WO2002028900A9 - Tach: new tnf-receptor family nucleic acids and polypeptides - Google Patents

Abstract

Disclosed are nucleic acids encoding TACH polypeptides, as well as antibodies to TACH polypeptides and pharmaceutical compositions including same. TACH polypeptides share sequence identity to TNF receptor family polypeptides, which have been associated with cancer, inflammatory or immunoregulatory conditions.

Description

TACH: NEW TNF-RECEPTOR FAMILY NUCLEIC ACIDS AND

POLYPEPTIDES

FIELD OF THE INVENTION The present invention provides a novel Tumor Necrosis Factor ("TNF") receptor family member named TACH. The invention generally relates to nucleic acids and polypeptides. The invention relates more particularly to nucleic acids encoding polypeptides related to TACH polypeptides, which are associated with anti-cancer or immunoregulatory applications.

BACKGROUND OF THE INVENTION Members of the tumor-necrosis factor (TNF) family of cytokines are involved in an ever expanding array of critical biological functions. Each member of the TNF family acts by binding to one or more members of a parallel family of receptor proteins. These receptors in turn signal intracellularly to induce a wide range of physiological or developmental responses. Many of the receptor signals influence cell fate, and often trigger terminal differentiation. Examples of cellular differentiation include proliferation, maturation, migration, and death.

TNF family members are Type II membrane bound proteins, having a short intracellular N-terminal domain, a transmembrane domain, and the C-terminal receptor binding domains lying outside the cell surface. In some cases the extracellular portion of the protein is cleaved off, creating a secreted form of the cytokine. While the membrane bound proteins act locally, presumably through cell contact mediated interaction with their receptors, the secreted forms have the potential to circulate or diffuse, and therefore can act at distant sites. Both membrane bound and secreted forms exist as trimers, and are thought to transduce their signal to receptors by facilitating receptor clustering.

The TNF receptor protein family is characterized by having one or more cysteine rich extracellular domains. Each cysteine rich region creates a disulfide- bonded core domain, which contributes to the three dimensional structure that forms the ligand binding pocket. The receptors are Type I membrane bound proteins, in which the extracellular domain is encoded by the N-terminus, followed by a transmembrane domain and a C-terminal intracellular domain. The intracellular domain is responsible for receptor signaling. Some receptors contain an intracellular "death domain", which can signal cell apoptosis, and these can be strong inducers of cell death. Another class of receptors can weakly induce cell death; these appear to lack a death domain. A third class of receptors do not induce cell death. All classes of receptors can signal cell proliferation or differentiation instead of death, depending on cell type or the occurrence of other signals.

A well studied example of the pluripotent nature of TNF family activity is the nominant member, TNF. TNF can exist as a membrane bound cytokine or can be cleaved and secreted. Both forms bind to the two TNF receptors, TNF-R55 and TNF- R75. Originally described on the basis on its' ability to directly kill tumor cells, TNF also controls a wide array of immune processes, including inducing acute inflammatory reactions, as well as maintaining lymphoid tissue homeostasis. Because of the dual role this cytokine can play in various pathological settings, both agonist and antagonist reagents have been developed as modifiers of disease. For example TNF and LTD (which also signals through the TNF receptors) have been used in treatment for cancers, especially those residing in peripheral sites, such as limb sarcomas. In this setting direct signaling by the cytokine through the receptor induces tumor cell death (Aggarwal and Natarajan, 1996. Eur Cytokine Netw 7:93-124).

In immunological settings, agents that block TNF receptor signaling (e.g., anti- TNF mAb, soluble TNF-R fusion proteins) have been used to treat diseases like rheumatoid arthritis and inflammatory bowel disease. In these pathologies TNF acts to induce cell proliferation and effector function, thereby exacerbating autoimmune disease, and in this setting blocking TNF binding to its receptor(s) has therapeutic benefit (Beutler, 1999. J Rheumatol 26 Suppl 57:16-21). A more recently discovered ligand/receptor system appears amenable to similar manipulations. Lymphotoxin beta (LTD), a TNF family member which forms heterotrimers with LTD, bind to the LTD-R. Some adenocarcinoma tumor cells which express LTD-R can be killed or differentiated when treated with an agonistic anti-LTD- R mAb (Browning et al., 1996. J Exp Med 183: 867-878). In immunological settings it has been shown that anti- LTD DmAb or soluble LTD-R-Ig fusion protein can block the development of inflammatory bowel diseases, possibly by influencing dendritic cell and T cell interaction (Mackay et al., 1998. Gastroenterology 115:1464-1475). SUMMARY OF THE INVENTION The present invention is based, in part, upon the discovery of TACH, polynucleotide sequences and the TACH polypeptides encoded by these nucleic acid sequences.

In one aspect, the invention provides an isolated nucleic acid which encodes a TACH polypeptide, or a fragment or derivative thereof. The nucleic acid can include, e.g., nucleic acid sequence encoding a polypeptide at least 50% identical, or at least 90% identical, to a polypeptide comprising the amino acid sequence of Figure 1 (SEQ ID NO:2).

The invention also provides a substantially pure nucleic acid molecule comprising a sequence that hybridizes under stringent conditions to a hybridization probe, the nucleic acid sequence of the probe consisting of the coding sequence of SEQ ID NO:l or the complement of said coding sequence.

In some embodiments, the nucleic acid sequence encodes a polypeptide having the sequence of SEQ ID NO: 2 with at least one conservative amino acid substitution. The nucleic acid can be, e.g., a genomic DNA fragment, or it can be a cDNA molecule.

Also included in the invention is a vector containing one or more of the nucleic acids described herein, and a cell containing the vectors or nucleic acids described herein. In another aspect, the invention provides a substantially pure nucleic acid molecule encoding a fusion protein comprising at least two segments, wherein one of the segments comprises a polypeptide or fragment thereof as described in the amino acid sequences set forth in the above embodiments of the invention. The invention also provides a fusion protein comprising at least two segments, wherein the first segment comprises a polypeptide or fragment thereof as described in the amino acid sequences set forth in the above embodiments of the invention and the second segment comprises an immunoglobulin polypeptide.

In other aspects, the invention provides a substantially pure binding agent that specifically binds to the polypeptide of the above-stated embodiments of the invention. The present invention is also directed to host cells transformed with a recombinant expression vector comprising any of the nucleic acid molecules described above. In another aspect, the invention includes a pharmaceutical composition that includes a TACH nucleic acid and a pharmaceutically acceptable carrier or diluent.

In a further aspect, the invention includes a substantially purified TACH polypeptide, e.g., any of the TACH polypeptides encoded by a TACH nucleic acid. The invention also includes a pharmaceutical composition that includes a

TACH polypeptide and a pharmaceutically acceptable carrier or diluent.

In a. still further aspect, the invention provides an antibody that binds specifically to a TACH polypeptide. The antibody can be, e.g., a monoclonal or polyclonal antibody. The invention also includes a pharmaceutical composition including TACH antibody and a pharmaceutically acceptable carrier or diluent. The present invention is also directed to isolated antibodies that bind to an epitope on a polypeptide encoded by any of the nucleic acid molecules described above.

The present invention is further directed to kits comprising antibodies that bind to a polypeptide encoded by any of the nucleic acid molecules described above and a negative control antibody.

The invention further provides a method for producing a TACH polypeptide. The method includes providing a cell containing a TACH nucleic acid, e.g., a vector that includes a TACH nucleic acid, and culturing the cell under conditions sufficient to express the TACH polypeptide encoded by the nucleic acid. The expressed TACH polypeptide is then recovered from the cell. Preferably, the cell produces little or no endogenous TACH polypeptide. The cell can be, e.g., a prokaryotic cell or eukaryotic cell.

The present invention provides a method of inducing an immune response in a mammal against a polypeptide encoded by any of the nucleic acid molecules disclosed above by administering to the mammal an amount of the polypeptide sufficient to induce the immune response.

The present invention is also directed to methods of identifying a compound that binds to TACH polypeptide by contacting the TACH polypeptide with a compound and determining whether the compound binds to the TACH polypeptide. The present invention is also directed to methods of identifying a compound that binds a nucleic acid molecule encoding TACH polypeptide by contacting TACH nucleic acid with a compound and determining whether the compound binds the nucleic acid molecule.

The invention further provides methods of identifying a compound that modulates the activity of a TACH polypeptide by contacting TACH polypeptide with a compound and determining whether the TACH polypeptide activity is modified. The present invention is also directed to compounds that modulate TACH polypeptide activity identified by contacting a TACH polypeptide with the compound and determining whether the compound modifies activity of the TACH polypeptide, binds to the TACH polypeptide, or binds to a nucleic acid molecule encoding a TACH polypeptide.

The present invention contemplates the use of TACH-Fc fusion proteins and monoclonal agonistic antibodies against TACH in modulating the activity of cytokines (TNF family members) that bind to TACH.

In another aspect, the invention provides a method of diagnosing a cancer, inflammatory or immunoregulatory condition in a subject. The method includes providing a protein sample from the subject and measuring the amount of TACH polypeptide in the subject sample. The amount of TACH in the subject sample is then compared to the amount of TACH polypeptide in a control protein sample. An alteration in the amount of TACH polypeptide in the subject protein sample relative to the amount of TACH polypeptide in the control protein sample indicates the subject has a cancer, inflammatory or immunoregulatory condition. A control sample is preferably taken from a matched individual, i.e., an individual of similar age, sex, or other general condition but who is not suspected of having a cancer, inflammatory or immunoregulatory condition. Alternatively, the control sample may be taken from the subject at a time when the subject is not suspected of having a cancer, inflammatory or immunoregulatory disorder. In some embodiments, the TACH polypeptide is detected using a TACH antibody.

The invention is also directed to methods of inducing an immune response in a mammal against a polypeptide encoded by any of the nucleic acid molecules described above. The method includes administering to the mammal an amount of the polypeptide sufficient to induce the immune response. In a further aspect, the invention includes a method of diagnosing a cancer, inflammatory or immunoregulatory condition in a subject. The method includes providing a nucleic acid sample, e.g., RNA or DNA, or both, from the subject and measuring the amount of the TACH nucleic acid in the subject nucleic acid sample. The amount of TACH nucleic acid sample in the subject nucleic acid is then compared to the amount of TACH nucleic acid in a control sample. An alteration in the amount of TACH nucleic acid in the sample relative to the amount of TACH in the control sample indicates the subject has a cancer, inflammatory or immunoregulatory condition. In a further aspect, the invention includes a method of diagnosing a cancer, inflammatory or immunoregulatory condition in a subject. The method includes providing a nucleic acid sample from the subject and identifying at least a portion of the nucleotide sequence of a TACH nucleic acid in the subject nucleic acid sample. The TACH nucleotide sequence of the subject sample is then compared to a TACH nucleotide sequence of a control sample. An alteration in the TACH nucleotide sequence in the sample relative to the TACH nucleotide sequence in said control sample indicates the subject has a cancer, inflammatory or immunoregulatory condition.

In a still further aspect, the invention provides method of treating or preventing or delaying a cancer, inflammatory or immunoregulatory condition. The method includes administering to a subject in which such treatment or prevention or delay is desired a TACH nucleic acid, a TACH polypeptide, or a TACH antibody in an amount sufficient to treat, prevent, or delay a cancer, inflammatory or immunoregulatory condition in the subject.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In the case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. Other features and advantages of the invention will be apparent from the following detailed description and claims.

BRIEF DESCRIPTION OF THE DRAWINGS Fig. 1 is a schematic drawing showing a murine TACH nucleic acid sequence (SEQ ID NO: 1) and a polypeptide (SEQ ID NO:2) encoded thereby.

Fig. 2 is a schematic drawing showing the coding region nucleic acid sequence of viral CrmB (SEQ ID NO: 4) and the translated amino acid sequence of viral CrmB (SEQ ID NO: 3).

Fig. 3 is a schematic drawing showing the predicted amino acid sequence (SEQ ID NO:5) of TACH, wherein the cysteine-rich domains are underlined and the transmembrane domain is boxed.

Fig. 4 is a schematic drawing showing the amino acid sequence alignment between the mouse TACH polypeptide (SEQ ID NO: 6) and the viral CrmB polypeptide (SEQ ID NO:7). Fig. 5 is a schematic drawing showing the nucleic acid sequence alignment between the murine TACH coding region nucleic acid sequence (SEQ ID NO: 8) and the viral CrmB cDNA sequence (SEQ ID NO: 9).

Fig. 6 shows the results of Northern blot and RT-PCR analysis of the tissue distribution of murine TACH. DETAILED DESCRIPTION OF THE INVENTION

The reference works, patents, patent applications, and scientific literature, including accession numbers to GenBank database sequences, that are referred to herein establish the knowledge of those with skill in the art and are hereby incorporated by reference in their entirety to the same extent as if each was specifically and individually indicated to be incorporated by reference. Any conflict between any reference cited herein and the specific teachings of this specification shall be resolved in favor of the latter. Likewise, any conflict between an art-understood definition of a word or phrase and a definition of the word or phrase as specifically taught in this specification shall be resolved in favor of the latter. Standard reference works setting forth the general principles of recombinant DNA technology known to those of skill in the art include Ausubel et al, Current Protocols in Molecular Biology, John Wiley & Sons, New York (1998); Sambrook et al, Molecular Cloning: A Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory Press, Plainview, New York (1989); Kaufman et al., Eds., Handbook of Molecular and Cellular Methods in Biology and Medicine, CRC Press, Boca Raton (1995); McPherson, Ed., Directed Mutagenesis: A Practical Approach, IRL Press, Oxford (1991).

The invention is based in part on the discovery of TACH nucleic acid sequences, which encode a protein that is homologous to members of the TNF receptor family, and in particular, to the viral protein CrmB, encoded by the cowpox virus.

Like other members of the TNF receptor family, TACH shares weak sequence similarity, including three distinct cysteine-rich motifs.

The present invention discloses TACH nucleic acids, isolated nucleic acids that encode TACH polypeptide or a portion thereof, TACH polypeptides, vectors containing these nucleic acids, host cells transformed with the TACH nucleic acids, anti-TACH antibodies, and pharmaceutical compositions. Also disclosed are methods of making TACH polypeptides, as well as methods of screening, diagnosing, treating conditions using these compounds, and methods of screening compounds that modulate TACH polypeptide activity.

The TACH nucleic acids and polypeptides, as well as TACH antibodies, as well as pharmaceutical compositions discussed herein, are useful, inter alia, in modulating the activity of cytokines (TNF ligand family members) in the treatment of cancer, inflammatory or immunoregulatory conditions. TACH Nucleic Acids

One aspect of the invention pertains to isolated nucleic acid molecules that encode TACH proteins or biologically active portions thereof. Also included are nucleic acid fragments sufficient for use as hybridization probes to identify TACH-encoding nucleic acids (e.g., TACH mRNA) and fragments for use as polymerase chain reaction (PCR) primers for the amplification or mutation of TACH nucleic acid molecules. As used herein, the term "nucleic acid molecule" is intended to include DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., mRNA), analogs of the DNA or RNA generated using nucleotide analogs, and derivatives, fragments and homologs thereof. The nucleic acid molecule can be single-stranded or double-stranded, but preferably is double-stranded DNA.

"Probes" refer to nucleic acid sequences of variable length, preferably between at least about 10 nucleotides (nt) or as many as about, e.g., 6,000 nt, depending on use. Probes are used in the detection of identical, similar, or complementary nucleic acid sequences. Longer length probes are usually obtained from a natural or recombinant source, are highly specific and much slower to hybridize than oligomers. Probes may be single- or double-stranded and designed to have specificity in PCR, membrane- based hybridization technologies, or ELISA-like technologies. An "isolated" nucleic acid molecule is one that is separated from other nucleic acid molecules which are present in the natural source of the nucleic acid. Examples of isolated nucleic acid molecules include, but are not limited to, recombinant DNA molecules contained in a vector, recombinant DNA molecules maintained in a heterologous host cell, partially or substantially purified nucleic acid molecules, and synthetic DNA or RNA molecules. Preferably, an "isolated" nucleic acid is free of sequences which naturally flank the nucleic acid (i.e., sequences located at the 5' and 3' ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived. For example, in various embodiments, the isolated TACH nucleic acid molecule can contain less than about 50 kb, 25 kb, 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb or 0.1 kb of nucleotide sequences which naturally flank the nucleic acid molecule in genomic DNA of the cell from which the nucleic acid is derived. Moreover, an "isolated" nucleic acid molecule, such as a cDNA molecule, can be substantially free of other cellular material or culture medium when produced by recombinant techniques, or of chemical precursors or other chemicals when chemically synthesized. A nucleic acid molecule of the present invention, e.g., a nucleic acid molecule having the nucleotide sequence of SEQ ID NO: 1, or a variant thereof, or a complement of any of these nucleotide sequences, can be isolated using standard molecular biology techniques and the sequence information provided herein. Using all or a portion of the nucleic acid sequences of SEQ ID NO: 1 as a hybridization probe, TACH nucleic acid sequences can be isolated using standard hybridization and cloning techniques (e.g., as described in Sambrook et αl, eds., MOLECULAR CLONING: A LABORATORY MANUAL 2^nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989; and Ausubel, et al., eds., CURRENT PROTOCOLS ΓN MOLECULAR BIOLOGY, John Wiley & Sons, New York, NY, 1993.)

A nucleic acid of the invention can be amplified using cDNA, mRNA or alternatively, genomic DNA, as a template and appropriate oligonucleotide primers according to standard PCR amplification techniques. The nucleic acid so amplified can be cloned into an appropriate vector and characterized by DNA sequence analysis. Furthermore, oligonucleotides corresponding to TACH nucleotide sequences can be prepared by standard synthetic techniques, e.g., using an automated DNA synthesizer. As used herein, the term "oligonucleotide" refers to a series of linked nucleotide residues, which oligonucleotide has a sufficient number of nucleotide bases to be used in a PCR reaction. A short oligonucleotide sequence may be based on, or designed from, a genomic or cDNA sequence and is used to amplify, confirm, or reveal the presence of an identical, similar or complementary DNA or RNA in a particular cell or tissue. Oligonucleotides comprise portions of a nucleic acid sequence having at least about 10 nt and as many as 50 nt, preferably about 15 nt to 30 nt. They may be chemically synthesized and may be used as probes.

In another embodiment, an isolated nucleic acid molecule of the invention comprises a nucleic acid molecule that is a complement of the nucleotide sequence shown in SEQ JJD NO:l. In another embodiment, an isolated nucleic acid molecule of the invention comprises a nucleic acid molecule that is a complement of the nucleotide sequence shown in SEQ ID NO:l, or a portion of this nucleotide sequence. A nucleic acid molecule that is complementary to the nucleotide sequence shown in SEQ ID NO:l is one that is sufficiently complementary to the nucleotide sequence shown in SEQ ID NO:l that it can hydrogen bond with little or no mismatches to the nucleotide sequence shown in SEQ ID NO:l, thereby forming a stable duplex.

As used herein, the term "complementary" refers to Watson-Crick or Hoogsteen base pairing between nucleotides units of a nucleic acid molecule, and the term "binding" means the physical or chemical interaction between two polypeptides or compounds or associated polypeptides or compounds or combinations thereof. Binding includes ionic, non-ionic, Von der Waals, hydrophobic interactions, etc. A physical interaction can be either direct or indirect. Indirect interactions may be through or due to the effects of another polypeptide or compound. Direct binding refers to interactions that do not take place through, or due to, the effect of another polypeptide or compound, but instead are without other substantial chemical intermediates. Moreover, the nucleic acid molecule of the invention can comprise only a portion of the nucleic acid sequence of SEQ ID NO:l, e.g., a fragment that can be used as a probe or primer or a fragment encoding a biologically active portion of TACH. Fragments provided herein are defined as sequences of at least 6 (contiguous) nucleic acids or at least 4 (contiguous) amino acids, a length sufficient to allow for specific hybridization in the case of nucleic acids or for specific recognition of an epitope in the case of amino acids, respectively, and are at most some portion less than a full length sequence. Fragments may be derived from any contiguous portion of a nucleic acid or amino acid sequence of choice. Derivatives are nucleic acid sequences or amino acid sequences formed from the native compounds either directly or by modification or partial substitution. Analogs are nucleic acid sequences or amino acid sequences that have a structure similar to, but not identical to, the native compound but differs from it in respect to certain components or side chains. Analogs may be synthetic or from a different evolutionary origin and may have a similar or opposite metabolic activity compared to wild type.

Derivatives and analogs may be full length or other than full length, if the derivative or analog contains a modified nucleic acid or amino acid, as described below. Derivatives or analogs of the nucleic acids or proteins of the invention include, but are not limited to, molecules comprising regions that are substantially homologous to the nucleic acids or proteins of the invention, in various embodiments, by at least about 45%, 50%, 70%, 80%, 95%, 98%, or even 99% identity (with a preferred identity of 80-99%) over a nucleic acid or amino acid sequence of identical size or when compared to an aligned sequence in which the alignment is done by a computer homology program known in the art, or whose encoding nucleic acid is capable of hybridizing to the complement of a sequence encoding the aforementioned proteins under stringent, moderately stringent, or low stringent conditions. See e.g. Ausubel, et αl., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, NY, 1993, and below. An exemplary program is the Gap program (Wisconsin Sequence Analysis Package, Version 8 for UNIX, Genetics Computer Group, University Research Park, Madison, WI) using the default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2: 482-489, which in incorporated herein by reference in its entirety).

A "homologous nucleic acid sequence" or "homologous amino acid sequence," or variations thereof, refer to sequences characterized by a homology at the nucleotide level or amino acid level as discussed above. Homologous nucleotide sequences encode those sequences coding for isoforms of TACH polypeptide. Isoforms can be expressed in different tissues of the same organism as a result of, for example, alternative splicing of RNA. Alternatively, isoforms can be encoded by different genes. In the present invention, homologous nucleotide sequences include nucleotide sequences encoding for a TACH polypeptide of species other than mouse, including, but not limited to, mammals, and thus can include, e.g., human, rat, rabbit, dog, cat cow, horse, and other organisms. Homologous nucleotide sequences also include, but are not limited to, naturally occurring allelic variations and mutations of the nucleotide sequences set forth herein. Homologous nucleic acid sequences include those nucleic acid sequences that encode conservative amino acid substitutions (see below) in SEQ ID NO: 2, as well as a polypeptide having TACH activity. A homologous amino acid sequence does not encode the amino acid sequence of a human TACH polypeptide.

The nucleotide sequence determined from the cloning of the murine TACH gene allows for the generation of probes and primers designed for use in identifying and/or cloning TACH homologues in other cell types, e.g., from other tissues, as well as TACH homologues from other mammals, including humans. The probe/primer typically comprises a substantially purified oligonucleotide. The oligonucleotide typically comprises a region of nucleotide sequence that hybridizes under stringent conditions to at least about 12, 25, 50, 100, 150, 200, 250, 300, 350 or 400 consecutive sense strand nucleotide sequence of SEQ ID NO: 1 ; or an anti-sense strand nucleotide sequence of SEQ ID NO:l; or of a naturally occurring mutant of SEQ ID NO:l.

Probes based on the murine TACH nucleotide sequence can be used to detect transcripts or genomic sequences encoding the same or homologous proteins. In various embodiments, the probe further comprises a label group attached thereto, e.g., the label group can be a radioisotope, a fluorescent compound, an enzyme, or an enzyme co-factor. Such probes can be used as a part of a diagnostic test kit for identifying cells or tissue which misexpress a TACH protein, such as by measuring a level of a TACH-encoding nucleic acid in a sample of cells from a subject e.g., detecting TACH mRNA levels or determining whether a genomic TACH gene has been mutated or deleted.

"A polypeptide having a biologically active portion of TACH" refers to polypeptides exhibiting activity similar, but not necessarily identical to, an activity of a polypeptide of the present invention, including mature forms, as measured in a particular biological assay, with or without dose dependency. A nucleic acid fragment encoding a "biologically active portion of TACH" can be prepared by isolating a portion of SEQ ID NO: 1, that encodes a polypeptide having a TACH biological activity (biological activities of the TACH proteins are described below), expressing the encoded portion of TACH protein (e.g., by recombinant expression in vitro) and assessing the activity of the encoded portion of TACH. For example, a nucleic acid fragment encoding a biologically active portion of TACH can optionally include an ATP-binding domain. In another embodiment, a nucleic acid fragment encoding a biologically active portion of TACH includes one or more regions. TACH variants

The invention further encompasses nucleic acid molecules that differ from the nucleotide sequences shown in Fig.l due to degeneracy of the genetic code. These nucleic acids thus encode the same TACH protein as that encoded by the nucleotide sequence shown in SEQ ID NO: 1. In another embodiment, an isolated nucleic acid molecule of the invention has a nucleotide sequence encoding a protein having an amino acid sequence shown in SEQ ID NO: 2.

In addition to the human TACH nucleotide sequence shown in SEQ ID NO:l, it will be appreciated by those skilled in the art that DNA sequence polymorphisms that lead to changes in the amino acid sequences of TACH may exist within a population (e.g., the human population). Such genetic polymorphism in the TACH gene may exist among individuals within a population due to natural allelic variation. As used herein, the terms "gene" and "recombinant gene" refer to nucleic acid molecules comprising an open reading frame encoding a TACH protein, preferably a mammalian TACH protein. Such natural allelic variations can typically result in 1-5% variance in the nucleotide sequence of the TACH gene. Any and all such nucleotide variations and resulting amino acid polymorphisms in TACH that are the result of natural allelic variation and that do not alter the functional activity of TACH are intended to be within the scope of the invention.

Moreover, nucleic acid molecules encoding TACH proteins from other species, and thus that have a nucleotide sequence that differs from the human sequence of , SEQ ID NO: 1 are intended to be within the scope of the invention. Nucleic acid molecules corresponding to natural allelic variants and homologues of the TACH cDNAs of the invention can be isolated based on their homology to the human TACH nucleic acids disclosed herein using the human cDNAs, or a portion thereof, as a hybridization probe according to standard hybridization techniques under stringent hybridization conditions. For example, a soluble human TACH cDNA can be isolated based on its homology to human membrane-bound TACH. Likewise, a membrane-bound human TACH cDNA can be isolated based on its homology to soluble human TACH.

Accordingly, in another embodiment, an isolated nucleic acid molecule of the invention is at least 6 nucleotides in length and hybridizes under stringent conditions to the nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 1. In another embodiment, the nucleic acid is at least 10, 25, 50, 100, 250 or 500 nucleotides in length. In another embodiment, an isolated nucleic acid molecule of the invention hybridizes to the coding region. As used herein, the term "hybridizes under stringent conditions" is intended to describe conditions for hybridization and washing under which nucleotide sequences at least 60% homologous to each other typically remain hybridized to each other.

Homologs (i.e., nucleic acids encoding TACH proteins derived from species other than human) or other related sequences (e.g., paralogs) can be obtained by low, moderate or high stringency hybridization with all or a portion of the particular human sequence as a probe using methods well known in the art for nucleic acid hybridization and cloning.

As used herein, the phrase "stringent hybridization conditions" refers to conditions under which a probe, primer or oligonucleotide will hybridize to its target sequence, but to no other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures than shorter sequences. Generally, stringent conditions are selected to be about 5°C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH. The Tm is the temperature (under defined ionic strength, pH and nucleic acid concentration) at which 50% of the probes complementary to the target sequence hybridize to the target sequence at equilibrium. Since the target sequences are generally present at excess, at Tm, 50% of the probes are occupied at equilibrium. Typically, stringent conditions will be those in which the salt concentration is less than about 1.0 M sodium ion, typically about 0.01 to 1.0 M sodium ion (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30°C for short probes, primers or oligonucleotides (e.g., 10 nt to 50 nt) and at least about 60°C for longer probes, primers and oligonucleotides. Stringent conditions may also be achieved with the addition of destabilizing agents, such as formamide.

Stringent conditions are known to those skilled in the art and can be found in CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6. Preferably, the conditions are such that sequences at least about 65%, 70%, 75%, 85%, 90%, 95%, 98%, or 99% homologous to each other typically remain hybridized to each other. A non-limiting example of stringent hybridization conditions is hybridization in a high salt buffer comprising 6X SSC, 50 mM Tris-HCl (pH 7.5), 1 mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.02% BSA, and 500 mg/ml denatured salmon sperm DNA at 65°C. This hybridization is followed by one or more washes in 0.2X SSC, 0.01% BSA at 50°C. An isolated nucleic acid molecule of the invention that hybridizes under stringent conditions to the sequence of SEQ ID NO: 1 or SEQ ID NO: 3 corresponds to a naturally occurring nucleic acid molecule. As used herein, a "naturally-occurring" nucleic acid molecule refers to an RNA or DNA molecule having a nucleotide sequence that occurs in nature (e.g., encodes a natural protein).

In a second embodiment, a nucleic acid sequence that is hybridizable to the nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 1 , or fragments, analogs or derivatives thereof, under conditions of moderate stringency is provided. A non-limiting example of moderate stringency hybridization conditions are hybridization in 6X SSC, 5X Denhardt's solution, 0.5% SDS and 100 mg/ml denatured salmon sperm DNA at 55°C, followed by one or more washes in IX SSC, 0.1% SDS at 37°C. Other conditions of moderate stringency that may be used are well known in the art. See, e.g., Ausubel et al. (eds.), 1993, CURRENT PROTOCOLS ΓN MOLECULAR BIOLOGY, John Wiley & Sons, NY, and Kriegler, 1990, GENE TRANSFER AND EXPRESSION, A LABORATORY MANUAL, Stockton Press, NY.

In a third embodiment, a nucleic acid that is hybridizable to the nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO:l or fragments, analogs or derivatives thereof, under conditions of low stringency, is provided. A non-limiting example of low stringency hybridization conditions are hybridization in 35% formamide, 5X SSC, 50 mM Tris-HCl (pH 7.5), 5 mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.2% BSA, 100 mg/ml denatured salmon sperm DNA, 10% (wt/vol) dextran sulfate at 40°C, followed by one or more washes in 2X SSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1% SDS at 50°C. Other conditions of low stringency that may be used are well known in the art (e.g., as employed for cross-species hybridizations). See, e.g., Ausubel et al. feds.), 1993, CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, NY, and Kriegler, 1990, GENE TRANSFER AND EXPRESSION, A LABORATORY MANUAL, Stockton Press, NY; Shilo and Weinberg, 1981, Proc Natl Acad Sci USA 78: 6789-6792. Conservative mutations

In addition to naturally-occurring allelic variants of the TACH sequence that may exist in the population, the skilled artisan will further appreciate that changes can be introduced by mutation into the nucleotide sequence of SEQ ID NO:l, thereby leading to changes in the amino acid sequence of the encoded TACH protein, without altering the functional ability of the TACH protein. For example, nucleotide substitutions leading to amino acid substitutions at "non-essential" amino acid residues can be made in the sequence of SEQ ID NO:2. A "non-essential" amino acid residue is a residue that can be altered from the wild-type sequence of TACH without altering the biological activity, whereas an "essential" amino acid residue is required for biological activity. For example, amino acid residues that are conserved among the TACH proteins of the present invention, are predicted to be particularly unamenable to alteration.

In addition, amino acid residues that are conserved among family members of the TACH proteins of the present invention, as indicated by the alignment presented as FIG. 4, are also predicted to be particularly unamenable to alteration. For example, TACH proteins of the present invention can contain at least one domain that is a typically conserved region in TNF family members, i.e., the cysteine-rich domains depicted in Fig. 3. As such, these conserved domains are not likely to be amenable to mutation. Other amino acid residues, however, (e.g., those that are not conserved or only semi-conserved among members of the TACH proteins) may not be essential for activity and thus are likely to be amenable to alteration.

Another aspect of the invention pertains to nucleic acid molecules encoding TACH proteins that contain changes in amino acid residues that are not essential for activity. Such TACH proteins differ in amino acid sequence from SEQ ID NO:2, yet retain biological activity. In one embodiment, the isolated nucleic acid molecule comprises a nucleotide sequence encoding a protein, wherein the protein comprises an amino acid sequence at least about 45% homologous to the amino acid sequence of SEQ ID NO:2. Preferably, the protein encoded by the nucleic acid molecule is at least about 60% homologous to SEQ ID NO:2, more preferably at least about 70%, 80%, 90%, 95%, 98%, and most preferably at least about 99% homologous to SEQ ID NO:2. An isolated nucleic acid molecule encoding a TACH protein homologous to the protein of SEQ ID NO: 2 can be created by introducing one or more nucleotide substitutions, additions or deletions into the nucleotide sequence of SEQ ID NO:l, such that one or more amino acid substitutions, additions or deletions are introduced into the encoded protein. Mutations can be introduced into SEQ ID NO: 1 by standard techniques, such as site-directed mutagenesis and PCR-mediated mutagenesis. Preferably, conservative amino acid substitutions are made at one or more predicted non-essential amino acid residues. A "conservative amino acid substitution" is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, a predicted nonessential amino acid residue in TACH is replaced with another amino acid residue from the same side chain family. Alternatively, in another embodiment, mutations can be introduced randomly along all or part of a TACH coding sequence, such as by saturation mutagenesis, and the resultant mutants can be screened for TACH biological activity to identify mutants that retain activity. Following mutagenesis of SEQ ID NO: 1_Λ the encoded protein can be expressed by any recombinant technology known in the art and the activity of the protein can be determined.

In one embodiment, a mutant TACH protein can be assayed for (1) the ability to form protein:protein interactions with other TACH proteins, other cell-surface proteins, or biologically active portions thereof, (2) complex formation between a mutant TACH protein and a TACH ligand; (3) the ability of a mutant TACH protein to bind to an intracellular target protein or biologically active portion thereof; (e.g., avidin proteins); (4) the ability to bind ATP; or (5) the ability to specifically bind a TACH protein antibody. Antisense Another aspect of the invention pertains to isolated antisense nucleic acid molecules that are hybridizable to or complementary to the nucleic acid molecule comprising the nucleotide sequence of SEQ JO NO:l or, or fragments, analogs or derivatives thereof. An "antisense" nucleic acid comprises a nucleotide sequence that is complementary to a "sense" nucleic acid encoding a protein, e.g., complementary to the coding strand of a double-stranded cDNA molecule or complementary to an mRNA sequence. In specific aspects, antisense nucleic acid molecules are provided that comprise a sequence complementary to at least about 10, 25, 50, 100, 250 or 500 nucleotides or an entire TACH coding strand, or to only a portion thereof. Nucleic acid molecules encoding fragments, homologs, derivatives and analogs of a TACH protein of SEQ ID NO: 2 or antisense nucleic acids complementary to a TACH nucleic acid sequence of SEQ ID NO: 1 or are additionally provided.

In one embodiment, an antisense nucleic acid molecule is antisense to a "coding region" of the coding strand of a nucleotide sequence encoding TACH. The term "coding region" refers to the region of the nucleotide sequence comprising codons which are translated into amino acid residues (e.g., the protein coding region of human TACH corresponds to SEQ ID NO:l). In another embodiment, the antisense nucleic acid molecule is antisense to a "noncoding region" of the coding strand of a nucleotide sequence encoding TACH. The term "noncoding region" refers to 5' and 3' sequences which flank the coding region that are not translated into amino acids (i.e., also referred to as 5' and 3' untranslated regions).

Given the coding strand sequences encoding TACH disclosed herein (e.g., SEQ ID NO: 1), antisense nucleic acids' of the invention can be designed according to the rules of Watson and Crick or Hoogsteen base pairing. The antisense nucleic acid molecule can be complementary to the entire coding region of TACH mRNA, but more preferably is an oligonucleotide that is antisense to only a portion of the coding or noncoding region of TACH mRNA. For example, the antisense oligonucleotide can be complementary to the region surrounding the translation start site of TACH mRNA.

An antisense oligonucleotide can be, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides in length. An antisense nucleic acid of the invention can be constructed using chemical synthesis or enzymatic ligation reactions using procedures known in the art. For example, an antisense nucleic acid (e.g., an antisense oligonucleotide) can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids, e.g., phosphorothioate derivatives and acridine substituted nucleotides can be used. Examples of modified nucleotides that can be used to generate the antisense nucleic acid include: 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine,

2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5 -methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and 2,6-diaminopurine. Alternatively, the antisense nucleic acid can be produced biologically using an expression vector into which a nucleic acid has been subcloned in an antisense orientation (i.e., RNA transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest, described further in the following subsection).

The antisense nucleic acid molecules of the invention are typically administered to a subject or generated in situ such that they hybridize with or bind to cellular mRNA and/or genomic DNA encoding a TACH protein to thereby inhibit expression of the protein, e.g., by inhibiting transcription and/or translation. The hybridization can be by conventional nucleotide complementarity to form a stable duplex, or, for example, in the case of an antisense nucleic acid molecule that binds to DNA duplexes, through specific interactions in the major groove of the double helix. An example of a route of administration of antisense nucleic acid molecules of the invention includes direct injection at a tissue site. Alternatively, antisense nucleic acid molecules can be modified to target selected cells and then administered systemically. For example, for systemic administration, antisense molecules can be modified such that they specifically bind to receptors or antigens expressed on a selected cell surface, e.g., by linking the antisense nucleic acid molecules to peptides or antibodies that bind to cell surface receptors or antigens. The antisense nucleic acid molecules can also be delivered to cells using the vectors described herein. To achieve sufficient intracellular concentrations of antisense molecules, vector constructs in which the antisense nucleic acid molecule is placed under the control of a strong pol U or pol DI promoter are preferred.

In yet another embodiment, the antisense nucleic acid molecule of the invention is an oc-anomeric nucleic acid molecule. An -anomeric nucleic acid molecule forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual -units, the strands run parallel to each other (Gaultier et al. (1987) Nucleic Acids Res 15: 6625-6641). The antisense nucleic acid molecule can also comprise a 2 -o-methylribonucleotide (Inoue et al. (1987) Nucleic Acids Res 15: 6131-6148) or a chimeric RNA -DNA analogue (Inoue et al. (1987) FEBS Lett 215: 327-330). Ribozymes and PNA moieties

In still another embodiment, an antisense nucleic acid of the invention is a ribozyme. Ribozymes are catalytic RNA molecules with ribonuclease activity that are capable of cleaving a single-stranded nucleic acid, such as an mRNA, to which they have a complementary region. Thus, ribozymes (e.g., hammerhead ribozymes (described in Haselhoff and Gerlach (1988) Nature 334:585-591)) can be used to catalytically cleave TACH mRNA transcripts to thereby inhibit translation of TACH mRNA. A ribozyme having specificity for a ACH-encoding nucleic acid can be designed based upon the nucleotide sequence of a TACΗ DNA disclosed herein (i.e., SEQ ID NO: 1. For example, a derivative of a Tetrahymena L-19 F S RNA can be constructed in which the nucleotide sequence of the active site is complementary to the nucleotide sequence to be cleaved in a TACΗ-encoding mRNA. See, e.g., Cech et al. U.S. Pat. No. 4,987,071; and Cech et al. U.S. Pat. No. 5,116,742. Alternatively, TACΗ mRNA can be used to select a catalytic RNA having a specific ribonuclease activity from a pool of RNA molecules. See, e.g., Bartel et al, (1993) Science 261:1411-1418. Alternatively, TACΗ gene expression can be inhibited by targeting nucleotide sequences complementary to the regulatory region of the TACΗ (e.g., the TACΗ promoter and/or enhancers) to form triple helical structures that prevent transcription of the TACΗ gene in target cells. See generally, Ηelene. (1991) Anticancer Drug Des. 6: 569-84; Ηelene. et al. (1992) Ann. N. Y. Acad. Sci. 660:27-36; and Maher (1992) Bioassays 14: 807-15.

In various embodiments, the nucleic acids of TACΗ can be modified at the base moiety, sugar moiety or phosphate backbone to improve, e.g., the stability, hybridization, or solubility of the molecule. For example, the deoxyribose phosphate backbone of the nucleic acids can be modified to generate peptide nucleic acids (see Ηyrap et al. (1996) Bioorg Med Chem 4: 5-23). As used herein, the terms "peptide nucleic acids" or "PNAs" refer to nucleic acid mimics, e.g., DNA mimics, in which the deoxyribose phosphate backbone is replaced by a pseudopeptide backbone and only the four natural nucleobases are retained. The neutral backbone of PNAs has been shown to allow for specific hybridization to DNA and RNA under conditions of low ionic strength. The synthesis of PNA oligomers can be performed using standard solid phase peptide synthesis protocols as described in Hyrup et al. (1996) above; Perry-OKeefe et al. (1996) PNAS 93: 14670-675.

PNAs of TACH can be used in therapeutic and diagnostic applications. For example, PNAs can be used as antisense or antigene agents for sequence-specific modulation of gene expression by, e.g., inducing transcription or translation arrest or inhibiting replication. PNAs of TACH can also be used, e.g., in the analysis of single base pair mutations in a gene by, e.g., PNA directed PCR clamping; as artificial restriction enzymes when used in combination with other enzymes, e.g., SI nucleases (Hyrup B. (1996) above); or as probes or primers for DNA sequence and hybridization (Hyrup et al. (1996), above; Perry-OKeefe (1996), above).

In another embodiment, PNAs of TACH can be modified, e.g., to enhance their stability or cellular uptake, by attaching lipophilic or other helper groups to PNA, by the formation of PNA-DNA chimeras, or by the use of liposomes or other techniques of drug delivery known in the art. For example, PNA-DNA chimeras of TACH can be generated that may combine the advantageous properties of PNA and DNA. Such chimeras allow DNA recognition enzymes, e.g., RNase H and DNA polymerases, to interact with the DNA portion while the PNA portion would provide high binding affinity and specificity. PNA-DNA chimeras can be linked using linkers of appropriate lengths selected in terms of base stacking, number of bonds between the nucleobases, and orientation (Hyrup (1996) above). The synthesis of PNA-DNA chimeras can be performed as described in Hyrup (1996) above and Finn et al. (1996) Nucl Acids Res 24: 3357-63. For example, a DNA chain can be synthesized on a solid support using standard phosphoramidite coupling chemistry, and modified nucleoside analogs, e.g., 5 '-(4-methoxytrityl)amino-5 -deoxy-thymidine phosphoramidite, can be used between the PNA and the 5' end of DNA (Mag et al. (1989) Nucl Acid Res 17: 5973-88). PNA monomers are then coupled in a stepwise manner to produce a chimeric molecule with a 5 'PNA segment and a 3 'DNA segment (Finn et al. (1996) above). Alternatively, chimeric molecules can be synthesized with a 5 'DNA segment and a 3 'PNA segment. See, Petersen et al. (1975) Bioorg Med Chem Lett 5: 1119-11124. In other embodiments, the oligonucleotide may include other appended groups such as peptides (e.g., for targeting host cell receptors in vivo), or agents facilitating transport across the cell membrane (see, e.g., Letsinger et al, 1989, Proc. Natl. Acad. Sci. U.S.A. 86:6553-6556; Lemaitre et al, 1987, Proc. Natl. Acad. Sci. 84:648-652; PCT Publication No. W088/09810) or the blood-brain barrier (see, e.g., PCT Publication No. W089/10134). In addition, oligonucleotides can be modified with hybridization triggered cleavage agents (See, e.g., Krol et al, 1988, BioTechniques 6:958-976) or intercalating agents. (See, e.g., Zon, 1988, Pharm. Res. 5: 539-549). To this end, the oligonucleotide may be conjugated to another molecule, e.g., a peptide, a hybridization triggered cross-linking agent, a transport agent, a hybridization-triggered cleavage agent, etc. TACH polypeptides One aspect of the invention pertains to isolated TACH proteins, and biologically active portions thereof, or derivatives, fragments, analogs or homologs thereof. Also provided are polypeptide fragments suitable for use as immunogens to raise anti-TACH antibodies. In one embodiment, native TACH proteins can be isolated from cells or tissue sources by an appropriate purification scheme using standard protein purification techniques. In another embodiment, TACH proteins are produced by recombinant DNA techniques. Alternative to recombinant expression, a TACH protein or polypeptide can be synthesized chemically using standard peptide synthesis techniques.

An "isolated" or "purified" protein or biologically active portion thereof is substantially free of cellular material or other contaminating proteins from the cell or tissue source from which the TACH protein is derived, or substantially free from chemical precursors or other chemicals when chemically synthesized. The language "substantially free of cellular material" includes preparations of TACH protein in which the protein is separated from cellular components of the cells from which it is isolated or recombinantly produced. In one embodiment, the language "substantially free of cellular material" includes preparations of TACH protein having less than about 30% (by dry weight) of non-TACH protein (also referred to herein as a "contaminating protein"), more preferably less than about 20% of non-TACH protein, still more preferably less than about 10% of non-TACH protein, and most preferably less than about 5% non-TACH protein. When the TACH protein or biologically active portion thereof is recombinantly produced, it is also preferably substantially free of culture medium, i.e., culture medium represents less than about 20%, more preferably less than about 10%, and most preferably less than about 5% of the volume of the protein preparation.

The language "substantially free of chemical precursors or other chemicals" includes preparations of TACH protein in which the protein is separated from chemical precursors or other chemicals that are involved in the synthesis of the protein. In one embodiment, the language "substantially free of chemical precursors or other chemicals" includes preparations of TACH protein having less than about 30% (by dry weight) of chemical precursors or non-TACH chemicals, more preferably less than about 20% chemical precursors or non-TACH chemicals, still more preferably less than about 10% chemical precursors or non-TACH chemicals, and most preferably less than about 5% chemical precursors or non-TACH chemicals.

Biologically active portions of a TACΗ protein include peptides comprising amino acid sequences sufficiently homologous to or derived from the amino acid sequence of the TACΗ protein, e.g., the amino acid sequence shown in SEQ ID NO:2 or SEQ ID NO:4 that include fewer amino acids than the full length TACΗ proteins, and exhibit at least one activity of a TACΗ protein. Typically, biologically active portions comprise a domain or motif with at least one activity of the TACΗ protein. A biologically active portion of a TACΗ protein can be a polypeptide which is, for example, 10, 25, 50, 100 or more amino acids in length. A biologically active portion of a TACΗ protein of the present invention may contain at least one of the above-identified domains conserved between the TACΗ proteins. An alternative biologically active portion of a TACΗ protein may contain at least two of the above-identified domains. Another biologically active portion of a TACΗ protein may contain at least three of the above-identified domains. Yet another biologically active portion of a TACΗ protein of the present invention may contain at least four of the above-identified domains.

Moreover, other biologically active portions, in which other regions of the protein are deleted, can be prepared by recombinant techniques and evaluated for one or more of the functional activities of a native TACΗ protein. In an embodiment, the TACΗ protein has an amino acid sequence shown in SEQ ID NO: 2. In other embodiments, the TACΗ protein is substantially homologous to SEQ ED NO: 2 and retains the functional activity of the protein of SEQ ED NO: 2, yet differs in amino acid sequence due to natural allelic variation or mutagenesis, as described in detail below. Accordingly, in another embodiment, the TACH protein is a protein that comprises an amino acid sequence at least about 45% homologous to the amino acid sequence of SEQ ID NO: 2 and retains the functional activity of the TACH proteins of SEQ ID NO:2.

Determining homology between two or more sequences

To determine the percent homology of two amino acid sequences or of two nucleic acids, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in the sequence of a first amino acid or nucleic acid sequence for optimal alignment with a second amino or nucleic acid sequence). The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are homologous at that position (i.e., as used herein amino acid or nucleic acid "homology" is equivalent to amino acid or nucleic acid "identity"). The nucleic acid sequence homology may be determined as the degree of identity between two sequences. The homology may be determined using computer programs known in the art, such as GAP software provided in the GCG program package. See Needleman and Wunsch 1970 J Mol Biol 48: 443-453. Using GCG GAP software with the following settings for nucleic acid sequence comparison: GAP creation penalty of 5.0 and GAP extension penalty of 0.3, the coding region of the analogous nucleic acid sequences referred to above exhibits a degree of identity preferably of at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99%, with the CDS (encoding) part of the DNA sequence shown in SEQ ED NO:l. The term "sequence identity" refers to the degree to which two polynucleotide or polypeptide sequences are identical on a residue-by-residue basis over a particular region of comparison. The term "percentage of sequence identity" is calculated by comparing two optimally aligned sequences over that region of comparison, determining the number of positions at which the identical nucleic acid base (e.g., A, T, C, G, U, or I, in the case of nucleic acids) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the region of comparison (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity. The term "substantial identity" as used herein denotes a characteristic of a polynucleotide sequence, wherein the polynucleotide comprises a sequence that has at least 80 percent sequence identity, preferably at least 85 percent identity and often 90 to 95 percent sequence identity, more usually at least 99 percent sequence identity as compared to a reference sequence over a comparison region. Chimeric and fusion proteins

The invention also provides TACH chimeric or fusion proteins. As used herein, a TACH "chimeric protein" or "fusion protein" comprises a TACH polypeptide operatively linked to a non-TACH polypeptide. A "TACH polypeptide" refers to a polypeptide having an amino acid sequence corresponding -to TACH, whereas a "non-TACH polypeptide" refers to a polypeptide having an amino acid sequence corresponding to a protein that is not substantially homologous to the TACH protein, e.g., a protein that is different from the TACH protein and that is derived from the same or a different organism. Within a TACH fusion protein the TACH polypeptide can correspond to all or a portion of a TACH protein. In one embodiment, a TACH fusion protein comprises at least one biologically active portion of a TACH protein. In another embodiment, a TACH fusion protein comprises at least two biologically active portions of a TACH protein. In yet another embodiment, a TACH fusion protein comprises at least three biologically active portions of a TACH protein. Within the fusion protein, the term "operatively linked" is intended to indicate that the TACH polypeptide and the non-TACH polypeptide are fused in-frame to each other. The non-TACH polypeptide can be fused to the N-terminus or C-terminus of the TACH polypeptide. For example, in one embodiment a TACH fusion protein comprises a TACH domain operably linked to the extracellular domain of a second protein. Such fusion proteins can be further utilized in screening assays for compounds which modulate TACH activity (such assays are described in detail below).

In yet another embodiment, the fusion protein is a GST-TACH fusion protein in which the TACH sequences are fused to the C-terminus of the GST (i.e., glutathione S -transferase) sequences. Such fusion proteins can facilitate the purification of recombinant TACH. In another embodiment, the fusion protein is a TACH protein containing a heterologous signal sequence at its N-terminus. For example, the native TACH signal sequence can be removed and replaced with a signal sequence from another protein. In certain host cells (e.g., mammalian host cells), expression and/or secretion of TACH can be increased through use of a heterologous signal sequence.

In yet another embodiment, the fusion protein is a TACH-immunoglobulin fusion protein in which the TACH sequences comprising one or more domains are fused to sequences derived from a member of the immunoglobulin protein family. The TACH-immunoglobulin fusion proteins of the invention can be incorporated into pharmaceutical compositions and administered to a subject to inhibit an interaction between a TACH ligand (TNF family ligand) and a TACH protein on the surface of a cell, to thereby suppress TACH-mediated signal transduction in vivo. The TACH-immunoglobulin fusion proteins can be used to affect the bioavailability of a TACH cognate ligand. Inhibition of the TACH ligand/TACH interaction may be useful therapeutically for both the treatment of proliferative and differentiative disorders, as well as modulating (e.g. promoting or inhibiting) cell survival. Moreover, the TACH-immunoglobulin fusion proteins of the invention can be used as immunogens to produce anti-TACH antibodies in a subject, to purify TACH ligands, and in screening assays to identify molecules that inhibit the interaction of TACH with a TACH ligand. A TACH chimeric or fusion protein of the invention can be produced by standard recombinant DNA techniques. For example, DNA fragments coding for the different polypeptide sequences are ligated together in-frame in accordance with conventional techniques, e.g., by employing blunt-ended or stagger-ended termini for ligation, restriction enzyme digestion to provide for appropriate termini, filling-in of cohesive ends as appropriate, alkaline phosphatase treatment to avoid undesirable joining, and enzymatic ligation. In another embodiment, the fusion gene can be synthesized by conventional techniques including automated DNA synthesizers. Alternatively, PCR amplification of gene fragments can be carried out using anchor primers that give rise to complementary overhangs between two consecutive gene fragments that can subsequently be annealed and reamplified to generate a chimeric gene sequence (see, for example, Ausubel et al. (eds.) CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, 1992). Moreover, many expression vectors are commercially available that already encode a fusion moiety (e.g., a GST polypeptide). A TACH-encoding nucleic acid can be cloned into such an expression vector such that the fusion moiety is linked in-frame to the TACH protein. TACH agonists and antagonists The present invention also pertains to variants of the TACH proteins that function as either TACH agonists (mimetics) or as TACH antagonists. Variants of the TACH protein can be generated by mutagenesis, e.g., discrete point mutation or truncation of the TACH protein. An agonist of the TACH protein can retain substantially the same, or a subset of, the biological activities of the naturally occurring form of the TACH protein. An antagonist of the TACH protein can inhibit one or more of the activities of the naturally occurring form of the TACH protein by, for example, competitively binding to a downstream or upstream member of a cellular signaling cascade which includes the TACH protein. Thus, specific biological effects can be elicited by treatment with a variant of limited function. In one embodiment, treatment of a subject with a variant having a subset of the biological activities of the naturally occurring form of the protein has fewer side effects in a subject relative to treatment with the naturally occurring form of the TACH proteins.

Variants of the TACH protein that function as either TACH agonists (mimetics) or as TACH antagonists can be identified by screening combinatorial libraries of mutants, e.g., truncation mutants, of the TACH protein for TACH protein agonist or antagonist activity. In one embodiment, a variegated library of TACH variants is generated by combinatorial mutagenesis at the nucleic acid level and is encoded by a variegated gene library. A variegated library of TACH variants can be produced by, for example, enzymatically ligating a mixture of synthetic oligonucleotides into gene sequences such that a degenerate set of potential TACH sequences is expressible as individual polypeptides, or alternatively, as a set of larger fusion proteins (e.g., for phage display) containing the set of TACH sequences therein. There are a variety of methods which can be used to produce libraries of potential TACH variants from a degenerate oligonucleotide sequence. Chemical synthesis of a degenerate gene sequence can be performed in an automatic DNA synthesizer, and the synthetic gene then ligated into an appropriate expression vector. Use of a degenerate set of genes allows for the provision, in one mixture, of all of the sequences encoding the desired set of potential TACH sequences. Methods for synthesizing degenerate oligonucleotides are known in the art (see, e.g., Narang (1983) Tetrahedron 39:3; Itakura et al. (1984) Annu Rev Biochem 53:323; Itakura et αZ. (1984) Science 198:1056; Ike et al. (1983) Nucl Acid Res 11:477.

Polypeptide libraries

In addition, libraries of fragments of the TACH protein coding sequence can be used to generate a variegated population of TACH fragments for screening and subsequent selection of variants of a TACH protein. In one embodiment, a library of coding sequence fragments can be generated by treating a double stranded PCR fragment of a TACH coding sequence with a nuclease under conditions wherein nicking occurs only about once per molecule, denaturing the double stranded DNA, renaturing the DNA to form double stranded DNA that can include sense/antisense pairs from different nicked products, removing single stranded portions from reformed duplexes by treatment with SI nuclease, and ligating the resulting fragment library into an expression vector. By this method, an expression library can be derived which encodes N-terminal and internal fragments of various sizes of the TACH protein.

Several techniques are known in the art for screening gene products of combinatorial libraries made by point mutations or truncation, and for screening cDNA libraries for gene products having a selected property. Such techniques are adaptable for rapid screening of the gene libraries generated by the combinatorial mutagenesis of TACH proteins. The most widely used techniques, which are amenable to high throughput analysis, for screening large gene libraries typically include cloning the gene library into replicable expression vectors, transforming appropriate cells with the resulting library of vectors, and expressing the combinatorial genes under conditions in which detection of a desired activity facilitates isolation of the vector encoding the gene whose product was detected. Recrusive ensemble mutagenesis (REM), a new technique that enhances the frequency of functional mutants in the libraries, can be used in combination with the screening assays to identify TACH variants (Arkin and Yourvan (1992) PNAS 89:7811-7815; Delgrave et al. (1993) Protein Engineering 6:327-331). Anti-TACH Antibodies

An isolated TACH protein, or a portion or fragment thereof, can be used as an immunogen to generate antibodies that bind TACH using standard techniques for polyclonal and monoclonal antibody preparation. The full-length TACH protein can be used or, alternatively, the invention provides antigenic peptide fragments of TACH for use as immunogens. The antigenic peptide of TACH comprises at least 8 amino acid residues of the amino acid sequence shown in SEQ ED NO: 2 and encompasses an epitope of TACH such that an antibody raised against the peptide forms a specific immune complex with TACH. Preferably, the antigenic peptide comprises at least 10 amino acid residues, more preferably at least 15 amino acid residues, even more preferably at least 20 amino acid residues, and most preferably at least 30 amino acid residues. Preferred epitopes encompassed by the antigenic peptide are regions of TACH that are located on the surface of the protein, e.g., hydrophilic regions. As disclosed herein, TACH protein sequence of SEQ ID NO:2, or derivatives, fragments, analogs or homologs thereof, may be utilized as immunogens in the generation of antibodies that immunospecifically-bind these protein components. The term "antibody" as used herein refers to immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, i.e., molecules that contain an antigen binding site that specifically binds (immunoreacts with) an antigen, such as TACH. Such antibodies include, but are not limited to, polyclonal, monoclonal, chimeric, single chain, F_ab and F(_a -)₂ fragments, and an F_ab expression library. In a specific embodiment, antibodies to human TACH proteins are disclosed. Various procedures known within the art may be used for the production of polyclonal or monoclonal antibodies to a TACH protein sequence of SEQ ED NO: 2 or derivative, fragment, analog or homolog thereof. Some of these proteins are discussed below. For the production of polyclonal antibodies, various suitable host animals (e.g., rabbit, goat, mouse or other mammal) may be immunized by injection with the native protein, or a synthetic variant thereof, or a derivative of the foregoing. An appropriate immunogenic preparation can contain, for example, recombinantly expressed TACH protein or a chemically synthesized TACH polypeptide. The preparation can further include an adjuvant. Various adjuvants used to increase the immunological response include, but are not limited to, Freund's (complete and incomplete), mineral gels (e.g., aluminum hydroxide), surface active substances (e.g., lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, dinitrophenol, etc.), human adjuvants such as Bacille Calmette-Guerin and Corynebacterium parvum, or similar immunostimulatory agents. If desired, the antibody molecules directed against TACH can be isolated from the mammal (e.g., from the blood) and further purified by well known techniques, such as protein A chromatography to obtain the IgG fraction.

The term "monoclonal antibody" or "monoclonal antibody composition", as used herein, refers to a population of antibody molecules that contain only one species of an antigen binding site capable of immunoreacting with a particular epitope of TACH. A monoclonal antibody composition thus typically displays a single binding affinity for a particular TACH protein with which it immunoreacts. For preparation of monoclonal antibodies directed towards a particular TACH protein, or derivatives, fragments, analogs or homologs thereof, any technique that provides for the production of antibody molecules by continuous cell line culture may be utilized. Such techniques include, but are not limited to, the hybridoma technique (see Kohler & Milstein, 1975 Nature 256: 495-497); the trioma technique; the human B-cell hybridoma technique (see Kozbor, et al, 1983 Immunol Today 4: 72) and the EBV hybridoma technique to produce human monoclonal antibodies (see Cole, et al, 1985 In: MONOCLONAL ANTIBODIES AND CANCER THERAPY, Alan R. Liss, Inc., pp. 77-96). Human monoclonal antibodies may be utilized in the practice of the present invention and may be produced by using human hybridomas (see Cote, et al, 1983. Proc Natl Acad Sci USA 80: 2026-2030) or by transforming human B -cells with Epstein Barr Virus in vitro (see Cole, et al, 1985 In: MONOCLONAL ANTIBODIES AND CANCER THERAPY, Alan R. Liss, Inc., pp. 77-96).

According to the invention, techniques can be adapted for the production of single-chain antibodies specific to a TACH protein (see e.g., U.S. Patent No. 4,946,778). In addition, methods can be adapted for the construction of F_a expression libraries (see e.g., Huse, et al, 1989 Science 246: 1275-1281) to allow rapid and effective identification of monoclonal F_ab fragments with the desired specificity for a TACH protein or derivatives, fragments, analogs or homologs thereof. Non-human antibodies can be "humanized" by techniques well known in the art. See e.g., U.S. Patent No. 5,225,539. Antibody fragments that contain the idiotypes to a TACH protein may be produced by techniques known in the art including, but not limited to: (i) an F(_{a "})₂ fragment produced by pepsin digestion of an antibody molecule; (ii) an F_ab fragment generated by reducing the disulfide bridges of an F^_b^ fragment; (iii) an F_ab fragment generated by the treatment of the antibody molecule with papain and a reducing agent and (iv) F_v fragments.

Additionally, recombinant anti-TACH antibodies, such as chimeric and humanized monoclonal antibodies, comprising both human and non-human portions, which can be made using standard recombinant DNA techniques, are within the scope of the invention. Such chimeric and humanized monoclonal antibodies can be produced by recombinant DNA techniques known in the art, for example using methods described in PCT International Application No. PCT/US86/02269; European Patent Application No. 184,187; European Patent Application No. 171,496; European Patent Application No. 173,494; PCT International Publication No. WO 86/01533; U.S. Pat. No. 4,816,567; European Patent Application No. 125,023; Better et «/.(1988) Science 240:1041-1043; Liu et al. (1987) PNAS 84:3439-3443; Liu et al. (1987) J Immunol. 139:3521-3526; Sun et al. (1987) PNAS 84:214-218; Nishimura et al. (1987) Cancer Res 47:999-1005; Wood et al. (1985) Nature 314:446-449; Shaw et al. (1988) J Natl Cancer hist 80:1553-1559); Morrison(1985) Science 229:1202-1207; Oi et al. (1986) BioTechniques 4:214; U.S. Pat. No. 5,225,539; Jones et al. (1986) Nature 321:552-525; Verhoeyan et al. (1988) Science 239:1534; and Beidler et al. (1988) J Immunol 141:4053-4060.

In one embodiment, methods for the screening of antibodies that possess the desired specificity include, but are not limited to, enzyme-linked immunosorbent assay (ELISA) and other immunologically-mediated techniques known within the art. In a specific embodiment, selection of antibodies that are specific to a particular domain of a TACH protein is facilitated by generation of hybridomas that bind to the fragment of a TACH protein possessing such a domain. Antibodies that are specific for one or more domains within a TACH protein, e.g., domains spanning the above-identified conserved regions of TACH family proteins, or derivatives, fragments, analogs or homologs thereof, are also provided herein. Anti-TACH antibodies may be used in methods known within the art relating to the localization and/or quantitation of a TACH protein (e.g., for use in measuring levels of the TACH protein within appropriate physiological samples, for use in diagnostic methods, for use in imaging the protein, and the like). In a given embodiment, antibodies for TACH proteins, or derivatives, fragments, analogs or homologs thereof, that contain the antibody derived binding domain, are utilized as pharmacologically-active compounds [hereinafter "Therapeutics"].

An anti-TACH antibody (e.g., monoclonal antibody) can be used to isolate TACH by standard techniques, such as affinity chromatography or immunoprecipitation. An anti-TACH antibody can facilitate the purification of natural TACH from cells and of recombinantly produced TACH expressed in host cells. Moreover, an anti-TACH antibody can be used to detect TACΗ protein (e.g., in a cellular lysate or cell supernatant) in order to evaluate the abundance and pattern of expression of the TACΗ protein. Anti-TACΗ antibodies can be used diagnostically to monitor protein levels in tissue as part of a clinical testing procedure, e.g., to, for example, determine the efficacy of a given treatment regimen. Detection can be facilitated by coupling (i.e., physically linking) the antibody to a detectable substance. Examples of detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, B-galactosidase, or acetylcholinesterase; examples of suitable prosthetic group complexes include streptavidin/biotin and avidin/biotin; examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; an example of a luminescent material includes luminol; examples of bioluminescent materials include luciferase, luciferin, and aequorin, and examples of suitable radioactive material include ¹²⁵L ¹³¹1, ³⁵S or ³Η. TACH Recombinant Expression Vectors and Host Cells

Another aspect of the invention pertains to vectors, preferably expression vectors, containing a nucleic acid encoding TACH protein, or derivatives, fragments, analogs or homologs thereof. As used herein, the term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of vector is a "plasmid", which refers to a circular double stranded DNA loop into which additional DNA segments can be ligated. Another type of vector is a viral vector, wherein additional DNA segments can be ligated into the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operatively linked. Such vectors are referred to herein as "expression vectors". In general, expression vectors of utility in recombinant DNA techniques are often in the form of plasmids. In the present specification, "plasmid" and "vector" can be used interchangeably as the plasmid is the most commonly used form of vector. However, the invention is intended to include such other forms of expression vectors, such as viral vectors (e.g., replication defective retroviruses, adenoviruses and adeno-associated viruses), which serve equivalent functions.

The recombinant expression vectors of the invention comprise a nucleic acid of the invention in a form suitable for expression of the nucleic acid in a host cell, which means that the recombinant expression vectors include one or more regulatory sequences, selected on the basis of the host cells to be used for expression, that is operatively linked to the nucleic acid sequence to be expressed. Within a recombinant expression vector, "operably linked" is intended to mean that the nucleotide sequence of interest is linked to the regulatory sequence(s) in a manner that allows for expression of the nucleotide sequence (e.g., in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell). The term "regulatory sequence" is intended to includes promoters, enhancers and other expression control elements (e.g., polyadenylation signals). Such regulatory sequences are described, for example, in Goeddel; GENE EXPRESSION TECHNOLOGY: METHODS IN ENZYMOLOGY 185, Academic Press, San Diego, Calif. (1990). Regulatory sequences include those that direct constitutive expression of a nucleotide sequence in many types of host cell and those that direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as the choice of the host cell to be transformed, the level of expression of protein desired, etc. The expression vectors of the invention can be introduced into host cells to thereby produce proteins or peptides, including fusion proteins or peptides, encoded by nucleic acids as described herein (e.g., TACH proteins, mutant forms of TACH, fusion proteins, etc.). The recombinant expression vectors of the invention can be designed for expression of TACH in prokaryotic or eukaryotic cells. For example, TACH can be expressed in bacterial cells such as E. coli, insect cells (using baculovirus expression vectors) yeast cells or mammalian cells. Suitable host cells are discussed further in Goeddel, GENE EXPRESSION TECHNOLOGY: METHODS IN ENZYMOLOGY 185, Academic Press, San Diego, Calif. (1990). Alternatively, the recombinant expression vector can be transcribed and translated in vitro, for example using T7 promoter regulatory sequences and T7 polymerase.

Expression of proteins in prokaryotes is most often carried out in E. coli with vectors containing constitutive or inducible promoters directing the expression of either fusion or non-fusion proteins. Fusion vectors add a number of amino acids to a protein encoded therein, usually to the amino terminus of the recombinant protein. Such fusion vectors typically serve three purposes: (1) to increase expression of recombinant protein; (2) to increase the solubility of the recombinant protein; and (3) to aid in the purification of the recombinant protein by acting as a ligand in affinity purification. Often, in fusion expression vectors, a proteolytic cleavage site is introduced at the junction of the fusion moiety and the recombinant protein to enable separation of the recombinant protein from the fusion moiety subsequent to purification of the fusion protein. Such enzymes, and their cognate recognition sequences, include Factor Xa, thrombin and enterokinase. Typical fusion expression vectors include pGEX

(Pharmacia Biotech Ine; Smith and Johnson (1988) Gene 67:31-40), pMAL (New England Biolabs, Beverly, Mass.) and pREE5 (Pharmacia, Piscataway, NJ.) that fuse glutathione S-transferase (GST), maltose E binding protein, or protein A, respectively, to the target recombinant protein. Examples of suitable inducible non-fusion E. coli expression vectors include pTrc (Amrann et al, (1988) Gene 69:301-315) and pET lid (Studier et al, GENE EXPRESSION TECHNOLOGY: METHODS IN ENZYMOLOGY 185, Academic Press, San Diego, Calif. (1990) 60-89).

One strategy to maximize recombinant protein expression in E. coli is to express the protein in a host bacteria with an impaired capacity to proteolytically cleave the recombinant protein. See, Gottesman, GENE EXPRESSION TECHNOLOGY: METHODS IN ENZYMOLOGY 185, Academic Press, San Diego, Calif. (1990) 119-128. Another strategy is to alter the nucleic acid sequence of the nucleic acid to be inserted into an expression vector so that the individual codons for each amino acid are those preferentially utilized in E. coli (Wada et al, (1992) Nucleic Acids Res. 20:2111-2118). Such alteration of nucleic acid sequences of the invention can be carried out by standard DNA synthesis techniques.

In another embodiment, the TACH expression vector is a yeast expression vector. Examples of vectors for expression in yeast S. cerivisae include pYepSecl (Baldari, et al, (1987) EMBO J 6:229-234), pMFa (Kurjan and Herskowitz, (1982) Cell 30:933-943), pJRY88 (Schultz et al, (1987) Gene 54: 113-123), pYES2 (Invitrogen Corporation, San Diego, Calif.), and picZ (LnVitrogen Corp, San Diego, Calif.). Alternatively, TACH can be expressed in insect cells using baculovirus expression vectors. Baculovirus vectors available for expression of proteins in cultured insect cells (e.g., SF9 cells) include the pAc series (Smith et al (1983) Mol Cell Biol 3:2156-2165) and the pVL series (Lucklow and Summers (1989) Virology 170:31-39). En yet another embodiment, a nucleic acid of the invention is expressed in mammalian cells using a mammalian expression vector. Examples of mammalian expression vectors include pCDM8 (Seed (1987) Nature 329:840) and pMT2PC (Kaufman et al (1987) EMBO J 6: 187-195). When used in mammalian cells, the expression vector's control functions are often provided by viral regulatory elements. For example, commonly used promoters are derived from polyoma, Adenovirus 2, cytomegalovirus and Simian Virus 40. For other suitable expression systems for both prokaryotic and eukaryotic cells. See, e.g., Chapters 16 and 17 of Sambrook et al, MOLECULAR CLONING: A LABORATORY MANUAL. 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989. En another embodiment, the recombinant mammalian expression vector is capable of directing expression of the nucleic acid preferentially in a particular cell type (e.g., tissue-specific regulatory elements are used to express the nucleic acid). Tissue-specific regulatory elements are known in the art. Non-limiting examples of suitable tissue-specific promoters include the albumin promoter (liver-specific; Pinkert et al. (1987) Genes Dev 1:268-277), lymphoid-specific promoters (Calame and Eaton (1988) Adv Immunol 43:235-275), in particular promoters of T cell receptors (Winoto and Baltimore (1989) EMBO J 8:729-733) and i munoglobulins (Banerji et al. (1983) Cell 33:729-740; Queen and Baltimore (1983) Cell 33:741-748), neuron-specific promoters (e.g., the neurofilament promoter; Byrne and Ruddle (1989) PNAS 86:5473-5477), pancreas-specific promoters (Edlund et al. (1985) Science 230:912-916), and mammary gland-specific promoters (e.g., milk whey promoter; U.S. Pat. No. 4,873,316 and European Application Publication No. 264,166). Developmentally-regulated promoters are also encompassed, e.g., the murine hox promoters (Kessel and Grass (1990) Science 249:374-379) and the D-fetoprotein promoter (Campes and Tilghman (1989) Genes Dev 3:537-546). The invention further provides a recombinant expression vector comprising a

DNA molecule of the invention cloned into the expression vector in an antisense orientation. That is, the DNA molecule is operatively linked to a regulatory sequence in a manner that allows for expression (by transcription of the DNA molecule) of an RNA molecule that is antisense to TACH mRNA. Regulatory sequences operatively linked to a nucleic acid cloned in the antisense orientation can be chosen that direct the continuous expression of the antisense RNA molecule in a variety of cell types, for instance viral promoters and/or enhancers, or regulatory sequences can be chosen that direct constitutive, tissue specific or cell type specific expression of antisense RNA. The antisense expression vector can be in the form of a recombinant plasmid, phagemid or attenuated virus in which antisense nucleic acids are produced under the control of a high efficiency regulatory region, the activity of which can be determined by the cell type into which the vector is introduced. For a discussion of the regulation of gene expression using antisense genes see Weintraub et al, "Antisense RNA as a molecular tool for genetic analysis," Reviews-Trends in Genetics, Vol. 1(1) 1986. Another aspect of the invention pertains to host cells into which a recombinant expression vector of the invention has been introduced. The terms "host cell" and "recombinant host cell" are used interchangeably herein. It is understood that such terms refer not only to the particular subject cell but to the progeny or potential progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein.

A host cell can be any prokaryotic or eukaryotic cell. For example, TACH protein can be expressed in bacterial cells such as E. coli, insect cells, yeast or mammalian cells (such as Chinese hamster ovary cells (CHO) or COS cells). Other suitable host cells are known to those skilled in the art. Vector DNA can be introduced into prokaryotic or eukaryotic cells via conventional transformation or transfection techniques. As used herein, the terms "transformation" and "transfection" are intended to refer to a variety of art-recognized techniques for introducing foreign nucleic acid (e.g., DNA) into a host cell, including calcium phosphate or calcium chloride co-precipitation, DΕAΕ-dextran-mediated transfection, lipofection, or electroporation. Suitable methods for transforming or transfecting host cells can be found in Sambrook, et al. (MOLECULAR CLONING: A LABORATORY MANUAL. 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y., 1989), and other laboratory manuals.

For stable transfection of mammalian cells, it is known that, depending upon the expression vector and transfection technique used, only a small fraction of cells may integrate the foreign DNA into their genome. En order to identify and select these integrants, a gene that encodes a selectable marker (e.g., resistance to antibiotics) is generally introduced into the host cells along with the gene of interest. Various selectable markers include those that confer resistance to drugs, such as G418, hygromycin and methotrexate. Nucleic acid encoding a selectable marker can be introduced into a host cell on the same vector as that encoding TACH or can be introduced on a separate vector. Cells stably transfected with the introduced nucleic acid can be identified by drug selection (e.g., cells that have incorporated the selectable marker gene will survive, while the other cells die). A host cell of the invention, such as a prokaryotic or eukaryotic host cell in culture, can be used to produce (i.e., express) TACH protein. Accordingly, the invention further provides methods for producing TACH protein using the host cells of the invention. En one embodiment, the method comprises culturing the host cell of invention (into which a recombinant expression vector encoding TACH has been introduced) in a suitable medium such that TACH protein is produced. En another embodiment, the method further comprises isolating TACH from the medium or the host cell. Transgenic animals

The host cells of the invention can also be used to produce nonhuman transgenic animals. For example, in one embodiment, a host cell of the invention is a fertilized oocyte or an embryonic stem cell into which TACH-coding sequences have been introduced. Such host cells can then be used to create non-human transgenic animals in which exogenous TACH sequences have been introduced into their genome or homologous recombinant animals in which endogenous TACH sequences have been altered. Such animals are useful for studying the function and/or activity of TACH and for identifying and/or evaluating modulators of TACH activity. As used herein, a "transgenic animal" is a non-human animal, preferably a mammal, more preferably a rodent such as a rat or mouse, in which one or more of the cells of the animal includes a transgene. Other examples of transgenic animals include non-human primates, sheep, dogs, cows, goats, chickens, amphibians, etc. A transgene is exogenous DNA that is integrated into the genome of a cell from which a transgenic animal develops and that remains in the genome of the mature animal, thereby directing the expression of an encoded gene product in one or more cell types or tissues of the transgenic animal. As used herein, a "homologous recombinant animal" is a non-human animal, preferably a mammal, more preferably a mouse, in which an endogenous TACH gene has been altered by homologous recombination between the endogenous gene and an exogenous DNA molecule introduced into a cell of the animal, e.g., an embryonic cell of the animal, prior to development of the animal.

A transgenic animal of the invention can be created by introducing TACH-encoding nucleic acid into the male pronuclei of a fertilized oocyte, e.g., by microinjection, retroviral infection, and allowing the oocyte to develop in a pseudopregnant female foster animal. The murine TACH DNA sequence of SEQ ED NO: 1 can be introduced as a transgene into the genome of a non-human animal. Alternatively, a nonhuman homologue of the human TACH gene, such as a mouse TACH gene, can be isolated based on hybridization to the human TACH cDNA (described further above) and used as a transgene. Entronic sequences and polyadenylation signals can also be included in the transgene to increase the efficiency of expression of the transgene. A tissue-specific regulatory sequence(s) can be operably linked to the TACH transgene to direct expression of TACH protein to particular cells. Methods for generating transgenic animals via embryo manipulation and microinjection, particularly animals such as mice, have become conventional in the art and are described, for example, in U.S. Pat. Nos. 4,736,866; 4,870,009; and 4,873,191; and Hogan 1986, In: MANIPULATING THE MOUSE EMBRYO, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y. Similar methods are used for production of other transgenic animals. A transgenic founder animal can be identified based upon the presence of the TACH transgene in its genome and/or expression of TACH mRNA in tissues or cells of the animals. A transgenic founder animal can then be used to breed additional animals carrying the transgene. Moreover, transgenic animals carrying a transgene encoding TACH can further be bred to other transgenic animals carrying other transgenes.

To create a homologous recombinant animal, a vector is prepared which contains at least a portion of a TACH gene into which a deletion, addition or substitution has been introduced to thereby alter, e.g., functionally disrupt, the TACH gene. The TACH gene can be a human gene, but more preferably, is a non-human homologue of a human TACH gene. For example, a mouse homologue of human TACH gene (e.g., the murine TACH nucleic acid of SEQ ED NO: 1) can be used to construct a homologous recombination vector suitable for altering an endogenous TACH gene in a genome. In one embodiment, the vector is designed such that, upon homologous recombination, the endogenous TACH gene is functionally disrupted (i.e., no longer encodes a functional protein; also referred to as a "knock out" vector). Alternatively, the vector can be designed such that, upon homologous recombination, the endogenous TACH gene is mutated or otherwise altered but still encodes functional protein (e.g., the upstream regulatory region can be altered to thereby alter the expression of the endogenous TACH protein). En the homologous recombination vector, the altered portion of the TACH gene is flanked at its 5' and 3' ends by additional nucleic acid of the TACH gene to allow for homologous recombination to occur between the exogenous TACH gene carried by the vector and an endogenous TACH gene in an embryonic stem cell. The additional flanking TACH nucleic acid is of sufficient length for successful homologous recombination with the endogenous gene. Typically, several kilobases of flanking DNA (both at the 5' and 3' ends) are included in the vector. See e.g., Thomas et al. (1987) Cell 51:503 for a description of homologous recombination vectors. The vector is introduced into an embryonic stem cell line (e.g., by electroporation) and cells in which the introduced TACH gene has homologously recombined with the endogenous TACH gene are selected (see e.g., Li et al. (1992) Cell 69:915).

The selected cells are then injected into a blastocyst of an animal (e.g., a mouse) to form aggregation chimeras. See e.g., Bradley 1987, En: TERATOCARCΓNOMAS AND EMBRYONIC STEM CELLS: A PRACTICAL APPROACH, Robertson, ed. RL, Oxford, pp. 113-152. A chimeric embryo can then be implanted into a suitable pseudopregnant female foster animal and the embryo brought to term. Progeny harboring the homologously recombined DNA in their germ cells can be used to breed animals in which all cells of the animal contain the homologously recombined DNA by germline transmission of the transgene. Methods for constructing homologous recombination vectors and homologous recombinant animals are described further in Bradley (1991) Curr Opin Biotechnol 2:823-829; PCT International Publication Nos.: WO 90/11354; WO 91/01140; WO 92/0968; and WO 93/04169. In another embodiment, transgenic non-humans animals can be produced that contain selected systems that allow for regulated expression of the transgene. One example of such a system is the cre/loxP recombinase system of bacteriophage PL For a description of the cre/loxP recombinase system, see, e.g., Lakso et al. (1992) PNAS S>9. -6232-6236. Another example of a recombinase system is the FLP recombinase system of Saccharomyces cerevisiae (O'Gorman et al. (1991) Science 251: 1351-1355. Ef a cre/loxP recombinase system is used to regulate expression of the transgene, animals containing transgenes encoding both the Cre recombinase and a selected protein are required. Such animals can be provided through the construction of "double" transgenic animals, e.g., by mating two transgenic animals, one containing a transgene encoding a selected protein and the other containing a transgene encoding a recombinase. Clones of the non-human transgenic animals described herein can also be produced according to the methods described in Wilmut et al. (1997) Nature 385:810-813. In brief, a cell, e.g., a somatic cell, from the transgenic animal can be isolated and induced to exit the growth cycle and enter G₀ phase. The quiescent cell can then be fused, e.g., through the use of electrical pulses, to an enucleated oocyte from an animal of the same species from which the quiescent cell is isolated. The reconstructed oocyte is then cultured such that it develops to morula or blastocyte and then transferred to pseudopregnant female foster animal. The offspring borne of this female foster animal will be a clone of the animal from which the cell, e.g., the somatic cell, is isolated.

Pharmaceutical Compositions

The TACH nucleic acid molecules, TACH proteins, and anti-TACH antibodies (also referred to herein as "active compounds") of the invention, and derivatives, fragments, analogs and homologs thereof, can be incorporated into pharmaceutical compositions suitable for administration. Such compositions typically comprise the nucleic acid molecule, protein, or antibody and a pharmaceutically acceptable carrier. As used herein, "pharmaceutically acceptable carrier" is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. Suitable carriers are described in the most recent edition of

Remington's Pharmaceutical Sciences, a standard reference text in the field, which is incorporated herein by reference. Preferred examples of such carriers or diluents include, but are not limited to, water, saline, finger's solutions, dextrose solution, and 5% human serum albumin. Liposomes and non-aqueous vehicles such as fixed oils may also be used. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the compositions is contemplated. Supplementary active compounds can also be incorporated into the compositions. A pharmaceutical composition of the invention is formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (topical), transmucosal, and rectal administration. Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates, and agents for the adjustment of tonicity such as sodium chloride or dextrose. The pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.

Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL™ (BASF, Parsippany, NJ.) or phosphate buffered saline (PBS). En all cases, the composition must be sterile and should be fluid to the extent that easy syringeability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the^' maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. En many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as manitol, sorbitol, sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin. Sterile injectable solutions can be prepared by incorporating the active compound (e.g., a TACH protein or anti-TACH antibody) in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those enumerated above. En the case of sterile powders for the preparation of sterile injectable solutions, methods of preparation are vacuum drying and freeze-drying that yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.

Oral compositions generally include an inert diluent or an edible carrier. They can be enclosed in gelatin capsules or compressed into tablets. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash, wherein the compound in the fluid carrier is applied orally and swished and expectorated or swallowed. Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition. The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring. For administration by inhalation, the compounds are delivered in the form of an aerosol spray from pressured container or dispenser which contains a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer.

Systemic administration can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration can be accomplished through the use of nasal sprays or suppositories. For transdermal administration, the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art.

The compounds can also be prepared in the form of suppositories (e.g., with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal delivery.

En one embodiment, the active compounds are prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. The materials can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeted to infected cells with monoclonal antibodies to viral antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811.

It is especially advantageous to formulate oral or parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the dosage unit forms of the invention are dictated by and directly dependent on the unique characteristics of the active compound and the particular therapeutic effect to be achieved.

The nucleic acid molecules of the invention can be inserted into vectors and used as gene therapy vectors. Gene therapy vectors can be delivered to a subject by any of a number of routes, e.g., as described in U.S. Patent Nos. 5,703,055. Delivery can thus also include, e.g., intravenous injection, local administration (see U.S. Pat. No. 5,328,470) or stereotactic injection (see e.g., Chen et al. (1994) PNAS 91:3054-3057). The pharmaceutical preparation of the gene therapy vector can include the gene therapy vector in an acceptable diluent, or can comprise a slow release matrix in which the gene delivery vehicle is imbedded. Alternatively, where the complete gene delivery vector can be produced intact from recombinant cells, e.g., retroviral vectors, the pharmaceutical preparation can include one or more cells that produce the gene delivery system. The pharmaceutical compositions can be included in a container, pack, or dispenser together with instructions for administration. Uses and Methods of the Invention

The nucleic acid molecules, proteins, protein homologues, and antibodies described herein can be used in one or more of the following methods: (a) screening assays; (b) detection assays (e.g., chromosomal mapping, tissue typing, forensic biology), (c) predictive medicine (e.g., diagnostic assays, prognostic assays, monitoring clinical trials, and pharmacogenomics); and (d) methods of treatment (e.g., therapeutic and prophylactic).

The isolated nucleic acid molecules of the invention can be used to express TACH protein (e.g., via a recombinant expression vector in a host cell in gene therapy applications), to detect TACH mRNA (e.g., in a biological sample) or a genetic lesion in a TACH gene, and to modulate TACH activity, as described further below. En addition, the TACH proteins can be used to screen drags or compounds that modulate the TACH activity or expression as well as to treat disorders characterized by insufficient or excessive production of TACH protein, or production of TACH protein forms that have decreased or aberrant activity compared to TACH wild type protein. In addition, the anti-TACH antibodies of the invention can be used to detect and isolate TACH proteins and modulate TACH activity. This invention further pertains to novel agents identified by the above described screening assays and uses thereof for treatments as described herein. Screening Assays

The invention provides a method (also referred to herein as a "screening assay") for identifying modulators, i.e., candidate or test compounds or agents (e.g., peptides, peptidomimetics, small molecules or other drugs) that bind to TACH proteins or have a stimulatory or inhibitory effect on, for example, TACH expression or TACH activity.

In one embodiment, the invention provides assays for screening candidate or test compounds which bind to or modulate the activity of a TACH protein or polypeptide or biologically active portion thereof. The test compounds of the present invention can be obtained using any of the numerous approaches in combinatorial library methods known in the art, including: biological libraries; spatially addressable parallel solid phase or solution phase libraries; synthetic library methods requiring deconvolution; the "one-bead one-compound" library method; and synthetic library methods using affinity chromatography selection. The biological library approach is limited to peptide libraries, while the other four approaches are applicable to peptide, non-peptide oiigomer or small molecule libraries of compounds (Lam (1997) Anticancer Drug Des 12:145). Examples of methods for the synthesis of molecular libraries can be found in the art, for example in: DeWitt et al. (1993) Proc Natl Acad Sci U.S.A. 90:6909; Erb et al. (1994) Proc Natl Acad Sci U.S.A. 91:11422; Zuckermann et al. (1994) J Med Chem 37:2678; Cho et al. (1993) Science 261:1303; Carrell et al. (1994) Angew Chem Int Ed Engl 33:2059; Carell et al. (1994) Angew Chem Int EdEngl 33:2061; and Gallop et al. (1994) J Med Chem 37:1233.

Libraries of compounds may be presented in solution (e.g., Houghten (1992) Biotechniques 13:412-421), or on beads (Lam (1991) Nature 354:82-84), on chips (Fodor (1993) Nature 364:555-556), bacteria (Ladner U.S. Pat. No. 5,223,409), spores (Ladner USP '409), plasmids (Cull et al. (1992) Proc Natl Acad Sci USA 89:1865-1869) or on phage (Scott and Smith (1990) Science 249:386-390; Devlin (1990) Science 249:404-406; Cwhla et al. (1990) Proc Natl Acad Sci U.S.A. 87:6378-6382; Felici (1991) J Mol Biol 222:301-310; Ladner above.).

In one embodiment, an assay is a cell-based assay in which a cell which expresses a membrane-bound form of TACH protein, or a biologically active portion thereof, on the cell surface is contacted with a test compound and the ability of the test compound to bind to a TACH protein determined. The cell, for example, can of mammalian origin or a yeast cell. Determining the ability of the test compound to bind to the TACH protein can be accomplished, for example, by coupling the test compound with a radioisotope or enzymatic label such that binding of the test compound to the TACH protein or biologically attive portion thereof can be determined by detecting the labeled compound in a complex. For example, test compounds can be labeled with ¹²⁵I, ³⁵S, ¹⁴C, or ³H, either directly or indirectly, and the radioisotope detected by direct counting of radioemission or by scintillation counting. Alternatively, test compounds can be enzymatically labeled with, for example, horseradish peroxidase, alkaline phosphatase, or luciferase, and the enzymatic label detected by determination of conversion of an appropriate substrate to product. In one embodiment, the assay comprises contacting a cell which expresses a membrane-bound form of TACH protein, or a biologically active portion thereof, on the cell surface with a known compound which binds TACH to form an assay mixture, contacting the assay mixture with a test compound, and determining the ability of the test compound to interact with a TACH protein, wherein determining the ability of the test compound to interact with a TACH protein comprises determining the ability of the test compound to preferentially bind to TACH or a biologically active portion thereof as compared to the known compound.

In another embodiment, an assay is a cell-based assay comprising contacting a cell expressing a membrane-bound form of TACH protein, or a biologically active portion thereof, on the cell surface with a test compound and determining the ability of the test compound to modulate (e.g., stimulate or inhibit) the activity of the TACH protein or biologically active portion thereof. Determining the ability of the test compound to modulate the activity of TACH or a biologically active portion thereof can be accomplished, for example, by determining the ability of the TACH protein to bind to or interact with a TACH target molecule. As used herein, a "target molecule" is a molecule with which a TACH protein binds or interacts in nature, for example, a molecule on the surface of a cell which expresses a TACH protein, a molecule on the surface of a second cell, a molecule in the extracellular milieu, a molecule associated with the internal surface of a cell membrane or a cytoplasmic molecule. A TACH target molecule can be a non-TACH molecule or a TACH protein or polypeptide of the present invention. En one embodiment, a TACH target molecule is a component of a signal transduction pathway that facilitates transduction of an extracellular signal (e.g., a signal generated by binding of a compound to a membrane-bound TACH molecule) through the cell membrane and into the cell. The target, for example, can be a second intercellular protein that has catalytic activity or a protein that facilitates the association of downstream signaling molecules with TACH.

Determining the ability of the TACH protein to bind to or interact with a TACH target molecule can be accomplished by one of the methods described above for determining direct binding. In one embodiment, determining the ability of the TACH protein to bind to or interact with a TACH target molecule can be accomplished by determining the activity of the target molecule. For example, the activity of the target molecule can be determined by detecting induction of a cellular second messenger of the target (i.e. intracellular Ca²⁺, diacylglycerol, EP₃, etc.), detecting catalytic/enzymatic activity of the target an appropriate substrate, detecting the induction of a reporter gene (comprising a TACH-responsive regulatory element operatively linked to a nucleic acid encoding a detectable marker, e.g., luciferase), or detecting a cellular response, for example, cell survival, cellular differentiation, or cell proliferation. In yet another embodiment, an assay of the present invention is a cell-free assay comprising contacting a TACH protein or biologically active portion thereof with a test compound and determining the ability of the test compound to bind to the TACH protein or biologically active portion thereof. Binding of the test compound to the TACH protein can be determined either directly or indirectly as described above. En one embodiment, the assay comprises contacting the TACH protein or biologically active portion thereof with a known compound which binds TACH to form an assay mixture, contacting the assay mixture with a test compound, and determining the ability of the test compound to interact with a TACH protein, wherein determining the ability of the test compound to interact with a TACH protein comprises determining the ability of the test compound to preferentially bind to TACH or biologically active portion thereof as compared to the known compound.

En another embodiment, an assay is a cell-free assay comprising contacting TACH protein or biologically active portion thereof with a test compound and determining the ability of the test compound to modulate (e.g., stimulate or inhibit) the activity of the TACH protein or biologically active portion thereof. Determining the ability of the test compound to modulate the activity of TACH can be accomplished, for example, by determining the ability of the TACH protein to bind to a TACH target molecule by one of the methods described above for determining direct binding. In an alternative embodiment, determining the ability of the test compound to modulate the activity of TACH can be accomplished by determining the ability of the TACH protein further modulate a TACH target molecule. For example, the catalytic/enzymatic activity of the target molecule on an appropriate substrate can be determined as previously described.

En yet another embodiment, the cell-free assay comprises contacting the TACH protein or biologically active portion thereof with a known compound which binds TACH to form an assay mixture, contacting the assay mixture with a test compound, and determining the ability of the test compound to interact with a TACH protein, wherein determining the ability of the test compound to interact with a TACH protein comprises determining the ability of the TACH protein to preferentially bind to or modulate the activity of a TACH target molecule. The cell-free assays of the present invention are amenable to use of both the soluble form or the membrane-bound form of TACH. In the case of cell-free assays comprising the membrane-bound form of TACH, it may be desirable to utilize a solubilizing agent such that the membrane-bound form of TACH is maintained in solution. Examples of such solubilizing agents include non-ionic detergents such as n-octylglucoside, n-dodecylglucoside, n-dodecylmaltoside, octanoyl-N-methylglucamide, decanoyl-N-methylglucamide, Triton^® X-100, Triton^® X-114, Thesit^®, Isotridecypoly(ethylene glycol ether)_n, 3-(3-cholanιidopropyl)dimethylamminiol-l-propane sulfonate (CHAPS), 3-(3-cholamidopropyl)dimethylamminiol-2-hydroxy-l-propane sulfonate (CHAPSO), or N-dodecyl--N,N-dimethyl-3-ammonio-l -propane sulfonate.

En more than one embodiment of the above assay methods of the present invention, it may be desirable to immobilize either TACH or its target molecule to facilitate separation of complexed from uncomplexed forms of one or both of the proteins, as well as to accommodate automation of the assay. Binding of a test compound to TACH, or interaction of TACH with a target molecule in the presence and absence of a candidate compound, can be accomplished in any vessel suitable for containing the reactants. Examples of such vessels include microtiter plates, test tubes, and micro-centrifuge tubes. In one embodiment, a fusion protein can be provided that adds a domain that allows one or both of the proteins to be bound to a matrix. For example, GST-TACH fusion proteins or GST-target fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis, MO) or glutathione derivatized microtiter plates, that are then combined with the test compound or the test compound and either the non-adsorbed target protein or TACH protein, and the mixture is incubated under conditions conducive to complex formation (e.g., at physiological conditions for salt and pH). Following incubation, the beads or microtiter plate wells are washed to remove any unbound components, the matrix immobilized in the case of beads, complex determined either directly or indirectly, for example, as described above. Alternatively, the complexes can be dissociated from the matrix, and the level of TACH binding or activity determined using standard techniques.

Other techniques for immobilizing proteins on matrices can also be used in the screening assays of the invention. For example, either TACH or its target molecule can be immobilized utilizing conjugation of biotin and streptavidin. Biotinylated TACH or target molecules can be prepared from biotin-NHS (N-hydroxy-succinimide) using techniques well known in the art (e.g., biotinylation kit, Pierce Chemicals, Rockford, Ell.), and immobilized in the wells of streptavidin-coated 96 well plates (Pierce Chemical). Alternatively, antibodies reactive with TACH or target molecules, but which do not interfere with binding of the TACH protein to its target molecule, can be derivatized to the wells of the plate, and unbound target or TACH trapped in the wells by antibody conjugation. Methods for detecting such complexes, in addition to those described above for the GST-immobilized complexes, include immunodetection of complexes using antibodies reactive with the TACH or target molecule, as well as enzyme-linked assays that rely on detecting an enzymatic activity associated with the TACH or target molecule.

In another embodiment, modulators of TACH expression are identified in a method wherein a cell is contacted with a candidate compound and the expression of TACH mRNA or protein in the cell is determined. The level of expression of TACH mRNA or protein in the presence of the candidate compound is compared to the level of expression of TACH mRNA or protein in the absence of the candidate compound. The candidate compound can then be identified as a modulator of TACH expression based on this comparison. For example, when expression of TACH mRNA or protein is greater (statistically significantly greater) in the presence of the candidate compound than in its absence, the candidate compound is identified as a stimulator of TACH mRNA or protein expression. Alternatively, when expression of TACH mRNA or protein is less (statistically significantly less) in the presence of the candidate compound than in its absence, the candidate compound is identified as an inhibitor of TACH mRNA or protein expression. The level of TACH mRNA or protein expression in the cells can be determined by methods described herein for detecting TACH mRNA or protein. In yet another aspect of the invention, the TACH proteins can be used as "bait proteins" in a two-hybrid assay or three hybrid assay (see, e.g., U.S. Pat. No. 5,283,317; Zervos et al. (1993) Cell 72:223-232; Madura et al. (1993) J Biol Chem 268:12046-12054; Bartel et al. (1993) Biotechniques 14:920-924; Iwabuchi etal. (1993) Oncogene 8:1693-1696; and Brent WO94/10300), to identify other proteins that bind to or interact with TACH ("TACH-binding proteins" or "TACH-bp") and modulate TACH activity. Such TACH-binding proteins are also likely to be involved in the propagation of signals by the TACH proteins as, for example, upstream or downstream elements of the TACH pathway. TACH-binding proteins include cytokines of the TNF family that bind TACH. The two-hybrid system is based on the modular nature of most transcription factors, which consist of separable DNA-binding and activation domains. Briefly, the assay utilizes two different DNA constructs. In one construct, the gene that codes for TACH is fused to a gene encoding the DNA binding domain of a known transcription factor (e.g., GAL-4). In the other construct, a DNA sequence, from a library of DNA sequences, that encodes an unidentified protein ("prey" or "sample") is fused to a gene that codes for the activation domain of the known transcription factor. Ef the "bait" and the "prey" proteins are able to interact, in vivo, forming a TACH-dependent complex, the DNA-binding and activation domains of the transcription factor are brought into close proximity. This proximity allows transcription of a reporter gene (e.g., LacZ) that is operably linked to a transcriptional regulatory site responsive to the transcription factor. Expression of the reporter gene can be detected and cell colonies containing the functional transcription factor can be isolated and used to obtain the cloned gene that encodes the protein which interacts with TACH.

This invention further pertains to novel agents identified by the above-described screening assays and uses thereof for treatments as described herein. Detection Assays

Portions or fragments of the cDNA sequences identified herein (and the corresponding complete gene sequences) can be used in numerous ways as polynucleotide reagents. For example, these sequences can be used to: (i) map their respective genes on a chromosome; and, thus, locate gene regions associated with genetic disease; (ii) identify an individual from a minute biological sample (tissue typing); and (iii) aid in forensic identification of a biological sample. These applications are described in the subsections below. Chromosome Mapping Once the sequence (or a portion of the sequence) of a gene has been isolated, this sequence can be used to map the location of the gene on a chromosome. This process is called chromosome mapping. Accordingly, portions or fragments of the TACH, sequences, described herein, can be used to map the location of the TACH genes, respectively, on a chromosome. The mapping of the TACH sequences to chromosomes is an important first step in correlating these sequences with genes associated with disease.

Briefly, TACH genes can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp in length) from the TACH sequences. Computer analysis of the TACH, sequences can be used to rapidly select primers that do not span more than one exon in the genomic DNA, thus complicating the amplification process.

These primers can then be used for PCR screening of somatic cell hybrids containing individual chromosomes of a given species. Only those hybrids containing the species- specific gene corresponding to the TACH sequences will yield an amplified fragment. PCR mapping of somatic cell hybrids is a rapid procedure for assigning a particular sequence to a particular chromosome. Three or more sequences can be assigned per day using a single thermal cycler. Using the TACH sequences to design oligonucleotide primers, sublocalization can be achieved with panels of fragments from specific chromosomes.

Fluorescence in situ hybridization (FISH) of a DNA sequence to a metaphase chromosomal spread can further be used to provide a precise chromosomal location in one step. Chromosome spreads can be made using cells whose division has been blocked in metaphase by a chemical like colcemid that disrupts the mitotic spindle. The chromosomes can be treated briefly with trypsin, and then stained with Giemsa. A pattern of light and dark bands develops on each chromosome, so that the chromosomes can be identified individually. The FISH technique can be used with a DNA sequence as short as 500 or 600 bases. However, clones larger than 1,000 bases have a higher likelihood of binding to a unique chromosomal location with sufficient signal intensity for simple detection. Preferably 1,000 bases, and more preferably 2,000 bases, will suffice to get good results at a reasonable amount of time. For a review of this technique, see Verma et al, HUMAN CHROMOSOMES: A MANUAL OF BASIC TECHNIQUES (Pergamon Press, New York 1988). Reagents for chromosome mapping can be used individually to mark a single chromosome or a single site on that chromosome, or panels of reagents can be used for marking multiple sites and/or multiple chromosomes. Reagents corresponding to noncoding regions of the genes actually are preferred for mapping purposes. Coding sequences are more likely to be conserved within gene families, thus increasing the chance of cross hybridizations during chromosomal mapping.

Once a sequence has been mapped to a precise chromosomal location, the physical position of the sequence on the chromosome can be correlated with genetic map data. Such data are found, for example, in McKusick, MENDELIAN INHERITANCE IN MAN, available on-line through Johns Hopkins University Welch Medical Library). The relationship between genes and disease, mapped to the same chromosomal region, can then be identified through linkage analysis (co-inheritance of physically adjacent genes), described in, for example, Egeland et al. (1987) Nature, 325:783-787.

Moreover, differences in the DNA sequences between individuals affected and unaffected with a disease associated with the TACH gene, can be determined. If a mutation is observed in some or all of the affected individuals but not in any unaffected individuals, then the mutation is likely to be the causative agent of the particular disease. Comparison of affected and unaffected individuals generally involves first looking for structural alterations in the chromosomes, such as deletions or translocations that are visible from chromosome spreads or detectable using PCR based on that DNA sequence. Ultimately, complete sequencing of genes from several individuals can be performed to confirm the presence of a mutation and to distinguish mutations from polymorphisms. Tissue Typing

The TACH sequences of the present invention can also be used to identify individuals from minute biological samples. In this technique, an individual's genomic DNA is digested with one or more restriction enzymes, and probed on a Southern blot to yield unique bands for identification. The sequences of the present invention are useful as additional DNA markers for RFLP ("restriction fragment length polymorphisms," described in U.S. Pat. No. 5,272,057).

Furthermore, the sequences of the present invention can be used to provide an alternative technique that determines the actual base-by-base DNA sequence of selected portions of an individual's genome. Thus, the TACH sequences described herein can be used to prepare two PCR primers from the 5' and 3' ends of the sequences. These primers can then be used to amplify an individual's DNA and subsequently sequence it.

Panels of corresponding DNA sequences from individuals, prepared in this manner, can provide unique individual identifications, as each individual will have a unique set of such DNA sequences due to allelic differences. The sequences of the present invention can be used to obtain such identification sequences from individuals and from tissue. The TACH sequences of the invention uniquely represent portions of the human genome. Allelic variation occurs to some degree in the coding regions of these sequences, and to a greater degree in the noncoding regions. It is estimated that allelic variation between individual humans occurs with a frequency of about once per each 500 bases. Much of the allelic variation is due to single nucleotide polymorphisms (SNPs), which include restriction fragment length polymorphisms (RFLPs).

Each of the sequences described herein can, to some degree, be used as a standard against which DNA from an individual can be compared for identification purposes. Because greater numbers of polymorphisms occur in the noncoding regions, fewer sequences are necessary to differentiate individuals. The noncoding sequences can comfortably provide positive individual identification with a panel of perhaps 10 to 1,000 primers that each yield a noncoding amplified sequence of 100 bases. Ef predicted coding sequences, such as those in SEQ ED NO:l are used, a more appropriate number of primers for positive individual identification would be 500-2,000. Predictive Medicine

The present invention also pertains to the field of predictive medicine in which diagnostic assays, prognostic assays, pharmacogenomics, and monitoring clinical trials are used for prognostic (predictive) purposes to thereby treat an individual prophylactically. Accordingly, one aspect of the present invention relates to diagnostic assays for determining TACH protein and/or nucleic acid expression as well as TACH activity, in the context of a biological sample (e.g., blood, serum, cells, tissue) to thereby determine whether an individual is afflicted with a disease or disorder, or is at risk of developing a disorder, associated with aberrant TACH expression or activity. The invention also provides for prognostic (or predictive) assays for determining whether an individual is at risk of developing a disorder associated with TACH protein, nucleic acid expression or activity. For example, mutations in a TACH gene can be assayed in a biological sample. Such assays can be used for prognostic or predictive purpose to thereby prophylactically treat an individual prior to the onset of a disorder characterized by or associated with TACH protein, nucleic acid expression or activity. Another aspect of the invention provides methods for determining TACH protein, nucleic acid expression or TACH activity in an individual to thereby select appropriate therapeutic or prophylactic agents for that individual (referred to herein as "pharmacogenomics"). Pharmacogenomics allows for the selection of agents (e.g., drugs) for therapeutic or prophylactic treatment of an individual based on the genotype of the individual (e.g., the genotype of the individual examined to determine the ability of the individual to respond to a particular agent.)

Yet another aspect of the invention pertains to monitoring the influence of agents (e.g., drugs, compounds) on the expression or activity of TACH in clinical trials. These and other agents are described in further detail in the following sections. Diagnostic Assays

An exemplary method for detecting the presence or absence of TACH in a biological sample involves obtaining a biological- sample from a test subject and contacting the biological sample with a compound or an agent capable of detecting TACH protein or nucleic acid (e.g., mRNA, genomic DNA) that encodes TACH protein such that the presence of TACH is detected in the biological sample. An agent for detecting TACH mRNA or genomic DNA is a labeled nucleic acid probe capable of hybridizing to TACH mRNA or genomic DNA. The nucleic acid probe can be, for example, a full-length TACH nucleic acid, such as the nucleic acid of SEQ ID NO: 1, or a portion thereof, such as an oligonucleotide of at least 15, 30, 50, 100, 250 or 500 nucleotides in length and sufficient to specifically hybridize under stringent conditions to TACH mRNA or genomic DNA. Other suitable probes for use in the diagnostic assays of the invention are described herein.

An agent for detecting TACH protein is an antibody capable of binding to TACH protein, preferably an antibody with a detectable label. Antibodies can be polyclonal, or more preferably, monoclonal. An intact antibody, or a fragment thereof (e.g., Fab or F(ab')₂) can be used. The term "labeled", with regard to the probe or antibody, is intended to encompass direct labeling of the probe or antibody by coupling (i.e., physically linking) a detectable substance to the probe or antibody, as well as indirect labeling of the probe or antibody by reactivity with another reagent that is directly labeled. Examples of indirect labeling include detection of a primary antibody using a fluorescently labeled secondary antibody and end-labeling of a DNA probe with biotin such that it can be detected with fluorescently labeled streptavidin. The term "biological sample" is intended to include tissues, cells and biological fluids isolated from a subject, as well as tissues, cells and fluids present within a subject. That is, the detection method of the invention can be used to detect TACH mRNA, protein, or genomic DNA in a biological sample in vitro as well as in vivo. For example, in vitro techniques for detection of TACH mRNA include Northern hybridizations and in situ hybridizations. In vitro techniques for detection of TACH protein include enzyme linked immunosorbent assays (ELISAs), Western blots, immunoprecipitations and immunofluorescence. In vitro techniques for detection of TACH genomic DNA include Southern hybridizations. Furthermore, in vivo techniques for detection of TACH protein include introducing into a subject a labeled anti-TACH antibody. For example, the antibody can be labeled with a radioactive marker whose presence and location in a subject can be detected by standard imaging techniques.

In one embodiment, the biological sample contains protein molecules from the test subject. Alternatively, the biological sample can contain mRNA molecules from the test subject or genomic DNA molecules from the test subject. A preferred biological sample is a peripheral blood leukocyte sample isolated by conventional means from a subject.

En another embodiment, the methods further involve obtaining a control biological sample from a control subject, contacting the control sample with a compound or agent capable of detecting TACH protein, mRNA, or genomic DNA, such that the presence of TACH protein, mRNA or genomic DNA is detected in the biological sample, and comparing the presence of TACH protein, mRNA or genomic DNA in the control sample with the presence of TACH protein, mRNA or genomic DNA in the test sample. The invention also encompasses kits for detecting the presence of TACH in a biological sample. For example, the kit can comprise: a labeled compound or agent capable of detecting TACH protein or mRNA in a biological sample; means for determining the amount of TACH in the sample; and means for comparing the amount of TACH in the sample with a standard. The compound or agent can be packaged in a suitable container. The kit can further comprise instructions for using the kit to detect TACH protein or nucleic acid. Prognostic Assays

The diagnostic methods described herein can furthermore be utilized to identify subjects having or at risk of developing a disease or disorder associated with aberrant TACH expression or activity. For example, the assays described herein, such as the preceding diagnostic assays or the following assays, can be utilized to identify a subject having or at risk of developing a disorder associated with TACH protein, nucleic acid expression or activity in, e.g., cancer, inflammatory or immunoregulatory conditions. Alternatively, the prognostic assays can be utilized to identify a subject having or at risk for developing a disease or disorder. Thus, the present invention provides a method for identifying a disease or disorder associated with aberrant TACH expression or activity in which a test sample is obtained from a subject and TACH protein or nucleic acid (e.g., mRNA, genomic DNA) is detected, wherein the presence of TACH protein or nucleic acid is diagnostic for a subject having or at risk of developing a disease or disorder associated with aberrant TACH expression or activity. As used herein, a "test sample" refers to a biological sample obtained from a subject of interest. For example, a test sample can be a biological fluid (e.g., serum), cell sample, or tissue. Furthermore, the prognostic assays described herein can be used to determine whether a subject can be administered an agent (e.g., an agonist, antagonist, peptidomimetic, protein, peptide, nucleic acid, small molecule, or other drug candidate) to treat a disease or disorder associated with aberrant TACH expression or activity. For example, such methods can be used to determine whether a subject can be effectively treated with an agent for a disorder, such as a cancer, inflammatory or immunoregulatory disorder. Thus, the present invention provides methods for determining whether a subject can be effectively treated with an agent for a disorder associated with aberrant TACH expression or activity in which a test sample is obtained and TACH protein or nucleic acid is detected (e.g., wherein the presence of TACH protein or nucleic acid is diagnostic for a subject that can be administered the agent to treat a disorder associated with aberrant TACH expression or activity.)

The methods of the invention can also be used to detect genetic lesions in a TACH gene, thereby determining if a subject with the lesioned gene is at risk for, or suffers from, a cancer, inflammatory or immunoregulatory disorder. En various embodiments, the methods include detecting, in a sample of cells from the subject, the presence or absence of a genetic lesion characterized by at least one of an alteration affecting the integrity of a gene encoding a TACH-protein, or the mis-expression of the TACH gene. For example, such genetic lesions can be detected by ascertaining the existence of at least one of (1) a deletion of one or more nucleotides from a TACH gene; (2) an addition of one or more nucleotides to a TACH gene; (3) a substitution of one or more nucleotides of a TACH gene, (4) a chromosomal rearrangement of a TACH gene; (5) an alteration in the level of a messenger RNA transcript of a TACH gene, (6) aberrant modification of a TACH gene, such as of the methylation pattern of the genomic DNA, (7) the presence of a non-wild type splicing pattern of a messenger RNA transcript of a TACH gene, (8) a non-wild type level of a TACH-protein, (9) allelic loss of a TACH gene, and (10) inappropriate post-translational modification of a TACH-protein. As described herein, there are a large number of assay techniques known in the art which can be used for detecting lesions in a TACH gene. A preferred biological sample is a peripheral blood leukocyte sample isolated by conventional means from a subject. However, any biological sample containing nucleated cells may be used, including, for example, buccal mucosal cells. En certain embodiments, detection of the lesion involves the use of a probe/primer in a polymerase chain reaction (PCR) (see, e.g., U.S. Pat. Nos. 4,683,195 and 4,683,202), such as anchor PCR or RACE PCR, or, alternatively, in a ligation chain reaction (LCR) (see, e.g., Landegran et al. (1988) Science 241:1077-1080; and Nakazawa et al. (1994) PNAS 91:360-364), the latter of which can be particularly useful for detecting point mutations in the TACH-gene (see Abravaya et al. (1995) Nucl Acids Res 23:675-682). This method can include the steps of collecting a sample of cells from a patient, isolating nucleic acid (e.g., genomic, mRNA or both) from the cells of the sample, contacting the nucleic acid sample with one or more primers that specifically hybridize to a TACH gene under conditions such that hybridization and amplification of the TACH gene (if present) occurs, and detecting the presence or absence of an amplification product, or detecting the size of the amplification product and comparing the length to a control sample. It is anticipated that PCR and/or LCR may be desirable to use as a preliminary amplification step in conjunction with any of the techniques used for detecting mutations described herein.

Alternative amplification methods include: self sustained sequence replication (Guatelli et al, 1990, Proc Natl Acad Sci USA 87:1874-1878), transcriptional amplification system (Kwoh, et al, 1989, Proc Natl Acad Sci USA 86:1173-1177), Q-Beta Replicase (Lizardi et al, 1988, BioTechnology 6:1197), or any other nucleic acid amplification method, followed by the detection of the amplified molecules using techniques well known to those of skill in the art. These detection schemes are especially useful for the detection of nucleic acid molecules if such molecules are present in very low numbers.

In an alternative embodiment, mutations in a TACH gene from a sample cell can be identified by alterations in restriction enzyme cleavage patterns. For example, sample and control DNA is isolated, amplified (optionally), digested with one or more restriction endonucleases, and fragment length sizes are determined by gel electrophoresis and compared. Differences in fragment length sizes between sample and control DNA indicates mutations in the sample DNA. Moreover, the use of sequence specific ribozymes (see, for example, U.S. Pat. No. 5,493,531) can be used to score for the presence of specific mutations by development or loss of a ribozyme cleavage site. ln other embodiments, genetic mutations in TACH can be identified by hybridizing a sample and control nucleic acids, e.g., DNA or RNA, to high density arrays containing hundreds or thousands of oligonucleotides probes (Cronin et al. (1996) Human Mutation 7: 244-255; Kozal et al. (1996) Nature Medicine 2: 753-759). For example, genetic mutations in TACH can be identified in two dimensional arrays containing light-generated DNA probes as described in Cronin et al. above. Briefly, a first hybridization array of probes can be used to scan through long stretches of DNA in a sample and control to identify base changes between the sequences by making linear arrays of sequential overlapping probes. This step allows the identification of point mutations. This step is followed by a second hybridization array that allows the characterization of specific mutations by using smaller, specialized probe arrays complementary to all variants or mutations detected. Each mutation array is composed of parallel probe sets, one complementary to the wild-type gene and the other complementary to the mutant gene. En yet another embodiment, any of a variety of sequencing reactions known in the art can be used to directly sequence the TACH gene and detect mutations by comparing the sequence of the sample TACH with the corresponding wild-type (control) sequence. Examples of sequencing reactions include those based on techniques developed by Maxim and Gilbert (1977) PNAS 74:560 or Sanger (1977) PNAS 74:5463. It is also contemplated that any of a variety of automated sequencing procedures can be utilized when performing the diagnostic assays (Naeve et al, (1995) Biotechniques 19:448), including sequencing by mass spectrometry (see, e.g., PCT International Publ. No. WO 94/16101; Cohen et al. (1996) Adv Chromatogr 36: 127-162; and Griffin et al. (1993) Appl Biochem Biotechnol 38: 147-159). Other methods for detecting mutations in the TACH gene include methods in which protection from cleavage agents is used to detect mismatched bases in RNA/RNA or RNA/DNA heteroduplexes (Myers et al. (1985) Science 230:1242). In general, the art technique of "mismatch cleavage" starts by providing heteroduplexes of formed by hybridizing (labeled) RNA or DNA containing the wild-type TACH sequence with potentially mutant RNA or DNA obtained from a tissue sample. The double-stranded duplexes are treated with an agent that cleaves single-stranded regions of the duplex such as which will exist due to basepair mismatches between the control and sample strands. For instance, RNA/DNA duplexes can be treated with RNase and DNA/DNA hybrids treated with SI nuclease to enzymatically digesting the mismatched regions. En other embodiments, either DNA/DNA or RNA/DNA duplexes can be treated with hydroxylamine or osmium tetroxide and with piperidine in order to digest mismatched regions. After digestion of the mismatched regions, the resulting material is then separated by size on denaturing polyacrylamide gels to determine the site of mutation. See, for example, Cotton et al (1988) Proc Natl Acad Sci USA 85:4397; Saleeba et al (1992) Methods Enzymol 217:286-295. En an embodiment, the control DNA or RNA can be labeled for detection. In still another embodiment, the mismatch cleavage reaction employs one or more proteins that recognize mismatched base pairs in double-stranded DNA (so called "DNA mismatch repair" enzymes) in defined systems for detecting and mapping point mutations in TACH cDNAs obtained from samples of cells. For example, the mutY enzyme of E. coli cleaves A at G/A mismatches and the thymidine DNA glycosylase from HeLa cells cleaves T at G/T mismatches (Hsu et al. (1994) Carcino genesis

15:1657-1662). According to an exemplary embodiment, a probe based on a TACH sequence, e.g., a wild-type TACH sequence, is hybridized to a cDNA or other DNA product from a test cell(s). The duplex is treated with a DNA mismatch repair enzyme, and the cleavage products, if any, can be detected from electrophoresis protocols or the like. See, for example, U.S. Pat. No. 5,459,039.

En other embodiments, alterations in electrophoretic mobility will be used to identify mutations in TACH genes. For example, single strand conformation polymorphism (SSCP) may be used to detect differences in electrophoretic mobility between mutant and wild type nucleic acids (Orita et άl. (1989) Proc Nαtl Acαd Sci 17SA: 86:2766, see also Cotton (1993) Mutαt Res 285: 125-144; Hayashi (1992) Genet Anal Tech Appl 9:73-79). Single-stranded DNA fragments of sample and control TACH nucleic acids will be denatured and allowed to renature. The secondary structure of single-stranded nucleic acids varies according to sequence, the resulting alteration in electrophoretic mobility enables the detection of even a single base change. The DNA fragments may be labeled or detected with labeled probes. The sensitivity of the assay may be enhanced by using RNA (rather than DNA), in which the secondary structure is more sensitive to a change in sequence. En one embodiment, the subject method utilizes heteroduplex analysis to separate double stranded heteroduplex molecules on the basis of changes in electrophoretic mobility (Keen et al. (1991) Trends Genet 7:5).

In yet another embodiment the movement of mutant or wild-type fragments in polyacrylamide gels containing a gradient of denaturant is assayed using denaturing gradient gel electrophoresis (DGGE) (Myers et al (1985) Nature 313:495). When DGGE is used as the method of analysis, DNA will be modified to insure that it does not completely denature, for example by adding a GC clamp of approximately 40 bp of high-melting GC-rich DNA by PCR. En a further embodiment, a temperature gradient is used in place of a denaturing gradient to identify differences in the mobility of control and sample DNA (Rosenbaum and Reissner (1987) Biophys Chem 265: 12753).

Examples of other techniques for detecting point mutations include, but are not limited to, selective oligonucleotide hybridization, selective amplification, or selective primer extension. For example, oligonucleotide primers may be prepared in which the known mutation is placed centrally and then hybridized to target DNA under conditions that permit hybridization only if a perfect match is found (Saiki et al. (1986) Nature 324:163); Saiki et al. (1989) Proc Natl Acad. Sci USA 86:6230). Such allele specific oligonucleotides are hybridized to PCR amplified target DNA or a number of different mutations when the oligonucleotides are attached to the hybridizing membrane and hybridized with labeled target DNA. Alternatively, allele specific amplification technology that depends on selective

PCR amplification may be used in conjunction with the instant invention. Oligonucleotides used as primers for specific amplification may carry the mutation of interest in the center of the molecule (so that amplification depends on differential hybridization) (Gibbs et al. (1989) Nucleic Acids Res 17:2437-2448) or at the extreme 3' end of one primer where, under appropriate conditions, mismatch can prevent, or reduce polymerase extension (Prossner (1993) Tibtech 11:238). En addition it may be desirable to introduce a novel restriction site in the region of the mutation to create cleavage-based detection (Gasparini et al (1992) Mol Cell Probes 6: 1). It is anticipated that in certain embodiments amplification may also be performed using Taq ligase for amplification (Barany (1991) Proc Natl Acad Sci USA 88: 189). In such cases, ligation will occur only if there is a perfect match at the 3' end of the 5' sequence, making it possible to detect the presence of a known mutation at a specific site by looking for the presence or absence of amplification.

The methods described herein may be performed, for example, by utilizing pre-packaged diagnostic kits comprising at least one probe nucleic acid or antibody reagent described herein, which may be conveniently used, e.g., in clinical settings to diagnose patients exhibiting symptoms or family history of a disease or illness involving a TACH gene.

Furthermore, any cell type or tissue, preferably peripheral blood leukocytes, in which TACH is expressed may be utilized in the prognostic assays described herein. However, any biological sample containing nucleated cells may be used, including, for example, buccal mucosal cells. Pharmacogenomics

Agents, or modulators that have a stimulatory or inhibitory effect on TACH activity (e.g., TACH gene expression), as identified by a screening assay described herein can be administered to individuals to treat (prophylactically or therapeutically) disorders (e.g., cancer, inflammatory or immunoregulatory disorders) associated with aberrant TACH activity. In conjunction with such treatment, the pharmacogenomics (i.e., the study of the relationship between an individual's genotype and that individual's response to a foreign compound or drug) of the individual may be considered. Differences in metabolism of therapeutics can lead to severe toxicity or therapeutic failure by altering the relation between dose and blood concentration of the pharmacologically active drug. Thus, the pharmacogenomics of the individual permits the selection of effective agents (e.g., drugs) for prophylactic or therapeutic treatments based on a consideration of the individual's genotype. Such pharmacogenomics can further be used to determine appropriate dosages and therapeutic regimens.

Accordingly, the activity of TACH protein, expression of TACH nucleic acid, or mutation content of TACH genes in an individual can be determined to thereby select appropriate agent(s) for therapeutic or prophylactic treatment of the individual.

Pharmacogenomics deals with clinically significant hereditary variations in the response to drags due to altered drug disposition and abnormal action in affected persons. See e.g., Eichelbaum, Clin Exp Pharmacol Physiol, 1996, 23:983-985 and Linder, Clin Chem, 1997, 43:254-266. In general, two types of pharmacogenetic conditions can be differentiated. Genetic conditions transmitted as a single factor altering the way drags act on the body (altered drug action) or genetic conditions transmitted as single factors altering the way the body acts on drags (altered drag metabolism). These pharmacogenetic conditions can occur either as rare defects or as polymorphisms. For example, glucose-6-phosphate dehydrogenase (G6PD) deficiency is a common inherited enzymopathy in which the main clinical complication is haemolysis after ingestion of oxidant drugs (anti-malarials, sulfonamides, analgesics, nitrofurans) and consumption of fava beans.

As an illustrative embodiment, the activity of drag metabolizing enzymes is a major determinant of both the intensity and duration of drag action. The discovery of genetic polymorphisms of drag metabolizing enzymes (e.g., N-acetyltransferase 2 (NAT 2) and cytochrome P450 enzymes CYP2D6 and CYP2C19) has provided an explanation as to why some patients do not obtain the expected drug effects or show exaggerated drug response and serious toxicity after taking the standard and safe dose of a drug. These polymorphisms are expressed in two phenotypes in the population, the extensive metabolizer (EM) and poor metabolizer (PM). The prevalence of PM is different among different populations. For example, the gene coding for CYP2D6 is highly polymorphic and several mutations have been identified in PM, which all lead to the absence of functional CYP2D6. Poor metabolizers of CYP2D6 and CYP2C19 quite frequently experience exaggerated drag response and side effects when they receive standard doses. Ef a metabolite is the active therapeutic moiety, PM show no therapeutic response, as demonstrated for the analgesic effect of codeine mediated by its CYP2D6-formed metabolite morphine. The other extreme are the so called ultra-rapid metabolizers who do not respond to standard doses. Recently, the molecular basis of ultra-rapid metabolism has been identified to be due to CYP2D6 gene amplification.

Thus, the activity of TACH protein, expression of TACH nucleic acid, or mutation content of TACH genes in an individual can be determined to thereby select appropriate agent(s) for therapeutic or prophylactic treatment of the individual. En addition, pharmacogenetic studies can be used to apply genotyping of polymorphic alleles encoding drag-metabolizing enzymes to the identification of an individual's drug responsiveness phenotype. This knowledge, when applied to dosing or drag selection, can avoid adverse reactions or therapeutic failure and thus enhance therapeutic or prophylactic efficiency when treating a subject with a TACH modulator, such as a modulator identified by one of the exemplary screening assays described herein.

Monitoring Clinical Efficacy Monitoring the influence of agents (e.g., drugs, compounds) on the expression or activity of TACH (e.g., the ability to modulate aberrant cell proliferation and/or differentiation) can be applied not only in basic drug screening, but also in clinical trials. For example, the effectiveness of an agent determined by a screening assay as described herein to increase TACH gene expression, protein levels, or upregulate TACH activity, can be monitored in clinical trials of subjects exhibiting decreased TACH gene expression, protein levels, or downregulated TACH activity. Alternatively, the effectiveness of an agent determined by a screening assay to decrease TACH gene expression, protein levels, or downregulate TACH activity, can be monitored in clinical trials of subjects exhibiting increased TACH gene expression, protein levels, or upregulated TACH activity. En such clinical trials, the expression or activity of TACH and, preferably, other genes that have been implicated in, for example, a cancer, inflammatory or immunoregulatory disorder, can be used as a "read out" or markers of the immune responsiveness of a particular cell. For example, genes, including TACH, that are modulated in cells by treatment with an agent (e.g., compound, drug or small molecule) that modulates TACH activity (e.g., identified in a screening assay as described herein) can be identified. Thus, to study the effect of agents on cellular proliferation disorders, for example, in a clinical trial, cells can be isolated and RNA prepared and analyzed for the levels of expression of TACH and other genes implicated in the disorder. The levels of gene expression

(i.e., a gene expression pattern) can be quantified by Northern blot analysis or RT-PCR, as described herein, or alternatively by measuring the amount of protein produced, by one of the methods as described herein, or by measuring the levels of activity of TACH or other genes. En this way, the gene expression pattern can serve as a marker, indicative of the physiological response of the cells to the agent. Accordingly, this response state may be determined before, and at various points during, treatment of the individual with the agent.

En one embodiment, the invention provides a method for monitoring the effectiveness of treatment of a subject with an agent (e.g., an agonist, antagonist, protein, peptide, peptidomimetic, nucleic acid, small molecule, or other drug candidate identified by the screening assays described herein) comprising the steps of ( ) obtaining a pre-administration sample from a subject prior to administration of the agent; (ii) detecting the level of expression of a TACH protein, mRNA, or genomic DNA in the preadministration sample; (iii) obtaining one or more post-administration samples from the subject; (iv) detecting the level of expression or activity of the TACH protein, mRNA, or genomic DNA in the post-administration samples; (v) comparing the level of expression or activity of the TACH protein, mRNA, or genomic DNA in the pre-administration sample with the TACH protein, mRNA, or genomic DNA in the post administration sample or samples; and (vi) altering the administration of the agent to the subject accordingly. For example, increased administration of the agent may be desirable to increase the expression or activity of TACH to higher levels than detected, i.e., to increase the effectiveness of the agent. Alternatively, decreased administration of the agent may be desirable to decrease expression or activity of TACH to lower levels than detected, i.e., to decrease the effectiveness of the agent. Methods of Treatment

The present invention provides for both prophylactic and therapeutic methods of treating a subject at risk of (or susceptible to) a disorder or having a disorder associated with aberrant TACH expression or activity.

Diseases and disorders that are characterized by increased (relative to a subject not suffering from the disease or disorder) levels or biological activity may be treated with Therapeutics that antagonize (i.e., reduce or inhibit) activity. Therapeutics that antagonize activity may be administered in a therapeutic or prophylactic manner. Therapeutics that may be utilized include, but are not limited to, (?) a TACH polypeptide, or analogs, derivatives, fragments or homologs thereof; (ii) antibodies to a TACH peptide; (iii) nucleic acids encoding a TACH peptide; (iv) administration of antisense nucleic acid and nucleic acids that are "dysfunctional" (i.e., due to a heterologous insertion within the coding sequences of coding sequences to a TACH peptide) are utilized to "knockout" endogenous function of a TACH peptide by homologous recombination (see, e.g., Capecchi, 1989. Science 244: 1288-1292); or (v) modulators (i.e., inhibitors, agonists and antagonists, including additional peptide mimetic of the invention or antibodies specific to a peptide of the invention) that alter the interaction between a TACH peptide and its binding partner.

Diseases and disorders that are characterized by decreased (relative to a subject not suffering from the disease or disorder) levels or biological activity may be treated with Therapeutics that increase (i.e., are agonists to) activity. Therapeutics that upregulate activity may be administered in a therapeutic or prophylactic manner. Therapeutics that may be utilized include, but are not limited to, a TACH peptide, or analogs, derivatives, fragments or homologs thereof; or an agonist that increases bioavailability.

Increased or decreased levels can be readily detected by quantifying peptide and/or RNA, by obtaining a patient tissue sample (e.g., from biopsy tissue) and assaying it in vitro for RNA or peptide levels, structure and/or activity of the expressed peptides (or mRNAs of a TACH peptide). Methods that are well-known within the art include, but are not limited to, immunoassays (e.g., by Western blot analysis, immunoprecipitation followed by sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis, immunocytochemistry, etc.) and/or hybridization assays to detect expression of mRNAs (e.g., Northern assays, dot blots, in situ hybridization, etc.).

En one aspect, the invention provides a method for preventing, in a subject, a disease or condition associated with an aberrant TACH expression or activity, by administering to the subject an agent that modulates TACH expression or at least one TACH activity. Subjects at risk for a disease that is caused or contributed to by aberrant TACH expression or activity can be identified by, for example, any or a combination of diagnostic or prognostic assays as described herein. Administration of a prophylactic agent can occur prior to the manifestation of symptoms characteristic of the TACH aberrancy, such that a disease or disorder is prevented or, alternatively, delayed in its progression. Depending on the type of TACH aberrancy, for example, a TACH agonist or TACH antagonist agent can be used for treating the subject. The appropriate agent can be determined based on screening assays described herein. Another aspect of the invention pertains to methods of modulating TACH expression or activity for therapeutic purposes. The modulatory method of the invention involves contacting a cell with an agent that modulates one or more of the activities of TACH protein activity associated with the cell. An agent that modulates TACH protein activity can be an agent as described herein, such as a nucleic acid or a protein, a naturally-occurring cognate ligand of a TACH protein, a peptide, a TACH peptidomimetic, or other small molecule. In one embodiment, the agent stimulates one or more TACH protein activity. Examples of such stimulatory agents include active TACH protein and a nucleic acid molecule encoding TACH that has been introduced into the cell. In another embodiment, the agent inhibits one or more TACH protein activity. Examples of such inhibitory agents include antisense TACH nucleic acid molecules and anti-TACH antibodies. These modulatory methods can be performed in vitro (e.g., by culturing the cell with the agent) or, alternatively, in vivo (e.g., by administering the agent to a subject). As such, the present invention provides methods of treating an individual afflicted with a disease or disorder characterized by aberrant expression or activity of a TACH protein or nucleic acid molecule. In one embodiment, the method involves administering an agent (e.g., an agent identified by a screening assay described herein), or combination of agents that modulates (e.g., upregulates or downregulates) TACH expression or activity. In another embodiment, the method involves administering a TACH protein or nucleic acid molecule as therapy to compensate for reduced or aberrant TACH expression or activity.

In another aspect, the present invention relates to the use of TACH-Fc fusion proteins and anti-TACH monoclonal agonistic antibodies to modulate the activity of cytokines (i.e., TNF ligand family members) that bind to TACH. The present invention is not to be limited in scope by the specific embodiments described herein. Indeed, various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description and accompanying figures. Such modifications are intended to fall within the scope of the appended claims. EXAMPLES

Isolation of murine TACH Various oligonucleotide primers were designed to detect predicted TACH and did detect corresponding mRNA from several mouse tissues. AC021547 was removed from the genebank and a mouse genomic BAC clone (RP23-6I17) was deposited (AC068006). Based on this information, a DNA probe was designed and a mouse spleen cDNA library (Stratagene) was screened. One cDNA clone containing the murine TACH was isolated from approximately 10 independent cDNA clones. Expression of murine TACH

Murine TACH is expressed at very low levels. Northern analysis of murine TACH expression was perfomed using multi-tissue Northern blots purchased from Clontech. Blots were hybridized with a 32P radio-labelled TACH probe generated by random- priming (Stratagene). Only the spleen and liver showed detectable expression. For RT- PCR analysis, first strand cDNAs from various mouse tissues were purchased from Clontech and the presence of murine TACH expression in these tissues was examined by PCR using primers NT2-393 (5' - GCACTTACCTCCGGAATCCATGCCA - 3') and NT2-396 (5' - GCATGTGTGGCACCTCTCCAAACAG - 3'). Several other mouse tissues showed expression, including heart, kidney, and lung, but not brain or testis, or tissues during embryonic development. Results are shown in Fig. 6. Equivalents From the foregoing detailed description of the specific embodiments of the invention, it should be apparent that unique have been described. Although particular embodiments have been disclosed herein in detail, this has been done by way of example for purposes of illustration only, and is not intended to be limiting with respect to the scope of the appended claims which follow. En particular, it is contemplated by the inventor that various substitutions, alterations, and modifications may be made to the invention without departing from the spirit and scope of the invention as defined by the claims.

Claims

What is claimed is:

1. An isolated nucleic acid comprising a sequence encoding a polypeptide at least 50% identical to a polypeptide comprising the amino acid sequence of Figure 1 (SEQ ED NO:2).

2. The nucleic acid of claim 1, wherein said nucleic acid encodes a polypeptide at least 90% identical to SEQ TD NO:2.

3. The nucleic acid of claim 1, wherein said nucleic acid encodes a polypeptide comprising SEQ ED NO: 2.

4. The nucleic acid of claim 1, wherein said nucleic acid comprises the nucleotide sequence shown in Figure 1 (SEQ ID NO:l).

5. The nucleic acid of claim 1, wherein said nucleic acid is DNA.

6. The nucleic acid of claim 1, wherein said nucleic acid is RNA.

7. The nucleic acid of claim 1, wherein said nucleic acid is a cDNA molecule.

8. An isolated nucleic acid comprising a nucleotide sequence complementary to at least a portion of SEQ ED NO: 1.

9. A complement of the nucleic acid of claim 8, wherein said nucleic acid of claim 8 encodes at least a portion of a TACH homolog protein.

10. The nucleic acid of claim 8 wherein said molecule is an antisense oligonucleotide directed to SEQ TD NO:l.

11. A vector comprising the nucleic acid of claims 1, 2, 3 or 4.

12. A vector of claim 11, wherein said nucleic acid comprises SEQ ID NO:l.

13. A cell comprising the vector of claim 12.

14. A pharmaceutical composition comprising the nucleic acid of claim 1 and a pharmaceutically acceptable carrier.

15. A substantially purified polypeptide encoded by the nucleic acid of claim 1, 2, 3, or 4.

16. A pharmaceutical composition comprising the polypeptide of claim 15 and a pharmaceutically acceptable carrier.

17. An antibody which binds specifically to the polypeptide of claim 15.

18. An antibody that binds to an epitope on a polypeptide of claim 15.

19. A kit comprising an antibody that binds to a polypeptide of claim 15, and, optionally, a negative control antibody.

20. A pharmaceutical composition comprising the antibody of claim 18 and a pharmaceutically acceptable carrier.

21. A method of producing a TACH polypeptide, the method comprising: providing the cell of claim 13; culturing said cell under conditions sufficient to express said TACH polypeptide; and recovering said TACH polypeptide, thereby producing said TACH polypeptide.

22. The method of claim 21, wherein said cell is a prokaryotic cell.

23. The method of claim 22, wherein said cell is a eukaryotic cell.

24. A method of diagnosing a cancer, inflammatory or immunoregulatory condition in a subject, the method comprising: providing a protein sample from said subject; measuring the amount of TACH polypeptide in said subject sample; and comparing the amount of TACH polypeptide in said subject protein sample to the amount of TACH polypeptide in a control protein sample, wherein an alteration in the amount of TACH polypeptide in said subject protein sample relative to the amount of TACH polypeptide in said control protein sample indicates the subject has a cancer, inflammatory or immunoregulatory condition.

25. The method of claim 24, wherein said TACH polypeptide is detected using the antibody of claim 17.

26. A method of diagnosing a cancer, inflammatory or immunoregulatory condition in a subject, the method comprising: providing a nucleic acid sample from said subject; ' measuring the amount of TACH nucleic acid in said subject nucleic acid sample; and comparing the amount of TACH nucleic acid sample in said subject nucleic acid to the amount of TACH nucleic acid in a control sample, wherein an alteration in the amount of TACH nucleic acid in said sample relative to the amount of TACH in said control sample indicates the subject has a cancer, inflammatory or immunoregulatory condition.

27. The method of claim 26, wherein the measured TACH nucleic acid is TACH RNA.

28. The method of claim 26, wherein the measured TACH nucleic acid is TACH

DNA.

29. The method of claim 26, wherein the TACH nucleic acid is measured using the nucleic acid of claim 1.

30. The method of claim 26, wherein the TACH nucleic acid is measured by using one or more nucleic acids which amplify the nucleic acid of claim 1.

31. A method of diagnosing a cancer, inflammatory or immunoregulatory condition in a subject, the method comprising: providing a nucleic acid sample from said subject; identifying at least a portion of the nucleotide sequence of a TACH nucleic acid in said subject nucleic acid sample; and comparing the TACH nucleotide sequence of said subject sample to a TACH nucleotide sequence of a control sample, wherein an alteration in the TACH nucleotide sequence in said sample relative to the TACH nucleotide sequence in said control sample indicates the subject has a cancer, inflammatory or immunoregulatory condition.

32. A method of treating or preventing or delaying a cancer, inflammatory or immunoregulatory condition, the method comprising administering to a subject in which such treatment or prevention or delay is desired the nucleic acid of claim 1 in an amount sufficient to treat, prevent, or delay a cancer, inflammatory or immunoregulatory condition in said subject.

33. A method of treating or preventing or delaying a cancer, inflammatory or immunoregulatory condition, the method comprising administering to a subject in which such treatment or prevention or delay is desired the polypeptide of claim 20 in an amount sufficient to treat, prevent, or delay a cancer, inflammatory or immunoregulatory condition in said subject.

34. A method of treating or preventing or delaying a cancer, inflammatory or immunoregulatory condition, the method comprising administering to a subject in which such treatment or prevention or delay is desired the antibody of claim 24 in an amount sufficient to treat, prevent or delay a cancer, inflammatory or immunoregulatory condition in said subject.

35. A method for identifying a compound that binds TACH protein comprising the steps of: a) contacting TACH protein with a compound; and b) determining whether said compound binds TACH protein.

36. A method of claim 35, wherein binding of said compound to TACH protein is determined by a protein binding assay.

37. A compound identified by the method of claim 35.

38. A method for identifying a compound that binds a nucleic acid encoding TACH protein comprising the steps of: a) contacting said nucleic acid encoding TACH protein with a compound; and b) determining whether said compound binds said nucleic acid molecule.

39. A compound identified by the method of claim 38.

40. A method for identifying a compound that modulates the activity of TACH protein comprising the steps of: a) contacting TACH protein with a compound; of b) determining whether TACH protein activity has been modulated.

41. A compound identified by the method of claim 40.