WO2002029097A2 - Procedes - Google Patents

Procedes Download PDF

Info

Publication number
WO2002029097A2
WO2002029097A2 PCT/GB2001/004332 GB0104332W WO0229097A2 WO 2002029097 A2 WO2002029097 A2 WO 2002029097A2 GB 0104332 W GB0104332 W GB 0104332W WO 0229097 A2 WO0229097 A2 WO 0229097A2
Authority
WO
WIPO (PCT)
Prior art keywords
polymorphism
positions
gpr10
polymoφhism
human
Prior art date
Application number
PCT/GB2001/004332
Other languages
English (en)
Other versions
WO2002029097A3 (fr
Inventor
John Charles Brennand
Carl Thomas Montague
Stephen O'rahilly
Sumit Bhattacharyya
Original Assignee
Astrazeneca Ab
Astrazeneca Uk Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Astrazeneca Ab, Astrazeneca Uk Limited filed Critical Astrazeneca Ab
Priority to AU2001292027A priority Critical patent/AU2001292027A1/en
Publication of WO2002029097A2 publication Critical patent/WO2002029097A2/fr
Publication of WO2002029097A3 publication Critical patent/WO2002029097A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Definitions

  • This invention relates to polymorphisms in the human GPR10 gene and to corresponding novel allelic peptides encoded thereby.
  • the invention also relates to methods and materials for analysing allelic variation in the GPR10 gene, and to the use of GPR10 polymorphism in the diagnosis and treatment of diseases in which modulation of GPR10 activity could be of therapeutic benefit, particularly disease states associated with the regulation of metabolism such as obesity, non-insulin dependent diabetes mellitus, insulin resistance syndrome, dyslipidemia and atherosclerosis.
  • Obesity is now a major health problem. Currently 22.5% of the US population is considered to be clinically obese, 18.5% in the UK with many other developed countries following this trend. It has been described as the most extensive non-communicable disease of the 21 st century. Currently available treatments are reviewed by M. Lean in Exp. Clin. Endocrinol. Diabetes, 1998, 106., Suppl. 2, 22-26. These include diet and, in extreme cases, surgery.
  • Leptin also appears to play an important role in relaying nutritional status to several other physiological systems.
  • the relevance of leptin to the pathogenesis of obesity in general is the subj ect of much study and underlines the complex nature of human obesity.
  • a human obesity gene map is now available and the number of genes and other markers that have been associated or linked with human obesity phenotypes now approaches 200.
  • GPCRs G-protein-coupled- receptors
  • GPR10 is a human pituitary-derived G protein coupled receptor (Marchese et al, Genomics, 1995, 29, 335-344).
  • the GPR10 gene was identified using a polymerase chain reaction (PCR) approach to identify novel members of the G-protein coupled receptor (GPCR) family from human genomic DNA.
  • PCR primers were designed against certain highly conserved regions in the transmembrane domains of ⁇ opioid and somatostatin receptors.
  • GPCR G-protein coupled receptor
  • One of the resultant cDNAs identified was GPR10. This contains an open reading frame of 1107 base pairs encoding a protein of 369 amino acids with 7 hydrophobic (transmembrane) domains.
  • a cDNA sequence encoding GPR10 has been submitted to the EMBL database under accession number L22647.
  • a cDNA sequence encoding GPR10 is set out in Table 1. All positions in the human GPR10 gene herein refer to the positions in Table 1 unless stated otherwise or apparent from the context. Note that the cDNA sequence of Table 1 is also set out as SEQ ID NO: 1 but with the first nucleotide accorded position 1 (which is the same as position -90 in Table 1). For convenience, a comparison of positions is set out below.
  • Table 1 c DNA sequence of the human GPR10 gene.
  • Positions of GPRl 0 protein sequence are defined with reference to SEQ ID NO: 21.
  • Drugs which change the level of a GPRl 0 mediated response or change the biological activity of GPRl 0 are expected to be useful in the treatment of all conditions in which the GPRl 0 plays a pathophysiological role. Such drugs are particularly useful in the treatment of 40 conditions associated with the regulation of metabolism such as obesity, non-insulin dependent diabetes mellitus, insulin resistance syndrome, dyslipidemia and atherosclerosis.
  • DNA polymorphisms are variations in DNA sequence between one individual and another. DNA polymorphisms may lead to variations in amino acid sequence and consequently to altered protein structure and functional activity. Polymorphisms may also 45 affect mRNA synthesis, maturation, transportation and stability. Polymorphisms which do not result in amino acid changes (silent polymorphisms) or which do not alter any known consensus sequences may nevertheless have a biological effect, for example by altering mRNA folding or stability. Knowledge of polymorphisms may be used to help identify patients most suited to therapy with particular pharmaceutical agents (this is often termed "pharmacogenetics"). Pharmacogenetics can also be used in pharmaceutical research to assist the drug selection process.
  • Polymorphisms ma be used in mapping the human genome and to elucidate the genetic component of diseases.
  • the reader is directed to the following references for background details on pharmacogenetics and other uses of polymorphism detection: Linder et al (1997), Clinical Chemistry, 43, 254; Marshall (1997), Nature Biotechnology, 15, 1249; International Patent Application WO 97/40462, Spectra Biomedical; and Schafer et al. (1998), Nature Biotechnology, 16, 33.
  • Clinical trials have shown that patient response to treatment with pharmaceuticals is often heterogeneous. Thus there is a need for improved approaches to pharmaceutical agent design and therapy.
  • the present invention is based on the discovery of eight polymorphisms in the human GPR10 gene and corresponding protein sequence variations. According to one aspect of the present invention there is provided a method for the diagnosis of a polymorphism in GPR10 in a human in which the method comprises determining the sequence of the human at one or more of: positions -62, -37, 285, 648, 747, 847, 914, and 1036 as defined by the positions in Table 1; positions 282 and 304 as defined by the position in SEQ ID NO: 21 ; and dete ⁇ ining the status of the human by reference to polymorphism in GPR10.
  • a method for the diagnosis of a polymorphism in an GPR10 gene in a human comprises deterxmning the sequence of the nucleic acid of the human at one or more of positions -62, -37, 285, 648, 747, 847, 914, and 1036 in the GPR10 gene as defined by the positions in Table 1; and determining the status of the human by reference to polymorphism in the GPR10 gene.
  • the term human includes both a human having or suspected of having an GPR10 mediated disease and an asymptomatic human who may be tested for predisposition or susceptibility to such disease. At each position the human may be homozygous for an allele or the human may be a heterozygote.
  • the term "status” refers to the genetic status of the human as detected by potential sequence variation at defined positions of a polynucleotide or corresponding protein.
  • diagnosis of a polymorphism refers to determination of the genetic status of an individual at a polymorphic position (in which the indiviual may be homozygous or heterozygous at each position).
  • the term 'GPRIO mediated disease' means any disease in which changing the level of a GPRIO mediated response or changing the biological activity of GPRIO would be of therapeutic benefit.
  • the term 'GPRIO drug' means any drug which changes the level of a GPRIO mediated response or changes the biological activity of GPRIO.
  • the drug may be an agonist or an antagonist of a natural ligand for GPRIO.
  • polymorphism includes single nucleotide substitution, nucleotide insertion and nucleotide deletion, which in the case of insertion and deletion includes insertion or deletion of one or more nucleotides at a position of a gene and variable numbers of a repeated DNA sequence.
  • polymorphism is further defined as: polymorphism at position -62 is presence of G and/or A; polymorphism at position -37 is presence of G and or C; polymorphism at position 285 is presence of G and/or A; polymorphism at position 648 is presence of C and/or A; polymorphism at position 747 is presence of A and/or C; polymorphism at position 847 is presence of G and/or A; polymorphism at position 914 is presence of C and/or T; polymorphism at position 1036 is presence of C and/or T; polymorphism at position 282 is presence of Val and/or He; and polymorphism at position 304 is presence of Pro and/or Leu.
  • polymorphism at position -62 is presence of G and/or A
  • polymorphism at position 914 is presence of C and/or T
  • polymorphism at position 304 is presence of Pro and/or Leu.
  • the polymorphism at position -62 is used to investigate blood pressure or a disease related thereto. More preferably the polymorphism at position 914 and/ or the polymorphism at position 304 is used to investigate blood pressure or a disease related thereto.
  • the polymorphism at position 914 and/ or the polymorphism at position 304 is used to investigate plasma leptin level or a disease related thereto.
  • the method for diagnosis described herein is one in which the single nucleotide polymorphism at position -62 in the GPRIO gene as defined by the positions in Table 1 is presence of G and/or A.
  • the method for diagnosis described herein is one in which the polymorphism at position -37 in the GPRIO gene as defined by the positions in Table 1 is presence of G andor C.
  • the method for diagnosis described herein is one in which the polymorphism at position 285 in the GPRIO gene as defined by the positions in Table 1 is presence of G and/or A.
  • the method for diagnosis described herein is one in which the polymorphism at position 648 in the GPRIO gene as defined by the positions in Table 1 is presence of C and/or A.
  • the method for diagnosis described herein is one in which the polymorphism at position 747 in the GPRIO gene as defined by the positions in Table 1 is presence of A and or C.
  • the method for diagnosis described herein is one in which the polymoiphism at position 847 in the GPR10 gene as defined by the positions in Table 1 is presence of G and/or A.
  • the method for diagnosis described herein is one in which the polymorphism at position 914 in the GPR10 gene as defined by the positions in Table 1 is presence of C and/or T.
  • the method for diagnosis described herein is one in which the polymorphism at position 1036 in the GPR10 gene as defined by the positions in Table 1 is presence of C andor T.
  • a method for the diagnosis of GPRl 0- mediated disease comprises: i) obtaining sample nucleic acid from an individual, ii) detecting the presence or absence of a variant nucleotide at one or more of positions -62, - 37, 285, 648, 747, 847, 914, and 1036 in the GPRIO gene as defined by the positions in Table 1 ; and iii) determining the status of the individual by reference to polymorphism in the GPRIO gene.
  • Allelic variation at each position in the GPRl 0 gene, including preferred variation is described herein.
  • the status of the individual may be determined by reference to allelic variation at any one, two, three, four, five, six, seven, or all eight positions optionally in combination with any other polymorphism in the gene that is (or becomes) known.
  • the test sample of nucleic acid is conveniently present in a sample of blood, sputum, skin, or other body fluid or tissue obtained from an individual. It will be appreciated that the test sample may equally comprise a nucleic acid sequence corresponding to the sequence in the test sample, that is to say that all or a part of the region in the sample nucleic acid may firstly be amplified using any convenient technique e.g. PCR, before analysis of allelic variation.
  • allelic variation requires a mutation discrimination technique, optionally an amplification reaction and optionally a signal generation system.
  • Table 2 lists a number of mutation detection techniques, some based on PCR. These may be used in combination with a number of signal generation systems, a selection of which is listed in Table 3. Further amplification techniques are listed in Table 4. Many current methods for the detection of allelic variation are reviewed by Nollau et al., Clin.
  • Hybridisation Based Solid phase hybridisation: Dot blots, MASDA, Reverse dot blots,
  • Oligonucleotide arrays (DNA Chips). Solution phase hybridisation: TaqmanTM - US-5210015 & US-5487972 (Hoffmann-La
  • Fluorescence Fluorescence: FRET, Fluorescence quenching, Fluorescence polarisation - United Kingdom
  • Patent No.2228998 (Zeneca Limited)
  • Peptide sequencing Preferred mutation detection techniques include ARMSTM, ALEXTM, COPS, Taqman, Molecular Beacons, RFLP, restriction site based PCR and FRET techniques, polyacrylamide gel electrophoresis and capillary electrophoresis.
  • Immunoassay techniques are known in the art e.g. A Practical Guide to ELISA by D M Kemeny, Pergamon Press 1991 ; Principles and Practice of Immunoassay, 2 nd edition, C P Price & D J Newman, 1997, published by Stockton Press in USA & Canada and by Macmillan Reference in the United Kingdom.
  • Histological techniques are described in Theory and Practice of Histological Techniques by J D Bancroft & A Stevens, 4 th Edition, Churchill Livingstone, 1996. Protein sequencing is described in Laboratory Techniques in Biochemistry and Molecular Biology, Nolume 9, Sequencing of Proteins and Peptides, G Allen, 2 nd revised edition, Elsevier, 1989. Particularly preferred methods include ARMSTM and RFLP based methods. ARMSTM is an especially preferred method.
  • the diagnostic methods of the invention are used to assess the efficacy of therapeutic compounds in the treatment of GPRlO-mediated diseases particularly disease states associated with the regulation of metabolism such as obesity, non-insulin dependent diabetes mellitus, insulin resistance syndrome, dyslipidemia and atherosclerosis.
  • Assays for example reporter-based assays, may be devised to detect whether one or more of the above polymorphisms affect transcription levels and/or message stability.
  • Polymorphisms of the present invention result in variations in amino acid sequence in the translated protein.
  • Polymorphism at position 847 as defined in Table 1 results in an amino acid change from valine to isoleucine at corresponding position 282 of the translated protein (Nal282He).
  • Polymorphism at position 914 as defined in Table 1 results in an amino acid change from proline to leucine at corresponding position 304 of the translated protein (Pro304Leu).
  • allelic variants of the GPRIO gene may exhibit differences in their ability to regulate protein biosynthesis under different physiological conditions and may display altered abilities to react to different diseases.
  • differences in protein regulation and/or the protein's properties arising as a result of allelic variation may have a direct effect on the response of an individual to drug therapy.
  • the diagnostic methods of the invention may be useful both to predict the clinical response to such agents and to determine therapeutic dose.
  • the diagnostic methods of the invention are used to assess the predisposition of an individual to diseases mediated by GPRIO.
  • GPRIO diseases mediated by GPRIO
  • This may be particularly relevant in the regulation of metabolism and in diseases which are mediated by GPRIO such as obesity, non-insulin dependent diabetes mellitus, insulin resistance syndrome, dyslipidemia and atherosclerosis.
  • the present invention may be used to recognise individuals who are particularly at risk from developing these conditions.
  • polymorphism at position 914 in the GPRIO gene as defined by the positions in Table 1, to detect the presence of or possible future development of lower than normal systolic and/or diastolic blood pressure; and/or leptin levels.
  • Low frequency polymorphisms may be particularly useful for haplotyping as described below.
  • a haplotype is a set of alleles found at linked polymorphic sites (such as within a gene) on a single (paternal or maternal) chromosome.
  • n haplotypes there may be as many as 2 n haplotypes, where 2 is the number of alleles at each polymorphic position and n is the number of polymorphic positions.
  • One approach to identifying mutations or polymorphisms which are correlated with clinical response is to carry out an association study using all the haplotypes that can be identified in the population of interest.
  • the frequency of each haplotype is limited by the frequency of its rarest allele, so that polymorphisms with low frequency alleles are particularly useful as markers of low frequency haplotypes.
  • low frequency polymorphisms may be particularly useful in identifying these mutations (for examples see: De Stefano N et al., Ann Hum Genet (1998) 62:481-90; and Keightley AM et al., Blood (1999) 93:4277-83.
  • the diagnostic methods of the invention are used in the development of new drug therapies which selectively target one or more allelic variants of the GPR10 gene. Identification of a link between a particular allelic variant and predisposition to disease development or response to drug therapy may have a significant impact on the design of new drugs. Drugs may be designed to regulate the biological activity of variants implicated in the disease process whilst minimising effects on other variants. In a further diagnostic aspect of the invention the presence or absence of variant nucleotides is detected by reference to the loss or gain of, optionally engineered, sites recognised by restriction enzymes.
  • nucleic acid comprising at least 20 bases of GPRIO and comprising an allelic variant selected from any one of the following: the nucleic acid of Table 1 with A at position -62; the nucleic acid of Table 1 with C at position -37; the nucleic acid of Table 1 with A at position 285; the nucleic acid of Table 1 with A at position 648; the nucleic acid of Table 1 with C at position 747; the nucleic acid of Table 1 with A at position 847; the nucleic acid of Table 1 with T at position 914; and the nucleic acid of Table 1 with T at position 1036.
  • nucleic acid comprising any one of the following polymorphisms: the nucleic acid of Table 1 with A at position -62 as defined by the positions in Table 1; the nucleic acid of Table 1 with C at position -37 as defined by the positions in Table 1 ; the nucleic acid of Table 1 with A at position 285 as defined by the positions in Table 1 ; the nucleic acid of Table 1 with A at position 648 as defined by the positions in Table 1; the nucleic acid of Table 1 with C at position 747 as defined by the positions in Table 1 ; the nucleic acid of Table 1 with A at position 847 as defined by the positions in Table 1 ; the nucleic acid of Table 1 with T at position 914 as defined by the positions in Table 1; the nucleic acid of Table 1 with T at position 1036 as defined by the positions in Table 1 ; or a complementary strand thereof or an antisense sequence thereto or a fragment thereof of at least 20 bases comprising at least one polymorphism
  • Fragments are at least 17 bases, more preferably at least 20 bases, more preferably at least 30 bases.
  • a nucleic acid of the invention is preferably in isolated form, for example through being at least partially purified from any substance with which it occurs naturally.
  • Novel sequence disclosed herein may be used in another embodiment of the invention to regulate expression of the gene in cells by the use of antisense constructs.
  • an example antisense expression construct can be readily constructed for instance using the pREPIO vector (Invitrogen Corporation).
  • Transcripts are expected to inhibit translation of the gene in cells transfected with this type of construct.
  • Antisense transcripts are effective for inhibiting translation of the native gene transcript, and capable of inducing the effects (e.g., regulation of tissue physiology) herein described.
  • Oligonucleotides which are complementary to and hybridisable with any portion of novel gene mRNA disclosed -herein are contemplated for therapeutic use.
  • Identification may be accomplished by recovering the vector or by polymerase chain reaction (PCR) amplification and sequencing the region containing the inserted nucleic acid material.
  • Antisense molecules can be synthes ⁇ sed for antisense therapy. These antisense molecules may be DNA, stable derivatives of DNA such as phosphorothioates or methylphosphonates, RNA, stable derivatives of RNA such as 2-O-alkyl-RNA, or other oligonucleotide mimetics.
  • U.S. Patent No. 5,652,355 "Hybrid Oligonucleotide Phosphorothioates", issued July 29, 1997, and U.S. Patent No.
  • Antisense molecules may be introduced into cells by microinjection, liposome encapsulation or by expression from vectors harboring the antisense sequence.
  • the invention further provides nucleotide primers which can detect the polymorphisms of the invention.
  • an allele specific primer capable of detecting a GPRIO gene polymorphism at one or more of positions -62, -37, 285, 648, 747, 847, 914, and 1036 in the GPRIO gene as defined by the positions in Table 1.
  • An allele specific primer is used, generally together with a constant primer, in an amplification reaction such as a PCR reaction, which provides the discrimination between alleles through selective amplification of one allele at a particular sequence position e.g. as used for ARMSTM assays.
  • the allele specific primer is preferably 17- 50 nucleotides, more preferably about 17-35 nucleotides, more preferably about 17-30 nucleotides.
  • An allele specific primer preferably corresponds exactly with the allele to be detected but derivatives thereof are also contemplated wherein about 6-8 of the nucleotides at the 3' terminus correspond with the allele to be detected and wherein up to 10, such as up to 8, 6, 4, 2, or 1 of the remaining nucleotides may be varied without significantly affecting the properties of the primer.
  • Primers may be manufactured using any convenient method of synthesis. Examples of such methods may be found in standard textbooks, for example "Protocols for
  • primer(s) may be labelled to facilitate detection.
  • an allele-specific oligonucleotide probe capable of detecting a GPRl 0 gene polymorphism at one or more of positions -62, -37, 285, 648, 747, 847, 914, and 1036 in the GPR10 gene as defined by the positions in Table 1.
  • probes will be apparent to the molecular biologist of ordinary skill.
  • Such probes are of any convenient length such as up to 50 bases, up to 40 bases, more conveniently up to 30 bases in length, such as for example 8-25 or 8-15 bases in length.
  • such probes will comprise base sequences entirely complementary to the corresponding wild type or variant locus in the gene.
  • one or more mismatches may be introduced, provided that the discriminatory power of the oligonucleotide probe is not unduly affected.
  • the probes of the invention may carry one or more labels to facilitate detection.
  • a diagnostic kit comprising an allele specific oligonucleotide probe of the invention and/or an allele-specific primer of the invention.
  • kits may comprise appropriate packaging and instructions for use in the methods of the invention.
  • kits may fiirther comprise appropriate buffer(s), nucleotides, and polymerase(s) such as thermostable polymerases, for example taq polymerase.
  • a polymorphism of this invention may be used as a genetic marker in a linkage study. This particularly applies to the polymorphisms at positions -62, 285 and 914 in the GPRIO gene as defined by the positions in Table 1 because of their relatively high frequency (See Example 1).
  • a method of treating a human in need of treatment with an GPRIO drug comprises: i) diagnosis of a polymorphism in the GPRl 0 gene in the human, which diagnosis comprises determining the sequence of the nucleic acid at one or more of positions -62, -37, 285, 648, 747, 847, 914, and 1036 in the GPRIO gene as defined by the positions in Table 1, and detemnning the status of the human by reference to polymorphism in the GPRIO gene; and ii) administering an effective amount of a GPRl 0 drug.
  • Preferably determination of the status of the human is clinically useful. Examples of clinical usefulness include deciding which drug or drugs to administer and or establishing the effective amount of the drug or drugs.
  • Drugs which change the activity of GPRl 0 may be of value in a number of disease conditions, including disease states associated with the regulation of metabolism such as obesity, non-insulin dependent diabetes mellitus, insulin resistance syndrome, dyslipidemia and atherosclerosis.
  • a GPRl 0 drug in the preparation of a medicament for treating a GPRlO-mediated disease in a human diagnosed as having a polymorphism at one or more of positions -62, -37, 285, 648, 747, 847, 914, and 1036 in the GPR10 gene as defined by the positions in Table 1.
  • the invention also provides a method of treating a human in need of treatment with an GPRl 0 drug in which the method comprises: i) dete-rmining the sequence of the human at one or more of: positions -62, -37, 285, 648, 747, 847, 914, and 1036 as defined by the positions in Table 1; or of positions 282 and 304 as defined by the position in SEQ ID NO: 21; and determining the status of the human by reference to polymorphism in the GPR10 gene; and ii) administering an effective amount of a GPRl 0 drug.
  • Another aspect of the invention provides the use of a GPRl 0 drug in the preparation of a medicament for treating a GPRl 0- mediated disease in a human diagnosed as having a polymorphism at one or more of positions -62, -37, 285, 648, 747, 847, 914, and 1036 in GPRIO as defined by the positions in Table 1; or of positions 282 and 304 as defined by the position in SEQ ID NO: 21.
  • a pharmaceutical pack comprising a GPRIO drug and instructions for administration of the drug to humans diagnostically tested for a polymorphism at one or more of positions -62, -37, 285, 648, 747, 847, 914, and 1036 in the GPR10 gene as defined by the positions in Table 1.
  • a computer readable medium comprising at least one novel polynucleotide sequence of the invention stored on the medium.
  • the computer readable medium may be used, for example, in homology searching, mapping, haplotyping, genotyping or pharmacogenetic analysis or any other bioinformatic analysis.
  • the reader is referred to Bioinformatics, A practical guide to the analysis of genes and proteins, Edited by A D Baxevanis & B F F Ouellette, John Wiley & Sons, 1998.
  • Any computer readable medium may be used, for example, compact disk, tape, floppy disk, hard drive or computer chips.
  • polynucleotide sequences of the invention or parts thereof, particularly those relating to and identifying the polymorphisms identified herein represent a valuable information source, for example, to characterise individuals in terms of haplotype and other sub-groupings, such as investigation of susceptibility to treatment with particular drugs. These approaches are most easily facilitated by storing the sequence information in a computer readable medium and then using the information in standard bioinformatics programs or to search sequence databases using state of the art searching tools such as "GCC". Thus, the polynucleotide sequences of the invention are particularly useful as components in databases useful for sequence identity and other search analyses.
  • sequence information in a computer readable medium and use in sequence databases in relation to 'polynucleotide or polynucleotide sequence of the invention' covers any detectable chemical or physical characteristic of a polynucleotide of the invention that may be reduced to, converted into or stored in a tangible medium, such as a computer disk, preferably in a computer readable form.
  • a tangible medium such as a computer disk
  • chromatographic scan data or peak data photographic scan or peak data
  • mass spectrographic data sequence gel (or other) data.
  • the invention provides a computer readable medium having stored thereon one or more polynucleotide sequences of the invention.
  • a computer readable medium comprising and having stored thereon a member selected from the group consisting of: a polynucleotide comprising the sequence of a polynucleotide of the invention, a polynucleotide consisting of a polynucleotide of the invention, a polynucleotide which comprises part of a polynucleotide of the invention, which part includes at least one of the polymorphisms of the invention, a set of polynucleotide sequences wherein the set includes at least one polynucleotide sequence of the invention, a data set comprising or consisting of a polynucleotide sequence of the invention or apart thereof comprising at least one of the polymorphisms identified herein.
  • a computer based method for performing sequence identification, said method comprising the steps of providing a polynucleotide sequence comprising a polymorphism of the invention in a computer readable medium; and comparing said polymorphism containing polynucleotide sequence to at least one other polynucleotide or polypeptide sequence to identify identity (homology), i.e. screen for the presence of a polymorphism.
  • Polymorphisms of the present invention result in variations in amino acid sequence in the translated protein.
  • Polymorphism at position 847 as defined in Table 1 results in an amino acid change from valine to isoleucine at corresponding position 282 of the translated protein (Val282Ile).
  • Polymorphism at position 914 as defined in Table 1 results in an amino acid change from proline to leucine at corresponding position 304 of the translated protein (Pro304Leu).
  • an allelic variant of the human GPR10 polypeptide having an isoleucine at position 282 and/or a leucine at position 304 or a fragment thereof comprising at least 10 amino acids provided that ttie fragment comprises the allelic variant at position 282 and/or position 304.
  • Fragments of GPR10 polypeptide are at least 10 amino acids, more preferably at least 15 amino acids, more preferably at least 20 amino acids.
  • the polypeptides of the invention do not encompass naturally occuring polypeptides as they occur in nature, for example, the polypeptide is at least partially purified from at least one component with which it occurs naturally.
  • the polypeptide is at least 30% pure, more preferably at least 60% pure, more preferably at least 90% pure, more preferably at least 95% pure, and more preferably at least 99% pure.
  • the invention also provides an antibody specific for an allelic variant of human
  • Antibodies can be prepared using any suitable method. For example, purified polypeptide may be utilised to prepare specific antibodies.
  • the term "antibodies” includes polyclonal antibodies, monoclonal antibodies, and the various types of antibody constructs such as for example F(ab') 2 , Fab and single chain Fv. Antibodies are defined to be specifically binding if they bind the antigen with a K ⁇ of greater than or equal to about 10 7
  • M "1 . Affinity of binding can be determined using conventional techniques, for example those described by Scatchard et al, Ann. N.Y. Ac ⁇ d. Sci., 51:660 (1949).
  • Polyclonal antibodies can be readily generated from a variety of sources, for example, horses, cows, goats, sheep, dogs, chickens, rabbits, mice or rats, using procedures that are well-known in the art.
  • antigen Is administered to the host animal typically through parenteral injection.
  • the immunogenicity of antigen may be enhanced through the use of an adjuvant, for example, Freund's complete or incomplete adjuvant.
  • an adjuvant for example, Freund's complete or incomplete adjuvant.
  • small samples of serum are collected and tested for reactivity to antigen. Examples of various assays useful for such determination include those described in:
  • Antibodies A Laboratory Manual, Harlow and Lane (eds.), Cold Spring Harbor Laboratory Press, 1988; as well as procedures such as countercurrent immuno-electrophoresis (CIEP), radioimmunoassay, radioimmunoprecipitation, enzyme-linked immuno-sorbent assays (ELISA), dot blot assays, and sandwich assays, see U.S. Patent Nos. 4,376,110 and 4,486,530.
  • Monoclonal antibodies may be readily prepared using well-known procedures, see for example, the procedures described in U.S. Patent Nos.
  • the monoclonal antibodies of the invention can be produced using alternative techniques, such as those described by Alting-Mees et al., "Monoclonal Antibody Expression Libraries: A Rapid Alternative to Hybridomas", Strategies in Molecular Biology 3: 1-9 (1990) which is incorporated herein by reference.
  • binding partners can be constructed using recombinant DNA techniques to incorporate the variable regions of a gene that encodes a specific binding antibody. Such a technique is described in Larrick et al., Biotechnology, 7: 394 (1989).
  • the antibodies may be used to detect the presence of antigen in a sample using established assay protocols.
  • the CTC polymorphism which encodes a Leucine at codon 304 of the GPR10 sequence was present in 3.8% of the alleles. This was a significantly lower level of occurrence than measured in the obese individual cohort.
  • Normal blood pressure is a systolic blood pressure of less than 140 mmHg and a diastolic blood pressure of less than 90 mmHg.
  • Hypertension is currently defined as an average systolic blood pressure greater than or equal to 140 mmHg and/or diastolie blood pressure greater than or equal to 90 mmHg based on multiple blood pressure recordings.
  • the codon 304 CTC polymorphism was also associated with lower circulating leptin levels in these individuals. Therefore, the presence of this polymorphism may be used to diagnose the presence of or future development of lower than normal plasma leptin levels.
  • SBP systolic blood pressure
  • DBP diastolic blood pressure
  • SBP systolic blood pressure
  • polymorphisms were identified by sequencing of the DNA from 96 individuals using an ABI 377 sequencer according to the manufacturers instructions. (Perkin Elmer, Cheshire, UK). Alternative procedures for sequencing DNA are well known in the art and are thoroughly described in Maniatis et al., ibid.
  • the primers used for sequencing were:
  • GPR10-1L (SEQ IDNO.2) ggtgataggacaacactttttgc GPR10-1R (SEQ ID NO.3) ccctaggaggccagttgaa GPR10-2L (SEQ ID NO.4) gaggcggaagcgtttaaata GPR10-2R (SEQ ID NO.5) ccctaggaggccagttgaag GPR10-3L (SEQ ID NO.6) gccccagggtttctgactta GPR10-3R (SEQ ID NO.7) aagttcgtcacgttgtgcag GPR10-4L (SEQ ID NO.8) gctgatcgtgctgctctac GPR10-4R (SEQ ID NO.9) gcgtgaacaccgacacatag GPR10-5L (SEQ ⁇ DNO.10) cctgtgccacctgg
  • Genotyping of -62 and 914 was carried out by PCR amplification and restriction digestion of the amplified products using standard molecular biological protocols. Restriction sites were introduced into the DNA by designing PCR primer pairs with one or two deliberately introduced mismatches.
  • PCR and restriction enzyme digestion were conducted in lO ⁇ l volumes and performed using standard protocols.
  • Digested samples were run on a 3%(w/v) agarose gel for 2 hours, which allowed the digested PCR product to be distinguished from undigested PCR product, and scored blind on 2 occasions.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne des polymorphismes dans le gène GPR10 humain et de nouveaux peptides alléliques correspondants codés ainsi. L'invention concerne également des procédés et des matériaux permettant d'analyser la variation allélique dans le gène GPR10 humain et l'utilisation du polymorphisme GPR10 dans le diagnostic et le traitement de maladies dans lesquelles la modulation de l'activité GPR10 pourrait présenter un avantage thérapeutique, en particulier dans les états maladifs associés à la régulation du métabolisme comme l'obésité, les diabètes non insulino-dépendants, le syndrome de résistance à l'insuline, la dislipidémie et l'athérosclérose.
PCT/GB2001/004332 2000-10-06 2001-09-28 Procedes WO2002029097A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2001292027A AU2001292027A1 (en) 2000-10-06 2001-09-28 Methods relating to polymorphisms in the human gpr10 gene

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GBGB0024510.0A GB0024510D0 (en) 2000-10-06 2000-10-06 Methods
GB0024510.0 2000-10-06

Publications (2)

Publication Number Publication Date
WO2002029097A2 true WO2002029097A2 (fr) 2002-04-11
WO2002029097A3 WO2002029097A3 (fr) 2003-08-28

Family

ID=9900796

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2001/004332 WO2002029097A2 (fr) 2000-10-06 2001-09-28 Procedes

Country Status (3)

Country Link
AU (1) AU2001292027A1 (fr)
GB (1) GB0024510D0 (fr)
WO (1) WO2002029097A2 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003080099A2 (fr) * 2002-03-26 2003-10-02 Bayer Healthcare Ag Diagnostics et traitements de maladies associees au recepteur 10 couple aux proteines g (gpr10)
WO2004048610A1 (fr) * 2002-11-28 2004-06-10 Universidad De Barcelona Methodes diagnostiques et therapeutiques pour le diabete et l'obesite

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000017641A1 (fr) * 1998-09-22 2000-03-30 Millennium Pharmaceuticals, Inc. Utilisation de la gpr10 comme cible pour l'identification de composes influant sur le poids
WO2001009182A1 (fr) * 1999-08-03 2001-02-08 Oy Juvantia Pharma Ltd. Peptide de liberation de la prolactine et methode destinee a la regulation de fonctions autonomes et au traitement de la douleur

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000017641A1 (fr) * 1998-09-22 2000-03-30 Millennium Pharmaceuticals, Inc. Utilisation de la gpr10 comme cible pour l'identification de composes influant sur le poids
WO2001009182A1 (fr) * 1999-08-03 2001-02-08 Oy Juvantia Pharma Ltd. Peptide de liberation de la prolactine et methode destinee a la regulation de fonctions autonomes et au traitement de la douleur

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK [Online] Human GPR10, 23 December 2002 (2002-12-23) retrieved from WWW.NCBI.NLM.NIH.GOV/ Database accession no. NM_004248, NM_005287 XP002233363 *
DATABASE GENBANK [Online] Human PrRP hormone receptor, 7 May 1999 (1999-05-07) retrieved from WWW.NCBI.NLM.NIH.GOV/ Database accession no. NM_004248 XP002233362 & HINUMA ET AL: "A prolactin-releasing peptide in the brain" NATURE, MACMILLAN JOURNALS LTD, vol. 393, 21 May 1998 (1998-05-21), pages 272-272-275, XP002077456 London, GB *
MARCHESE A ET AL: "CLONING AND CHROMOSOMAL MAPPING OF THREE NOVEL GENES, GPR9 GPR10, AND GPR14, ENCODING RECEPTORS RELATED TO INTERLEUKIN 8, NEUROPEPTIDE Y, AND SOMATOSTATIN RECEPTORS" GENOMICS, ACADEMIC PRESS, SAN DIEGO, US, vol. 29, no. 2, 20 September 1995 (1995-09-20), pages 335-344, XP000673922 ISSN: 0888-7543 *
SCHAFER A J ET AL: "DNA VARIATION AND THE FUTURE OF HUMAN GENETICS" NATURE BIOTECHNOLOGY, NATURE PUBLISHING, US, vol. 16, January 1998 (1998-01), pages 33-39, XP000890128 ISSN: 1087-0156 *
STADEL J M ET AL: "Orphan G protein-coupled receptors: a neglected opportunity for pioneer drug discovery" TRENDS IN PHARMACOLOGICAL SCIENCES, ELSEVIER TRENDS JOURNAL, CAMBRIDGE, GB, vol. 18, no. 11, 1 November 1997 (1997-11-01), pages 430-437, XP004099345 ISSN: 0165-6147 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003080099A2 (fr) * 2002-03-26 2003-10-02 Bayer Healthcare Ag Diagnostics et traitements de maladies associees au recepteur 10 couple aux proteines g (gpr10)
WO2003080099A3 (fr) * 2002-03-26 2004-02-19 Bayer Healthcare Ag Diagnostics et traitements de maladies associees au recepteur 10 couple aux proteines g (gpr10)
WO2004048610A1 (fr) * 2002-11-28 2004-06-10 Universidad De Barcelona Methodes diagnostiques et therapeutiques pour le diabete et l'obesite

Also Published As

Publication number Publication date
GB0024510D0 (en) 2000-11-22
AU2001292027A1 (en) 2002-04-15
WO2002029097A3 (fr) 2003-08-28

Similar Documents

Publication Publication Date Title
US20030211486A1 (en) Compositions and methods for detecting polymorphisms associated with pigmentation
NO20100798L (no) Polymorfismer i det humane MDR-1-genet og deres diagnostiske og terapeutiske anvendelse
US20020090622A1 (en) Chemical compounds
US20020192647A1 (en) Diagnostic method
US20050059067A1 (en) Chemical compounds
EP1194595A1 (fr) Polymorphismes du gene de hmg-coa reductase humaine
WO2002029097A2 (fr) Procedes
US20020137048A1 (en) Association of protein kinase C zeta polymorphisms with diabetes
EP1130122A2 (fr) Méthode de diagnostic des polymorphismes du gène humain EP1-R
WO2003104381A2 (fr) Procedes
WO2000017394A1 (fr) Polymorphismes du gene humain de la sous-unite alpha 4 de l'integrine, appropries au diagnostic et au traitement des maladies mediees par un ligand d'integrine
EP1199372A2 (fr) Polymorphismes du gène humain P2X7
AU743778B2 (en) Disease association by locus stratification
EP1100962A1 (fr) Polymorphismes genetiques du gene du recepteur neurokininique 1 de l'homme et leurs utilisations pour le diagnostic et le traitement d'affections
US20070243528A1 (en) Methods for detecting polymorphisms using arms or rflp
US20070122803A1 (en) Methods for the detection of polymorphisms in the human oatpf gene
WO2000039331A1 (fr) Polymorphisme nucleotidique unique dans un pyruvate deshydrogenase kinase isoenzyme 2 (pdk2) chez l'homme
US20030223986A1 (en) Methods
US20030198969A1 (en) Haplotypes of the TACR2 gene
JP2008502341A (ja) 電位型カリウムチャネルをコードするヒト肥満感受性遺伝子およびその使用
US20050118579A1 (en) Chemical compounds
EP1264841A1 (fr) ADN codant une mutante du coactivateur PGC-1 du recepteur gamma active de la prolifération des peroxysomes (PPAR-gamma), méthodes de détéction et trousse d'essay correspondants
EP1741722A2 (fr) Polymorphismes du gène humain P2X7
Gonzalez Single nucleotide polymorphisms and haplotype analyses of complex medical disorders

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PH PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase in:

Ref country code: JP