WO2002033078A1 - A novel-polypeptide, a proliferating cell antigen p120-51.59 and the polynucleotide encoding the polypeptide - Google Patents

Abstract

The present invention discloses a novel polypeptide, a proliferating cell antigen P120-51.59, the polynucleotide encoding the polypeptide and the method for producing the polypeptide by DNA recombinant technology. The invention also discloses the uses of the polypeptide in methods for treating various diseases, such as embryonic development deforming, tumour, infection, autoimmune disease, etc. The invention also discloses the agonistes against the polypeptide and the therapeutic action thereof. The invention also discloses the uses of the polynucleotide encoding the novel proliferating cell antigen P120-51.59.

Description

A new peptide-proliferation cell, antigen P120_51.59 and a polynucleotide encoding this polypeptide Antagonistic field

 The present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, "germ cell antigen P120-51.59, and a polynucleotide sequence encoding the polypeptide. The invention also relates to the polynucleotide and the polypeptide Preparation method and application.Technical background

Self-proliferation is an important function of organisms. During the cell division process, the genetic information contained in the parent cell is transmitted to the two daughter cells, and the cell DM carries all the genetic information of the mother cell. Therefore, DNA needs to be accurately copied into two copies and distributed to two daughter cells. DM replication is a very complicated enzymatic process. It requires more than 30 types of enzymes and proteins. People often call these enzymes and proteins a replication system. Some of these enzymes and proteins are combined and work together to form the so-called replication. body. Among them, DNA polymerase III is the main polymerase that lengthens the DNA chain, and DM polymerase II is extremely complicated. It is known that its total enzyme contains 10 kinds of 22 subunits, and its composition is α ₂ ε ₂ θ ₂ τ ₂ γ

₂ δ, ₂ δ ₂ X ₂ ^ 2 P 4.

 Proliferating cell nuclear antigen is a protein that participates in DNA replication by acting as a DNA polymerase delta cofactor. DM polymerase is responsible for lead strand DNA replication. In addition, PCNA is also involved in nucleotide excision repair (Kuriyan et al. J Mol. Bio 234: 915-925 (1993)). PCNA is a structure-specific endonuclease with three to five exonuclease activities that contact the antigen nucleic acid and is homologous to the endonucleotide repair factor. The signature template of this family is two conserved regions located in the N-terminal part: [GA] ― [LIVMF] -X- [LIVMA] -x- [SAV]-[LIVM] -Dx- [NSAE] ― [HKR ] — [VI] -x- [LY]-[VGA] -x- [LIVM] -x- [LIVM] -x (4) -F and [RKA] -C- [DE]-[RH] -x (3)-[LIVMF]-x (3)-[LIVM] -x- [SGAN]-[LIVMF] -xK- [LIVMF] (2) The second template is combined with DNA. Members of this family can be used to regulate the activity of the immune system, related to autoimmune diseases, cancer and other diseases, and can be used to treat graft versus host diseases (Bravo R., Frank R., Blundell PA, McDonald-Bravo H., Nature 326: 515-517 (1987); Suzuka I., Hata S., Matsuoka M., osugi S., Hashimoto J., Eur. J. Biochem. 195: 571-575 (1991)).

The polypeptide of the present invention and the proliferating cell antigen P120 have 33% and 53% identity and similarity at the amino acid level, respectively, and have similar structural characteristics. They both belong to the proliferating cell antigen P120 family and are therefore named as proliferating cell antigen P120 — 51.59, and it is speculated that it has similar biological functions. As described above, the proliferating cell antigen P120-51.59 protein plays an important role in regulating important functions of the body such as cell division and embryo development, and it is believed that a large number of proteins are involved in these regulatory processes, so more needs to be identified in the art The proliferating cell antigen P120-51.59 protein involved in these processes, especially the amino acid sequence of this protein is identified. The isolation of the new proliferating cell antigen P120-51.59 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for developing diagnostic and / or therapeutic drugs for the disease, so isolating its coding for DM is very important. Object of the invention

 An object of the present invention is to provide an isolated new polypeptide, a proliferating cell antigen P120-51.59, and fragments, analogs and derivatives thereof.

 Another object of the invention is to provide a polynucleotide encoding the polypeptide.

 Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a proliferating cell antigen P120-51.59.

 Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a proliferating cell antigen P120-51.59.

 Another object of the present invention is to provide a method for producing a proliferating cell antigen P120-51.59.

 Another object of the present invention is to provide the polypeptide of the present invention-proliferating cell antigen P120-

51. 59 antibodies.

 Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention, the proliferating cell antigen P120-51.59.

 Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities of the proliferating cell antigen P120-51.59. Summary of invention

 The present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

 The invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;

(b) a polynucleotide complementary to polynucleotide (a); (c) A polynucleotide having at least 70% identity to a polynucleotide sequence of (a) or (b).

 More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 400-1809 in SEQ ID NO: 1; and (b) a sequence having 1-2191 in SEQ ID NO: 1 Sequence of bits.

 The present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.

 The invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.

 The invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of the proliferating cell antigen P120-51.59 protein, which comprises using the polypeptide of the invention. The invention also relates to compounds obtained by this method.

 The present invention also relates to a method for detecting a disease or susceptibility to disease associated with abnormal expression of a proliferating cell antigen P120-51.59 protein in vitro, comprising detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or Detection of the amount or biological activity of a polypeptide of the invention in a biological sample.

 The invention also relates to a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

 The present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of proliferating cell antigen P120-51.59.

 Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein.

The following drawings are used to illustrate specific embodiments of the invention, but not to limit the scope of the invention as defined by the claims.

 Fig. 1 is a comparison diagram of the amino acid sequence homology of the proliferating cell antigen P120-51.59 and the proliferating cell antigen P120 of the present invention. The upper sequence is the proliferating cell antigen P120-51.59, and the lower sequence is the proliferating cell antigen P120. Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by "+".

 Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated proliferating cell antigen P120-51.59. 51. 59kDa is the molecular weight of the protein. The arrow indicates the isolated protein band. Summary of the Invention

Unless otherwise specified, the following terms used in this specification and the requirements have the following meanings: "Nucleic acid sequence" refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and may also refer to genomic or synthetic DNA or RM, which may be single-stranded or double-stranded, representing the sense strand or Antisense strand. Similarly, the term "amino acid sequence" refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof. When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .

 A "variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.

 "Deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.

 "Insert" or "addition" refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule. "Replacement" refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.

 "Biological activity" refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similarly, the term "immunologically active" refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.

 An "agonist" refers to a molecule that, when combined with the proliferating cell antigen P120-51.59, can cause changes in the protein and thereby regulate the activity of the protein. Agonists can include proteins, nucleic acids, carbohydrates, or any other molecule that can bind to the proliferating cell antigen P120-51.59.

 An "antagonist" or "inhibitor" refers to a molecule that can block or regulate the biological or immunological activity of the proliferating cell antigen P120-51.59 when combined with the proliferating cell antigen P120-51.59. Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind to the proliferating cell antigen P 120-51.59.

 "Regulation" refers to a change in the function of the proliferating cell antigen P120-51.59, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological property, function, or immunity of the proliferating cell antigen P120-51.59. Change of nature.

"Substantially pure '" means essentially free of other proteins, lipids, carbohydrates or other substances with which it is naturally associated. Those skilled in the art can purify proliferating cell antigen P120-51.59 using standard protein purification techniques. Basically pure proliferating cell antigen P120-51.59 can be produced on non-reducing polyacrylamide gels Create a single main band. The purity of the proliferating cell antigen P120-51.59 polypeptide can be analyzed by amino acid sequence.

 "Complementary" or "complementary" refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "C-T-G-A" can be combined with the complementary sequence "G-A-C-T". The complementarity between two single-stranded molecules may be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.

 "Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.

"Percent identity" refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences (Higg ins, DG and PM Sharp (1988) Gene 73: 237-244) in different ways according to method _a Clus ter Clus ter method checks the distance between each of all pairs Group sequences are arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:

 Number of residues matching between sequence ^ and sequence ^

Number of residues in sequence ^-sequence ^ (number of intermediate residues-number of interval residues in sequence 3 ^X

Clus ter method or may be used as known in the art by: Fotun Hein Determination of percentage identity between nucleic acid sequences (Hein J., (1990) Methods in enzymology 183: 625-645) 0

"Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences. Amino acids used for conservative substitution, for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

 "Antisense" refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence. "Antisense strand" refers to a nucleic acid strand that is complementary to a "sense strand."

"Derivative" refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives encode major organisms that retain natural molecules Peptides with chemical properties.

"Antibody" refers to a complete antibody molecule and its fragments, such as Fa, F (ab,) ₂ and Fv, which can specifically bind to the epitope of the proliferating cell antigen P120-51.59.

 A "humanized antibody" refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.

 The term "isolated" refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring). For example, a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system. Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.

 As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .

 As used herein, "isolated proliferating cell antigen P120-51.59" refers to proliferating cell antigen P120-51.59 that is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify proliferating cell antigen P120-51.59 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the proliferating cell antigen P120-51.59 polypeptide can be analyzed by amino acid sequence.

 The invention provides a novel polypeptide-proliferating cell antigen? 120-51.59, which basically consists of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptides of the present invention can be naturally purified products, or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude initial methionine residues.

The invention also includes fragments, derivatives and analogs of the proliferating cell antigen P120-51.59. As used in the present invention, the terms "fragment", "derivative" and "analog" refer to a polypeptide that substantially maintains the same biological function or activity of the proliferating cell antigen P120-51.59 of the present invention. A fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution Amino An acid may or may not be encoded by a genetic codon; or (II) such a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or (Π Ι) such A type in which a mature polypeptide is fused to another compound (such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol); or (IV) a type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide ( Such as leader sequences or secreted sequences or sequences used to purify this polypeptide or protease sequences). As set forth herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.

 The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1. The polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 2191 bases, and its open reading frame 400-1809 encodes 469 amino acids. According to the amino acid sequence homology comparison, it was found that this polypeptide has 33% homology with the proliferating cell antigen P120, and it can be deduced that the proliferating cell antigen P120-51. 59 has similar structure and function to the proliferating cell antigen P120.

 The polynucleotide of the present invention may be in the form of DNA or RNA. DNA forms include cDM, genomic DNA, or synthetic DNA. DNA can be single-stranded or double-stranded. DNA can be coding or non-coding. The coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used herein, a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.

 The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.

 The term "polynucleotide encoding a polypeptide" refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.

 The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .

The present invention also relates to a polynucleotide that hybridizes to a sequence described above 50% less, preferably 70% identity). The invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1Vj, bovine serum / 0.1% Fi col l, 42 ° C, etc .; or (3) only between two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%. In addition, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.

 The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used in the present invention, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding the proliferating cell antigen P120-51.59.

 The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity. The specific polynucleotide sequence encoding the proliferating cell antigen P120-51.59 of the present invention can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.

 The DM fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DM sequence to obtain the double-stranded DNA of the polypeptide.

 Of the methods mentioned above, genomic DM is the least commonly used. Direct chemical synthesis of DM sequences is often the method of choice. The more commonly used method is the separation of cDM sequences. The standard method for isolating the cDNA of interest is to isolate mRM from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. Various methods have been used to extract mRNA, and kits are also commercially available (Qiagene). It is also a common method to construct a CDM library (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spiring Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.

 The genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the appearance or loss of marker gene function; (3) determination of the level of transcripts of proliferating cell antigen P120 · ~ 51.59 (4) Detecting protein products expressed by genes through immunological techniques or measuring biological activity. The above methods can be used alone or in combination.

In the method (1), the probe used for hybridization is any part of the polynucleotide of the present invention Homologous, at least 10 nucleotides in length, preferably at least 30 nucleotides, more preferably at least 50 nucleotides, most preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides. The probe used herein is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).

 In the (4) method, the protein product of the proliferating cell antigen P120-51.59 gene can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).

 A method (Sa ik i, et al. Sc ience 1985; 230: 1350-1 354) using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention. In particular, when it is difficult to obtain a full-length cDNA from a library, the RACE method (RACE-Rapid Amplification of cDNA Ends) can be preferably used. The primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods. The amplified DM / RNA fragment can be isolated and purified by conventional methods such as by gel electrophoresis.

 The polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDM sequence of multiple clones in order to splice into a full-length cDNA sequence.

 The present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a proliferating cell antigen P120-51.59 coding sequence, and the recombinant technology to produce the present invention Polypeptide method.

In the present invention, a polynucleotide sequence encoding a proliferating cell antigen P120 to 51.59 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al. Gene, 1987, 56: 125) expressed in bacteria; pMSXND expression vectors expressed in mammalian cells (Lee and Na thans, J Bio Chem. ² 63: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In short, as long as it can be replicated and stabilized in a host, any plasmid and vector can be used to construct a recombinant expression vector. An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.

Methods well known to those skilled in the art can be used to construct a gene containing proliferating cell antigen P120- 51. 59 DM sequences and expression vectors with suitable transcriptional / translational regulatory elements. These methods include in vitro recombinant DM technology, DM synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Molecular Cloning, a Labora tory Manual, Cold Spirit Harbor Labora tory. New York, 1989). The DM sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E. coli; the PL promoter of lambda phage; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, Retroviral LTRs and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.

 In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.

 Those of ordinary skill in the art will know how to select appropriate vector / transcription control elements (such as promoters, enhancers, etc.) and selectable marker genes.

 In the present invention, a polynucleotide encoding a proliferating cell antigen P120-51.59 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector. . The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E. coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as fly S2 or Sf9; animal cells such as CH0, COS or Bowes melanoma cells.

Transformation of a host cell with a DNA sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as E. coli, competent cells capable of absorbing DNA can be harvested after exponential growth and treated with CaCl. The steps used are well known in the art. Alternatively, MgCl ₂ is used. If necessary, transformation can also be performed by electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.

Using conventional recombinant DNA technology, the polynucleotide sequence of the present invention can be used to express or produce recombinant proliferating cell antigen P120-51. 59 (Science, 1984; 224: 1431). Generally have The following steps:

 (1) using a polynucleotide (or variant) encoding the human proliferating cell antigen P120-51.59 of the present invention, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;

 (2) culturing host cells in a suitable medium;

 (3) Isolate and purify protein from culture medium or cells.

 In step (2), depending on the host cell used, the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

 In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.

 The polypeptides of the present invention, as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.

 Proliferating cell nuclear antigen (PCNA) is a DM polymerase del ta cofactor. In the human body, it is involved in the processes of DNA replication and nucleotide excision repair. In addition, members of this protein family also play a role in regulating the activity of the immune system. Its abnormal expression can cause human DNA replication, cell proliferation, and disorders of the immune system, which can lead to the occurrence of related diseases.

 The polypeptide and the proliferating cell nuclear antigen of the present invention are proliferating cell antigen P120, which contains characteristic sequences of the protein family, and both have similar biological functions. The abnormal expression of the polypeptide in vivo can cause human DNA replication, cell proliferation and the immune system Disorders, which in turn lead to the development of embryonic malformations, tumors, and immune disorders, including but not limited to:

 Common Embryonic Malformations

 1. Common deformities of face, neck and limbs:

 1. Cleft lip (most common, with alveolar cleft and cleft palate), cleft lip, facial oblique cleft, cervical pouch, cervical fistula, etc.

 2. Common deformities of the limbs:

1) Missing limbs: Horizontal absence (congenital short limbs): no arms, no forearms, no hands, no fingers, no legs, no toes, etc .; longitudinal absences: radial / ulnar abscess of upper extremity, tibia / fibula absent of lower extremity, etc .;

 Seal-like hand / foot deformities, etc .;

 2) Limb differentiation disorder: Absence of a certain muscle or muscle group, joint dysplasia, bone deformity, bone fusion, multi-finger (toe) deformity, finger (toe) deformity, horseshoe varus, etc .;

 Common malformations of the digestive system:

 Bloating thyroglossal ducts, occlusion or stenosis of the digestive tract, ileal diverticulum, umbilical fistula, congenital umbilical hernia, congenital aganglion-free megacolon, impervious anus, abnormal bowel transition, bile duct atresia, circular pancreas, etc

 3. Common malformations of the respiratory system: laryngotracheal stenosis / occlusion, tracheoesophageal fistula, hyaline membrane disease, unilateral lung does not occur, ectopic lung lobe, congenital lung cyst, pulmonary insufficiency, etc .;

 4. Common deformities of the urinary system: polycystic kidney, ectopic kidney, horseshoe kidney, double ureter, umbilical fistula, bladder eversion, etc.

 V. Common malformations of the reproductive system: cryptorchidism, congenital inguinal hernia, double uterus, vaginal atresia, hypospadias, true / false hermaphroditism, testicular feminization syndrome, etc.

 6. Common malformations of the cardiovascular system: atrial septal defect, ventricular septal defect, abnormal separation of arterial trunk (dislocation of aorta and pulmonary artery, aortic or pulmonary stenosis), open artery duct, etc.

 7. Common malformations of the nervous system: neural tube defects (no cerebellar malformations, spina bifida, spinal meningocele, hydrocephalous meningoencephalocele), hydrocephalus inside / outside the brain, etc.

 8. Common malformations of eyes and ears: iris defect, retention of pupillary membrane, congenital cataract, congenital glaucoma, sole / no / small eye deformity, congenital deafness, auricle deformity, etc.

 Common tumors in various tissues:

 I. Epithelial tissue:

 Papilloma, squamous cell carcinoma [skin, nasopharynx, larynx, cervix], adenoma (carcinoma) [breast, thyroid], mucinous / serous cystadenoma (carcinoma) [ovarian], basal cell carcinoma [head and face Skin], (malignant) polytype adenoma [extending gland], papilloma, transitional epithelial cancer [bladder, renal pelvis], etc .;

 Mesenchymal organization:

Fibrous (sarcoma) [limbs], (Malignant) fibrohistiocytoma [limbs], lipo (sarcoma) [subcutaneous tissue, lower limbs, retroperitoneum], leiomyosarcoma (uterus and gastrointestinal), striated muscle (Sarcoma) [head and neck, genitourinary tract, limbs], hemangio (sarcoma), lymphangioma (sarcoma) [skin, subcutaneous tissue, tongue, lips], bone (sarcoma) [cranium, long bone], (malignant Giant cell tumor [femoral / tibia / upper humerus], cartilage (sarcoma) [hand and foot short bone, pelvis / rib / femur / humerus / scapula], synovial (sarcoma) tumor [knee / ankle / wrist / shoulder / Near the elbow], (malignant) mesothelioma [thoracic / peritoneal], etc .; Three. Lymphatic hematopoietic tissue:

 Malignant lymphoma [Neck, mediastinum, mesenteric and retroperitoneal lymph nodes], various leukemias [lymphoid hematopoietic tissue], multiple myeloma [push / thoracic / rib / skull and long bone], etc .;

 4. Nervous tissue:

 Nerve fiber (sarcoma) [systemic cutaneous nerve / deep nerve and internal organs], (malignant) schwannoma [nervous of head, neck, limbs, etc.], (malignant) glioblastoma [brain], medulloblastoma [ Cerebellum], (malignant) meningiomas [meninges 1, ganglioblastoma / neuroblastoma [mediastinum and retroperitoneum / adrenal medulla], etc .;

 V. Other tumors:

 Moles, malignant melanoma [skin, mucous membrane], (malignant) hydatidiform mole, chorionic epithelial cancer [uterine], (malignant) supporter cells, stromal cell tumor, (malignant) granulosa cell tumor [ovarian, testicular], fine Blastoma [testis], asexual cell tumor [ovary], embryonal cancer [testis, ovary], (malignant) teratoma [ovary, testis, mediastinum and palate tail], etc .;

 Immune disorders

 1. Defects in cellular immune function can lead to various intracellular parasitic infections and various viral infections. These diseases include but are not limited to:

 1) Intracellular parasitic infections: typhoid, paratyphoid (typhoid), tuberculosis (tuberculosis), leprosy (leprosy), wave thermal conductivity (brutella), etc .;

 2) Various viral infectious diseases: such as measles virus (measles, measles bronchitis, pneumonia, otitis media, subacute sclerosis and panencephalitis), herpes virus (shingles, chicken pox), etc .;

 3) Other, certain fungal (Candida albicans) infections, etc .;

 2. Humoral immune deficiency can cause various extracellular parasites and various viral infections. These diseases include but are not limited to:

 1) Various extracellular parasitic infections: lobular pneumonia, otitis media, mastoiditis, sinusitis, meningitis, sepsis (pneumococcus), epidemic meningococcal (meningococcus), trauma, burns Infection (Pseudomonas aeruginosa), etc .;

 2) Various viral infections: poliovirus (poliomyelitis), hepatitis virus (A, B, C, D, E, H, G), etc .;

 3) Others, such as parasite (Pneumocystis carinii) infection, etc .;

 3. Patients with primary immunodeficiency are prone to malignant tumors, with leukemia and lymphomas (malignant lymphoma [neck, mediastinum, mesenteric and retroperitoneal lymph nodes]) being the most common;

4. Primary immunodeficiency patients are prone to autoimmune diseases, such as SLE, rheumatoid arthritis and malignant disease. W 02 anemia is more common;

 To sum up, the polypeptide of the present invention and the antagonist, agonist and inhibitor of the polypeptide can be directly used for the treatment of various diseases, such as embryonic malformation, tumor, infection, autoimmune disease, and the like.

 The invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) the proliferating cell antigen P120-51.59. Do agonists increase proliferating cell antigens? 120-51. 59 stimulates biological functions such as cell proliferation, and antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers. For example, mammalian cells or membrane preparations expressing proliferating cell antigen P120-51.59 can be cultured with labeled proliferating cell antigen P120-51.59 in the presence of drugs. The ability of the drug to increase or block this interaction is then measured.

 Antagonists of the proliferating cell antigen P120-51.59 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of the proliferating cell antigen P120-51.59 can bind to the proliferating cell antigen P120-51.59 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot function biological functions.

 In screening compounds that act as antagonists, proliferating cell antigen P120-51.59 can be added to the bioanalytical assay and determined by measuring the effect of the compound on the interaction between proliferating cell antigen P120 ~~ 51.59 and its receptors. Whether the compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same way as above for screening compounds. Polypeptide molecules capable of binding to the proliferating cell antigen P120-51.59 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. During screening, the proliferating cell antigen P120-51.59 molecule should generally be labeled.

 The present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides antibodies directed against the proliferating cell antigen P120-51.59 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.

Polyclonal antibodies can be produced by proliferating cell antigen P120-51. 59 by direct injection in immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's Adjuvant, etc. Techniques for preparing monoclonal antibodies to the proliferating cell antigen P120- 51. 59 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridization Tumor technology, EBV-hybridoma technology, etc. Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). ₀ Existing techniques for producing single-chain antibodies (US Pat No. 4946778) can also be used to produce single chain antibodies against the anti-proliferating cell antigen P120-51.59. Antibodies against proliferating cell antigen P120-51.59 can be used in immunohistochemical techniques to detect proliferating cell antigen P120-51.59 in biopsy specimens.

 Monoclonal antibodies that bind to proliferating cell antigen P120-51.59 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

 Antibodies can also be used to design immunotoxins against a specific bead site in the body. For example, proliferating cell antigen P120- 51. 59. High-affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP, and bind the toxin to the antibody through the disulfide exchange. This hybrid antibody can be used to kill the proliferating cell antigen P120-51.59 positive Cell.

 The antibodies of the present invention can be used to treat or prevent diseases related to the proliferating cell antigen P120-5 L 59. The proper dose of antibody can stimulate or block the production or activity of proliferating cell antigen P120-51.59.

 The invention also relates to a diagnostic test method for quantitatively and locally detecting the level of the proliferating cell antigen P120-51.59. These tests are well known in the art and include FISH assays and radioimmunoassays. The level of proliferating cell antigen P120- 51. 59 detected in the test can be used to explain the importance of proliferating cell antigen P120- 51. 59 in various diseases and to diagnose proliferating cell antigen P120 ~ · 51. 59. Disease.

 The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.

The polynucleotide encoding the proliferating cell antigen P120-51.59 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of the proliferating cell antigen Pl ² 0 ~~ 51.59. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated proliferating cell antigen P120-51.59 to inhibit endogenous proliferating cell antigen P120-51.59 activity. For example, a variant proliferating cell antigen P120-51.59 may be a shortened proliferating cell antigen P120 ~ · 51.59 that lacks a signaling functional domain. Although it can bind to downstream substrates, it lacks signaling activity. . Therefore, the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of the proliferating cell antigen Pl ² 0-51. 59. Virus-derived expression vectors such as retroviruses, adenoviruses, adenovirus-associated viruses, herpes simplex virus, parvoviruses, and the like can be used to transfer polynucleotides encoding the proliferating cell antigen Pl ^{2 0 to} 51. 59 into cells. A method for constructing a recombinant viral vector carrying a polynucleotide encoding a proliferating cell antigen P120-51.59 can be found in the literature (Sambrook, et a l.). In addition, the recombinant polynucleotide encoding the proliferating cell antigen P120-51.59 can be packaged into liposomes and transferred into cells.

 Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.

 Oligonucleotides (including antisense RNA and DM) and ribozymes that inhibit the proliferating cell antigen P120-51.59 are also within the scope of the present invention. A ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation. Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides. Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the MA. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.

 The polynucleotide encoding the proliferating cell antigen P120-51.59 can be used for the diagnosis of diseases related to the proliferating cell antigen P120-51.59. The polynucleotide encoding the proliferating cell antigen P120-51.59 can be used to detect the expression of the proliferating cell antigen P120-51.59 or the abnormal expression of the proliferating cell antigen P120-51.59 in a disease state. For example, the DNA sequence encoding the proliferating cell antigen P120- · 51.59 can be used to hybridize biopsy specimens to determine the expression status of the proliferating cell antigen P120-51.59. Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available. A part or all of the polynucleotide of the present invention can be used as a probe to be fixed on a micro array or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in a tissue. RM-polymerase chain reaction (RT-PCR) in vitro amplification with proliferating cell antigen PU 0-51.59 specific primers can also detect the transcription product of proliferating cell antigen P120-51.59.

 Detection of mutations in the proliferating cell antigen P120-51.59 gene can also be used to diagnose diseases related to the proliferating cell antigen P120-51.59. Proliferating cell antigen P120-51.59 mutations include point mutations, translocations, deletions, recombination, and any other abnormalities compared to normal wild-type proliferating cell antigens P120 · ~ 51.59 DM sequences. Mutations can be detected using existing techniques such as Southern blotting, DM sequence analysis, PCR and in situ hybridization. In addition, mutations may affect the expression of proteins. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.

The sequences of the invention are also valuable for chromosome identification. This sequence will be specific to someone The chromosome is in a specific location and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for labeling chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.

 In short, PCR primers (preferably 15-35bp) are prepared from the cDNA, and the sequences can be located on the chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.

 PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes. Using the oligonucleotide primers of the present invention, in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.

 Fluorescent in situ hybridization (FISH) of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step. For a review of this technique, see Verma et al., Human Chromosomes: a Manu l of Basic Techniques, Pergamon Pres s, New York (1988).

 Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in V. Mckusick, Mendelian Inherance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.

 Next, the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).

 'The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

The present invention also provides a kit or kit containing one or more containers, the containers containing one or more An ingredient of the pharmaceutical composition of the present invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders authorize them to be administered to humans by government agencies that manufacture, use, or sell them. In addition, the polypeptides of the invention can be used in combination with other therapeutic compounds.

 The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. Proliferating cell antigen P120-51. 59 is administered in an amount effective to treat and / or prevent a specific indication. The amount and range of P120-51.59 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples

 The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods without specific conditions in the following examples are generally performed according to the general conditions such as Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Harbor Harbor Laboratory Pres s, 1989), or according to the conditions Conditions recommended by the manufacturer.

 Example 1 Cloning of Proliferating Cell Antigen P120-51.59

Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Using Quik mRNA solat I ion Ki t ( Qiegene Products) isolating _{poly (A) mRNA 0 2ug poly} (A) mRNA from total RNA by reverse transcription form cDNA. A Smart cDM cloning kit (purchased from Clontech) was used to insert the cDNA fragment into the multicloning site of pBSK (+) vector (Clontech) to transform DH5α to form a cDNA library. The sequences at the 5 'and 3' ends of all clones were determined using a Dye terminate cycle reaction ionizing kit (Perkin-Elmer) and an ABI 377 automatic sequencer (Perkin-Elmer). The determined cDNA sequence was compared with an existing public DM sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 1212b08 was new DNA. A series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions. The results showed that the full-length cDNA contained in the 1212b08 clone was 2191bp (as shown in Seq ID N0: 1), and there was an Ml Obp open reading frame (0RF) from 400bp to 1809bp, encoding a new protein (such as Seq ID NO: 2). We named this clone pBS-1212b08, and the encoded protein was named proliferating cell antigen P120-51.59. Example 2 Homologous search of cDNA clones

The sequence of the proliferating cell antigen P120-51.59 of the present invention and the protein sequence encoded by the same are used by Blas t The program (Basic loca l al ignment search tool) [Al tschul, SF et al. J. Mol. Biol. 1990; 215: 403-10] performs homology search in databases such as Genbank, Switzerland, and so on. The gene with the highest homology to the proliferating cell antigen PΠ 0-51.59 of the present invention is a known proliferating cell antigen P120, and the accession number encoded by the protein in Genbank is AJ248288. The protein homology results are shown in Figure 1. The two are highly homologous, with 33% identity; 53% similarity. Example 3 The gene encoding the proliferating cell antigen P120-51.59 was cloned by RT-PCR. The total RNA of fetal brain cells was used as a template, and oligo-dT was used as a primer to perform reverse transcription reaction to synthesize cDNA. , Using the following primers for PCR amplification:

 Primerl: 5'- GGTTTTTGGAAATTGATAGAAAAG -3, (SEQ ID NO: 3)

 Primer 2: 5,-CACATCAAATATTGCTAATTTATT -3 '(SEQ ID NO: 4)

 Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;

 Pr imer2 is the 3'-end reverse sequence in SEQ ID NO: 1.

Amplification reaction conditions: containing 50mmol / L KCl in a reaction volume of ₅₀ μ 1, 10mmol / L Tri s-HCl pH8 5, 1. 5mraol / L MgCl 2, 200 μ ηιο1 / 1 dNTP, l Opmol primer. 1U of Taq DNA polymerase (Clontech). The reaction was performed on a PE ^ OO DM thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94. C 30sec; 55 ° C 30sec; 72 ° C 2min. During RT-PCR, β-act in was set as a positive control and template blank was set as a negative control. The amplified product was purified using a QIAGEN kit and ligated to a PCR vector using a TA cloning kit (Invitrogen). The DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as 1-2191bp shown in SEQ ID NO: 1. Example 4 Northern blot analysis of the expression of the proliferating cell antigen P120-51.59 gene Total RM was extracted in one step [Anal. Biochem 1987, 162, 156-159]. This method involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue was homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1), centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water. Using 20 μ _§ RNA, electrophoresis was performed on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0) -5raM sodium acetate-IraM EDTA-2, 2M formaldehyde. It was then transferred to a nitrocellulose membrane. A ³² P dATP was used to prepare ³² P-labeled DM probes by random primer method. The DM probe used was the PCR-amplified proliferating cell antigen P120-51.59 coding sequence (400bp to 1809, bp) shown in FIG. 1. A 32P-labeled probe (approximately 2 × 10 ⁶ cpm / ral) and RNA-transferred nitrocellulose membrane were placed in a solution at 42 ° C. C hybridization overnight, the solution contains 50% formamide-25mM KH ₂ P0 ₄ (pH7. 4)-5 <33 (]-5 <061111 & 1, 3 solutions and ²⁰ (^ 8/1111 salmon sperm 0.) After hybridization, the filter was placed in 1 x SSC-0. 1% SDS at 55 ° C was washed for 30 min. Then, Phosphor Imager was used for analysis and quantification. Example 5 In Vitro Expression, Isolation and Purification of Recombinant Proliferating Cell Antigen P120-51.59 In accordance with the coding region sequence shown in SEQ ID NO: 1 and Figure 1, design A pair of specific amplification primers was generated, and the sequence is as follows:

Pr imer3: 5 '-CCCCATATGATGTCTATTTTCCCTAAGATATCT- 3' (Seq ID No: 5) Pr imer4: 5'-CCCAAGCTTCTATGTGCTTTTGCATTTTACAAA-3 '(Seq ID No: 6) These two primers contain Ndel and Hindll l digestion respectively 3, and coding sequences for the 5 'and 3' ends of the gene of interest, respectively. The Ndel and Hindll l digestion sites correspond to the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3 Selective endonuclease sites on). The pBS-1212b08 plasmid containing the full-length target gene was used as a template for the PCR reaction. PCR reaction conditions were: 1 in a total volume of ₅₀ μ plasmid pBS-1212b08 containing 10pg, primer Primer - 3 respectively, and Pr imer- 4 l Opmol, Advantage polymerase Mix (Clontech Products) 1 _μ 1. Cycle parameters: 94. C 20s, 60. C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and Hindl11 were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into E. coli DH5a by the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 30 μ _§ / ιη1), positive clones were selected by colony PCR method and sequenced. A positive clone (PET-1212b08) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method. In containing kanamycin (final concentration of 3 (^ g / ml) of LB liquid medium, host strain BL21 _(P ET-1212b08) incubated at 37 ° C to logarithmic phase, IPTG was added to a final concentration of 1 implicit ol / L, continue to culture for 5 hours. Centrifuge to collect the bacteria, blast the bacteria with ultrasound, collect the supernatant by centrifugation, and use an affinity chromatography column His s. Bind Quick that can bind 6 histidines (6His-Tag). Cartridge (product of Novagen) was chromatographed to obtain purified target protein proliferating cell antigen P120-51. 59. After SDS-PAGE electrophoresis, a single band was obtained at 51.59kDa (Figure 2). The band was transferred to a PVDF membrane and the N-terminal amino acid sequence was analyzed by the Edams hydrolysis method. As a result, the 15 amino acids at the N-terminus were completely identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2. Example 6 Anti-proliferation Production of Cell Antigen P120- 51. 59 Antibody

 Polypeptide synthesizer (product of PE company) was used to synthesize the following proliferating cell antigen P120- 51. 59 specific peptides:

NH2-Met-Ser-I le-Phe-Pro-Lys-I le-Ser-Leu-Arg-Pro-Glu-Val-Glu-Asn-C00H (SEQ ID NO: 7). The polypeptide is coupled with hemocyanin and bovine serum albumin to form a complex, respectively. See: Avrameas, et al. Immunochemistry, 1969; 6:43. Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once. A titer plate coated with 15 _g / ml bovine serum albumin peptide complex was used as an ELISA to determine the antibody titer in rabbit serum. Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose. The peptide was bound to a cyanogen bromide-activated Sephar _0Se 4B column, and the anti-peptide antibody was separated from the total IgG by affinity chromatography. The immunoprecipitation method proved that the purified antibody could specifically bind to the proliferating cell antigen P120-51.59. Example 7 Application of the polynucleotide fragment of the present invention as a hybridization probe

 Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways. For example, the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.

 The purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method Acid sequence or a homologous polynucleotide sequence thereof. Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter. These same steps are as follows: The sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer. The pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of membrane washing steps. This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals. The probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention The polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment. In this example, the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.

 First, the selection of the probe

 The selection of oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:

 1. The preferred range of probe size is 18-50 nucleotides;

2. The GC content is 30% -70%, and the non-specific hybridization increases when it exceeds; 3. There should be no complementary regions inside the probe;

 4. Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other unknown genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;

 5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments. After completing the above analysis, select and synthesize the following two probes:

 Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):

 5'-TGTCTATTTTCCCTAAGATATCTTTGAGACCTGAGGTTGAA-3 '(SEQ ID NO: 8) Probe 1 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutation sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (understand):

 5'-TGTCTATTTTCCCTAAGATACCTTTGAGACCTGAGGTTGAA-3 '(SEQ ID NO: 9) For other commonly used reagents and their preparation methods related to the following specific experimental steps, please refer to the literature: DNA PROBES GH Kel ler; MM Manak; Stockton Press, 1989 ( USA) and more commonly used molecular cloning laboratory manual books such as "Molecular Cloning Experiment Guide" (Second Edition 1998) [US] Sambrook et al., Science Press.

 Sample Preparation:

 1. Extract DNA from fresh or frozen tissue

Steps: 1) Place fresh or freshly thawed normal liver tissue in a plate immersed in ice and filled with phosphate buffered saline (PBS). Cut the tissue into small pieces with scissors or a scalpel. Keep tissue moist during operation. 2) Centrifuge the tissue at 1,000 g for 10 minutes. 3) Suspend the pellet (approximately 10 ml / g) with cold homogenization buffer (0.25 mol / L sucrose; 25 mmol / L Tris-HCl, pH 7.5; 25 ramol / L NaCl; 25 ol / L MgCl ₂ ). 4) Homogenize the tissue suspension at 4 ° C at full speed with an electric homogenizer until the tissue is completely broken. 5) Centrifuge at 1000g for 10 minutes. 6) Resuspend the cell pellet (1-5 ml per 0.1 g of the initial tissue sample), and centrifuge at 1,000 g for 10 minutes. 7) Resuspend the pellet in lysis buffer (add ltnl per 0.1 g of the initial tissue sample), and then follow the phenol extraction method below.

 2, DNA phenol extraction method

Steps: 1) Wash the cells with 1-10ml cold PBS and centrifuge at 1000g for 10 minutes. 2) Resuspend the pelleted cells with cold cell lysate (lx 10 ⁸ cells / ml). Use a minimum of 100ul lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is added directly to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 ⁷ cells. 4) Protease K was added to a final concentration of ^{2 00ug} / ml. ⁵⁾ 5 0 ° C or incubated gently shaking for 1 hour at 37 ° C overnight. 6) Extract with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge in a small centrifuge tube for 10 ^ minutes. The two should be clearly separated, otherwise centrifuge again. 7) Transfer the water phase to a new tube. 8) Extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 9) Transfer the DNA-containing aqueous phase to a new tube. Purification of DM and ethanol precipitation were then performed.

 3. Purification of DNA and ethanol precipitation

Steps: 1) Add 1/10 volume of 2mol / L sodium acetate and 2 volumes of cold 100% ethanol to the DNA solution and mix. At -20. C Let stand for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) Wash the pellet with 500ul of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol. Wash the pellet with 500ul of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, then invert on the absorbent paper to drain off the residual ethanol. Air dry for 10-15 minutes to allow the surface ethanol to evaporate. Be careful not to allow the pellet to dry completely, otherwise it will be more difficult to re-dissolve. 7) Resuspend the DNA pellet in a small volume of TE or water. Vortex at low speed or suck with a dropper while gradually increasing TE, mix until the DNA is fully lysed, and add approximately 1 ul for each 1-5 × 10 ^δ cells extracted.

 The following steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.

8) Add RNase A to DM solution to a final concentration of 100ug / ml, 37. C was held for 30 minutes. 9) Add .SDS and proteinase K to final concentrations of 0.5% and 100ug / ml. 37. C was held for 30 minutes. 10) Extract the reaction solution with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase and re-extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 12) Carefully remove the water phase, add 1/10 volume of 2mol / L sodium acetate and 2.5 volume of cold ethanol, mix well and set to -20. C for 1 hour. 13) Wash the pellet with 70% ethanol and 100% ethanol, air dry, and resuspend the nucleic acid. The process is the same as steps 3-6. 14) Determine A _2fi . And A ₂₈ . To check the purity and yield of DM. 15) Store at -20 after packing. (.

 Preparation of sample film:

 1) Take 4x2 pieces of nitrocellulose membranes (NC membranes) of appropriate size, and mark the spotting position and sample number on it with a pencil. Two NC membranes are required for each probe, so that they can be used in the following experimental steps. The film was washed with high-strength conditions and strength conditions, respectively.

 2) Pipette and control 15 microliters each, spot on the sample film, and dry at room temperature.

 3) Place on filter paper infiltrated with 0.1 mol / L NaOH, 1.5 mol / L NaCl for 5 minutes (twice), dry and put in 0.5 mol / L Tris-HCl (pH 7.0), 3 mol / L NaCl filter paper for 5 minutes (twice) and allowed to dry.

 4) Clamped in clean filter paper, wrapped in aluminum foil, and dried under vacuum at 60-80 ° C for 2 hours.

 Labeling of probes

1) 3μ1 Probe (0.1OD / Ιθμΐ), add 2μ1 Kinase buffer, 8-10 uCi γ- ³² P-dATP + 2U Kinase to make up to a final volume of 20μ1. ' 2) Incubate at 37 ° C for 1 hour.

 3) Add 1/5 volume of Bromophenol Blue Indicator (BPB).

 4) Pass through a Sephadex G-50 column.

5) Start to collect the first peak before ³² P-Probe washes out (can be monitored by Monitor).

 6) 5 drops / tube, collect 10-15 tubes.

 7) Monitor the amount of isotope with a liquid scintillator.

8) After combining the collection solutions of the first peak, the ³² P-Probe (the second peak is free γ- ³² P-dATP) is prepared.

 Pre-hybridization

 The sample membrane was placed in a plastic bag, and 3 to 10 mg of prehybridization solution (10xDenhardt> s; 6xSSC, 0.1 mg / ml CT DM (calf thymus DNA)) was added. After sealing the bag, shake at 68 ° C for 2 hours.

 Cross

 Cut a corner of the plastic bag, add the prepared probe, seal the bag, and shake it at 42 ° C in a water bath overnight. Wash film:

 High-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1 SDS, 40. C Wash for 15 minutes (twice).

 3) Wash in 0.1xSSC, 0.1% SDS for 15 minutes at 40 ° C (twice).

 4) 0. lxSSC, 0.1 ° /. Wash in SDS at 55 ° C for 30 minutes (twice) and dry at room temperature. Low-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, wash at 37 ° C for 15 minutes (twice).

 3) 0.1xSSC, 0.1 SDS, 37. C Wash for 15 minutes (twice).

 4) Wash in 0.1xSSC, 0.1% SDS at 40 ° C for 15 minutes (twice), and dry at room temperature.

X-ray autoradiography:

 -70 ° C, X-ray autoradiography (pressing time depends on the radioactivity of the hybrid spot).

 Experimental results:

 The hybridization experiments performed under low-intensity membrane washing conditions showed no significant difference in the radioactive intensity of the above two probes. However, in the hybridization experiments performed under high-intensity membrane washing conditions, the radioactive intensity of probe 1 was significantly stronger than that of hybridization spots. The radioactive intensity of the hybridization spot of the other probe. Therefore, the presence and differential expression of the polynucleotide of the present invention in different tissues can be analyzed qualitatively and quantitatively with the probe 1.

Claims

Uncle demand

1. An isolated polypeptide-proliferating cell antigen P120-51.59, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID NO: 2, or an active fragment, analog, or derivative thereof. .

 2. The polypeptide according to claim 1, characterized in that the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.

 3. The polypeptide according to claim 2, characterized in that it comprises a polypeptide having the amino acid sequence shown in SEQ ID NO: 2.

 4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having an amino acid sequence shown in SEQ ID NO: 2 or a fragment, analog, or derivative thereof;

 (b) a polynucleotide complementary to polynucleotide (a); or

 (c) A polynucleotide that is at least 70% identical to (a) or (b).

 5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence represented by SEQ ID NO: 2.

 6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises a sequence of positions 400-1809 in SEQ ID NO: 1 or a sequence of positions 1-2191 in SEQ ID NO: 1. sequence.

 7. A recombination vector containing an exogenous polynucleotide, characterized in that it is a recombination constructed by the polynucleotide according to any one of claims 4-6 and a plasmid, virus or a carrier expression vector Carrier.

 8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from one of the following host cells:

 (A) a host cell transformed or transduced with the recombinant vector of claim 7; or

 (b) a host cell transformed or transduced with a polynucleotide according to any one of claims 4-6.

 9. A method for preparing a polypeptide having proliferating cell antigen P120-51.59 activity, characterized in that the method includes:

 (a) culturing the engineered host cell of claim 8 under the condition of expressing the proliferating cell antigen P12 G-51.59;

(b) A polypeptide having proliferating cell antigen P120-51.59 activity is isolated from the culture.

10. An antibody capable of binding to a polypeptide, characterized in that the antibody is an antibody capable of specifically binding to the proliferating cell antigen P120-51.59.

 11. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they are compounds that mimic, promote, antagonize or inhibit the activity of the proliferating cell antigen P120-51.59.

 12. The compound according to claim 11, characterized in that it is an antisense sequence of the polynucleotide sequence shown in SEQ ID NO: 1 or a fragment thereof.

 1 3. A use of the compound according to claim 11, characterized in that the compound is used for regulating proliferating cell antigen? 120-51. 59 Method of in vivo and in vitro activity.

 14. A method for detecting a disease or susceptibility to a disease associated with a polypeptide according to any one of claims 1-3, characterized in that it comprises detecting the expression level of the polypeptide, or detecting the activity of the polypeptide Or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.

 15. Use of the polypeptide according to any one of claims 1-3, characterized in that it is used for screening mimetics, agonists, antagonists or inhibitors of the proliferating cell antigen P120-51.59; or Identification of peptide fingerprints.

 16. The application of the nucleic acid molecule according to any of the claims 4-6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or for manufacturing Gene chip or microarray.

 17. Use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that the polypeptide, polynucleotide or mimetic, agonist, antagonist is used Or the inhibitor is composed of a safe and effective dose with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with the abnormality of the proliferating cell antigen P120-51.59.

 18. The use of a polypeptide, polynucleotide or compound according to any one of claims 1 to 6 and 11, characterized in that the polypeptide, polynucleotide or compound is used for the preparation of treatments such as embryonic developmental abnormalities, Drugs for tumors, infections, autoimmune diseases.