WO2002032936A2

WO2002032936A2 - E. histolytica-specific antibodies and clinical uses thereof

Info

Publication number: WO2002032936A2
Application number: PCT/CA2001/001443
Authority: WO
Inventors: Kevin C. Kain; Yvonne C. W Yau; Ian Crandall
Original assignee: Kain Kevin C; Yau Yvonne C W; Ian Crandall
Priority date: 2000-10-20
Filing date: 2001-10-22
Publication date: 2002-04-25
Also published as: WO2002032936A9; WO2002032936A3; AU2001295337A1

Abstract

Invasive amoebiasis is caused by the pathogenic protozoa Entamoeba histolytica. E. histolytica is genetically distinct but morphologically identical to a nonpathogenic species Entamoeba dispar. Current methods for distinguishing between these species generally require the use of fresh, unpreserved stool specimens. This requirement limits their use in developed countries since the great majority of specimens are submitted preserved in stool fixative. This invention provides a method for generating monoclonal antibodies against the recombinant 170 kDa subunit of the Gal/GalNAc specific lectin of E. histolytica, that specifically recognize E. histolytica, but not E. dispar, in preserved stool samples. These antibodies do not cross-react with other bowel protozoa including Entamoeba coli, Giardia lamblia, and Dientamoeba fragilis. This invention also provides a method of expressing a functional recombinant 170 kDa subunit of the Gal/GalNAc specific lectin of E. histolyca and its cysteine-rich fragment in Spodoptera frugiperda cells infected by recombinant baculoviruses: The recombinant protein is used for developing improved vaccines and diagnostic tests.

Description

Expression of Biologically Active Recombinant Gal/GalNAc Specific Lectin of Entamoeba histolytica and Diagnostic Test for E. histolytica Infection in Preserved Fecal Samples

TECHNICAL FIELD

The present invention relates to the diagnosis, analysis and therapy of parasitic diseases. In particular, this invention provides a method to detect and distinguish the pathogenic Entamoeba histolytica from the non-pathogenic Entamoeba dispar in preserved fecal samples. This invention also provides a method of expressing the cell surface lectin of E. histolytica.

BACKGROUND ART

Expression of E. histolytica lectin

As the third leading cause of death from parasitic infections, E. histolytica is responsible for 40 to 50 million cases of amoebic colitis and liver abscess, and 40,000 to 1 10,000 deaths annually [1]. Adhesion of E. histolytica trophozoites to colonic mucin and epithelial cells plays a central role in amoebic colonization of the colon. Adhesion is also a requirement for the subsequent contact-dependent cytolysis of epithelial and immune effector cells leading to invasion of the host [2].

Adherence and contact-dependent killing of host cells is mediated via a 260 kDa cell surface lectin of E. histolytica trophozoites [3]. This novel lectin, a heterodimeric glycoprotein consisting of heavy (170 kDa) and light (31/35 kDa) subunits linked by disulfide bonds [4-7], recognizes non-reducing terminal galactose (Gal) and N-acetyl- galactosamine (GalNAc) residues present in colonic mucin and cell surface carbohydrates [8, 9]. The 170 kDa heavy subunit (HGL) is encoded by a family of genes (hgl 1 to 5) [10]. Three of these genes (hgl 1 to 3) have been completely sequenced [10-12]. Sequence analysis indicates that the heavy subunit is an integral membrane protein containing a carboxyl-terminal cytoplasmic and transmembrane domain, and an extensive extracellular cysteine-rich domain [ 1 1 , 12]. It is heavily glycosylated with 9 to 16 potential N-linked glycosylation sites. The position and number of the 97 cysteine residues in every gene is conserved, suggesting their importance for lectin structure and function [ 10- 12]. Both adherence-inhibitory and - enhancing monoclonal antibody epitopes have been mapped to the cysteine-rich region (CRR) of the heavy subunit [13, 14], and recent binding studies with fragments of the heavy subunit propose that several carbohydrate recognition sites lie within the CRR [15,16].

A recombinant protein that is substantially identical to the 170 kDa heavy unit or its cysteine-rich fragment would be useful for developing diagnostic tests for E. histolytica infection and for developing vaccines against infection. Although regions of the lectin gene have previously been expressed in bacteria [31-33], attempts to express the full- length heavy subunit have been unsuccessful because of either: 1) misfolding; 2) incomplete folding; 3) instability of the synthesized product; or 4) toxicity of the product to bacteria. Accordingly, there is a need for an effective method for expressing the full-length heavy subunit and its cysteine-rich fragment.

Diagnosis of E. histolytica infection

Epidemiologic and molecular research has now established that the organism previously known as E. histolytica actually comprises two genetically distinct but morphologically identical species. The pathogenic species, for which the name E. histolytica has been retained, is capable of causing invasive disease including amoebic dysentery and liver abscess. On the other hand, the nonpathogenic species termed Entamoeba dispar, is not associated with invasive disease and is considered to be a commensal [44, 51]. It is important to differentiate between these two species in order to provide appropriate therapy for E. histolytica infection and to avoid unnecessary treatment of patients infected with E. dispar. Although there are shared epitopes between the Gal/GalNAc specific adherence lectin of E. histolytica and E. dispar, there is only 77% to 85% DNA sequence identity between these lectin molecules.

Traditionally, the diagnosis of E. histolytica infection has depended on the microscopic examination of stool samples. However, this method is labour intensive, requires considerable expertise and often lacks sensitivity and specificity [41 , 47, 49, 50, 58, 61].

In addition, it cannot distinguish between E. histolytica and E, dispar [47, 58]. The inability to distinguish between these species may lead to unnecessary therapy for E. dispar infection and the potential to mϊsdiagnose other treatable conditions [58].

New diagnostic tools including the polymerase chain reaction and antigen detection ELISA assays, although potentially sensitive and specific, are generally unsuitable for n routine diagnostic use because of their requirement for fresh, unpreserved stool samples and/or technical difficulties [38, 40, 41, 42, 48, 49, 50, 52, 53, 54, 59, 62]. There are at least four ELISA-based stool antigen detection kits that are commercially available. Two of these tests, the Entamoeba test (Techlab, Blacksburg, VA) and the Prospect T ELISA (Alexon Co., Sunnyvale, CA) detect the E. lύstolytica/E. dispar complex, but do not distinguish pathogenic E. histolytica and nonpathogenic E. dispar. The Entamoeba test, which recognizes the Gal/GalNAc lectin of E. histolytica and E. dispar, has reported sensitivities of 80-93% and specificities of 98-99%, when compared to microscopic examination and culture, or culture alone [48, 49, 50]. Prospect T also has similar reported ranges of sensitivity and specificity compared to microscopy or other ELISA tests [58]. The other two tests, the E. histolytica test (Techlab, Blacksburg, VA) and the Optimum S kit (Merlin Diagnostica, Bornheim, Germany) only identify E. histolytica. Reconstitution experiments indicates that the detection limit of the E. histolytica test to be -500 trophozoites per ml [54] which is slightly higher than the detection limits of the Prospect T and Optimum S kits which report detection limits of -100 trophozoites per ml [54, 59]. A notable limitation of all the currently available ELISA stool antigen assays is the requirement for fresh, unpreserved fecal specimens.

Stool culture for E. histolytica/E. dispar and subsequent isoenzyme analysis is regarded as the reference standard with which to discriminate E. histolytica from E. dispar [38, 47, 48, 49, 50, 56, 60, 61]. However, this approach is time consuming and laborious, and to date has remained largely a research tool. Therefore, there is a need for an effective test for distinguishing between E. histolytica and E. dispar infection in preserved fecal samples.

Similarly, there is also a need to develop a test for diagnosing all common types of parasitic infection, such as infection by cryptosporidia, cyclospora, giardia, and E. histolytica in preserved fecal samples.

DISCLOSURE OF INVENTION

Accordingly, it is an object of the invention to provide a method for expressing a recombinant protein substantially identical to the 170 kDa heavy subunit of the surface lectin of E. histolytica, and its cysteine-rich region (CRR). It is a further object of the invention to provide a method for detecting and distinguishing E. histolytica from E, dispar in preserved fecal samples.

These objects are achieved by providing a recombinant protein substantially identical to the native 170 kDa heavy subunit of the Gal/GalNAc specific lectin of E. histolytica and a recombinant protein substantially identical to the native cysteine-rich fragment of the 170 kDa subunit of the Gal/GalNAc specific lectin of E. histolytica. The recombinant cysteine-rich fragment lacks the adherence-enhancing epitopes recognized by monoclonal antibodies 8A3 and 3F4. The 170 kDa subunit or the cysteine-rich fragment may be used as a vaccine (either recombinant protein or as a "naked" DNA vaccine), with a pharmaceutically acceptable earner, excipient, diluent, or adjuvant. These genes and the recombinant proteins they encode can also be used in serologic assays, using techniques known to those skilled in the art.

In another embodiment, this invention provides a method for expressing recombinant proteins substantially identical to a 170 kDa heavy subunit of a Gal/GalNAc specific lectin of an E. histolytica trophozoite and its cysteine-rich fragment, the method comprising (a) isolating nucleotide sequences which encode the 170 kDa heavy subunit of a Gal/GalNAc specific lectin and the cysteine-rich fragment of the lectin; (b) cloning the nucleotide sequences into a first transfer vector; (c) subcloning the nucleotide sequences into a second transfer vector to form a recombinant transfer vector; (d) cotransfecting insect host cells with an expression vector and the recombinant transfer vector to form recombinant clones; and (e) selecting, propagating, and purifying the recombinant clones.

In another embodiment, this invention provides a transformed insect host cell capable of synthesizing recombinant proteins substantially identical to a 170 kDa heavy subunit of a Gal/GalNAc specific lectin of an E. histolytica trophozoite and its cysteine-rich fragment, the host cell infected with (a) a recombinant baculovirus transfer vector in which an isolated nucleotide sequence encoding the 170 kDa heavy subunit of a Gal/GalNAc lectin and cysteine-rich fragment of the lectin has been inserted, the recombinant baculovirus transfer vector having a honeybee melittin signal sequence at the 5' end and polyhistidines at the 3' end of its insertion site, and (b) a viral expression vector. In a further embodiment, this invention provides a method of detecting and distinguishing the presence of E. histolytica from the presence of E. dispar in a preserved fecal sample, which method comprises (a) contacting said sample with a monoclonal antibody that binds to an epitope of the 170 kDa subunit of Gal/GalNAc lectin of E. histolytica but not to an epitope of E. dispar, in preserved fecal samples and (b) detecting the reaction between said monoclonal antibody and said epitope.

In a further embodiment, this invention provides a method of producing monoclonal antibodies that recognize E. histolytica trophozoites but not E. dispar trophozoites in preserved stool samples, the method comprising (a) producing a purified recombinant protein substantially identical to the 170 kDa subunit of the Gal/GalNAc specific lectin of E. histolytica trophozoites, (b) fixing the recombinant protein with a stool preservative, (c) immunizing a mammal with the fixed recombinant protein, and (d) harvesting the antibodies or cells secreting the antibodies from the mammal.

In a further embodiment, this invention provides monoclonal antibodies which specifically bind to epitopes of E. histolytica but not to epitopes of E. dispar, and the use of these monoclonal antibodies for detecting and distinguishing the presence of E. histolytica from the presence of E. dispar in a preserved biological sample.

In a still further embodiment, this invention provides a kit for detecting and distinguishing the presence of E. histolytica from the presence of E. dispar in preserved fecal samples, the kit comprising (a) a monoclonal antibody that binds to an epitope of the 170 kDa subunit of Gal/GalNAc lectin of E. histolytica, but not to epitopes of E. dispar, in preserved fecal samples, and (b) a means for detecting the reaction between the monoclonal antibody and the epitope, such as an immunoflourescence or enzyme linked immunoassay.

In a still further embodiment, this invention provides a method for producing monoclonal antibodies for diagnosing parasitic infection in preserved fecal samples, comprising (a) fixing the appropriate recombinant or native protein with a stool preservative, (b) immunizing a mammal with the fixed protein, and (c) harvesting the antibodies produced or cells secreting the antibodies from the mammal. An advantage of this invention is that it provides an effective method for synthesizing a functional 170 kDa heavy subunit of the Gal/GalNAc specific lectin of E. histolytica, as well as its cysteine-rich fragment.

A further advantage of this invention is that it provides an effective method for detecting and distinguishing E. histolytica from E. dispar in preserved fecal samples.

BRIEF DESCRIPTION OF THE DRAWINGS

A better understanding of the invention will be obtained by considering the detailed description below, with reference to the following drawings.

Figure 1: Immunoblots of whole cell lysates for identification of recombinant

AcNPV's. A, Sf21 cells infected with potential recombinant CR domain producing baculovirus; B, Sf21 cells infected with potential recombinant HGL producing baculovirus. Lanes M; Marker; C: uninfected Sf21 cells; V: Sf21 cells infected with wild-type virus; 1-10: Sf21 cells infected with clones of recombinant AcNPV's.

Figure 2: Tunicamycin treatment of recombinant AcNPV's infected Sf21 cells.

Whole cell lysates were analyzed by SDS-PAGE followed by Western blot with Mab 1G7. A, Sf21 cells infected with recombinant AcNPV for the CR domain; B, Sf21 cells infected with recombinant AcNPV for HGL. Mobility shift was observed on SDS- PAGE for each recombinant protein in the presence of tunicamycin.

Figure 3: Optimization of expression of recombinant proteins. Whole cell lysates infected with recombinant AcNPV for HGL at either a MOI of 5 or 10 and harvested at 24, 48, 60, 72 and 84 hours, were analyzed by SDS-PAGE followed by Western blot with Mab 1G7.

Figure 4: Coomassie Blue stained SDS-PAGE and Immunoblot of the Immunoaffinity Purified Recombinant Heavy Subunit of the Adherence Lectin of E. histolytica. The molecular mass of the recombinant lectin is estimated to be about 160 kDa by mobility in SDS-PAGE. The purified product is recognized by the monoclonal antibody 1G7 on Western blot. Lanes 1-3; Coomassie blue stained SDS-PAGE of the elution fractions from the immunoaffinity column; lanes 4-5: molecular weight markers; lanes 6-8: Western blot of the elution fractions from the immunoaffinity column.

Figure 5: Binding of biotinylated asialofetuin to recombinant proteins. Biotinylated asialofetuin binding as measured by densitometry was performed under conditions described in materials and methods using 1 μg of purified recombinant protein and the indicated concentrations of biotin-asialofetuin. Total binding is represented by closed squares; background binding (in the presence of lOmg/ml of unlabelled asialofetuin) is represented by closed triangles; and specific binding calculated by subtracting background binding from total binding is represented by open squares. A, binding to recombinant CR domain; and B, binding to recombinant HGL. Data are presented as mean + SE for triplicate determinations.

Figure 6: Inhibition of biotinylated asialofetuin binding to recombinant proteins by monosaccharides. Both HGL (closed bars) and the CR domain (open bars) were significantly inhibited by Gal and GalNAc, but not by mannose. Data are means + SE from triplicate determinations. Statistical significance was determined by one-way analysis of variance (*, P < 0.05; **, P < 0.01).

Figure 7: Inhibition of biotinylated asialofetuin binding to recombinant proteins by

GalNAc. Significant blockage of binding to HGL (0) occurred at higher concentration of GalNAc (5 mM) when compared to the CR domain (♦) (0.5mM). Standard inhibition curves generated from these data estimated the IC50 of 5.75 + 0.48 mM and 1.66 + 0.94 mM for HGL and the CR domain respectively. Data are means 4- SE for five determinations. Statistical significance was determined by one-way analysis of variance (**, P < 0.01).

Figure 8: Representative IFA of E. histolytica (A and B) and E. dispar (C and D) trophozoites with monoclonal antibodies. A, C: with MAb SB4G1 1, B, D: with MAb NL3B3; E: with irrelevant IgGl, and F: with irrelevant IgM. (Magnification 600x, 1 min exposure).

Figure 9: IFA of Stool Specimens with MAb SB4D7. A: a fixed stool specimen with HM IMSS trophozoites under low magnification ( 150x), B: corresponding sample under higher magnification, E. histolytica (arrow) (600x), C: E. dispar (arrowhead) and E. histolytica (arrow) in stool sample (600x), D: Giardia lamblia (arrow) in stool sample (600x), E: Entamoeba. coli (arrow) in stool sample (600x).

MODES FOR CARRYING OUT THE INVENTION

Illustrative embodiments of the invention are provided below.

I. Expression of the 170 kDa Heavy Subunit of E. histolytica 's Gal/GalNAc

Specific Lectin, and its Cysteine-Rich Fragment

This invention provides for the expression of the heavy subunit of the Gal/GalNAc specific lectin of E. histolytica and a fragment of the cysteine-rich region (CRR). Because of the requirements for glycosylation and extensive disulfide bond formation within the 170 kDa Gal/GalNAc specific lectin of E. histolytica, baculovirus expression of recombinant lectin constructs provides a suitable system for further analysis of the structure and function of this lectin.

Polymerase Chain Reaction (PCR), PCR Product Cloning and Sequencing:

Genomic DNA of E. histolytica strain HMLIMSS (kindly provided by Dr. J. Ravdin) was used as the template for the amplification of the heavy subunit lectin gene (hgl) and a CRR fragment (a. a. 475 to 896). PCR was performed using Vent DNA polymerase (New England Biolabs, Beverly, MA ) to ensure the fidelity of the PCR products. Primers KK129 (5'-ACTTGGATCCTGATTATTATGACCTTGGTATT) and KK130 (5'-ACTCGGATCCCCAACATATTCTGCATTTTCAT), and primers KK131 (5'- TCCAGGATCCAGTATGTAAACAAAAAGCTAAT) and KK132 (5'-

TTATGGATCCTATGCTTCTTTGTCTGCCTCTTT) were used to generate hgl and the CRR fragment respectively. Amplifications were performed under the following conditions: 1) a "hot start", followed by 5 cycles of 94°C for 1 minute, 50°C for 1 minute, and 72°C for 4 minutes 30 seconds, and then another 30 cycles of 94°C for 1 minute, 59°C for 1 minute, and 72°C for 4 minutes 30 seconds for hgl; 2) a "hot start", followed by 35 cycles of 94°C for 1 minute, 50°C for 1 minute, and 72°C for 2 minutes for the CRR fragment. A final elongation step at 72°C for 7 minutes was carried out for both reactions. The PCR products were analyzed by electrophoresis on 1 % agarose. Both PCR products were cloned into pCR™II (TA Cloning Kit, Invitrogen, San Diego, CA) and then sequenced with Sequenase version 2.0 (Sequenase Plasmid Sequencing Kit, USB, Cleveland, OH). Using the BamHI sites engineered in the 5' terminus of the primers, both hgl and its CRR fragment were subcloned in frame into the baculovirus transfer vector pAcMeHό which contained a honeybee melittin signal sequence at the 5'end and polyhistidines at the 3' end of its insertion site. The orientation of the recombinant plasmids was verified by restriction digests and sequencing.

Construction of Recombinant Baculovirus: Spodoptera frugiperda insect cells (Sf21) were maintained as monolayer culture using Grace's medium supplemented with 10% heat inactivated fetal bovine serum (FBS; Wisent, St. Bruno, QC), penicillin (100 units/ml) and streptomycin sulfate (100 -g/ml) (Life Technologies, Gaithersburg, MD) at 27°C as described by Summers et al [23]. Sf21 cells were cotransfected with 250 ng of Bsu36I digested BacPakό viral DNA and 500 ng of recombinant transfer vector using 11 μg of Lipofectin (Life Technologies, Gaithersburg, MD) as recommended by the manufacturer (BacPak Baculovirus Expression System, Clonetech, Palto Alto, CA). Culture supernatants were harvested 5 days after cotransfection and used to infect Sf21 cells in plaque assays. Viral plaques were selected and amplified. Expression of recombinant proteins were screened by immunoblots with pooled anti-lectin antibodies (7F4, 3F4, 1G7).

Time Course Study and the Effect of Tunicamycin Treatment on the Expression of Recombinant Lectin:

Amplified viral stock titers were determined by plaque assay. Sf21 cells were infected with recombinant AcNPV at a multiplicity of infection (MOI) of 5 and 10 pfu/cell. Infected cells were harvested at 24, 48, 60, 72 and 84 hours post infection. Whole cell lysates collected at these intervals were analyzed for their level of recombinant lectin synthesis by immunoblot using the lectin specific monoclonal antibody 1G7.

To evaluate the presence of N-linked oligosaccharides, infected Sf21 cells were treated with 5 μg/ml of tunicamycin (Sigma Chemical Co., St. Louis, MO) 19 to 20 hours after infection [12, 24]. Cells were incubated at 27°C with tunicamycin until 72 to 84 hours before they were harvested. Cell lysates with and without tunicamycin treatment were then examined by immunoblot. Purification of Recombinant HGL and its CR domain:

Recombinant proteins were purified by immunoaffinity chromatography using anti- lectin antibodies (8A3 for HGL and 1G7 for the CRR fragment). Sf21 cell monolayers (4 to 5 confluent 75 cm² flasks) infected with recombinant AcNPV's at a MOI of 10 were harvested 72 to 84 hours post-infection. Trans-epoxysuccinyl-L-leucylamide(4- guanido)-butane (E64; Sigma Chemical Co., St. Louis, MO) was added at a concentration of 1 μg/ml to culture supernatant 24 hours after infection. Cells were pelleted by centrifugation at 1000 g x 10 minutes and resuspended in 5 ml of ice-cold 0.5% NP-40 phosphate buffered saline (PBS, pH 7.0) with 1 mM phenylmethysulfonyl fluoride (PMSF, ICN Pharmaceuticals, Costa Mesa, CA), 5 μg/ml of leupeptin (Sigma Chemical Co., St. Louis, MO), 1 μg/ml of pepstatin A (Sigma), and 1 μg/ml of E64 (Sigma). Cell suspension was solubilized for 2 hours at 4°C and then pelleted. Solubilization was repeated with an additional 5 ml of buffer at 4°C for 2 hours. Supernatants from both solubilizations were pooled and allowed to adsorb to 0.5 or 1 ml of anti-lectin monoclonal antibody (1G7 for the CRR fragment, 8A3 for HGL, kindly provide by Dr. W. Petri) coupled Protein G sepharose ( at 2 mg of antibody immobilized per ml of Protein G Fast Flow Sepharose; Amersham Pharmacia Biotech, Baie d'Urfe, QC) at 4°C overnight. Sepharose beads were then washed with 30 ml of 0.5% NP-40 in PBS (pH 7.0), followed by 10 ml of 0.5% NP-40 in phosphate buffer (pH 6.2), before eluting with 12 ml of 0.5% NP-40 in 100 mM glycine (pH 2.5). Eluted fractions were immediately neutralized with 1 M Tris at pH 8.0 (1:20 dilution).

In addition to purification from the cell pellet, the recombinant CRR fragment was also purified from culture supernatant in a similar procedure as described above with slight modifications. Culture supernatant (10 ml per 75 cm" flask) was first dialyzed against 100 volumes of PBS (pH 7.0) with 2 mM PMSF at 4°C overnight before batch adsorbing to 1G7 coupled protein G sepharose. Sepharose beads were then washed and eluted with the same buffers as above excluding 0.5% NP-40.

Recombinant proteins were concentrated with buffer exchange to PBS by repeated centrifugation through Ultrafree-4 centrifugal filter devices; Biomax-10 for the CRR fragment and Biomax-30 for HGL (Mϊllipore, Bedford, MA). These pooled proteins were aliquoted and stored at -70°C until ready for use in binding experiments. Biotinylated Asialofetuin/Lectin Binding Assay:

Asialofetuin (Sigma Chemical Co, St. Louis, MO) Was labelled by reacting 170 nM of maleimidobutyrylbiocytin (MBB; Calbiochem, La Jolla, CA) with 2.5 mg of asialofetuin in the presence of 0.5 mM EDTA at pH 7.5 for 2 hours at room temperature. Unreacted MBB was removed by repeated washes with PBS in the Ultrafree-4 centrifugal device, Biomax-10 (Millipore, Bedford, MA). Washes were continued until the filtrates were free of biotin.

The biotin-asialofetuin/lectin binding assay was modified from a method described by Zheng and Gabius [25]. Pooled recombinant HGL and its CRR fragment were pretreated in 2.5 mM dithiothreitol (DTT; ICN) for 48 hours at 4°C prior to binding assays. This concentration of DTT reduced lectin polymerization, but did not affect intramolecular disulfide bonds within the lectin [26, 27, 28]. Using a slot blot manifold (Hoefer PR 600 series; Amersham Pharmcica Biotech, Baie d'Ufre, QC), recombinant proteins were slot blotted onto nitrocellulose membranes (Life Technologies, Gaithersburg, MD) at 1 μg per slot. Each well was washed with 100 μl of PBS (x 3) before the apparatus was disassembled. Nitrocellulose membranes were air dried for 30 minutes, cut into appropriate sizes and placed into 12-well plates. They were then blocked with 0.5 ml per well of 2% gelatin in 10 mM Tris, 150 mM NaCl, pH 7.5 for 1 hour. Blots were washed once with solution A (1% gelatin in 20 mM Tris, 150 mM NaCl, 20 mM CaCL, pH 7.5) before incubation with biotin-asialofetuin in solution A (0.3 ml per well) for 2 hours at room temperature. These were washed with 1 ml per well of solution A (x 3), followed by another 3 washes for 10 minutes each. Slot blots were incubated with streptavidin-alkaline phospatase (1: 1000 dilution; Pierce, Rockford, IL ) in solution A for 1 hour. After 6 washes with solution A and one wash with TBS, blots were developed with the substrate nitroblue tetrazolium chloride/5-bromo-4- chloro-3-indolyphosphate p-toluidine salt (NBT/BCIP; Life Technologies, Gaithersburg, MD).

For inhibition studies, slot blots were first pre-incubated with the corresponding concentrations of mannose, galactose, or N-acetyl galactosamine before the addition of biotin-asialofetuin at a fixed concentration of 25 μg/ml. Cold competition with unlabelled asialofetuin at 10 mg/ml was used to determine nonspecific binding in the assay. Adherence of E. histolytica Trophozoites to CHO Cells:

E. histolytica strain HM IMSS was grown axenically in TY1-S-33 medium supplemented with penicillin (100 units/ml) and streptomycin sulfate ( 100 μg/ml) at 37°C [43]. CHO cells were cultured in RPMI 1640 (Life Technologies) with 10% FBS and gentamicin (lOOmg/ml) (Life Technologies) and harvested with 0.25% trypsin in Dulbeco's PBS without Ca²⁺ and Mg²⁺. The measurement of E. histolytica adherence to

CHO cells were performed as previously described [2]. Amoebic trophozoites ( 1 x 10 ) and CHO cells (2 x 10⁵) were suspended in RPMI 1640, centrifuged at 150 g for 5 minutes and then incubated at 4°C for 2 hours. For inhibition assays, 1G7 and GalNAc were preincubated with amoebic trophozoites on ice for 1 hour. Competition with the CRR fragment was done by preincubating CHO cells with the recombinant protein at 4°C for 1 hour. Adherence was measured as the number of amoebae having at least three adherent CHO cells upon resuspension and expressed as a percentage in paired studies performed in control medium (where 62% of amoebae had at least 3 adherent CHO cells).

Sodium Dodecyl Sulfate-Polyacrylamide Electrophoresis (SDS-PAGE) and

Immunoblot: Whole cell lysates and purified recombinant proteins were subjected to SDS-PAGE using 7.5% to 10% acrylamide gels according to the method of Laemmli [29].

Separated proteins were then transferred onto nitrocellulose (Life Technologies,

Gaithersburg, MD) at 10 volts overnight or 30 volts for 5 hours in 20% methanol, 10 mM NaHC0₃, 3 mM Na₂C0₃. The nitrocellulose membranes were blocked with 2% gelatin in TBS (20 mM Tris, 500 mM NaCl, pH 7.5) for one hour at room temperature before incubation with primary antibody (10 μg/ml for purified monoclonal IgG) in 1% gelatin in TTBS (0.05% Tween-20, 20 mM Tris, 500 mM NaCl, pH 7.5) for one hour.

Membranes were washed with TTBS x 3 and incubated with secondary antibody

(alkaline phosphatase conjugated anti-mouse IgG at 1 :500 dilution; Biorad, Hercules, CA) in 1 % gelatin in TTBS for one hour at room temperature. After two washes with

TTBS, followed by one wash with TBS, membranes were developed with NBT/BCIP.

Primary antibodies examined included purified monoclonal IgG 8A3, 7F4, 3F4, 5B8, and 1G7 (gift from Drs. K. Chadee, W. Petri Jr. and J, Ravdin). Densitometric Analysis:

Slot blots of biotinylated asialofetuin/lectin binding assays were scanned (PaperPort, Visoneer Communications, Palo Alto, CA) and analyzed with the software by Scion Image (Scion Corp., Federick, MD).

Results were analyzed by one-way analysis of variance with Dunnett's test. P < 0.05 was considered significant.

Construction of Recombinant AcNPV's: PCR primer sets KK129/KK130 and KK131/KK132 were designed based on known cDNA nucleotide sequence of the E. histolytica lectin gene hgl 2 [11]. A BamHI restriction site was added to the 5' terminus of each of these primers. PCR products of 3.1 kb and 1.2 kb were generated for the full-length 170 kDa Gal/GalNAc specific lectin gene and the CRR fragment respectively. Both of these products were cloned into pCR II ^M vector directly and then sequenced. Analysis of the sequence of the 3.7 kb product (nucleotide 61 to 3800) revealed sequence identity to previously described hgl 2 [1 1] except for 15 basepair substitutions (2 amino acids difference), while the 1.2 kb fragment showed sequence identity to the cysteine-rich region of hgl 1 (nucleotide 1422 to 2689) [12] except for 8 basepair substitutions (2 amino acids difference). There is no evidence to support functional differences between members of the hgl gene family. The homology between these two gene products at the CRR is approximately 90%.

Using the BamHI sites engineered into the 5' and 3' end of the PCR products, the heavy subunit lectin gene and its CRR fragment were subcloned into the modified baculovirus transfer vector pAcMeHό. This vector has been designed to incorporate the honeybee melittin signal sequence at the amino terminus and polyhistidines at the carboxy terminus of the inserted foreign genes. Melittin signal sequence had been shown to significantly enhance expression and secretion [30], and the polyhistidines permit purification of proteins using metal chelating resins. Cotransfection in Sf 21 cells with the viral expression vector BacPak 6 and the two transfer vectors resulted in recombinant clones selected by plaque assay. Positive plaques selected From each construct were propagated and screened for expression of recombinant proteins by immunoblots of whole cell lysates with E. histolytica lectin specific monoclonal antibodies. As illustrated in figure 1 , nine of ten clones screened expressed the CRR domain, and six of ten clones screened expressed HGL. The molecular weight of recombinant HGL and its CRR fragment were 160 kDa and 56 kDa respectively as determined by mobility in SDS-PAGE. The deduced mass based on amino acid sequences are 140 kDa (amino acids 1 1 to 1256) and 46 kDa (amino acids 475 to 896) respectively. Hence, these baculovirus expressed proteins appeared to be post- translationally modified. Tunicamycin treatment of recombinant AcNPV's infected Sf 21 cells led to mobility shifts of the recombinant proteins in SDS-PAGE, suggesting that these proteins contained N-linked oligosaccharides (figure 2).

Optimization of Recombinant Proteins Expression and Purification: To determine the optimal condition for recombinant protein production, Sf 21 cells were infected with recombinant AcNPV at MOIs of 5 and 10 pfu/cell, and followed at various time points. Immunoblots of whole cell lysates showed no significant difference in the amount of protein expressed at a MOI of 5 versus 10 for both HGL (figure 3) and the CRR fragment (data not shown). Production of HGL began at 48 hours and remained relatively stable up to 84 hours after infection (figure 3). For the CRR fragment, recombinant protein production began earlier at 24 hours and remained stable up to 84 hours post-infection (data not shown). The recombinant CRR fragment was secreted and detected in culture supernatant but also found in the cell pellet, while HGL was membrane-bound and detected only in whole cell lysates (data not shown).

Purification of recombinant proteins from infected Sf 21 cells with nickel affinity chromatography was attempted under both native and denaturing conditions. The yield from this method, however, was low because of poor binding of recombinant products to chelated nickel sepharose with significant losses in the flow-through and wash fractions (data not shown). Therefore, immunoaffinity chromatography with lectin- specific monoclonal antibody (1G7 or 8A3) coupled to Protein G Sepharose was used instead. Purification of HGL resulted in an intact 160 kDa and a 56kDa band on SDS- PAGE for the HGL and the CRR fragment respectively (figure 4). Approximately 4 to 7 μg of HGL were purified per confluent 75 cm" flask of cells, while purification of the CRR fragment from the cell pellet yielded 2 to 7 μg per confluent 75 cm² flask of cells. Purification of the CRR fragment from culture supernatant resulted in approximately 3 to 9 μg of protein per ml of supernatant (8 to 10 ml per 75 cm^" flask). Therefore, the majority of the recombinant CR fragment was secreted into the supernatant as expected. Immunoreactivity of the Expressed Recombinant Proteins:

Whole cell lysates of infected Sf 21 cells were analyzed by immunoblotting with a series of monoclonal IgG antibodies against purified E. histolytica lectin (Table 1). Baculovirus expressed HGL was recognized by all the IgG antibodies including those reported to recognize both adherence-inhibitory and -enhancing epitopes. The CRR fragment reacted only with the adherence-inhibitory epitope 1G7, but not with the adherence-enhancing antibodies 8A3 and 3F4.

Biological Function of the Purified Recombinant Proteins: To assess the recombinant proteins for lectin activity, HGL and its CRR fragment were allowed to bind to the Gal/GalNAc-terminal glycoprotein, asialofetuin. Both HGL and the CRR domain bound biotinylated asialofetuin in a concentration-dependent manner that was saturable (figure 5). Using a single class receptor-ligand binding equation, the dissociation constants KD of the interaction between the recombinant proteins and asialofetuin were estimated to be 0.16+0.08 μM for HGL and 0.19+0.06 μM for the CR domain. There was no significant difference between these values. This is of interest since the CRR does not include the region 895-998 previously associated with carbohydrate binding [15]. The binding of HGL to asialofetuin was significantly inhibited by 5 mM, 50 mM, and 500 mM of Gal, 50 mM and 500 mM of GalNAc, but not by equal concentrations of mannose (figure 6). Similarly, the binding of the CR domain to asialofetuin was significantly blocked by 50 mM and 500 mM of Gal and GalNAc, but not by mannose (figure 6). Thus, the interaction between the purified recombinant proteins and asialofetuin were Gal/GalNAc specific, consistent with the lectin activity of native E. histolytica Gal/GalNAc inhibitable lectin.

A more detailed examination of the inhibition by GalNAc revealed that GalNAc blocked the binding of asialofetuin to recombinant lectins in a dose-dependent fashion (figure 7). Significant inhibition of binding of asialofetuin to the CRR fragment occurred at GalNAc concentrations greater than 0.5 mM (n = 5, p<0.01 ), while significant inhibition of asialofetuin to HGL binding required higher concentrations of GalNAc over 5 mM (n = 5, p<0.01). Standard inhibition curves generated from these data gave a IC₅₀(GalNAc) of 1.66+0.94 mM for the CRR fragment and 5.75+0.48 mM for HGL. The binding of the CRR fragment purified from culture supernatant behaved in a similar fashion to that obtained from purified cell extracts (data not shown). In addition to Gal/GalNAc specificity in asialofetuin binding, the CRR fragment was able to significantly inhibit binding of amoebic trophozoites to target cells. The CRR fragment significantly reduced E. histolytica trophozoite adherence to CHO cells; with levels of inhibition comparable to that observed with the lectin inhibitory Mab 1G7. Bovine serum albumin that served as a control did not demonstrate any significant inhibition.

Analysis of Results

The 170 kDa heavy subunit of the Gal/GalNAc specific lectin of E. histolytica is a multifunctional glycoprotein that is thought to play a crucial role in the pathogenesis of amoebiasis. This invention provides the use of a baculovirus expression system in synthesizing the entire heavy subunit of the lectin and its CRR fragment in Sf 21 cells. Although regions of the lectin gene have previously been expressed in bacteria [31-33], attempts to express the full-length heavy subunit have been unsuccessful because of either: 1) misfolding; 2) incomplete folding; 3) instability of the synthesized product; or 4) toxicity of the product to bacteria. Post-translational modifications in Sf 21 cells may have facilitated proper folding of the recombinant lectin and therefore prevented degradation [34]. The full-length heavy subunit (residues 1 1 to 1256) was found to contain all of the previously described monoclonal antibody binding epitopes of the E. histolytica lectin [14], while the CRR fragment (residues 475 to 896) was only recognized by the adherence-inhibitory antibody 1G7. Approximately 6% of the native heavy subunit is carbohydrate and N-linked glycosylation has been shown to be important in lectin function since tunicamycin treatment of trophozoites results in a dramatic decrease in their adherence to target cells [12]. Both baculovirus expressed proteins contained N-glycans as demonstrated by mobility shifts of the proteins on SDS- PAGE when treated with tunicamycin.

In hemagglutination assays with E. histolytica membranes, asialofetuin has been found to be a more potent inhibitor of hemagglutination than the GalNAc monosaccharide, resulting in hemagglutination inhibition concentrations (IC) of 0.31 μM and 710 μM respectively [35]. In our assay, the binding of biotinylated asialofetuin to recombinant HGL and the CRR fragment was concentration-dependent and saturable, yielding KQ values of 0.16 +0.08 μM and 0.19 +.0.06 μM respectively. Gal and GalNAc specifically inhibited the interaction of asialofetuin with the recombinant lectins, but mannose did not. This is consistent with the carbohydrate specificity of the E. histolytica native lectin [3], and provides direct evidence that the recombinant HGL in the absence of the light chain exhibits Gal/GalNAc lectin activity. Moreover, the CRR fragment is sufficient for Gal/GalNAc activity, achieving K_D values similar to that of HGL. The ability of the CRR fragment to significantly inhibit adherence of amoebic trophozoites to target cells at levels similar to Mab 1G7 and GalNAc further confirms its E. histolytica lectin activity. Contrary to the previous reported carbohydrate recognition domain that lies between amino acids 895 to 998 [15], this data suggests that the CRR fragment (residues 475 to 896) contains the principal sugar-binding site of the lectin. Although past work with rabbit reticulocyte lysates expressed CRR fragment found slightly less efficient Gal/GalNAc specific binding when compared to a larger fragment (residues 356 to 1143) [16], no such difference is observed in the Gal/GalNAc specific binding of the baculovirus expressed CRR fragment and HGL. This may be attributable to more favourable conformation that better resembles the native lectin with improved folding, glycosylations and other post-translational modifications unique to baculovirus expressed recombinant proteins. Since approximately 6% of the native heavy subunit is carbohydrate and tunicamycin treatment of trophozoites has been observed to have marked decrease adherence to target cells [12], the presence of N-glycans on the baculovirus generated proteins may play an important role in their carbohydrate binding ability.

Although there is no significant difference between the Kp values in asialofetuin binding, the IC₅₀ (GalNAc) for the CRR fragment was found to be lower than that for HGL. It is possible that other regions of the full-length heavy subunit may either interact directly or affect the conformation of the molecule to enhance its interaction with GalNAc residues on asialofetuin.

Immunizations with either native E. histolytica adherence lectin or bacterially expressed recombinant fusion proteins containing the CRR of the lectin have protected gerbils from developing amoebic liver abscess [31 , 32, 36]. The use of native hololectin provided vaccine efficacy of 67% [36], However, a subset of the immunized gerbils was noted to have more severe disease upon amoebic challenge and it was suggested this might to be due to the presence of immunosuppressive or antibody-enhancing epitopes.

Zhang and Stanley, using a recombinant derived from amino acids 649 to 1202 [31], and Soong et al, using a recombinant derived from amino acids 758 to 1 134 [32], revealed vaccine efficacy of 83% and 71 % respectively. Both of these recombinant proteins contain adherence-enhancing monoclonal antibody epitopes, although no gerbils were observed to develop more severe disease after immunization. The recombinant CRR fragment we generated lacks the putative adherence-enhancing epitopes recognized by monclonal antibodies 8A3 and 3F4, and is therefore useful as an immunogen. In addition to the lack of adherence-enhancing epitopes, the CRR fragment contains a region of the lectin molecule capable of inducing IL-12 which may facilitate the induction of cell-mediated immunity [37]. The recombinant proteins of the present invention or the DNA encoding them may be used in a vaccine, with a pharmaceutically acceptable carrier, excipient, diluent, or adjuvent, using techniques known to those skilled in the art.

These recombinant proteins and the genes encoding them may also be used in a serologic assay, using techniques known to those skilled in the art. The serologic assay may be used to diagnose infection with E. histolytica by detecting the presence of antibodies to E. histolytica in a blood sample. Antigens of the protein bind with antibodies to E. histolytica in the blood sample. The binding complexes are detected using standard techniques known to those skilled in the art.

II. Test for Detecting and Distinguishing E. histolyica from E. dispar in Preserved Biological Samples

We generated monoclonal antibodies that specifically recognized preserved E. histolytica trophozoites by immunizing mice with the recombinant 170 kDa heavy subunit of the Gal/GalNAc specific lectin that had been fixed in stool preservative, sodium acetate-acetic acid formalin (SAF). These antibodies can be used to diagnose E. histolytica infection in preserved fecal samples.

Cells and Virus Recombinant Autographa califomica nuclear polyhydrosis virus (AcNPV) was grown in Spodoptera frugiperda (Sf21) cell monolayers at 27°C using Grace's medium supplemented with 10% heat-inactivated fetal bovine serum (FBS), penicillin ( 100 units/ml) and streptomycin sulfate (100 μg/ml) (Life Technologies, Gaithersburg, MD)

[23]. Axenic E. histolytica strain HM LIMSS (ATCC 30459; American Type Culture Collection, Rockville, MD) was grown in TYI-S-33 medium supplemented with penicillin (100 units/ml) and streptomycin sulfate (100 μg/ml)(Life Technologies, Gaithersburg, MD) at 37°C as described [43].

Expression of Recombinant 170 kDa Heavy Subunit of the Galactose-specific lectin of E. histolytica and Protein Purification:

Recombinant AcNPV was produced in accordance with the methods described above. Sf21 cell monolayers (4 confluent 75 cm² flasks) were infected with recombinant AcNPV at a multiplicity of infection (MOI) of 10 and incubated at 27°C for 72 to 84 hours. Cells were pelleted by centrifugation at 1000 g x 30 minutes and resuspended in 5 mLs of ice-cold 0.5% NP-40 in phosphate buffered saline (PBS, pH 7.0) with I mM phenylmethyl sulfonyl fluoride (PMSF; ICN), 5μg/mL leupeptin (Sigma Chemical Co., St. Louis, Mo), 1 μg/mL pepstatin A (Sigma), and 1 μg/mL of trans-epoxysuccinyl-L- leucylamide(4-guanidino)-butane (E-64; Sigma). Cell suspension was solubilized at 4°C for 2 hours and then pelleted. Solubilization of cells was repeated with another 5 mLs of buffer. Supernatants from both solubilizations were pooled and allowed to adsorb to 0.5 mL of anti-lectin monoclonal antibody (8A3) coupled to protein G sepharose (2 mg of antibody immobilized per mL of Protein G Fast Flow Sepharose; Amersham Pharmacia Biotech, Baie d'Urfe, QP) at 4°C overnight. The sepharose beads were then washed with 30 mLs of 0.5% NP-40 in PBS at pH 7.0, followed by 10 mLs of phosphate buffer at pH 6.2, and eluted with 10 mLs of 100 mM glycine at pH 2.5. Eluted fractions were immediately neutralized with 1 M Tris at pH 8.0 (1:20 dilution). Approximately 200 μg of recombinant lectin was obtained by pooling elution fractions from multiple purifications. A portion of the purified protein was fixed with SAF (Med- Ox Chemicals Limited, Nepean, ON) in a 1:3 dilution for 30 minutes. The SAF solution was then removed from the fixed sample by repeated centrifugation through Ultrafee-4 centrifugal filter devices, Biomax-30 (Millipore, Bedford, MA) with the addition of PBS at pH 7.0.

Immunization of mice: BALB/c (Charles River, Wilmington, MA) mice were immunized intraperitoneally with either purified native or SAF-fixed recombinant 170 kDa heavy subunit of the adherence lectin of E. histolytica. Ten micrograms of recombinant protein emulsified in complete Freund's adjuvant were given initially, followed by 2 injections of the recombinant protein (10 μg) in incomplete Freund's adjuvant at week 4 and week 6. Mice were boosted with 10 μg of lectin in PBS three days prior to harvesting spleen cells.

Cell Fusions and Hybridoma Culture: Cell fusions were performed according to the methods of Galfre et al [46]. Immunized animals were killed 3 days after the last injection and the spleens were isolated under sterile conditions. Spleen cells mixed with NS 1 myeloma cells were fused by adding 50% polyethylene glycol 1500 (PEG; Boehringer Mannheim, Indianapolis, IN). Cells were resuspended in RPMI 1640 (Life Technologies, Gaithersburg, MD) with 20% FBS after fusion and seeded into 96-well plates. The cells were then incubated at 37°C in 5% C0₂ and saturated humidity. After 24 hours, half of the medium was replaced with hypoxanthine-aminopterin-thymidine (HAT) medium. The medium change was repeated every 2 days. Microplates were screened for hybridoma clones 10 days after fusion. Culture supernatants from hybridoma clones were tested for the presence of anti-lectin activity by indirect immunofluorescence assay (IFA).

Indirect Immunofluorescence Assay:

SAF-fixed E. histolytica trophozoites (strain HM IMSS), recombinant AcNPV infected

Sf21 cells, SAF-fixed E.dispar trophozoites (strain cyno.16), or clinical fecal specimens with known microscopy results were spotted onto poly-L-lysine (1 mg/mL; Sigma Chemical Co., St. Louis, MO) coated glass slides and allowed to air dry. Twenty-five microliters of culture supernatant from each mAb clone was added and allowed to incubate at room temperature for 1 hour. Slides were washed with PBS (x 5) before incubation with fluorescein-isothiocyanate (FITC)-labeled anti mouse IgG antibody ( 1 in 100 dilution; Sigma) for 1 hour at room temperature. After 5 washes with PBS, slides were mounted with Vectashield (Vector Laboratories, Inc., Burlingame,CA) and observed using an epifluorescent microscope (Nikon).

Isotyping Monoclonal Antibodies, Sodium Dodecyl Sulfate-Polyacrylamide Gel Electrophoresis (SDS-PAGE) and Immunoblotting:

The isotypes of monoclonal antibodies were determined with a strip assay (Iso Strip, Boehringer Mannheim, Indianapolis, IN) as per manufacturer's recommendation.

E. histolytica trophozoites and recombinant AcNPV-infected Sf21 cells were subjected to SDS-PAGE according to the method of Laemmli [29] using 7.5% acrylamide gels and transferred to nitrocellulose membranes (Life Technologies, Gaithersburg, MD) at 10 volts overnight or 30 volts for 5 hours in carbonate transfer buffer ( 10 mM NaHC0₃, 3 mM Na₂C0₃, 20% methanol). The membranes were blocked with 2% gelatin in TBS (20 mM Tris, 500 mM NaCl, pH 7.5) for 2 hours at room temperature. Monoclonal antibody culture supernatants (direct or 1 : 10 dilution in 1 % gelatin-TTBS [0.05% Tween-20, 20 mM Tris, 500 mM NaCl, pH 7.5]) were incubated with membranes for one hour at room temperature. Membranes were then washed three times with TTBS before incubation with secondary antibody (alkaline phosphatase conjugated anti-mouse IgG at 1 in 500 or anti-mouse IgM at 1 in 100 dilution) for one hour. After two washes with TTBS, followed by one wash with TBS, membranes were developed with nitroblue tetrazolium chloride/5-bromo-4-chloro-3-indolyphosphate p-toluidine salt (NBT/BCIP; Life Technologies, Gaithersburg, MD).

Purification of the recombinant 170 kDa heavy subunit of the galactose-specific adherence lectin of E. histolytica:

Sf21 cells hyperinfected with recombinant AcNPV were examined by IFA using E. histolytica anti-lectin antibody 1G7 prior to purification to ensure adequate protein expression. Approximately 4 to 7 μg of recombinant protein were purified per confluent 75 cm" flask of cells by immunoaffinity chromatography. The molecular weight of the purified lectin was -160 kDa as determined by the mobility in SDS-PAGE (figure 4).

Production of monoclonal antibodies and screening by IFA:

Purified recombinant protein, either in native state or fixed in SAF preservative, was used to immunize BALB/c mice. Fusion of NSl cells and spleen with animal immunized with native recombinant lectin generated 162 clones on initial screening of five 96-well plates. Culture supernatants from 44 of 162 clones (27%) were found to contain antibodies that recognized Sf21 cells expressing the lectin by IFA. In the fusion experiment with animal immunized with SAF-preserved recombinant protein, 21 of 187 clones (1 1%) produced antibodies which recognized SAF-fixed Sf21 cells expressing the lectin. All clones identified on screening were confirmed again by IEA of SAF-fixed E. histolytica trophozoites; all were found to be reactive.

Four clones were selected on the basis of their strong reactivity for E. histolytica trophozoites by IFA and were further evaluated for cross-reactivity with E. dispar. All \ 4 monoclonal antibodies (SB4D7, SB2F2, SB4G11, NL3B3) demonstrated specific bright apple-green fluorescence against fixed E. histolytica trophozoites (figure 8 A & B), while E. dispar trophozoites displayed only nonspecific background yellow fluorescence (figure 8 C & D). Incubation with control irrelevant antibodies of matching isotype (figure 8 Ε & F) gave similar yellow background fluorescence. In smears made with SAF-preserved stool specimens spiked with E. histolytica HMLIMSS, fluorescent green trophozoites could be detected easily by screening at low magnification (figure 9 A) followed by confirmation of the morphology at higher magnification (figure 9 B & C). By spiking fixed fecal samples with known concentrations of fixed HMLIMSS trophozoites, the detection limit of the monoclonal antibodies by IFA was found to range from 300 to 3000 trophozoites per ml when 100 μl of the sample was spotted onto the slide, as shown in Table 1, below:

TABLE 1. Isotypes and Detection Limit of Monoclonal Antibodies

Name Isotype Detection Limit³

SB2F2 IgM 3 x 10³ trophozoites/mL

SB4D7 IgM 3 x 10² trophozoites/mL

SB4G11 IgGl 3 x 10³ trophozoites/mL

NL3B3 IgM 3 x 10³ trophozoites/mL ^a Based on IFA of fixed stool samples spiked with known numbers of HMLIMSS trophozoites.

There was no cross-reactivity observed with E. dispar (figure 9 C), Giardia lambda (figure 9 D), Entamoeba coli (figure 9 E), and Dientamoeba fragilis (data not shown) previously identified in the stool samples.

Characterization of specific monoclonal antibodies:

The isotypes of the 4 selected monoclonal antibodies were determined by a strip assay. Three of the four were IgM (SB2F2, SB4D7, NL3B3) and one was shown to be IgG l , as set out in Table 1, above.

in Analysis of Results:

In accordance with this invention, monoclonal antibodies can be generated against the recombinant 170 kDa heavy chain of the adherence lectin which has been pre-treated with stool preservative, which recognize E. histolytica trophozoites in preserved stool samples. These antibodies recognize E. histolytica trophozoites with little to no cross- reactivity to other stool protozoa including E. dispar, E. coli, G. lamblia, and D. frag ills.

Monoclonal antibodies generated to fixed recombinant 170 kDa heavy chain of the Gal/GalNAc inhibitable lectin of E. histolytica permit the detection of E. histolytica trophozoites in preserved stool samples. Using immunofluorescence assays (IFA) with these monoclonal antibodies, we were able to detect > 300 trophozoites/ml. This detection limit is comparable to those previously reported for other ELISA stool antigen tests. Since most of the fecal samples submitted for ova and parasite examination in developed countries are received in fixative, the ability to identify E. histolytica in preserved samples represents a real advantage. Other methods of detecting the trophozoites can be used, including a simple automated capture-ELISA system or a rapid immunochromatographic dipstick assay. Monoclonal antibodies produced by the recombinant protein of this invention may also be used for detecting and distinguishing the presence of E. dispar from E. histolytica in other types of fixed biological samples, including serum, blood, tissue, or aspirate samples.

The novel method disclosed herein for generating monoclonal antibodies that recognize antigens in preserved fecal samples may be applied to other types of recombinant or native proteins, in order to test for other types of parasitic infection in preserved fecal samples. For example, one could use this method to detect other clinically important intestinal protozoa, such as cryptosporidia, cyclospora and/or giardia. In accordance with this invention, one would produce or identify the appropriate recombinant or native protein having antigens specific to antibodies produced in response to the parasitic infection, fix the protein with a stool fixative such as SAF or formalin, immunize a mammal with the fixed protein, harvest the antibodies and/or the cells secreting antibodies from the mammal, and select those antibodies that have strong reactivity with the parasite in question, and little cross-reactivity with other parasites. This invention is not to be construed as limited to the particular embodiments disclosed, since these are regarded as illustrative rather than restrictive. Moreover, variations and changes may be made by those skilled in the art without departing from the spirit of the invention.

References:

1. Walsh, J. A. Problems in recognition and diagnosis of amebiasis: estimation of the global magnitude of morbidity and mortality. Rev Infect Dis 1986; 8:228-38.

2. Ravdin, J. I., and R. L. Guerrant. Role of adherence in cytopathogenic mechanisms of Entamoeba histolytica. Study with mammalian tissue culture cells and human erythrocytes. J Clin Invest 1981; 68: 1305- 13.

3. Petri, W. A., Jr., R. D. Smith, P. H. Schlesinger, C. F. Murphy, and J. I. Ravdin. Isolation of the galactose-binding lectin that mediates the in vitro adherence of Entamoeba histolytica. J Clin Invest 1987; 80: 1238-44.

4. Petri, W. A., Jr., M. D. Chapman, T. Snodgrass, B. J. Mann, J. Broman, and J. I. Ravdin. Subunit structure of the galactose and N-acetyl-D-galactosamine- inhibitable adherence lectin of Entamoeba histolytica, J Biol Chem 1989; 264:3007- 12.

5. Ravdin, J. I., and C. F. Murphy, Characterization of the galactose-specific binding activity of a purified soluble Entamoeba histolytica adherence lectin. J Protozool 1992; 39:319-23.

6. McCoy, J. J., B. J. Mann, T. S. Vedvick, Y. Pak, D. B. Heimark, and W. A. Petri, Jr. Structural analysis of the light subunit of the Entamoeba histolytica galactose- specific adherence lectin. J Biol Chem 1993; 268:24223-31.

7. McCoy, J. J., B. J. Mann, T. S. Vedvick, and W. A. Petri, Jr. Sequence analysis of genes encoding the light subunit of the Entamoeba histolytica galactose-specific adhesin. Mol Biochem Parasitol 1993; 63:325-8.

8. Chadee, K, W. A. Petri, Jr., D. J. Innes, and J. I. Ravdin. Rat and human colonic mucins bind to and inhibit adherence lectin of Entamoeba histolytica. J Clin Invest 1987; 80: 1245-54.

9. Chadee, K, M. L. Johnson, E. Orozco, W. A. Petri, Jr., and J. I. Ravdin. Binding and interualization of rat colonic mucins by the galactose/N-acetyl-D-galactosamine adherence lectin of Entamoeba histolytica. J Infect Dis 1988; 158:398-406.

10. Purdy, J. E., B. J. Mann, E. C. Shugart, and W. A. Petri, Jr. Analysis of the gene family encoding the Entamoeba histolytica galactose-specific adhesin 170-kDa subunit. Mol Biochem Parasitol 1993; 62:53-9. l l . Tannich, E., F. Ebert, and R. D. Horstmann. Primary structure of the 170-kDa surface lectin of pathogenic Entamoeba histolytica. Proc Natl Acad Sci U S A 1991 ; 88: 1849-53.

12. Mann, B. J., B. E. Torian, T. S. Vedvick, and W. A. Petri, Jr. Sequence of a cysteine-rich galactose-specific lectin of Entamoeba histolytica. Proc Natl Acad Sci U S A 1991; 88:3248-52.

13. Petri, W. A., Jr., T. L. Snodgrass, T. F. Jackson, V. Gathiram, A. E. Simjee, K. Chadee, and M. D. Chapman. Monoclonal antibodies directed against the galactose- binding lectin of Entamoeba histolytica enhance adherence. J Immunol 1990; 144:4803-9.

14. Mann, B. J., C. Y. Chung, J. M. Dodson, L. S. Ashley, L. L. Braga, and T. L. Snodgrass. Neutralizing monoclonal antibody epitopes of the Entamoeba histolytica galactose adhesin map to the cysteine-rich extracellular domain of the 170- kilodalton subunit. Infect Immun 1993; 61 : 1772-8.

15. Dodson, J. M., P. W. Lenkowski, Jr., A. C. Eubanks, T. F. Jackson, J. Napodano, D. M. Lyerly, L. A. Lockhart, B. J. Mann, and W. A. Petri, Jr. Infection and immunity mediated by the carbohydrate recognition domain of the Entamoeba histolytica Gal/GalNAc lectin. J Infect Dis 1999; 179:460-6.

16. Pillai, D. R., P. S. Wan, Y. C. Yau, J. I. Ravdin, and K. C. Kain. The cysteine-rich region of the Entamoeba histolytica adherence lectin (170-kilodalton subunit) is sufficient for high-affinity Gal/GalNAc-specific binding in vitro. Infect Immun 1999; 67:3836-41.

17. Kang, C.Y. Baculovirus vectors for expression of foreign genes. Adv Virus Res 1995; 35: 117- 192.

18. Smith, G. E., M. DD. Summers, and M. J. Frazer. Production of human beta interferon in insect cells infected with a baculovirus expression vector. Mol Cell Biol 1983; 5:2860-5.

19. Smith, G. E., G. Ju, B. C. Ericson, J. Moschera, H. W. Lahm, R. Chizzonite and M. D. Summers. Modification and secretion of human interleukin 2 produced in insect cells by a baculovirus expression vector. Proc Natl Acad Sci U S A 1985; 82:8404- 8.

20. Altmann, F., E. Staudacher, LB. H. Wilson, and L. Marz. Insect cells as hosts for the expression of recombinant glycoproteins. Glycoconjugate J 1999; 16: 109-23. 21. Ailor, E., and M. J. Betenbaugh. Modifying secretion and post-translational processing in insect cells. Curr Opin Biotech 1999; 10: 142-5.

22. Miyamoto, C, G. E. Smith, J. Farrell-Towt, R. Chizzonite, M. D. Summers, and G. Ju. Production of human c-myc protein in insect cells infected with baculovirus expression vector. Mol Cell Biol 1985; 5:2860-5.

23. Summers, M. D. and G. E. Smith. A manual of methods for baculovirus vectors and insect cell culture procedures. Tex Agric Exp Stn Bull 1987; 1555.

24. Longacre, S., Mendis, K. N., and David, P. H. Plasmodium vivax merozoite surface protein 1 C-terminal recombinant proteins in baculovirus. Mol Biochem Parasitol 1994; 64: 191-205.

25. Zeng, F.Y. and Gabius, H. J. Determination of carbohydrate specificity in solid- phase assays. In: Gabius, H. J. and Gabius, S., eds. Lectins and Glycobiology. New York: Springer- Verlag, 1993:81-85.

26. Tatu, U., Brachman, I., and Helenius, A. Membrane glycoprotein foling oligomerization and intracellular transport: effect of dithiothreitol on living cells. Euro Mol Biol Organ J 1993; 12:2151-7.

27. Markovic, I., Pulyaeva, H, Sokoloff, A., and Chernomordik, L. V. Membrane fusion mediated by baculovirus gp64 involves assembly of stable gp64 timers into multiprotein aggregates. J Cell Biol 1998; 38:321 1-7.

28. Chang, J. Y. A two-stage mechanism for the reductive unfolding of disulfide containing proteins. J Biol Chem 1997; 272:69-75.

29. Laemmli, U. K. Cleavage of structural protein during the assembly of the head of bacteriophage T4. Nature 1970; 277:680-685.

30. Tessier, C. D., D. Y. Thomas, H E. Khoair, F. Lalibecte, and T. Vetnet. Enhanced secretion from insect cells of a foreign protein fused to the honeybee melittin signal peptide. Gene 1991; 98:177-83.

31. Zhang, T., and S. L. Stanley, Jr. Protection of gerbils from amebic liver abscess by immunization with a recombinant protein derived from the 170-kilodalton surface adhesin of Entamoeba histolytica. Infect Immun 1994; 62:2605-8.

32. Soong, C. J., K. C. Kain, M. Abd-Alla, T. F. Jackson, and J. I. Ravdin. A recombinant cysteine-rich section of the Entamoeba histolytica galactose-inhibitable lectin is efficacious as a subunit vaccine in the gerbil model of amebic liver abscess. J Infect Dis 1995; 171 :645-51. 33. Lotter, H, T. Zhang, K. B. Seydel, S. L. Stanley, Jr., and E. Tannich. Identification of an epitope on the Entamoeba histolytica 170-kD lectin conferring antibody- mediated protection against invasive amebiasis. J Exp Med 1997; 185: 1793-801.

34. Pajot-Augy, E., V. Bozon, J. Remy, L. Couture, and R. Salesse. Critical relationship between glycosylation of recombinant lutropic receptor extodomain and its secretion from baculovirus infected insect cells. Eur J Biochem 1999; 260:635-48.

35. Adler, P., S. J. Wood, Y. C. Lee, R. T. Lee, W. A. Petri, Jr., and R. L Schnaar. High affinity binding of the Entamoeba histolytica lectin to polyvalent N- acetylgalactosaminides. J Biol Chem 1995; 270:5164-71.

36. Petri, W. A., Jr., and J. I. Ravdin. Protection of gerbils from amebic liver abscess by immunization with the galactose-specific adherence lectin of Entamoeba histolytica. Infect Immun 1991; 59:97-101.

37. Campbell, D., B. J. Mann, and K. Chadee. A subunit vaccine candidate region of the Entamoeba histolytica galactose-adherence lectin promotes interleukin- 12 gene transcription and protein production in human macrophages. Eur J Immunol 2000; 30:423-30.

38. Abd-Alla, M. D., T. F. Jackson, V. Gathiram, A. M. el-Hawey, and J. I. Ravdin. 1993. Differentiation of pathogenic Entamoeba histolytica infections from nonpathogenic infections by detection of galactose-inhibitable adherence protein antigen in sera and feces. J Clin Microbiol.31:2845-2850.

39. Acuna-Soto, R., J. Samuelson, P. De Girolami, L. Zarate, F. Millan-Velasco, G. Schoolnick, and D. Wirth. 1993. Application of the polymerase chain reaction to the epidemiology of pathogenic and nonpathogenic Entamoeba histolytica. Am J Trop Med Hyg.48:58-70.

40. Aguirre, A., S. Molina, C. Blotkamp, J. Verveij, T. Vinuesa, M. E. Vails, F. Guhl, A. Polderman, M. T. Jimenez de Anta, M. Corachan, A. Gonzalez-Ruiz, I. A. Frame, and D. Warhurst. 1997. Diagnosis of Entamoeba histolytica and Entamoeba dispar in clinical specimens by PCR-SHELA. Arch Med Res.28:282-284.

41. Benzeguir, A. K, and A. Aust Kettis. 1997. Evaluation of an enzyme-immunoassay test kit for diagnosing infections with Entamoeba histolytica. Arch Med Res.28:276- 278.

42. Britten, D„ S. M. Wilson, R. McNerney, A. H. Moody, P. L. Chiodini, and J. P. Ackers. 1997. An improved colorimetric PCR-based method for detection and differentiation of Entamoeba histolytica and Entamoeba dispar in feces. J Clin Microbiol.35: l 108- 1 1 1 1.

43. Diamond, L.S., D. R. Harlow and C. C. Cunnick. 1978. A new medium for the axenic cultivation of Entamoeba histolytica and other Entamoeba. Trans R Soc Trop Med Hyg.72:431-432.

44. Diamond, L. S., and C. G. Clark. 1993. A redescription of Entamoeba histolytica Schaudinn, 1903 (Emended Walker, 1911) separating it from Entamoeba dispar Brumpt, 1925. J Eukaryot Microbiol.40: 340-344.

45. Dobson, D. R., C. G. Clark, L. A. Lockhart, B. M. Leo, J.W. Schroeder, and B. J. Mann. 1999. Comparison of adherence, cytotoxicity and Gal/GalNAc lectin gene structure in Entamoeba histolytica and Entamoeba dispar. Parasitol Int.46:225-235.

46. Galfre, G„ S. C. Howe, C. Milstein, G. W. Butcher, and J.C. Howard. 1977. Antibodies to major histocompability antigens produced by hybrid cell lines. Nature.266;550-552.

47. Gonzalez-Ruiz, A., R. Haque, A. Aguiiτe, G. Castanon, A. Hall, F. Guhl, G. Ruiz- Palacios, M. A. Miles, and D. C. Warhurst. 1994. Value of microscopy in the diagnosis of dysentery associated with invasive Entamoeba histolytica, J Clin Pathol.47:236-239.

48. Haque, R., K. Kress, S. Wood, T. F. Jackson, D. Lyerly, T. Wilkins, and W. A. Petri, Jr. 1993. Diagnosis of pathogenic Entamoeba histolytica infection using a stool ELISA based on monoclonal antibodies to the galactose-specific adhesin [see comments]. J Infect Dis.167:247-249.

49. Haque, R., L. M. Neville, P. Hahn, and W. A. Petri, Jr. 1995. Rapid diagnosis of Entamoeba infection by using Entamoeba and Entamoeba histolytica stool antigen detection kits. J Clin Microbiol.33:2558-2561.

50. Haque, R., I. K. Ali, S. Akther, and W. A. Petri, Jr. 1998. Comparison of PCR, isoenzyme analysis, and antigen detection for diagnosis of Entamoeba histolytica infection. J Clin Microbiol.36:449-452.

51. Jackson, T. F. 1998. Entamoeba histolytica and Entamoeba dispar are distinct species; clinical, epidemiological and serological evidence. Int J Parasitol.28- 181- 186.

52. Jelinek, T., G. Peyerl, T. Loscher, and H. D. Nothdurft. 1996. Evaluation of an antigen-capture enzyme immunoassay for detection of Entamoeba histolytica in stool samples. Eur J Clin Microbiol Infect Dis.15:752-755. 53. Mackenstedt, U., and A. M. Johnson. 1995. Genetic differentiation of pathogenic and nonpathogenic strains of Entamoeba histolytica by random amplified polymorphic DNA polymerase chain reaction. Parasitol Res.81 :217-221.

54. Mirelman, D., Y. Nuchamowitz, and T. Stolarsky. 1997. Comparison of use of enzyme-linked immunosorbent assay-based kits and PCR amplification of rRNA genes for simultaneous detection of Entamoeba histolytica and E, dispar. J Clin Microbiol.35:2405-2407.

55. Petri, W. A., Jr., J. Broman, G. Healy, T. Quinn, and J. I. Ravdin. 1989. Antigenic stability and immunodominance of the Gal/GalNAc adherence lectin of Entamoeba histolytica. Am J Med Sci.297:163-165.

56. Petri, W. A., Jr., T. F. Jackson, V. Gathiram, K. Kress, L. D. Saffer, T. L. Snodgrass, M. D. Chapman, Z. Keren, and D. Mirelman. 1990. Pathogenic and nonpathogenic strains of Entamoeba histolytica can be differentiated by monoclonal antibodies to the galactose-specific adherence lectin. Infect Immun.58: 1802-1806.

57. Pillai, D. R„ D. Britten, J. P. Ackers, J. I. Ravdin, and K. C. Kain. 1997. A gene homologous to hgl2 of Entamoeba histolytica is present and expressed in Entamoeba dispar. Mol Biochem Parasitol.87: 101-105.

58. Pillai, D. R„ J. S. Keystone, D. C. Sheppard, J. D. MacLean, D. W. MacPherson, and K. C. Kain. 1999. Entamoeba histolytica and Entamoeba dispar. epidemiology and comparison of diagnostic methods in a setting of nonendemicity. Clin Infect Dis.29: 1315-1318.

59. Pillai, D. R., and K. C. Kain. 1999. Immunochromatographic strip-based detection of Entamoeba histolytica-E. dispar and Giardia lamblia coproantigen. J Clin Microbiol.37:3017-3019.

60. Sargeaunt, P. G., J. E. Williams, and J. D. Grene. 1978. The differentiation of invasive and non-invasive Entamoeba histolytica by isoenzyme electrophoresis. Trans R Soc Trop Med Hyg.72:519-521.

61. Strachan, W. D., P. L. Chiodini, W. M. Spice, A. H. Moody, and J. P. Ackers. 1988. Immunological differentiation of pathogenic and non-pathogenic isolates of Entamoeba histolytica, Lancet. l :561-563.

62. Troll, H., H. Marti, and N. Weiss. 1997. Simple differential detection of Entamoeba histolytica and Entamoeba dispar in fresh stool specimens by sodium acetate-acetic acid-formalin concentration and PCR. J Clin Microbiol.35:1701- 1705.

Claims

We claim:

1. A recombinant protein substantially identical to a 170 kDa heavy subunit of the Gal/GalNAc specific lectin of Entamoeba histolytica.

2. A recombinant protein in accordance with Claim 1, wherein the protein is immunoreactive with E. histolytica lectin specific antibodies and wherein the protein is capable of binding asialofetuin in a Gal/GalNAc inhibitable manner.

3. A recombinant protein substantially identical to the cysteine-rich fragment of the 170 kDa subunit of the Gal/GalNAc specific lectin of E. histolytica.

4. A recombinant protein in accordance with Claim 3, wherein the protein is immunoreactive with adherence-inhibitory antibody IG7 and wherein the protein lacks the adherence-enhancing epitopes recognized by monoclonal antibodies 8A3 and 3F4.

5. A vaccine comprising the recombinant protein of Claim 1 or 3 and a pharmaceutically acceptable carrier, excipient, diluent, or adjuvant.

6. A vaccine comprising a nucleotide sequence encoding the recombinant protein of Claim 1 or 3 and a pharmaceutically acceptable earner, excipient, diluent, or adjuvant.

7. A serologic assay comprising the recombinant protein of Claim 1 or 3.

8. A serologic assay comprising a nucleotide sequence encoding the recombinant protein of Claim 1 or 3 and a pharmaceutically acceptable carrier, excipient, diluent, or adjuvant.

9. Use of the protein of Claim 1 or 3 or a gene sequence encoding said protein as an immunogen.

10. A transformed insect host cell capable of expressing recombinant proteins substantially identical to a 170 kDa heavy subunit of a Gal/GalNAc specific lectin of an E. histolytica trophozoite and its cysteine-rich fragment, said host cell infected with:

(a) a recombinant baculovirus transfer vector in which an isolated nucleotide sequence encoding the 170 kDa heavy subunit of a Gal/GalNAc lectin and cysteine-rich fragment of the lectin has been inserted, said recombinant baculovirus transfer vector having a honeybee melittin signal sequence at the 5' end and polyhistidines at the 3' end of its insertion site, and

(b) a viral expression vector.

1 1. A transformed insect host cell in accordance with Claim 10, wherein said transformed host cell is Spodoptera frugiperda and said baculovirus transfer vector is pAcMeH6.

12. Monoclonal antibodies which specifically bind to epitopes of E. histolytica but not to epitopes of E. dispar, in preserved biological samples.

13. Monoclonal antibodies in accordance with Claim 12, wherein the biological samples are preserved fecal samples.

14. Monoclonal antibodies in accordance with Claim 13, wherein said monoclonal antibodies are selected from the group consisting of SB4D7, SB2F2, SB4G1 L or NL3B3.

15. Use of the monoclonal antibody described in Claim 12 for detecting and distinguishing the presence of E. histolytica from the presence of E. dispar in a preserved biological sample.

16. Use in accordance with claim 15 wherein said biological sample is a preserved fecal sample.

17. Use in accordance with claim 15 wherein said preserved biological sample is a preserved serum, blood, tissue, or aspirate sample.

18. A kit for detecting and distinguishing the presence of E. histolytica from the presence of E. dispar in preserved fecal samples, said kit comprising:

(a) a monoclonal antibody that binds to an epitope of the 170 kDa subunit of Gal/GalNAc lectin of E. histolytica, but not to epitopes of E. dispar, in preserved fecal samples; and

(b) means for detecting the reaction between the monoclonal antibody and the epitope.

19. A method for expressing recombinant proteins substantially identical to a 170 kDa heavy subunit of a Gal/GalNAc specific lectin of an E. histolytica trophozoite and its cysteine-rich fragment, said method comprising;

(a) isolating nucleotide sequences which encode the 170 kDa heavy subunit of a Gal/GalNAc specific lectin and the cysteine-rich fragment of the lectin;

(b) cloning the nucleotide sequences into a first transfer vector;

(c) subcloning the nucleotide sequences into a second transfer vector to form a recombinant transfer vector;

(d) cotransfecting insect host cells with an expression vector and the recombinant transfer vector to form recombinant clones; and

(e) selecting, propagating, and purifying the recombinant clones.

20. A method in accordance with Claim 19, wherein the first transfer vector is pCRtmll, the second transfer vector is baculovirus transfer vector pAcMeH6 having a honeybee melittin signal sequence at its 5' end and polyhistidines at the 3'end of its insertion site; the insect host cell is a Spodoptera frugiperda insect cell; and the expression vector is Bsu36I digested BacPakό viral DNA.

21. The recombinant proteins produced according to the method of Claim 19 or 20.

22. A method of producing monoclonal antibodies that recognize E. histolytica but not E. dispar in preserved fecal samples, said method comprising: (a) producing a purified recombinant protein substantially identical to the 170 kDa subunit of the Gal/GalNAc specific lectin of E. histolytica trophozoites in accordance with the method of claim 19 or 20;

(b) fixing said recombinant protein with a stool preservative;

(c) immunizing a mammal with the fixed recombinant protein; and

(d) harvesting the antibodies or cells secreting the antibodies from the mammal.

23. The method of claim 22 wherein said stool preservative is sodium acetate-acetic acid formalin.

24. The monoclonal antibodies produced by the method of claim 22.

25. Use of the monoclonal antibodies of claim 24 for diagnosing E. histolytica infection in preserved fecal samples.

26. A method of diagnosing E, histolytica infection in a preserved fecal sample, which method comprises:

(a) detecting and distinguishing the presence of E. histolytica from E. dispar in the sample by contacting said sample with a monoclonal antibody that binds to an epitope of the 170 kDa subunit of Gal/GalNAc lectin of E. histolytica but not to an epitope of E. dispar, in preserved fecal samples; and

(b) detecting the reaction between said monoclonal antibody and said epitope.

27. The method of Claim 26, wherein said monoclonal antibody does not bind with any other bowel protozoa.

28. The method of claim 26 wherein said monoclonal antibody is selected from the group consisting of SB4D7, SB2F2, SB4G1 1, or NL3B3.

29. The method of claim 26 wherein step (b) is conducted using a method selected from the group consisting of an immunoflourescence assay, a capture-ELISA system or a rapid immunochromatographic dipstick assay.

30. A method of producing monoclonal antibodies for diagnosing parasitic infection in preserved biological samples, said method comprising:

(a) fixing a recombinant protein or a native protein having antigens specific to antibodies produced in response to said parasitic infection, with a stool preservative,

(b) immunizing a mammal with the fixed protein, and

(c) harvesting the antibodies or cells secreting the antibodies from the mammal.

31. The method of claim 30 wherein said preserved biological sample is a preserved fecal sample.

32. The method of claim 30 wherein said parasitic infection is giardia or cyclospora or cryptosporidia.

33. The monoclonal antibodies produced by the method of claim 30, 31 or 32.

34. Use of the monoclonal antibodies of claim 33 for diagnosing a parasitic infection in preserved biological samples.

35. Use of the monoclonal antibodies of claim 33 for diagnosing a parasitic infection in preserved serum, blood, tissue, or aspirate samples.