containing an agent effective to confer a therapeutic degree of immunity on an organism while causing only very low levels of morbidity or mortality. Methods of making vaccines are, of course, useful in the study of the immune system and in preventing and treating animal or human disease. An "immunogenic amount" is an amount effective to elicit an immune response in a subject. A "targeting moiety" is the portion of an immunoconjugate intended to target the immunoconjugate to a molecule recognized by the targeting moiety. Typically, the targeting moiety is an antibody, a scFv, a dsFv, an Fab, or an F(ab')₂.

A "detectable label" means, with respect to an immunoconjugate, a portion of the immunoconjugate which has a property rendering its presence detectable. For example, the immunoconjugate may be labeled with a radioactive isotope which permits cells in which the immunoconjugate is present to be detected in immunohistochemical assays.

The term "effector moiety" means the portion of an immunoconjugate intended to have a function other than targeting of the conjugate to a cell or molecule of interest. As used herein, an effector moiety is a detectable label, such as a radiolabel or a fluorescent label.

The term "immunoconjugate" includes reference to a covalent linkage of an effector molecule to an antibody. The terms "effective amount" or "amount effective to" or "therapeutically effective amount" with reference to a vaccine embodiment includes reference to a dosage of the vaccine sufficient to raise a detectable immune response in the subject. Preferably, the immune response is effective in reducing the proliferation of cancer cells or in inhibiting the growth of cancer cells present in a subject. Assays for determining humoral and cellular immune responses to an immunogenic formulation are well known in the art.

The term "contacting" includes reference to placement in direct physical association.

An "expression plasmid" comprises a nucleotide sequence encoding a molecule or interest, which is operably linked to a promoter. As used herein, a "heterologous promoter" in reference to ghep34 or ghep35 means a promoter from a gene other than GHEP. In preferred embodiments, the heterologous promoter is capable of driving high expression of a ghep protein in a host cell, such as a prokaryotic cell. In preferred embodiments, the heterologous promoter is capable of driving high expression in a eukaryotic expression system, such as yeast, Sf-9 cells, CHO cells, or cells from non-human primates. Numerous promoters and expression systems appropriate for the promoters are known in the art.

As used herein, the term "anti-ghep" in reference to an antibody, includes reference to an antibody which is generated against ghep34 or ghep35. In a particularly preferred embodiment, the antibody is generated against human ghep34 or ghep35 synthesized by a non-primate mammal after introduction into the animal of cDNA which encodes a human ghep protein.

"Polypeptide" refers to a polymer composed of amino acid residues, related naturally occurring structural variants, and synthetic non-naturally occurring analogs thereof linked via peptide bonds, related naturally occurring structural variants, and synthetic non-naturally occurring analogs thereof. Synthetic polypeptides can be synthesized, for example, using an automated polypeptide synthesizer. The term

"protein" typically refers to large polypeptides. The term "peptide" typically refers to short polypeptides. Conventional notation is used herein to portray polypeptide sequences: the left-hand end of a polypeptide sequence is the amino-terminus; the right-hand end of a polypeptide sequence is the carboxyl-terminus.

"Fusion protein" refers to a polypeptide formed by the joining of two or more polypeptides through a peptide bond formed by the amino terminus of one polypeptide and the carboxyl terminus of the other polypeptide. A fusion protein may is typically expressed as a single polypeptide from a nucleic acid sequence encoding the single contiguous fusion protein. However, a fusion protein can also be formed by the chemical coupling of the constituent polypeptides.

"Conservative substitution" refers to the substitution in a polypeptide of an amino acid with a functionally similar amino acid. The following six groups each contain amino acids that are conservative substitutions for one another:

1) Alanine (A), Serine (S), Threonine (T);

2) Aspartic acid (D), Glutamic acid (E);

3) Asparagine (N), Glutamine (Q); 4) Arginine (R), Lysine (K);

5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); and

6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W). See also, Creighton, PROTEINS, W.H. Freeman and Company, New York (1984).

Two proteins are "homologs" of each other if they exist in different species, are derived from a common genetic ancestor and share at least 70% amino acid sequence identity.

"Substantially pure" or "isolated" means an object species is the predominant species present (i.e., on a molar basis, more abundant than any other individual macromolecular species in the composition), and a substantially purified fraction is a composition wherein the object species comprises at least about 50% (on a molar basis) of all macromolecular species present. Generally, a substantially pure composition means that about 80% to 90% or more of the macromolecular species present in the composition is the purified species of interest. The object species is purified to essential homogeneity (contaminant species cannot be detected in the composition by conventional detection methods) if the composition consists essentially of a single macromolecular species. Solvent species, small molecules (<500 Daltons), stabilizers (e.g., BSA), and elemental ion species are not considered macromolecular species for purposes of this definition. "Nucleic acid" refers to a polymer composed of nucleotide units

(ribonucleotides, deoxyribonucleotides, related naturally occurring structural variants, and synthetic non-naturally occurring analogs thereof) linked via phosphodiester bonds, related naturally occurring structural variants, and synthetic non-naturally occurring analogs thereof. Thus, the term includes nucleotide polymers in which the nucleotides and the linkages between them include non-naturally occurring synthetic analogs, such as, for example and without limitation, phosphorothioates, phosphoramidates, methyl phosphonates, chiral-methyl phosphonates, 2-O-methyl ribonucleotides, peptide-nucleic acids (PNAs), and the like. Such polynucleotides can be synthesized, for example, using an automated DNA synthesizer. The term "oligonucleotide" typically refers to short polynucleotides, generally no greater than about 50 nucleotides. It will be understood that when a nucleotide sequence is represented by a DNA sequence (i.e., A, T, G, C), this also includes an RNA sequence (i.e., A, U, G, C) in which "U" replaces "T."

Conventional notation is used herein to describe nucleotide sequences: the left-hand end of a single-stranded nucleotide sequence is the 5'-end; the left-hand direction of a double-stranded nucleotide sequence is referred to as the 5'-direction. The direction of 5' to 3' addition of nucleotides to nascent RNA transcripts is referred to as the transcription direction. The DNA strand having the same sequence as an mRNA is referred to as the "coding strand"; sequences on the DNA strand having the same sequence as an mRNA transcribed from that DNA and which are located 5' to the 5'-end of the RNA transcript are referred to as "upstream sequences"; sequences on the DNA strand having the same sequence as the RNA and which are 3' to the 3' end of the coding RNA transcript are referred to as "downstream sequences."

" "cDNA" refers to a DNA that is complementary or identical to an mRNA, in either single stranded or double stranded form. "Encoding" refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an mRNA, to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (i.e., r NA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom. Thus, a gene encodes a protein if transcription and translation of mRNA produced by that gene produces the protein in a cell or other biological system. Both the coding strand, the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings, and non-coding strand, used as the template for transcription, of a gene or cDNA can be referred to as encoding the protein or other product of that gene or cDNA. Unless otherwise specified, a "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. Nucleotide sequences that encode proteins and RNA may include introns. "Recombinant nucleic acid" refers to a nucleic acid having nucleotide sequences that are not naturally joined together. This includes nucleic acid vectors comprising an amplified or assembled nucleic acid which can be used to transform a suitable host cell. A host cell that comprises the recombinant nucleic acid is referred to as a "recombinant host cell." The gene is then expressed in the recombinant host cell to produce, e.g., a "recombinant polypeptide." A recombinant nucleic acid may serve a non- coding function (e.g., promoter, origin of replication, ribosome-binding site, etc.) as well.

"Expression control sequence" refers to a nucleotide sequence in a polynucleotide that regulates the expression (transcription and/or translation) of a nucleotide sequence operatively linked thereto. "Operatively linked" refers to a functional relationship between two parts in which the activity of one part (e.g., the ability to regulate transcription) results in an action on the other part (e.g., transcription of the sequence). Expression control sequences can include, for example and without limitation, sequences of promoters (e.g., inducible or constitutive), enhancers, transcription terminators, a start codon (i.e., ATG), splicing signals for introns, and stop codons.

"Expression cassette" refers to a recombinant nucleic acid construct comprising an expression control sequence operatively linked to an expressible nucleotide sequence. An expression cassette generally comprises sufficient cis-acting elements for expression; other elements for expression can be supplied by the host cell or in vitro expression system.

"Expression vector" refers to a vector comprising an expression cassette. Expression vectors include all those known in the art, such as cosmids, plasmids (e.g., naked or contained in liposomes) and viruses that incorporate the expression cassette. Terms used to describe sequence relationships between two or more nucleotide sequences or amino acid sequences include "reference sequence," "selected from," "comparison window," "identical," "percentage of sequence identity," "substantially identical," "complementary," and "substantially complementary." For sequence comparison of nucleic acid sequences, typically one sequence acts as a reference sequence, to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters are used. Methods of alignment of sequences for comparison are well-known in the art. Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Nat 'I. Acad. Sci. USA 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and

TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI), or by manual alignment and visual inspection (see, e.g., Current Protocols in Molecular Biology (Ausubel et al., eds 1995 supplement)). One example of a useful algorithm is PILEUP. PILEUP uses a simplification of the progressive alignment method of Feng & Doolittle, J. Mol. Evol. 35:351-360 (1987). The method used is similar to the method described by Higgins & Sharp, CABIOS 5:151-153 (1989). Using PILEUP, a reference sequence is compared to other test sequences to determine the percent sequence identity relationship using the following parameters: default gap weight (3.00), default gap length weight (0.10), and weighted end gaps. PILEUP can be obtained from the GCG sequence analysis software package, e.g., version 7.0 (Devereaux et al., Nuc. Acids Res. 12:387-395 (1984).

Another example of algorithms that are suitable for determining percent sequence identity and sequence similarity are the BLAST and the BLAST 2.0 algorithm, which are described in Altschul et al, J. Mol. Biol. 215:403-410 (1990) and Altschul et al, Nucleic Acids Res. 25:3389-3402 (1977)). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/). The BLASTN program (for nucleotide sequences) uses as defaults a word length (W) of 11, alignments (B) of 50, expectation (E) of 10, M=5, N=-4, and a comparison of both strands. The BLASTP program (for amino acid sequences) uses as defaults a word length (W) of 3, and expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff & Henikoff, Proc. Natl Acad. Sci. USA 89:10915 (1989)).

"Stringent hybridization conditions" refers to 50% formamide, 5 x SSC and 1% SDS incubated at 42° C or 5 x SSC and 1% SDS incubated at 65° C, with a wash in 0.2 x SSC and 0.1% SDS at 65° C.

"Naturally-occurring" as applied to an object refers to the fact that the object can be found in nature. For example, an amino acid or nucleotide sequence that is present in an organism (including viruses) that can be isolated from a source in nature and which has not been intentionally modified by man in the laboratory is naturally-occurring.

"Linker" refers to a molecule that joins two other molecules, either covalently, or through ionic, van der Waals or hydrogen bonds, e.g., a nucleic acid molecule that hybridizes to one complementary sequence at the 5' end and to another complementary sequence at the 3' end, thus joining two non-complementary sequences. "Pharmaceutical composition" refers to a composition suitable for pharmaceutical use in a mammal. A pharmaceutical composition comprises a pharmacologically effective amount of an active agent and a pharmaceutically acceptable carrier.

"Pharmacologically effective amount" refers to an amount of an agent effective to produce the intended pharmacological result.

"Pharmaceutically acceptable carrier" refers to any of the standard pharmaceutical carriers, buffers, and excipients, such as a phosphate buffered saline solution, 5% aqueous solution of dextrose, and emulsions, such as an oil/water or water/oil emulsion, and various types of wetting agents and/or adjuvants. Suitable pharmaceutical carriers and formulations are described in REMINGTON'S

PHARMACEUTICAL SCIENCES, 19th Ed. (Mack Publishing Co., Easton, 1995). Preferred pharmaceutical carriers depend upon the intended mode of administration of the active agent. Typical modes of administration include enteral (e.g., oral) or parenteral (e.g., subcutaneous, intramuscular, intravenous or intraperitoneal injection; or topical, transdermal, or transmucosal administration). A "pharmaceutically acceptable salt" is a salt that can be formulated into a compound for pharmaceutical use including, e.g., metal salts (sodium, potassium, magnesium, calcium, etc.) and salts of ammonia or organic amines. A "subject" of diagnosis or treatment is a human or non-human mammal.

"Administration" of a composition refers to introducing the composition into the subject by a chosen route of administration. For example, if the chosen route is intravenous, the composition is administered by introducing the composition into a vein of the subject. "Treatment" refers to prophylactic treatment or therapeutic treatment.

A "prophylactic" treatment is a treatment administered to a subject who does not exhibit signs of a disease or exhibits only early signs for the purpose of decreasing the risk of developing pathology.

A "therapeutic" treatment is a treatment administered to a subject who exhibits signs of pathology for the purpose of diminishing or eliminating those signs.

"Diagnostic" means identifying the presence or nature of a pathologic condition. Diagnostic methods differ in their sensitivity and specificity. The "sensitivity" of a diagnostic assay is the percentage of diseased individuals who test positive (percent of true positives). The "specificity" of a diagnostic assay is 1 minus the false positive rate, where the false positive rate is defined as the proportion of those without the disease who test positive. While a particular diagnostic method may not provide a definitive diagnosis of a condition, it suffices if the method provides a positive indication that aids in diagnosis.

"Prognostic" means predicting the probable development (e.g., severity) of a pathologic condition.

PROTEINS SYNTHESIZED FROM GHEP

This invention provides isolated, recombinant proteins synthesized from GHEP. Two proteins can be expressed from GHEP. In in vitro translation experiments, cells preferentially synthesize a 34-amino acid protein which is termed herein ghep34. With reference to Figure 2, the amino acid sequence of ghep34 (SEQ ID NO:3) is shown commencing with the methionine residue encoded by the codon commencing at position 23 of the GHEP transcript (SEQ ID NO:l). Second, a 35-amino acid protein can be synthesized from GHEP. The sequence of this protein (SEQ ID NO: 5) is also shown in Figure 2, and commences with the methionine encoded by the codon which commences at base 96 of the GHEP transcript. The nucleotide sequences (SEQ ID NO:2 and SEQ ID NO:4, respectively) encoding the proteins are set forth above the respective amino acid sequences. Because of the degeneracy of the genetic code, persons of skill will recognize that numerous other nucleotide sequences could encode the same amino acid sequences. In certain embodiments, this invention provides polypeptides comprising an epitope comprising at least 5 to at least 15 consecutive amino acids from ghep34 or from ghep35, respectively. Such proteins bind to antibodies raised against full-length ghep34 or ghep35, respectively. In other embodiments, this invention provides fusion proteins comprising a first and second polypeptide moiety in which one of the polypeptide moieties comprises an amino acid sequence of at least 5 amino acids, and more preferably 6, 7, 8, or 9 amino acids identifying an epitope of ghep34 or ghep35. In some embodiments, the ghep moiety is all or substantially of ghep34 or ghep35. The other moiety can be, e.g., an immunogenic protein. Such fusions also are useful to evoke an immune response against ghep34 or ghep35, respectively. In preferred embodiments, the protein is ghep34, and the immune response is raised against cells expressing ghep34.

In other embodiments, this invention provides ghep34-like peptides ("ghep34 analogs") whose amino acid sequences are at least 90% identical to ghep34 (although they may have 91%, 92%, 93%, 94%, 95%, or even higher sequence identity to ghep34) and which are specifically bound by antibodies which specifically bind to ghep34. In preferred embodiments this invention provides ghep34-like peptides (also sometimes referred to herein as "ghep34-analogs") whose amino acid sequences are at least 90% identical to ghep34 (although they may have 91%, 92%, 93%, 94%, 95%, or even higher sequence identity to ghep34) and which activate T-lymphocytes to cells which express ghep34.

Similarly, in some embodiments, this invention provides ghep35-like peptides ("ghep35 analogs") whose amino acid sequences are at least 90% identical to (although they may have 91%, 92%, 93%, 94%, 95%, or even higher sequence identity to ghep35) and which are specifically bound by antibodies which specifically bind to ghep35. In preferred embodiments this invention provides ghep35-like peptides (also sometimes referred to herein as "ghep35-analogs") whose amino acid sequences are at least 90% identical to gheρ35 (although they may have 91%, 92%, 93%, 94%, 95%, or even higher sequence identity to ghep35) and which activate T-lymphocytes to cells which express ghep35.

In another embodiment, the polypeptide comprises an epitope that binds an MHC molecule, e.g., an HLA molecule or a DR molecule. These molecules bind polypeptides having the correct anchor amino acids separated by about eight or nine amino acids. These peptides can be identified by inspection of the amino acid sequence of ghep34 and by knowledge of the MHC binding motifs, well known in the art.

Ghep34, ghep35, immunogenic fragments of these proteins, and ghep34 and ghep35 analogs can be synthesized recombinantly. Immunogenic fragments of ghep34 and ghep35 and the full length proteins can also be chemically synthesized by standard methods. If desired, polypeptides can also be chemically synthesized by emerging technologies. One such process is described in W. Lu et al, Federation of European Biochemical Societies Letters.429:31-35 (1998).

GHEP NUCLEIC ACIDS

In one aspect this invention provides isolated, recombinant nucleic acid molecules comprising nucleotide sequences encoding the ghep34 and ghep35 proteins (see, e.g., Figure 2). The nucleic acids are useful for expressing ghep34 and ghep35, which can then be used, for example, to raise antibodies for diagnostic purposes. As noted, GHEP is translated as two proteins which have alternative start codons. The nucleic acid sequence (SEQ ID NO:2) encoding ghep34 commences with base 23 of the GHEP transcript (base 23 is noted as the first nucleotide underlined in Figure 2); the nucleic acid sequence (SEQ ID NO:4) encoding ghep35 commences with base 96 of the GHEP transcript shown in Figure 2; the ATG marking the start codon is underlined (the "ATG" denoting the start of the ghep35 protein is the second underlined ATG).

The practitioner can use these sequences to prepare PCR primers for isolating nucleotide sequences of the invention. Exemplary primers are set forth in the Examples, below. The sequences encoding ghep34 and ghep35 can be modified to engineer nucleic acids encoding related molecules of this invention using well known techniques.

A nucleic acid comprising sequences of the invention can be cloned or amplified by in vitro methods, such as the polymerase chain reaction (PCR), the ligase chain reaction (LCR), the transcription-based amplification system (TAS), the self- sustained sequence replication system (3SR) and the Qβ replicase amplification system (QB). For example, a polynucleotide encoding the ghep34 or the ghep35 protein can be isolated by polymerase chain reaction of cDNA using primers based on the DNA sequence of the molecule.

A wide variety of cloning and in vitro amplification methodologies are well-known to persons skilled in the art. PCR methods are described in, for example, U.S. Pat. No. 4,683,195; Mullis et al. (1987) Cold Spring Harbor Symp. Quant. Biol. 51 :263; and Erlich, ed., PCR TECHNOLOGY, (Stockton Press, NY, 1989). Polynucleotides also can be isolated by screening genomic or cDNA libraries with probes selected from the sequences of the desired polynucleotide under stringent hybridization conditions. Engineered versions of the nucleic acids can be made by site-specific mutagenesis of other polynucleotides encoding the proteins, or by random mutagenesis caused by increasing the error rate of PCR of the original polynucleotide with 0.1 mM MhCl₂ and unbalanced nucleotide concentrations.

A. Expression vectors

The invention provides expression vectors for expressing ghep34 and ghep35. Construction of an exemplary expression vector is discussed in the Examples, below. Expression vectors can be adapted for function in prokaryotes or eukaryotes by inclusion of appropriate promoters, replication sequences, markers, etc. for transcription and translation of mRNA. The construction of expression vectors and the expression of genes in transfected cells involves the use of molecular cloning techniques also well known in the art. Sambrook et al. , MOLECULAR CLONING - A LABORATORY MANUAL, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, (1989) and CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, F.M. Ausubel et al, eds., (Current Protocols, Greene Publishing Associates, Inc. and John Wiley & Sons, Inc.) ("Ausubel"). Usefiil promoters for such purposes include a metallothionein promoter, a constitutive adenovirus major late promoter, a dexamethasone-inducible MMTV promoter, a SV40 promoter, a MRP polIII promoter, a constitutive MPSV promoter, a tetracycline-inducible CMV promoter (such as the human immediate-early CMV promoter), and a constitutive CMV promoter. A plasmid useful for gene therapy can comprise other functional elements, such as selectable markers, identification regions, and other genes.

Expression vectors useful in this invention depend on their intended use. Such expression vectors must, of course, contain expression and replication signals compatible with the host cell. Expression vectors useful for expressing proteins and peptides of the invention include viral vectors such as retro viruses, adenoviruses and adeno-associated viruses, plasmid vectors, cosmids, and the like. Viral and plasmid vectors are preferred for transfecting mammalian cells. The expression vector pcDNA3 (Invitrogen, San Diego, CA), in which the expression control sequence comprises the CMV promoter, provides good rates of transfection and expression. Adeno-associated viral vectors are useful in gene therapy methods using the GHEP promoter to target high levels of expression of a desired protein to the prostate.

A variety of means are available for delivering polynucleotides to cells including, for example, direct uptake of the molecule by a cell from solution, facilitated uptake through lipofection (e.g. , liposomes or immunoliposomes), particle-mediated transfection, and intracellular expression from an expression cassette having an expression control sequence operably linked to a nucleotide sequence that encodes the inhibitory polynucleotide. See also U.S. Patent 5,272,065 (friouye et al); METHODS IN ENZYMOLOGY, vol. 185, Academic Press, Inc., San Diego, CA (D.V. Goeddel, ed.) (1990) or M. Krieger, GENE TRANSFER AND EXPRESSION ~ A LABORATORY MANUAL,

Stockton Press, New York, NY, (1990). Recombinant DNA expression plasmids can also be used to prepare the polynucleotides of the invention for delivery by means other than by gene therapy, although it may be more economical to make short oligonucleotides by in vitro chemical synthesis. The construct can also contain a tag to simplify isolation of the protein.

For example, a polyhistidine tag of, e.g., six histidine residues, can be incorporated at the amino terminal end of the protein. The polyhistidine tag allows convenient isolation of the protein in a single step by nickel-chelate chromatography.

B. Recombinant cells

The invention also provides recombinant cells comprising an expression vector for expression of the nucleotide sequences of this invention ("host cells"). Host cells can be selected for high levels of expression in order to purify the protein. The cells can be prokaryotic cells, such as E. coli, or eukaryotic cells. Useful eukaryotic cells include yeast and mammalian cells. The cell can be, e.g., a recombinant cell in culture or a cell in vivo.

Cells expressing ghep34 or ghep35 are useful for active or passive immunization of subjects against cells expressing these peptides. In certain embodiments, the cells are bacterial cells. In one version of active immunization, recombinant cells are autologous cells of the subject that can present the polypeptides in association with HLA molecules. For example, antigen presenting cells are useful for this purpose. In this case, it is preferable to use "autologous cells," that is, cells derived from the subject. Such cells are MHC compatible. The ghep34- or ghep35- encoding nucleotide sequence should be placed under the control of a constitutive promoter in such cells because one goal is to express the polypeptides in high density on the cell surface, preferably more densely than they are expressed in healthy testis cells.

METHODS OF ELICITING A CELL-MEDIATED IMMUNE RESPONSE AGAINST CELLS EXPRESSING GHEP

GHEP (SEQ ID NO: 1) is expressed by normal and malignant prostate cells. Therefore, GHEP can be used as a marker for cancer cells that have metastasized from prostate cancers. This invention also provides methods of raising an immune response against GHEP-expressing cancers. The methods involve immunizing a subject against ghep34 or ghep35, or both, or with nucleic acids encoding these proteins, thereby eliciting a cell-mediated immune response against cells expressing these proteins. Preferably, the immune response is sufficiently robust to slow or inhibit the growth of a GHEP-expressing cancer.

Immunization can be active or passive. In active immunization, the immune response is elicited in the subject in vivo. In passive immunization, Tc cells activated against a polypeptide are cultured in vitro and administered to the subject. Such methods may be expected to result in the destruction of healthy prostate tissue that expresses GHEP. However, the prostate is not an essential organ, and is often removed surgically in the normal course of treating prostate cancer. Thus, its removal in the course of GHEP-related immunofherapy must be balanced against the possibility of the loss of the subject's life from the cancer.

The immunizing agent can be full-length ghep34 (SΕQ ID NO:3) or ghep35 (SΕQ ID NO:5), a peptide comprising an antigenic determinant of ghep34 or ghep35, e.g., an immunogenic fragment of ghep34, or a protein or peptide that is substantially identical to ghep34 or ghep35. In preferred embodiments, the immunizing agent is full-length ghep34, an immunogenic fragment thereof, or a protein or peptide that is substantially identical to ghep34 (that is, which has 90% or more sequence identity to ghep34 and preferably about 95% or more sequence identity). When one is attempting to elicit a cell-mediated immune response against GHEP, preferred peptides comprising antigenic determinants are those peptides bearing a binding motif for an HLA molecule of the subject. These motifs are well known in the art. For example, HLA-A2 is a common allele in the human population. The binding motif for this molecule includes polypeptides with 9 or 10 amino acids having leucine or methionine in the second position and valine or leucine in the last positions. Given the very short sequences of ghep34 and ghep35, only a limited number of iterations are necessary to review and to test all possible 9 and 10 contiguous amino acids which can be formed from the proteins.

Based on the polypeptide sequence of ghep34 and ghep35, one can identify amino acid sequences bearing motifs for any particular HLA molecule. Peptides comprising these motifs can be prepared by any of the typical methods (e.g. , recombinantly, chemically, etc.). Because ghep34 and ghep35 are self proteins, the preferred amino acid sequences bearing HLA binding motifs are those that encode subdominant or cryptic epitopes. Those epitopes can be identified by a lower comparative binding affinity for the HLA molecule with respect to other epitopes in the molecule or compared with other molecules that bind to the HLA molecule.

Polypeptides that comprise an amino acid sequence from ghep34 or ghep35 that, in turn, comprise an HLA binding motif also are useful for eliciting an immune response. This is because, in part, such proteins will be processed by the cell into a peptide that can bind to the HLA molecule and that have a ghep34 or ghep35 epitope.

A complex of an HLA molecule and a peptidic antigen acts as the ligand recognized by HLA-restricted T cells (Buus, S. et al., Cell 47:1071 (1986); Babbitt, B. P. et al., Nature 317:359 (1985); Townsend, A. and Bodmer, H., Annu. Rev. Immunol. 7:601, 1989; Germain, R. N., Annu. Rev. Immunol. 11:403 (1993)). Through the study of single amino acid substituted antigen analogs and the sequencing of endogenously bound, naturally processed peptides, critical residues that correspond to motifs required for specific binding to HLA antigen molecules have been identified (see, e.g., Southwood, et al., J. Immunol. 160:3363 (1998); Rammensee, et al., Immunogenetics 41:178 (1995); Rammensee et al., Sette, A. and Sidney, J. Curr. Opin. Immunol. 10:478 (1998); Engelhard, V. H., Curr. Opin. Immunol. 6:13 (1994); Sette, A. and Grey, H. M., Curr. Opin. Immunol. 4:79, (1992)).

Furthermore, x-ray crystallographic analysis of HLA-peptide complexes has revealed pockets within the peptide binding cleft of HLA molecules which accommodate, in an allele-specific mode, residues borne by peptide ligands; these residues in turn determine the HLA binding capacity of the peptides in which they are present. (See, e.g., Madden, D.R. Annu. Rev. Immunol. 13:587, 1995; Smith, et al., Immunity 4:203, 1996; Fremont et al., Immunity 8:305, 1998; Stern et al., Structure 2:245, 1994; Jones, EN. Curr. Opin. Immunol. 9:75, 1997; Brown, J. H. et al., Nature 364:33, 1993.)

Accordingly, the definition of class I and class II allele-specifϊc HLA binding motifs, or class I or class II supermotifs allows identification of regions within ghep34 or ghep35 that have the potential of binding particular HLA molecules.

Molecules with high levels of sequence identity to ghep34 or ghep35 are also useful to elicit an immune response. Such molecules can be recognized as "foreign" to the immune system, yet generate antibodies or CTLs that cross react with ghep34 or ghep35. Analogs of ghep34 whose amino acid sequences are at least 90% identical to ghep34 (although they may have 91%, 92%, 93%, 94%, 95%, or even higher sequence identity to ghep34) and which are specifically bound by antibodies which specifically bind to ghep34 may be used. Further useful in this regard are ghep34 analogs, that is, peptides whose amino acid sequences are at least 90% identical to gheρ34 (although they may have 91%, 92%, 93%, 94%, 95%, or even higher sequence identity to ghep34) and which activate T-lymphocytes to cells which express ghep34. Similarly, analogs of ghep35 whose amino acid sequences are at least 90% identical to ghep35 (although they may have 91%, 92%, 93%, 94%>, 95%, or even higher sequence identity to ghep35) and which are specifically bound by antibodies which specifically bind to ghep34 may be used. Further useful in this regard are ghep35 analogs, that is, peptides whose amino acid sequences are at least 90% identical to ghep35 (although they may have 91%, 92%, 93%, 94%, 95%), or even higher sequence identity to ghep35) and which activate T- lymphocytes to cells which express ghep35.

Another molecule that is substantially homologous to a ghep34 or ghep35 antigenic determinant can be made by modifying the sequence of a natural ghep34 or ghep35 epitope so that it binds with greater affinity for the HLA molecule.

One method of identifying genes encoding antigenic determinants is as follows: TILs from a subject with metastatic cancer are grown and tested for the ability to recognize the autologous cancer in vitro. These TILs are administered to the subject to identify the ones that result in tumor regression. The TILs are used to screen expression libraries for genes that express epitopes recognized by the TILs. Subjects then are immunized with these genes. Alternatively, lymphocytes are sensitized in vitro against antigens encoded by these genes. Then the sensitized lymphocytes are adoptively transferred into subjects and tested for their ability to cause tumor regression. Rosenberg, et al., Immunol. Today 1997 18:175 (1997).

The application of these molecules is now described. These methods are also described in Rosenberg et al, supra, and Restifo et al, Oncology 11 :50 (1999). One method of invoking an immune response involves immunizing the subject with a polypeptide comprising an antigenic determinant from ghep34 or ghep35, either alone or, more preferably, combined with an adjuvant, such as Freund's incomplete adjuvant, lipids or liposomes, gp96, Hsp70 or Hsp90. The polypeptide can be ghep34 or ghep35, an antigenic fragment of ghep34 or ghep35, a fusion protein comprising the antigenic determinant, or a peptide comprising a sequence substantially identical to such an antigenic determinant.

Another method involves pulsing a polypeptide comprising an epitope from ghep34 or ghep35 onto antigen presenting cells and administering the cells to the subject.

In another method, a recombinant virus containing a nucleic acid sequence encoding a polypeptide comprising an antigenic determinant from ghep34 or ghep35 in an expression cassette is administered to the subject. The virus optionally also can encode cytokines (e.g., IL-2), a costimulatory molecule or other genes that enhance the immune response. The virus can be, for example, adenovirus, fowlpox virus or vaccinia virus. Upon infection, the infected cells will express the ghep34 or gheρ35 peptide and express the antigenic determinant on the cell surface in combination with the HLA molecule which binds peptides having the same motif as the antigenic determinant. These cells will then stimulate the activation of CTLs that recognize the presented antigen, resulting in destruction of cancer cells that also bear the determinant.

In another method, the subject is immunized with naked DNA encoding a polypeptide comprising an antigenic determinant from ghep34 or ghep35 by, e.g., intramuscular, biolistic injection or linked to lipids. Such methods have been shown to result in the stimulation of a cell-mediated response against cells that express the encoded polypeptide.

In another method, recombinant bacteria that express the epitope, such as Bacillus Calmette-Guerin (BCG), Salmonella oxListeria, optionally also encoding cytokines, costimulatory molecules or other genes to enhance the immune response, are administered to the subject. In another method, cells expressing the antigen are administered to the subject. This includes, for example, dendritic cells pulsed with ghep34 or ghep35 epitopes, cells transfected with polypeptides comprising ghep34 or ghep35 antigenic determinants, HLA and B7 genes. The multiple transfection results in the production of several components necessary for presenting the antigenic determinant on the cell surface. In one embodiment, the molecule is a fusion protein in which the polypeptide bearing the antigenic determinant is fused to an HLA molecule (usually through a linker) so as to improve binding of the peptide to the HLA molecule. In one embodiment, the cell is an antigen presenting cell. Preferably, the cells are eukaryotic cells, more preferably, mammalian cells, more preferably, human cells, more preferably autologous human cells derived from the subject.

In another method, antigen presenting cells (APCs) are pulsed or co- incubated with peptides comprising an epitope from ghep34 or ghep35 in vitro. These cells are used to sensitize CD8 cells, such as tumor infiltrating lymphocytes from prostate cancer tumors or peripheral blood lymphocytes. The TILs or PBLs preferably are from the subject. However, they should at least be MHC Class-I restricted to the HLA types the subject possesses. The sensitized cells are then administered to the subject.

In a supplemental method, any of these immunotherapies is augmented by admimstering a cytokine, such as IL-2, IL-3, IL-6, IL-10, IL-12, IL-15, GM-CSF, interferons.

In addition to the methods for evaluating immunogenicity of peptides set forth above, immunogenicity can also be evaluated by: evaluation of primary T cell cultures from normal individuals (see, e.g., Wentworth, P. A. et al., Mol. Immunol. 32:603, (1995); Celis, E. et al, Proc. Natl. Acad. Sci. USA 91:2105, (1994); Tsai, V. et al., J. Immunol. 158:1796 (1997); Kawashima, I. et al., Human Immunol. 59:1 (1998)); by immunization of HLA transgenic mice (see, e.g., Wentworth, P. A. et al., J. Immunol. 26:97, (1996); Wentworth, P. A. et al., Int. Immunol. 8:651 (1996); Alexander, J. et al., J. Immunol. 159:4753 (1997)), and by demonstration of recall T cell responses from patients who have been effectively vaccinated or who have a tumor; (see, e.g., Rehermann, B. et al., J. Exp. Med. 181:1047 (1995); Doolan, D. L. et al., Immunity 7:97, (1997); Bertoni, R. et al., J. Clin. Invest. 100:503 (1997); Threlkeld, S. C. et al., J. Immunol. 159:1648 (1997); Diepolder, H. M. et al., J. Virol. 71:6011 (1997)).

In choosing CTL-inducing peptides of interest for vaccine compositions, peptides with higher binding affinity for class I HLA molecules are generally preferable. Peptide binding is assessed by testing the ability of a candidate peptide to bind to a purified HLA molecule in vitro.

To ensure that a ghep34 or ghep35 analog when used as a vaccine, actually elicits a CTL response to ghep34 or ghep35 in vivo (or, in the case of class II epitopes, elicits helper T cells that cross-react with the wild type peptides), the ghep34 or ghep35 analog may be used to immunize T cells in vitro from individuals of the appropriate HLA allele. Thereafter, the immunized cells' capacity to induce lysis of ghep34- or ghep35- sensitized target cells is evaluated.

More generally, peptides from ghep34 or ghep35 or an analog thereof (a "peptide of the invention") can be synthesized and tested for their ability to bind to HLA proteins and to activate HTL or CTL responses, or both.

Conventional assays utilized to detect T cell responses include proliferation assays, lymphokine secretion assays, direct cytotoxicity assays, and limiting dilution assays. For example, antigen-presenting cells that have been incubated with a peptide can be assayed for the ability to induce CTL responses in responder cell populations.

PBMCs may be used as the responder cell source of CTL precursors. The appropriate antigen-presenting cells are incubated with peptide, after which the peptide- loaded antigen-presenting cells are then incubated with the responder cell population under optimized culture conditions. Positive CTL activation can be determined by assaying the culture for the presence of CTLs that kill radio-labeled target cells, both specific peptide-pulsed targets as well as target cells expressing endogenously processed forms of the antigen from which the peptide sequence was derived.

A method which allows direct quantification of antigen-specific T cells is staining with Fluorescein-labeled HLA tetrameric complexes (Altman et al., Proc. Natl. Acad. Sci. USA 90:10330 (1993); Altman et al, Science 274:94 (1996)). Alternatively, staining for intracellular lymphokines, interferon-γ release assays or ELISPOT assays, can be used to evaluate T-cell responses.

HTL activation may be assessed using such techniques known to those in the art such as T cell proliferation and secretion of lymphokines, e.g. IL-2 (see, e.g. Alexander et al., Immunity 1:751-761 (1994)). ANTIBODIES AGAINST GHEP34 AND GHEP35

Once ghep34 or ghep35 are expressed, antibodies which specifically bind to the proteins can be generated by conventional techniques, such as those described below. In preferred embodiments of the present invention, the anti- ghep34 or ghep35 antibody is a recombinant antibody such as a scFv or a disulfide stabilized Fv (dsFV) antibody. Fv antibodies are typically about 25 kDa and contain a complete antigen- binding site with 3 CDRs per heavy and light chain. If the VH and the V_L chain are expressed non-contiguously, the chains of the Fv antibody are typically held together by noncovalent interactions. These chains tend to dissociate upon dilution, however, so methods have been developed to crosslink the chains through glutaraldehyde, intermolecular disulfides, or a peptide linker.

In a particularly preferred embodiment, the antibody is a single chain Fv (scFv). The VH and the V_L regions of a scFv antibody comprise a single chain which is folded to create an antigen binding site similar to that found in two chain antibodies. Once folded, noncovalent interactions stabilize the single chain antibody. In a more preferred embodiment, the scFv is recombinantly produced. One of skill will realize that conservative variants of the antibodies of the instant invention can be made. Such conservative variants employed in scFv fragments will retain critical amino acid residues necessary for correct folding and stabilizing between the V_H and the V regions. The anti- ghep34 or ghep35 antibodies generated in the present invention can be linked to effector molecules (EM) through the EM carboxyl terminus, the EM amino terminus, through an interior amino acid residue of the EM such as cysteine, or any combination thereof. Similarly, the EM can be linked directly to the heavy, light, Fc (constant region) or framework regions of the antibody. Linkage can occur through the antibody's amino or carboxyl termini, or through an interior amino acid residue. Further, multiple EM molecules (e.g., any one of from 2-10) can be linked to the anti- ghep34 or ghep35 antibody and/or multiple antibodies (e.g., any one of from 2-5) can be linked to an EM. The antibodies used in a multivalent immunoconjugate composition of the present invention can be directed to the same or different ghep34 or ghep35 epitopes. In some embodiments of the present invention, the scFv antibody is directly linked to the EM through the light chain. However, scFv antibodies can be linked to the EM via its amino or carboxyl terminus.

While the VH and V_L regions of some antibody embodiments can be directly joined together, one of skill will appreciate that the regions may be separated by a peptide linker consisting of one or more amino acids. Peptide linkers and their use are well-known in the art. See, e.g., Huston, et al, Proc. Nat 'I Acad. Sci. USA 8:5879 (1988); Bird, et al, Science 242:4236 (1988); Glockshuber, et al, Biochemistry 29:1362 (1990); U.S. Patent No. 4,946,778, U.S. Patent No. 5,132,405 and Stemmer, et al, Biotechniques 14:256-265 (1993), all incorporated herein by reference. Generally the peptide linker will have no specific biological activity other than to join the regions or to preserve some minimum distance or other spatial relationship between them. However, the constituent amino acids of the peptide linker may be selected to influence some property of the molecule such as the folding, net charge, or hydrophobicity. Single chain Fv (scFv) antibodies optionally include a peptide linker of no more than 50 amino acids, generally no more than 40 amino acids, preferably no more than 30 amino acids, and more preferably no more than 20 amino acids in length. In some embodiments, the peptide linker is a concatamer of the sequence Gly-Gly-Gly-Ser (SEQ ID NO:7), preferably 2, 3, 4, 5, or 6 such sequences. However, it is to be appreciated that some amino acid substitutions within the linker can be made. For example, a valine can be substituted for a glycine.

A. Antibody Production

Methods of producing polyclonal antibodies are known to those of skill in the art. In brief, an immunogen, preferably isolated ghep34 or ghep35 or extracellular ghep34 or ghep35 epitopes are mixed with an adjuvant and animals are immunized with the mixture. When appropriately high titers of antibody to the immunogen are obtained, blood is collected from the animal and antisera are prepared. If desired, further fractionation of the antisera to enrich for antibodies reactive to the polypeptide is performed. See, e.g. , Coligan, CURRENT PROTOCOLS IN IMMUNOLOGY, Wiley/Greene, NY (1991); and Harlow & Lane, supra, which are incorporated herein by reference., A number of immunogens can be used to produce antibodies that specifically bind ghep34 or ghep35. Full-length ghep34 or ghep35 is a suitable immunogen. Typically, the immunogen of interest is a peptide of at least about 3 amino acids, more typically the peptide is at least 5 amino acids in length, preferably, the fragment is at least 10 amino acids in length and more preferably the fragment is at least 15 amino acids in length. The peptides can be coupled to a carrier protein (e.g., as a fusion protein), or are recombinantly expressed in an immunization vector. Antigenic determinants on peptides to which antibodies bind are typically 3 to 10 amino acids in length. Naturally occurring polypeptides are also used either in pure or impure form.

Monoclonal antibodies may be obtained by various techniques familiar to those skilled in the art. Description of techniques for preparing such monoclonal antibodies may be found in, e.g., Stites, et al (eds.) BASIC AND CLINICAL IMMUNOLOGY (4TH ED.), Lange Medical Publications, Los Altos, CA, and references cited therein; Harlow & Lane, supra; Goding, MONOCLONAL ANTIBODIES: PRINCIPLES AND PRACTICE (2D ED.), Academic Press, New York, NY (1986); Kohler & Milstein, Nature 256:495- 497 (1975); and particularly (Chowdhury, P.S., et al, Mol Immunol. 34:9 (1997)), which discusses one method of generating monoclonal antibodies.

It is prefeπed that monoclonal antibodies are made by immunizing an animal with the target antigen or with nucleic acid sequence that encodes the desired immunogen, such as ghep34 or ghep35. Immunization with non-replicating transcription units that encode a heterologous proteins elicits antigen specific immune responses. After translation into the foreign protein, the protein is processed and presented to the immune system like other cellular proteins. Because it is foreign, an immune response is mounted against the protein and peptide epitopes that are derived from it (Donnelly, et al, J. Immunol. Methods 176:145-152 (1994); and Boyer, et al, J. Med. Primatol 25:242-250 (1996)). This technique has two significant advantages over protein-based immunization. One is that it does not require the purification of the protein, which at best, is time consuming and in cases of many membrane proteins, is very difficult. A second advantage is that since the immunogen is synthesized in a mammalian host, it undergoes proper post-translational modifications and folds into the native structure.

To immunize with gheρ34- or ghep35-coding DNA, ghep34- or ghep35- coding cDNA is introduced into a plasmid so that transcription of the coding sequence is under the control of a promoter such as the CMV promoter. The plasmid is then injected into an animal, either subcutaneously, intradermally, intraperitoneally, etc. As a result, the ghep34 or ghep35 cDNA is transcribed in the animal into mRNA, ghep34 or ghep35 is translated from the mRNA, the translated protein undergoes proper post-translational modifications and is expressed on the surface of cells which synthesized ghep34 or ghep35. The animal raises antibodies to ghep34 or ghep35 and the sera is monitored for antibody titer.

Optionally, in addition to the coding region and regulatory elements, the plasmid carries an ampicillin resistance (Amp) gene. The Amp gene is known to have immunostimulatory sequences for Thl responses necessary for increased antibody production (Sato, et al, Science 273:352-354 (1996)).

As described above, in preferred embodiments, the monoclonal antibody is a scFv. Methods of making scFv antibodies have been described. See, Huse, et al, supra; Ward, et al. Nature 341:544-546 (1989); and Vaughan, et al, supra. In brief, mRNA from B- cells is isolated and cDNA is prepared. The cDNA is amplified by well known techniques, such as PCR, with primers specific for the variable regions of heavy and light chains of immunoglobulins. The PCR products are purified by, for example, agarose gel electrophoresis, and the nucleic acid sequences are joined. If a linker peptide is desired, nucleic acid sequences that encode the peptide are inserted between the heavy and light chain nucleic acid sequences. The sequences can be joined by techniques known in the art, such as blunt end ligation, insertion of restriction sites at the ends of the PCR products or by splicing by overlap extension (Chowdhury, et al, Mol Immunol. 34:9 (1997)). After amplification, the nucleic acid which encodes the scFv is inserted into a vector, again by techniques well known in the art. Preferably, the vector is capable of replicating in prokaryotes and of being expressed in both eukaryotes and prokaryotes.

In a prefeπed embodiment, scFv are chosen through a phage display library. The procedure described above for synthesizing scFv is followed. After amplification by PCR, the scFv nucleic acid sequences are fused in frame with gene III (gill) which encodes the minor surface protein glllp of the filamentous phage (Marks, et al, J. Biol Chem. 267:16007-16010 (1992); Marks, et al, Behringlnst. Mitt. 91:6-12 (1992); and Brinkmann, et al, J. Immunol Methods 182:41-50 (1995)). The phage express the resulting fusion protein on their surface. Since the proteins on the surface of the phage are functional, phage bearing ghep34- or ghep35- binding antibodies can be separated from non-binding or lower affinity phage by panning or antigen affinity chromatography (McCafferty, et al, Nature 348:552-554 (1990)).

In a preferred embodiment, scFv that specifically bind to ghep34 or ghep35 are found by panning. Panning is done by coating a solid surface with ghep34 or ghep35 and incubating the phage on the surface for a suitable time under suitable conditions. The unbound phage are washed off the solid surface and the bound phage are eluted. Finding the antibody with the highest affinity is dictated by the efficiency of the selection process and depends on the number of clones that can be screened and the stringency with which it is done. Typically, higher stringency corresponds to more selective panning. If the conditions are too stringent, however, the phage will not bind. After one round of panning, the phage that bind to ghep34 or ghep35 coated plates are expanded in E. coli and subjected to another round of panning. In this way, an enrichment of 2000-fold occurs in 3 rounds of panning. Thus, even when enrichment in each round is low, multiple rounds of panning will lead to the isolation of rare phage and the genetic material contained within which encodes the sequence of the highest affinity antibody. The physical link between genotype and phenotype provided by phage display makes it possible to test every member of a cDNA library for binding to antigen, even with large libraries of clones.

B. Binding Affinity of Antibodies

Binding affinity for a target antigen is typically measured or determined by standard antibody-antigen assays, such as competitive assays, saturation assays, or immunoassays such as ΕLISA or RIA.

Such assays can be used to determine the dissociation constant of the antibody. The phrase "dissociation constant" refers to the affinity of an antibody for an antigen. Specificity of binding between an antibody and an antigen exists if the dissociation constant (K_D = 1/K, where K is the affinity constant) of the antibody is < lμM, preferably < 100 nM, and most preferably < 0.1 nM. Antibody molecules will typically have a K_D in the lower ranges. Kp = [Ab-Ag]/[Ab][Ag] where [Ab] is the concentration at equilibrium of the antibody, [Ag] is the concentration at equilibrium of the antigen and [Ab-Ag] is the concentration at equilibrium of the antibody-antigen complex. Typically, the binding interactions between antigen and antibody include reversible noncovalent associations such as electrostatic attraction, Van der Waals forces and hydrogen bonds.

C. Immunoassays

The antibodies can be detected and or quantified using any of a number of well recognized immunological binding assays (see, e.g., U.S. Patents 4,366,241; 4,376,110; 4,517,288; and 4,837,168). For a review of the general immunoassays, see also METHODS IN CELL BIOLOGY, VOL. 37, Asai, ed. Academic Press, Inc. New York (1993); BASIC AND CLINICAL IMMUNOLOGY 7TH EDITION, Stites & Terr, eds. (1991). Immunological binding assays (or immunoassays) typically utilize a ligand (e.g., ghep34 or ghep35) to specifically bind to and often immobilize an antibody. The antibodies employed in immunoassays of the present invention are discussed in greater detail supra. In a prefeπed embodiment, the immunoassay is a radioimmunoassay.

Immunoassays also often utilize a labeling agent to specifically bind to and label the binding complex formed by the ligand and the antibody. The labeling agent may itself be one of the moieties comprising the antibody/analyte complex, i.e., the anti- ghep34 or ghep35 antibody. Alternatively, the labeling agent may be a third moiety, such as another antibody, that specifically binds to the antibody/ ghep34 or ghep35 protein complex. hi one aspect, a competitive assay is contemplated wherein the labeling agent is a second anti- ghep34 or ghep35 antibody bearing a label. The two antibodies then compete for binding to the immobilized ghep34 or ghep35. Alternatively, in a non- competitive format, the anti- ghep34 or ghep35 antibody lacks a label, but a second antibody specific to antibodies of the species from which the anti- ghep34 or ghep35 antibody is derived, e.g., murine, and which binds the anti- ghep34 or ghep35 antibody, is labeled.

Other proteins capable of specifically binding immunoglobulin constant regions, such as Protein A or Protein G may also be used as the label agent. These proteins are normal constituents of the cell walls of streptococcal bacteria. They exhibit a strong non-immunogenic reactivity with immunoglobulin constant regions from a variety of species (see, generally Kronval, et al, J. Immunol. 111:1401-1406 (1973); and Akerstrom, et al, J. Immunol. 135:2589-2542 (1985)).

Throughout the assays, incubation and/or washing steps may be required after each combination of reagents. Incubation steps can vary from about 5 seconds to several hours, preferably from about 5 minutes to about 24 hours. However, the incubation time will depend upon the assay format, antibody, volume of solution, concentrations, and the like. Usually, the assays will be carried out at ambient temperature, although they can be conducted over a range of temperatures, such as 10°C to 40°C.

While the details of the immunoassays of the present invention may vary with the particular format employed, the method of detecting anti- ghep34 or ghep35 antibodies in a sample containing the antibodies generally comprises the steps of contacting the sample with an antibody which specifically reacts, under immunologically reactive conditions, to the ghep34 or ghep35/antibody complex. METHODS OFDETECTINGCELLSTHATEXPRESS GHEP

In another aspect, this invention provides methods of detecting cells that express GHEP. The methods involve detecting either a GHEP transcript or polypeptide. Because cells of many prostate cancers express GHEP, methods of detection are useful in the detection of such cancers. In a particularly preferred embodiment, prostate cancer cells biopsied from sites other than the prostate can be distinguished from other cells by the expression of GHEP.

In one method, a biopsy is performed on the subject and the collected tissue is tested in vitro. Typically, the cells are disrupted by lysing, sonic disruption, osmotic pressure, freezing and thawing, enzymatic treatment, or other means routine in the art to render the intracellular proteins accessible without denaturing them. The cellular contents are then contacted, for example, with an anti- ghep34 or ghep35 antibody. Any immune complexes which result indicate the presence of a ghep protein in the biopsied sample. To facilitate such detection, the antibody can be radiolabeled or coupled to an effector molecule which is a detectable label, such as a radiolabel. In another method, the cells can be detected in vivo using typical imaging systems. For example, the method can involve the administration to a subject of a labeled composition capable of reaching the cell nucleus. Then, the localization of the label is determined by any of the known methods for detecting the label. Any conventional method for visualizing diagnostic imaging can be used. For example, paramagnetic isotopes can be used for MRI.

A. Detection of GHEP and ghep proteins

GHEP and ghep proteins can be identified by any methods known in the art. In one embodiment, the methods involve detecting a polypeptide with a ligand that specifically recognizes the polypeptide (e.g., an immunoassay). The antibodies of the invention are particularly useful for specific detection of ghep34 or ghep35. A variety of antibody-based detection methods are known in the art. These include, for example, radioimmunoassay, sandwich immunoassays (including ELISA), immunofluorescence assays, Western blot, affinity chromatography (affinity ligand bound to a solid phase), and in situ detection with labeled antibodies. Another method for detecting ghep34 or ghep35 involves identifying the polypeptide according to its mass through, for example, gel electrophoresis, mass spectrometry or HPLC. Subject samples can be taken from any number of appropriate sources, such as saliva, peritoneal fluid, blood or a blood product (e.g., serum), urine, tissue biopsy (e.g., lymph node tissue), etc. Samples from blood or serum are particularly useful for detecting secreted ghep34 or ghep35.

The ghep34 or ghep35 proteins can be detected in cells in vitro, in samples from biopsy and in vivo using imaging systems described above.

B. Detection of transcript encoding GHEP

Cells that express GHEP transcript can be detected by contacting the sample with a nucleic acid probe that specifically hybridizes with the transcript, and detecting hybridization. This includes, for example, methods of in situ hybridization, in which a labeled probe is contacted with the sample and hybridization is detected by detecting the attached label. However, the amounts of transcript present in the sample can be small. Therefore, other methods employ amplification, such as RT-PCR. In these methods, probes are selected that function as amplification primers which specifically amplify the GHEP sequences from mRNA. Then, the amplified sequences are detected using typical methods .

The probes are selected to specifically hybridize with GHEP transcripts. Generally, complementary probes are used. However, probes need not be exactly complementary if they have sufficient sequence homology and length to hybridize under stringent conditions.

PHARMACEUTICAL COMPOSITIONS

In another aspect, this invention provides pharmaceutical compositions that comprise a pharmaceutically acceptable carrier and a composition of this invention. In one group of embodiments, the pharmaceutical composition comprises ghep34 or ghep35, an immunogenic fragment of one of these proteins, such as a polypeptide comprising a ghep34 epitope, or a ghep34 or ghep35 analog, in an amount effective to elicit a cell-mediated immune response or a humoral response in a subject, e.g., a polypeptide bearing an MHC binding motif. Such pharmaceutical compositions are useful as vaccines in the therapeutic methods of this invention and for preparing antibodies.

In another embodiment, the pharmaceutical composition comprises a nucleic acid molecule comprising a nucleotide sequence encoding ghep34 or ghep35 in an amount effective to elicit an immune response against cells expressing ghep34 or ghep35 in a subject. Such compositions also are useful in the therapeutic methods of this invention.

In yet another embodiment, the pharmaceutical composition may comprise a chimeric molecule comprising a targeting molecule and a detector molecule to detect cells expressing ghep35 or ghep34. If the detector molecule is one capable of binding specifically to a nucleic acid encoding ghep34 or ghep35 (such as a DNA binding protein which can bind specifically to DNA encoding ghep34 or ghep35), than the composition can be used to detect cells which express that nucleic acid.

The pharmaceutical compositions of this invention can be prepared in unit dosage forms for administration to a subject. The amount and timing of administration are at the discretion of the treating physician to achieve the desired purposes.

The compositions for administration will commonly comprise a solution of the ghep34 or ghep35 protein, immunogenic fragment, or analog dissolved in a pharmaceutically acceptable carrier, preferably an aqueous carrier. A variety of aqueous carriers can be used, e.g., buffered saline and the like. These solutions are sterile and generally free of undesirable matter. These compositions may be sterilized by conventional, well known sterilization techniques. The compositions may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions such as pH adjusting and buffering agents, toxicity adjusting agents and the like, for example, sodium acetate, sodium chloride, potassium chloride, calcium chloride, sodium lactate and the like. The concentration of ghep protein or analog in these formulations can vary widely, and will be selected primarily based on fluid volumes, viscosities, body weight and the like in accordance with the particular mode of administration selected. The compositions of the present invention can be administered to inhibit the growth of cells of GHEP expressing cancers. In these applications, compositions are administered to a patient suffering from a disease, in an amount sufficient to raise an immune response to GHEP-expressing cells. Preferably, the immune response is sufficient to slow the proliferation of such cells or to inhibit their growth. Amounts effective for this use will depend upon the severity of the disease, the general state of the patient's health, and the robustness of the patient's immune system. An effective amount of the compound is that which provides either subjective relief of a symptom(s) or an objectively identifiable improvement as noted by the clinician or other qualified observer. Single or multiple administrations of the compositions are administered depending on the dosage and frequency as required and tolerated by the patient. In any event, the composition should provide a sufficient quantity of the proteins of this invention to raise an immune response to GHEP-expressing cells. Preferably, the dosage is administered once but may be applied periodically until either a therapeutic result is achieved or until side effects warrant discontinuation of therapy. Generally, the dose is sufficient to treat or ameliorate symptoms or signs of disease without producing unacceptable toxicity to the patient. The administrations can also include one or more immune adjuvants to amplify the patient's response to the administration. Typically, the immune adjuvant is selected from a non-specific immune adjuvant, a subcellular microbial product or fraction, a haptens, an immunogenic protein, an immunomodulator, an interferon, a thymic hormone, and a colony stimulating factor. The use of such adjuvants is well known in the art.

Controlled release parenteral formulations of the protein compositions of the present invention can be made as implants, oily injections, or as particulate systems. For a broad overview of protein delivery systems see, Banga, A.J., THERAPEUTIC PEPTIDES AND PROTEINS: FORMULATION, PROCESSING, AND DELIVERY SYSTEMS, Technomic Publishing Company, Inc., Lancaster, PA, (1995) incorporated herein by reference. Particulate systems include microspheres, microparticles, microcapsules, nanocapsules, nanospheres, and nanoparticles. Microcapsules contain the protein as a central core. In microspheres the protein is dispersed throughout the particle. Particles, microspheres, and microcapsules smaller than about 1 μm are generally referred to as nanoparticles, nanospheres, and nanocapsules, respectively. Capillaries have a diameter of approximately 5 μm so that only nanoparticles are administered intravenously. Microparticles are typically around 100 μm in diameter and are administered subcutaneously or intramuscularly. See, e.g., Kreuter, J., COLLOIDAL DRUG DELIVERY SYSTEMS, J. Kreuter, ed., Marcel Dekker, Inc., New York, NY, pp. 219-342 (1994); and Tice & Tabibi, TREATISE ON CONTROLLED DRUG DELIVERY, A. Kydonieus, ed., Marcel Dekker, Inc. New York, NY, pp. 315-339, (1992) both of which are incorporated herein by reference.

Polymers can be used for ion-controlled release of immunogenic compositions of the present invention. Various degradable and nondegradable polymeric matrices for use in controlled drug delivery are known in the art (Langer, R., Accounts Chem. Res. 26:537-542 (1993)). For example, the block copolymer, polaxamer 407 exists as a viscous yet mobile liquid at low temperatures but forms a semisolid gel at body temperature. It has shown to be an effective vehicle for formulation and sustained delivery of recombinant interleukin-2 and urease (Johnston, et al, Pharm. Res. 9:425-434 (1992); and Pec, et al, J. Parent. Sci. Tech. 44(2):58-65 (1990)). Alternatively, hydroxyapatite has been used as a microcarrier for controlled release of proteins (Ijntema, et al, Int. J. Pharm. 112:215-224 (1994)). In yet another aspect, liposomes are used for controlled release as well as drug targeting of the lipid-capsulated drug (Betageri, et al, LIPOSOME DRUG DELIVERY SYSTEMS, Technomic Publishing Co., Inc., Lancaster, PA (1993)). Numerous additional systems for controlled delivery of therapeutic proteins are known. See, e.g., U.S. Pat. No. 5,055,303, 5,188,837, 4,235,871, 4,501,728, 4,837,028 4,957,735 and 5,019,369, 5,055,303; 5,514,670; 5,413,797; 5,268,164; 5,004,697; 4,902,505; 5,506,206, 5,271,961; 5,254,342 and 5,534,496, each of which is incorporated herein by reference.

DIAGNOSTIC KITS AND IN VITRO USES

In another embodiment, this invention provides for kits for the detection of ghep34 or ghep35 or an immunoreactive fragment thereof, (i.e., collectively, a "ghep protein") in a biological sample. A "biological sample" as used herein is a sample of biological tissue or fluid that contains a ghep protein. Such samples include, but are not limited to, tissue from biopsy, sputum, blood, and blood cells (e.g., white cells). Biological samples also include sections of tissues, such as frozen sections taken for histological purposes.

Kits will typically comprise an anti- ghep34 or ghep35 antibody of the present invention. In some embodiments, the anti- ghep34 or ghep35 antibody may be an anti- ghep34 or ghep35 Fv fragment, such as a scFv fragment or a dsFv.

In addition the kits will typically include instructional materials disclosing means of use of an antibody of the present invention (e.g. for detection of prostate cancer cells in a sample). The kits may also include additional components to facilitate the particular application for which the kit is designed. Thus, for example, the kit may additionally contain means of detecting the label (e.g. enzyme substrates for enzymatic labels, filter sets to detect fluorescent labels, appropriate secondary labels such as a sheep anti-mouse-HRP, or the like). The kits may additionally include buffers and other reagents routinely used for the practice of a particular method. Such kits and appropriate contents are well known to those of skill in the art.

In one embodiment of the present invention, the diagnostic kit comprises an immunoassay. As described above, although the details of the immunoassays of the present invention may vary with the particular format employed, the method of detecting ghep34 or ghep35 in a biological sample generally comprises the steps of contacting the biological sample with an antibody which specifically reacts, under immunologically reactive conditions, to ghep34 or to ghep35. Since ghep34 is an intracellular protein, cells to be tested for ghep34 will typically be disrupted prior to contact with the antibody. Conveniently, disruption can be by sonication, although other methods known in the art may also be used so long as they do not denature ghep34 or interfere with antibody binding. The antibody is allowed to bind to ghep34 or to ghep35 under immunologically reactive conditions, and the presence of the bound antibody is detected directly or indirectly. The antibodies provided herein will be especially useful as diagnostic agents and in in vitro assays to detect the presence of ghep34 or ghep35 in biological samples. For example, the antibodies made by the methods taught herein can be used as the targeting moieties of immunoconjugates in immunohistochemical assays to determine whether a sample contains cells expressing ghep34 or ghep35. If the sample is one taken from a tissue of a patient which should not normally express ghep34 or ghep35, detection of one of those proteins would indicate, for example, that the patient has a cancer characterized by the presence of GHEP-expressing cells, in a patient not previously known to have such a cancer or, for a patient under treatment for such a cancer, that the treatment has not yet been successful at eradicating it.

EXAMPLES

The following examples are offered to illustrate, but no to limit the claimed invention.

Example 1: Materials and Methods

This Example sets forth the materials and methods used to discover the GΗEP gene and proteins. RNA dot blot and northern blot hybridizations

The human multiple tissue RNA blot (RNA Masterblot, Clontech, Palo Alto, CA) and northern blot (Multiple Tissue Northern blot, Human II, Clontech) hybridizations were carried out as described previously (Liu, et al., Biochem. Biophys. Res. Commun., 264:833-839 (1999)). Briefly, the RNA membranes were blocked for 90 minutes in hybridization solution (Hybrisol I, Oncor, Gaithersburg, MD) at 45 °C. The cDNA clone for EST nc46cl0 was labeled with ³²P by random primer extension (Lofstrand Labs Ltd, Gaithersburg, MD), added to the membranes and hybridized for 16 hours. The membranes were then washed 2 x 15 minutes in 2xSSC, 0.1% SDS, at room temperature and then washed 2 x 15 minutes in 0.5xSSC, 0.1 %SDS, at 55°C. Finally the membranes were exposed on x-ray film for 1 - 2 days. The same procedure was used for hybridization of the nc46cl0 EST clone to a mouse multiple tissue RNA dot blot (RNA Master Blot, Clontech).

Northern blot hybridization, using the 3' extending part of EST ncl6a06, was performed by first PCR amplifying the 3 ' extended part using the nc 16a06 cDNA clone as template and primers C15'3' forw and C13':2. The PCR product was then cloned into a the pCR2.1 TOPO vector (Invitrogen, Carlsbad, CA). After sequencing the probe was prepared by restriction digestion. The hybridization experiment was then performed as described above.

Primers

Primers used in this study were: C1N5, position 91-111 and sequence 5'-CATGGATGGCCTTGGGAACGT-3' (SEQ ID NO:8). C13':l, 445-465, 5'-AAGACATGACATCGCATCGTG-3' (SEQ ID NO:9). C15'3' forw, 535-560, 5'-CCCTTTTTAACTGCTGGGAAGATACT-3' (SEQ ID NO:10). C13':2, 680-657, 5'- ACTTGCCACTCACTCTATACAGGG-3' (SEQ ID NO:l 1). CloligoAS, 281-247, 5'- CAGTATAGGACTGACAGGATTCAAGCAGTGTAACC-3' (SEQ ID NO: 12). ClexLrl, 118-99, 5'-CTTTTCCACGTTCCCAAGGC-3' (SEQ ID NO:13). ClRibol, - (415-390), 5'TCCAGATAAGCTTTCTTCATGTTGC-3' (SEQ ID NO: 14). Clinvl, -11- 10, 5'-CTCGAG)TGAGAGAGGGAGGCAGAAGAG-3' (SEQ ID NO:15). Clinv4,

150-130, 5'-(GAATTC)CCTTGAGTTCATGTCGTCCCA-3' (SEQ ID NO:16). Cldell, 33-67,5 '(CTCGAG)AAATCTACTACCGTTTGCTGGTTTTGAAAATAGAG-3 ' (SEQ ID NO:17). Clinv2, 511 -484,5 '(GAATTC)TCCTGCTTATTCTCTTTTTATTGAAC AT-3' (SEQ ID NO:18). Clmutl, 2-46, 5'-GCAGAAGAGGAAGTCAGAGCGAT ATGCTGTGAAATCTACTACCG-3' (SEQ ID NO:19). Clmut2, 46-2, complement reverse of Clmutl. Clmut3, 81-118, 5'AACTGAGAAACATGGACGGC CTTGGGAACGTGGAAAAG-3' (SEQ ID NO:20). Clmut4, 118-81, complement reverse of Clmut3. C15', -(105-82), 5'-TAGAATTGAAGTTGCTCGTCAGC-3' (SEQ ID NO:21). C15'rev, 98-75, 5'-CATCCATGTTTCTCAGTTCCTTCAC-3' (SEQ ID NO:22). All primers were synthesized by Sigma-Genosys (The Woodlands, TX).

RT-PCR analysis PCR was performed on cDNA from 24 different human tissues using the

Rapid-Scan gene expression panel (OriGene Technologies, Inc., Rockville, MD). The thermocycling protocol was: Initial denaturation at 94°C for 3 minutes, 35 cycles of denaturation at 94°C for 1 minute, annealing at 58°C for 1 minute, and elongation at 72°C for 2 minutes. The primers used were C1N/5 and C13':l. The PCR reactions were analyzed on agarose gels.

Preparations of cDNA from the LNCaP, PC-3 and DU145 cell lines were made using the Micro-FastTrack kit from Invitrogen (Carlsbad, CA). cDNA was prepared by reverse transcription using MMLV (Life Technologies, Gaithersburg, MD) with oligo dT priming. A PCR analysis for GHEP expression, using conditions described above, was performed using primers C 1N5 and C 13 ' : 1. The PCR products were analyzed on agarose gels.

Total RNA was prepared from 4 normal (2 normal and 2 benign prostate hyperplasia) and 5 prostate cancer tissue samples using Trizol (Life Technologies, Gaithersburg, MD). Reverse transcription and PCR analysis was performed as described above.

RACE PCR

Rapid amplification of cDNA ends (RACE) was performed on Marathon Ready normal prostate cDNA (Clontech, Palo Alto, CA) and on total RNA from a prostate cancer sample (prepared using Trizol, Life Technologies). The RACE PCR on the total RNA sample was made using the SMART RACE cDNA amplification kit (Clontech, Palo Alto, CA). Gene specific primer used for the 5 'RACE was Cl oligo AS (position 281). The 5 'RACE PCR product was gel purified (QIAquick gele extraction, Qiagen, Santa Clarita, CA) and cloned into the pCR2.1 TOPO vector (Invitrogen, Carlsbad, CA). Different clones were analyzed by restriction digestion using EcoRI restriction enzyme. The longest and shortest clones were sequenced using Perkin-Ehner's dRhodamine terminator sequencing kit (Perkin-Elmer Applied System, Warrington, UK).

Ribonuclease protection assay

Using a genomic PI artificial chromosome (PAC) clone containing the GHEP gene (see below) as a PCR template with primers Clexl.rl and Cl Ribol, a 533 bp long PCR product was generated containing 415 bp 5' of the GHEP transcript. The PCR product was cloned into the pCRII TOPO vector (Invitrogen, Carlsbad, CA) and sequenced as described above. A riboprobe was then prepared using the SP6 promoter in the pCRII TOPO vector (Lofstrand Labs Ltd, Gaithersburg, MD). Ribonuclease protection was performed using the RPA III kit from Ambion (Austin, TX). The ribonuclease protection assay was analyzed on a denaturing polyacrylamide (15%) TBE- Urea gel (Novex, San Diego, CA).

In vitro translation

The complete GHEP transcript (SEQ ID NO: 1), shown in Figure 3, plus 10 extra bases in the 5' end detected by the longest of the 5 'RACE clones (the transcript plus the extra 10 bases is (SEQ ID NO:23), was cloned into pBluescript II SK (+) (Stratagene) and sequenced (Construct 1). Deleted versions of this construct were prepared by PCR using Construct 1 as template. Primers Clinvl and Clinv4 were used to produce Construct 2. The PCR product was directionally cloned into the pBluescript II SK (+) vector utilizing restriction sites in the primers. Construct 3 was prepared in the same way using primers Cldell and Clinv2. This was examined in an in vitro transcription coupled translation system using T7 RNA polymerase and wheat germ extract (TNT, Promega, Madison, WI). ³⁵S-Met (ICN, Costa Mesa, CA) was incorporated in the reaction for visualization of translated products. The reaction was analyzed under reducing condition on a polyacrylamide gel (16.5% Tris/Tricine, Bio-Rad) together with a pre-stained marker (Life Technologies, Gaithersburg, MD). The gel was dried and subjected to autoradiography.

Using the Quickchange Site-Directed Mutagenesis kit from Stratagene (La Jolla, CA), the first ATG at position 23 was changed to ATA. The ATG for ORF2 at position 96 was changed to ACG. Primers Clmutl and Clmut2 were used for mutation 1, and primers Cmut3 and Clmut4 for mutation 2. The in vitro translation and analysis was performed as described above.

Genomic clone A PI artificial chromosome clone (PAC) containing the GHEP gene was obtained from Genome Systems (St. Louis, MO). The PAC vector was pAdlOSacBII with an approximate 120 kb genomic insert. Five different restriction digestions were made, with enzymes; BamHl, EcoRI, EcoRV, Hindlll, and Pstl. The restriction digests were separated on an agarose gel and a Southern transfer was performed. Oligonucleotides from different parts of the GHEP transcript were labeled with P (Lofstrand Labs, Ltd.) and in turn hybridized to the Southern membrane. Briefly, the membrane was blocked for 90 minutes in hybridization solution (Hybrisol II, Oncor, Gaithersburg, MD) at 45°C. The labeled oligonucleotide was then added to the membrane and hybridized for 16 hours. The membranes were washed 2 x 10 minutes in 2xSSC, 0.1 % SDS, at room temperature and once for 10 minutes in 0.5xSSC, 0.1 %SDS, at 55°C. Finally, the membranes were exposed on x-ray film for 1 - 2 days. Identified bands, from a parallel agarose gel, were cut out, gel purified (QIAquick gele extraction, Qiagen, Santa Clarita, CA) and subcloned into the pBluescript II SK (+) vector. These subcloned genomic sequences were sequenced as described above. As new genomic sequence was revealed, new oligonucleotides to use as probes were synthesized.

Potential promoter elements were analyzed using the MacVector 6.5 program (Oxford Molecular Group Pic, Oxford, UK). The database used was a modified version of "nucleic acid subsequences" with added sequences for androgen response elements (ARE) (Cleutjens, K. B., et al., J. Biol. Chem., 271:6379-6388 (1996)).

Chromosomal location

The EST clone nc46cl0 was used as a probe in a hybridization to a human chromosome blot (Oncor, Gaithersburg, MD). The procedure used for the hybridization was the same as for the northern blot hybridizations. The Stanford G3 radiation hybrid panel was used for mapping the chromosomal localization of GHEP (Research Genetics, Huntsville, AL). Primers used were C15' and C15'rev . The result was analyzed using the Stanford Human Genome Center radiation hybrid server (http://shgc.stanford.edu/.. Example 2: Results of the Studies

EST database analysis

An earlier study identified a cluster, Cl (from now on called GHEP), that contained EST sequences from prostate cDNA libraries (Vasmatzis, G., et al., Proc. Natl Acad. Sci. USA., 95:300-304 (1998)). This cluster currently contains 19 ESTs from 13 cDNA clones. The ESTs are derived from three normal prostate cDNA libraries and one prostate tumor cDNA library. The three normal libraries are CGAP libraries Pr_l (microdissected), Pr_22 (bulk), and Pr_28 (subtracted library derived from Pr_22). The prostate tumor library is CGAP library Pr_3 (microdissected). No ESTs from tissues other than prostate are in the cluster. The composite sequence made up from the individual EST sequences is about 510 nucleotides in length and is shown in Figure 1. At position 495 in the composite sequence there is a polyadenylation signal (AATAAA) (SEQ ID NO:24). It is followed by a polyA stretch, present in some of the ESTs, which begins at position 511. There are two ESTs that diverge from the GHEP consensus sequence.

These are shown at the bottom of Figure 1. EST ncl6a06.rl extends beyond the 3' end of the cluster. It is missing the polyA stretch found in many of the other ESTs and probably represents an extended 3' UTR. EST ncl3dl 1.rl contains a gap and is missing bases 305 - 389 of the composite sequence. There are two other short EST sequences (-250 bp) that overlap with about 90 bp in the beginning of the composite sequence but the rest of these ESTs do not show any homology to the rest of the cluster (not shown).

Experimental expression analysis

Using cDNA clone nc46cl0 as a probe on a multiple tissue RNA dot blot (Human RNA Master Blot, Clontech), a strong signal was detected in prostate. No signal from any of the other tissues on the blot could be detected. Among the negative tissues on the blot were brain, liver, heart, kidney, salivary gland, testis and stomach. To verify the expression pattern, a PCR analysis Was carried out using a Rapid Scan multiple tissue cDNA panel (24 different tissues) obtained from OriGene. Using primers C1N5 and C13':l, we confirmed that there was very strong expression in prostate. Very weak expression was observed in two other tissues: salivary gland and liver. The Rapid Scan panel included 4 different concentrations of cDNA from each tissue (normalized against β-actin) making it possible to do a rough comparison of the expression levels in different tissues. In a side by side comparison, the expression in prostate was >100 times stronger than in the salivary gland and >1000 times stronger than in the liver. The expression in salivary gland and liver was not detected in the dot blot experiment.

GHEP expression was also analyzed in three different prostate cancer cell lines. Very weak expression of GHEP could be detected in the LNCaP prostate cell line using 35 cycles of PCR on LNCaP cDNA (using same primers as above). No expression was detected in either in the PC-3 prostate cell line or in the DU145 prostate cancer cell line.

To investigate whether there is a mouse homologue of the GHEP gene, hybridization was performed using the nc46cl0 EST clone as a probe on a mouse RNA dot blot (Mouse RNA Master blot, Clontech). The hybridization conditions used were the same as for the human dot blot. No hybridization signal was detected in any of the mouse tissues present on the blot which included, among others, prostate, kidney, and liver.

Size of the GHEP transcripts Northern blot hybridization with the nc46cl 0 cDNA clone on a multiple tissue northern blot (Clontech) revealed three different size bands in the prostate lane. No bands were detected in any of the other tissues on the northern blot. The sizes of the bands in the prostate were approximately 500, 1500, and 2300 bases. The 500 base band was by far the strongest. In a northern blot hybridization experiment, using the 3' extended part of the ncl6a06 EST clone as a probe (bases 535 - 680), only the 1500 and 2300 base bands were detected. This indicates that these transcripts arise from the use of alternative sites of polyadenylation of GHEP. The lower signal strength of the two upper bands, and the fact that only one of 13 EST clones is extended at the 3' end indicated these transcripts are rather uncommon when compared to the major transcript.

Investigation of the full length GHEP transcript

Because ESTs are frequently not full length, a 5'RACE-PCR was performed using both commercial normal prostate cDNA (Marathon-Ready cDNA, Clontech) and total RNA prepared from a prostate cancer sample. All these sources gave rise to one clear band. This band was cloned in order to obtain the sequence. After restriction digestion of four different clones obtained as RACE-PCR products, it was found that the clones varied slightly in length. The longest and shortest of these clones were sequenced. The longest was about 10 bases longer than the EST composite cluster in Figure 1 and the shortest about 10 bases shorter.

In a further effort to define the 5' end of the GHEP transcript, a ribonuclease protection experiment was performed using either commercial normal prostate mRNA (Clontech) or total RNA we prepared from a prostate cancer sample (same total RNA as was used in the 5'RACE-PCR). The riboprobe was 600 bases long extending towards the 5' end from position 130 in the cluster sequence. The upstream sequence used for the riboprobe was obtained by analysis of a genomic GHEP PAC- clone. With both RNA samples, a band around 130 - 140 bases was detected. This confirmed the findings from the 5'RACE-PCR that the GHEP cluster sequence presented in Figure 1 is the entire major transcript of GHEP.

The sequence of the GHEP transcript

The entire sequence of the GHEP transcript (SEQ ID NO:l) is shown in Figure 2. The sequence is identical to the consensus sequence derived from the GHEP composite cluster shown in Figure 1, except for a 10 bp extension (SEQ ID NO:23) in the 5' end obtained from one of the 5 'RACE clones. Also shown in Figure 2 are the two longest possible open reading frames (ORF) in the GHEP transcript. ORF1 begins at base 23 and contains 34 amino acids (SEQ ID NO:3). ORF2 begins at base 96 and contains 35 amino acids (SEQ ID NO:5). It is striking that both open reading frames encode short peptides.

In vitro translation of the GHEP transcript

To investigate whether the two open reading frames that are found in the GHEP transcript could be expressed in vitro, a translation experiment was performed using the TNT wheat germ in vitro translation procedure (Promega). Because the two proteins are similar in size, 34 amino acids (4.0 kDa) for ORF1 and 35 amino acids (4.2 kDa) for ORF2, two sets of experiments were carried out to determine if ORF 1 and/or ORF2 could be expressed. In a deletion experiment, three different kinds of cDNA constructs were made. A schematic overview of the constructs is shown in Figure 3 A. Construct 1 was the full-length GHEP transcript (SEQ ID NO:l) shown in Figure 2 with the addition of 10 extra bases (SEQ ID NO:23) in the 5' end present in the longest of the 5 'RACE clones. Construct 2 contained only the first 160 bp of the GHEP transcript, basically containing only ORFl . Construct 3 had a deletion of the 43 first bases of GHEP so that the transcript started just after the first ATG of ORFl, and only contained ORF2. Translation of ORFl, using the second ATG at position 62, was avoided by introducing a mutation (ATG to ATA) with the primer used for making the construct. The vector used to express each of the cDNAs for the in vitro translation experiments was pBlueskript II SK+. Constructs 1 and 2 gave a clear band around the expected size of 4.0 kDa. No band was detected with construct 3 (Figure 3B). This result indicated that ORFl is the preferred open reading frame and translation initiates at the ATG (positions 23-25). To confirm this result, the ATGs of ORFl and ORF2 were each mutated into a sequence that would not initiate translation. The ATG for ORFl was mutated into ATA (mutation 1) and the ATG of ORF2 was mutated into ACG (mutation 2) (Figure 3 A). The mutation of ORF2 was made so that it would not cause an amino acid change in the reading frame in ORFl . The result of the transcription-translation experiment is also shown in Figure 3B. When the first ATG of ORFl is mutated no translated protein could be detected. Mutations of the ATG for ORF2 show a band at around the expected size, 4.0 kDa.

Thus, both sets of experiments show that ORFl is used to make a small peptide that is 34 amino acids in length (SEQ ID NO:3). BLAST was used to compare the amino acid sequence of ORFl against Genbank and Swissprot but no significant homology to any known protein was found. One unusual feature of the 34 amino acid peptide is that it contains five amino acid doublets.

Genomic organization of GHEP

A genomic PAC-clone with an approximate size of 120 kb containing the GHEP gene was obtained from Genome Systems (See Materials and Methods). Using restriction digestion, with five different restriction enzymes, a Southern blot of the digested PAC-clone was prepared. This Southern blot was probed, in turn, with oligonucleotides from different parts of the GHEP transcript. This identified smaller pieces of the GHEP gene that could be subcloned and sequenced. Sequencing of subcloned pieces of the GHEP gene revealed that there is a splice site at position 118 (See Figure 2) in the GHEP transcript. This splice site contains the highly conserved sequences of the donor and acceptor ends of a splice site (Stephens, et al, J. Mol. Biol, 228:1124-1136 (1992)). A PCR experiment was conducted to try and connect the ends of the intron at this point but it failed to give a product, suggesting an intron greater than 15 kb in size. The genomic sequence of the GHEP gene did not reveal any introns at the site where the diverging ncl3dl l.rl EST had a gap. Also, the sequence does not contain any of the highly conserved donor and acceptor sequences for splice indicating that this is probably an erroneous EST.

Analysis of the promoter sequence of GHEP

Using the genomic PAC-clone of GHEP, about 1300 bp 5 ' of the GHEP transcript start site was sequenced. This enabled analysis of possible promoter sequences. Examination of the sequence just upstream of the starting point of the GHEP transcript did not reveal a clear TATA-box; however, there is a CAAT-box at position ~ -71. The lack of a TATA-box could explain the rather large variation of transcription start points seen in the 5'RACE-PCR experiment. Further upstream of the transcription start, there are several possible androgen response elements (ARE) (Cleutjens, K. B., et al., J. Biol. Chem., 271:6379-6388 (1996)) at positions -456, -969 and -1008. There is also an API site at position -728.

Genomic localization of GHEP

The GHEP gene was found to be located on chromosome 4 by using the nc46cl0 EST clone as a probe on a chromosomal blot (Oncor). The Stanford G3 hybrid panel was used to map the GHEP gene using primers C15' and C15' rev. When the results were analyzed by the SHGC radiation hybrid server, Oittp ://shgc. Stanford. edu/). it was found that GHEP is located closest to SHGC-8625 with a LOD Score of 14.47 and a distance of 5cR. The reference interval is D4S2947-D4S400, which maps to 4q21.1. The closest known gene is fibroblast growth factor 5.

GHEP expression in different normal and tumor prostate samples

Because most of the samples tested for GHEP expression were commercial cDNA or mRNA preparations, made from a pool of samples from different people, there was no information about GHEP expression in specific individuals. To investigate expression in specific samples, total RNA was prepared (Trizol, Life

Technologies) from 9 different samples from 9 different patients; 4 samples were from normal prostate (or benign prostate hyperplasia), and 5 were from prostate cancer samples. RT-PCR analysis of these RNA samples was performed using primers C1N5 and C13' 1. The results are shown in Figure 4. GHEP was expressed in all the samples ^• tested. It should be noted that the prostate cancer samples were probably mixed samples containing some normal prostate epithelial cells. There is other evidence, however, that indicates that GHEP is expressed in prostate cancer epithelial cells. Five of the 13 EST cDNA clones in the GHEP cluster are derived from a microdissected prostate cancer library (Pr_3) which contains only cancer cells.

Example 3: Radioimmunoassays to detect ghep34 and ghep35

The following example sets forth a protocol for a radioimmunoassay to detect the presence of ghep34 or ghep35 in a sample.

Radiolabeling of GHEP

Two and a half micrograms of chemically synthesized ghep34 or ghep35 are labeled with ¹²⁵I using the chloramine T method (Hunter and Greenwood, Nature 194:495 (1962)). The labeled protein is then purified using a PD-10 column (Amersham Pharmacia Biotech) .

Anti-GHEP antibody

Anti-ghep34 antibodies or anti-ghep35 antibodies are prepared by using proteinA purified antisera from rabbits immunized with a Pseudomonas exotoxin (PE) - ghep34 fusion protein or a Pseudomonas exotoxin (PE) - ghep35 fusion protein, respectively (Bruggeman et al., BioTechniques 10:202 (1992)).

Standard curve

A standard curve is established by mixing a fixed amount of labeled ghep34 or ghep35 (~ 0.2 ng at about 170 μCi/μg) with different concentrations of unlabeled ghep34 or ghep35, respectively (O.lng - 50ng) in 250 μl buffer (PBS with 0.25% bovine serum albumin) containing 1 μg of anti-ghep34 or anti-ghep35 antibody. The samples are incubated at room temperature for 4h. ProteinA sepharose beads are added and incubated for another hour. Finally the beads are collected by centrifugation and washed with buffer 3 times. The remaining bead pellet is measured for radioactivity in a gamma counter. Sample measurement

To measure the amount of gheρ34 or ghep35 in a tissue extract or a protein extract from a cell culture the same procedure is used, but with the sample substituted for the known amounts of the protein used in the standard curve description.

It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims. All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes.

Claims

WHAT IS CLAIMED IS:

1. An isolated polypeptide comprising an amino acid sequence selected from the group consisting of a ghep34 protein ("ghep34," SEQ ID NO:2), an immunogenic fragment thereof, a polypeptide with at least 90% sequence identity to ghep34 and which is specifically recognized by an antibody which specifically recognizes ghep34, and a polypeptide which has at least 90 % sequence identity with ghep34 and which, when processed and presented in the context of Major Histocompatibility Complex molecules, activates T lymphocytes against cells which express ghep34.

2. An isolated polypeptide of claim 1 , wherein the polypeptide comprises the sequence of ghep34.

3. An isolated polypeptide of claim 1 , wherein the polypeptide comprises the sequence of an immunogenic fragment of ghep34.

4. An isolated polypeptide of claim 1, which polypeptide has at least 90%) sequence identity to ghep34 and is specifically recognized by an antibody which specifically recognizes ghep34.

5. An isolated polypeptide of claim 1, which polypeptide has at least 90 % sequence identity with ghep34 and which, when processed and presented in the context of Major Histocompatibility Complex molecules, activates T lymphocytes against cells which express ghep34.

6. A composition comprising a polypeptide of claim 1 and a pharmaceutically acceptable carrier.

7. A composition comprising a polypeptide of claim 2 and a pharmaceutically acceptable carrier.

8. A composition comprising a polypeptide of claim 3 and a pharmaceutically acceptable carrier.

9. A composition comprising a polypeptide of claim 4 and a pharmaceutically acceptable carrier.

10. A composition comprising a polypeptide of claim 5 and a pharmaceutically acceptable carrier.

11. An isolated polypeptide comprising an amino acid sequence selected from the group consisting of a ghep35 protein ("ghep35," SEQ ED NO:2), an immunogenic fragment thereof, a polypeptide with at least 90% sequence identity to ghep35 and which is specifically recognized by an antibody which specifically recognizes ghep35, and a polypeptide which has at least 90 % sequence identity with ghep35 and which, when processed and presented in the context of Major Histocompatibility Complex molecules, activates T lymphocytes against cells which express ghep35.

12. An isolated polypeptide of claim 11 , wherein the polypeptide comprises the sequence of ghep35.

13. An isolated polypeptide of claim 11 , wherein the polypeptide comprises the sequence of an immunogenic fragment of ghep35.

14. An isolated polypeptide of claim 11 , which polypeptide has at least 90% sequence identity to ghep35 and is specifically recognized by an antibody which specifically recognizes ghep35.

15. An isolated polypeptide of claim 11 , which polypeptide has at least 90 % sequence identity with ghep35 and which, when processed and presented in the context of Major Histocompatibility Complex molecules, activates T lymphocytes against cells which express ghep35.

16. A composition comprising a polypeptide of claim 11 and a pharmaceutically acceptable carrier.

17. A composition comprising a polypeptide of claim 12 and a pharmaceutically acceptable carrier.

18. A composition comprising a polypeptide of claim 13 and a pharmaceutically acceptable carrier.

19. A composition comprising a polypeptide of claim 14 and a pharmaceutically acceptable carrier.

20. A composition comprising a polypeptide of claim 15 and a pharmaceutically acceptable carrier.

21. An isolated, recombinant nucleic acid molecule comprising a promoter from a gene other than GHEP (SEQ ID NO: 1) operatively linked to a nucleotide sequence selected from the group consisting of: a nucleotide sequence encoding a polypeptide having the amino acid sequence of a ghep34 protein ("ghep34", SEQ ID NO:2), an immunogenic fragment thereof, a polypeptide with at least 90% sequence identity to ghep34 and which is specifically recognized by an antibody which specifically recognizes ghep34, and a polypeptide which has at least 90 % sequence identity with ghep34 and which, when processed and presented in the context of Major Histocompatibility Complex molecules, activates T lymphocytes against cells which express ghep34.

22. The isolated, recombinant nucleic acid molecule of claim 21 , wherein the nucleotide sequence encodes a polypeptide comprising the sequence of gheρ34.

23. The isolated, recombinant nucleic acid molecule of claim 21 , wherein the nucleotide sequence encodes an immunogenic fragment of ghep34.

24. The isolated, recombinant nucleic acid molecule of claim 21 , wherein the nucleotide sequence encodes a polypeptide with at least 90% sequence identity to ghep34 and which is specifically recognized by an antibody which specifically recognizes ghep34.

25. An isolated, recombinant nucleic acid molecule comprising a promoter from a gene other than GHEP (SEQ ID NO: 1) operatively linked to a nucleotide sequence selected from the group consisting of: a nucleotide sequence encoding encoding a polypeptide having the amino acid sequence of a ghep35 protein ("ghep35" (SEQ ID NO:5)), a nucleotide sequence encoding an immunogenic fragment of ghep35, a nucleotide sequence encoding a polypeptide with at least 90% sequence identity to ghep35 and which is specifically recognized by an antibody which specifically recognizes ghep35, and a nucleotide sequence encoding a polypeptide which has at least 90 % sequence identity with ghep35 and which, when processed and presented in the context of Major Histocompatibility Complex molecules, activates T lymphocytes against cells which express ghep35.

26. The isolated, recombinant nucleic acid molecule of claim 25, which encodes a polypeptide comprising the sequence of ghep35.

27. The isolated, recombinant nucleic acid molecule of claim 25, wherein the nucleotide sequence encodes an immunogenic fragment of ghep35.

28. The isolated, recombinant nucleic acid molecule of claim 25, wherein the nucleotide sequence encodes a polypeptide with at least 90% sequence identity to ghep35 and which is specifically recognized by an antibody which specifically recognizes ghep35.

29. A host cell comprising an expression vector comprising a promoter other than a promoter from a GHEP gene (SEQ ID NO: 1) operatively linked to a nucleotide sequence encoding a protein or peptide selected from the group consisting of: ghep34 (SEQ ID NO:3), an immunogenic fragment thereof, a polypeptide with at least 90% sequence identity to ghep34 and which is specifically recognized by an antibody which specifically recognizes ghep34, an immunogenic fragment of ghep34, and a polypeptide with at least 90%> sequence identity to ghep34 and which is specifically recognized by an antibody which specifically recognizes ghep34.

30. A host cell comprising an expression vector comprising a promoter, other than a promoter from a GHEP gene (SEQ ID NO: 1), operatively linked to a nucleotide sequence encoding a protein or peptide selected from the group consisting of: ghep35 (SEQ ID NO: 5), an immunogenic fragment thereof, a polypeptide with at least 90% sequence identity to ghep35 and which is specifically recognized by an antibody which specifically recognizes ghep35, an immunogenic fragment of ghep35, and a polypeptide with at least 90% sequence identity to ghep35 and which is specifically recognized by an antibody which specifically recognizes ghep35.

31. A method of activating T lymphocytes against cells expressing ghep34 (SEQ 3D NO:3), the method comprising administering to a subject a composition, which composition is selected from the group consisting of: an isolated polypeptide having the amino acid sequence of ghep34, an immunogenic fragment thereof, a polypeptide with at least 90% sequence identity to ghep34 and which is specifically recognized by an antibody which specifically recognizes ghep34, a polypeptide which has at least 90 % sequence identity with ghep34 and which, when processed and presented in the context of Major Histocompatibility Complex molecules, activates T lymphocytes against cells which express ghep34, an isolated nucleic acid encoding one of these polypeptides, an antigen presenting cell pulsed with a polypeptide comprising an epitope of ghep34, an antigen presenting cell sensitized in vitro to ghep34, an antigen presenting cell sensitized in vitro to an immunogenic fragment of ghep34, an antigen presenting cell sensitized in vitro to a polypeptide with at least 90% sequence identity to ghep34 which is specifically recognized by an antibody which specifically recognizes ghep34, and an antigen presenting cell sensitized in vitro to polypeptide which has at least 90 % sequence identity with ghep34 which, when processed and presented in the context of Major Histocompatibility Complex molecules, activates T lymphocytes against cells which express ghep34.

32. The method of claim 31 comprising administering to the subject ghep34 or an immunogenic fragment thereof.

33. The method of claim 31 wherein the polypeptide has at least 90%) sequence identity to ghep34 and is specifically recognized by an antibody which specifically recognizes ghep34.

34. The method of claim 31 , wherein the polypeptide has at least 90 % sequence identity with ghep34 and, when processed and presented by an antigen presenting cell in conjunction with an MHC molecule, activates T lymphocytes against cells expressing ghep34.

35. The method of claim 31, wherein the composition is administered to a subject who suffers from prostate cancer.

36. The method of claim 31 , wherein the administration comprises sensitizing CD8+ cells in vitro to an epitope of a ghep34 protein and administering the sensitized cells to the subject.

37. The method of claim 31, further comprising co-administering to the subject an immune adjuvant selected from a non-specific immune adjuvant, a subcellular microbial product or fraction, a haptens, an immunogenic protein, an immunomodulator, an interferon, a thymic hormone, and a colony stimulating factor.

38. The method of claim 31 , comprising administering an antigen presenting cell pulsed with a polypeptide comprising an epitope of ghep34.

39. The method of claim 31 , comprising administering a nucleic acid sequence encoding polypeptide comprising an epitope of ghep34, which nucleic acid is in a recombinant virus.

40. The method of claim 31 , comprising administering a nucleic acid sequence encoding a polypeptide comprising an epitope of a ghep34 protein.

41. The method of claim 31 , further comprising administering an expression vector that expresses a polypeptide comprising an epitope of a ghep34 protein, which expression vector is in a recombinant bacterial cell.

42. The method of claim 31 , comprising immunizing the subject with a expression vector that expresses a polypeptide comprising an epitope of a ghep34 protein, which expression vector is in an autologous recombinant cell.

43. The method of claim 31 wherein the CD8+ cells are Tc cells.

44. The method of claim 43 wherein the Tc cells are tumor infiltrating lymphocytes.

45. A use of a composition for the manufacture of a medicament for activating T lymphocytes against cells expressing ghep 34 (SEQ ID NO:3), which composition is selected from the group consisting of: an isolated polypeptide having the amino acid sequence of ghep34, an immunogenic fragment thereof, a polypeptide with at least 90% sequence identity to ghep34 and which is specifically recognized by an antibody which specifically recognizes ghep34, a polypeptide which has at least 90 % sequence identity with ghep34 and which, when processed and presented in the context of Major Histocompatibility Complex molecules, activates T lymphocytes against cells which express ghep34, an isolated nucleic acid encoding one of these polypeptides, an antigen presenting cell pulsed with a polypeptide comprising an epitope of ghep34, an antigen presenting cell sensitized in vitro to ghep34, an antigen presenting cell sensitized in vitro to an immunogenic fragment of ghep34, an antigen presenting cell sensitized in vitro to a polypeptide with at least 90% sequence identity to ghep34 which is specifically recognized by an antibody which specifically recognizes gheρ34, and an antigen presenting cell sensitized in vitro to polypeptide which has at least 90 % sequence identity with ghep34 which, when processed and presented in the context of Major Histocompatibility Complex molecules, activates T lymphocytes against cells which express ghep34.

46. A method of activating T lymphocytes against cells expressing ghep35 (SEQ ID NO: 5), the method comprising administering to a subject a composition, which composition is selected from the group consisting of: an isolated polypeptide having the amino acid sequence of ghep35, an immunogenic fragment thereof, a polypeptide with at least 90% sequence identity to ghep35 and which is specifically recognized by an antibody which specifically recognizes ghep35, a polypeptide which has at least 90 % sequence identity with ghep35 and which, when processed and presented in the context of Major Histocompatibility Complex molecules, activates T lymphocytes against cells which express ghep35, an isolated nucleic acid encoding one of these polypeptides, an antigen presenting cell pulsed with a polypeptide comprising an epitope of ghep35, an antigen presenting cell sensitized in vitro to ghep35, an antigen presenting cell sensitized in vitro to an immunogenic fragment of ghep35, an antigen presenting cell sensitized in vitro to a polypeptide with at least 90% sequence identity to ghep35 which is specifically recognized by an antibody which specifically recognizes ghep35, and an antigen presenting cell sensitized in vitro to polypeptide which has at least 90 % sequence identity with ghep35 which, when processed and presented in the context of Major Histocompatibility Complex molecules, activates T lymphocytes against cells which express ghep35.

47. The method of claim 46 comprising administering to the subject ghep35 or an immunogenic fragment thereof.

48. The method of claim 46, wherein the polypeptide has at least 90% sequence identity to ghep35 and is specifically recognized by an antibody which specifically recognizes ghep35.

49. The method of claim 46, wherein the polypeptide has at least 90 % sequence identity with ghep35 and, when processed and presented by an antigen presenting cell in conjunction with an MHC molecule, activates T lymphocytes against cells expressing ghep35.

50. The method of claim 46, wherein the composition is administered to a subject who suffers from prostate cancer.

51. The method of claim 46 wherein the administration comprises sensitizing CD8+ cells in vitro to an epitope of a ghep35 protein and administering the sensitized cells to the subject.

52. The method of claim 46, further comprising co-administering to the subject an immune adjuvant selected from a non-specific immune adjuvant, a subcellular microbial product or fraction, a hapten, an immunogenic protein, an immunomodulator, an interferon, a thymic hormone, and a colony stimulating factor.

53. The method of claim 46, comprising administering an antigen presenting cell pulsed with a polypeptide comprising an epitope of ghep35.

54. The method of claim 46, comprising administering a nucleic acid sequence encoding polypeptide comprising an epitope of ghep35, which nucleic acid is in a recombinant virus.

55. The method of claim 46, comprising administering a nucleic acid sequence encoding a polypeptide comprising an epitope of a ghep35 protein.

56. The method of claim 46, further comprising administering an expression vector that expresses a polypeptide comprising an epitope of a ghep35 protein, which expression vector is in a recombinant bacterial cell.

57. The method of claim 46, comprising immunizing the subject with a expression vector that expresses a polypeptide comprising an epitope of a ghep35 protein, which expression vector is in an autologous recombinant cell.

58. The method of claim 46, wherein the CD8+ cells are T_c cells.

59. The method of claim 46, wherein the Tc cells are tumor infiltrating lymphocytes.

60. A use of a composition for the manufacture of a medicament for activating T lymphocytes against cells expressing ghep 35 (SEQ ID NO: 5), which composition is selected from the group consisting of: an isolated polypeptide having the amino acid sequence of ghep35, an immunogenic fragment thereof, a polypeptide with at least 90% sequence identity to ghep35 and which is specifically recognized by an antibody which specifically recognizes ghep35, a polypeptide which has at least 90 %> sequence identity with ghep35 and which, when processed and presented in the context of Major Histocompatibility Complex molecules, activates T lymphocytes against cells which express ghep35, an isolated nucleic acid encoding one of these polypeptides, an antigen presenting cell pulsed with a polypeptide comprising an epitope of ghep35, an antigen presenting cell sensitized in vitro to ghep35, an antigen presenting cell sensitized in vitro to an immunogenic fragment of ghep35, an antigen presenting cell sensitized in vitro to a polypeptide with at least 90% sequence identity to ghep35 which is specifically recognized by an antibody which specifically recognizes ghep35, and an antigen presenting cell sensitized in vitro to polypeptide which has at least 90 % sequence identity with ghep35 which, when processed and presented in the context of Maj or Histocompatibility Complex molecules, activates T lymphocytes against cells which express ghep35.

61. A method for determining whether a subj ect has a ghep35 (SEQ ID NO:5)-expressing cancer, comprising taking a cell sample from said subject from a site other than the prostate, and determining whether a cell in said sample contains a nucleic acid transcript encoding ghep35, or detecting ghep35 produced by translation of the transcript, whereby detection of the transcript or of the protein in said sample indicates that the subject has a ghep35-expressing cancer.

62. The method of claim 61 , comprising detecting the transcript.

63. The method of claim 61 , comprising detecting the protein.

64. The method of claim 61 , comprising contacting RNA from the cell with a nucleic acid probe that specifically hybridizes to the transcript under hybridization conditions, and detecting hybridization.

65. The method of claim 61 , comprising disrupting said cell and contacting a portion of the cell contents with a chimeric molecule comprising a targeting moiety and a detectable label, wherein the targeting moiety specifically binds to ghep35, and detecting the label bound to the ghep35.

66. The method of claim 61 , wherein the sample is a serum sample.

67. An antibody that specifically binds to an epitope of a protein selected from the group consisting of ghep34 (SEQ ID NO:3), an immunogenic fragment thereof, a polypeptide with at least 90% sequence identity to ghep34 and which is specifically recogmzed by an antibody which specifically recognizes ghep34, and a polypeptide which has at least 90 % sequence identity with ghep34 and which, when processed and presented in the context of Major Histocompatibility Complex molecules, activates T lymphocytes against cells which express ghep34.

68. An antibody of claim 67, wherein said protein is ghep34.

69. The antibody of claim 67, further comprising a detectable label.

70. An antibody that specifically binds to an epitope of a protein selected from the group consisting of ghep35 (SEQ ID NO: 5), an immunogenic fragment thereof, a polypeptide with at least 90% sequence identity to ghep35 and which is specifically recognized by an antibody which specifically recognizes ghep35, and a polypeptide which has at least 90 % sequence identity with ghep35 and which, when processed and presented in the context of Major Histocompatibility Complex molecules, activates T lymphocytes against cells which express ghep35.

71. An antibody of claim 70, wherein said protein is ghep35.

72. The antibody of claim 70, further comprising a detectable label.

73. The antibody of claim 72, wherein the detectable label is a radiolabel.

74. A kit for the detection of ghep34 (SEQ ID NO:3)-expressing cells in a sample, said kit comprising a container and an antibody which specifically recognizes ghep34.

75. A kit for the detection of ghep35 (SEQ ID NO:5)-expressing cells in a sample, said kit comprising a container and an antibody which specifically recognizes ghep35.