WO2002022800A2

WO2002022800A2 - Expression cassettes and adenovirus vectors

Info

Publication number: WO2002022800A2
Application number: PCT/EP2001/010654
Authority: WO
Inventors: Leopold DÖHNER; Dietmar Becher; Salah Salim
Original assignee: Micromun Privates Institut Für Mikrobiologische Forschung Gmbh
Priority date: 2000-09-15
Filing date: 2001-09-14
Publication date: 2002-03-21
Also published as: DE10045687B4; AU2002221595A1; DE10045687A1; WO2002022800A3

Abstract

The invention relates to expression cassettes, comprising the regulatory sequence of the polypeptide IX gene from adenovirus, functionally connected to the DNA of a foreign DNA for expression, the expression vectors containing the above and method for production thereof.

Description

Expression cassettes and adenovirus vectors

The invention relates to an expression cassette, vectors containing the same and a method for producing expression vectors which are derived from the genome of adenoviruses.

Viral vectors enable the expression of exogenous nucleotide sequences in eukaryotic cells and thus both the expression of proteins and their post-translational modifications which are important for the effectiveness of the proteins. Adenoviruses are a suitable type of virus. They can infect many types of cells, which is why they have been considered for both gene therapy and the expression of foreign proteins. A number of groups of adenoviruses are known, for example those which infect dogs, monkeys or humans. Of the Human adenoviruses are classified into subtypes according to neutralization reactions. The Ad2 and Ad5 adenoviruses were examined particularly intensively and the genome of adenovirus Ad5 was completely sequenced.

The sequence can be obtained from Genbank (EMBL) under accession number M73260. All of the nucloeotide positions of adenovirus DNA given below refer to this published sequence.

The adenovirus infection cycle is divided into early and late phases, and important proteins necessary for infection are designated E or L depending on their function in the early or late phase. Proteins important for the expression of the viral DNA include the proteins of the E1, E2 and E4 region, with E1 being crucial for replication. The gene for polypeptide IX (pIX) is an independent transcription unit within the E1 region and plays a role in the construction of the virus envelope, among other things. The E3 region is not required for replication. Region E3 is therefore a preferred region of the viral genome for inserting foreign DNA.

The expression of the adenovirus type 5 pIX gene presupposes the presence of the 21 kDa protein of the E1b region from Adeno 5 (Babiss and Vales, 1991). This is ensured in the case of using a wild-type Adenoδ virus without deletions in the E1b region, or, when using E1 deleted viruses, by using recipient cell lines which have integrated the genes of the E1 region into their genome and express the corresponding proteins (on 293 based cell lines).

The limited capacity of adenoviruses to take up additional DNA (approximately only up to 5% of the genome size) usually requires that compensatory deletions be carried out, which on the one hand do not disturb the stability and replication of the virus and on the other hand are large enough for nucleotides can be inserted, which encode the desired proteins. In addition to region E3, deletions in regions E1, E2 and E4 were also considered for deletions, these deletions being made possible by growing the deleted viruses in cell lines which have integrated the corresponding virus genes into their genome. such Cell lines are known and described in the literature. For example, cell line 293, which is commercially available, and is used, for example, in US Pat. No. 5,891,690 or by Lochmuller et al. (in Hum. Gene Ther. 5: 1485-1491, 1994). In viruses with a deleted pIX gene, a reduced thermostability and a reduction in the DNA absorption capacity to 2000 bp below the normal genome size are given as the phenotype (Caravokyri and Leppard, 1995). This gene is therefore not considered for insertions of foreign DNA.

Many expression systems based on adenoviruses have already been developed, but are not yet fully satisfactory. Problems often arise which are attributable to a decrease in vitality and the occurrence of genomic instabilities and which ultimately lead to reduced protein yields.

It was now the object of the invention to provide a new expression system based on adenovirus which delivers high expression rates. In addition, it was an object of the invention to provide a method which can be used to provide genetically modified adenoviruses which can express foreign DNA in a simple manner without using ligations.

The object is achieved with the expression systems and vectors described in the claims and with the claimed method.

Surprisingly, it was found that the use of the regulatory sequences of the polypeptide IX gene, hereinafter referred to as pIX, leads to an increased expression rate. The regulatory sequences of pIX are therefore used according to the invention for the expression of foreign proteins in adenovirus.

According to the invention, expression cassettes are therefore provided which, in operative connection, contain the regulatory sequences of the polypeptide IX gene of adenovirus in addition to the nucleotide sequence for a foreign DNA to be expressed.

Adenoviruses, the genome of which can be considered for the cassettes and vectors according to the invention, are in particular human adenoviruses of group C, in particular that of Subtypes 1, 2, 5 or 6, or subtypes 3, 4, 7 or 8, particularly preferably subtypes 2 or 5.

According to the invention, at least the promoter and terminator are used as "regulatory sequences". However, the sequences can include other nucleotides that contribute to increased activity or stability, or also enhancers. The pIX promoter comprises at least the sequence between positions 3515 and 3611 of the adenovirus genome, while the terminator comprises the nucleotides at positions 4028 to 4090. The corresponding analog sections of other adenoviruses can also be used for the cassettes according to the invention. They can be found easily by analogy.

The expression cassette according to the invention contains, in addition to the regulatory sequences, foreign DNA to be expressed. The term "foreign DNA" as used here is to be understood to mean any nucleotide sequence which is naturally not present in the adenovirus genome and is therefore foreign. Foreign DNA can mean genes, parts of genes, fused genes, cDNA or other DNA sequences which encode, for example, polypeptides or proteins or also RNA or antisense RNA. Foreign DNA can also be a reporter gene. The foreign DNA can be a naturally occurring, genetically engineered or chemically synthesized sequence or a combination thereof. The nucleotide sequence used is not critical as long as it is expressible under the pIX promoter and is of a size that does not exceed the capacity of the adenovirus vector.

Regulatory sequences of the pIX gene of adenoviruses of group C and in particular of type 2 or 5 adenovirus are preferably used for the expression cassette according to the invention.

In a preferred embodiment, the expression cassette furthermore has nucleotides at both ends which encode at least a part of the E3 region of adenovirus in order to facilitate the insertion of the cassette by homologous recombination into the adenogenome. The areas homologous to the adenogenome should each have a length of about 1000 to 2500, preferably about 1500 to 2500 bp. As flanking E3 DNA sections, those of group C adenoviruses, in particular of type 2 or 5 adenovirus, are also preferably used. They preferably end in original H / nc /// interfaces, which are regarded as free ends as particularly recombinogenic and, on the other hand, enable simple cassette cloning.

The expression cassettes according to the invention are preferably constructed according to a modular principle, which allow the replacement of each functional subunit and thus perform a wide variety of functions. They particularly preferably consist of the following components:

E3 left flanking fragment as Hindlll-Kpnl-Fragmer p, pIX gene promoter as pn / -Λ / co / fragment,

Foreign DNA as an Ncol-Bcll fragment, pIX gene terminator as a ßc // - Sac // - fragment and

E3 fragment flanking the right as a Sacll-Xbal-Hindlll fragment. By substituting the range from Kpnl to Sacll, for example, an integration cassette is obtained, with the aid of which any DNA can be integrated into the E3 region (see also the exemplary embodiments). The Kpnl-Sacll fragment containing the pIX gene promoter, the polylinker (foreign DNA) and the pIX gene terminator can, for example, be combined with other flanking fragments in order to integrate it elsewhere in the virus genome, etc.

The expression cassettes according to the invention are used for insertion into adenovirus vectors. Since, in a preferred embodiment, an E3 deletion is carried out for adenovirus vectors in the range from positions 28 308 to 29 449 or 30471, the regulatory sequences in particularly preferred expression cassettes are flanked by DNA sections of the adenovirus type 5 genome which this E3 Deletion of the vectors are adjacent. This means that preferred cassettes, for example, have the nucleotides from positions 26329 to 28308 and 26329 to 28523 from the E2 / E3 region on one side and on the other Side (a) nucleotides from positions 29449 to 32012 or (b) nucleotides from positions 30471 to 32012 contain.

Variant (b) serves to further increase the absorption capacity of the vector and thus the expression cassette. By restriction, e.g. with Xbal and ligation, the right flanking nucleotides between positions 29449 and 30471 can be deleted from the E3 region from variant (a). This additional, compensatory deletion increases the capacity of the expression cassettes from approx. 980 bp to approx. 2000 bp, so that when this size is inserted the normal genome size of the adenovirus type 5 (35935 bp) is not exceeded, even without deletion of the E1 region , In this case, the nucleotides flanking the regulatory sequences on the right are selected from the region downstream from position 32012.

The Ad5 expression vectors that are preferably used here usually have an intact pIX gene at the original genome position, which increases their maximum absorption capacity even up to approximately 4000 bp. It is possible to further increase the absorption capacity through compensating deletions in other known regions of the adenovirus genome. Expression cassettes can therefore be provided which can be expressed inserted in adenovirus and which contain the coding DNA up to a size of more than 4 kb and even when all possible deletions up to 7 or 8 kb are used.

Examples of the expression cassettes according to the invention and their production are described in the experimental part. Thus, in a preferred embodiment, an expression cassette is provided which contains a reporter gene which can then be used for a method for the ligationless production of an expression system. In this case the nucleotide sequence to be expressed is a reporter gene. Reporter genes are known per se and the person skilled in the art can select the appropriate one for this. An example of a reporter gene which is preferably used according to the invention is a sequence which encodes the green fluorescent protein "GFP". The expression cassettes according to the invention can be propagated in a manner known per se in bacterial vector plasmids (general cloning vectors such as pBR322 or pUC19) in Escherichia coli and from the vector plasmid by cleavage with restriction endonucleases, for example HindIII, as linear DNA fragments (ie in the form of the expression cassette) be isolated.

In order to facilitate the production of an expression cassette with a nucleotide sequence to be expressed, an expression cassette is provided according to the invention which has the regulatory sequences of the polypeptide IX gene of adenovirus and which has an insertion site between the promoter and terminator into which a sequence to be expressed can then be inserted , This insertion site is formed by a sequence that cleaves for various restriction endonucleases. By appropriate selection of the interfaces in this "empty" cassette and by appropriate interfaces being provided in the nucleotide sequence to be inserted, the insertion can be effected in the correct direction so that the inserted DNA can be read correctly. One or both restriction sites can be converted into blunt ends in a manner known per se by fill-in reactions.

The insertion site is therefore preferably a polylinker which provides various unique interfaces in order to permit a directed insertion. Such polylinker sequences are known per se and the sequences known in the prior art can be used for this. An example is the insertion sequence contained in the plasmid pSL1180.

An example of a cassette according to the invention is described in the experimental part and stored as a plasmid. In this cassette, which was obtained from an adenovirus genome fragment, successively at the site of the E3 region of the original fragment, the promoters of the adenovirus type 5 pIX gene (positions 3515 to 3611), a modified insertion site [Ncol - Bell as in the polylinker fragment of bacterial cloning vector pSL1180, J. Brosius, 1998) for the directed insertion of a reading frame of the foreign gene to be expressed, and the terminator of the adenovirus type 5 pIX gene (positions 4028 to 4090), the downstream ends in a synthetic Xbal-Sacll interface. The regulatory sequences of the pIX gene are thus introduced into the Ad5 genome in addition to the original pIX gene, so that the gene important for the function is retained and the capacity for foreign DNA is not restricted by these manipulations.

Further examples of "empty" cassettes and their production are also described in the experimental part and various embodiments have been deposited with the DSM as plasmids with the deposit numbers DSM 13703, DSM 13704, DSM 13705 and DSM 13706.

The expression cassettes according to the invention serve to insert foreign DNA into adenovirus, which is used as a vector. They are therefore used in a manner known per se for the production of adenovirus expression vectors for the expression of desired peptides and proteins. They are also suitable for insertion into conventional vectors, as are generally used in the field of genetic engineering. The expression cassettes according to the invention can e.g. first inserted into an E. coli vector to amplify the cassette. The amplified vector can then be obtained and the cassette cut out again in order to be used in the adenovirus genome for expression in eukaryotic cells. Vectors which are suitable for amplifying the expression cassette in microorganisms are known to the person skilled in the art and need not be explained in more detail here.

The expression vectors according to the invention are produced by inserting an expression cassette according to the invention into the suitable location of the adenovirus genome. The insertion is carried out in a manner known per se. The insertion site or the location of the substituting deletion and the size of the deleted part are determined depending on the selected expression cassette.

For the expression of the desired peptide or protein, eukaryotic cells are infected with the expression vector according to the invention. A variety of cells of animal and human origin come into consideration which can be infected by adenovirus and it becomes the one for the respective peptide or Protein suitable cell selected.

The size of the deletions, as stated above, depends on the size of the nucleotide sequence to be expressed. Since the capacity of the adenovirus for foreign DNA is not very high, larger deletions have to be carried out with larger nucleotide sequences to be expressed. Such methods and the ranges suitable for deletions are known to the person skilled in the art.

For example, according to the invention, a recombinant "transfer vector" based on adenovirus type 5 is provided, which contains a reporter gene. This transfer vector consists of the adenovirus genome or Ad5 and carries a substitution in the E3 region which comprises nucleotides which correspond to the region from positions 28308 to 30471 of the Ad5 virus genome. This area is not essential for virus replication and can be used as a compensating deletion for the accommodation of expression cassettes. In one of the exemplary embodiments described in more detail below, this region of the adenovirus type 5 genome is a 2045 bp DNA fragment (Bst 1107-C / al) from the plasmid pGREEN-LANTERN ™ -1 (Life Technologies), consisting of the CMV promoter, Green Fluorescence protein (GFP) and SV40 terminator, or replaced by the pIX promoter-GFP-pIX terminator cassette described below. When irradiated with blue or UV light, the expression of the GFP leads to fluorescence of the cells infected with recombinant adenovirus type 5 transfer vectors. The vector which contained the cassette with the CMV promoter showed less fluorescence when expressed than the vector which contained the cassette according to the invention. Two vectors with the cassette according to the invention were deposited with the DSM with the accession numbers DSM 13707 and DSM 13708.

The adenovirus vectors according to the invention are grown in any cell lines or complementing cell lines, depending on the deletions made. An advantageous system for the expression of proteins or peptides is, for example, the combination of an adenovirus vector in which the regions of the genes E1 and E3 and optionally also E2 and / or E4 are replaced by a nucleotide sequence which codes for a desired protein, in combination with one Cell line that provides the proteins encoded by E1. Such cells are available and are available, for example, as cell line 293.

Another object of the invention is the use of the regulatory sequences of the gene for polypeptide pIX from adenoviruses, in particular those of group C, for the production of expression cassettes for the expression of foreign DNA in adenovirus expression systems.

It was found that the regulatory sequences of pIX are very well suited for the expression of foreign DNA in adenoviruses and lead to high expression rates. Many expression systems are known, including for adenoviruses, but they do not lead to satisfactory yields. However, if the regulatory sequences of pIX are used for expression for foreign DNA in adenovirus and conditions are provided which allow expression, higher yields are achieved in comparison to other expression systems.

The regulatory sequences are obtained in a manner known per se, e.g. by providing primers and using PCR using these primers or by cloning corresponding gene segments as restriction fragments of the adenogenome and inserting them into plasmids which are propagated in suitable microorganisms. Methods for this are known to the person skilled in the art and these require no further explanation.

In order to be able to produce the expression vectors according to the invention and generally expression systems without ligations, a method was developed which facilitates the production of the vectors and systems. The invention therefore furthermore relates to a method for producing a virus expression system for the expression of foreign DNA, which comprises the following steps:

I. providing a transfer vector containing an expression cassette that expresses a reporter gene, the vector being derived from the viral genome, and wherein the expression cassette is substituted for part of the viral genome;

II. Provision of an expression cassette which contains regulatory sequences and the DNA for a nucleotide sequence to be expressed among the regulatory sequences and is flanked by DNA from the virus genome which is adjacent to the insertion site of the cassette,

III. Transfection of the cassette into cells in which the DNA is to be expressed,

IV. Infection of the cells from stage III with the transfer vector from stage I;

V. obtaining a virus lysate from the cells obtained in stage IV, which contains recombinant viruses which have arisen by recombination between the expression cassette and the transfer vector;

VI. Infection of cells with the stage V virus lysate;

VII. Selection of the cells in which the expression product of the reporter gene is replaced by the expression product of the target DNA, as a result of which the expression product of the reporter gene is no longer detectable and

VIII. Obtaining virus lysate, which corresponds to the virus expression vector, from the cells selected in stage VII.

With this method it is possible to produce expression vectors without performing ligations, which simplifies the extraction of vectors. For this purpose, the expression product of a reporter gene is used, on the one hand to track the infection of cells by detecting the reporter gene product and, on the other hand, to exchange the target DNA for the reporter gene by detecting the disappearance of the reporter gene product. This method therefore makes it possible to generate reproducible vectors and other expression systems using prepared expression cassettes using in vivo recombinations, since the insertion can be followed via reporter gene products, for example fluorescent dyes. This method is suitable for producing the expression vectors according to the invention. In a preferred embodiment, the method according to the invention is therefore used to produce an adenovirus expression system for the expression of foreign DNA, which comprises the following stages:

1. Provision of an adenovirus-based transfer vector which contains an expression cassette in the E3 region which expresses a reporter gene and substitutes at least part of the E3 region of the adenovirus genome;

2. Provision of an expression cassette which contains the DNA for a nucleotide sequence to be expressed under the regulatory sequences of the pIX gene and is flanked by DNA from adenovirus which is homologous to the adenovirus DNA which flanks the substitution in the E3 region of the transfer vector ;

3. Transfection of the cassette into eukaryotic cells;

4. Infection of the cells from stage 3 with the transfer vector from stage 1;

5. Obtaining a virus lysate from the cells obtained in step 4, which contains recombinant adenoviruses which have arisen by recombination between the expression cassette and the transfer vector;

6. Infection of eukaryotic cells with the level 5 virus lysate;

7. Selection of the cells in which the expression product of the reporter gene is replaced by the expression product of the target gene, whereby the expression product of the reporter gene is no longer detectable and

8. Obtaining virus lysate, which corresponds to the adenovirus expression vector, from the cells selected in step 7.

According to the invention, a vector is used as the transfer vector which expresses the sequence of the reporter gene under the control of suitable regulatory sequences, preferably the regulatory sequences of pIX, and also contains sequences on both sides which correspond to sequences of the E3 region of the adenovirus genome. This transfer vector is used to infect cells in which the desired product of the foreign DNA is to be expressed. At the same time, however, the cells are also transfected with a cassette which has the desired foreign DNA with the regulatory sequences of pIX and flanking sequences from the E3 region of the adenovirus. The cassette comes into contact with the transfer vector in the cell and matching areas accumulate against one another, which makes recombination events possible. All cells that have been infected with adenovirus are lysed, the reporter gene product being detectable in the cells in which the transfer vector has remained unchanged, while in the cells in which a recombination event has occurred, no reporter gene product can be detected , The disappearance of the reporter gene product is used to select those cells which contain the desired expression vector with an inserted expression cassette.

In a preferred embodiment of the method according to the invention, the gene for the green fluorescent protein is used as the reporter gene, since its fluorescence is easy to detect. The fluorescence can then be used to separate cells that fluoresce from non-fluorescent cells. This can be done either manually, microscopically (selection of cytopathic effects CPE from titration series) or with the help of automated devices, e.g. with the help of a FACS.

The cells in which the reporter gene product is undetectable are selected and from their lysate the desired vector containing the target DNA can then be obtained.

In a further preferred embodiment of the method according to the invention, the transfer vector is also obtained using a method as just described. For this purpose an expression cassette is used which contains a DNA region which codes for a reporter gene. This area is flanked by regulatory sequences, preferably by the pIX regulatory sequences of adenovirus. In addition, the cassette has sequences from the E3 region or regions of the adenovirus adjacent to the E3 region at both ends. Eukaryotic cells are then infected with wild-type adenovirus and transfected with the expression cassette containing the reporter gene. Cells infected with virus are lysed and those cells in which a recombination event has occurred between the wild-type DNA and the expression cassette contain the reporter gene product, which is detectable. In this way, after selecting the Cells in which the reporter gene product is detectable and the virus lysate is obtained. Vectors are obtained which are suitable as transfer vectors.

The adenovirus expression vector obtained by the method according to the invention, which contains a DNA to be expressed, can then be used to produce the expression product by infecting eukaryotic cells with this adenovirus expression vector in a manner known per se, the infected cells under such conditions, which allow the expression of the foreign protein, are grown and then the expressed protein is obtained and optionally purified.

An embodiment of the method is explained below by way of example. Expression cassettes in bacterial vector plasmids (general cloning vectors such as pBR322 or pUC19) are propagated in Escherichia coli and isolated from the vector plasmid by cleavage with the restriction endonuclease Hindlll as linear DNA fragments (expression cassettes).

The expression cassettes are then transfected into recipient cell lines such as 293 and the transfected cells are then infected with the GFP transfer vector. During adenovirus infection and replication, homologous recombinations occur between sequences of the E3 region in the genome of the GFP transfer vector and the flanking sequences of the expression cassettes. The GFP sequence of the transfer vector is replaced by the reading frame of the expression cassette to be expressed.

The selection of recombinant expression vectors which have replaced the GFP gene with the gene to be expressed is preferably carried out after infection with appropriately diluted lysates by microscopic detection of non-fluorescent CPEs. After overlaying with agarose, these can be cut out and titrated again for further purification.

There is thus provided a method for obtaining proteins with which a high yield can be achieved and which is used for expression Vector can be obtained in a simple manner without ligation methods by in vivo recombination.

The invention is illustrated by the following FIGS. 1 to 8, FIG. 1 showing the gene map of the plasmid pMBACOI (DSM 13703), which contains an empty expression cassette with a linker; Figure 2 shows the gene map of plasmid pMBAC02 (DSM 13704), which is an empty one

Contains expression cassette with a linker; Figure 3 shows the gene map of plasmid pMBAC03 (DSM 13705), which is an empty one

Contains expression cassette with a linker; Figure 4 shows the gene map of plasmid pMBAC04 (DSM 13706), which is an empty one

Contains expression cassette with a linker; Figure 5 shows the gene map of the plasmid pMBACOδ (DSM 13707), the one

Contains expression cassette into which the gene for GFP has been inserted; Figure 6 shows the gene map of the plasmid pMBAC06 (DSM 13708), the one

Contains expression cassette into which the gene for GFP has been inserted; Figure 7 shows the gene map of the plasmid pMBAC31 (DSM 13709), the one

Contains expression cassette in which the gene for the

Rabies virus surface glycoprotein is inserted (Ra-GP1) and Figure 8 shows the gene map of the plasmid pMBAC37 (DSM 13710), which is a

Contains expression cassette into which Ra-GP1 has been inserted.

E. coli, which contained the plasmids shown in the figures and were designated accordingly, were deposited on September 1, 2000 at DSM, Mascheroder Weg 1b, 38124 Braunschweig, with the deposit numbers given in brackets. The preparation and use of the plasmids is explained in the following exemplary embodiments.

The invention is further illustrated by the following examples. example 1

General expression cassettes: MBAC01, MBACOP, MBAC03 and MBACn4

The plasmid pSL1180 was used to clone sections of the expression cassettes. The DNA of the wild-type adenovirus type 5 strain: adenoid 75 (ATCC number: VR-5) served as the DNA template for PCR reactions. Individual sections of the adenovirus genome were amplified by PCR with sequence-specific primer oligonucleotides, to which sequences for restriction enzyme recognition sites were attached, and cloned into pSL1180 in the following steps:

1. Amplification of the pIX promoter area with the primer pair BA1 A / BA10

P9 promoter reverse end: from position 3611 with 5 ^' appended Λ / col location GAACCATGGCGGCGGCGGCTGCTGC = BA10

P9 promoter start forward: from position 3515 with 5 'appended \ place ATATAGGTACCGAAATGTGTGGGCGTGGCTTAAGGG = BA1A

Cloning as a Kpn \ INco \ fragment in pSL1180 results in plasmid "p1P".

2. Amplification of the "left" E3 flanking sequence with the primer pair:

BA8 / BA9 or BA8A / BA9:

Hindlll forward from position 26329 ATATAGAAGCTTCCGAGGTCGAAGAGG = BA9

Kpnl applied revers from position 28308 ATATAGGTACCGGGTTGAAACTGTTGTAAATCAC = BA8

Kpnl applied revers from position 28523 ATATAGGTACCTGGCCTAATACCCTAAGGGTTTTC = BA8A

Cloning as Hinά \\\ lKpn \ fragment in plasmid p1P results in “p2P8” or “p2P8A”

3. Amplification of the pIX terminator area with the primer pair BA3C / BA4B:

P IX terminator forward primer from position 4028 with attached ßc / l location TATATGATCATAAAACATAAATAAAAAACCAG = BA3C

P IX Terminator reverse primer from position 4090 with attached Xba \ and Sacll

locate

ATATCCGCGGTCTAGAGACAGCAAGACACTTGCTTGATCC = BA4B Cloning as a βc / l / Sacll fragment in pSL1180 results in plasmid "p1T".

4. Amplification of the "right" E3 flanking sequence with the primer pair BA6 / BA7A:

Sacll location forward from position 29449 ATATACCCGCGGATTTGTTCCAGTCCAAC = BA6 H / ndlll location reverse from position 32012 AGGTTAACCTCAAGCTTTTTGGAATTG = BA7A

Cloning as H / ndlll / Sacll fragment in p1T results in "p2T".

5. Obtaining the inserts: H / ndlll / Λ / col from p2P8 or p2P8A

6. Obtaining the insert: H / ndlll / ßc / l from P2T

7. Obtaining the Polylinker fragment: Λ / col / ßc / l from pSL1180

8. Ligation of the mixture of the three DNA fragments and subsequent cleavage with H / ndlll

9. Size fractionation of the ligation batch cleaved with H / llll in the agarose gel

10. Cloning in plasmid pBR322 cleaved with H / III results in the empty expression cassette “MBAC02” when using p2P8A as the starting material or in the case of using p2P8 as starting material the empty expression cassette “MBAC01”.

11. By cleavage with Xba \ and recircularization using ligase, the right flanking sequence in the plasmids MBAC01 and MBAC02 1028bp can be deleted. The expression cassettes MBAC03 from MBAC01 and MBAC04 from MBAC02 are created with a correspondingly expanded DNS uptake capacity. Example 2

Fxp gutter cassette for GFP-MBAOFi and MRACβ

1. Amplification of the pIX promoter area using the primer pair BA1A / BA2

The pIX promoter reverse primer covers position 3611-3593. The first 16 bases of the coding sequence of the GFP are attached to the 5 ^' end of the primer. GTTCCTCGCCCTTGCTCATGGCGGCGGCGGCTGCT = BA2

2. Amplification of the pIX terminator area using the primer pair BA4B / BA3

The pIX terminator forward primer from position 4028: The last 16 bases (including stop codon) of the coding sequence of the GFP end are appended to the end of the primer. CGAGCTGTACAAGTGATAAAACATAAATAAAAAACCAG = BA3

3. Generation of a DNA fragment by means of PCR, which consists of pIX promoter, GFP and pIX terminator. The plasmid pGREEN LANTERN-1 is used as a DNA template. The PCR products from steps 1 and 2 are used as primers.

4. Cleavage of the PCR product from step 3 with the restriction enzymes Kpn \ and Sacll and cloning of the 878 bp restriction fragment into the plasmids MBAC01 and MBAC02, which were cleaved with the same restriction enzymes. This creates the expression cassettes MBAC5 and MBAC6. Example 3

Fxprftssionskassettn for GFP-MBAC15 and MBAC17

In the plasmid MBAC01, the DNA fragment containing the regulatory sequences of the pIX gene is deleted by cleavage with Kpnl and SacII and replaced by a KpnUSacU fragment of the polylinker of the plasmid pSL1180. The resulting plasmid is named MBA17. The insert consisting of E3 on the left, polylinker fragment of pSL1180 and E3 on the right, is obtained from MBA17 by cleavage with H / nαII and cloned into the plasmid pUC19. The plasmid MBA21 is formed. MBA21 has the unique cleavage sites for the restriction enzymes C / al and SnaBI in the polylinker fragment of the plasmid pSL1180.

A DNA fragment which contains the GFP reading frame under the control of the CMV promoter and the SV40 terminator is obtained from the plasmid pGREEN LANTERN-1 by cleavage with ßsf1107l and C / al. Since SnaBI and ßsf1107l provide blunt restriction sites, the fragment from pGREEN LANTERN-1 can be ligated into the plasmid MBA21 cleaved with SnaBI and C / al. The expression plasmid MBAC13 is formed. MBAC13 of the expression cassette as H ^'can be cut out ndlll fragment / and ligated into the plasmid pBR322. The expression plasmid MBAC15 is produced. A 1022 bp fragment of the sequence flanking the E3 on the right is deleted from MBAC15 by cleavage with Sacll and Xbal and replaced by a 116 bp Sac \ IXba fragment from the polylinker of the plasmid pSL1180. The expression plasmid MBAC17 is produced. Bassispifil 4

FxpressinnskassettFtn for Oherflär.hfinglympmreingen of the Tollwiitvirus:

MBAC31 and MBAC37

1. Amplification of the pIX promoter area using the primer pair RA1A / BA10

P9 promoter: from 3515 forward primer with 5 'attached Kpnl location ATATAGGTACCGAAATGTGTGGGCGTGGCTTAAGGG = BA1A

P9 promoter end - Rabies GP1 start reverse primer

(from 3591) 5'GCAGCAGCCGCCGCCGCCATG3 'P9 promoter end

5ΑTGGTTCCTCAGGTTCTTTTG3 'Rabies start δ'CAAAAGAACCTGAGGAACCATGGCGGCGGCGGCTGCTGCS' = BA10

The plasmid “p1 P” (exemplary embodiment No. 1) served as the DNA matrix.

2. In the GP1 gene of the Rabies virus there is a restriction site for H / ndlll at position +86. In order to be able to maintain the simple extraction of expression cassettes by H / ndlll cleavage, the H / ndlll location was corrected by a "silent" point mutation by means of PCR. The codon for lysine AAG is converted into AAA. For this PCR, one cDNA of the Plasmid containing GP1 gene: pUC18-TWG as template, the PCR product from step 1 acts as forward primer and the mutagenesis primer BA16, which covers position +86 of the GP1 gene, is used as reverse primer.

Gp1 Rabies H / ndlll correction primer revers:

5OACGATACCAGACA G_C LTGGTCCC3 '= Gp1 original sequence 5OACGATACCAGACAAAC L GGTCCC3' = Gp1 corrected sequence 5OGGACCAΔQIIIGTCTGGTATCGTG3 ^! = BA16 revers

3 Amplification of the pIX terminator area using the primer pair

BA3A / BA4A

P9 terminator reverse primer 5 'at 4090 to 4066 with attached Sacll location 5ATATCCGCGGGACAGCAAGACACTTGCTTGATCC3' = BA4A

Claims

P9 Terminator forward primer (4028 to 4054) with 5' attached RabiesGP gene end 5'AAGAGTGGAGGTGAGATCAGACTGTGATAAAACATAAATAAAAAACCAGACTC 3'= BA3A 4. Generation of a DNA fragment using PCR, which consists of pIX promoter, Rabies glycoprotein gene reading frame (from ATG to TGA 1575bp) and pIX terminator . The plasmid pUC18-TWG, which carries a c-DNA clone of the rabies virus glycoprotein gene RNA, served as the DNA template. The PCR products from steps 2 and 3 were used as primer oligonucleotides. 5. Cleavage of the PCR product from step 4 with the restriction enzymes Kpnl and SacII and cloning of the 1735bp restriction fragment into the plasmid MBAC5 cleaved with the same restriction enzymes. The expression plasmid BAC31 is created. In analogy to MBAC17, a 1022bp fragment of the E3 right flanking sequence is deleted in MBAC31 by cleavage with SacII and Xal and replaced by a 116bp SacII/XbaI fragment from the polylinker of the plasmid pSL1180. The expression plasmid MBAC37 is created. Example 5 Production of the GFP transfer vector Ad-PGFPT.IX (green/white fiction): After cleavage of the corresponding plasmid pMBACδ with H/ndIII, the DNA of the expression cassette MBAC5 is purified using a preparative agarose gel and eluted from the gel. Tissue culture plates (6 wells) with a well diameter of 35 mm are routinely used for transfection. 2x105 A549 cells are used per well. When using 6μl GENEJAMMER™ (STRATAGENE) and 1μg cassette DNA, approximately 10% of the cells used were transfected. The same results could be achieved when using 3μl FuGENE ™ 6 (Röche). Six hours after transfection, the cell medium is renewed and the cells are infected with wild-type Ad5 virus (Adenoid 75) at a multiplicity of 5 (1x106 viruses per well). Approximately 48 hours after infection, fluorescent cells can be identified using UV microscopy. These cells are infected with virus and express the previously transfected cassette. To obtain a cell lysate, the infected cultures are frozen three times at -70°C after 4 to 5 days of incubation at 37°C and thawed at room temperature. The lysate is titrated on A549 cells in 96 well plates. Starting after 48 hours, the titration plates are examined for fluorescent cells by UV microscopy and after 7 days of incubation, a preliminary final virus titer is determined by counting the cytopathic effects (CPE). Fluorescent cells arise from infection with at least one recombinant virus. This allows the proportion of recombinant viruses in the primary lysate to be determined. The ratio to wild-type viruses is on average 1:10,000. Appropriate dilution levels of the primary lysates are used to infect 6-well plates. After three to five days of incubation, fluorescent CPE can be identified. By overlaying the wells with low gelling point agarose, the areas can be picked out with fluorescent CPE and added to cell medium. By mechanically homogenizing the agarose and 3 freeze/thaw cycles, secondary virus lysates are obtained in which the ratio between recombinant and wild-type viruses is on average 1:300. The secondary lysates are titrated again on A549 cells in 96-well plates and recombinant individual plaques are obtained. To exclude contamination with non-recombined Ad5 viruses, the lysates from recombinant individual plaques are purified by at least two further titration passages. The Ad5 GFP transfer vector (Ad-PGFPT.IX) described by this exemplary embodiment simultaneously represents the basic type of the Ad5 pIX expression vector and represents the construction and selection principle. Patent claims

1. Expression cassette containing in operative connection the regulatory sequences of the polypeptide IX (plX) gene of human adenovirus group C and a nucleotide sequence coding for foreign DNA.

2. Expression cassette according to claim 1, characterized in that the nucleotide sequence encoding the peptide or protein is inserted at an insertion site between the promoter and terminator with unique interfaces.

3. Expression cassette according to one of the preceding claims, characterized in that the regulatory sequences are additionally on both sides of DNA sections from the adenovirus E3 region and adenovirus genome sections adjoining the E3 region, preferably 1 to 2.5 each kb size are flanked.

4. Expression cassette according to one of the preceding claims, characterized in that the E3 DNA sections and the DNA sections flanking the E3 region contain nucleotides from the range from position 26329 to 28308 or from the range from position 29449 to 32012 of adenovirus Type 5 or the analogous gene regions from group C adenoviruses.

5. Expression cassette according to one of the preceding claims, characterized in that it contains E3 DNA sections from adenovirus type 5 genome.

6. Expression cassette according to one of the preceding claims, characterized in that it contains the regulatory sequences of the pIX gene of adenovirus type 5.

7. Expression cassette according to one of the preceding claims, characterized in that the nucleic acid sequence encodes a reporter gene.

8. Expression cassette according to one of the preceding claims, characterized in that the nucleic acid sequence encodes a foreign protein.

9. Expression cassette containing the regulatory sequences of the polypeptide IX (pIX) of adenovirus and, between the promoter and terminator, an insertion site for a nucleotide sequence encoding a peptide or protein, which has two unique interfaces.

10. Expression cassette according to claim 9, characterized in that the regulatory sequences are additionally flanked on both sides by DNA sections from the adenovirus gene E3.

11. Adenovirus vector in which at least part of the E3 gene is replaced by an expression cassette according to one of claims 1 to 10.

12. Adenovirus vector according to claim 11, characterized in that the entire E3 gene is replaced by an expression cassette according to one of claims 1 to 10.

13. Adenovirus vector according to claim 11 or 12, characterized in that additional nucleotide sequences from the genes E1, E2 and / or E4 are deleted.

14. Adenovirus vector according to claim 13, characterized in that nucleotide sequences of the E1 region are deleted.

15. Adenovirus vector according to one of claims 11 to 14, characterized in that it contains a reporter gene as a nucleotide sequence.

16. Adenovirus vector according to claim 15, characterized in that the reporter gene encodes a fluorescent compound.

17. Adenovirus vector according to claim 16, characterized in that the fluorescent compound is green fluorescent protein (GFP).

18. Adenovirus vector according to one of claims 11 to 13, characterized in that it contains a transcribeable DNA as the nucleotide sequence.

19. Expression system for a protein consisting of a recipient cell line and an expression vector according to one of claims 11 to 18.

20. Expression system for a protein consisting of cells of the cell line A549 or 293 and adenovirus vectors according to one of claims 11 to 18, in which the nucleotide sequences of the E1 and E3 regions are deleted.

21. Use of the regulatory sequences of the gene for polypeptide pIX from group C adenoviruses to produce expression cassettes for the expression of foreign proteins in adenovirus expression systems.

22. Method for producing a virus expression system for expressing foreign DNA, comprising the following steps:

I. Providing a transfer vector containing an expression cassette expressing a reporter gene, the vector being derived from viral genome, and wherein the expression cassette substitutes a portion of the viral genome;

II. Providing an expression cassette which contains regulatory sequences and the DNA for a nucleotide sequence to be expressed among the regulatory sequences and is flanked by DNA from the viral genome which is adjacent to the insertion site of the cassette,

V. Obtaining a virus lysate from the cells obtained in stage IV, which contains recombinant viruses that were created by recombination between the expression cassette and the transfer vector;

VI. Infection of cells with the stage V viral lysate; VII. Selection of cells in which the expression product of the reporter gene is replaced by the expression product of the target DNA, whereby the expression product of the reporter gene is no longer detectable and

VIII. Obtaining virus lysate corresponding to the virus expression vector from the cells selected in stage VII.

23. Method for producing an adenovirus expression system for expressing foreign protein, comprising the following steps:

1. Providing a transfer vector containing an expression cassette in the E3 region that expresses a reporter gene and substitutes at least part of the E3 region of the adenovirus genome,

2. Providing an expression cassette containing the DNA for a nucleotide sequence to be expressed among the regulatory sequences of the pIX gene and flanked by DNA from adenovirus that is homologous to the part of the adenovirus DNA containing the substitution in the E3 region flanked by the transfer vector,

3. Transfection of the cassette into eukaryotic cells,

4. Infection of the cells at stage 3 with the transfer vector from stage 1

5. Obtaining a virus lysate from stage 4 cells that contains recombinant adenoviruses that were created by recombination between the expression cassette and the transfer vector,

6. Infection of eukaryotic cells with virus lysate from stage 5

7. Selection of the cells in which the expression product of the reporter gene is replaced by the expression product of the target gene and thus the expression product of the reporter gene is no longer detectable and

8. Obtaining viral lysate corresponding to the adenovirus vector from selected stage 7 cells.

24. A process for producing a protein, characterized in that one produces an adenovirus expression system according to claim 22 or 23 and further carries out the following steps:

- Mass infection of eukaryotic cells with an expression system according to claim 22 or 23

- Cultivation of the infected cells under conditions that allow the expression of the foreign protein,

- Obtaining the expressed protein.

25. The method according to claim 22 or 23, characterized in that the reporter gene encodes the fluorescent protein GFP.

26. The method according to one of claims 22 to 25, characterized in that the expression cassette used in stage 1 and / or in stage 2 is a cassette according to one of claims 1 to 8.

27. E. coli containing plasmid pMBACOI with an expression cassette deposited with the DSM with the deposit no. 13703.

28. E. coli containing plasmid pMBAC02 with an expression cassette deposited with the DSM with the deposit no. 13704.

29. E. coli containing plasmid pMBAC03 with an expression cassette deposited with the DSM with the deposit no. 13705.

30. E. coli containing plasmid pMBAC04 with an expression cassette deposited with the DSM with the deposit no. 13706.

31. E. coli containing plasmid pMBACδ with an expression cassette deposited with the DSM with the deposit no. 13707.

32. E. coli containing plasmid pMBAC6 with an expression cassette deposited with the DSM with the deposit no. 13708.

33. E. coli containing plasmid pMBAC31 with an expression cassette deposited with the DSM with the deposit no. 13709.

34. E. coli containing plasmid pMBAC37 with an expression cassette deposited with the DSM with the deposit no. 13710.