WO2002026996A2 - Regulation d'enzyme humaine de type phospholipase c specifique du phosphatidylinositol - Google Patents

Regulation d'enzyme humaine de type phospholipase c specifique du phosphatidylinositol Download PDF

Info

Publication number
WO2002026996A2
WO2002026996A2 PCT/EP2001/011012 EP0111012W WO0226996A2 WO 2002026996 A2 WO2002026996 A2 WO 2002026996A2 EP 0111012 W EP0111012 W EP 0111012W WO 0226996 A2 WO0226996 A2 WO 0226996A2
Authority
WO
WIPO (PCT)
Prior art keywords
plc
enzyme
polypeptide
seq
polynucleotide
Prior art date
Application number
PCT/EP2001/011012
Other languages
English (en)
Other versions
WO2002026996A3 (fr
Inventor
Zhimin Zhu
Original Assignee
Bayer Aktiengesellschaft
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Bayer Aktiengesellschaft filed Critical Bayer Aktiengesellschaft
Priority to AU2002210514A priority Critical patent/AU2002210514A1/en
Publication of WO2002026996A2 publication Critical patent/WO2002026996A2/fr
Publication of WO2002026996A3 publication Critical patent/WO2002026996A3/fr

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • A61P11/06Antiasthmatics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide

Definitions

  • the invention relates to the area of enzyme regulation. More particularly, the invention relates to the regulation of human phosphatidylinositol-specific phospholipase C-like enzyme and its regulation.
  • PLC Phospholipase C
  • PI-PLC phosphatidylinositol-specific phospholipase C
  • PI-PLC-like enzyme phosphatidylinositol-specific phospholipase C-like enzyme
  • amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO: 2, and
  • Yet another embodiment of the invention is a method of screening for agents which decrease extracellular matrix degradation.
  • a test compound is contacted with a PI- PLC-like enzyme polypeptide comprising an amino acid sequence selected from the group consisting of:
  • amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO: 2, and
  • Binding between the test compound and the PI-PLC-like enzyme polypeptide is detected.
  • a test compound which binds to the PI-PLC-like enzyme polypeptide is thereby identified as a potential agent for decreasing extracellular matrix degradation.
  • the agent can work by decreasing the activity of the PI-PLC-like enzyme.
  • Another embodiment of the invention is a method of screening for agents which decrease extracellular matrix degradation.
  • a test compound is contacted with a polynucleotide encoding a PI-PLC-like enzyme polypeptide, wherein the poly- nucleotide comprises a nucleotide sequence selected from the group consisting of: nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO: 1 and,
  • a test compound which binds to the polynucleotide is identified as a potential agent for decreasing extracellular matrix degradation.
  • the agent can work by decreasing the amount of the PI-PLC-like enzyme through interacting with the PI-PLC-like enzyme mRNA.
  • Another embodiment of the invention is a method of screening for agents which regulate extracellular matrix degradation.
  • a test compound is contacted with a PI- PLC-like enzyme polypeptide comprising an amino acid sequence selected from the group consisting of:
  • amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO: 2 and,
  • a PI-PLC-like enzyme activity of the polypeptide is detected.
  • a test compound which increases PI-PLC-like enzyme activity of the polypeptide relative to PI-PLC- like enzyme activity in the absence of the test compound is thereby identified as a potential agent for increasing extracellular matrix degradation.
  • a test compound which decreases PI-PLC-like enzyme activity of the polypeptide relative to PI-PLC- like enzyme activity in the absence of the test compound is thereby identified as a potential agent for decreasing extracellular matrix degradation.
  • Yet another embodiment of the invention is a method of screening for agents which decrease extracellular matrix degradation.
  • a test compound is contacted with a PI- PLC-like enzyme product of a polynucleotide which comprises a nucleotide sequence selected from the group consisting of:
  • nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO: 1 and,
  • Binding of the test compound to the PI-PLC-like enzyme product is detected.
  • test compound which binds to the PI-PLC-like enzyme product is thereby identified as a potential agent for decreasing extracellular matrix degradation.
  • Still another embodiment of the invention is a method of reducing extracellular matrix degradation.
  • a cell is contacted with a reagent which specifically binds to a polynucleotide encoding a PI-PLC-like enzyme polypeptide or the product encoded by the polynucleotide, wherein the polynucleotide comprises a nucleotide sequence selected from the group consisting of:
  • nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO: 1 and,
  • PI-PLC-like enzyme activity in the cell is thereby decreased.
  • the invention thus provides a human phosphatidylinositol-specific phospholipase C- like enzyme which can be used to identify test compounds which may act, for example, as agonists or antagonists at the enzyme's active site.
  • Human phosphatidylinositol-specific phospholipase C-like enzyme and fragments thereof also are useful in raising specific antibodies which can block the enzyme and effectively reduce its activity.
  • Fig. 1 shows the DNA-sequence encoding a PI-PLC-like enzyme polypeptide (SEQ ID NO: 1).
  • Fig. 2 shows the amino acid sequence deduced from the DNA-sequence of Fig.1 (SEQ ID NO:2).
  • Fig. 3 shows the amino acid sequence of Drosophila melanogaster protein identified with Swissprot Accession No. P25455 (SEQ ID NO:3).
  • Fig. 4 shows the DNA-sequence encoding a PI-PLC-like enzyme polypeptide
  • Fig. 5 shows the DNA-sequence encoding a PI-PLC-like enzyme polypeptide
  • Fig. 6 shows the DNA-sequence encoding a PI-PLC-like enzyme polypeptide (SEQ ID NO: 6).
  • Fig. 7 shows the DNA-sequence encoding a PI-PLC-like enzyme polypeptide (SEQ ID NO: 7).
  • Fig. 8 shows the DNA-sequence encoding a PI-PLC-like enzyme polypeptide
  • Fig. 9 shows the DNA-sequence encoding a PI-PLC-like enzyme polypeptide (SEQ ID NO: 9).
  • Fig. 10 shows the DNA-sequence encoding a PI-PLC-like enzyme polypeptide (SEQ ID NO: 10).
  • Fig. 11 shows the DNA-sequence encoding a PI-PLC-like enzyme polypeptide (SEQ ID NO: 11).
  • Fig. 12 shows the DNA-sequence encoding a PI-PLC-like enzyme polypeptide (SEQ ID NO: 12).
  • Fig. 13 shows the DNA-sequence encoding a PI-PLC-like enzyme polypeptide
  • Fig. 14 shows the DNA-sequence encoding a PI-PLC-like enzyme polypeptide
  • Fig.15 shows the DNA-sequence encoding a PI-PLC-like enzyme polypeptide
  • Fig. 16 shows the DNA-sequence encoding a PI-PLC-like enzyme polypeptide (SEQ ID NO: 16).
  • Fig. 17 shows the DNA-sequence encoding a PI-PLC-like enzyme polypeptide (SEQ ID NO: 17).
  • Fig. 18 shows the DNA-sequence encoding a PI-PLC-like enzyme polypeptide
  • Fig. 19 shows the DNA-sequence encoding a PI-PLC-like enzyme polypeptide (SEQ ID NO: 19).
  • Fig. 20 shows the DNA-sequence encoding a PI-PLC-like enzyme polypeptide (SEQ ID NO:20).
  • Fig. 21 shows the BLASTP alignment of SEQ ID NO:2 with SEQ ID NO:3.
  • Fig. 22 shows the HMMPFAM - alignment of SEQ ID NO:2 against pfam
  • Fig. 23 shows the HMMPFAM - alignment of SEQ ID NO:2 against pfam
  • Fig. 24 shows the HMMPFAM - alignment of SEQ ED NO:2 against pfam
  • Fig. 25 shows the expression profiling of PI-PLC-like enzyme mRNA, whole- body screen
  • Fig. 26 shows the expression profiling of PI-PLC-like enzyme mRNA, in cancer tissues (normalized to 18S RNA)
  • Fig. 27 shows the expression profiling of PI-PLC-like enzyme mRNA, in cancer tissues (copy number)
  • the invention relates to an isolated polynucleotide encoding a PI-PLC-like enzyme polypeptide and being selected from the group consisting of:
  • a polynucleotide encoding a PI-PLC-like enzyme polypeptide comprising an amino acid sequence selected from the group consisting of: amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO: 2 and, the amino acid sequence shown in SEQ ID NO: 2.
  • PI-PLC-like enzyme phosphatidylinositol-specific phospholipase C-like enzyme
  • Human PI-PLC-like enzyme comprises the amino acid sequence shown in SEQ ID NO: 1
  • Human PI-PLC-like enzyme is 31% identical over 672 amino acids to the Drosophila melanogaster protein identified with SwissProt Accession No. P25455 and annotated as ' -PHOSPHAT_DYLINOSITOI_-4 5 5-BISPHOSPHATE PHOSPHODIESTERASE
  • a coding sequence for human PI-PLC-like enzyme is shown in SEQ ID NO:l and located on chromosome 3.
  • Related ESTs (SEQ ID NOS:4-20) are expressed in colon, pooled endometrial adenocarcinoma, pooled tumors, pooled fetal lung, testis, B cells, multiple sclerosis lesions, and the infant brain of a muscular atrophy patient.
  • Human PI-PLC-like enzyme of the invention is expected to be useful for the same purposes as previously identified phospholipase C enzymes.
  • human PI-PLC- like enzyme can be used in therapeutic methods to treat disorders such as asthma, cancer, CNS disorders, and chronic obstructive pulmonary disease.
  • Human PI-PLC- like enzyme also can be used to screen for human PI-PLC-like enzyme agonists and antagonists.
  • Human PI-PLC-like enzyme polypeptides comprise at least 6, 10, 15, 20, 25, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, 600, 625, 650, 675, 700, 725, 750, 775, or 785 contiguous amino acids selected from the amino acid sequence shown in SEQ ID NO:2 or a biologically active variant thereof, as defined below.
  • a PI-PLC-like enzyme polypeptide of the invention therefore can be a portion of a PI-PLC-like enzyme protein, a full-length PI-PLC-like enzyme protein, or a fusion protein comprising all or a portion of a PI-PLC-like enzyme protein.
  • naturally or non-naturally occurring PI-PLC-like enzyme polypeptide variants have amino acid sequences which are at least about 50, 55, 60, 65, or 70, preferably about 75, 80, 85, 90, 96, 96, or 98% identical to the amino acid sequence shown in SEQ ID NO:2 or a fragment thereof.
  • Percent identity between a putative PI-PLC-like enzyme polypeptide variant and an amino acid sequence of SEQ ID NO:2 is deteraiined using the Blast2 alignment program (Blosum62, Expect 10, standard genetic codes).
  • Variations in percent identity can be due, for example, to amino acid substitutions, insertions, or deletions.
  • Amino acid substitutions are defined as one for one amino acid replacements. They are conservative in nature when the substituted amino acid has similar structural and/or chemical properties. Examples of conservative replacements are substitution of a leucine with an isoleucine or valine, an aspartate with a glutamate, or a threonine with a serine.
  • Amino acid insertions or deletions are changes to or within an amino acid sequence. They typically fall in the range of about 1 to 5 amino acids. Guidance in determining which amino acid residues can be substituted, inserted, or deleted without abolishing biological or immunological activity of a PI-PLC-like enzyme polypeptide can be found using computer programs well known in the art, such as DNASTAR software.
  • Whether an amino acid change results in a biologically active PI-PLC-like enzyme polypeptide can readily be determined by assaying for phospholipase C activity, as described for example, in the specific Examples, below.
  • Fusion proteins are useful for generating antibodies against PI-PLC-like enzyme polypeptide amino acid sequences and for use in various assay systems. For example, fusion proteins can be used to identify proteins which interact with portions of a PI- PLC-like enzyme polypeptide. Protein affinity chromatography or library-based assays for protein-protein interactions, such as the yeast two-hybrid or phage display systems, can be used for this purpose. Such methods are well known in the art and also can be used as drug screens.
  • a PI-PLC-like enzyme polypeptide fusion protein comprises two polypeptide segments fused together by means of a peptide bond.
  • the first polypeptide segment comprises at least 6, 10, 15, 20, 25, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, 600, 625, 650, 675, 700, 725, 750, 775, or 785 contiguous amino acids of SEQ ID NO:2 or of a biologically active variant, such as those described above.
  • the first polypeptide segment also can comprise full-length PI-PLC-like enzyme protein.
  • the second polypeptide segment can be a full-length protein or a protein fragment.
  • Proteins commonly used in fusion protein construction include ⁇ -galactosidase, ⁇ - glucuronidase, green fluorescent protein (GFP), autofluorescent proteins, including blue fluorescent protein (BFP), glutathione-S-transferase (GST), luciferase, horseradish peroxidase (HRP), and chloramphenicol acetyltransferase (CAT).
  • epitope tags are used in fusion protein constructions, including histidine (His) tags, FLAG tags, influenza hemagglutinin (HA) tags, Myc tags, VSV-G tags, and thioredoxin (Trx) tags.
  • fusion constructions can include maltose binding protein (MBP), S-tag, Lex a DNA binding domain (DBD) fusions, GAL4 DNA binding domain fusions, and herpes simplex virus (HSV) BP16 protein fusions.
  • MBP maltose binding protein
  • S-tag S-tag
  • GAL4 DNA binding domain fusions GAL4 DNA binding domain fusions
  • HSV herpes simplex virus
  • a fusion protein also can be engineered to contain a cleavage site located between the PI-PLC-like enzyme polypeptide-encoding sequence and the heterologous protein sequence, so that the PI-PLC-like enzyme polypeptide can be cleaved and purified away from the heterologous moiety.
  • a fusion protein can be synthesized chemically, as is known in the art.
  • a fusion protein is produced by covalently linking two polypeptide segments or by standard procedures in the art of molecular biology.
  • Recombinant DNA methods can be used to prepare fusion proteins, for example, by making a DNA construct which comprises coding sequences selected from SEQ ID NO:l in proper reading frame with nucleotides encoding the second polypeptide segment and expressing the DNA construct in a host cell, as is known in the art.
  • kits for constructing fusion proteins are available from companies such as Promega Corporation (Madison, WI), Stratagene (La Jolla, CA), CLONTECH (Mountain View, CA), Santa Cruz Biotechnology (Santa Cruz, CA), MBL International Corporation (MIC; Watertown, MA), and Quantum Biotechnologies (Montreal, Canada; 1-888-DNA-KITS).
  • Species homologs of human PI-PLC-like enzyme polypeptide can be obtained using PI-PLC-like enzyme polypeptide polynucleotides (described below) to make suitable probes or primers for screening cDNA expression libraries from other species, such as mice, monkeys, or yeast, identifying cDNAs which encode homologs of PI-PLC- like enzyme polypeptide, and expressing the cDNAs as is known in the art.
  • a PI-PLC-like enzyme polynucleotide can be single- or double-stranded and comprises a coding sequence or the complement of a coding sequence for a PI-PLC- like enzyme polypeptide.
  • a partial coding sequence for human PI-PLC-like enzyme is shown in SEQ ID NO:l.
  • nucleotide sequences encoding human PI-PLC-like enzyme polypeptides, as well as homologous nucleotide sequences which are at least about 50, 55, 60, 65,
  • PI-PLC-like enzyme polynucleotides 70, preferably about 75, 90, 96, or 98% identical to the nucleotide sequence shown in SEQ ID NO:l or its complement also are PI-PLC-like enzyme polynucleotides. Percent sequence identity between the sequences of two polynucleotides is determined using computer programs such as ALIGN which employ the FASTA algorithm, using an affine gap search with a gap open penalty of -12 and a gap extension penalty of -2.
  • cDNA Complementary DNA
  • species homologs, and variants of PI-PLC-like enzyme polynucleotides which encode biologically active PI-PLC-like enzyme polypeptides also are PI-PLC-like enzyme polynucleotides. Identification of Polynucleotide Variants and Homologs
  • Variants and homologs of the PI-PLC-like enzyme polynucleotides described above also are PI-PLC-like enzyme polynucleotides.
  • homologous PI-PLC-like enzyme polynucleotide sequences can be identified by hybridization of candidate polynucleotides to known PI-PLC-like enzyme polynucleotides under stringent conditions, as is known in the art.
  • Species homologs of the PI-PLC-like enzyme polynucleotides disclosed herein also can be identified by making suitable probes or primers and screening cDNA expression libraries from other species, such as mice, monkeys, or yeast.
  • Human variants of PI-PLC-like enzyme polynucleotides can be identified, for example, by screening human cDNA expression libraries. It is well known that the T m of a double-stranded DNA decreases by 1-1.5°C with every 1% decrease in homology (Bonner et al, J. Mol. Biol. 81, 123 (1973).
  • Variants of human PI-PLC-like enzyme polynucleotides or PI-PLC-like enzyme polynucleotides of other species can therefore be identified by hybridizing a putative homologous PI-PLC-like enzyme polynucleotide with a polynucleotide having a nucleotide sequence of SEQ ID NO:l or the complement thereof to form a test hybrid.
  • the melting temperature of the test hybrid is compared with the melting temperature of a hybrid comprising polynucleotides having perfectly complementary nucleotide sequences, and the number or percent of basepair mismatches within the test hybrid is calculated.
  • Nucleotide sequences which hybridize to PI-PLC-like enzyme polynucleotides or their complements following stringent hybridization and/or wash conditions also are PI-PLC-like enzyme polynucleotides.
  • Stringent wash conditions are well known and understood in the art and are disclosed, for example, in Sambrook et al, MOLECULAR CLONING: A LABORATORY MANUAL, 2d ed., 1989, at pages 9.50-9.51.
  • T m of a hybrid between a PI-PLC-like enzyme polynucleotide having a nucleotide sequence shown in SEQ ID NO:l or the complement thereof and a polynucleotide sequence which is at least about 50, preferably about 75, 90, 96, or 98% identical to one of those nucleotide sequences can be calculated, for example, using the equation of Bolton and McCarthy, Proc. Natl. Acad. Sci. U.S.A. 48, 1390 (1962):
  • Stringent wash conditions include, for example, 4X SSC at 65°C, or 50% formamide, 4X SSC at 42°C, or 0.5X SSC, 0.1% SDS at 65°C.
  • Highly stringent wash conditions include, for example, 0.2X SSC at 65°C.
  • a PI-PLC-like enzyme polynucleotide can be isolated free of other cellular components such as membrane components, proteins, and lipids.
  • Polynucleotides can be made by a cell and isolated using standard nucleic acid purification techniques, or synthesized using an amplification technique, such as the polymerase chain reaction (PCR), or by using an automatic synthesizer. Methods for isolating polynucleotides are routine and are known in the art. Any such technique for obtaining a polynucleotide can be used to obtain isolated PI-PLC-like enzyme polynucleotides.
  • restriction enzymes and probes can be used to isolate polynucleotide fragments which comprises PI-PLC-like nucleotide sequences.
  • Isolated polynucleotides are in preparations which are free or at least 70, 80, or 90% free of other molecules.
  • Human PI-PLC-like enzyme cDNA molecules can be made with standard molecular biology techniques, using PI-PLC-like enzyme mRNA as a template. Human PI- PLC-like enzyme cDNA molecules can thereafter be replicated using molecular biology techniques known in the art and disclosed in manuals such as Sambrook et al. (1989). An amplification technique, such as PCR, can be used to obtain additional copies of polynucleotides of the invention, using either human genomic DNA or cDNA as a template.
  • PI-PLC-like enzyme polynucleotides can be synthesized using synthetic chemistry techniques to synthesize PI-PLC-like enzyme polynucleotides.
  • the degeneracy of the genetic code allows alternate nucleotide sequences to be synthesized which will encode a PI-PLC-like enzyme polypeptide having, for example, an amino acid sequence shown in SEQ ID NO:2 or a biologically active variant thereof.
  • the partial sequences disclosed herein can be used to identify the corresponding full length gene from which they were derived.
  • the partial sequences can be nick-translated or end-labeled with 32 P using polynucleotide kinase using labeling methods known to those with skill in the art (BASIC METHODS IN MOLECULAR
  • a lambda library prepared from human tissue can be directly screened with the labeled sequences of interest or the library can be converted en masse to pBluescript (Stratagene Cloning Systems, La Jolla, Calif. 92037) to facilitate bacterial colony screening (see Sambrook et al, MOLECULAR CLONING: A LABORATORY MANUAL, Cold Spring Harbor Laboratory
  • Positive cDNA clones are analyzed to determine the amount of additional sequence they contain using PCR with one primer from the partial sequence and the other primer from the vector.
  • Clones with a larger vector-insert PCR product than the original partial sequence are analyzed by restriction digestion and DNA sequencing to determine whether they contain an insert o
  • the complete sequence of the clones can be determined , for example after exonuclease III digestion (McCom- bie et al., Methods 3, 33-40, 1991).
  • a series of deletion clones are generated, each of which is sequenced.
  • the resulting overlapping sequences are assembled into a single contiguous sequence of high redundancy (usually three to five overlapping sequences at each nucleotide position), resulting in a highly accurate final sequence.
  • PCR-based methods can be used to extend the nucleic acid sequences disclosed herein to detect upstream sequences such as promoters and regulatory elements.
  • restriction-site PCR uses universal primers to retrieve unknown sequence adjacent to a known locus (Sarkar, PCR Methods Applic. 2,
  • Genomic DNA is first amplified in the presence of a primer to a linker sequence and a primer specific to the known region. The amplified sequences are then subjected to a second round of PCR with the same linker primer and another specific primer internal to the first one. Products of each round of PCR are transcribed with an appropriate RNA polymerase and sequenced using reverse transcriptase.
  • Inverse PCR also can be used to amplify or extend sequences using divergent primers based on a known region (Triglia et al, Nucleic Acids Res. 16, 8186, 1988).
  • Primers can be designed using commercially available software, such as OLIGO 4.06 Primer Analysis software (National Biosciences Inc., Madison, Minn.), to be 22-30 nucleotides in length, to have a GC content of 50% or more, and to anneal to the target sequence at temperatures about 68-72 °C.
  • the method uses several restriction enzymes to generate a suitable fragment in the known region of a gene. The fragment is then circularized by intramolecular ligation and used as a PCR template.
  • capture PCR involves PCR amplification of DNA fragments adjacent to a known sequence in human and yeast artificial chromosome DNA (Lagerstrom et al, PCR Methods Applic. 1, 111-119, 1991).
  • multiple restriction enzyme digestions and ligations also can be used to place an engineered double-stranded sequence into an unknown fragment of the DNA molecule before performing PCR.
  • Randomly-primed libraries are preferable, in that they will contain more sequences which contain the 5' regions of genes. Use of a randomly primed library may be especially preferable for situations in which an oligo d(T) library does not yield a full-length cDNA. Genomic libraries can be useful for extension of sequence into 5' non-transcribed regulatory regions.
  • capillary electrophoresis systems can be used to analyze the size or confirm the nucleotide sequence of PCR or sequencing products.
  • capillary sequencing can employ flowable polymers for electrophoretic separation, four different fluorescent dyes (one for each nucleotide) which are laser activated, and detection of the emitted wavelengths by a charge coupled device camera.
  • Output/light intensity can be converted to electrical signal using appropriate software (e.g. GENOTYPER and Sequence NAVIGATOR, Perkin Elmer), and the entire process from loading of samples to computer analysis and electronic data display can be computer controlled.
  • Capillary electrophoresis is especially preferable for the sequencing of small pieces of DNA which might be present in limited amounts in a particular sample.
  • Human PI-PLC-like enzyme polypeptides can be obtained, for example, by purification from human cells, by expression of PI-PLC-like enzyme polynucleotides, or by direct chemical synthesis.
  • Human PI-PLC-like enzyme polypeptides can be purified from any cell which expresses the enzyme, including host cells which have been transfected with PI-PLC- like enzyme expression constructs.
  • a purified PI-PLC-like enzyme polypeptide is separated from other compounds which normally associate with the PI-PLC-like enzyme polypeptide in the cell, such as certain proteins, carbohydrates, or lipids, using methods well-known in the art. Such methods include, but are not limited to, size exclusion chromatography, ammonium sulfate fractionation, ion exchange chromatography, affinity chromatography, and preparative gel electrophoresis.
  • a preparation of purified PI-PLC-like enzyme polypeptides is at least 80% pure; preferably, the preparations are 90%, 95%, or 99% pure. Purity of the preparations can be assessed by any means known in the art, such as SDS-polyacrylamide gel electrophoresis. ,
  • the polynucleotide can be inserted into an expression vector which contains the necessary elements for the transcription and translation of the inserted coding sequence.
  • Methods which are well known to those skilled in the art can be used to construct expression vectors containing sequences encoding PI-PLC-like enzyme polypeptides and appropriate transcriptional and translational control elements. These methods include in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. Such techniques are described, for example, in Sambrook et al. (1989) and in Ausubel et al, CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, N.Y., 1989.
  • a variety of expression vector/host systems can be utilized to contain and express sequences encoding a PI-PLC-like enzyme polypeptide.
  • microorganisms such as bacteria transformed with recombinant bacteriophage, plasmid, or cosmid DNA expression vectors; yeast transformed with yeast expression vectors, insect cell systems infected with virus expression vectors (e.g., baculovirus), plant cell systems transformed with virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or with bacterial expression vectors (e.g., Ti or pBR322 plasmids), or animal cell systems.
  • microorganisms such as bacteria transformed with recombinant bacteriophage, plasmid, or cosmid DNA expression vectors
  • yeast transformed with yeast expression vectors insect cell systems infected with virus expression vectors (e.g., baculovirus), plant cell systems transformed with virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic
  • control elements or regulatory sequences are those non-translated regions of the vector - enhancers, promoters, 5' and 3' untranslated regions - which interact with host cellular proteins to carry out transcription and translation. Such elements can vary in their strength and specificity. Depending on the vector system and host utilized, any number of suitable transcription and translation elements, including constitutive and inducible promoters, can be used. For example, when cloning in bacterial systems, inducible promoters such as the hybrid lacZ promoter of the BLUESCRIPT phagemid (Stratagene, LaJolla, Calif.) or pSPORTl plasmid (Life Technologies) and the like can be used. The baculovirus polyhedrin promoter can be used in insect cells.
  • Promoters or enhancers derived from the genomes of plant cells e.g., heat shock, RUBISCO, and storage protein genes
  • plant viruses e.g., viral promoters or leader sequences
  • promoters from mammalian genes or from mammalian viruses are preferable. If it is necessary to generate a cell line that contains multiple copies of a nucleotide sequence encoding a PI-PLC-like enzyme polypeptide, vectors based on SN40 or EBN can be used with an appropriate selectable marker.
  • a number of expression vectors can be selected depending upon the use intended for the PI-PLC-like enzyme polypeptide. For example, when a large quantity of a PI-PLC-like enzyme polypeptide is needed for the induction of antibodies, vectors which direct high level expression of fusion proteins that are readily purified can be used. Such vectors include, but are not limited to, multifunctional E. coli cloning and expression vectors such as BLUESCRIPT (Stratagene).
  • a sequence encoding the PI-PLC-like enzyme polypeptide can be ligated into the vector in frame with sequences for the amino-terminal Met and the subsequent 7 residues of ⁇ -galactosidase so that a hybrid protein is produced.
  • pI ⁇ vectors Na Heeke & Schuster, J. Biol. Chem. 264,
  • GST glutathione S-transferase
  • fusion proteins are soluble and can easily be purified from lysed cells by adsorption to glutathione-agarose beads followed by elution in the presence of free glutathione.
  • Proteins made in such systems can be designed to include heparin, thrombin, or factor Xa protease cleavage sites so that the cloned polypeptide of interest can be released from the GST moiety at will.
  • yeast Saccharomyces cerevisiae a number of vectors containing constitutive or inducible promoters such as alpha factor, alcohol oxidase, and PGH can be used.
  • PI-PLC- like enzyme polypeptides can be driven by any of a number of promoters.
  • viral promoters such as the 35S and 19S promoters of CaMV can be used alone or in combination with the omega leader sequence from TMV (Takamatsu, EMBO J. 6, 307-311, 1987).
  • plant promoters such as the small subunit of RUBISCO or heat shock promoters can be used (Coruzzi et al, EMBO J. 3, 1671-1680, 1984; Broglie et al, Science 224, 838-843, 1984; Winter et al, Results Probl. Cell Differ. 17, 85-105, 1991).
  • These constructs can be introduced into plant cells by direct DNA transformation or by pathogen-mediated transfection. Such techniques are described in a number of generally available reviews (e.g., Hobbs or
  • An insect system also can be used to express a PI-PLC-like enzyme polypeptide.
  • PI-PLC-like enzyme polypeptide for example, in one such system Autographa californica nuclear polyhedrosis virus
  • PI-PLC-like enzyme polypeptides are used as a vector to express foreign genes in Spodoptera frugiperda cells or in Trichoplusia larvae. Sequences encoding PI-PLC-like enzyme polypeptides can be cloned into a non-essential region of the virus, such as the polyhedrin gene, and placed under control of the polyhedrin promoter. Successful insertion of PI-PLC-like enzyme polypeptides will render the polyhedrin gene inactive and produce recombinant virus lacking coat protein. The recombinant viruses can then be used to infect S. frugiperda cells or Trichoplusia larvae in which PI-PLC-like enzyme polypeptides can be expressed (Engelhard et al, Proc. Nat. Acad. Sci. 91, 3224-3227, 1994).
  • a number of viral-based expression systems can be used to express PI-PLC-like enzyme polypeptides in mammalian host cells.
  • sequences encoding PI-PLC-like enzyme polypeptides can be ligated into an adenovirus transcription/translation complex comprising the late promoter and tripartite leader sequence. Insertion in a non-essential El or E3 region of the viral genome can be used to obtain a viable virus which is capable of expressing a PI-PLC-like enzyme polypeptide in infected host cells (Logan & Shenk, Proc. Natl. Acad. Sci. 81, 3655-3659, 1984).
  • transcription enhancers such as the Rous sarcoma virus (RSV) enhancer, can be used to increase expression in mammalian host cells.
  • RSV Rous sarcoma virus
  • HACs Human artificial chromosomes
  • 6M to 10M are constructed and delivered to cells via conventional delivery methods (e.g., liposomes, polycationic amino polymers, or vesicles).
  • Specific initiation signals also can be used to achieve more efficient translation of sequences encoding PI-PLC-like enzyme polypeptides. Such signals include the ATG initiation codon and adjacent sequences. In cases where sequences encoding a
  • PI-PLC-like enzyme polypeptide, its initiation codon, and upstream sequences are inserted into the appropriate expression vector, no additional transcriptional or translational control signals may be needed.
  • exogenous translational control signals including the ATG initiation codon
  • the initiation codon should be in the correct reading frame to ensure translation of the entire insert.
  • Exogenous translational elements and initiation codons can be of various origins, both natural and synthetic. The efficiency of expression can be enhanced by the inclusion of enhancers which are appropriate for the particular cell system which is used (see Schaif et al, Results Probl. Cell Differ. 20, 125-162, 1994).
  • a host cell strain can be chosen for its ability to modulate the expression of the inserted sequences or to process the expressed PI-PLC-like enzyme polypeptide in the desired fashion.
  • modifications of the polypeptide include, but are not limited to, acetylation, carboxylation, glycosylation, phosphorylation, lipidation, and acylation.
  • Post-translational processing which cleaves a "prepro" form of the polypeptide also can be used to facilitate correct insertion, folding and/or function, different host cells which have specific cellular machinery and characteristic mechanisms for post-translational activities (e.g., CHO, HeLa, MDCK, HEK293, and
  • WI38 are available from the American Type Culture Collection (ATCC; 10801 University Boulevard, Manassas, VA 20110-2209) and can be chosen to ensure the correct modification and processing of the foreign protein.
  • Stable expression is preferred for long-term, high-yield production of recombinant proteins.
  • cell lines which stably express PI-PLC-like enzyme polypeptides can be transformed using expression vectors which can contain viral origins of replication and or endogenous expression elements and a selectable marker gene on the same or on a separate vector. Following the introduction of the vector, cells can be allowed to grow for 1-2 days in an enriched medium before they are switched to a selective medium.
  • the purpose of the selectable marker is to confer resistance to selection, and its presence allows growth and recovery of cells which successfully express the introduced PI-PLC-like enzyme sequences.
  • Resistant clones of stably transformed cells can be proliferated using tissue culture techniques appropriate to the cell type. See, for example, ANIMAL CELL CULTURE, R.I. Freshney, ed., 1986. Any number of selection systems can be used to recover transformed cell lines.
  • herpes simplex virus thymidine kinase (Wigler et al, Cell 11, 223-32, 1977) and adenine phosphoribosylrransferase (Lowy et al, Cell 22, 817-23, 1980) genes which can be employed in tk ⁇ or aprf cells, respectively.
  • antimetabolite, antibiotic, or herbicide resistance can be used as the basis for selection.
  • dhfr confers resistance to methotrexate (Wigler et al, Proc. Natl. Acad. Sci.
  • npt confers resistance to the aminoglycosides, neomycin and G-418 (Colbere-Garapin et al, J. Mol. Biol. 150, 1-14, 1981), and als and pat confer resistance to chlorsulfuron and phosphinotricin acetyltransferase, respectively (Murray, 1992, supra). Additional selectable genes have been described. For example, trpB allows cells to utilize indole in place of tryptophan, or hisD, which allows cells to utilize histinol in place of histidine (Hartman & Mulligan, Proc. Natl. Acad. Sci. 85, 8047-51, 1988).
  • Visible markers such as anthocyanins, ⁇ -glucuronidase and its substrate GUS, and luciferase and its substrate luciferin, can be used to identify transformants and to quantify the amount of transient or stable protein expression attributable to a specific vector system (Rhodes et al, Methods Mol. Biol. 55, 121-131, 1995).
  • marker gene expression suggests that the PI-PLC-like enzyme polynucleotide is also present, its presence and expression may need to be confirmed.
  • a sequence encoding a PI-PLC-like enzyme polypeptide is inserted within a marker gene sequence, transformed cells containing sequences which encode a PI-PLC-like enzyme polypeptide can be identified by the absence of marker gene function.
  • a marker gene can be placed in tandem with a sequence encoding a PI-PLC-like enzyme polypeptide under the control of a single promoter. Expression of the marker gene in response to induction or selection usually indicates expression of the PI-PLC-like enzyme polynucleotide.
  • host cells which contain a PI-PLC-like enzyme polynucleotide and which express a PI-PLC-like enzyme polypeptide can be identified by a variety of procedures known to those of skill in the art. These procedures include, but are not limited to, DNA-DNA or DNA-RNA hybridizations and protein bioassay or immunoassay techniques which include membrane, solution, or chip-based technologies for the detection and/or quantification of nucleic acid or protein.
  • the presence of a polynucleotide sequence encoding a PI-PLC-like enzyme polypeptide can be detected by DNA-DNA or DNA-RNA hybridization or amplification using probes or fragments or fragments of polynucleotides encoding a PI-PLC-like enzyme polypeptide.
  • Nucleic acid amplification-based assays involve the use of oligonucleotides selected from sequences encoding a PI-PLC-like enzyme polypeptide to detect transformants which contain a PI-PLC-like enzyme polynucleotide.
  • a variety of protocols for detecting and measuring the expression of a PI-PLC-like enzyme polypeptide, using either polyclonal or monoclonal antibodies specific for the polypeptide, are known in the art. Examples include enzyme-linked irnmuno- sorbent assay (ELISA), radioimmunoassay (RIA), and fluorescence activated cell sorting (FACS).
  • ELISA enzyme-linked irnmuno- sorbent assay
  • RIA radioimmunoassay
  • FACS fluorescence activated cell sorting
  • a two-site, monoclonal-based immunoassay using monoclonal antibodies reactive to two non-interfering epitopes on a PI-PLC-like enzyme polypeptide can be used, or a competitive binding assay can be employed.
  • Means for producing labeled hybridization or PCR probes for detecting sequences related to polynucleotides encoding PI-PLC-like enzyme polypeptides include oligolabeling, nick translation, end-labeling, or PCR amplification using a labeled nucleotide.
  • sequences encoding a PI-PLC-like enzyme polypeptide can be cloned into a vector for the production of an mRNA probe.
  • RNA probes are known in the art, are commercially available, and can be used to synthesize RNA probes in vitro by addition of labeled nucleotides and an appropriate RNA polymerase such as T7, T3, or SP6. These procedures can be conducted using a variety of commercially available kits (Amersham Pharmacia Biotech, Promega, and US. Biochemical). Suitable reporter molecules or labels which can be used for ease of detection include radionuclides, enzymes, and fluorescent, chemiluminescent, or chromogenic agents, as well as substrates, cofactors, inhibitors, magnetic particles, and the like.
  • Host cells transformed with nucleotide sequences encoding a PI-PLC-like enzyme polypeptide can be cultured under conditions suitable for the expression and recovery of the protein from cell culture.
  • the polypeptide produced by a transformed cell can be secreted or contained intracellularly depending on the sequence and/or the vector used.
  • expression vectors containing polynucleotides which encode PI-PLC-like enzyme polypeptides can be designed to contain signal sequences which direct secretion of soluble PI-PLC-like enzyme polypeptides through a prokaryotic or eukaryotic cell membrane or which direct the membrane insertion of membrane-bound PI-PLC-like enzyme polypeptide.
  • purification facilitating domains include, but are not limited to, metal chelating peptides such as histidine-tryptophan modules that allow purification on immobilized metals, protein
  • a domains that allow purification on immobilized immunoglobulin, and the domain utilized in the FLAGS extension/affinity purification system (Immunex Corp., Seattle, Wash.). Inclusion of cleavable linker sequences such as those specific for Factor Xa or enterokinase (Invitrogen, San Diego, CA) between the purification domain and the PI-PLC-like enzyme polypeptide also can be used to facilitate purification.
  • One such expression vector provides for expression of a fusion protein containing a PI-PLC-like enzyme polypeptide and 6 histidine residues preceding a thioredoxin or an enterokinase cleavage site.
  • the histidine residues facilitate purification by IMAC (immobilized metal ion affinity chromatography, as described in Porath et al, Prot. Exp. Purif. 3, 263-281, 1992), while the enterokinase cleavage site provides a means for purifying the PI-PLC-like enzyme polypeptide from the fusion protein.
  • Vectors which contain fusion proteins are disclosed in Kroll et al, DNA Cell Biol. 72, 441-453, 1993.
  • Sequences encoding a PI-PLC-like enzyme polypeptide can be synthesized, in whole or in part, using chemical methods well known in the art (see Caruthers et al, Nucl. Acids Res. Symp. Ser. 215-223, 1980; Horn et al. Nucl. Acids Res. Symp. Ser. 225-232, 1980).
  • a PI-PLC-like enzyme polypeptide itself can be produced using chemical methods to synthesize its amino acid sequence, such as by direct peptide synthesis using solid-phase techniques (Merrifield, J Am. Chem. Soc. 85, 2149-2154, 1963; Roberge et al, Science 269, 202-204, 1995).
  • Protein synthesis can be performed using manual techniques or by automation. Automated synthesis can be achieved, for example, using Applied Biosystems 431 A Peptide Synthesizer (Perkin Elmer). Optionally, fragments of PI-PLC-like enzyme polypeptides can be separately synthesized and combined using chemical methods to produce a full- length molecule.
  • the newly synthesized peptide can be substantially purified by preparative high performance liquid chromatography (e.g., Creighton, PROTEINS: STRUCTURES AND
  • composition of a synthetic PI-PLC-like enzyme polypeptide can be confirmed by amino acid analysis or sequencing (e.g., the Edman degradation procedure; see Creighton, supra). Additionally, any portion of the amino acid sequence of the PI- PLC-like enzyme polypeptide can be altered during direct synthesis and/or combined using chemical methods with sequences from other proteins to produce a variant polypeptide or a fusion protein.
  • codons preferred by a particular pro- karyotic or eukaryotic host can be selected to increase the rate of protein expression or to produce an RNA transcript having desirable properties, such as a half-life which is longer than that of a transcript generated from the naturally occurring sequence.
  • nucleotide sequences disclosed herein can be engineered using methods generally known in the art to alter PI-PLC-like enzyme polypeptide-encoding sequences for a variety of reasons, including but not limited to, alterations which modify the cloning, processing, and/or expression of the polypeptide or mRNA product.
  • DNA shuffling by random fragmentation and PCR reassembly of gene fragments and synthetic oligonucleotides can be used to engineer the nucleotide sequences.
  • site-directed mutagenesis can be used to insert new restriction sites, alter glycosylation patterns, change codon preference, produce splice variants, introduce mutations, and so forth.
  • Antibody as used herein includes intact immunoglobulin molecules, as well as fragments thereof, such as Fab, F(ab') 2 , and Fv, which are capable of binding an epitope of a PI-PLC-like enzyme polypeptide.
  • Fab fragment antigen binding protein
  • F(ab') 2 fragment antigen binding protein
  • Fv fragment antigen binding protein
  • epitopes which involve non-contiguous amino acids may require more, e.g., at least 15, 25, or 50 amino acids.
  • An antibody which specifically binds to an epitope of a PI-PLC-like enzyme polypeptide can be used therapeutically, as well as in immunochemical assays, such as Western blots, ELISAs, radioimmunoassays, immunohistochemical assays, immunoprecipitations, or other immunochemical assays known in the art.
  • immunochemical assays such as Western blots, ELISAs, radioimmunoassays, immunohistochemical assays, immunoprecipitations, or other immunochemical assays known in the art.
  • Various immunoassays can be used to identify antibodies having the desired specificity. Numerous protocols for competitive binding or immunoradiometric assays are well known in the art. Such immunoassays typically involve the measurement of complex formation between an immunogen and an antibody which specifically binds to the immunogen.
  • an antibody which specifically binds to a PI-PLC-like enzyme polypeptide provides a detection signal at least 5-, 10-, or 20-fold higher than a detection signal provided with other proteins when used in an immunochemical assay.
  • antibodies which specifically bind to PI-PLC-like polypeptides do not detect other proteins in immunochemical assays and can immunoprecipitate a PI-PLC-like enzyme polypeptide from solution.
  • Human PI-PLC-like enzyme polypeptides can be used to immunize a mammal, such as a mouse, rat, rabbit, guinea pig, monkey, or human, to produce polyclonal antibodies.
  • a PI-PLC-like enzyme polypeptide can be conjugated to a carrier protein, such as bovine serum albumin, thyroglobulin, and keyhole limpet hemocyanin.
  • a carrier protein such as bovine serum albumin, thyroglobulin, and keyhole limpet hemocyanin.
  • various adjuvants can be used to increase the immunological response.
  • adjuvants include, but are not limited to, Freund's adjuvant, mineral gels (e.g., aluminum hydroxide), and surface active substances (e.g.
  • BCG Bacilli Calmette-Gueri ⁇
  • Corynebacterium parvum are especially useful.
  • Monoclonal antibodies which specifically bind to a PI-PLC-like enzyme polypeptide can be prepared using any technique which provides for the production of antibody molecules by continuous cell lines in culture. These techniques include, but are not limited to, the hybridoma technique, the human B-cell hybridoma technique, and the EBV-hybridoma technique (Kohler et al, Nature 256, 495-497, 1985; Kozbor et al, J. Immunol. Methods 81, 31-42, 1985; Cote et al, Proc. Natl. Acad. Sci. 80, 2026-2030, 1983; Cole et al, Mol. Cell Biol. 62, 109-120, 1984).
  • Monoclonal and other antibodies also can be "humanized” to prevent a patient from mounting an immune response against the antibody when it is used therapeutically.
  • Such antibodies may be sufficiently similar in sequence to human antibodies to be used directly in therapy or may require alteration of a few key residues. Sequence differences between rodent antibodies and human sequences can be minimized by replacing residues which differ from those in the human sequences by site directed mutagenesis of individual residues or by grating of entire complementarity determining regions.
  • humanized antibodies can be produced using recombinant methods, as described in GB2188638B.
  • Antibodies which specifically bind to a PI-PLC-like enzyme polypeptide can contain antigen binding sites which are either partially or fully humanized, as disclosed in U.S. 5,565,332.
  • Single chain antibodies can be adapted using methods known in the art to produce single chain antibodies which specifically bind to PI-PLC-like enzyme polypeptides.
  • Antibodies with related specificity, but of distinct idiotypic composition can be generated by chain shuffling from random combinatorial immunoglobin libraries (Burton, Proc. Natl. Acad. Sci. 88, 11120-23, 1991).
  • Single-chain antibodies also can be constructed using a DNA amplification method, such as PCR, using hybridoma cDNA as a template (Thirion et al, 1996, Eur. J. Cancer Prev. 5, 507-11).
  • Single-chain antibodies can be mono- or bispecific, and can be bivalent or tetravalent. Construction of tetravalent, bispecific single-chain antibodies is taught, for example, in Coloma & Morrison, 1997, Nat. Biotechnol. 15,
  • a nucleotide sequence encoding a single-chain antibody can be constructed using manual or automated nucleotide synthesis, cloned into an expression construct using standard recombinant DNA methods, and introduced into a cell to express the coding sequence, as described below.
  • single-chain antibodies can be produced directly using, for example, filamentous phage technology (Verhaar et al, 1995, Int. J. Cancer 61, 497-501; Nicholls et al, 1993, J Immunol. Meth. 165, 81-91).
  • Antibodies which specifically bind to PI-PLC-like enzyme polypeptides also can be produced by inducing in vivo production in the lymphocyte population or by screening immunoglobulin libraries or panels of highly specific binding reagents as disclosed in the literature (Orlandi et al, Proc. Natl. Acad. Sci. 86, 3833-3837, 1989; Winter et al, Nature 349, 293-299, 1991).
  • chimeric antibodies can be constructed as disclosed in WO 93/03151.
  • Binding proteins which are derived from immunoglobulins and which are multivalent and multispecific, such as the "diabodies" described in WO
  • Antibodies according to the invention can be purified by methods well known in the art. For example, antibodies can be affinity purified by passage over a column to which a PI-PLC-like enzyme polypeptide is bound. The bound antibodies can then be eluted from the column using a buffer with a high salt concentration.
  • Antisense Oligonucleotides can be affinity purified by passage over a column to which a PI-PLC-like enzyme polypeptide is bound. The bound antibodies can then be eluted from the column using a buffer with a high salt concentration.
  • Antisense oligonucleotides are nucleotide sequences which are complementary to a specific DNA or RNA sequence. Once introduced into a cell, the complementary nucleotides combine with natural sequences produced by the cell to form complexes and block either transcription or translation. Preferably, an antisense oligonucleotide is at least 11 nucleotides in length, but can be at least 12, 15, 20, 25, 30, 35, 40, 45, or 50 or more nucleotides long. Longer sequences also can be used. Antisense oligonucleotide molecules can be provided in a DNA construct and introduced into a cell as described above to decrease the level of PI-PLC-like enzyme gene products in the cell.
  • Antisense oligonucleotides can be deoxyribonucleotides, ribonucleotides, or a combination of both. Oligonucleotides can be synthesized manually or by an automated synthesizer, by covalently linking the 5' end of one nucleotide with the 3' end of another nucleotide with non-phosphodiester internucleotide linkages such alkylphosphonates, phosphorothioates, phosphorodithioates, alkylphosphonothioates, alkylphosphonates, phosphoramidates, phosphate esters, carbamates, acetamidate, carboxymethyl esters, carbonates, and phosphate triesters. See Brown, Meth. Mol.
  • Modifications of PI-PLC-like enzyme gene expression can be obtained by designing antisense oligonucleotides which will form duplexes to the control, 5', or regulatory regions of the PI-PLC-like enzyme gene. Oligonucleotides derived from the transcription initiation site, e.g., between positions -10 and +10 from the start site, are preferred. Similarly, inhibition can be achieved using "triple helix" base-pairing methodology. Triple helix pairing is useful because it causes inhibition of the ability of the double helix to open sufficiently for the binding of polymerases, transcription factors, or chaperons.
  • An antisense oligonucleotide also can be designed to block translation of mRNA by preventing the transcript from binding to ribosomes.
  • Antisense oligonucleotides which comprise, for example, 2, 3, 4, or 5 or more stretches of contiguous nucleotides which are precisely complementary to a PI-PLC-like enzyme polynucleotide, each separated by a stretch of contiguous nucleotides which are not complementary to adjacent PI-PLC-like enzyme nucleotides, can provide sufficient targeting specificity for PI-PLC-like enzyme mRNA.
  • each stretch of complementary contiguous nucleotides is at least 4, 5, 6, 7, or 8 or more nucleotides in length.
  • Non-complementary intervening sequences are preferably 1, 2, 3, or 4 nucleotides in length.
  • One skilled in the art can easily use the calculated melting point of an antisense-sense pair to determine the degree of mismatching which will be tolerated between a particular antisense oligonucleotide and a particular PI-PLC-like enzyme polynucleotide sequence.
  • Antisense oligonucleotides can be modified without affecting their ability to hybridize to a PI-PLC-like enzyme polynucleotide. These modifications can be internal or at one or both ends of the antisense molecule. For example, inter- nucleoside phosphate linkages can be modified by adding cholesteryl or diamine moieties with varying numbers of carbon residues between the amino groups and terminal ribose.
  • Modified bases and/or sugars such as arabinose instead of ribose, or a 3', 5'-substituted oligonucleotide in which the 3' hydroxyl group or the 5' phosphate group are substituted, also can be employed in a modified antisense oligonucleotide.
  • modified oligonucleotides can be prepared by methods well known in the art. See, e.g., Agrawal et al, Trends Biotechnol. 10, 152-158, 1992; Uhlmann et al, Chem. Rev. 90, 543-584, 1990; Uhlmann et al, Tetrahedron. Lett. 215, 3539-3542, 1987.
  • Ribozymes are RNA molecules with catalytic activity. See, e.g., Cech, Science 236, 1532-1539; 1987; Cech, Ann. Rev. Biochem. 59, 543-568; 1990, Cech, Curr. Opin. Struct. Biol. 2, 605-609; 1992, Couture & Stinchcomb, Trends Genet. 12, 510-515, 1996. Ribozymes can be used to inhibit gene function by cleaving an RNA sequence, as is known in the art (e.g., Haseloff et al, U.S. Patent 5,641,673).
  • ribozyme action involves sequence-specific hybridization of the ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage.
  • Examples include engineered hammerhead motif ribozyme molecules that can specifically and efficiently catalyze endonucleolytic cleavage of specific nucleotide sequences.
  • the coding sequence of a PI-PLC-like enzyme polynucleotide can be used to generate ribozymes which will specifically bind to mRNA transcribed from the PI- PLC-like enzyme polynucleotide.
  • Methods of designing and constructing ribozymes which can cleave other RNA molecules in trans in a highly sequence specific manner have been developed and described in the art (see Haseloff et al Nature 334, 585-591, 1988).
  • the cleavage activity of ribozymes can be targeted to specific RNAs by engineering a discrete "hybridization" region into the ribozyme.
  • the hybridization region contains a sequence complementary to the target RNA and thus specifically hybridizes with the target (see, for example, Gerlach et al, EP
  • Specific ribozyme cleavage sites within a PI-PLC-like enzyme RNA target can be identified by scanning the target molecule for ribozyme cleavage sites which include the following sequences: GUA, GUU, and GUC. Once identified, short RNA sequences of between 15 and 20 ribonucleotides corresponding to the region of the target RNA containing the cleavage site can be evaluated for secondary structural features which may render the target inoperable. Suitability of candidate PI-PLC-like enzyme RNA targets also can be evaluated by testing accessibility to hybridization with complementary oligonucleotides using ribonuclease protection assays. Longer complementary sequences can be used to increase the affinity of the hybridization sequence for the target. The hybridizing and cleavage regions of the ribozyme can be integrally related such that upon hybridizing to the target RNA through the complementary regions, the catalytic region of the ribozyme can cleave the target.
  • Ribozymes can be introduced into cells as part of a DNA construct. Mechanical methods, such as microinjection, liposome-mediated transfection, electroporation, or calcium phosphate precipitation, can be used to introduce a ribozyme-containing DNA construct into cells in which it is desired to decrease PI-PLC-like enzyme expression. Alternatively, if it is desired that the cells stably retain the DNA construct, the construct can be supplied on a plasmid and maintained as a separate element or integrated into the genome of the cells, as is known in the art.
  • a ribozyme-encoding DNA construct can include transcriptional regulatory elements, such as a promoter element, an enhancer or UAS element, and a transcriptional terminator signal, for controlling transcription of ribozymes in the cells.
  • ribozymes can be engineered so that ribozyme expression will occur in response to factors which induce expression of a target gene. Ribozymes also can be engineered to provide an additional level of regulation, so that destruction of mRNA occurs only when both a ribozyme and a target gene are induced in the cells.
  • genes whose products interact with human phosphatidylinositol-specific phospholipase C-like enzyme may represent genes which are differentially expressed in disorders including, but not limited to, asthma, cancer, CNS disorders, and chronic obstructive pulmonary disease. Further, such genes may represent genes which are differentially regulated in response to manipulations relevant to the progression or treatment of such diseases. Additionally, such genes may have a temporally modulated expression, increased or decreased at different stages of tissue or organism development. A differentially expressed gene may also have its expression modulated under control versus experimental conditions. In addition, the human phosphatidylinositol-specific phospholipase C-like enzyme gene or gene product may itself be tested for differential expression.
  • the degree to which expression differs in a normal versus a diseased state need only be large enough to be visualized via standard characterization techniques such as differential display techniques.
  • standard characterization techniques such as differential display techniques.
  • Other such standard characterization techniques by which expression differences may be visualized include but are not limited to, quantitative RT (reverse transcriptase), PCR, and Northern analysis.
  • RNA samples are obtained from tissues of experimental subjects and from corresponding tissues of control subjects. Any RNA isolation technique which does not select against the isolation of mRNA may be utilized for the purification of such RNA samples. See, for example, Ausubel et al, ed. dislike CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, Inc. New York, 1987-1993. Large numbers of tissue samples may readily be processed using techniques well known to those of skill in the art, such as, for example, the single-step RNA isolation process of Chomczynski, U.S. Patent 4,843,155.
  • Transcripts within the collected RNA samples which represent RNA produced by differentially expressed genes are identified by methods well known to those of skill in the art. They include, for example, differential screening (Tedder et al, Proc. Natl. Acad. Sci. U.S.A. 85, 208-12, 1988), subtractive hybridization (Hedrick et al, Nature 308, 149-53; Lee et al, Proc. Natl. Acad. Sci. U.S.A. 88, 2825, 1984), and, preferably, differential display (Liang & Pardee, Science 257, 967-71, 1992; U.S. Patent 5,262,311).
  • the differential expression information may itself suggest relevant methods for the treatment of disorders involving the human phosphatidylinositol-specific phospholipase C-like enzyme.
  • treatment may include a modulation of expression of the differentially expressed genes and/or the gene encoding the human phosphatidylinositol-specific phospholipase C-like enzyme.
  • the differential expression information may indicate whether the expression or activity of the differentially expressed gene or gene product or the human phosphatidylinositol- specific phospholipase C-like enzyme gene or gene product are up-regulated or down-regulated.
  • the invention provides assays for screening test compounds which bind to or modulate the activity of a PI-PLC-like enzyme polypeptide or a PI-PLC-like enzyme polynucleotide.
  • a test compound preferably binds to a PI-PLC-like enzyme polypeptide or polynucleotide. More preferably, a test compound decreases or increases PI-PLC-like by at least about 10, preferably about 50, more preferably about 75, 90, or 100% relative to the absence of the test compound.
  • Test compounds can be pharmacologic agents already known in the art or can be compounds previously unknown to have any pharmacological activity.
  • the compounds can be naturally occurring or designed in the laboratory. They can be isolated from microorganisms, animals, or plants, and can be produced recombinantly, or synthesized by chemical methods known in the art. If desired, test compounds can be obtained using any of the numerous combinatorial library methods known in the art, including but not limited to, biological libraries, spatially addressable parallel solid phase or solution phase libraries, synthetic library methods requiring deconvolution, the "one-bead one-compound” library method, and synthetic library methods using affinity chromatography selection.
  • the biological library approach is limited to polypeptide libraries, while the other four approaches are applicable to polypeptide, non-peptide oligomer, or small molecule libraries of compounds. See Lam, Anticancer Drug Des. 12, 145, 1997.
  • Test compounds can be screened for the ability to bind to PI-PLC-like enzyme polypeptides or polynucleotides or to affect PI-PLC-like enzyme activity or PI-PLC- like enzyme gene expression using high throughput screening.
  • high throughput screening many discrete compounds can be tested in parallel so that large numbers of test compounds can be quickly screened.
  • the most widely established techniques utilize 96-well microtiter plates. The wells of the microtiter plates typically require assay volumes that range from 50 to 500 ⁇ l.
  • many instruments, materials, pipettors, robotics, plate washers, and plate readers are commercially available to fit the 96-well format.
  • free format assays or assays that have no physical barrier between samples, can be used.
  • an assay using pigment cells (melanocytes) in a simple homogeneous assay for combinatorial peptide libraries is described by Jayawickreme et al, Proc. Natl. Acad. Sci. U.S.A. 19, 1614-18 (1994).
  • the cells are placed under agarose in petri dishes, then beads that carry combinatorial compounds are placed on the surface of the agarose.
  • the combinatorial compounds are partially released the compounds from the beads. Active compounds can be visualized as dark pigment areas because, as the compounds diffuse locally into the gel matrix, the active compounds cause the cells to change colors.
  • Chelsky placed a simple homogenous enzyme assay for carbonic anhydrase inside an agarose gel such that the enzyme in the gel would cause a color change throughout the gel. Thereafter, beads carrying combinatorial compounds via a photolinker were placed inside the gel and the compounds were partially released by UN-light. Compounds that inhibited the enzyme were observed as local zones of inhibition having less color change.
  • test samples are placed in a porous matrix.
  • One or more assay components are then placed within, on top of, or at the bottom of a matrix such as a gel, a plastic sheet, a filter, or other form of easily manipulated solid support.
  • a matrix such as a gel, a plastic sheet, a filter, or other form of easily manipulated solid support.
  • the test compound is preferably a small molecule which binds to and occupies, for example, the active site of the PI-PLC-like enzyme polypeptide, such that normal biological activity is prevented.
  • small molecules include, but are not limited to, small peptides or peptide-like molecules.
  • either the test compound or the PI-PLC-like enzyme polypeptide can comprise a detectable label, such as a fluorescent, radioisotopic, chemilumines- cent, or enzymatic label, such as horseradish peroxidase, alkaline phosphatase, or luciferase.
  • a detectable label such as a fluorescent, radioisotopic, chemilumines- cent, or enzymatic label, such as horseradish peroxidase, alkaline phosphatase, or luciferase.
  • Detection of a test compound which is bound to the PI-PLC-like enzyme polypeptide can then be accomplished, for example, by direct counting of radio- emmission, by scintillation counting, or by determining conversion of an appropriate substrate to a detectable product.
  • binding of a test compound to a PI-PLC-like enzyme polypeptide can be determined without labeling either of the interactants.
  • a micro- physiometer can be used to detect binding of a test compound with a PI-PLC-like enzyme polypeptide.
  • a microphysiometer e.g., CytosensorTM
  • a microphysiometer is an analytical instrument that measures the rate at which a cell acidifies its environment using a light-addressable potentiometric sensor (LAPS). Changes in this acidification rate can be used as an indicator of the interaction between a test compound and a PI-PLC- like enzyme polypeptide (McConnell et al, Science 257, 1906-1912, 1992).
  • Determining the ability of a test compound to bind to a PI-PLC-like enzyme polypeptide also can be accomplished using a technology such as real-time Bimolecular Interaction Analysis (BIA) (Sjolander & Urbaniczky, Anal. Chem. 63,
  • BIA is a technology for studying biospecific interactions in real time, without labeling any of the interactants (e.g., BIAcoreTM). Changes in the optical phenomenon surface plasmon resonance (SPR) can be used as an indication of real-time reactions between biological molecules.
  • SPR surface plasmon resonance
  • a PI-PLC-like enzyme polypeptide can be used as a "bait protein" in a two-hybrid assay or three-hybrid assay (see, e.g., U.S. Patent 5,283,317; Zervos et al, Cell 72, 223-232, 1993; Madura et al, J. Biol. Chem.
  • the two-hybrid system is based on the modular nature of most transcription factors, which consist of separable DNA-binding and activation domains.
  • the assay utilizes two different DNA constructs.
  • polynucleotide encoding a PI-PLC-like enzyme polypeptide can be fused to a polynucleotide encoding the DNA binding domain of a known transcription factor (e.g., GAL-4).
  • a DNA sequence that encodes an unidentified protein (“prey" or "sample” can be fused to a polynucleotide that codes for the activation domain of the known transcription factor.
  • the DNA-binding and activation domains of the transcription factor are brought into close proximity. This proximity allows transcription of a reporter gene (e.g., LacZ), which is operably linked to a transcriptional regulatory site responsive to the transcription factor.
  • a reporter gene e.g., LacZ
  • Expression of the reporter gene can be detected, and cell colonies containing the functional transcription factor can be isolated and used to obtain the DNA sequence encoding the protein which interacts with the PI-PLC-like enzyme polypeptide.
  • either the PI-PLC-like enzyme polypeptide (or polynucleotide) or the test compound can be bound to a solid support.
  • Suitable solid supports include, but are not limited to, glass or plastic slides, tissue culture plates, microtiter wells, tubes, silicon chips, or particles such as beads (including, but not limited to, latex, polystyrene, or glass beads).
  • Any method known in the art can be used to attach the enzyme polypeptide (or polynucleotide) or test compound to a solid support, including use of covalent and non-covalent linkages, passive absorption, or pairs of binding moieties attached respectively to the polypeptide (or polynucleotide) or test compound and the solid support.
  • Test compounds are preferably bound to the solid support in an array, so that the location of individual test compounds can be tracked. Binding of a test compound to a v enzyme polypeptide (or polynucleotide) can be accomplished in any vessel suitable for containing the reactants. Examples of such vessels include microtiter plates, test tubes, and microcentrifuge tubes.
  • the PI-PLC-like enzyme polypeptide is a fusion protein comprising a domain that allows the PI-PLC-like enzyme polypeptide to be bound to a solid support.
  • glutathione-S-transferase fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis, Mo.) or glutathione derivatized microtiter plates, which are then combined with the test compound or the test compound and the non-adsorbed PI-PLC-like enzyme polypeptide; the mixture is then incubated under conditions conducive to complex formation (e.g., at physiological conditions for salt and pH).
  • Binding of the interactants can be determined either directly or indirectly, as described above. Alternatively, the complexes can be dissociated from the solid support before binding is determined.
  • PI-PLC- like enzyme polypeptide or polynucleotide
  • test compound can be immobilized utilizing conjugation of biotin and streptavidin.
  • Biotinylated PI-PLC-like enzyme polypeptides (or polynucleotides) or test compounds can be prepared from biotin-NHS(N-hydroxysuccinimide) using techniques well known in the art (e.g., biotinylation kit, Pierce Chemicals, Rockford, 111.) and immobilized in the wells of streptavidin-coated 96 well plates (Pierce Chemical).
  • biotinylation kit Pierce Chemicals, Rockford, 111.
  • antibodies which specifically bind to a PI-PLC-like enzyme polypeptide, polynucleotide, or a test compound, but which do not interfere with a desired binding site, such as the active site of the PI-PLC-like enzyme polypeptide can be derivatized to the wells of the plate. Unbound target or protein can be trapped in the wells by antibody conjugation.
  • GST-immobilized complexes include immunodetection of complexes using antibodies which specifically bind to the PI-PLC-like enzyme polypeptide or test compound, enzyme-linked assays which rely on detecting an activity of the PI-PLC-like enzyme polypeptide, and SDS gel electrophoresis under non-reducing conditions.
  • Screening for test compounds which bind to a PI-PLC-like enzyme polypeptide or polynucleotide also can be carried out in an intact cell.
  • Any cell which comprises a PI-PLC-like enzyme polypeptide or polynucleotide can be used in a cell-based assay system.
  • a PI-PLC-like enzyme polynucleotide can be naturally occurring in the cell or can be introduced using techniques such as those described above. Binding of the test compound to a PI-PLC-like enzyme polypeptide or polynucleotide is determined as described above.
  • Test compounds can be tested for the ability to increase or decrease the phospholipase C activity of a human PI-PLC-like enzyme polypeptide.
  • Phospholipase C activity can be measured, for example, as described in the specific examples, below.
  • Enzyme assays can be carried out after contacting either a purified PI-PLC-like enzyme polypeptide, a cell membrane preparation, or an intact cell with a test compound.
  • a test compound which decreases a phospholipase C activity of a PI- PLC-like enzyme polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% is identified as a potential therapeutic agent for decreasing PI-PLC-like enzyme activity.
  • a test compound which increases a phospholipase C activity of a human PI-PLC-like enzyme polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% is identified as a potential therapeutic agent for increasing human PI-PLC-like enzyme activity.
  • test compounds which increase or decrease PI-PLC-like enzyme gene expression are identified.
  • a PI-PLC-like enzyme polynucleotide is contacted with a test compound, and the expression of an RNA or polypeptide product of the v enzyme polynucleotide is determined.
  • the level of expression of appropriate mRNA or polypeptide in the presence of the test compound is compared to the level of expression of mRNA or polypeptide in the absence of the test compound.
  • the test compound can then be identified as a modulator of expression based on this comparison. For example, when expression of mRNA or polypeptide is greater in the presence of the test compound than in its absence, the test compound is identified as a stimulator or enhancer of the mRNA or polypeptide expression.
  • test compound when expression of the mRNA or polypeptide is less in the presence of the test compound than in its absence, the test compound is identified as an inhibitor of the mRNA or polypeptide expression.
  • the level of v enzyme mRNA or polypeptide expression in the cells can be determined by methods well known in the art for detecting mRNA or polypeptide. Either qualitative or quantitative methods can be used.
  • the presence of polypeptide products of a PI-PLC-like enzyme polynucleotide can be determined, for example, using a variety of techniques known in the art, including immunochemical methods such as radioimmunoassay, Western blotting, and immunohistochemistry.
  • polypeptide synthesis can be determined in vivo, in a cell culture, or in an in vitro translation system by detecting incorporation of labeled amino acids into a PI- PLC-like enzyme polypeptide.
  • Such screening can be carried out either in a cell-free assay system or in an intact cell.
  • Any cell which expresses a PI-PLC-like enzyme polynucleotide can be used in a cell-based assay system.
  • the PI-PLC-like enzyme polynucleotide can be naturally occurring in the cell or can be introduced using techniques such as those described above.
  • Either a primary culture or an established cell line, such as CHO or human embryonic kidney 293 cells, can be used.
  • compositions of the invention can comprise, for example, a PI-PLC-like enzyme polypeptide, PI-PLC- like enzyme polynucleotide, ribozymes or antisense oligonucleotides, antibodies which specifically bind to a PI-PLC-like enzyme polypeptide, or mimetics, agonists, antagonists, or inhibitors of a PI-PLC-like enzyme polypeptide activity.
  • compositions can be administered alone or in combination with at least one other agent, such as stabilizing compound, which can be administered in any sterile, biocompatible pharmaceutical carrier, including, but not limited to, saline, buffered saline, dextrose, and water.
  • agent such as stabilizing compound
  • the compositions can be administered to a patient alone, or in combination with other agents, drugs or hormones.
  • compositions of the invention can be administered by any number of routes including, but not limited to, oral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, intraventricular, transdermal, subcutaneous, intraperitoneal, infranasal, parenteral, topical, sublingual, or rectal means.
  • Pharmaceutical compositions for oral administration can be formulated using pharmaceutically acceptable carriers well known in the art in dosages suitable for oral administration. Such carriers enable the pharmaceutical compositions to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for ingestion by the patient.
  • compositions for oral use can be obtained through combination of active compounds with solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores.
  • Suitable excipients are carbohydrate or protein fillers, such as sugars, including lactose, sucrose, mannitol, or sorbitol; starch from corn, wheat, rice, potato, or other plants; cellulose, such as methyl cellulose, hydroxypropylmethyl-cellulose, or sodium carboxymethylcellulose; gums including arabic and tragacanth; and proteins such as gelatin and collagen.
  • disintegrating or solubilizing agents can be added, such as the cross-linked polyvinyl pyrrolidone, agar, alginic acid, or a salt thereof, such as sodium alginate.
  • Dragee cores can be used in conjunction with suitable coatings, such as concentrated sugar solutions, which also can contain gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
  • suitable coatings such as concentrated sugar solutions, which also can contain gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
  • Dyestuffs or pigments can be added to the tablets or dragee coatings for product identification or to characterize the quantity of active compound, i.e., dosage.
  • Push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a coating, such as glycerol or sorbitol.
  • Push-fit capsules can contain active ingredients mixed with a filler or binders, such as lactose or starches, lubricants, such as talc or magnesium stearate, and, optionally, stabilizers.
  • the active compounds can be dissolved or suspended in suitable liquids, such as fatty oils, liquid, or liquid polyethylene glycol with or without stabilizers.
  • compositions suitable for parenteral administration can be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks' solution, Ringer's solution, or physiologically buffered saline.
  • Aqueous injection suspensions can contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran.
  • suspensions of the active compounds can be prepared as appropriate oily injection suspensions.
  • Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes.
  • Non-lipid polycationic amino polymers also can be used for delivery.
  • the suspension also can contain suitable stabilizers or agents which increase the solubility of the compounds to allow for the preparation of highly concentrated solutions.
  • penetrants appropriate to the particular barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
  • compositions of the present invention can be manufactured in a manner that is known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping, or lyophilizing processes.
  • the pharmaceutical composition can be provided as a salt and can be formed with many acids, including but not limited to, hydrochloric, sulfuric, acetic, lactic, tartaric, malic, succinic, etc. Salts tend to be more soluble in aqueous or other pro tonic solvents than are the coreesponding free base forms.
  • the preferred preparation can be a lyophilized powder which can contain any or all of the following: 1-50 mM histidine, 0.1%-2% sucrose, and 2-7% mannitol, at a pH range of 4.5 to 5.5, that is combined with buffer prior to use.
  • compositions After pharmaceutical compositions have been prepared, they can be placed in an appropriate container and labeled for treatment of an indicated condition. Such labeling would include amount, frequency, and method of administration.
  • Human PI-PLC-like enzyme can be regulated to treat asthma, cancer, CNS disorders, and chronic obstructive pulmonary disease.
  • Cancer is a disease fundamentally caused by oncogenic cellular transformation. There are several hallmarks of transformed cells that distinguish them from their normal covinterparts and underlie the pathophysiology of cancer. These include uncontrolled cellular proliferation, unresponsiveness to normal death-inducing signals (immortalization), increased cellular motility and invasiveness, increased ability to recruit blood supply through induction of new blood vessel formation (angiogenesis), genetic instability, and dysregulated gene expression.
  • Various combinations of these abereant physiologies, along with the acquisition of drug-resistance frequently lead to an intractable disease state in which organ failure and patient death ultimately ensue.
  • genomics-driven molecular target identification has opened up the possibility of identifying new cancer-specific targets for therapeutic intervention that will provide safer, more effective treatments for cancer patients.
  • tumor-associated genes and their products can be tested for their role(s) in disease and used as tools to discover and develop innovative therapies.
  • Genes playing important roles in any of the physiological processes outlined above can be characterized as cancer targets.
  • Genes or gene fragments identified through genomics can readily be expressed in one or more heterologous expression systems to produce functional recombinant proteins. These proteins are characterized in vitro for their biochemical properties and then used as tools in high-throughput molecular screening programs to identify chemical modulators of their biochemical activities.
  • Agonists and/or antagonists of target protein activity can be identified in this manner and subsequently tested in cellular and in vivo disease models for anti-cancer activity. Optimization of lead compounds with iterative testing in biological models and detailed pharmacokinetic and toxicological analyses form the basis for drug development and subsequent testing in humans.
  • Allergies including asthma can be treated: Allergy is a complex process in which environmental antigens induce clinically adverse reactions.
  • the inducing antigens, called allergens typically elicit a specific IgE response and, although in most cases the allergens themselves have little or no intrinsic toxicity, they induce pathology when the IgE response in turn elicits an IgE-dependent or T cell-dependent hypersensitivity reaction.
  • Hypersensitivity reactions can be local or systemic and typically occur within minutes of allergen exposure in individuals who have previously been sensitized to an allergen.
  • the hypersensitivity reaction of allergy develops when the allergen is recognized by IgE antibodies bound to specific receptors on the surface of effector cells, such as mast cells, basophils, or eosinophils, which causes the activation of the effector cells and the release of mediators that produce the acute signs and symptoms of the reactions.
  • Allergic diseases include asthma, allergic rhinitis (hay fever), atopic dermatitis, and anaphylaxis.
  • Asthma is though to arise as a result of interactions between multiple genetic and environmental factors and is characterized by three major features: 1) intermittent and reversible airway obstruction caused by bronchoconstriction, increased mucus production, and thickening of the walls of the airways that leads to a narrowing of the airways, 2) airway hyperresponsiveness caused by a decreased control of airway caliber, and 3) airway inflammation.
  • Certain cells are critical to the inflammatory reaction of asthma and they include T cells and antigen presenting cells, B cells that produce IgE, and mast cells, basophils, eosinophils, and other cells that bind IgE.
  • effector cells accumulate at the site of allergic reaction in the airways and release toxic products that contribute to the acute pathology and eventually to the tissue destruction related to the disorder.
  • Other resident cells such as smooth muscle cells, lung epithelial cells, mucus-producing cells, and nerve cells may also be abnormal in individuals with asthma and may contribute to the pathology. While the airway obstruction of asthma, presenting clinically as an intermittent wheeze and shortness of breath, is generally the most pressing symptom of the disease requiring immediate treatment, the inflammation and tissue destruction associated with the disease can lead to irreversible changes that eventually make asthma a chronic disabling disorder requiring long-term management.
  • agents that can reduce the underlying inflammation can have major drawbacks that range from immunosuppression to bone loss (Goodman and Gilman's The Pharmacologic Basis of Therapeutics, Seventh Edition, MacMillan Publishing Company, NY, USA, 1985).
  • many of the present therapies such as inhaled corticosteroids, are short-lasting, inconvenient to use, and must be used often on a regular basis, in some cases for life, making failure of patients to comply with the treatment a major problem and thereby reducing their effectiveness as a treatment.
  • Glycophorin A Cho and Sharom, Cell Immunol 145:223-239, 1992
  • cyclosporin Alexander et al., Lancet 1992, 339:324-328
  • a nonapeptide fragment of IL-2 Zav'yalov et al. Immunol Lett 1992, 31:285-288
  • cyclosporin is used as a irnmuno- suppressant after organ transplantation.
  • CNS disorders which can be treated include brain injuries, cerebrovascular diseases and their consequences, Parkinson's disease, corticobasal degeneration, motor neuron disease, dementia, including ALS, multiple sclerosis, traumatic brain injury, stroke, post-stroke, post-traumatic brain injury, and small-vessel cerebrovascular disease.
  • Dementias such as Alzheimer's disease, vascular dementia, dementia with Lewy bodies, frontotemporal dementia and Parkinsonism linked to chromosome 17, fronto temporal dementias, including Pick's disease, progressive nuclear palsy, corticobasal degeneration, Huntington's disease, thalamic degeneration, Creutzfeld- Jakob dementia, HIV dementia, schizophrenia with dementia, and Korsakoff s psychosis also can be treated.
  • cognitive-related disorders such as mild cognitive impairment, age-associated memory impairment, age-related cognitive decline, vascular cognitive impairment, attention deficit disorders, attention deficit hyperactivity disorders, and memory disturbances in children with learning disabilities, by regulating the activity of human PI-PLC-like enzyme.
  • COPD chronic obstructive pulmonary (or airways) disease
  • COPD chronic obstructive pulmonary (or airways) disease
  • COPD chronic obstructive pulmonary (or airways) disease
  • Emphysema is characterized by destruction of alveolar walls leading to abnormal enlargement of the air spaces of the lung.
  • Chronic bronchitis is defined clinically as the presence of chronic productive cough for three months in each of two successive years.
  • airflow obstruction is usually progressive and is only partially reversible. By far the most important risk factor for development of COPD is cigarette smoking, although the disease does occur in non-smokers.
  • the inflammatory cell population comprises increased numbers of macrophages, neutrophils, and CD8 + lymphocytes.
  • Inhaled irritants such as cigarette smoke, activate macrophages which are resident in the respiratory tract, as well as epithelial cells leading to release of chemokines (e.g., interleukin-8) and other chemotactic factors.
  • chemokines e.g., interleukin-8
  • chemotactic factors act to increase the neutrophil/- monocyte trafficking from the blood into the lung tissue and airways.
  • Neutrophils and monocytes recruited into the airways can release a variety of potentially damaging mediators such as proteolytic enzymes and reactive oxygen species.
  • Matrix degradation and emphysema along with airway wall thickening, surfactant dysfunction, and mucus hypersecretion, all are potential sequelae of this inflammatory response that lead to impaired airflow and gas exchange.
  • PI-PLC isozymes are critical components of the transduction machinery responsible for cell activation in response to occupancy of G-protein coupled receptors. Jiang et al, Proc. Natl. Acad. Sci. 94, 7971-75, 1997; Stern Stamm 8c Smrcka, Ciba Found. Symp. 176, 96-11, 1993. Hydrolysis of membrane inositol containing phospholipids by specific PLC isozymes produces inositol phosphates that can act as calcium releasing second messengers (e.g., inositol 1,4,5-trisphosphate), and the protein kinase C activator, diacylglycerol.
  • inositol 1,4,5-trisphosphate e.g., inositol 1,4,5-trisphosphate
  • PLCs currently are classified into b, g and d families. Subtypes within these families have been identified. For example, the b family consists of 4 subtypes. There is clear evidence of differential tissue distribution of these isoforms and, importantly, differential activation by G-protein subunits. Studies on the inflammatory response in knock-out mice lacking the gene for PLC b-2 have shown selective abrogation of certain features of the inflammatory response. PI-PLC subtypes are therefore attractive therapeutic targets for the inhibition of the inflammatory response in
  • This invention further pertains to the use of novel agents identified by the screening assays described above. Accordingly, it is within the scope of this invention to use a test compound identified as described herein in an appropriate animal model.
  • an agent identified as described herein e.g., a modulating agent, an antisense nucleic acid molecule, a specific antibody, ribozyme, or a PI-PLC-like enzyme polypeptide binding. molecule
  • an agent identified as described herein can be used in an animal model to determine the efficacy, toxicity, or side effects of treatment with such an agent.
  • an agent identified as described herein can be used in an animal model to determine the mechanism of action of such an agent.
  • this invention pertains to uses of novel agents identified by the above-described screening assays for treatments as described herein.
  • a reagent which affects PI-PLC-like enzyme activity can be administered to a human cell, either in vitro or in vivo, to reduce PI-PLC-like enzyme activity.
  • the reagent preferably binds to an expression product of a human PI-PLC-like enzyme gene. If the expression product is a protein, the reagent is preferably an antibody.
  • an antibody can be added to a preparation of stem cells which have been removed from the body. The cells can then be replaced in the same or another human body, with or without clonal propagation, as is known in the art.
  • the reagent is delivered using a liposome.
  • the liposome is stable in the animal into which it has been administered for at least about 30 minutes, more preferably for at least about 1 hour, and even more preferably for at least about 24 hours.
  • a liposome comprises a lipid composition that is capable of targeting a reagent, particularly a polynucleotide, to a particular site in an animal, such as a human.
  • the lipid composition of the liposome is capable of targeting to a specific organ of an animal, such as the lung, liver, spleen, heart brain, lymph nodes, and skin.
  • a liposome useful in the present invention comprises a lipid composition that is capable of fusing with the plasma membrane of the targeted cell to deliver its contents to the cell.
  • the transfection efficiency of a liposome is about 0.5 ⁇ g of DNA per 16 nmole of liposome delivered to about 10 6 cells, more preferably about 1.0 ⁇ g of DNA per 16 nmole of liposome delivered to about 10 6 cells, and even more preferably about 2.0 ⁇ g of DNA per 16 nmol of liposome delivered to about 10 cells.
  • a liposome is between about 100 and 500 nm, more preferably between about 150 and 450 nm, and even more preferably between about 200 and 400 nm in diameter.
  • Suitable liposomes for use in the present invention include those liposomes standardly used in, for example, gene delivery methods known to those of skill in the art. More preferred liposomes include liposomes having a polycationic lipid composition and/or liposomes having a cholesterol backbone conjugated to polyethylene glycol.
  • a liposome comprises a compound capable of targeting the liposome to a particular cell type, such as a cell-specific ligand exposed on the outer surface of the liposome.
  • a liposome with a reagent such as an antisense oligonucleotide or ribozyme can be achieved using methods which are standard in the art (see, for example, U.S. Patent 5,705,151).
  • a reagent such as an antisense oligonucleotide or ribozyme
  • from about 0.1 ⁇ g to about 10 ⁇ g of polynucleotide is combined with about 8 nmol of liposomes, more preferably from about 0.5 ⁇ g to about 5 ⁇ g of polynucleotides are combined with about 8 nmol liposomes, and even more preferably about 1.0 ⁇ g of polynucleotides is combined with about 8 nmol liposomes.
  • antibodies can be delivered to specific tissues in vivo using receptor-mediated targeted delivery.
  • Receptor-mediated DNA delivery techniques are taught in, for example, Findeis et al. Trends in Biotechnol. 11, 202-05 (1993); Chiou et al, GENE THERAPEUTICS: METHODS AND APPLICATIONS OF DIRECT GENE
  • a therapeutically effective dose refers to that amount of active ingredient which increases or decreases PI-PLC-like enzyme activity relative to the PI-PLC-like enzyme activity which occurs in the absence of the therapeutically effective dose.
  • the therapeutically effective dose can be estimated initially either in cell culture assays or in animal models, usually mice, rabbits, dogs, or pigs. The animal model also can be used to determine the appropriate concentration range and route of administration. Such information can then be used to determine useful doses and routes for administration in humans.
  • Therapeutic efficacy and toxicity e.g., ED 5 o (the dose therapeutically effective in 50% of the population) and LD 50 (the dose lethal to 50% of the population), can be determined by standard pharmaceutical procedures in cell cultures or experimental animals.
  • the dose ratio of toxic to therapeutic effects is the therapeutic index, and it can be expressed as the ratio, LDso/ED . n.
  • compositions which exhibit large therapeutic indices are preferred.
  • the data obtained from cell culture assays and animal studies is used in formulating a range of dosage for human use.
  • the dosage contained in such compositions is preferably within a range of circulating concentrations that include the ED 50 with little or no toxicity.
  • the dosage varies within this range depending upon the dosage form employed, sensitivity of the patient, and the route of administration.
  • the exact dosage will be determined by the practitioner, in light of factors related to the subject that requires treatment. Dosage and administration are adjusted to provide sufficient levels of the active ingredient or to maintain the desired effect. Factors which can be taken into account include the severity of the disease state, general health of the subject, age, weight, and gender of the subject, diet, time and frequency of administration, drug combination(s), reaction sensitivities, and tolerance/response to therapy. Long-acting pharmaceutical compositions can be administered every 3 to 4 days, every week, or once every two weeks depending on the half-life and clearance rate of the particular formulation. Normal dosage amounts can vary from 0.1 to 100,000 micrograms, up to a total dose of about 1 g, depending upon the route of administration.
  • polynucleotides encoding the antibody can be constructed and introduced into a cell either ex vivo or in vivo using well- established techniques including, but not limited to, transferrin-polycation-mediated DNA transfer, transfection with naked or encapsulated nucleic acids, liposome- mediated cellular fusion, intracellular transportation of DNA-coated latex beads, protoplast fusion, viral infection, electroporation, "gene gun,” and DEAE- or calcium phosphate-mediated transfection.
  • Effective in vivo dosages of an antibody are in the range of about 5 ⁇ g to about 50 ⁇ g/kg, about 50 ⁇ g to about 5 mg/kg, about 100 ⁇ g to about 500 ⁇ g/kg of patient body weight, and about 200 to about 250 ⁇ g/kg of patient body weight.
  • effective in vivo dosages are in the range of about 100 ng to about 200 ng, 500 ng to about 50 mg, about 1 ⁇ g to about 2 mg, about 5 ⁇ g to about 500 ⁇ g, and about 20 ⁇ g to about 100 ⁇ g of DNA.
  • the reagent is preferably an antisense oligonucleotide or a ribozyme.
  • Polynucleotides which express antisense oligonucleotides or ribozymes can be introduced into cells by a variety of methods, as described above.
  • a reagent reduces expression of a PI-PLC-like enzyme gene or the activity of a PI-PLC-like enzyme polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% relative to the absence of the reagent.
  • the effectiveness of the mechanism chosen to decrease the level of expression of a PI- PLC-like enzyme gene or the activity of a PI-PLC-like enzyme polypeptide can be assessed using methods well known in the art, such as hybridization of nucleotide probes to PI-PLC-like enzyme-specific mRNA, quantitative RT-PCR, immunologic detection of a PI-PLC-like enzyme polypeptide, or measurement of PI-PLC-like enzyme activity.
  • any of the pharmaceutical compositions of the invention can be administered in combination with other appropriate therapeutic agents.
  • Selection of the appropriate agents for use in combination therapy can be made by one of ordinary skill in the art, according to conventional pharmaceutical principles.
  • the combination of therapeutic agents can act synergistically to effect the treatment or prevention of the various disorders described above. Using this approach, one may be able to achieve therapeutic efficacy with lower dosages of each agent, thus reducing the potential for adverse side effects.
  • any of the therapeutic methods described above can be applied to any subject in need of such therapy, including, for example, mammals such as dogs, cats, cows, horses, rabbits, monkeys, and most preferably, humans.
  • Human PI-PLC-like enzyme also can be used in diagnostic assays for detecting diseases and abnormalities or susceptibility to diseases and abnormalities related to the presence of mutations in the nucleic acid sequences which encode the enzyme. For example, differences can be determined between the cDNA or genomic sequence encoding PI-PLC-like enzyme in individuals afflicted with a disease and in normal individuals. If a mutation is observed in some or all of the afflicted individuals but not in normal individuals, then the mutation is likely to be the causative agent of the disease. Sequence differences between a reference gene and a gene having mutations can be revealed by the direct DNA sequencing method. In addition, cloned DNA segments can be employed as probes to detect specific DNA segments.
  • a sequencing primer can be used with a double-stranded PCR product or a single-stranded template molecule generated by a modified PCR.
  • the sequence determination is performed by conventional procedures using radiolabeled nucleotides or by automatic sequencing procedures using fluorescent tags.
  • DNA sequence differences can be carried out by detection of alteration in electrophoretic mobility of DNA fragments in gels with or without denaturing agents. Small sequence deletions and insertions can be visualized, for example, by high resolution gel electrophoresis. DNA fragments of different sequences can be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific melting or partial melting temperatures (see, e.g., Myers et al, Science 230, 1242, 1985). Sequence changes at specific locations can also be revealed by nuclease protection assays, such as RNase and S 1 protection or the chemical cleavage method (e.g., Cotton et al, Proc. Natl. Acad. Sci. USA 85,
  • the detection of a specific DNA sequence can be performed by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes and Southern blotting of genomic DNA.
  • direct methods such as gel-electrophoresis and DNA sequencing, mutations can also be detected by in situ analysis.
  • Altered levels of a PI-PLC-like enzyme also can be detected in various tissues.
  • Assays used to detect levels of the receptor polypeptides in a body sample, such as blood or a tissue biopsy, derived from a host are well known to those of skill in the art and include radioimmunoassays, competitive binding assays, Western blot analysis, and ELISA assays. All patents and patent applications cited in this disclosure are expressly incorporated herein by reference. The above disclosure generally describes the present invention. A more complete understanding can be obtained by reference to the following specific examples which are provided for purposes of illustration only and are not intended to limit the scope of the invention.
  • the polynucleotide of SEQ ID NO: 1 is inserted into the expression vector pCEV4 and the expression vector pCEV4-PI-PLC-like enzyme polypeptide obtained is transfected into human embryonic kidney 293 cells. From these cells extracts are obtained and phosphatidylinositol hydrolyzing activity is measured by incubation for
  • Pichia pastoris expression vector pPICZB (Invitrogen, San Diego, CA) is used to produce large quantities of recombinant human PI-PLC-like polypeptides in yeast.
  • the PI-PLC-like enzyme-encoding DNA sequence is derived from SEQ ID NO:l.
  • the DNA sequence is modified by well known methods in such a way that it contains at its 5 '-end an initiation codon and at its 3'-end an enterokinase cleavage site, a His6 reporter tag and a termination codon.
  • the modified DNA sequence is ligated into pPICZB.
  • This expression vector is designed for inducible expression in Pichia pastoris, driven by a yeast promoter. The resulting pPICZ/md-His6 vector is used to transform the yeast.
  • the yeast is cultivated under usual conditions in 5 liter shake flasks and the recombmantly produced protein isolated from the culture by affinity chromatography (Ni-NTA-Resin) in the presence of 8 M urea.
  • the bound polypeptide is eluted with buffer, pH 3.5, and neutralized. Separation of the polypeptide from the His6 reporter tag is accomplished by site-specific proteolysis using enterokinase (Invitrogen, San
  • Purified human PI-PLC-like enzyme polypeptide is obtained.
  • Purified PI-PLC-like enzyme polypeptides comprising a glutathione-S-transferase protein and absorbed onto glutathione-derivatized wells of 96-well microtiter plates are contacted with test compounds from a small molecule library at pH 7.0 in a physiological buffer solution.
  • Human PI-PLC-like enzyme polypeptides comprise the amino acid sequence shown in SEQ ID NO:2.
  • the test compounds comprise a fluorescent tag.
  • the samples are incubated for 5 minutes to one hour. Control samples are incubated in the absence of a test compound.
  • the buffer solution containing the test compounds is washed from the wells.
  • Binding of a test compound to a PI-PLC-like enzyme polypeptide is detected by fluorescence measurements of the contents of the wells.
  • a test compound which increases the fluorescence in a well by at least 15% relative to fluorescence of a well in which a test compound is not incubated is identified as a compound which binds to a PI-PLC- like enzyme polypeptide.
  • test compound is administered to a culture of human cells transfected with a PI- PLC-like enzyme expression construct and incubated at 37°C for 10 to 45 minutes.
  • a culture of the same type of cells which have not been transfected is incubated for the same time without the test compound to provide a negative control.
  • RNA is isolated from the two cultures as described in Chirgwin et al, Biochem. 18, 5294-99, 1979).
  • Northern blots are prepared using 20 to 30 ⁇ g total RNA and hybridized with a 32 P-labeled PI-PLC-like enzyme-specific probe at 65°C in Express- hyb (CLONTECH).
  • the probe comprises at least 11 contiguous nucleotides selected from SEQ ID NO:l.
  • a test compound which decreases the PI-PLC-like enzyme- specific signal relative to the signal obtained in the absence of the test compound is identified as an inhibitor of PI-PLC-like enzyme gene expression.
  • test compound is administered to a culture of human cells transfected with a PI-
  • PLC-like enzyme expression construct and incubated at 37 °C for 10 to 45 minutes.
  • a culture of the same type of cells which have not been transfected is incubated for the same time without the test compound to provide a negative control.
  • Phospholipase C activity can be measured using assays known in the art (e.g., Mullinax et al, J. Biomol. Screen. 4, 151-55, 1999;Litosch, Biochemistry 39, 1136-
  • test compound which decreases the phospholipase C activity of the PI- PLC-like enzyme relative to the phospholipase C activity in the absence of the test compound is identified as an inhibitor of PI-PLC-like enzyme activity.
  • oligonucleotides comprising at least 11 contiguous nucleotides selected from SEQ ID NO:l is performed on a Pharmacia Gene Assembler series synthesizer using the phosphoramidite procedure (Uhlmann et al, Chem. Rev. 90, 534-83, 1990). Following assembly and deprotection, oligonucleotides are ethanol-precipitated twice, dried, and suspended in phosphate- buffered saline (PBS) at the desired concentration. Purity of these oligonucleotides is tested by capillary gel electrophoreses and ion exchange HPLC. Endotoxin levels in the oligonucleotide preparation are determined using the Limulus Amebocyte Assay (Bang, Biol. Bull. (Woods Hole, Mass.) 105, 361-362, 1953).
  • the antisense oligonucleotides are administered directly to a tumor of a patient with cancer.
  • the size of the patient's tumor is decreased.
  • Quantitative Expression profiling is based on a quantitative polymerase chain reaction (PCR) analysis, also called kinetic analysis, first described in Higuchi et al., 1992 and Higuchi et al., 1993. The principle is that at any given cycle within the exponential phase of PCR, the amount of product is proportional to the initial number of template copies.
  • PCR polymerase chain reaction
  • mRNA messenger RNA
  • quantitative RT-PCR quantitative reverse transcription-polymerase chain reaction
  • RNA from different human tissues was used as a template to synthsize first-strand cDNA using the SUPERSCRIPTTM First-Strand Synthesis System for RT-PCR (Life Technologies,
  • First-strand cDNA synthesis was carried out according to the manufacturer's protocol using oligo (dT) to hybridize to the 3' poly A tails of mRNA and prime the synthesis reaction. 10 ng of the first-strand cDNA was then used as template in a polymerase chain reaction. The polymerase chain reaction was performed in a LightCycler (Roche Molecular Biochemicals, Indianapolis, IN, USA), in the presence of the DNA-binding fluorescent dye S YBR Green I which binds to the minor groove of the DNA double helix, produced only when double-stranded DNA is successfully synthesized in the reaction (Morrison et al., 1998).
  • SYBR Green I Upon binding to double-stranded DNA, SYBR Green I emits light that can be quantitatively measured by the LightCycler machine.
  • the polymerase chain reaction was carried out using oligonucleotide primers 126_DNA-L3 (CCGAGCTGCAACATCCTTTTCT) and 126_DNA-R3 (GGACAATGGCCTGACATCACAC) and measurements of the intensity of emitted light were taken following each cycle of the reaction when the reaction had reached a temperature of 81 degrees C. Intensities of emitted light were converted into copy numbers of the gene transcript per nanogram of template cDNA by comparison with simultaneously reacted standards of known concentration.
  • G3PDH glyceraldehyde-3-phosphatase
  • HPRT hypoxanthine guanine phophoribosyl transferase
  • beta-actin beta-actin
  • PBGD porphobilinogen deaminase
  • the level of housekeeping gene expression is considered to be relatively constant for all tissues (Adams et al., 1993, Adams et al., 1995, Liew et al., 1994) and therefore can be used as a gauge to approximate relative numbers of cells per .mu.g of total RNA used in the cDNA synthesis step. Except for the use of a slightly different set of housekeeping genes and the use of the LightCycler system to measure expression levels, the normalization procedure was similar to that described in the RNA Master Blot User Manual, Apendix C (1997, Clontech Laboratories, Palo Alto, CA, USA). In brief, expression levels of the five housekeeping genes in all tissue samples were measured in three independent reactions per gene using the
  • Phospholipase C family enzymes are cytoplasmic molecules that can be activated by a variety of different signaling molecules including G proteins following their activation by G protein-coupled receptors, the T cell receptor complex, and other cell surface receptors such as EGFR, PDGFR, and Fc receptors. Once activated, phospholipase C breaks down phosphatidylinositol bisphosphate to form inositol trisphosphate (IP3) and diacylglycerol (DG).
  • IP3 inositol trisphosphate
  • DG diacylglycerol
  • IP3 acts on specific receptors to release intracellular stores of Ca 2+ , which in turn activates several calcium-dependent enzymes such as CaMK and calcineurin and is involved in many cellular processes including fertilization, cell growth, transformation, secretion, smooth muscle contraction, sensory perception, and neuronal signaling.
  • Enzymes activated by Ca 2+ can induce the translocation of transcription factors such as NFAT into the nucleus and initiate the transcription of inflammation mediating genes.
  • Activated DG acts via protein kinase C family enzymes to open calcium channels in the plasma membrane and activate transcription factors such as AP-1.
  • PI-PLC-like enzyme is most highly expressed in testis, central nervous system tissue, and skeletal muscle, and is moderately expressed in lung, thymus, and thyroid.
  • Testis expression of several phospholipase C isoforms has been reported in the past, and the targeted disruption of one phospholipase gene, PLC delta 4, has been shown to have a severe impact on fertility (Fukami et al., 2001). Accordingly, PI-PLC-like enzyme regulation may have applicability in the treatment of infertility and in contraception.
  • the high expression of PI-PLC-like enzyme in central nervous system tissues such as cerebellum and adult and fetal brain, indicate that PI-PLC-like enzyme may play an important role in cell signaling by neurotransmitters.
  • PI-PLC-like enzyme in skeletal muscle suggests that this phospholipase C isoform may be involved in contraction and glucose uptake in skeletal muscle, in a way analogous to other known isoforms of phospholipase C that play such a role in smooth muscle.
  • PCR polymerase chain reaction
  • BALB/c mice are injected with a single intravenous injection of 10 ⁇ g of 145-2C11 (purified hamster anti-mouse CD3 ⁇ monoclonal antibodies, PHARMTNGEN). Compound is administered intraperitoneally 60 min prior to the anti-CD3 mAb injection. Blood is collected 90 min after the antibody injection. Serum is obtained by centrifugation at 3000 r.p.m. for 10 min. IL-2 and IL-4 levels in the serum is determined by an ELIS A. Proteins which regulate the CD3 downstream signaling can be evaluated in this model.
  • B cell receptor signalling molecules, any molecule involved in B cell activation/Ig class switching
  • mice are injected intravenously with 0.8 mg of purified goat anti-mouse IgD antibody or PBS (defined as day 0). Compound is administered intraperitoneally from day 0 to day 6. On day 7 blood is collected and serum is obtained by centrifugation at 3000 r.p.m. for 10 min. Serum total levels of IgE are determined by YAMASA's ELIS A kit and their Ig subtypes are done by an Ig ELIS A KIT (Rougier Bio-tech's, Montreal, Canada). Proteins which regulate the IgD downstream signaling and Ig class switching can be evaluated.
  • mice are injected intraperitoneally with LPS (200 g/mouse). Compound is administered intraperitoneally 1 hr before the LPS injection. Blood is collected at 90 min post-LPS injection and plasma is obtained. TNF- concentration in the sample is determined using an ELISA kit. Proteins (RDPIs) which regulate the LPS downstream signaling, such as NF- B activation, can be evaluated.
  • LPS 200 g/mouse
  • RDPIs Proteins which regulate the LPS downstream signaling, such as NF- B activation
  • GPCR Eotaxin-eotaxin receptor
  • BALB/c mice are injected intradermally with a 2.5 ml of air on days -6 and -3 to prepare airpouch.
  • compound On day 0 compound is administered intraperitoneally 60 min before eotaxin injection (3 ⁇ g/mouse, i.d.).
  • IL-5 300 ng/mouse
  • leukocytes in exudate is collected and the number of total cells is counted.
  • the differential cell counts in the exudate are performed by staining with May-Grunwald Gimsa solution. Proteins which regulate the eotaxin/CCR3 binding and CCR3 downstream signaling can be evaluated. Alternatively, proteins which modulates eosinophil function can be also evaluated.
  • D10.G4.1 cells (1 x 10 7 cells/mouse) containing 2 mg of conalbumin in saline is administered i.v. to AKR mice. After 6 hr blood is collected and serum is obtained by centifugation at 3000 r.p.m. for lOmin. IL-4 and IL-5 level in serum are determined by ELISA kits. Compound is admimintered intraperitoneally at -4 and +1 hr after these cells injection. Proteins which regulate the Th2 activation can be evaluated.
  • Proteins which inhibit adhesion of Th2 cells can be also evaluated.
  • control rats with sensitization, challenge and vehicle treatment are used to determine a value without inhibition. Thirty min after the challenge, the rats are killed, and the skin of the back is removed. Evans blue dye in the skin is extracted in formamide overnight at 63°C. Then an absorbance at 620 nm is measured to obtain the optical density of the leaked dye.
  • Percent inhibition of PCA with a compound is calculated as follows:
  • % inhibition ⁇ (mean vehicle value - sample value)/(mean vehicle value — mean control value) ⁇ x 100
  • Proteins which regulate mast cell degranulation, vascular permeability or receptor antagonists against histamine/serotonin/systeinyl leukotriene receptors can be evaluated.
  • Proteins which regulate mast cell degranulation, vascular permeability or receptor antagonists against histamine/serotonin/systeinyl leukotriene receptors can be evaluated. Proteins which regulate the contraction of smooth muscle can be also evaluated.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Veterinary Medicine (AREA)
  • Pulmonology (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

L'invention concerne des réactifs qui permettent de réguler une enzyme humaine de type phospholipase C spécifique du phosphatidylinositol ainsi que des réactifs qui se lient aux produits géniques de cette enzyme, et qui peuvent jouer un rôle dans la prévention, l'amélioration ou la correction de dysfonctionnements ou de maladies comprenant, notamment, l'asthme, le cancer, des troubles du système nerveux central, et la broncho-pneumopathie chronique obstructive.
PCT/EP2001/011012 2000-09-27 2001-09-24 Regulation d'enzyme humaine de type phospholipase c specifique du phosphatidylinositol WO2002026996A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2002210514A AU2002210514A1 (en) 2000-09-27 2001-09-24 Regulation of human phosphatidylinositol-specific phospholipase c-like enzyme

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US23555200P 2000-09-27 2000-09-27
US60/235,552 2000-09-27

Publications (2)

Publication Number Publication Date
WO2002026996A2 true WO2002026996A2 (fr) 2002-04-04
WO2002026996A3 WO2002026996A3 (fr) 2002-09-26

Family

ID=22885960

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2001/011012 WO2002026996A2 (fr) 2000-09-27 2001-09-24 Regulation d'enzyme humaine de type phospholipase c specifique du phosphatidylinositol

Country Status (2)

Country Link
AU (1) AU2002210514A1 (fr)
WO (1) WO2002026996A2 (fr)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003041737A1 (fr) * 2001-11-13 2003-05-22 The University Of Liverpool Traitement des etats inflammatoires
WO2004003189A2 (fr) * 2002-06-26 2004-01-08 Bayer Healthcare Ag Regulation de phospholipase c humaine
WO2008067019A2 (fr) * 2006-10-02 2008-06-05 Regents Of University Of Colorado Phospholipase c et procédé d'utilisation

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001075067A2 (fr) * 2000-03-31 2001-10-11 Hyseq, Inc. Nouveaux acides nucleiques et polypeptides

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001075067A2 (fr) * 2000-03-31 2001-10-11 Hyseq, Inc. Nouveaux acides nucleiques et polypeptides

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DATABASE SWISSPROT [Online] 1 July 1989 (1989-07-01) SUH ET AL.: "1-PHOSPHATIDYLINOSITOL-4,5-BISPHOSPHATE PHOSPHODIESTERASE DELTA 1 (EC 3.1.4.11) (PLC-DELTA-1) (PHOSPHOLIPASE C-DELTA-1) (PLC-III)." Database accession no. P10688 XP002199648 *
DATABASE SWISSPROT [Online] 1 May 2000 (2000-05-01) KIKUNO ET AL.: "KIAA1069 Protein (Fragment)" Database accession no. Q9UPT3 XP002199647 -& KIKUNO ET AL.: "Prediction of the coding sequences of unidentified human genes. XIV. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro." DNA RESEARCH, vol. 6, 1999, pages 197-205, XP000852618 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003041737A1 (fr) * 2001-11-13 2003-05-22 The University Of Liverpool Traitement des etats inflammatoires
WO2004003189A2 (fr) * 2002-06-26 2004-01-08 Bayer Healthcare Ag Regulation de phospholipase c humaine
WO2004003189A3 (fr) * 2002-06-26 2004-06-10 Bayer Healthcare Ag Regulation de phospholipase c humaine
WO2008067019A2 (fr) * 2006-10-02 2008-06-05 Regents Of University Of Colorado Phospholipase c et procédé d'utilisation
WO2008067019A3 (fr) * 2006-10-02 2008-10-23 Univ Colorado Phospholipase c et procédé d'utilisation

Also Published As

Publication number Publication date
WO2002026996A3 (fr) 2002-09-26
AU2002210514A1 (en) 2002-04-08

Similar Documents

Publication Publication Date Title
WO2002028906A2 (fr) Regulation d'une proteine humaine de type sphingosine kinase
US20040043470A1 (en) Regulation of human histone deacetylase
US20020146407A1 (en) Regulation of human eosinophil serine protease 1- like enzyme
US20060141552A1 (en) Regulation of human caspase-1-like protease
US6821745B2 (en) Regulation of human pyroglutamyl peptidase-like enzyme
WO2002026996A2 (fr) Regulation d'enzyme humaine de type phospholipase c specifique du phosphatidylinositol
US20050170486A1 (en) Nucleic acids encoding human inositolpolyphosphate 5-phosphatase
JP2004522429A (ja) ヒトケモカイン様レセプターの調節
WO2003016345A1 (fr) Regulation du regulateur humain de la signalisation des proteines g
WO2002048397A2 (fr) Regulation d'adenylate cyclase humaine de type vii
US20030186919A1 (en) Regulation of human sodium-dependent monoamine transporter
WO2004031377A1 (fr) Regulation de la proteine phosphatase humaine de type pp2c
WO2002040684A2 (fr) Regulation de phosphatase acide pourpre d'origine humaine
US20040101529A1 (en) Regulation of human serine-threonine protein kinase
US20030175941A1 (en) Regulation of human serine racemase enzyme
WO2002053714A2 (fr) Regulation de la phosphatidylinositol-4-phosphate 5-kinase humaine
WO2001072833A2 (fr) Regulation de recepteur humain de type ephrine
WO2002031126A2 (fr) Regulation d'une peptidyl-prolyl cis-trans isomerase de type cyclophiline humaine
WO2002033056A2 (fr) Regulation de serine-threonine kinase humaine
US20040115670A1 (en) Regulation of human carboxypeptidase a
WO2002040651A2 (fr) Regulation de l'adenosine desaminase humaine specifique a arnt
WO2002033097A2 (fr) Regulation de la sulfotransferase humaine
WO2002029049A2 (fr) Regulation du transporteur de monoamine humain dependant du sodium
WO2001072955A2 (fr) Regulation de la proteine humaine apparentee a nedd1
WO2001073077A2 (fr) Regulation de serine racemase humaine

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PH PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
AK Designated states

Kind code of ref document: A3

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PH PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP