WO2002030976A1

WO2002030976A1 - Cell control nucleic acids and proteins

Info

Publication number: WO2002030976A1
Application number: PCT/AU2001/001281
Authority: WO
Inventors: Peter Smith; Marie Dziadek; Nigel Parker; Richard Williams; Paul Senior; Jean-Pierre Eid
Original assignee: The University Of Melbourne
Priority date: 2000-10-11
Filing date: 2001-10-11
Publication date: 2002-04-18

Abstract

The present invention relates to a novel molecule, STIM2. In particular, it relates to a nucleic acid molecule encoding STIM2, or a biologically active fragment thereof.

Description

Cell Control Nucleic Acids and Proteins

Field of the Invention

The present invention relates to a novel molecule, STIM2. In particular, it relates to proteins and antibodies directed to STIM2 and uses therefor.

Background of the Invention

Cell growth is controlled through a complex interplay between cells and their environment. This interplay includes cells integrating diverse external signals from soluble growth factors, protein substrata and other cells through signalling cascades. These cascades involve growth factor receptors and signal transduction proteins and enzymes, which ultimately impinge on the regulation of the cell's genes. Positive and negative growth control has in recent times emerged as concepts to describe the nature of signals, which either accelerate or slow down cell growth, respectively. The prototype gene in the gene family being considered here, STIMl, was identified as being a gene located adjacent to RRMl at human chromosome llpl5.5 (Parker et al . 1996), and encoding a protein that could interact with pre-B cells (Oritani and incade, 1996) . The region to which STIMl maps is implicated in several childhood and adult tumours, including Wilms' tumour, rhabdomyosarcoma, neuroblastoma, lung and breast cancers and the overgrowth disorder, Beckwith Wiedemann syndrome (B S) (Hoovers et al . , 1995; Koufos et al . , 1989; Mannens et al . , 1996) . BWS is associated with increased risk of a number of paediatric tumours (Sotel-Avila and Gooch, 1976) . Our recent unpublished work and that of others (Sabbioni et al . 1997) has indicated that STIMl acts as a growth suppressor in the rhabdoid cell line G401 and also suppresses cell proliferation of rodent myogenic cell lines (Morison et al , in preparation) . Previous work using the G401 cell line had shown that a 2.5Mb subchromosomal fragment of llpl5.5, which includes STIMl, could suppress growth and tumorigenicity, suggesting the presence of a tumour suppressor gene in this region ( oi et al . 1993). Since over-expression of STIMl in G401 cells after transfection of STIMl cDNA results in growth suppression it must be considered a candidate tumour suppressor from the region.

The 4kb cDNA sequence of STIMl predicts a novel transmembrane protein of 74kDa following the cleavage of the 22 amino acid leader peptide. The extracellular domain consists of 190 amino acids, and has two closely spaced cysteine residues that may be involved in intra- or interchain disulphide bonding. The position and spacing of these residues are conserved in the Drosophila homologue of STIMl. The extracellular domain also has two potential N- linked glycosylation sites, and contains no obvious receptor motifs. The intracellular domain, of 450 amino acids, has several features: i) a double coiled-coil domain that shares weak homology with some cytoskeletal proteins in that they all form amphipathic helices, the structure of this motif is conserved in the Drosophila homologue; ii) two potential SH2 binding motifs, one of which conforms to the consensus binding sequence for GRB2 ; and iii) a proline rich domain (30% P) that contains many potential proline-directed serine/threonine phosphorylation sites and a potential SH3 binding motif (PXXPXP) .

• These features suggest that STIMl may be involved in signal transduction by acting as a transmembrane receptor or as an adaptor molecule for a protein that lacks signalling motifs .

STIMl binds to the surface of pre-B cells, and promotes their survival and proliferation, with binding being dependent on divalent cations, especially Mn^÷ (Oritani and Kincade, 1996) . STIMl has no homology with other cell surface receptors, and appears to be a novel transmembrane protein. We have demonstrated, by cell surface biotinylation studies in addition to immunofluorescent analysis, that STIMl is indeed present on the cell surface of K562 cells. STIMl is glycosylated and is phosphorylated predominantly on serine residues in vivo (Manji et al , 2000) . Despite these data no physiological function has yet been assigned to STIMl.

It will be clearly understood that, although a number of prior art publications are referred to herein, this reference does not constitute an admission that any of these documents forms part of the common general knowledge in the art, in Australia or in any other country.

STIM2 was identified from database -searches to encode a protein having a closely related structure to STIMl . This homology indicates that STIM2 may have a similar biological function to STIMl.

Additionally, we confirm the existence of a single STIM family member in D. melanogaster , that shares genomic structure, protein domain organisation, and biochemical features with STIMl and STIM2. Finally, we provide evidence that the STIM family has evolved from a single gene family in lower eukaryotes, to a dual family in vertebrates.

Summary of the Invention

Accordingly, in a first aspect, the present invention provides a nucleic acid molecule encoding STIM2 , or a biologically active fragment thereof.

The nucleic acid may be genomic DNA, cDNA, RNA, or a hybrid molecule thereof. Most preferably, the nucleic acid is a cDNA molecule having a nucleotide sequence as shown in Figure 1, or a nucleic acid molecule, which is able to hybridize thereto under stringent conditions.

In a second aspect, the present invention provides a STIM2 polypeptide, or a biologically active fragment thereof . Preferably the polypeptide has an amino acid sequence as shown in Figure 2. Modified and variant forms of STIM2 may be produced in vi tro by means of chemical or enzymatic treatment, or in vivo by means of recombinant DNA technology. Such polypeptides may differ from native STIM2 , for example, by virtue of one or more amino acid substitutions, deletions or insertions, or in the extent or pattern of glycosylation, but substantially retains a biological activity of native STIM2.

In a third aspect, the present invention provides a method of modulating the activity of cells, comprising the step of administering to mammalian cells a protein encoded by the nucleic acid sequence shown in Figure 1. Preferably the activity modulated is selected from the group consisting of cell proliferation, cell differentiation and cell viability.

In a fourth aspect, the present invention provides an antisense nucleic acid that is capable of binding to the coding sequence of STIM2. Preferably the antisense sequence has the ability to inhibit the activity of STIM2 in cells when transfected into them. More preferably the activity which is inhibited is selected from the group consisting of cell proliferation, cell differentiation and cell viability. Most preferably, the antisense sequence has a sequence as shown in Figure 17.

In a fifth aspect, the present invention provides a fragment of STIM2 which is capable of eliciting an antibody which co-precipitates a STIM2 ligand. Preferably the fragment is the C-terminal portion of STIM2. Most preferably, the fragment is the C-terminal 22 amino acid segment shown below:

CHNGEKSKKPSEIKSLFKKKSK .

In a sixth aspect, the present invention provides an antibody elicited by a STIM2 fragment according to the fifth aspect of the invention. Antibodies to STIM2 are produced by immunizing an animal with STIM2 , or a fragment thereof, optionally in conjunction with an immunogenic polypeptide, and thereafter recovering antibodies from the serum of the immunized animals. Alternatively, monoclonal antibodies are prepared from cells of the immunized animal in conventional fashion. Accordingly, the antibody may be polyclonal or monoclonal, but is preferably monoclonal. Immobilized anti-STIM2 antibodies are particularly useful in the detection of STIM2 in clinical samples for diagnostic purposes, and in the purification of STIM2. Methods of immobilization of antibodies on solid supports such as beads, plastic or glass surfaces are well known in the art . In a seventh aspect, the invention provides a polypeptide which is specifically co-precipitated by an antibody of the invention from a cell expressing full- length STIM2 protein. Preferably the cell is stably over- expressing the full-length STIM2 protein. Even more preferably the polypeptide is co-precipitated by an antibody directed against the C-terminal peptide.

In a particularly preferred embodiment, the polypeptide has the ability to bind to STIM2 , and thereby to modulate an activity selected from the group consisting of cell cycle control, cellular differentiation, cell proliferation, cell survival and cell migration.

In an eighth aspect, the invention provides a method of screening for a ligand able to bind to and to modulate the activity of STIM2. Such methods include but are not limited to: a) . use of antibodies to STIM2 to immunoprecipitate STIM2 and proteins bound to STIM2 ; b) . screening lambda phage expression libraries for proteins that bind STIM2 peptides or fragments; c) . using cDNA sequences coding for specific extracellular and intracytoplasmic domains of STIM2 as "bait" sequences in the yeast two-hybrid system, to screen for binding proteins; d) . using STIM2 peptides and/or fragments in solid- phase affinity binding assays such as chromatography and biosensor assays to identify proteins extracted from cells and tissues that bind to STIM2 peptides and fragments; and e) . using monoclonal antibodies to STIM2 and/or fragments thereof to compete for binding of STIM2 ; f) .^" using epitope-labelled STIM2 fragments to screen for binding proteins in eukaryotic cell lysates . In further aspects, the invention provides a method for determining the presence of a nucleic acid molecule encoding STIM2 in test samples prepared from cells, tissues, or biological fluids, comprising the step of contacting the test sample with isolated DNA comprising all or a portion of the nucleotide coding sequence for

STIM2, and determining whether the isolated DNA hybridizes to a nucleic acid molecule in the test sample. DNA comprising all or a portion of the nucleotide coding sequence for STIM2 may also be used in hybridization assays to identify and to isolate nucleic acids sharing substantial sequence identity to the coding sequence for STIM2 , such as nucleic acids that encode allelic variants of STIM2.

Also provided is a method for amplifying a nucleic acid molecule encoding STIM2 that is present in a test sample, comprising the use of oligonucleotides having' a portion of the nucleotide coding sequence for STIM2 as primers in a polymerase chain reaction.

Accordingly, the present invention provides molecules capable of binding to STIM2.

Preferably the molecules are either ligands or antibodies, or functional fragments thereof. Where the molecule is an antibody, it is preferable that the antibody is an antagonist or an agonist of STIM2. It is contemplated that by using the polypeptides of the invention, or an agonist or antagonist thereof, it will be possible to effect a number of interventions into cell growth, proliferation and invasive behaviour, for example : (a) induction of cell cycling, and hence proliferation, of normally non-dividing cells, such as neurons and skeletal or cardiac muscle cells; (b) induction of cell cycle arrest, for example inhibition of growth of dividing cells such as tumour cells;

(c) induction of cellular differentiation, for example differentiation of tumour cells; and

(d) induction or inhibition of cell migration and tissue invasion, for example, metastasis of tumour cells .

(e) induction of cell death, for example death of tumour cells.

It is therefore further contemplated that the polypeptides of the invention will be applicable to methods of treatment of neurological and muscular degenerative conditions and to wound healing, and to treatment of a variety of cancers, especially embryonal tumours, rhabdomyosarcoma, brain tumours such as glioma and astrocytoma, lung cancer, breast cancer and head and neck squamous carcinoma.

STIM2 , its derivatives, or its antibodies may also be formulated with physiologically acceptable carriers, especially for therapeutic use. Such carriers are used, for example, to provide sustained-release formulations of STIM2.

In a ninth aspect, the present invention provides a method of screening for anti-cancer agents that have the ability to modulate interaction of STIM2 with the Notch signalling pathway comprising the steps of: a) . exposing a candidate anti-cancer agent to STIM2 in the presence of Notch receptor-ligand; b) . detecting the interaction of STIM2 with the

Notch receptor-ligand; and c) . determining the effects of step b) on Notch activation.

Throughout the description and claims of this specification, the word "comprise" and variations of the word, such as "comprising" and "comprises", means "including but not limited to" and is not intended to exclude other additives, components, integers or steps.

Brief description of Figures

Figure 1 shows the cDNA sequence of STIM2. Figure 2 shows the deduced amino acid sequence of

STIM2.

Figure 3 shows a comparison of the amino acid sequences of STIMl, STIM2 and Drosophila STIM.

Figure 4 shows a schematic view of the three STIM2 cDNA clones.

Figure 5 shows the 600 base pair 5' region of clone H5F7 and annotation of sequence features.

Figure 6 shows the comparison of the sequence of human and rodent STIM2 cDNAs in the regions corresponding to the translation start sites.

Figure 7 shows the outline of the mutational strategy to identify the in vivo translational start site in Human STIM2.

Figure 8 shows a schematic of the domain structure of Human STIMl (left) Human STIM2 (centre) and D. Melanogaster STIM (right) .

Figure 9 shows the chromosomal localisation to 4pl5.1 of human STIM2.

Figure 10 shows the map figure from the Jackson BSS backcross showing part of Chromosome 5.

Figure 11 shows expression of STIMl and STIM2 mRNA as determined by Northern analysis .

Figure 12 shows the biallelic expression of murine STIM2 mRNA in foetal tissues. Figure 13 shows recognition of STIM2 expressed in cells by an antibody to the C-terminal peptide of STIM2.

Figure 14 shows that Human STIMl and STIM2 are both modified by N-linked glycosylation.

Figure 15 shows the characterisation of antibodies reactive with Human STIMl and STIM2.

Figure 16 shows the association of Human STIMl with Human STIM2 in vivo .

Figure 17 shows an antisense STIM2 sequence.

Figure 18 shows histological sections of PC12 tumours stained with haematoxylin and eosin.

Figure 19 shows scanning electron micrographs of eyes of adult Drosophila.

Figure 20 shows wing phenotypes of 32B GAL4/UAS- DStim flies at 29°C.

Detailed Description of the Invention For the purposes of this specification, "STIM2" or "STIM2 protein" refers to a polypeptide or protein encoded by the STIM2 nucleotide sequence set forth in Figure 1; a polypeptide that is the translated amino acid sequence set forth in Figure 2; fragments thereof having greater than about 5 amino acid residues, and comprising an immune epitope or other biologically active site of STIM2 ; amino acid sequence variants of the amino acid sequence set forth in Figure 2 wherein one or more amino acid residues are added at the N- or C-terminus of, or within, said Figure 2 sequence or its fragments as defined above; amino acid sequence variants of said Figure 2 sequence or its fragments as defined above wherein one or more amino acid residues of said Figure 2 sequence or fragment thereof are deleted, and optionally substituted by one or more amino acid residues; and derivatives of the above proteins, polypeptides, or fragments thereof, wherein an amino acid residue has been covalently modified so that the resulting product is a non-naturally occurring amino acid. STIM2 amino acid sequence variants may be made synthetically, for example by site-directed or PCR mutagenesis, or may exist naturally, as in the case of allelic forms and other naturally-occurring variants of the translated amino acid sequence set forth in Figure 2 that may occur in human and other animal species .

A STIM2 amino acid sequence variant is included within the scope of the invention, provided that it is functionally active. As used herein, the terms

"functionally active" and "functional activity" in reference to STIM2 means that the STIM2 is able to function in a similar way to naturally-occurring STIM2 , and/or that the STIM2 is immunologically cross-reactive with an antibody directed against an epitope of naturally-occurring STIM2. Therefore, STIM2 amino acid sequence variants generally will share at least about 75% (preferably greater than 80%, and more preferably greater than 90%) sequence identity with the amino acid sequence set forth in Figure 2, after aligning the sequences to provide for maximum homology, as determined, for example, by the Fitch, et al . , Proc . Nat . Acad. Sci . USA 80:1382-1386 (1983), version of the algorithm described by Needleman, et al . , J. Mol . Biol . 48:443-453 (1970). Amino acid sequence variants of STIM2 are prepared by introducing appropriate nucleotide changes into STIM2 cDNA and thereafter expressing the resulting modified cDNA in a host cell, or by in vi tro synthesis. Such variants include, for example, deletions from, or insertions or substitutions of, amino acid residues within the STIM2 amino acid sequence set forth in Figure 2. Any combination Of deletion, insertion, and substitution may be made to arrive at an amino acid sequence variant of STIM2 , provided that such variant possesses the desired characteristics described herein. Changes that are made in the amino acid sequence set forth in Figure 2 to arrive at an amino acid sequence variant of STIM2 also may result in further modifications of STIM2 upon its expression in host cells, for example, by virtue of such changes introducing or moving sites of glycosylation, or introducing membrane anchor sequences as described, for example, in PCT Pat. Pub. No. WO89/01041 (published February 9, 1989) . There are two principal variables in the construction of amino acid sequence variants of STIM2 : the location of the mutation site and the nature of the mutation. These are variants from the amino acid sequence set forth in Figure 2 , and may represent naturally occurring allelic forms of STIM2 , or predetermined mutant forms of STIM2 made by mutating STIM2 DNA, either to arrive at an allele or a variant not found in nature. In general, the location and nature of the mutation chosen will depend upon the STIM2 characteristic to be modified.

For example, due to the degeneracy of nucleotide coding sequences , mutations can be made in the STIM2 nucleotide sequence set forth in Figure 1 without affecting the amino acid sequence of the STIM2 encoded thereby. Other mutations can be made that will result in a STIM2 that has an amino acid sequence different from that set forth in Figure 2, but which is functionally active. Such functionally active amino acid sequence variants of STIM2 are selected, for example, by substituting one or more amino acid residues in the amino acid sequence set forth in Figure 2 with other amino acid residues of a similar or different polarity or charge.

- One useful approach is called "alanine scanning mutagenesis." Here, an amino acid residue or group of target residues are identified (e.g., charged residues such as arg, asp, his, lys, and glu) and, by means of recombinant DNA technology, replaced by a neutral or negatively charged amino acid (most preferably alanine or polyalanine) to affect the interaction of the amino acids with the surrounding aqueous environment in or outside the cell. Cunningham, et al . , Science 244: 1081-1085 (1989). Those domains demonstrating functional sensitivity to the substitutions then are refined by introducing further or other variants at or for the sites of substitution. Obviously, such variations that, for example, convert the amino acid sequence set forth in Figure 2 to the amino acid sequence of a known polypeptide or protein are not included within the scope of this invention, nor are any other fragments, variants, and derivatives of the amino acid STIM2 that are not novel and unobvious over the prior art . Thus, while the site for introducing an amino acid sequence variation is predetermined, the nature of the mutation per se need not be predetermined. For example, to optimize the performance of a mutation at a given site, alanine scanning or random mutagenesis is conducted at the target codon or region and the expressed STIM2 variants are screened for functional activity.

Amino acid sequence deletions generally range from about 1 to 30 residues, .more preferably about 1 to 10 residues, and typically are contiguous. Generally, the number of consecutive deletions will be selected so as to preserve the tertiary structure of STIM2 in the affected domain, e.g., beta-pleated sheet or alpha helix.

Amino acid sequence insertions include amino- and/or carboxyl-terminal fusions ranging in length from one amino acid residue to polypeptides containing a hundred or more residues, as well as intrasequence insertions of single or multiple amino acid residues. Intrasequence insertions (i.e., insertions made within the amino acid sequence set forth in Figure 2) may range generally from about 1 to 10 residues, more preferably 1 to 5, most preferably 1 to 3. Examples of terminal insertions include STIM2 with an N-terminal methionyl residue (such as may result from the direct expression of STIM2 in recombinant cell culture) , and STIM2 with a heterologous N-terminal signal sequence to improve the secretion of STIM2 from recombinant host cells. Such signal sequences generally will be homologous to the host cell used for expression of STIM2, and include STII or lpp for E. coli , alpha factor for yeast, and viral signals such as herpes gD for mammalian cells . Other insertions include the fusion to the N- or C-terminus of STIM2 of immunogenic polypeptides

(for example, bacterial polypeptides such as beta-lactamase or an enzyme encoded by the Ξ. coli trp locus, or yeast protein, or a polyHis tag) , and C-terminal fusions with proteins having a long half-life such as immunoglobulin constant regions, albumin, or ferritin, as described in PCT Pat. Pub. No. WO89/02922 (published April 6, 1989) . The third group of variants are those in which at least one amino acid residue in the amino acid sequence set forth in Figure 2. Preferably one to four, more preferably one to three, even more preferably one to two, and most preferably only one amino acid residue has been removed and a different residue inserted in its place. The sites of greatest interest for making such substitutions are in the regions of the amino acid sequence set forth in Figure 2 that have the greatest homology with STIMl. Those sites are likely to be important to the functional activity of the STIM2. Accordingly, to retain functional activity, those sites,, especially those falling within a sequence of at least three other identically conserved sites, are substituted in a relatively conservative manner. Such conservative substitutions are shown in Table 1 under the heading of preferred substitutions. If such substitutions do not result in a change in functional activity, then more substantial changes, denominated exemplary substitutions in Table 1, or as further described below in reference to amino acid classes, may be introduced and the resulting variant STIM2 analyzed for functional activity..

Table 1

Original Exemplary Preferred Residue Substitutions Substitutions

Ala (A) val; leu; ile val

Arg (R) lys; gin; asn lys

Asn (N) gin; his; lys; arg gin

Asp (D) glu glu

Cys (C) ser ser Gin (Q) asn asn

Glu (E) asp asp

Gly (G) pro pro

His (H) asn; gin; lys; arg arg

Ile (I) leu; val; met; ala; phe; norleucine leu

Leu (L) norleucine; ile; val; met; ala; phe ile

Lys (K) arg; gin; asn arg

Met (M) leu; phe; ile leu Phe (F) leu; val; ile; ala leu

Pro (P) gly gly

Ser (S) thr thr

Thr (T) ser ser

Trp (W) tyr tyr Tyr (Y) trp; phe; thr; ser phe

Val (V) ile; leu; met; phe; ala; norleucine leu

Insertional, deletional, and substitutional changes in the amino acid sequence set forth in Figure 2 may be made to improve the stability of STIM2. For example, trypsin or other protease cleavage sites are identified by inspection of the encoded amino acid sequence for an arginyl or lysinyl residue. These are rendered inactive to protease by substituting the residue with another residue, preferably a basic residue such as glutamine or a hydrophobic residue such as serine; by deleting the residue; or by inserting a prolyl residue immediately after the residue. Also, any cysteine residues not involved in maintaining the proper conformation of STIM2 for functional activity may be substituted, generally with serine, to improve the oxidative stability of the molecule and prevent aberrant crosslinking.

Cysteinyl residues most commonly are reacted with α-haloacetates (and corresponding amines), such as chloroacetic acid or chloroacetamide, to give carboxymethyl or carboxyamidomethyl derivatives. Cysteinyl residues also are derivatized by reaction with bromotrifluoroacetone, - bromo-β- (5-imidozoyl)propionic acid, chloroacetyl phosphate, N-alkylmaleimides, 3-nitro-2-pyridyl disulfide, methyl 2-pyridyl disulfide, p-chloromercuribenzoate, 2- chloromercuri-4-nitrophenol, or chloro-7-nitrobenzo-2-oxa- 1,3-diazole.

Histidyl residues are derivatized by reaction with diethylpyrocarbonate at pH 5.5-7.0 because this agent is relatively specific for the histidyl side chain. Para- bromophenacyl bromide also is useful; the reaction is preferably performed in 0. IM sodium cacodylate at pH 6.0. Lysinyl and amino terminal residues are reacted with succinic or other carboxylic acid anhydrides . Derivatization with these agents has the effect of reversing the charge of the lysinyl residues. Other suitable reagents for derivatizing -amino-containing residues include imidoesters such as methyl picolinimidate; pyridoxal phosphate; pyridoxal; chloroborohydride; trinitrobenzenesulfonic acid; O-methylisourea; 2,4- pentanedione; and transaminase-catalyzed reaction with glyoxylate .

Arginyl residues are modified by reaction with one or several conventional reagents, among them phenylglyoxal , 2, 3-butanedione, 1, 2-cyclohexanedione, and ninhydrin. Derivatization of arginine residues requires that the reaction be performed in alkaline conditions because of the high pK_a of the guanidine functional group. Furthermore, these reagents may react with the groups of lysine as well as the arginine epsilon-amino group.

The specific modification of tyrosyl residues may be made, with particular interest in introducing spectral labels into tyrosyl residues by reaction with aromatic diazonium compounds or tetranitromethane. Most commonly,

N-acetylimidizole and tetranitromethane are used to form 0- acetyl tyrosyl species and 3-nitro derivatives, respectively. Tyrosyl residues are iodinated using ¹²⁵I or ¹³¹I to prepare labeled proteins for use in radioimmunoassay, the chloramine T method described above being suitable.

Carboxyl side groups (aspartyl or glutamyl) are selectively modified by reaction with carbodiimides (R'- N=C=N-R'), where R and R' are different alkyl groups, such as l-cyclohexyl-3- (2-morpholinyl-4-ethyl) carbodiimide or l-ethyl-3- (4-azonia-4, 4-dimethylpentyl) carbodiimide. Furthermore, aspartyl and glutamyl residues are converted to asparaginyl and glutaminyl residues by reaction with ammonium ions . Derivatization with bifunctional agents is useful for crosslinking STIM2 to a water-insoluble support matrix or surface for use in the method for purifying anti-STIM2 antibodies, or for therapeutic use. Commonly used crosslinking agents include, e.g., 1, 1-bis (diazoacetyl) -2- phenylethane, glutaraldehyde, N-hydroxysuccinimide esters, for example, esters with 4-azidosalicylic acid, homobifunctional imidoesters, including disuccinimidyl esters such as 3 , 3 ' -dithiobis (succinimidylpropionate) , and bifunctional maleimides such as bis-N-maleimido-1, 8-octane. Derivatizing agents such as methyl-3- [ (p-azidophenyl) - dithio]propioimidate yield photoactivatable intermediates that are capable of forming crosslinks in the presence of light. Alternatively, reactive water-insoluble matrices such as cyanogen bromide-activated carbohydrates and the reactive substrates described in U.S. Pat. Nos . 3,969,287; 3,691,016; 4,195,128; 4,247,642; 4,229,537; and 4,330,440 are employed for protein immobilization.

Glutaminyl and asparaginyl residues are frequently deamidated to the corresponding glutamyl and aspartyl residues, respectively. Alternatively, these residues are deamidated under mildly acidic conditions . Either form of these residues falls within the scope of this invention.

Other modifications include hydroxylation of proline and lysine, phosphorylation of hydroxyl groups of seryl or threonyl residues, methylation of the α-amino groups of lysine, arginine, and histidine side chains, acetylation of the N-terminal amine, and amidation of any C-terminal carboxyl group. Creighton, Proteins: Structure and Molecular Properties, pp.79-86 (W.H. Freeman & Co., 1983) . STIM2 may also be covalently linked to non- proteinaceous polymers, e.g. polyethylene glycol, polypropylene glycol or polyoxyalkylenes, in the manner set forth in U.S. Pat. Nos. 4,179,337; 4,301,144; 4,496,689; 4,640,835; 4,670,417; or 4,791,192.

"STIM2 antagonist" or "antagonist" refers to a substance that opposes or interferes with a functional activity of STIM2.

"Cell," "host cell," "cell line," and "cell culture" are used interchangeably and all such terms should be understood to include progeny. Thus, the words "transformants" and "transformed cells" include the primary subject cell and cultures derived therefrom without regard for the number of times the cultures have been passaged. It should also be understood that all progeny may not be precisely identical in DNA content, due to deliberate or inadvertent mutations .

"Plasmids" are DNA molecules that are capable of replicating within a host cell, either extrachromosomally or as part of the host cell chromosome (s) , and are designated by a lower case "p" preceded and/or followed by capital letters and/or numbers. The starting plasmids herein are commercially available, are publicly available on an unrestricted basis, or can be constructed from such available plasmids as disclosed herein and/or in accordance with published procedures. In certain instances, as will be apparent to the ordinarily skilled artisan, other plasmids known in the art may be used interchangeably with plasmids described herein.

"Control sequences" refers to DNA sequences necessary for the expression of an operably linked nucleotide coding sequence in a particular host cell. The control sequences that are suitable for expression in prokaryotes, for example, include origins of replication, promoters, ribosome binding sites, and transcription termination sites. The control sequences that are suitable, for expression in eukaryotes, for example, include origins of replication, promoters, ribosome binding sites, polyadenylation signals, and enhancers.

An "exogenous" element is one that is foreign to the host cell, or homologous to the host cell but in a position within the host cell in which the element is ordinarily not found. "Digestion" of DNA refers to the catalytic cleavage of DNA with an enzyme that acts only at certain locations in the DNA. Such enzymes are called restriction enzymes or restriction endonucleases, and the sites within DNA where such enzymes cleave are called restriction sites . If there are multiple restriction sites within the DNA, digestion will produce two or more linearized DNA fragments (restriction fragments) . The various restriction enzymes used herein are commercially available and their reaction conditions, cofactors, and other requirements as established by the enzyme manufacturers are used.

Restriction enzymes commonly are designated by abbreviations composed of a capital letter followed by other letters representing the microorganism from which each restriction enzyme originally was obtained and then a number designating the particular enzyme. In general, about 1 μg of DNA is digested with about 1-2 units of enzyme in about 20 μl of buffer solution. Appropriate buffers and substrate amounts for particular restriction enzymes are specified by the manufacturer, and/or are well known in the art .

"Recovery" or "isolation" of a given fragment of DNA from a restriction digest typically is accomplished by separating the digestion products, which are referred to as "restriction fragments," on a polyacrylamide or agarose gel- by electrophoresis, identifying the fragment of interest on the basis of its mobility relative to that of marker DNA fragments of known molecular weight, excising the portion . of the gel that contains the desired fragment, and separating the DNA from the gel, for example by electroelution . "Ligation" refers to the process of forming phosphodiester bonds between two double-stranded -DNA fragments. Unless otherwise specified, ligation is accomplished using known buffers and conditions with 10 units of T4 DNA ligase per 0.5 μg of approximately equimolar amounts of the DNA fragments to be ligated. "Oligonucleotides" are short-length, single- or double-stranded polydeoxynucleotides that are chemically synthesized by known methods (involving, for example, triester, phosphoramidite, or phosphonate chemistry) , such as described by Engels, et al . , Agnew. Chem . Int . Ed. Engl . 28:716-734 (1989). They are then purified, for example, by polyacrylamide gel electrophoresis.

"Polymerase chain reaction, " or "PCR, " as used herein generally refers to a method for amplification of a desired nucleotide sequence in vi tro, as described in U.S. Pat. No. 4,683,195. In general, the PCR method involves repeated cycles of primer extension synthesis, using two oligonucleotide primers capable of hybridizing preferentially to a template nucleic acid. Typically, the primers used in the PCR method will be complementary to nucleotide sequences within the template at both ends of or flanking the nucleotide sequence to be amplified, although primers complementary to the nucleotide sequence to be amplified also may be used. Wang, et al . , in PCR Protocols, pp.70-75 (Academic Press, 1990); Ochman, et al . , in PCR Protocols, pp. 219-227; Triglia, et al . , Nuc . Acids Res . 16:8186 (1988) . "PCR cloning" refers to the use of the PCR method to amplify a specific desired nucleotide sequence that is present amongst the nucleic acids from a suitable cell or tissue source, including total genomic DNA and cDNA transcribed from total cellular RNA. Frohman, et al . , Proc . Nat . Acad. Sci . USA 85:8998-9002 (1988); Saiki, et al . , Science 239:487-492 (1988); Mullis, et al . , Meth . Enzymol . 155:335-350 (1987).

"Stringent conditions" for hybridization or annealing of nucleic acid molecules are those that (1) employ low ionic strength and high temperature for washing, for example, 0.015 M NaCl/0.0015 M sodium citrate/0.1% sodium dodecyl sulfate (SDS) at 50°C, or (2) employ during hybridization a denaturing agent such as formamide, for example, 50% (vol/vol) formamide with 0.1% bovine serum albumin/0.1% Ficoll/0.1% polyvinylpyrrolidone/50 mM sodium phosphate buffer at pH 6.5 with 750 mM NaCl, 75 mM sodium citrate at 42°C. Another example is use of 50% formamide, 5 X SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 X Denhardt's solution, sonicated salmon sperm DNA (50 μg/mL), 0.1% SDS, and 10% dextran sulfate at 42°C, with washes at 42°C in 0.2 X SSC and 0.1% SDS. " STIM2 nucleic acid" is RNA or DNA that encodes STIM2. " STIM2 DNA" is DNA that encodes STIM2. STIM2 DNA is obtained from cDNA or genomic DNA libraries, or by in vi tro synthesis. Identification of STIM2 DNA within a cDNA or a genomic DNA library, or in some other mixture of various DNAs, is conveniently accomplished by the use of an oligonucleotide hybridization probe that is labeled with a detectable moiety, such as a radioisotope. Keller, et al . , DNA Probes, pp.149-213 (Stockton Press, 1989). To identify DNA encoding STIM2 , the nucleotide sequence of the hybridization probe preferably is selected so that the hybridization probe is capable of hybridizing preferentially to DNA encoding the STIM2 amino acid sequence set forth in Figure 2, or a variant or derivative thereof as described herein, under the hybridization conditions chosen. Another method for obtaining STIM2 nucleic acid is to chemically synthesize it using one of the methods described, for example, by Engels, et al . , Agnew. Chem . Int . Ed. Engl . 28:716-734 (1989). If the entire nucleotide coding sequence for

STIM2 is not obtained in a single cDNA, genomic DNA, or other DNA, as determined, for example, by DNA sequencing or restriction endonuclease analysis, then appropriate DNA fragments (e.g., restriction fragments or PCR amplification products) may be recovered from several DNAs and covalently joined to one another to construct the entire ' coding sequence. The preferred means of covalently joining DNA fragments is by ligation using a DNA ligase enzyme, such as T4 DNA ligase. "Isolated" STIM2 nucleic acid is STIM2 nucleic acid that is identified and separated from (or otherwise substantially free from) , contaminant nucleic acid encoding other polypeptides . The isolated STIM2 nucleic acid can be incorporated into a plasmid or expression vector, or can be labeled for diagnostic and probe purposes, using a label as described further herein in the discussion of diagnostic assays and nucleic acid hybridization methods. For example, isolated STIM2 DNA, or a fragment thereof comprising at least about 15 nucleotides, is used as a hybridization probe to detect, diagnose, or monitor disorders or diseases that involve changes in STIM2 expression, such as may result from cancer. In one embodiment of the invention, total RNA in a tissue sample from a patient (that is, a human or other mammal) can be assayed for the presence of STIM2 messenger RNA, wherein the decrease in the amount of STIM2 messenger RNA may be indicative of disease.

Isolated STIM2 nucleic acid also is used to produce STIM2 by recombinant DNA and recombinant cell culture methods. In various embodiments of the invention, host cells are transformed or transfected with recombinant DNA molecules comprising an isolated STIM2 DNA, to obtain expression of the STIM2 DNA and thus the production of STIM2 in large quantities. DNA encoding amino acid sequence variants of STIM2 is prepared by a variety of methods known in the art. These methods include, but are not limited to, isolation from a natural source (in the case of naturally-occurring amino acid sequence variants of STIM2 ) or preparation by site-directed (or oligonucleotide- mediated) mutagenesis, PCR mutagenesis, and cassette mutagenesis of an earlier prepared DNA encoding a variant or a non-variant form of STIM2.

Site-directed mutagenesis is a preferred method for preparing substitution, deletion, and insertion variants of STIM2 DNA. This technique is well known in the art, Zoller, et al . , Meth . Enz . 100:4668-500 (1983); Zoller, et al . , Meth . Enz . 154:329-350 (1987); Carter,

Meth . Enz . 154:382-403 (1987); Horwitz, et al . , Meth . Enz . 185:599-611 (1990), and has been used, for example, to produce amino acid sequence variants of trypsin and T4 lysozyme, which variants have certain desired functional properties. Perry, et al . , Science 226:555-557 (1984); Craik, et al . , Science 228:291-297 (1985).

Briefly, in carrying out site-directed mutagenesis of STIM2 DNA, the STIM2 DNA is altered by first hybridizing an oligonucleotide encoding the desired mutation to a single strand of such STIM2 DNA. After hybridization, a DNA polymerase is used to synthesize an entire second strand, using the hybridized oligonucleotide as a primer, and using the single strand of STIM2 DNA as a template. Thus, the oligonucleotide encoding the desired mutation is incorporated in the resulting double-stranded DNA. Oligonucleotides for use as hybridization probes or primers may be prepared by any suitable method, such as by purification of a naturally occurring DNA or by in vi tro synthesis. For example, oligonucleotides are readily synthesized using various techniques in organic chemistry, such as described by Narang, et al . , Meth . Enzymol . 68:90- 98 (1979); Brown, et al . , Meth . Enzymol . 68:109-151 (1979); Caruther, et al . , Meth . Enzymol . 154:287-313 (1985). The general approach to selecting a suitable hybridization probe or primer is well known. Keller, et al . , DNA Probes, pp.11-18 (Stockton Press, 1989) . Typically, the hybridization probe or primer will contain 10-25 or more nucleotides, and will include at least 5 nucleotides on either side of the sequence encoding the desired mutation so as to ensure that the oligonucleotide will hybridize preferentially to the single-stranded DNA template molecule.

Multiple mutations are introduced into STIM2 DNA to produce amino acid sequence variants of STIM2 comprising several or a combination of insertions, deletions, or substitutions of amino acid residues as compared to the amino acid sequence set forth in Figure 2. If the sites to be mutated are located close together, the mutations may be introduced simultaneously using a single oligonucleotide that encodes all of the desired mutations. If, however, the sites to be mutated are located some distance from each other (separated by more than about ten nucleotides) , it is more difficult to generate a single oligonucleotide that encodes all of the desired changes. Instead, one of two alternative methods may be employed.

In the first method, a separate oligonucleotide is generated for each desired mutation. The oligonucleotides are then annealed to the single-stranded template DNA simultaneously, and the second strand of DNA that is synthesized from the template will encode all of the desired amino acid substitutions.

The alternative method involves two or more rounds of mutagenesis to produce the desired mutant. The first round is as described for ^• introducing a single mutation: a single strand of a previously prepared STIM2 DNA is used as a template, an oligonucleotide encoding the first desired mutation is annealed to this template, and a heteroduplex DNA molecule is then generated. The second round of mutagenesis utilizes the mutated DNA produced in the first round of mutagenesis as the template. Thus, this template already contains one or more mutations . The oligonucleotide encoding the additional desired amino acid substitution (s) is then annealed to this template, and the resulting strand of DNA now encodes mutations from both the first and second rounds of mutagenesis. This resultant DNA can be used as a template in a third round of mutagenesis, and so on. PCR mutagenesis is also suitable for making amino acid sequence variants of STIM2. Higuchi, in PCR Protocols, pp.177-183 (Academic Press, 1990); Vallette, et al . , Nuc . Acids Res . 17:723-733 (1989). Briefly, when small amounts of template DNA are used as starting material in a PCR, primers that differ slightly in sequence from the corresponding region in a template DNA can be used to generate relatively large quantities of a specific DNA fragment that differs from the template sequence only at the positions where the primers differ from the template. For introduction of a mutation into a plasmid

DNA, for example, one of the primers is designed to overlap the position of the mutation and to contain the mutation; the sequence of the other primer must be identical to a nucleotide sequence within the opposite strand of the plasmid DNA, but this sequence can be located anywhere along the plasmid DNA. It is preferred, however, that the sequence of the second primer is located within 200 nucleotides from that of the first, such that in the end the entire amplified region of DNA bounded by the primers can be easily sequenced. PCR amplification using a primer pair like the one just described results in a population of DNA fragments that differ at the position of the mutation specified by the primer, and possibly at other positions, as template copying is somewhat error-prone. Wagner, et al . , in PCR Topics, pp.69-71 (Springer-Verlag, 1991).

If the ratio of template to product amplified DNA is extremely low, the majority of product DNA fragments incorporate the desired mutation (s) . This product DNA is used to replace the corresponding region in the plasmid that served as PCR template using standard recombinant DNA methods. Mutations at separate positions can be introduced simultaneously by either using a mutant second primer, or performing a second PCR with different mutant primers and ligating the two resulting PCR fragments simultaneously to the plasmid fragment in a three (or more) -part ligation. Another method for preparing variants, cassette mutagenesis, is based on the technique described by Wells et al . , Gene, 34:315-323 (1985) . The .starting material is the plasmid (or other vector) comprising the STIM2 DNA to be mutated. The codon(s) in the STIM2 DNA to be mutated are identified. There must be a unique restriction endonuclease site on each side of the identified mutation site(s) . If no such restriction sites exist, they may be generated using the above-described oligonucleotide- mediated mutagenesis method to introduce them at appropriate locations in the STIM2 DNA. The plasmid DNA is cut at these sites to linearize it. A double-stranded oligonucleotide encoding the sequence of the DNA between the restriction sites but containing the desired mutation (s) is synthesized using standard procedures, wherein the two strands of the oligonucleotide are synthesized separately and then hybridized together using standard techniques. This double-stranded oligonucleotide is referred to as the cassette. This cassette is designed to have 5' and 3' ends that are compatible with the ends of the linearized plasmid, such that it can be directly ligated to the plasmid. This plasmid now contains the mutated STIM2 DNA sequence. STIM2 DNA, whether cDNA or genomic DNA or a product of in vi tro synthesis, is ligated into a replicable vector for further cloning , or for expression. "Vectors" are plasmids and other DNAs that are capable of replicating autonomously within a host cell, and as such, are useful for performing two functions in conjunction with compatible host cells (a vector-host system) . One function is to facilitate the cloning of the nucleic acid that encodes the STIM2, i.e., to produce usable quantities of the nucleic acid. The other function is to direct the expression of STIM2. One or both of these functions are performed by the vector-host system. The vectors will contain different components depending upon the function they are to perform as well as the host cell with which they are to be used for cloning or expression. To produce STIM2 , an expression vector will contain nucleic acid that encodes. STIM2 as described above. The STIM2 of this invention may be expressed directly in ■ recombinant cell culture, or as a fusion with a heterologous polypeptide, preferably a signal sequence or other polypeptide having a specific cleavage site at the junction between the heterologous polypeptide and the STIM2.

In one example of recombinant host cell expression, mammalian cells are transfected with an expression vector comprising STIM2 DNA and the STIM2 encoded thereby is recovered from the culture medium in which the recombinant host cells are grown. But the expression vectors and methods disclosed herein are suitable for use over a wide range of prokaryotic and eukaryotic organisms .

Prokaryotes may be used for the initial cloning of DNAs and the construction of the vectors useful in the invention. However, prokaryotes may also be used for expression of DNA encoding STIM2. Polypeptides that are produced in prokaryotic host cells typically will be non- glycosylated. Plasmid or viral vectors containing replication origins and other control sequences that are derived from species compatible with the host cell are used in connection with prokaryotic host cells, for cloning or expression of an isolated DNA. For example, ___.. coli typically is transformed using pBR322, a plasmid derived from an -__.. coli species. Bolivar, et al . , Gene 2:95-113

(1987) . PBR322 contains genes for ampicillin and tetracycline resistance so that cells transformed by the plasmid can easily be identified or selected. For it to serve as an expression vector, the pBR322 plasmid, or other plasmid or viral vector, must also contain, or be modified to contain, a promoter that functions in the host cell to provide messenger RNA (mRNA) transcripts of a DNA inserted downstream of the promoter. Rangagwala, et al . , Bio /Technology 9:477-479 (1991).

In addition to prokaryotes, eukaryotic microbes, such as yeast, may also be used as hosts for the cloning or expression of DNAs useful in the invention. Saccharomyces cerevisiae, or common baker's yeast, is the most commonly used eukaryotic microorganism. Plasmids useful for cloning or expression in yeast cells of a desired DNA are well known, as are various promoters that function in yeast cells to produce mRNA transcripts .

Furthermore, cells derived from multicellular organisms also may be used as hosts for the cloning or expression of DNAs useful in the invention. Mammalian cells are most commonly used, and the procedures for maintaining or propagating such cells in vi tro, which procedures are commonly referred to as tissue culture, are well known. Kruse & Patterson, eds . , Tissue Culture (Academic Press, 1977) . Examples of useful mammalian cells are human cell lines such as 293, HeLa, and WI-38, monkey cell lines such as COS-7 and VERO, and hamster cell lines such as BHK-21 and CHO, all of which are publicly available from the American Type Culture Collection (ATCC) , Rockville, Maryland 20852 USA. Expression vectors, unlike cloning vectors, should contain a promoter that is recognized by the host organism and is operably linked to the STIM2 nucleic acid. Promoters are untranslated sequences that are located upstream from the start codon of a gene and that control transcription of the gene (that is, the synthesis of mRNA) . Promoters typically fall into two classes, inducible and constitutive. Inducible promoters are promoters that initiate high level transcription of the DNA under their control in response to some change in culture conditions, for example, the presence or absence of a nutrient or a change in temperature .

A large number of promoters are known, that may be operably linked to STIM2 DNA to achieve expression of STIM2 in a host cell. This is not to say that the promoter associated with naturally-occurring STIM2 DNA s not usable. However, heterologous promoters generally will result in greater transcription and higher yields of expressed STIM2.

Promoters suitable for use with prokaryotic hosts include the β-lactamase and lactose promoters, Goeddel, et al . , Nature 281:544-548 (1979), tryptophan (trp) promoter, Goeddel, et al . , Nuc . Acids Res . 8:4057-4074 (1980), and hybrid promoters such as the tac promoter, deBoer, et al . , Proc . Natl . Acad. Sci . USA 80:21-25 (1983). However, other known bacterial promoters are suitable. Their nucleotide sequences have been published, Siebenlist, et al . , Cell 20:269-281 (1980), thereby enabling a skilled worker operably to ligate them to DNA encoding STIM2 using linkers or adaptors to supply any required restriction sites. Wu, et al . , Meth . Enz . 152:343-349 (1987).

Suitable promoters for use with yeast hosts include the promoters for 3-phosphoglycerate kinase,

Hitzeman, et al . , J. Biol . Chem. 255:12073-12080 (1980); Kingsman, et al . , Meth . Enz . 185:329-341 (1990), or other glycolytic enzymes such as enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 3- phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase, and glucokinase. Dodson, et al . , Nuc . Acids res. 10:2625-2637 (1982); Emr, Meth . Enz . 185:231-279 (1990). Expression vectors useful in mammalian cells typically include a promoter derived from a virus . For example, promoters derived from polyoma virus, adenovirus, cytomegalovirus (CMV) , and simian virus 40 (SV40) are commonly used. Further, it is also possible, and often desirable, to utilize promoter or other control sequences associated with a naturally occurring DNA that encodes STIM2 , provided that such control sequences are f nctional in the particular host cell used for recombinant DNA expression. Other control sequences that are desirable in an expression vector in addition to a promoter are a ribosome binding site, and in the case of an expression vector used with eukaryotic host cells, an enhancer. Enhancers are cis-acting elements of DNA, usually about from 10-300 bp, that act on a promoter to increase the level of transcription. Many enhancer sequences are now known from mammalian genes (for example, the genes for globin, elastase, albumin, α-fetoprotein and insulin) . Typically, however, the enhancer used will be one from a eukaryotic cell virus. Examples include the SV40 enhancer on the late side of the replication origin (bp 100-270) , the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers. Kriegler, Meth. Enz. 185:512-527 (1990) .

Expression vectors may also contain sequences necessary for the termination of transcription and for stabilizing the messenger RNA (mRNA) . Balbas, et al . , Meth . Enz . 185:14-37 (1990); Levinson, Meth . Enz . 185:485- 511 (1990) . In the case of expression vectors used with eukaryotic host cells, such transcription termination sequences may be obtained from the untranslated regions of eukaryotic or viral DNAs or cDNAs . These regions contain polyadenylation sites as well as transcription termination sites. Birnsteil, et al . , Cell 41:349-359 (1985).

In general, control sequences are DNA sequences necessary for the expression of an operably linked coding sequence in a particular host cell. "Expression" refers to transcription and/or translation. "Operably linked" refers to the covalent joining of two or more DNA sequences, by means of enzymatic ligation or otherwise, in a configuration relative to one another such that the normal function of the sequences can be performed. For example, DNA for a presequence or secretory leader is operably linked to DNA for a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide; a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation. Generally, "operably linked" means that the DNA sequences being linked are contiguous and, in the case of a secretory leader, contiguous and in reading phase. Linking is accomplished by ligation at convenient restriction sites. If such sites do not exist, then synthetic oligonucleotide adaptors or linkers are used, in conjunction with standard recombinant DNA methods.

Expression and cloning vectors also will contain a sequence that enables the vector to replicate in one or more selected host cells. Generally, in cloning vectors this sequence is one that enables the vector to replicate independently of the host chromosome (s) , and includes origins of replication or autonomously replicating sequences . Such sequences are well known for a variety of bacteria, yeast, and viruses. The origin of replication from the plasmid pBR322 is suitable for most gram-negative bacteria, the 2μ plasmid origin is suitable for yeast, and various viral origins (for example, from SV40, polyoma, or adenovirus) are useful for cloning vectors in mammalian cells. Most expression vectors are "shuttle" vectors, i.e. they are capable of replication in at least one class of organisms but can be transfected into another organism for expression. For example, a vector may be cloned in ___.. coli and then the same vector is transfected into yeast or mammalian cells for expression even though it is not capable of replicating independently of the host cell chromosome.

The expression vector may also include an amplifiable gene, such as that comprising the coding sequence for dihydrofolate reductase (DHFR) . Cells containing an expression vector that includes a DHFR gene may be cultured in the presence of methotrexate, a competitive antagonist of DHFR. This leads to the synthesis of multiple copies of the DHFR gene and, concomitantly, multiple copies of other DNA sequences comprising the expression vector, Ringold, et al . , J. Mol . Apl . Genet . 1:165-175 (1981), such as a DNA sequence encoding STIM2. In that manner, the level of STIM2 produced by the cells may be increased.

DHFR protein encoded by the expression vector also may be used as a selectable marker of successful transfection. For example, if the host cell prior to transformation is lacking in DHFR activity, successful transformation by an expression vector comprising DNA sequences encoding STIM2 and DHFR protein can be determined by cell growth in medium containing methotrexate. Also, mammalian cells transformed by an expression vector comprising DNA sequences encoding STIM2 , DHFR protein, and aminoglycoside 3 ' phosphotransferase (APH) can be determined by cell growth in medium containing an aminoglycoside antibiotic such as kanamycin or neomycin. Because eukaryotic cells do not normally express an endogenous APH activity, genes encoding APH protein, commonly referred to as neo^r genes, may be used as dominant selectable markers in a wide range of eukaryotic host cells, by which cells transfected by the vector can easily be identified or selected. Jiminez, et al . , Nature, 287:869-871 (1980); Colbere-Garapin, et al . , J. Mol . Biol . 150:1-14 (1981); Okayama & Berg, Mol . Cell . Biol . , 3:280- 289 (1983) . Many other selectable markers are known that may be used for identifying and isolating recombinant host cells that express STIM2. For example, a suitable selection marker for use in yeast is the trpl gene present in the yeast plasmid YRp7. Stinchcomb, et al . , Nature 282:39-43 (1979); Kingsman, et al . , Gene 7:141-152 (1979); Tschemper, et al . , Gene 10:157-166 (1980). The trpl gene provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, for example, ATCC No. 44076 or PEP4-1 (available from the American Type Culture Collection, Rockville, Maryland 20852 USA). Jones, Genetics 85:12 (1977). The presence of the trpl lesion in the yeast host cell genome then provides an effective environment for detecting transformation by growth in the absence of tryptophan. Similarly, Leu2-deficient yeast strains (ATCC Nos. 20622 or 38626) are complemented by known plasmids bearing the Leu2 gene .

Particularly useful in the invention are expression vectors that provide for the transient expression in mammalian cells of DNA encoding STIM2. In general, transient expression involves the use of an expression vector that is able to efficiently replicate in a host cell, such that the host cell accumulates many copies of the expression vector and, in turn, synthesizes high levels of a desired polypeptide encoded by the expression vector. Transient expression systems, comprising a suitable expression vector and a host cell, allow for the convenient positive identification of polypeptides encoded by cloned DNAs, as well as for the rapid screening of such polypeptides for desired biological or physiological properties. Yang, et al . , Cell 47:3-10 (1986); Wong, et al . , Science 228:810-815 (1985); Lee, et al . , Proc . Nat Acad. Sci . USA 82:4360-4364 (1985). Thus, transient expression systems are particularly useful in the invention for expressing DNAs encoding amino acid sequence variants of STIM2 , to identify those variants which are functionally active. Since it is often difficult to predict in advance the characteristics of an amino acid sequence variant of STIM2 , it will be appreciated that some screening of such variants will be needed to identify those that are functionally active. Such screening may be performed in vitro, using routine assays for receptor binding, or assays for cell proliferation, cell differentiation or cell viability, or using immunoassays with monoclonal antibodies that selectively bind to STIM2 that effect the functionally active STIM2 , such as a monoclonal antibody that selectively binds to the active site or receptor binding site of STIM2.

As used herein, the terms "transformation" and "transfection" refer to the process of introducing a desired nucleic acid, such a plasmid or an expression vector, into a host cell. Various methods of transformation and transfection are available, depending on the nature of the host cell. In the case of E. coli cells, the most common methods involve treating the cells with aqueous solutions of calcium chloride and other salts . In the case of mammalian cells, the most common methods are transfection mediated by either calcium phosphate or DEAE- dextran, or electroporation. Sambrook, et al . , eds . , Molecular Cloning, pp. 1.74-1.84 and 16.30-16.55 (Cold Spring Harbor Laboratory Press, 1989) . Following transformation or transfection, the desired nucleic acid may integrate into the host cell genome, or may exist as an extrachromosomal element .

Host cells that are transformed or transfected with the above-described plasmids and expression vectors are cultured in conventional nutrient media modified as is appropriate for inducing promoters or selecting for drug resistance or some other selectable marker or phenotype. The culture conditions, such as temperature, pH, and the like, suitably are those previously used for culturing the host cell used for cloning or expression, as the case may be, and will be apparent those skilled in the art. Suitable host cells for cloning or expressing the vectors herein are prokaryotes, yeasts, and higher eukaryotes, including insect, vertebrate, and mammalian host cells. Suitable prokaryotes include eubacteria, such as Gram- negative or Gram-positive organisms, for example, E. coli , Bacillus species such as B. subtilis, Pseudomonas species such as P. aeruginosa, Salmonella typhimurium, or Serratia marcescens .

In addition to prokaryotes, eukaryotic microbes' such as filamentous fungi or yeast are suitable hosts for STIM2-encoding vectors. Saccharomyces cerevisiae, or common baker's yeast, is the most commonly used among lower eukaryotic host microorganisms. However, a number of other genera, species, and strains are commonly available and useful herein, such as Schizosaccharomyces pombe, Beach and Nurse, Nature 290:140-142 (1981), Pichia pastoris, Cregg, et al., Bi o/Technology 5:479-485 (1987); Sreekrishna, et al . , Biochemistry 28:4117-4125 (1989), Neurospora crassa, Case, et al . , Proc . Natl . Acad. Sci . USA 76:5259-5263 (1979) , and Aspergillus hosts such as A. nidulans , Ballance, et al . , Biochem. Biophys . Res . Commun . 112:284- 289 (1983); Tilburn, et al . , Gene 26:205-221 (1983); Yelton, et al . , Proc . Natl . Acad. Sci . USA 81:1470-1474 (1984), and A. niger, Kelly, et al . , EMBO J. 4:475-479 (1985) .

Suitable host cells for the expression of STIM2 are also derived from multicellular organisms. Such host cells are capable of complex processing and glycosylation activities. In principle, any higher eukaryotic cell culture is useable," whether from vertebrate or invertebrate culture.- It will be appreciated, however, that because of the species-, tissue-, and cell-specificity of glycosylation, Rademacher, et al . , Ann . Rev. Biochem.

57:785-838 (1988), the extent or pattern of glycosylation of STIM2 in a foreign host cell typically will differ from that of STIM2 obtained from a cell in which it is naturally expressed. Examples of invertebrate cells include insect and plant cells . Numerous baculoviral strains and variants and corresponding permissive insect host cells from hosts such as Spodoptera frugiperda (caterpillar) , Aedes aegypti (mosquito) , Aedes albopictus (mosquito) , Drosophila melanogaster (fruitfly) , and Bombyx mori host cells have been identified. Luckow, et al . , Bio/Technology 6:47-55 (1988); Miller, et al . , in Genetic Engineering, vol. 8, pp.277-279 (Plenum Publishing, 1986); Maeda, et al . , Nature 315:592-594 (1985). Plant cell cultures of cotton, corn, potato, soybean, petunia, tomato, and tobacco can be utilized as hosts. Typically, plant cells are transfected by incubation with certain strains of the bacterium Agrobacterium tumefaciens, which has been previously altered to contain STIM2 DNA. During incubation of the plant cells with A . tumefaciens, the DNA encoding the STIM2 is transferred into cells, such that they become transfected, and will, under appropriate conditions, express the STIM2 DNA. In addition, regulatory and signal sequences compatible with plant cells are available, such as the nopaline synthase promoter and polyadenylation signal sequences, and the ribulose biphosphate carboxylase promoter. Depicker, et al . , J . Mol. Appl . Gen. 1:561-573 (1982). Herrera-Estrella, et al . , Nature 310:115-120 (1984) . In addition, DNA segments isolated from the upstream region of the T-DNA 780 gene are capable of activating or increasing transcription levels of plant- expressible genes in recombinant DNA-containing plant tissue. European Pat. Pub. No. EP 321,196 (published June 21, 1989) .

However, interest has been greatest in vertebrate cells, and propagation of vertebrate cells in culture

(tissue culture) has become a routine procedure in recent years. Kruse & Patterson, eds . , Tissue Culture (Academic Press, 1973). Examples of useful mammalian host cells are the monkey kidney CVl line transformed by SV40 (COS-7, ATCC CRL 1651) ; human embryonic kidney line 293 (or 293 cells subcloned for growth in suspension culture) , Graham, et al . , J. Gen Virol . 36:59-72 (1977); baby hamster kidney cells (BHK, ATCC CCL 10) ; Chinese hamster ovary cells (including DHFR-deficient CHO cells, Urlaub, et al . , Proc . Natl . Acad. Sci . USA 77:4216-4220 (1980); mouse sertoli cells (TM4, Mather, Biol. Reprod. 23:243-251 (1980); monkey kidney cells (CVl, ATCC CCL 70); African green monkey kidney cells (VERO-76, ATCC CRL-1587); human cervical carcinoma cells (HELA, ATCC CCL 2); canine kidney cells (MDCK, ATCC CCL 34); buffalo rat liver cells (BRL 3A, ATCC CRL 1442); human lung cells (W138, ATCC CCL 75); human liver cells (Hep G2 , HB 8065); mouse mammary tumor (MMT 060562, ATCC CCL51) ; TRI cells (Mather, et al . , Annals N. Y. Acad. Sci . 383:44-68 (1982)); MRC 5 cells; FS4 cells; and a human hepatoma line (Hep G2) .

Construction of suitable vectors containing the nucleotide sequence encoding STIM2 and appropriate control sequences employs standard recombinant DΝA methods. DΝA is cleaved into fragments, tailored, and ligated together in the form desired to generate the vectors required.

For analysis to confirm correct sequences in the vectors constructed, the vectors are analyzed by restriction digestion (to confirm the presence in the vector of predicted restriction endonuclease) and/or by sequencing by the dideoxy chain termination method of Sanger, et al . , Proc . Nat . Acad. Sci . USA 72:3918-3921 (1979) .

The mammalian host cells used to produce the STIM2 of this invention may be cultured in a variety of media. Commercially available media such as Ham's F10 (Sigma) , Minimal Essential Medium (MEM, Sigma) , RPMI-1640 (Sigma), and Dulbecco's Modified Eagle's Medium (DMEM, Sigma) are suitable for culturing the host cells. In addition, any of the media described in Ham, et al . , Meth. Enz. 58:44-93 (1979); Barnes, et al . , Anal . Biochem . 102:255-270 (1980); Bottenstein, et al . , Meth. Enz. 58:94- 109 (1979); U.S. Pat. Nos. 4,560,655; 4,657,866; 4,767,704; or 4,927,762; or in PCT Pat. Pub. Nos. WO 90/03430 (published April 5, 1990), may be used as culture media for the host cells. Any of these media may be supplemented as necessary with hormones and/or other growth factors (such as insulin, transferrin, or epidermal growth factor) , salts (such as sodium chloride, calcium, magnesium, and phosphate) , buffers (such as HEPES) , nucleosides (such as adenosine and thymidine) , antibiotics, trace elements (defined as inorganic compounds usually present at final concentrations in the micromolar range) , and glucose or an equivalent energy source. Any other necessary supplements may also be included at appropriate concentrations that would be known to those skilled in the art. The culture conditions, such as temperature, pH, and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.

The host cells referred to in this disclosure encompass cells in culture in vi tro as well as cells that are within a host animal, for example, as a result of transplantation or implantation.

One particularly preferred system of expression useful in this invention involves adenoviral delivery. Adenoviruses have a broad range of host specificity and have low pathogenicity in humans. They do not require cells to be replicating for viral infection to occur and will not insert into the genome of the cell. They provide a versatile and efficient gene delivery system for in vi tro expression studies and are also being used for gene delivery in vivo . Multiple genes can be expressed from a single adenoviral vector. Recombinant adenoviral vectors used for gene delivery are made to be replication-deficient by the deletion of viral gene sequences necessary for viral replication. In the most commonly used adenoviral vector (serotype 5) the El and E3 regions are deleted. The El deletion renders the virus incapable of producing infectious virus particles in target cells. The E3 region encodes proteins that counter host defence mechanisms and is not required for viral replication. STIMl and STIM2 cDNAs are inserted into an adenoviral vector by first cloning each cDNA into a pShuttle vector. This vector then undergoes homologous recombination with the adenoviral genome vector AdEasy-1 within the ___.. coli strain BJ5183. Recombinant colonies are selected and the viral plasmid isolated and transfected into HEK293 cells which convert the viral plasmid into functional viral particles used for infection of cells. The HEK293 cells have the Ela and Elb viral genes integrated in their genome, and thus support replication of the El-deleted virus . Adenovirus containing either STIMl or STIM2 cDNA have been produced. The STIM2 vector expresses protein at very high levels . Both constructs are being used to study the biological effects of STIM protein overexpression in cells, complementing the studies using plasmid expression vectors.

It is further contemplated that the STIM2 of this invention may be produced by homologous recombination, for example, as described in PCT Pat. Pub. No. WO 91/06667

(published May 16, 1991) . Briefly, this method involves transforming cells containing an endogenous gene encoding STIM2 with a homologous DNA, which homologous DNA comprises (1) an amplifiable gene, such as DHFR, and (2) at least one flanking sequence, having a length of at least about 150 base pairs, which is homologous with a nucleotide sequence in the cell genome that is within or in proximity to the gene encoding STIM2. The transformation is carried out under conditions such that the homologous DNA integrates into the cell genome by recombination. Cells having integrated the homologous DNA then are subjected to conditions which select for amplification of the amplifiable gene, whereby the STIM2 gene amplified concomitantly. The resulting cells then are screened for production of desired amounts of STIM2. Flanking sequences that are in proximity to a gene encoding STIM2 are readily identified, for example, by the method of genomic walking, using as a starting point the STIM2 nucleotide sequence set forth in Figure 1. Spoerel, et al . , Meth. Enz. 152:598-603 (1987) .

Gene amplification and/or gene expression may be measured in a sample directly, for example, by conventional

Southern blotting to quantitate DNA, or Northern blotting to quantitate mRNA, using an appropriately labeled oligonucleotide hybridization probe, based on the sequences provided herein. Various labels may be employed, most commonly radioisotopes, particularly ³²P. However, other techniques may also be employed, such as using biotin- odified nucleotides for introduction into a polynucleotide. The biotin then serves as the site for binding to avidin or antibodies, which may be labeled with a wide variety of labels, such as radioisotopes, fluorophores, chromophores , or the like. Alternatively, antibodies may be employed that can recognize specific duplexes, including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or DNA-protein duplexes . The antibodies in turn may be labeled and the assay may be carried out where the duplex is bound to a surface, so that upon the formation of duplex on the surface, the presence of antibody bound to the duplex can be detected.

Gene expression, alternatively, may be measured by immunological methods, such as immunohistochemical staining of tissue sections and assay of cell culture or body fluids, to quantitate directly the expression of the gene product, STIM2. With immunohistochemical staining techniques, a cell sample is prepared, typically by dehydration and fixation, followed by reaction with labeled antibodies specific for the gene product coupled, where the labels are usually visually detectable, such as enzymatic labels, fluorescent labels, luminescent labels, and the like. A particularly sensitive staining technique suitable for use in the present invention is described by Hsu, et al . , Am. J. Clin . Path . , 75:734-738 (1980). Antibodies useful for immunohistochemical staining and/or assay of sample fluids may be either monoclonal or polyclonal. Conveniently, the antibodies may be prepared against a synthetic peptide based on the DNA sequences provided herein. Preferably STIM2 is recovered from the culture medium as a secreted polypeptide, although it also may be recovered from host cell lysates . To obtain STIM2 that is substantially free of contaminating proteins or polypeptides of the host cell in which it is produced it is necessary to purify the STIM2 , based on the differential physical properties of STIM2 as compared to the contaminants with which it may be associated. For example, as a first step, the culture medium or lysate is centrifuged to remove particulate cell debris. STIM2 thereafter is purified from contaminant soluble proteins and polypeptides, for example, by ammonium sulfate or ethanol precipitation, gel filtration (molecular exclusion chromatography) , ion-exchange chromatography, immunoaffinity chromatography, reverse phase HPLC, and/or gel electrophoresis. For example, STIM2 can be purified by immunoaffinity chromatography using a REK7-IgG resin (comprising REK7-IgG coupled to the resin material) . The ordinarily skilled artisan will appreciate that purification methods suitable for naturally occurring STIM2 may require modification to account for changes in the character of STIM2 or its variants or derivatives produced in recombinant host cells.

The purity of STIM2 produced according to the present invention is determined according to methods well known in the art, such as by analytical sodium dodecyl sulfate (SDS) gel electrophoresis, immunoassay, or amino acid composition or sequence analysis electrophoresis.

Preferably, the STIM2 is purified to such an extent that it is substantially free of other proteins . For therapeutic uses, the purified STIM2 will be greater than 99% STIM2 and, accordingly, non-STIM2 proteins will comprise less than 1% of the total protein in the purified STIM2 composition.

STIM2 may be used as an immunogen to generate anti-STIM2 antibodies. Such antibodies, which specifically bind to STIM2 , are useful as standards in assays for STIM2 , such as by labeling purified STIM2 for use as a standard in. a radioimmunoassay, enzyme-linked immunoassay, or competitive-type receptor binding assays radioreceptor assay, as well as in affinity purification techniques. Ordinarily, the anti-STIM2 antibody will bind STIM2 with an affinity of at least about 10⁶ L/mole, and preferably at least about 10⁷ L/mole.

Polyclonal antibodies directed toward STIM2 generally are raised in animals by multiple subcutaneous or intraperitoneal injections of STIM2 and an adjuvant. It may be useful to conjugate STIM2 or a peptide fragment thereof to a carrier protein that is immunogenic in the species to be immunized, such as keyhole limpet hemocyanin, serum albumin, bovine thyroglobulin, or soybean trypsin inhibitor, using a bifunctional or derivatizing agent, for example, maleimidobenzoyl sulfosuccinimide ester (conjugation through cysteine residues) , N- hydroxysuccinimide (conjugation through lysine residues) , glutaraldehyde, succinic anhydride, SOCl₂, or R^"^ = C = NR, where R and R¹ are different alkyl groups .

Animals are immunized with such STIM2-carrier protein conjugates combining 1 mg or 1 μg of conjugate (for rabbits or mice, respectively) with 3 volumes of Freund's complete adjuvant and injecting the solution intradermally at multiple sites . One month later the animals are boosted with l/5th to 1/lOth the original amount of conjugate in Freund's complete adjuvant by subcutaneous injection at multiple sites. 7 to 14 days later animals are bled and the serum is assayed for anti-STIM2 antibody titer. Animals are boosted until the antibody titer plateaus . Preferably, the animal is boosted by injection with a conjugate of the same STIM2 with a different carrier protein and/or through a different cross-linking agent.

Conjugates of STIM2 and a suitable carrier protein also can be made in recombinant cell culture as fusion proteins. Also, aggregating agents such as alum are used to enhance the immune response. Monoclonal antibodies directed toward STIM2 are produced using any method which provides for the production of antibody molecules by continuous cell lines in culture. The modifier "monoclonal" indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to . be construed as requiring production of the antibody by any particular method. Examples of suitable methods for preparing monoclonal antibodies include the original hybridoma method of Kohler, et al . , Nature 256:495-497 (1975), and the human B-cell hybridoma method, Kozbor, J^". Immunol . 133:3001

(1984); Brodeur, et al . , Monoclonal Antibody Production Techniques and Applications, pp.51-63 (Marcel Dekker, Inc., New York, 1987) .

The monoclonal antibodies of the invention specifically include "chimeric" antibodies

(immunoglobulins) in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain (s) is identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, so long as they exhibit the desired biological activity (Cabilly, et al . , U.S. Patent No. 4,816,567; Morrison, et al . , Proc . Natl . Acad. Sci . 81:6851-6855 (1984)).

In a preferred embodiment, the- chimeric anti- STIM2 antibody is a "humanized" antibody. Methods for humanizing non-human antibodies are well known in the art. Generally, a humanized antibody has one or more amino acid residues introduced into it from a source which is non- human. These non-human amino acid residues are often referred to as "import" residues, which are typically taken from an "import" variable domain.

Humanization can be performed following methods known in the art (Jones, et al . , Nature 321:522-525 (1986); Riechmann, et al . , Nature, 332:323-327 (1988); Verhoeyen, et al . , Science 239:1534-1536 (1988)), by substituting rodent complementarity-determining regions (CDRs) for the corresponding regions of a human antibody. Alternatively, it is now possible to produce transgenic: animals (e.g., mice) that are capable, upon immunization, of producing a full repertoire of human antibodies in the absence of endogenous immunoglobulin production. For example, it has been described that the homozygous deletion of the antibody heavy-chain joining region (J_H) gene in chimeric and germ- line mutant mice results in complete inhibition of endogenous antibody production. Transfer of the human germ- line immunoglobulin gene array in such germ-line mutant mice will result in the production of human antibodies upon antigen challenge. See, for example, Jakobovits, et al . ,

Proc . Natl . Acad. Sci . 90: 2551-2555 (1993); Jakobovits, et al . , Nature 362:255-258 (1993); Bruggermann, et al . , Year in Immuno . 7:33 (1993) . Human antibodies can also be produced in phage-display libraries (Hoogenboom, et al . , J. Mol . Biol . 227:381 (1991); Marks, et al . , J. Mol . Biol . 222:581 (1991) . For diagnostic applications, anti-STIM2 antibodies typically will be labeled with a detectable moiety. The detectable moiety can be any one which is capable of producing, either directly or indirectly, a detectable signal. For example, the detectable moiety may be a radioisotope, such as ³H, ¹C, ³²P, ³⁵S, or ¹²⁵I, a fluorescent or chemiluminescent compound, such as fluorescein isothiocyanate, rhodamine, or luciferin; radioactive isotopic labels, such as, e.g., ¹²⁵I, ³²P, ¹⁴C, or ³H, or an enzyme, such as alkaline phosphatase, beta- galactosidase or horseradish peroxidase.

Any method known in the art for separately conjugating the antibody to the detectable moiety may be employed, including those methods described by David, et al . , Biochemistry 13:1014-1021 (1974); Pain, et al . , J. Immunol . Meth . 40:219-231 (1981); and Bayer, et al . , Meth. Enz. 184:138-163 (1990).

The anti-STIM2 antibodies may be employed in any known assay method, such as competitive binding assays, direct and indirect sandwich assays, and immunoprecipitation assays. Zola, Monoclonal Antibodies: A Manual of Techniques, pp.147-158 (CRC Press, Inc., 1987).

Competitive binding assays rely on the ability of a labeled standard (e.g., STIM2 or an immunologically reactive portion thereof) to compete with the test sample analyte (STIM2) for binding with a limited amount of antibody. The amount of STIM2 in the test sample is inversely proportional to the amount of standard that becomes bound to the antibodies. To facilitate determining the amount of standard that becomes bound, the antibodies generally are insolubilized before or after the competition, so that the standard and analyte that are bound to the antibodies may conveniently be separated from the standard and analyte which remain unbound. Sandwich assays involve the use of two antibodies, each capable of binding to a different immunogenic portion, or epitope, of the protein to be detected. In a sandwich assay, the test sample analyte is bound by a first antibody which is immobilized on a solid support, and thereafter a second antibody binds to the analyte, thus forming an insoluble three part complex. David, et al . , U.S. Pat No. 4,376,110. The second antibody may itself be labeled with a detectable moiety (direct sandwich assays) or may be measured using an anti-immunoglobulin antibody that is labeled with a detectable moiety (indirect sandwich assay) . For example, one type of sandwich assay is an ELISA assay, in which case the detectable moiety is an enzyme. The anti-STIM2 antibodies of the invention also are useful for in vivo imaging, wherein an antibody labeled with a detectable moiety is administered to a host, preferably into the bloodstream, and the presence and location of the labeled antibody in the host is assayed. This imaging technique is useful in the staging and treatment of various neurological disorders . The antibody may be labeled with any moiety that is detectable in a host, whether by nuclear magnetic resonance, radiology, or other detection means known in the art . Neutralizing anti-STIM2 antibodies are useful as antagonists of STIM2. The term "neutralizing anti-STIM2 antibody" as used herein refers to an antibody that is capable of specifically binding to STIM2 , and which is capable of substantially inhibiting or eliminating the functional activity of STIM2 in vivo or in vi tro .

Typically a neutralizing antibody will inhibit the functional activity of STIM2 at least about 50%, and preferably greater than 80%, as determined, for example, by an in vi tro receptor binding assay. The invention will now be further described by way of reference only to the following non-limiting examples. It should be understood, however, that the examples following are illustrative only, and should not be taken in any way as a restriction on the generality of the invention described above. Amino acid sequences referred to herein are given in standard single letter code.

Example 1 Identification of STIM2 Gene

In the course of investigations of the STIMl gene, we found a novel human STIM, designated STIM2. By carrying out TBLASTN searches of the dbEST section of GenBank with protein sequence from the extracellular domain of human STIMl (aa 1 to 212), two overlapping -human expressed sequence tags - (ESTs) were identified, which had open reading frames similar, but not identical, to that of human STIMl protein. Further searches revealed additional EST sequences with open reading frames similar to STIMl . A 4kb cDNA isolated from a foetal brain library (clone H5F7) was obtained from Origene, and the 5' region sequenced. The composite cDNA sequence of human STIM2 , obtained from alignment of EST sequences and our own sequences, is shown in Figure 1. In addition, we have identified STIM2 genomic sequences in the human genomic databases that have regions of identity with the STIM2 cDNA sequence. Alignment of cDNA and genomic sequences has identified the intron-exon boundaries. The nucleotides spanning the boundaries are ^• indicated ' in Figure 1. These alignments indicate that STIM2 cDNA contains 12 coding exons . The intron-exon boundaries are highly conserved between STIMl , STIM2 and Drosophila Stim (see example 5) . The human STIM2 cDNA (clone H5F7) used to determine the nucleotide and amino acid sequences shown in Figures 1-3 was deposited at the Australian Government Analytical Laboratories on 21 September 1999, and accorded the accession number NM99/06770.

Example 2 Regulatory Binding Motifs of STIM2

The STIM2 cDNA sequence predicts an open reading frame encoding a 93kDa protein. The amino acid sequence of human STIM2 is shown in Figure 2, in which the putative transmembrane domain is double underlined; coiled-coil. domains are dotted underlined; putative SH2 binding motifs are shown in bold italic; the proline-rich domain is italicized, and within this region PXH repeats are underlined and putative SH3 binding domains are shown in bold.

As shown in Figure 3 , the N-terminal region of the STIM molecules is not highly conserved between the family members. The NWT N-linked glycosylation site in the predicted extracellular domain is conserved in all three proteins as is a predicted transmembrane .domain.

While the ORF for STIM2 showed high degree of sequence similarity to human STIMl an equivalent AUG translation start site was not present at the same position when the two sequences were aligned. Figure 4 shows clones H5F7 and F5A6 aligned in schematic form with the KIAA 1482 clone (Nagase et al . , 2000), with the predicted open reading frame indicated by the boxed area, and the arrow indicating the translation start site.

The 5' end of clone H5F7 in which three potential AUG start sites were identified at bases 19-21, 29-31 and 100-102, the first and last of which conform to adequate Kozak start sites in two different reading frames (Kozak et al , 1996) . Both of these are followed by stop codons in their respective reading frames at bases 259-261 and 254- 256, predicting unrelated 80 and 51 amino acid peptides, neither of which resemble previously characterized proteins. The ORF for the 80 amino acid peptide corresponds to the reading frame predicted for the STIM2 protein, indicating that the true translation start site for STIM2 resides downstream from base 261.

Comparison of the STIM2 sequence with the structure of STIMl protein would have predicted the existence of a signal peptide at the amino terminus of STIM2 if it was indeed a functional homologue of STIMl. Modeling with the Signal P Version 2.0 signal peptide prediction server, indicated that the amino acids encoded by bases approximately 505 to 573 had a very high probability of residing within a signal peptide, and that there was a high probability of cleavage immediately carboxy terminal to this sequence .

The nucleotide and amino acid sequence of the 360 base pair region of the STIM2 cDNA, within which the single AUG codon and several unconventional non-AUG candidate start codons reside, was analyzed. The context of the first potential start site (an AUG codon at bases 271-273) was found not to lie within an adequate Kozak consensus, whereas several downstream potential start sites (all non- AUG) did lie within either acceptable or even strong initiation contexts (Kozak et al , 1996) . ESTs corresponding to this region of mouse and rat STIM2 were identified, and the ORFs aligned with human STIM2. Figure 5 shows the 600 base pair 5' region of clone H5F7 and annotation of sequence features . The corresponding 5 ' ends of clones F5A6 and KIAA 1482 are indicated, as is the potential 84 amino acid upstream Open Reading Frame (uORF)

MRA....RNQ, which commences with the first of the three upstream ATG initiation codons (single underlined) . Potential translation start sites for the STIM2 protein are indicated (double underlined) , with the initiating codons bolded. The authentic translation start site is predicted to be at bases 531-533, producing a 15 amino .acid signal peptide (LLV....DGC; bold and underlined) . Translation at this unconventional TTG start site would encode a Methionine in vivo, not a Leucine as indicated. In both rat and mouse STIM2 cDNAs, AUG codons aligned with a non-AUG codon in human STIM2 (TTG, bases 532-534) and all lay within adequate Kozak sequence contexts. The Signal P prediction server predicted similar signal peptides and cleavage sites for all three proteins. Figure 6 shows the comparison of the sequence of human and rodent STIM2 cDNAs in the regions corresponding to the translation start sites. The human STIM2 cDNA sequence was aligned with two independent publicly available STIM2 ESTs from mouse (M. mus) and a single rat (R . Nor) STIM2 EST, and all sequences were translated in the same reading frame. The predicted translation start sites are underlined, with the initiator codon in bold. The predicted signal peptides produced are in bold and underlined.

The translation start site of human STIM2 was determined experimentally using H5F7 and the F5A6 cDNA clones in which three specific mutations were introduced. In Figure 7 the outline of the mutational strategy to identify the in vivo translational start site in Human STIM2 is shown. A series of three mutations (Mut #1 to 3, mutations indicated in bold type) were engineered into the clone H5F7 expression construct, and all four constructs were transiently transfected into both human G401 and 293T cells. The production of STIM2 protein was assayed by immunoblotting with a STIM2 specific antibody.

Translation of the cDNAs was assayed by Western blotting for STIM2 protein after transient transfection of human G401 and 293T cells. Transfection of the normal, non-mutated cDNAs resulted in translation of a predominant 105kDa STIM2 protein in G401 cells that was similar in size to the endogenously synthesized STIM2 , and proteins of 105 and 115kDa in 293T cells.

Our study suggested that the larger isoform represented a highly phosphorylated form of STIM2 (see below) . Introduction of a stop codon at bases 523-525 (Mutation #1) three codons immediately upstream of the putative TTG start codon resulted in the translation of

STIM2 protein species identical to the non-mutated cDNA in both cell lines . Modification of the sequence around this tentative start region (mutants #2 and #3) resulted in the production of a STIM2 protein species having electrophoretic mobility intermediate between the 105 and 115kDa isoforms, indicating usage of a different translation start site. The size of the product in mutants #2 and #3 was consistent with translation from a downstream, normally silent, start site that resulted in the production of a non-signal peptide-containing STIM2 protein. Taken together, these data demonstrated that STIM2 protein produced in cells after transfection of STIM2 cDNA initiated translation from a single unconventional (i.e. non-AUG) start site in an adequate Kozak context, and that the resulting protein therefore possessed a functional amino terminal signal peptide. The similarity in size between endogenously produced, immunodetectable, STIM2 and the recombinant forms indicated the strong likelihood that this non-AUG start site was used in vivo .

Protein sequencing was performed to determine the actual amino terminal sequence of mature STIM2 protein. Human STIM2 was purified from 293T cells transfected with clone H5F7 by immunoprecipitation with anti-STIM2-CT affinity purified antibodies followed by electrophoretic protein separation. Proteins were electroblotted to BioTrace PVDF transfer membranes and the STIM2 protein band localized by Coomassie Blue R-250 staining. The protein bands were excised from the blot and subjected to conventional amino terminal (Edman) sequence analysis using an Applied Biosystems 494 Precise Protein Sequencing System. This analysis identified the first ten amino- terminal residues as XELVPRHLRG .(single letter code) , which is in precise agreement with the sequence of the predicted mature protein (see Figure 5) . These data strongly support the location of the translation start site as determined through the mutagenesis studies, and indicates a signal peptide of 14 residues in STIM2 , in contrast to the 22 amino acids predicted for STIMl.

The predicted cytoplasmic region contains several regulatory motifs which implicate STIM2 in a signalling pathway. Five tyrosine residues are situated in the cytoplasmic region near the transmembrane domain, at least two of which are surrounded by amino acids known to favour targetting of protein kinases . A sequence within this region (YYNI when Y is phosphorylated) is a potential binding site for Src homology type 2 (SH2) domains, and matches the minimal consensus sequence found to be required for the binding of the SH2 domain of the adaptor protein Growth factor receptor bound protein 2 (Grb2) .

This region demonstrates sequence homology to STIMl, especially the sequences immediately surrounding the tyrosine residues that may be recognized by protein kinases, as shown in Figure 3. The sequence identity between STIMl and STIM2 is high in this region, and the conservation of the tyrosines and the coiled-coil structure suggests that interactions in this part of the molecule are essential for protein function.

A proline-rich domain (aa521 to 560, Figure 2) is located closer to the C-terminus of STIM2. It contains 5 potential SH3 domain binding motifs, which have a minimum consensus sequence of PXXP. In addition, there is a PXH motif that is repeated four consecutive times within this SH3 binding region. This sequence has no homology to any known regulatory motifs, but may represent a novel proline- rich motif within the molecule. There are 8 serine and threonine residues adjacent to proline residues clustered together in the C-terminal region; these are potential in vivo targets of phosphorylation by members of the proline- directed protein kinase (PDPK) family, such as the MAP/ERK kinases and the cyclin-dependent kinases (Cdk) . Proline- directed phosphorylation of growth factor receptors is emerging as a regulatory mechanism in eukaryotic signaling pathways, as evidenced by the association and activation of members of the MAPK/ERK family with the EGF receptor in response to EGF, and the central role of NGF receptor- associated ERKs in the propagation of the NGF signal.

Since we have shown that STIMl is associated with kinase activities, we expect that STIM2 will also have kinase activity. We have identified several sequences which suggest that this will be the case in the primary protein sequence. Without wishing to be bound by any proposed mechanism, the applicant considers that STIM2-associated kinase (s) and/or activities may be modulated by ligand binding, resulting in receptor dimerisation or oligomerisation, and/or through cell-substrate or cell-cell interactions .

The applicant considers that there is a strong potential for the formation of heterodimers between STIMl and STIM2 , through coiled-coil domains and/or other mechanisms; this dimer formation may modulate the function of either one or both of these proteins .

Example 3 Mapping of STIM2 Genes

The full-length cDNA sequence of the human STIM2 gene was used to search the dbSTS (sequence tagged site) section of GenBank. Two sequence tagged sites (STSs) showing identity to human STIM2 were located. Figure 8 shows a schematic diagram of human chromosome 4, showing the region of 4pl5.1 to which the STSs in STIM2 map. The relative positions of the markers are taken from the White ead radiation hybrid map (July 1997) .

The transmembrane region separates an amino terminal extracellular region from a carboxy terminal cytoplasmic region. Indicated are the signal peptides, the conserved pair of closely spaced Cysteine residues, and predicted EF Hand and SAM domains . In the cytoplasmic region are alpha helical regions predicted to form coiled coil structures, and the proline rich domains unique to the human STIM family members. Drosophila Stim2 (D-Stim2) contains amino acid sequence in the extracellular region un-matched by either human family member. Involvement of a region of 4p in head and neck squamous cell carcinoma has been reported, and this region is also indicated. Both of these map to the same point of chromosome 4, at pl5.1. The nearest known genes are the cholecystokinin type A receptor (CCKAR) and BH-protocadherin (PCDH7), respectively. The region between 4pl5.2 and the centromere contains a gene involved in head and neck squamous cell carcinoma, and is indicated in the schematic shown in Figure 9 by HNSCC . We are investigating the effect of over-expression of STIM2 in SCC cell lines.

Example 4 Murine STIM2

Several mouse ESTs showing significant homology to the 3 ' UTR of human STIM2 have been identified, indicating the existence of a murine homologue of STIM2. Following sequencing of this region from two mouse strains a Ddel polymorphism was found, and was used to obtain the mouse chromosomal localisation for Stim2 by analysing the Jackson Laboratory interspecies backcross panel BSS (C57BL/6JEi x SPRET/Ei)Fl x SPRET/Ei) (Rowe et al . 1994). Genomic DNA from each of 94 samples of the panel was amplified by PCR using the primers:

TGGAAGAGTAAAACTTGATCGA and AGAACATTTAAAGATTTCAAACT ,

then digested with Ddel and the reaction product subjected to electrophoresis. More than 90 of the 94 samples were successfully typed. Missing typings were inferred from surrounding data where assignment was unambiguous . This analysis places murine Stim2 at the same position as Cckar on Chromosome 5 (Figure 10) . Murine Stim2 thus maps to a region of Chromosome 5 that is syntenic to the human 4pl5.1 region containing CCKAR and PCDH7.

Example 5 Identification of Drosophila STIM

Further database searching revealed the existence of one Drosophila melanogaster STIM family member, on the basis of significant homology between the human STIMl amino acid sequence and the ORFs of several overlapping Drosophila ESTs. A cDNA clone represented by one of the 5' ^■ESTs (Clone LD06112) was obtained and sequenced. The 2101 bases contain a 1710 bp ORF with significant homology to human STIMl and STIM2 , a 148 bp of 5 'UTR, and a 243 bp 3 'UTR with a poly A tail. The ORF predicts a 570 amino acid protein, which is considerably smaller than human STIMl and STIM2 (Figure 3) . A best-fit alignment between D-Stim and the human STIMs indicates an approximate addition of 70-80 amino acids at the amino terminus and a truncated carboxy terminus. This cDNA sequence was aligned with Drosophila transcripts produced as part of the Celera Drosophila genome sequencing project, and was found to be identical to the predicted Stromal cell protein homologue transcript CT26146 (derived from predicted gene CG9126) . This 3223 bp transcript, CT26146, predicts an identical coding region over the first 556 residues, with an alternative 3' coding region producing a further 510 amino acids (CP26146) rather than the very short 14 amino acid tail identified in clone LD06112 depicted schematically in Figure 8. The 3' region of CT26146 predicts an amino acid sequence that has no detectable similarity to either human STIMl or STIM2 , and also independently clusters with the 5' ends of several separate Drosophila ESTs, suggesting that this clone represents a hybrid transcript. To determine the real transcript size and sequence in Drosophila we performed RT-PCR and DNA sequence analysis of RNA extracted from wild type w¹¹⁸ adult flies. In all cases the sequences were identical to clone LD06112 over the entire predicted coding region (including the stop codon) , except for a single amino acid substitution in position 38 (R to C) of wll8 flies compared to the Celera and LD06112 sequences, demonstrating that this clone represents the actual endogenous D-Stim transcript (not shown) . A 64.8kDa protein was produced from the D-Stim cDNA clone LD06112 by coupled in vitro transcription and translation, which reacted with the Pan-STIM antibody in immunoprecipitation and Western blotting analyses. This cDNA generated a 65kDa protein after transient transfection into S2 Schneider cells, that was similar in size to the major endogenous immunoreactive protein in a variety of Drosophila cell lines. This 65kDa protein is consistent with a 570 amino acid polypeptide sequence for D-Stim, and is smaller than both human STIMl and STIM2. We found no evidence of an endogenous immunoreactive protein that would correspond to the 1066 amino acid CP26146 protein. These data indicate that the Celera sequence for D-Stim does not represent the true endogenous sequence of this transcript. No additional sequences could be identified in the completed sequence of the euchromatic, gene rich, portion of the Drosophila genome that had homology to mammalian STIMl or STIM2 , indicating that only one STIM homologue exists in the Drosophila genome.

Example 6 Domain Structural Comparison of Human STIM2 , STIMl and Drosophila STIM

The STIM2 protein predicted from the nucleotide sequence contains 746 amino acids that would generate a mature protein of 732 residues and after cleavage of the signal peptide. STIM2 thus has additional 59 amino acids when compared to STIMl. BLAST comparison of human STIMl and STIM2 reveals 53% amino acid identity and 66% similarity over 577 amino acids (approximately 85% of the length of STIMl) , with significant divergence located in the extreme carboxy terminal regions only. The D-Stim protein of 570 amino acids, including a predicted signal peptide of 23 residues, is equally similar to both STIMl (33% identical, 50% conserved) and STIM2 (31% identical, 46% conserved) . Overall, the three STIM family members are predicted to represent type I transmembrane proteins, with a single transmembrane segment separating an amino terminal exoplasmic region from a carboxy terminal cytoplasmic region. The predicted STIM2 protein and D-Stim protein share several structural features with human STIMl (Parker et al . , 1996). All three STIMs contain a pair of cysteine residues spaced 8 amino acids apart at identical positions near the N-terminus, in addition to an unpaired Helix-Loop- Helix region which contains several acidic residues and conforms to the consensus for an EF-Hand calcium binding motif. A SAM (sterile alpha motif) domain which forms a five helical bundle structure is situated in the exoplasmic region of the three proteins close to the predicted membrane-spanning domain. An N-linked glycosylation site delineates the amino terminal limit of the SAM domains in all three proteins, while STIMl possesses a unique potential N-linked glycosylation site within the SAM domain. The single pass transmembrane region is highly conserved in all STIM proteins and contains a single cysteine residue. Unique to D-STIM is the presence of an 70-80 amino acid region between the signal .peptide and the cysteine pair, that possesses no obvious structural features . Like STIMl, the cytoplasmic region of STIM2 and

D-STIM contain a significant degree of alpha helical structure, a large proportion of which is predicted to form coiled-coils, and which display weak homology to known structural proteins such as myosin. Further towards the carboxy terminus, beyond the tail of D-STIM, STIM2 contains, a proline- and histidine-rich motif (10 prolines and 8 histidines within a 27 amino acid stretch) at a similar position to a serine- and proline-rich region in STIMl. The two human STIM proteins diverge significantly in structure distal to this region with the .exception of similar, yet distinct, lysine-rich tails of 14 residues (5 lysines in STIMl) and 17 amino acids (9 lysines in STIM2 ) . None of the three STIM proteins contains an identifiable catalytic domain.

Example 7 STIM Gene Family Members in Other

Vertebrates and Invertebrates TBLASTN searches of publicly available databases were performed to identify STIM family members in other species. Murine STIMl has been previously identified

(Oritani and Kincade, 1996) , and ESTs were identified for rat and bovine STIMl genes, and murine, rat and bovine STIM2 genes . While the available ESTs do not cover the complete cDNA sequences for these species, the predicted amino acid sequences indicate that they represent true STIM family members (see below) . EST sequences representing STIM2 homologues can be identified in amphibian (Xenopus) and Avian (Chicken) , but no STIMl homologues are present in the relatively limited EST sequences available. Recent sequencing of the genome of the pufferfish Tetraodon nigroviridis as part of a large scale comparative Human/pufferfish genomic project, allowed us to identify two sequence clusters, each with several overlapping pufferfish genomic fragments, ..that independently code for STIMl- and STIM2-like proteins. These analyses indicate that the STIM gene family is represented by two genes in vertebrates. A sequence alignment of the highly conserved EF hand regions of the available STIM homologues is presented to demonstrate the high degree of sequence conservation during 400 million years of evolution from pufferfish to humans . From TBLASTN searching of the Caenorhabdi tis elegans genomic and EST databases, and the subsequent annotation of genes and gene products thereof derived, it is clear that C-Stim represents the single bona fide STIM homologue in the nematode. The predicted C-Stim gene product is based on the genomic sequence and .two C. elegans EST sequences (5' and 3' reads from clone yk663e5) that correspond to the translation start site, signal peptide and EF hand, and the cytoplasmic portion of the protein, respectively. The EF hand region of both invertebrate genes is also compared to their vertebrate homologues.

Extensive searching has failed to identify additional family members, indicating a single STIM gene in this invertebrate. No STIM-like genes can be identified in databases representing lower eukaryote or prokaryote genomes .

Example 8 Tissue Expression and Imprinting of STIM2 A 900bp fragment of the cDNA for human STIM2 was used to analyse the tissue distribution of mRNA expression of STIM2. Figure 11 shows a comparison of a Northern blot probed separately with fragments of STIMl, STIM2 and β- actin. Expression of STIM2 mRNA is widespread, and our results show that STIM2 is more uniformly expressed in tissues than is STIMl mRNA. The apparent doublet of STIM2 transcript bands is presumed to result from the alternate use of a polyadenylation signal approximately 200 bp upstream of the true 3' end of the mRNA. This became apparent during database searches, where it was found that a class of STIM2 ESTs had, as their 3' end, sequences 200 bp from the true 3 ' end of the gene .

To determine whether murine Stim2 expression is regulated by genomic imprinting, the parental origin of

Stim2 transcripts was analyzed in mouse tissues. C57BL/6J and Mus spretus (SPRET/Ei) mice were mated to generate Fl offspring of known parentage. Total RNA was isolated from various tissues from Fl foetuses on day 13.5 of gestation, from newborn mice, and from neonates on days 5 and 13 after birth. cDNA was synthesized using M-MLV reverse transcriptase and oligo (dT) _]_g . This cDNA was amplified using the primers described in Example 4, digested with Ddel and then separated by electrophoresis. Biallelic expression was found in all newborn and. neonatal tissues examined, as shown in Figure 12. These data demonstrate that murine STIM2 expression is not regulated by genomic imprinting in any mouse tissues analysed.

Example 9 Anti-STIM2 Antibodies

One STIM2-specific antibody, designated anti- STIM2-CT, was produced in sheep by immunization with the immunogenic peptide:

CHNGEKSKKPSEIKSLFKKKSK,

coupled to diphtheria toxoid. The sequence above corresponds to the sequence of the extreme carboxy terminus of the mature human STIM2 protein, except for one amino acid difference in the corrected sequence (CHNGEKSKKPSKIKSLFKKKSK) . Polyclonal antisera were affinity-purified by standard procedures (Harlow and Lane, 1988) .

The STIM2-specific antibody detects a protein of 120kDa expressed from transfected STIM2 cDNA (Figure 13). This 120kDa protein is detected at low levels in non- transfected G401 cells (Figure 13) and in K562 erythroleukemia cells. This 120kDa protein was competable by the C-terminal peptide to which the antibody was raised. The 120kDa protein becomes reduced in size upon treatment of the lysate with endoglycosidase H, indicating N-linked glycosylation.

Furthermore, by utilising all or most of the extracellular domain of STIM2 as an immunogen, a monoclonal antibody can also be produced which will either block or activate STIM2 signalling in cells.

Example 10 Comparative Expression of Human STIMl and STIM2 A Northern blot of RNA from various human tissues probed with STIM2 cDNA demonstrated a single 4. Okb mRNA species in all tissue samples, with some modest variation in abundance. This mRNA species corresponded most closely in size to cDNA clone H5F7. The absence of detectable transcripts of 4.8kb suggested that the larger STIM2 cDNA clones represented less abundant mRNA species, consistent with the EST sequence data.

An affinity-purified polyclonal antibody was prepared against a peptide at the extreme carboxy terminus of human STIM2 (and completely conserved in mouse Stim2). In Western blotting the STIM2 specific antibody detected a 105 and 115kDa doublet in cells transfected with STIM2 cDNA, and showed weak reactivity against a putative endogenous STIM2 of 105kDa. Figure 14 shows that Human STIMl and STIM2 are both modified by N-linked glycosylation. Human 293T cells were transfected with either STIMl (Si) or STIM2 (S2) expression constructs, and the cells were subsequently metabolically labelled overnight with [³⁵S] cysteine and methionine in either the absence (-) or presence (+) of Tunicamycin (TUN) . Lysates were immunoprecipitated with their respective antibodies (+; STIM1-NT for the STIMl-transfected cells, and STIM2-CT for the STIM2-transfected cells) or with no primary antibody (-) . The immune complexes were resolved by SDS- PAGE and labelled proteins were visualised by autoradiography.

These proteins did not react with antibodies raised to the carboxy-terminus of STIMl (Manji et al , 2000) . STIMl antibodies detected the 90kDa STIMl protein in 293T cells transfected with STIMl cDNA, which did not react with STIM2 antibodies. These data demonstrate the specificity of the STIMl and STIM2 antibodies. Parallel immunoblots were used to characterize two additional STIM family antibodies. A Pan-STIM antibody was prepared by immunizing animals with a mixture of peptides modeled on the highly conserved Helix-Loop-Loop region (putative EF hand) in the amino terminal region of STIMl, STIM2 and D- Stim. While this antibody was not as sensitive in its ability to detect endogenous STIM expression, , it reacted with both STIMl and STIM2 proteins produced by transfected cells, confirming the reading frame assigned to the STIM2 cDNA close to the amino terminus of the protein. This antibody also detected both endogenous and transiently transfected D-Stim. Additionally, we utilized a commercial anti-GOK (STIMl) monoclonal antibody that was generated to ' an extreme amino terminal region of human STIMl, a region that is highly- conserved at the primary sequence level between STIMl and STIM2. This monoclonal antibody reacted with both STIMl and STIM2 in transfected cells, confirming the structural similarity between these two STIM molecules (Figure 14) . Example 11 Interaction Between STIM Family Members

Co-transfeetion assays were used to examine the possibility of specific interactions between STIMl and STIM2, and the ability of D-Stim to interact with mammalian STIM proteins. 293T cells were transiently transfected with either STIMl, STIM2 or D-Stim cDNAs alone or with two constructs . Proteins were immunoprecipitated with anti- STIMl amino terminal (NT) , anti-STIMl carboxy terminal (CT) , or anti-STIM2 antibodies, and i munoblotted with the Pan-STIM antibody.

Figure 15 shows the characterisation of antibodies reactive with Human STIMl and STIM2. Human 293T cells were transfected with either Human STIMl (Si) or STIM2 (S2) cDNAs in eukaryotic expression vectors.

Immunoblots were performed on these cellular lysates with the STIMl-specific antibodies (STIMl-NT and STIMl-CT) , STIM2 specific antibodies (STIM2-CT) , with antibodies designed to detect multiple STIM family members (PAN-STIM) , or with a commercial monoclonal antibody (GOK) raised against the amino terminal region of human STIMl. This amino terminal region is highly conserved at the primary amino acid sequence in human STIM2.

The result of this study suggested that not only do all three specific antibodies immunoprecipitate their respective ligands with moderate efficiency, but that readily detectable levels of STIM2 are specifically co- precipitated with STIMl, and vice versa. That is, the STIMl specific antibodies only precipitate STIM2 when it is co-expressed with STIMl, and STIMl is only detected in the

STIM2 immunoprecipitates when co-expressed with STIM2. Parallel immunoblots of the transfected cell lysates without immunoprecipitation confirmed the appropriate expression of the STIM family members in these studies. These data can be complemented with: i) co-transfection studies with STIMl and STIM2 in MT vector (to establish that this association is not simply an artefact of very high levels of over-expression) ; and ii) studies with the GCSFR and one of the chimeric GCSFR-STIM1 molecules and STIM2 establishing the specificity of interaction to the cytoplasmic region.

Example 12 Post-Translational Modification of STIM2

STIMl and STIM2 cDNA constructs were independently transfected into 293T cells that were then labeled overnight with a mixture [³⁵S] methionine and [³⁵S] cysteine in the presence or absence of tunicamycin. Newly synthesized STIMl and STIM2 proteins were recovered by immunoprecipitation. Figure 16 shows the association of Human STIMl with Human STIM2 in vivo .

Human 293T cells were transfected with either empty vector (-), STIMl (SI), STIM2 (S2), or both STIMl and STIM2 (S1/S2) expression constructs, and lysates were prepared. Immunoprecipitations were then performed with the indicated STIMl- and STIM2-specific antibodies and the resulting immune complexes were immunoblotted with the PAN- STIM antibody to detect both human STIMl and STIM2.

In the absence of tunicamycin STIMl existed exclusively as a single species of 90kDa that was reduced to a 84kDa form when N-linked glycosylation was inhibited by tunicamycin, similar to the size of in vi tro translated STIMl and STIMl digested with endoglycosidase H (Manji et al , 2000) . In contrast, inhibition of N-linked sugar modification of STIM2 with tunicamycin only marginally increased its gel mobility and failed to shift all isoforms to a single lower form. Similar results were obtained by immunoblotting cell lysates of STIM2-transfeeted 293T cells cultured in the presence or absence of tunicamycin. These results indicated that STIM2 was modified by N-linked glycosylation, but that this modification did not account for the size difference between the two major isoforms (105 and 115kDa) observed on immunoblots and in metabolic labeling studies .

Phosphorylation of STIM2 was analysed in G401 and 293T cells transiently transfected with STIM2 cDNA. Cells were cultured in the presence or absence of the phophatase inhibitor calyculin and changes in electrophoretic mobility were assessed by immunoblotting. A decrease in electorphoretic mobility of the low level of endogenously produced STIM2 is seen. in both G401 and 293T cells treated with calyculin. The apparent molecular size, 115kDa, of this STIM2 protein is similar to that of the larger isoform observed in transiently transfected, non-calyculin treated, 293T and G401 cells. In both cell lines, calyculin treatment results in decreased mobility of virtually all STIM2 produced from the transfected construct to a single larger isoform of approximately 115kDa. On immunoblots purposely over-developed, only a very small degree of smearing is observed above these larger isoforms, indicating that even larger forms are not generated after inhibition of phosphatase activity. A difference in the proportion of the two dominant isoforms was detected in the STIM2-transfected G410 and 293T cells, with much lower abundance of the larger 115kDa form produced by G401 cells. These data indicated that the larger isoform (115kDa) of STIM2 was a more highly phosphorylated form of the smaller isoform (105kDa) .

To provide more direct evidence for phosphorylation, 293T cells independently transfected with STIMl and STIM2 expression constructs were labelled with [³²P] orthophosphate, either in the presence or absence of calyculin. Phosphorylated STIM proteins were detected by autoradiography after immunoprecipitation. The level of incorporation of [³²P] orthophosphate in the absence of calyculin appeared to be similar for STIMl and STIM2 when compared to the amounts of each protein recovered (Coomassie stained). A 2.5-3 fold increase in incorporation into both proteins was seen after calyculin treatment, with the larger isoform of STIM2 incorporating significantly more label than the smaller isoform) . Phosphatase treatment of [³²P] orthophosphate labeled STIM2 resulted in reduced mobility of the larger isoform to the smaller 105kDa form. These results demonstrated that STIM2 was modified by phosphorylation in vivo, and that the observed heterogeneity in molecular size of STIM2 arose through variable degrees of phosphorylation.

Example 13 Comparative Genomic Organization of

STIMl and STIM2 Alignment of the STIM2 cDNA sequence against the dbSTS division of Genbank revealed several Sequence tagged sites (STS's), all of which mapped to chromosome 4pl5.1. STIM2 is located between the cholecytokinin type A receptor (CCKAR; telomeric) and BH-protocadherin (PCDH7; centromeric) . The 4pl5.1 region has been implicated in head and neck squamous carcinoma. Mouse Stim2 was mapped to a syntenic region of mouse chromosome 5 by analysing the Jackson Laboratory interspecies backcross panel BSS . D- Stim was mapped to band 14A of the X chromosome by FISH. Southern blot hybridization of D-Stim cDNA to a cosmid spanning this chromosome region (Van der Bliek and

Meyerowitz, 1991) positioned D-Stim 25-50kb proximal to shibire (shi) . This cytogenetic localization has been confirmed in the recent sequencing and annotation of the Drosophila melanogaster genome. The intron-exon. boundaries of STIMl and STIM2 were determined by alignment of cDNA sequences with genomic sequences in the human genome database. The genomic organization of these two genes are highly conserved. Approximately 85% of the coding region and the entire 3 ' UTR of human STIM2 is encoded by 10 exons spaced over 71kb within a single 170kb contig (NT_002811; HS4_2957). The GC-rich 5 ' end of STIM2 and the promoter region are yet to be completed by the Human Genome Project. The STIMl transcript is encoded by 12 exons, spaced over approximately 250kb (Sabbioni et al . , 1997). Most importantly, in comparing STIMl and STIM2 , the intron-exon boundaries are exquisitely conserved, with only the position of the most 3 ' intron differing, suggesting that these two genes have evolved from a common ancestor. Comparison of the D-Stim cDNA clone with the Celera Drosophila genomic database reveals that the D-Stim locus is significantly more compact, encompassing 7 coding exons spaced over only 4.2kb. The exon structure of D-Stim is conserved with STIMl and STIM2 , particularly with respect to exons coding for the extracellular region. In contrast, the cytoplasmic region is encoded by a single large exon in D-Stim (E6) , and by four exons (E7-E10) in STIMl and STIM2.

Example 14 Function of STIM2

The rat PC12 pheochromocytoma cell line (neural crest origin) was used to study the precise role of STIMl and STIM2 in neuronal proliferation and differentiation, since the signalling pathways regulating proliferation, survival and NGF-induced neuronal differentiation have been intensively characterized in this cell line. PC12 cells express moderate levels of STIMl and very low levels of STIM2, and neurites induced by NGF in PC12 cells are intensely stained with STIMl antibodies . The Tet-Off™ inducible expression system (Clontech) was used to generate¹ stable PC12 cell lines in which the level of either STIMl or STIM2 expression can be controlled by doxycycline.^' Clones were selected that- expressed high levels of protein from the transfected cDNA in the absence of doxycycline (Dox) , with no leaky expression in the presence of lOμg/ml Dox. PC12 clones expressing 50-fold elevated levels of STIMl (PC12-ST1) and similar levels of STIM2 (PC12-ST2) were studied in detail using in vi tro assays. These analyses clearly demonstrated that overexpression of either STIMl or STIM2 had no autonomous effects on the phenotype of PC12 cells in vi tro in the following assays:

(1) Proliferation rates in the absence of NGF (measured by MTT assays, cell counts, and flow cytometry)

(2) Incidence and extent of neurite outgrowth induced by NGF, and survival in the absence of serum. These data demonstrate that, unlike the cell autonomous effects on myogenic cell proliferation, neither STIMl nor STIM2 overexpression resulted in suppression of growth of PC12 cell line in vi tro. To determine whether STIM proteins may influence cell behaviour mediated by non- autonomous cell interactions in vivo we analysed the effects of STIMl and STIM2 overexpression on the growth of xenografts after subcutaneous injection of PC12 cells into nude mice. PC12-ST1 and PC12-ST2 were induced to express maximal levels of STIM proteins in vi tro prior to injection of 10⁷ cells at one site per mouse. Parental PC12 cells were used for comparison. Specific and reproducible changes in cell phenotype were observed in these studies. Firstly, the average size of tumours formed from PC12-ST1 cells was half that of parental PC12 tumours, with a more moderate reduction seen in the size of PC12-ST2 tumours. Secondly, major changes in the morphology of the PC12 cells and their interaction with the host body wall was evident when expression of STIM proteins was elevated. Figure 18 shows histological sections of PC12 tumours stained with haematoxylin and eosin. Panels A-C show parental PC12 cells having round, pale-stained nuclei. Panels D-F demonstrate that PC12 cells that are overexpressing STIMl have dark nuclei and elongated. (m = skeletal muscle of mouse body wall; col = collagen fibrils) .

The predominant features of PC12-ST1 and PC12-ST2 tumours were:

1) Significant infiltration of PC12 cells between skeletal muscle fibres of the mouse body wall (Figure 18 Panel D) compared to minimal infiltration of skeletal muscle by parental cells (Figure 18 Panel A) . An altered morphology of the PC12 cells, from compact rounded parental PC12 cells with pale nuclei (type A) (Figure 18 Panels B & C) to more elongated cells with darkly stained nuclei (type B) (Figure 18 Panels E & F) .

The presence of regions containing more abundant and disorganised collagenous extracellular matrix (Figure 18 Panel F) compared to tumours from parental cells (Figure 18 Panel C) . This collagenous matrix appears to be derived from the host tissue rather than synthesised by PC12 cells . Histological analysis showed that cells in all tumours could be readily classified into the two morphological phenotypes . Parental PC12 tumours contained predominantly type A cells, while both PC12-ST1 and PC12- ST2 tumours contained predominantly type B cells . These data suggest that the majority of PC12 cells overexpressing STIMl or STIM2 have switched their phenotype to a more migratory, invasive cell phenotype.

Total RNA was prepared from each tumour sample for analysis of changes in gene expression. PolyA RNA was prepared from two parental PC12 tumours, one PC12-ST1 and one PC12-ST2 and used for generation of cDNA to probe a rat cDNA expression array (Clontech, Atlas array) . These expression arrays contain 588 known rat cDNAs that code for a range of proteins having different functions within the cell . While the overall patterns of gene expression appeared quite similar in all four tumours analyzed, several genes showed consistent changes in the PC12-ST1 and PC12-ST2 tumours compared to controls. Two of these, neuronatin (Nnat) and CD24 appeared to be significantly down-regulated in the PC12 cells overexpressing STIM protein. cDNA probes were prepared for these two genes, and all remaining tumour samples were analyzed by Northern blotting to determine whether this is a consistent finding. While precise quantitation still needs to be done, the initial data indicate a significant down-regulation of these two transcripts in 4/5 of PC12-ST2 tumours compared to both parental controls and PC12-ST1 tumours. These data suggest that the downstream effects of STIMl and STIM2 overexpression differ in terms of alterations in gene expression, despite the apparent similarities in invasive behaviour. Accurate quantitation of the data and analysis of additional genes will reveal the full extent of the similarities and differences in the response of cells to STIMl and STIM2 overexpression.

Nnat is a gene expressed highly in the developing mouse brain, with levels of expression apparently decreasing in the neonate and adult brain (Kikyo et al, 1997) . It is an imprinted gene in mice (Kikyo et al, 1997) being expressed exclusively from the paternal allele. Nnat expression is reduced upon differentiation of P19 embryonal carcinoma cells (Wijnholds et al, 1995) and is down- regulated in PC12 cells upon stimulation with NGF (Joseph et al, 1996) . These observations implicate a role for Nnat in neuronal differentiation. While three alternatively spliced forms of Nnat have been identified, neither the cellular localization nor the actual biological function of these proteins has been elucidated. We propose a role for STIM2 in the regulation of Nnat expression, with downstream effects on cell proliferation and differentiation in the developing brain.

CD24 is glycosyl phosphatidylinositol (GPI) anchored cell surface protein that is variably glycosylated (Nedelec et al, 1992) . It is highly expressed by neurons with expression down-regulated in the adult brain compared to fetal stages (Calaora et al, 1996; Shirasawa et al, 1993) . CD24 plays a role in axon guidance through its interaction with Ll, a potent promoter of neurite outgrowth (Brummendorf et al, 1998) . CD24 can either promote or inhibit neurite outgrowth, depending on the neuronal cell type, implying the existence of complex, interdependent regulatory molecules that participate in signaling pathways that mediate cell adhesion and axon guidance (Kleene et al, 2001) . We propose a role for STIM2 in the regulation of CD24 expression, with downstream effects on neuronal tracking in the developing nervous system.

In summary - overexpression of STIMl or STIM2 in PC12 cells results in a dramatic change in phenotype induced by alterations in the interaction of PC12 cells with host tissue.

An invasive phenotype is characteristic of metastatic tumour cells . These data provide evidence for a potential role of STIM proteins in metastatic tumour growth. While not wishing to be bound by any particular hypothesis we believe that STIM proteins promote tumour invasion by interacting with the Notch signalling pathway (see Example 15) .

Example 15 Function of Drosophila STIM

The developmental function of D-Stim is determined by using various experimental methods to interfere with expression of D-Stim in vivo, either by down-regulation as for example in a null mutant, or by ectopic expression of a D-Stim transgene. A transgenic fly line has been generated that allows the over-expression of D-Stim in various specific tissues and during specific developmental stages. The transgene comprises an upstream activation sequence - (UAS) flanking the 5' end of the full-length D-Stim cDNA, all constructed in a P-element based cassette (Brand and Perrimon, 1993). This stable transgenic line is then outcrossed to various existing driver lines expressing the yeast GAL4 transcription factor under the spatial and temporal regulation of specific enhancers/promoters . GAL4 binds to the UAS, and consequently drives the expression of the transgene, D- Stim. The transgene has so far'been tested with two GAL4 driver lines, and preliminary results, based on the phenotypes observed as a result of D-Stim over-expression, implicate D-Stim in Delta-Notch signalling.

Figure 19 shows scanning electron micrographs of eyes of adult Drosophila. GMR GAL4/+ heterozygote flies maintained at 29°C (A) have normal inter-ommatidial bristles but slight roughening of the surface of the eye due to irregular ommatidia. When crossed with the UAS-DStim transgenic strain, flies maintained at 29°C (B) have few inter-ommatidial bristles and have the same roughening of the ommatidial pattern as the controls flies in A. The roughening is not evident at 25°C (C) , but the reduction in bristle number is clearly seen.

Expression of D-Stim under GMR-GAL4 (an eye specific driver) , results in the loss of inter-ommatidial bristles when flies are maintained at 25°C (Figure 19) . The effect is further enhanced when the cross is maintained at 29°C, where some roughening of the eye can be observed (Figure 19) . This latter effect appears to be due to the over-expression of GAL4 in the relative tissue, but the loss of inter-ommatidial bristle is specific to D-Stim, since GAL4 on its own does not result in such a phenotype (Figure 19) . Using the 32B GAL4 driver to regulate expression in all imaginal discs, results in ectopic wing vein, deltoid formations at wing vein extremities, and notching of wing margins. Figure 20 shows wing phenotypes of 32B GAL4/UAS-DStim flies at 29°C. Three different abnormalities in wing structure are evident: ectopic wing veins (E) , notching of wing margins (N) and deltoid formations at wing vein extremities (D) . All three can be seen in the wings of some flies (A) , while only one or two- of these abnormalities are seen in other flies (B,C) . The' wing shown in C appears normal except for the notch at the tip of the wing.

Using another driver line, MS1096 that expresses in the wing disc, D-Stim overexpression results in ectopic wing veins, vein thickening, veins ending in deltas, and also the formation of extra .scutellar bristles and duplicated michrochaetes on the scutum (part of the mesothorax) that develops from the dorsal wing pouch. The latter phenotypes implicate D-Stim in the sensory progenitor asymmetric divisions (Simpson et al, 1999) .

These phenotypes have been previously described in various Delta and Notch mutants (Parody and Muskavitch, 1993) . The bristle pattern on the scutum is known to be regulated to a major extent by Notch signaling (Simpson et al, 1999) . Based on these phenotypic similarities it appears that D-Stim most likely has a role associated with Notch signaling. D-Stim may be antagonising Notch or Delta, either directly suppressing their function, or indirectly. Further genetic crosses with existing Notch and Delta mutants, as well as other components of the pathways, are required before verifying the interaction. It may be that D-Stim is involved in other pathways associated with Notch signalling, such as the Wingless pathway.

The Notch signalling pathway plays a crucial role in the specification of cell fate in Drosophila development (Greenwald, 1998) , and numerous studies have now clearly demonstrated a central role of Notch signalling in mediating cell fate decisions and regulating cellular processes in a diverse range of tissues during vertebrate development (Artavanis-Tsakonas et al , 1999) . For example, Notch signalling inhibits differentiation of myoblasts (Kuroda et al , 1999; Luo et al , 1997) and neuronal precursors (Chitnis et al , 1995; Haddon et al , 1998) , and regulates the proliferation and differentiation of haematopoietic cells in bone marrow (Jones et al , 1998; Walker et al , 1999) .

Notch signalling depends on the activation of Notch receptors (4 in vertebrates) by binding of ligands expressed on the surface of adjacent cells (Deltal-4, and Jagged 1 and 2) . In simplest terms, ligand-induced activation of Notch receptors results in proteolytic cleavage of the intracellular domain of Notch, which translocates to the nucleus where it associates with the DNA-binding protein RBP-J/CBFland activates target genes such as HES-1 that repress the transcription of differentiation factors (Greenwald, 1998; Artavanis- Tsakonas et al , 1999) . Additional factors influence the actual biochemical pathway and developmental consequences of Notch signalling in different cellular contexts, providing a highly complex regulatory system. For example, Fringe proteins can inhibit or potentate Notch receptor activation depending on the specific receptor-ligand pair (Hicks et al , 2000) . Other modulators include presenilins and the transmembrane metalloproteinase Kuzbanian, which appear to regulate the formation and intracellular trafficking of Notch receptors and ligands and may influence the quantity of receptors and ligands present at the cell surface (Artavanis-Tsakonas et al , 1999) . The developmental consequences of Notch signalling depend on cross-talk between different cellular factors. For example, Wiskott-Aldrich syndrome proteins (WASP) have been recently shown to have a role in Notch signalling in Drosophila (Ben-Yaacov et al , 2001) . These proteins link signal transduction pathways with the cytoskeleton, and can promote reorganization of cytoskeletal structures (Mullins, 2000) . Deregulation of Notch signalling not only causes developmental abnormalities, but has also been implicated in tumourigenesis . A constitutively active truncated Notch protein comprising only the intracellular portion of the molecule is implicated in human and mouse leukemias (Ellisen et al , 1991; Pear et al , 1996) , and can transform mammary epithelial cells in transgenic mice (Gallahan et al , 1996) or kidney epithelial cells in vi tro (Capobianco et al , 1997) . Transfection of mammary epithelial cells with a truncated form of Notch 4 disrupts epithelial organization and promotes an invasive phenotype (Soriano et al , 2000) . Much still remains to be elucidated regarding the biochemical nature and regulation of Notch signalling in different cells, and how various modulators of this crucial signalling pathway act to precisely regulate cell phenotype. Our Drosophila data leads us to hypothesise that STIM proteins would act to antagonise the Notch signalling pathway by interfering with Notch receptor- ligand binding directly or indirectly by interacting with other components that modulate Notch signalling.

It will be apparent to the person skilled in the art that while the invention has been described in some detail for the purposes of clarity and understanding, various modifications and alterations to the embodiments and methods described herein may be made without departing from the scope of the inventive concept disclosed in this specification.

References cited herein are listed on the following pages, and are incorporated herein by this reference.

Reference

Artavanis-Tsakonas et al . (1999). Science. 284: 770-776

Ben-Yaacov et al . (2001). J Cell Biol. 152: 1-13. Brand & Perrimon (1993). Development. 118: 401-415.

Brummendorf et al . (1998). Curr Opin Neurobiol . 8: 87-97

Calaora et al . (1996). Neuroscience . 73: 581-94.

Capobianco et al . (1997). Mol Cell Biol. 17: 6265-6273.

Chitnis et al . (1995). Nature. 375: 761-766. Ellisen et al . (1991). Cell. 66: 649-661.

Gallahan et al . (1996). Cancer Res. 56: 1775-1785.

Greenwald I (1998). Genes Devel . 12: 1751-1762.

Haddon et al . (1998). Development. 125: 359-370.

Harlow & Lane (1988) . Antibodies: A Laboratory Manual. Cold Spring Harbor Laboratory Press, New York.

Hicks et al . (2000). Nature Cell Biol. 2: 515-520.

Hoovers et al . (1995). Proc. Natl. Acad. Sci. USA. 92:

12456-12460.

Jones et al . (1998). Blood. 92: 1505-1511. Joseph et al . (1996). Brain Res. 738: 32-38.

Kikyo et al . (1997). Dev Biol . 190: 66-77.

Kleene et al . (2001). J Biol Chem. 276: 21656-21663.

Koi et al . (1993). Science. 260: 361-364.

Koufos et al . (1989). Am. J. Hum. Genet. 44: 711-719. Kozak (1996). Mamm. Genome. 7: 563-574.

Kuroda et al . (1999). J Biol Chem. 274: 7238-7244.

Luo et al . (1997). Mol Cell Biol. 17: 6057-6067.

_'Manji et al . (2000). Biochim. Biophys . Acta. 1481: 147-

155. Mannens et al . (1996). Med. Pediatr. Oncol. 27: 490-494.

Morison et al . (in preparation)

Mullins R (2000). Curr Opin Cell Biol. 12: 91-96.

Nagase et al . (2000). DNA Res . 7: 143-150.

Nedelec et al . (1992). Eur J Biochem. 203: 433-42. Oritani & Kincade (1996). J. Cell Biol. 134: 771-782.

Parker et al . (1996). Genomics . 37: 253-256.

Parody & Muskavitch (1993). Genetics. 135: 527-539. Pear et al . (1996). J Exp Med. 183: 2283-2291. Rowe et al . (1994). Mammalian Genome. 5: 253-274. Sabbioni et al . (1997). Cancer Res. 57: 4493-4497. Shirasawa et al . (1993). Dev Dyn. 198: 1-13. Simpson et al . (1999) . Development. 126: 1349-1364 Soriano et al . (2000). Int J Cancer. 86: 652-659. Sotel-Avila & Gooch (1976). Perspect. Pediatr. Pathol. 3 255-272.

Van der Bliek & Meyerowitz (1991). Nature. 351: 411-414. Walker et al . (1999). Stem Cells. 17: 162-171. Wijnholds et al . (1995). Dev Biol. 171: 73-84.

Claims

THE CLAIMS DEFINING THE INVENTION ARE AS FOLLOWS:

1. A nucleic acid molecule encoding STIM2 , or a biologically active fragment thereof.

2. A nucleic acid according to claim 1, wherein said nucleic acid is either genomic DNA, cDNA, RNA, or a hybrid molecule thereof.

3. A nucleic acid according to claim 1, wherein said nucleic acid is as shown in Figure 1, or a nucleic acid molecule, which is able to hybridize thereto under stringent conditions .

4. A nucleic acid according to claim 1, wherein said nucleic acid encodes a STIM2 polypeptide which has an amino acid sequence as shown in Figure 2, or a biologically active fragment thereof.

5. A nucleic acid according to claim 1, wherein said nucleic acid encodes a modified and/or variant form of STIM2 with the proviso that the modified and/or variant form of STIM2 is biologically active.

6. A nucleic acid according to claim 5, wherein the modified and/or variant form of STIM2 has an amino acid sequence as shown in Figure 2 with one or more amino acid substitutions, deletions or insertions.

7. A method of modulating the activity of cells, comprising the step of administering to mammalian cells a protein encoded by a nucleic according to claim 1.

8. A method according to claim 7, wherein the activity modulated is selected from the group consisting of cell proliferation, cell differentiation and cell viability.

10. An antisense nucleic acid molecule that binds to a nucleic acid molecule that encodes STIM2.

11. An antisense nucleic acid according to claim 10, wherein said antisense nucleic acid molecule has the ability to inhibit the activity of STIM2 in cells when transfected into them.

12. An antisense nucleic acid according to claim 11, wherein the activity which is inhibited is selected from the group consisting of cell proliferation, cell differentiation and cell viability.

13. An antisense nucleic acid according to claim 10, wherein the antisense nucleic acid has a sequence as shown in Figure 17.

14. A fragment of STIM2 which is capable of eliciting an antibody which co-precipitates a STIM2 ligand.

15. A fragment according to claim 14, wherein said fragment is the C-terminal portion of STIM2.

16. A fragment according to .claim 14, wherein said fragment is the C-terminal 22 amino acid segment CHNGEKSKKPSEIKSLFKKKS .

17. An antibody elicited by a STIM2 fragment according to claim 16.

18. An antibody according to claim 17, wherein said antibody is a polyclonal antibody.

19. An antibody according to claim 17, wherein said antibody is a monoclonal antibody.

20. A polypeptide which is specifically co- precipitated by an antibody according to claim 17 from a cell expressing full-length STIM2 protein.

21. A polypeptide according to claim 20, wherein the cell is stably over-expressing the full-length STIM2 protein.

22. A polypeptide according to claim 20, wherein the polypeptide has the ability to bind to STIM2 , and thereby to modulate an activity selected from the group consisting of cell cycle control, cellular differentiation, cell proliferation, cell survival and cell migration.

23. A method of screening for a ligand able to bind to and to modulate the activity of STIM2.

24. A method of treating a disease or disorder comprising the step of administering to a subject in need thereof a therapeutically-effective amount of STIM2 , its derivatives, and/or its antibodies.

25. A method according to claim 24, wherein the disease or disorder is either a neurological or muscular degenerative condition or a cancer.

26. A method according to claim 25, wherein the cancer is selected from the group consisting of embryonal tumours, rhabdomyosarcoma, brain tumours such as glioma and astrocytoma, lung cancer, breast cancer and head and neck squamous carcinoma.

27. A method according to claim 24, wherein STIM2 , its derivatives, and/or its antibodies are formulated for administration by combining these with a pharmaceutically- acceptable carrier.

28. A method of screening for anti-cancer agents that have the ability to modulate interaction of STIM2 with the Notch signalling pathway comprising the steps of: a) . exposing a candidate anti-cancer agent to STIM2 in the presence of Notch receptor-ligand; b) . detecting the interaction of STIM2 with the Notch receptor-ligand; and c) . determining the effects of step b) on Notch activation.