WO2002020805A2 - Regulation of human carboxypeptidase-like enzyme - Google Patents

Regulation of human carboxypeptidase-like enzyme Download PDF

Info

Publication number
WO2002020805A2
WO2002020805A2 PCT/EP2001/010203 EP0110203W WO0220805A2 WO 2002020805 A2 WO2002020805 A2 WO 2002020805A2 EP 0110203 W EP0110203 W EP 0110203W WO 0220805 A2 WO0220805 A2 WO 0220805A2
Authority
WO
WIPO (PCT)
Prior art keywords
carboxypeptidase
enzyme
polypeptide
seq
polynucleotide
Prior art date
Application number
PCT/EP2001/010203
Other languages
French (fr)
Other versions
WO2002020805A3 (en
Inventor
Jiing-Ren Liou
Original Assignee
Bayer Aktiengesellschaft
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Bayer Aktiengesellschaft filed Critical Bayer Aktiengesellschaft
Priority to AU2002218160A priority Critical patent/AU2002218160A1/en
Publication of WO2002020805A2 publication Critical patent/WO2002020805A2/en
Publication of WO2002020805A3 publication Critical patent/WO2002020805A3/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/136—Screening for pharmacological compounds
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Definitions

  • the invention relates to the regulation of human carboxypeptidase-like enzyme and to provide therapeutic effects.
  • Carboxypeptidases are enzymes that function in many physiological processes by removing a wide range of amino acid residues from the carboxyl termini of polypeptides. In doing so, carboxypeptidases are able to activate, inactivate, and modulate enzyme and peptide hormone activity.
  • carboxypeptidase M which cleaves carboxyl-terminal arginine or lysrne residues from polypeptides, modulates the activity of the peptide hormones bradykinin and Lys 6 -enkephalin in the lung (Dragovic et al, Am. J. Respir. Crit. Care Med. 152, 760, 1995).
  • carboxypeptidase H Another such enzyme is carboxypeptidase H, which removes carboxyl-terminal arginine or lysine in the processing of neuropeptide precursors and prohormones in tissues including adrenal gland, pituitary, and brain (Hwang and Hook, Brain Res. Mol.
  • carboxypeptidases are metalloproteases, such as the eukaryotic zinc-dependent carboxypeptidases A, B, H, M, and N (Tan et al, J. Biol Chem. 264, 13165, 1989), and the bacterial carboxypeptidase G2 (Rowsell et al, Structure 15, 337, 1997).
  • Carboxypeptidases have been implicated in a number of diseases, including pulmonary diseases, cancer, asthma, and allergies (Dragovic et al, 1995; Pinto et al, Clin. Cancer Res. 2, 1445, 1996; Li et al, J. Immunol 161, 5079, 1998). Because of the importance of carboxypeptidases in a variety of metabolic pathways and their implications in a number of diseases, there is a need in the art to identify additional human carboxypeptidase enzymes which can be regulated to provide therapeutic effects.
  • amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO: 24;
  • Yet another embodiment of the invention is a method of screening for agents which decrease extracellular matrix degradation.
  • a test compound is contacted with a carboxypeptidase-like enzyme polypeptide comprising an amino acid sequence selected from the group consisting of:
  • amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO: 24;
  • a test compound which binds to the carboxypeptidase-like enzyme polypeptide is thereby identified as a potential agent for decreasing extra- cellular matrix degradation.
  • the agent can work by decreasing the activity of the carboxypeptidase-like enzyme.
  • Another embodiment of the invention is a method of screening for agents which decrease extracellular matrix degradation.
  • a test compound is contacted with a polynucleotide encoding a carboxypeptidase-like enzyme polypeptide, wherein the polynucleotide comprises a nucleotide sequence selected from the group consisting of:
  • nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO: 23;
  • a test compound which binds to the polynucleotide is identified as a potential agent for decreasing extracellular matrix degradation.
  • the agent can work by decreasing the amount of the carboxypeptidase-like enzyme through interacting with the carboxypeptidase-like enzyme mRNA.
  • Another embodiment of the invention is a method of screening for agents which regulate extracellular matrix degradation.
  • a test compound is contacted with a carboxypeptidase-like enzyme polypeptide comprising an amino acid sequence selected from the group consisting of:
  • amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ 3D NO: 24;
  • a carboxypeptidase-like enzyme activity of the polypeptide is detected.
  • a test compound which increases carboxypeptidase-like enzyme activity of the polypeptide relative to carboxypeptidase-like enzyme activity in the absence of the test compound is thereby identified as a potential agent for increasing extracellular matrix degradation.
  • a test compound which decreases carboxypeptidase-like enzyme activity of the polypeptide relative to carboxypeptidase-like enzyme activity in the absence of the test compound is thereby identified as a potential agent for decreasing extracellular matrix degradation.
  • Yet another embodiment of the invention is a method of screening for agents which decrease extracellular matrix degradation.
  • a test compound is contacted with a carboxypeptidase-like enzyme product of a polynucleotide which comprises a nucleotide sequence selected from the group consisting of:
  • nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO: 23;
  • Binding of the test compound to the carboxypeptidase-like enzyme product is detected.
  • a test compound which binds to the carboxypeptidase-like enzyme product is thereby identified as a potential agent for decreasing extracellular matrix degradation.
  • Still another embodiment of the invention is a method of reducing extracellular matrix degradation.
  • a cell is contacted with a reagent which specifically binds to a polynucleotide encoding a carboxypeptidase-like enzyme polypeptide or the product encoded by the polynucleotide, wherein the polynucleotide comprises a nucleotide sequence selected from the group consisting of: nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO: 23; and
  • Carboxypeptidase-like enzyme activity in the cell is thereby decreased.
  • the invention thus provides a human carboxypeptidase-like enzyme which can be used to identify test compounds which may act, for example, as agonists or antagomsts at the enzyme's active site.
  • Human carboxypeptidase-like enzyme and fragments thereof also are useful in raising specific antibodies which can block the enzyme and effectively reduce its activity.
  • Fig. 1 shows the DNA-sequence encoding a carboxypeptidase-like enzyme polypeptide (SEQ ID NO:l).
  • Fig. 2 shows the DNA-sequence encoding a carboxypeptidase-like enzyme polypeptide (SEQ ID NO:2).
  • Fig. 3 shows the DNA-sequence encoding a carboxypeptidase-like enzyme polypeptide (SEQ ID NO:3).
  • Fig. 4 shows the DNA-sequence encoding a carboxypeptidase-like enzyme polypeptide (SEQ ID NO:4).
  • Fig. 5 shows the DNA-sequence encoding a carboxypeptidase-like enzyme polypeptide (SEQ ID NO:5).
  • Fig. 6 shows the DNA-sequence encoding a carboxypeptidase-like enzyme polypeptide (SEQ ID NO:6).
  • Fig. 7 shows the DNA-sequence encoding a carboxypeptidase-like enzyme polypeptide (SEQ ID NO:7).
  • Fig. 8 shows the DNA-sequence encoding a carboxypeptidase-like enzyme polypeptide (SEQ ID NO: 8).
  • Fig. 9 shows the DNA-sequence encoding a carboxypeptidase-like enzyme polypeptide (SEQ ID NO:9).
  • Fig. 10 shows the DNA-sequence encoding a carboxypeptidase-like enzyme polypeptide (SEQ ID NO: 10).
  • Fig. 11 shows the DNA-sequence encoding a carboxypeptidase-like enzyme polypeptide (SEQ ID NO: 11).
  • Fig. 12 shows the DNA-sequence encoding a carboxypeptidase-like enzyme polypeptide (SEQ ID NO: 12).
  • Fig. 13 shows the DNA-sequence encoding a carboxypeptidase-like enzyme polypeptide (SEQ ID NO: 13).
  • Fig. 14 shows the DNA-sequence encoding a carboxypeptidase-like enzyme polypeptide (SEQ ID NO: 14).
  • Fig. 15 shows the DNA-sequence encoding a carboxypeptidase-like enzyme polypeptide (SEQ ID NO: 15).
  • Fig. 16 shows the DNA-sequence encoding a carboxypeptidase-like enzyme polypeptide (SEQ ID NO: 16).
  • Fig. 17 shows the DNA-sequence encoding a carboxypeptidase-like enzyme polypeptide (SEQ ID NO: 17).
  • Fig. 18 shows the DNA-sequence encoding a carboxypeptidase-like enzyme polypeptide (SEQ ID NO: 18).
  • Fig. 19 shows the DNA-sequence encoding a carboxypeptidase-like enzyme polypeptide (SEQ ID NO: 19).
  • Fig. 20 shows the DNA-sequence encoding a carboxypeptidase-like enzyme polypeptide (SEQ ID NO:20).
  • Fig. 21 shows the DNA-sequence encoding a carboxypeptidase-like enzyme polypeptide (SEQ ID NO.21).
  • Fig. 22 shows the DNA-sequence encoding a carboxypeptidase-like enzyme polypeptide (SEQ ID NO:22).
  • Fig. 23 shows the DNA-sequence encoding a cafboxypeptidase-like enzyme polypeptide (SEQ ID NO:23).
  • Fig. 24 shows the amino acid sequence deduced from the DNA-sequence of
  • Fig. 25 shows the amino acid sequence of the protein identified with
  • Fig. 26 shows the amino acid sequence of the protein identified with
  • Fig. 27 shows the amino acid sequence of pfam/hmm/Peptidase_M20 (SEQ ID NO:27).
  • Fig. 28 shows the DNA-sequence encoding a carboxypeptidase-like enzyme polypeptide (SEQ ID NO:28).
  • Fig.29 shows the BLASTP alignment of human carboxypeptidase-like enzyme (SEQ ID NO:24) with the protein identified with pdb
  • Fig. 30 shows the BLASTP alignment of human carboxypeptidase-like enzyme (SEQ ID NO:24) with the protein identified with the
  • Fig. 31 shows the HMMPFAM alignment of human carboxypeptidase-like enzyme (SEQ ID NO:24) against pfam
  • Fig. 32 shows the relative expression of human carboxypeptidase-like enzyme in various human tissues.
  • Fig. 33 shows the relative expression of human carboxypeptidase-like enzyme in various human respiratory tissues and cells.
  • HBEC cultured human bronchial epithelial cells
  • H441 Clara-like cells
  • SMC cultured airway smooth muscle cells
  • SAE cultured small airway epithelial cells
  • PMN polymorphonuclear leukocytes
  • Mono monocytes
  • Cult Cult.
  • the invention relates to an isolated polynucleotide encoding a carboxypeptidase-like enzyme polypeptide and being selected from the group consisting of:
  • amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO: 24; and the amino acid sequence shown in SEQ ID NO: 24.
  • Human carboxypeptidase-like enzyme comprises the amino acid sequence shown in SEQ ID NO:24, as encoded by the coding sequence shown in SEQ ID NO:23.
  • a number of ESTs are contained within or overlap with the coding sequence of human carboxypeptidase-like enzyme, indicating that SEQ ID NO:23 is expressed (SEQ ID NOS: 1-22).
  • Expression occurs in, inter alia, in lung (small cell carcinoma), breast, uterus, placenta (chorio- carcinoma), cervix, kidney (renal cell adenocarcinoma), skin (melanotic melanoma), colon, head, neck, esophagus (squamous cell carcinoma), fetal brain, lymph, retina, and white blood cells.
  • Human carboxypeptidase-like enzyme is 26% identical over a 254 amino acid overlap to the bacterial protein identified by Accession Nos. P06621 and W38239 and annotated as carboxypeptidase G2 precursor (FIGS. 29 and 30).
  • Carboxy- peptidase G2 has five active site zinc binding residues that bind two zinc ions, and an additional active site residue that is proposed to coordinate a water molecule on the substrate (Rowsell et al, 1997).
  • Four active carboxypeptidase G2 active site residues are conserved in human carboxypeptidase-like enzyme, while a fifth active site residue, a glutamate, is conservatively replaced by a similar aspartate (see FIG. 29).
  • the sixth active site residue, which binds zinc is outside the range of the alignment.
  • Human carboxypeptidase-like enzyme also contains many identities to amino acids present in a hidden Markov model (hrnm) of several families classified as peptidases, including the glutamate carboxypeptidases (Rawlings and Barrett, Methods Enzymol 248, 183-228, 1995).
  • hrnm hidden Markov model
  • human carboxypeptidase-like enzyme of the invention is expected to be useful for the same purposes as previously identified carboxypeptidases.
  • human carboxypeptidase-like enzyme can be used in therapeutic methods to treat disorders such as chronic obstructive cardiopulmonary disease, cancer, asthma, and allergies.
  • Human carboxypeptidase-like enzyme also can be used to screen for human carboxypeptidase-like enzyme agonists and antagonists.
  • Carboxypeptidase-like enzyme polypeptides according to the invention comprise at least 4, 5, 10, 15, 25, 50, 75, 100, 125, 150, 175, 200, 250, 300, 350, 400, 450, or 475 contiguous amino acids selected from the amino acid sequence shown in SEQ ID NO: 1
  • a carboxypeptidase-like enzyme polypeptide of the invention therefore can be a portion of a carboxypeptidase-like enzyme protein, a full-length carboxypeptidase-like enzyme protein, or a fusion protein comprising all or a portion of a carboxypeptidase-like enzyme protein.
  • Carboxypeptidase-like enzyme polypeptide variants which are biologically active, e.g., retain the ability to catalyze the removal of carboxy terminal amino acids from a protein, also are carboxypeptidase-like enzyme polypeptides.
  • naturally or non-naturally occurring carboxypeptidase-like enzyme polypeptide variants have amino acid sequences which are at least about 30, 35, 40, 45, 50, 55, 60, 65, or 70, preferably about 75, 80, 85, 90, 96, 96, or 98% identical to the amino acid sequence shown in SEQ ID NO:24 or a fragment thereof. Percent identity between a putative carboxypeptidase-like enzyme polypeptide variant and an amino acid sequence of SEQ ID NO:24 is determined using the Blast2 alignment program (Blosum62, Expect 10, standard genetic codes).
  • Variations in percent identity can be due, for example, to amino acid substitutions, insertions, or deletions.
  • Amino acid substitutions are defined as one for one amino acid replacements. They are conservative in nature when the substituted -irnino acid has similar structural and/or chemical properties. Examples of conservative replacements are substitution of a leucine with an isoleucine or valine, an aspartate with a glutamate, or a threonine with a serine.
  • Amino acid insertions or deletions are changes to or within an amino acid sequence. They typically fall in the range of about 1 to 5 amino acids.
  • Fusion proteins are useful for generating antibodies against carboxypeptidase-like enzyme polypeptide amino acid sequences and for use in various assay systems. For example, fusion proteins can be used to identify proteins which interact with portions of a carboxypeptidase-like enzyme polypeptide. Protein affinity chromatography or library-based assays for protein-protein interactions., such as the yeast two-hybrid or phage display systems, can be used for this purpose. Such methods are well known in the art and also can be used as drug screens.
  • a carboxypeptidase-like enzyme polypeptide fusion protein comprises two polypeptide segments fused together by means of a peptide bond.
  • the first polypeptide segment comprises at least 4, 5, 10, 15, 25, 50, 75, 100, 125, 150, 175, 200, 250, 300, 350, 400, 450, or 475 contiguous amino acids of SEQ ED NO:24 or of a biologically active variant, such as those described above.
  • the first polypeptide segment also can comprise full-length carboxypeptidase-like enzyme protein.
  • the second polypeptide segment can be a full-length protein or a protein fragment.
  • Proteins commonly used in fusion protein construction include ⁇ -galactosidase, ⁇ - glucuronidase, green fluorescent protein (GFP), autofluorescent proteins, including blue fluorescent protein (BFP), glutathione-S-transferase (GST), luciferase, horseradish peroxidase (HRP), and chloramphenicol acetyltransferase (CAT).
  • epitope tags are used in fusion protein constructions, including histidine (His) tags, FLAG tags, influenza hemagglutinin (HA) tags, Myc tags, NSN-G tags, and thioredoxin (Trx) tags.
  • Other fusion constructions can include maltose binding protein (MBP), S-tag, Lex a D ⁇ A binding domain (DBD) fusions, GAL4 D ⁇ A binding domain fusions, and herpes simplex virus (HSN) BP16 protein fusions.
  • a fusion protein also can be engineered to contain a cleavage site located between the carboxypeptidase-like enzyme polypeptide-encoding sequence and the heterologous protein sequence, so that the carboxypeptidase-like enzyme polypeptide can be cleaved and purified away from the heterologous moiety.
  • a fusion protein can be synthesized chemically, as is known in the art.
  • a fusion protein is produced by covalently linking two polypeptide segments or by standard procedures in the art of molecular biology.
  • Recombinant D ⁇ A methods can be used to prepare fusion proteins, for example, by making a D ⁇ A construct which comprises coding sequences selected from SEQ ID ⁇ O:23 in proper reading frame with nucleotides encoding the second polypeptide segment and expressing the DNA construct in a host cell, as is known in the art.
  • kits for constructing fusion proteins are available from companies such as Promega Corporation (Madison, WT), Stratagene (La Jolla, CA), CLONTECH (Mountain View, CA), Santa Cruz Biotechnology (Santa Cruz, CA), MBL International Corporation (MIC; Watertown,
  • Species homologs of human carboxypeptidase-like enzyme polypeptide can be obtained using carboxypeptidase-like enzyme polypeptide polynucleotides (described below) to make suitable probes or primers for screening cDNA expression libraries from other species, such as mice, monkeys, or yeast, identifying cDNAs which encode homologs of carboxypeptidase-like enzyme polypeptide, and expressing the cDNAs as is known in the art.
  • carboxypeptidase-like enzyme polypeptide polynucleotides described below
  • a carboxypeptidase-like enzyme polynucleotide can be single- or double-stranded and comprises a coding sequence or the complement of a coding sequence for a carboxypeptidase-like enzyme polypeptide.
  • a coding sequence for human carboxypeptidase-like enzyme is shown in SEQ ID NO:23. This coding sequence is contained in the human genomic clone identified with Accession No. AC009704. Additional sequences 5' and 3' to the coding sequence are shown in SEQ ID NO:28.
  • nucleotide sequences encoding human carboxypeptidase-like enzyme polypeptides as well as homologous nucleotide sequences which are at least about 50, 55, 60, 65, 70, preferably about 75, 90, 96, or 98% identical to the nucleotide sequence shown in SEQ ID NO:23 also are carboxypeptidase-like enzyme poly- nucleotides. Percent sequence identity between the sequences of two polynucleotides is determined using computer programs such as ALIGN which employ the FASTA algorithm, using an affine gap search with a gap. open penalty of -12 and a gap extension penalty of -2.
  • cDNA Complementary DNA molecules, species homologs, and variants of carboxypeptidase-like enzyme polynucleotides which encode biologically active carboxypeptidase-like enzyme polypeptides also are carboxypeptidase-like enzyme polynucleotides.
  • variants and homologs of the carboxypeptidase-like enzyme polynucleotides de- scribed above also are carboxypeptidase-like enzyme polynucleotides.
  • homologous carboxypeptidase-like enzyme polynucleotide sequences can be identified by hybridization of candidate polynucleotides to known carboxypeptidase-like enzyme polynucleotides under stringent conditions, as is known in the art. For example, using the following wash conditions: 2X SSC (0.3 M NaCI, 0.03 M sodium citrate, pH 7.0), 0.1% SDS, room temperature twice, 30 minutes each; then
  • homologous nucleic acid strands contain 15-25% basepair mismatches, even more preferably 5-15% basepair mismatches.
  • Species homologs of the carboxypeptidase-like enzyme polynucleotides disclosed herein also can be identified by making suitable probes or primers and screening cDNA expression libraries from other species, such as mice, monkeys, or yeast.
  • Human variants of carboxypeptidase-like enzyme polynucleotides can be identified, for example, by screening human cDNA expression libraries. It is well known that the T m of a double-stranded DNA decreases by 1-1.5°C with every 1% decrease in homology (Bonner et al, J. Mol Biol. 81, 123 (1973).
  • Variants of human carboxypeptidase-like enzyme polynucleotides or carboxypeptidase-like enzyme polynucleotides of other species can therefore be identified by hybridizing a putative homologous carboxypeptidase-like enzyme polynucleotide with a polynucleotide having a nucleotide sequence of SEQ ID NO:23 or the complement thereof to form a test hybrid.
  • the melting temperature of the test hybrid is compared with the melting temperature of a hybrid comprising polynucleotides having perfectly complementary nucleotide sequences, and the number or percent of basepair mismatches within the test hybrid is calculated.
  • Nucleotide sequences which hybridize to carboxypeptidase-like enzyme polynucleotides or their complements following stringent hybridization and/or wash conditions also are carboxypeptidase-like enzyme polynucleotides.
  • Stringent wash conditions are well known and understood in the art and are disclosed, for example, in Sambrook et al, MOLECULAR CLONING: A LABORATORY MANUAL, 2d ed., 1989, at pages 9.50-9.51.
  • T m of a hybrid between a carboxypeptidase-like enzyme polynucleotide having a nucleotide sequence shown in SEQ ID NO:23 or 28 or the complement thereof and a polynucleotide sequence which is at least about 50, 55, 60, 65, 70, preferably about 75, 90, 96, or 98% identical to one of those nucleotide sequences can be calculated, for example, using the equation of Bolton and McCarthy, Proc Natl Acad. Set U.S.A. 48, 1390 (1962):
  • Stringent wash conditions include, for example, 4X SSC at 65°C, or 50% formamide,
  • a naturally occurring carboxypeptidase-like enzyme polynucleotide can be isolated free of other cellular components such as membrane components, proteins, and lipids.
  • Polynucleotides can be made by a cell and isolated using standard nucleic acid purification techniques, or synthesized using an amplification technique, such as the polymerase chain reaction (PCR), or by using an automatic synthesizer. Methods for isolating polynucleotides are routine and are known in the art. Any such technique for obtaining a polynucleotide can be used to obtain isolated carboxypeptidase-like enzyme polynucleotides.
  • restriction enzymes and probes can be used to isolate polynucleotide fragments which comprises carboxypeptidase-like enzyme nucleotide sequences.
  • Isolated polynucleotides are in preparations which are free or at least 70, 80, or 90% free of other molecules.
  • Carboxypeptidase-like enzyme cDNA molecules can be made with standard molecular biology techniques, using carboxypeptidase-like enzyme mRNA as a template. Carboxypeptidase-like enzyme cDNA molecules can thereafter be replicated using molecular biology techniques known in the art and disclosed in manuals such as Sambrook et al. (1989). An amplification technique, such as PCR, can be used to obtain additional copies of polynucleotides of the invention, using either human genomic DNA or cDNA as a template.
  • restriction site PCR uses universal primers to retrieve unknown sequence adjacent to a known locus (Sarkar, PCR Methods Applic 2, 318322, 1993). Genomic DNA is first amplified in the presence of a primer to a linker sequence and a primer specific to the known region. The amplified sequences are then subjected to a second round of PCR with the same linker primer and another specific primer internal to the first one. Products of each round of PCR are transcribed with an appropriate RNA polymerase and sequenced using reverse transcriptase.
  • Inverse PCR also can be used to amplify or extend sequences using divergent primers based on a known region (Triglia et al, Nucleic Acids Res. 16, 8186, 1988).
  • Primers can be designed using commercially available software, such as OLIGO 4.06 Primer Analysis software (National Biosciences Inc., Madison, Minn.), to be 2230 nucleotides in length, to have a GC content of 50% or more, and to anneal to the target sequence at temperatures about 68-72°C.
  • the method uses several restriction enzymes to generate a suitable fragment in the known region of a gene. The fragment is then circularized by intramolecular ligation and used as a PCR template.
  • capture PCR involves PCR amplification of DNA fragments adjacent to a known sequence in human and yeast artificial chromosome DNA (Lagerstrom et al, PCR Methods Applic 1, 111119, 1991).
  • multiple restriction enzyme digestions and ligations also can be used to place an engineered double-stranded sequence into an unknown fragment of the DNA molecule before performing PCR.
  • Randomly-primed libraries are preferable, in that they will contain more sequences which contain the 5' regions of genes. Use of a randomly primed library may be especially preferable for situations in which an oligo d(T) library does not yield a full-length cDNA. Genomic libraries can be useful for extension of sequence into 5 ' nontranscribed regulatory regions.
  • capillary electrophoresis systems can be used to analyze the size or confirm the nucleotide sequence of PCR or sequencing products.
  • capillary sequencing can employ flowable polymers for electrophoretic separation, four different fluorescent dyes (one for each nucleotide) which are laser activated, and detection of the emitted wavelengths by a charge coupled device camera.
  • Output/light intensity can be converted to electrical signal using appropriate software (e.g. GENOTYPER and Sequence NAVIGATOR, Perkin Elmer), and the entire process from loading of samples to computer analysis and electronic data display can be computer controlled.
  • Capillary electrophoresis is especially preferable for the sequencing of small pieces of DNA which might be present in limited amounts in a particular sample.
  • Carboxypeptidase-like enzyme polypeptides can be obtained, for example, by purification from human cells, by expression of carboxypeptidase-like enzyme polynucleotides, or by direct chemical synthesis.
  • Carboxypeptidase-like enzyme polypeptides can be purified from any cell which expresses the enzyme, including host cells which have been transfected with carboxypeptidase-like enzyme expression constructs.
  • Lung small cell carcinoma
  • breast uterus
  • placenta choriocarcinoma
  • cervix kidney
  • renal cell adeno- carcinoma skin
  • melanotic melanoma colon
  • head, neck esophagus (squamous cell carcinoma)
  • fetal brain, lymph, retina, white blood cells provides an especially useful source of carboxypeptidase-like enzyme polypeptides.
  • a purified carboxypeptidase-like enzyme polypeptide is separated from other compounds which normally associate with the carboxypeptidase-like enzyme polypeptide in the cell, such as certain proteins, carbohydrates, or lipids, using methods well-known in the art. Such methods include, but are not limited to, size exclusion chromatography, ammonium sulfate fractionation, ion exchange chromatography, affinity chromatography, and preparative gel electrophoresis.
  • a preparation of purified carboxypeptidase-like enzyme polypeptides is at least 80% pure; preferably, the preparations are 90%, 95%, or 99% pure. Purity of the preparations can be assessed by any means known in the art, such as SDS-polyacrylamide gel electrophoresis.
  • the polynucleotide can be inserted into an expression vector which contains the necessary elements for the transcription and translation of the inserted coding sequence.
  • Methods which are well known to those skilled in the art can be used to construct expression vectors containing sequences encoding carboxypeptidase-like enzyme polypeptides and appropriate transcriptional and translational control elements. These methods include in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. Such techniques are described, for example, in Sambrook et al. (1989) and in Ausubel et al, CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, N.Y., 1989.
  • a variety of expression vector/host systems can be utilized to contain and express sequences encoding a carboxypeptidase-like enzyme polypeptide.
  • microorganisms such as bacteria transformed with recombinant bacteriophage, plasmid, or cosmid DNA expression vectors; yeast transformed with yeast expression vectors, insect cell systems infected with virus expression vectors (e.g., baculovirus), plant cell systems transformed with virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or with bacterial expression vectors (e.g., Ti or pBR322 plasmids), or animal cell systems.
  • microorganisms such as bacteria transformed with recombinant bacteriophage, plasmid, or cosmid DNA expression vectors
  • yeast transformed with yeast expression vectors insect cell systems infected with virus expression vectors (e.g., baculovirus), plant cell systems transformed with virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco
  • control elements or regulatory sequences are those nontranslated regions of the vector enhancers, promoters, 5' and 3' untranslated regions which interact with host cellular proteins to carry out transcription and translation. Such elements can vary in their strength and specificity. Depending on the vector system and host utilized, any number of suitable transcription and translation elements, including constitutive and inducible promoters, can be used. For example, when cloning in bacterial systems, inducible promoters such as the hybrid lacZ promoter of the BLUESCRIPT phagemid (Stratagene, LaJolla, Calif.) or pSPORTl plasmid (Life Technologies) and the like can be used. The baculovirus polyhedrin promoter can be used in insect cells.
  • Promoters or enhancers derived from the genomes of plant cells e.g., heat shock, RUBISCO, and storage protein genes
  • plant viruses e.g., viral promoters or leader sequences
  • promoters from mammalian genes or from mammalian viruses are preferable. If it is necessary to generate a cell line that contains multiple copies of a nucleotide sequence encoding a carboxypeptidase-like enzyme polypeptide, vectors based on SV40 or EBV can be used with an appropriate selectable marker.
  • a number of expression vectors can be selected depending upon the use intended for the carboxypeptidase-like enzyme polypeptide. For example, when a large quantity of a carboxypeptidase-like enzyme polypeptide is needed for the induction of antibodies, vectors which direct high level expression of fusion proteins that are readily purified can be used. Such vectors include, but are not limited to, multifunctional E. coli cloning and expression vectors such as BLUESCRIPT (Stratagene).
  • a sequence encoding the carboxypeptidase-like enzyme polypeptide can be ligated into the vector in frame with sequences for the amino terminal Met and the subsequent 7 residues of ⁇ - galactosidase so that a hybrid protein is produced.
  • pESf vectors Van Heeke &
  • yeast Saccharomyces cerevisiae a number of vectors containing constitutive or inducible promoters such as alpha factor, alcohol oxidase, and PGH can be used.
  • constitutive or inducible promoters such as alpha factor, alcohol oxidase, and PGH.
  • sequences encoding carboxypeptidase-enzyme polypeptides can be driven by any of a number of promoters.
  • viral promoters such as the 35S and 19S promoters of CaMV can be used alone or in combination with the omega leader sequence from TMV (Takamatsu, EMBO J. 6, 307311, 1987).
  • plant promoters such as the small subunit of RUBISCO or heat shock promoters can be used (Coruzzi et al, EMBO J. 3, 16711680, 1984; Broglie et al, Science 224, 838843, 1984; Winter et al, Results Probl Cell Differ. 17, 85105, 1991).
  • constructs can be introduced into plant cells by direct DNA transformation or by pathogen-mediated transfection.
  • pathogen-mediated transfection Such techniques are described in a number of generally available reviews (e.g., Hobbs or Murray, in McGRAW HILL YEARBOOK OF SCIENCE AND TECHNOLOGY, McGraw Hill, New York, N.Y., pp. 191196, 1992).
  • An insect system also can be used to express a carboxypeptidase-like enzyme poly- peptide.
  • Autographa californica nuclear poly- hedrosis virus (AcNPV) is used as a vector to express foreign genes in Spodoptera frugiperda cells or in Trichoplusia larvae.
  • Sequences encoding carboxypeptidase-like enzyme polypeptides can be cloned into a nonessential region of the virus, such as the polyhedrin gene, and placed under control of the polyhedrin promoter.
  • Successful insertion of carboxypeptidase-like enzyme polypeptides will render the polyhedrin gene inactive and produce recombinant virus lacking coat protein.
  • the recombinant viruses can then be used to infect S. frugiperda cells or
  • a number of viral-based expression systems can be used to express carboxypeptidase-like enzyme polypeptides in mammalian host cells.
  • sequences encoding carboxypeptidase-like enzyme polypeptides can be ligated into an adenovirus transcription/translation complex comprising the late promoter and tripartite leader sequence. Insertion in a nonessential El or E3 region of the viral genome can be used to obtain a viable virus which is capable of expressing a carboxypeptidase-like enzyme polypeptide in infected host cells (Logan & Shenk, Proc Natl Acad. Sci. 81,
  • transcription enhancers such as the Rous sarcoma virus (RS V) enhancer, can be used to increase expression in mammalian host cells.
  • RS V Rous sarcoma virus
  • HACs Human artificial chromosomes
  • 6M to 10M are constructed and delivered to cells via conventional delivery methods (e.g., liposomes, polycationic amino polymers, or vesicles).
  • Specific initiation signals also can be used to achieve more efficient translation of sequences encoding carboxypeptidase-like enzyme polypeptides.
  • Such signals include the ATG initiation codon and adjacent sequences.
  • sequences encoding a carboxypeptidase-like enzyme polypeptide, its imtiation codon, and upstream sequences are inserted into the appropriate expression vector, no additional transcriptional or translational control signals may be needed.
  • exogenous translational control signals including the ATG initiation codon
  • the initiation codon should be in the correct reading frame to ensure translation of the entire insert. Exogenous translational elements and initiation codons can be of various origins, both natural and synthetic. The efficiency of expression can be enhanced by the inclusion of enhancers which are appropriate for the particular cell system which is used (see Scharf etal, Results Probl Cell Differ. 20, 125162, 1994). Host Cells
  • a host cell strain can be chosen for its ability to modulate the expression of the inserted sequences or to process the expressed carboxypeptidase-like enzyme polypeptide in the desired fashion.
  • modifications of the polypeptide include, but are not limited to, acetylation, carboxylation, glycosylation, phosphorylation, lipidation, and acylation.
  • Posttranslational processing which cleaves a "prepro" form of the polypeptide also can be used to facilitate correct insertion, folding and/or function.
  • Different host cells which have specific cellular machinery and characteristic mechanisms for post-translational activities (e.g., CHO, HeLa, MDCK, HE 293, and WI38), are available from the American Type Culture Collection (ATCC; 10801 University Boulevard, Manassas, VA 20110-2209) and can be chosen to ensure the correct modification and processing of the foreign protein.
  • ATCC American Type Culture Collection
  • Stable expression is preferred for long-term, high-yield production of recombinant proteins.
  • cell lines which stably express carboxypeptidase-like enzyme polypeptides can be transformed using expression vectors which can contain viral origins of replication and/or endogenous expression elements and a selectable marker gene on the same or on a separate vector. Following the introduction of the vector, cells can be allowed to grow for 12 days in an enriched medium before they are switched to a selective medium.
  • the purpose of the selectable marker is to confer resistance to selection, and its presence allows growth and recovery of cells which successfully express the introduced carboxypeptidase-like enzyme sequences.
  • Resistant clones of stably transformed cells can be proliferated using tissue culture techniques appropriate to the cell type. See, for example, ANIMAL CELL CULTURE, R.I. Freshney, ed., 1986.
  • any number of selection systems can be used to recover transformed cell lines. These include, but are not limited to, the herpes simplex virus thymidine kinase (Wigler et al, Cell 11, 22332, 1977) and adenine phosphoribosylxransferase (Lowy et al, Cell 22, 81723, 1980) genes which can be employed in tk " or aprf cells, respectively. Also, antimetabolite, antibiotic, or herbicide resistance can be used as the basis for selection. For example, dhfr confers resistance to methotrexate (Wigler et al, Proc Nail. Acad. Sci.
  • npt confers resistance to the amino- glycosides, neomycin and G418 (Colbere-Garapin et al, J. Mol Biol. 150, 114, 1981), and als and pat confer resistance to chlorsulfuron and phosphinotricin acetyltransferase, respectively (Murray, 1992, supra). Additional selectable genes have been described. For example, trpB allows cells to utilize indole in place of tryptophan, or hisD, which allows cells to utilize histinol in place of histidine (Hartman & Mulligan, Proc. Natl Acad. Sci. 85, 804751, 1988).
  • Visible markers such as anthocyanins, ⁇ -glucuronidase and its substrate GUS, and luciferase and its substrate luciferin, can be used to identify transformants and to quantify the amount of transient or stable protein expression attributable to a specific vector system
  • marker gene expression suggests that the carboxypeptidase-like enzyme polynucleotide is also present, its presence and expression may need to be confirmed.
  • a sequence encoding a carboxypeptidase-like enzyme polypeptide is inserted within a marker gene sequence, transformed cells containing sequences which encode a carboxypeptidase-like enzyme polypeptide can be identified by the absence of marker gene function.
  • a marker gene can be placed in tandem with a sequence encoding a carboxypeptidase-like enzyme polypeptide under the control of a single promoter. Expression of the marker gene in response to induction or selection usually indicates expression of the carboxypeptidase-like enzyme polynucleotide.
  • host cells which contain a carboxypeptidase-like enzyme polynucleotide and which express a carboxypeptidase-like enzyme polypeptide can be identified by a variety of procedures known to those of skill in the art. These procedures include, but are not limited to, DNA-DNA or DNA-RNA hybridizations and protein bioassay or immunoassay techniques which include membrane, solution, or chip-based technologies for the detection and/or quantification of nucleic acid or protein.
  • the presence of a polynucleotide sequence encoding a carboxypeptidase-like enzyme polypeptide can be detected by DNA-DNA or DNA- RNA hybridization or ampHfication using probes or fragments or fragments of polynucleotides encoding a carboxypeptidase-like enzyme polypeptide.
  • Nucleic acid amplification-based assays involve the use of oligonucleotides selected from sequences encoding a carboxypeptidase-like enzyme polypeptide to detect transfor- ants which contain a carboxypeptidase-like enzyme polynucleotide.
  • a variety of protocols for detecting and measuring the expression of a carboxypeptidase-like enzyme polypeptide, using either polyclonal or monoclonal antibodies specific for the polypeptide, are known in the art. Examples include enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), and fluorescence activated cell sorting (FACS).
  • ELISA enzyme-linked immunosorbent assay
  • RIA radioimmunoassay
  • FACS fluorescence activated cell sorting
  • a two-site, monoclonal-based immuno- assay using monoclonal antibodies reactive to two non-interfering epitopes on a carboxypeptidase-like enzyme polypeptide can be used, or a competitive binding assay can be employed.
  • labels and conjugation techniques are known by those skilled in the art and can be used in various nucleic acid and amino acid assays.
  • Means for producing labeled hybridization or PCR probes for detecting sequences related to polynucleotides encoding carboxypeptidase-like enzyme polypeptides include oHgolabeling, nick translation, end-labeling, or PCR amplification using a labeled nucleotide.
  • sequences encoding a carboxypeptidase-like enzyme polypeptide can be cloned into a vector for the production of an mRNA probe.
  • RNA probes are known in the art, are commercially available, and can be used to synthesize RNA probes in vitro by addition of labeled nucleotides and an appropriate RNA polymerase such as T7, T3, or SP6. These procedures can be conducted using a variety of commercially available kits (Amersham Pharmacia Biotech, Promega, and US Biochemical). Suitable reporter molecules or labels which can be used for ease of detection include radionuclides, enzymes, and fluorescent, chemiluminescent, or chromogenic agents, as well as substrates, cofactors, inhibitors, magnetic particles, and the like.
  • Host cells transformed with nucleotide sequences encoding a carboxypeptidase-like enzyme polypeptide can be cultured under conditions suitable for the expression and recovery of the protein from cell culture.
  • the polypeptide produced by a transformed cell can be secreted or contained intracellularly depending on the sequence and/or the vector used.
  • expression vectors containing polynucleotides which encode carboxypeptidase-like enzyme polypeptides can be designed to contain signal sequences which direct secretion of soluble carboxypeptidase-like enzyme polypeptides through a prokaryotic or eukaryotic cell membrane or which direct the membrane insertion of membrane-bound carboxypeptidase-Hke enzyme polypeptide.
  • purification facilitating domains include, but are not limited to, metal chelating peptides such as histidine-tryptophan modules that allow purification on immobilized metals, protein A domains that allow purification on immobilized immunoglobulin, and the domain utilized in the FLAGS extension/affinity purification system
  • cleavable linker sequences such as those specific for Factor Xa or enterokinase (frivitrogen, San Diego, CA) between the purification domain and the carboxypeptidase-like enzyme polypeptide also can be used to facilitate purification.
  • One such expression vector provides for expression of a fusion protein containing a carboxypeptidase-like enzyme polypeptide and 6 histidine residues preceding a thioredoxin or an enterokinase cleavage site. The histidine residues facilitate purification by IMAC (immobiHzed metal ion affinity chromatography, as described in Porath et al, Prot. Exp. Purif.
  • enterokinase cleavage site provides a means for purifying the carboxypeptidase-like enzyme polypeptide from the fusion protein.
  • Vectors which contain fusion proteins are disclosed in Kroll et al, DNA Cell Biol. 12, 441453,
  • Sequences encoding a carboxypeptidase-like enzyme polypeptide can be synthesized, in whole or in part, using chemical methods well known in the art (see Caruthers et al, Nucl Acids Res. Symp. Ser. 215223, 1980; Horn et al. Nucl Acids Res. Symp. Ser. 225232, 1980).
  • a carboxypeptidase-like enzyme polypeptide itself can be produced using chemical methods to synthesize its amino acid sequence, such as by direct peptide synthesis using solid-phase techniques (Merrifield, J. Am. Chem.
  • Protein synthesis can be performed using manual techniques or by automation. Automated synthesis can be achieved, for example, using Applied Biosystems 431 A Peptide Synthesizer (Perkin Elmer).
  • fragments of carboxypeptidase-like enzyme polypeptides can be separately synthesized and combined using chemical methods to produce a full-length molecule.
  • the newly synthesized peptide can be substantially purified by preparative high performance liquid chromatography (e.g., Creighton, PROTEINS: STRUCTURES AND MOLECULAR PRINCIPLES, WH Freeman and Co., New York, N.Y., 1983).
  • the composition of a synthetic carboxypeptidase-like enzyme polypeptide can be confirmed by amino acid analysis or sequencing (e.g., the Edman degradation procedure; see Creighton, supra). Additionally, any portion of the amino acid sequence of the carboxypeptidase-like enzyme polypeptide can be altered during direct synthesis and/or combined using chemical methods with sequences from other proteins to produce a variant polypeptide or a fusion protein.
  • codons preferred by a particular prokaryotic or eukaryotic host can be selected to increase the rate of protein expression or to produce an RNA transcript having desirable properties, such as a half-life which is longer than that of a transcript generated from the naturally occurring sequence.
  • nucleotide sequences disclosed herein can be engineered using methods generally known in the art to alter carboxypeptidase-like enzyme polypeptide-encoding sequences for a variety of reasons, including but not limited to, alterations which modify the cloning, processing, and/or expression of the polypeptide or mRNA product.
  • DNA shuffling by random fragmentation and PCR reassembly of gene fragments and synthetic oligonucleotides can be used to engineer the nucleotide sequences.
  • site-directed mutagenesis can be used to insert new restriction sites, alter glycosylation patterns, change codon preference, produce splice variants, introduce mutations, and so forth.
  • oAntibodyo as used herein includes intact immunoglobulin molecules, as well as fragments thereof, such as Fab, F(ab ⁇ ) 2 , and Fv, which are capable of binding an epitope of a carboxypeptidase-like enzyme polypeptide.
  • Fab fragment antigen binding protein
  • F(ab ⁇ ) 2 fragment antigen binding protein
  • Fv fragment antigen binding protein
  • at least 6, 8, 10, or 12 contiguous amino acids are required to form an epitope.
  • epitopes which involve non-contiguous amino acids may require more, e.g., at least 15, 25, or 50 amino acids.
  • An antibody which specifically binds to an epitope of a carboxypeptidase-like enzyme polypeptide can be used therapeutically, as well as in immunochemical assays, such as Western blots, ELISAs, radioimmunoassays, immunohistochemical assays, immunoprecipitations, or other immunochemical assays known in the art.
  • immunochemical assays such as Western blots, ELISAs, radioimmunoassays, immunohistochemical assays, immunoprecipitations, or other immunochemical assays known in the art.
  • Various immimoassays can be used to identify antibodies having the desired specificity. Numerous protocols for competitive binding or immunoradiometric assays are well known in the art. Such immunoassays typically involve the measurement of complex formation between an immunogen and an antibody which specifically binds to the immunogen.
  • an antibody which specifically binds to. a carboxypeptidase-like enzyme polypeptide provides a detection signal at least 5-, 10-, or 20-fold higher than a detection signal provided with other proteins when used in an immunochemical assay.
  • antibodies which specifically bind to carboxypeptidase-like enzyme polypeptides do not detect other proteins in immunochemical assays and can immunoprecipitate a carboxypeptidase-like enzyme polypeptide from solution.
  • Carboxypeptidase-like enzyme polypeptides can be used to immunize a mammal, such as a mouse, rat, rabbit, guinea pig, monkey, or human, to produce polyclonal antibodies.
  • a carboxypeptidase-like enzyme polypeptide can be conjugated to a carrier protein, such as bovine serum albumin, thyroglobulin, and keyhole limpet hemocyanin.
  • a carrier protein such as bovine serum albumin, thyroglobulin, and keyhole limpet hemocyanin.
  • adjuvants include, but are not limited to, Freund's adjuvant, mineral gels (e.g., aluminum hydroxide), and surface active substances (e.g.
  • BCG Bacilli Calmette-Guerin
  • Corynebacterium parvum are especially useful.
  • Monoclonal antibodies which specifically bind to a carboxypeptidase-like enzyme polypeptide can be prepared using any technique which provides for the production of antibody molecules by continuous cell lines in culture. These techniques include, but are not limited to, the hybridoma technique, the human B cell hybridoma technique, and the EBV HYBRIDOMA technique (Kohler et al, Nature 256, 495497, 1985; Kozbor et al, J. Immunol. Methods 81, 3142, 1985; Cote et al, Proc. Natl Acad. Sci. 80, 20262030, 1983; Cole et al, Mol. Cell Biol. 62, 109120, 1984).
  • Monoclonal and other antibodies also can be ohumanizedo to prevent a patient from mounting an immune response against the antibody when it is used therapeutically.
  • Such antibodies may be sufficiently similar in sequence to human antibodies to be used directly in therapy or may require alteration of a few key residues. Sequence differences between rodent antibodies and human sequences can be minimized by replacing residues which differ from those in the human sequences by site directed mutagenesis of individual residues or by grating of entire complementarity determining regions.
  • humanized antibodies can be produced using recombinant methods, as described in GB2188638B.
  • Antibodies which specifically bind to a carboxypeptidase-like enzyme polypeptide can contain antigen binding sites which are either partially or fully humanized, as disclosed in U.S. 5,565,332.
  • single chain antibodies can be adapted using methods known in the art to produce single chain antibodies which specifically bind to carboxypeptidase-like enzyme polypeptides.
  • Antibodies with related specificity, but of distinct idiotypic composition can be generated by chain shuffling from random combinatorial immunoglobin libraries (Burton, Proc. Natl. Acad. Sci. 88, 1112023, 1991).
  • Single-chain antibodies also can be constructed using a DNA amplification method, such as PCR, using hybridoma cDNA as a template (Thirion et al, 1996, Eur. J. Cancer Prev. 5, 507-11).
  • Single-chain antibodies can be mono- or bispecific, and can be bivalent or tetravalent. Construction of tetravalent, bispecific single-chain antibodies is taught, for example, in Coloma & Morrison, 1997, Nat. Biotechnol 15, 159-63. Construction of bivalent, bispecific single-chain antibodies is taught in
  • a nucleotide sequence encoding a single-chain antibody can be constructed using manual or automated nucleotide synthesis, cloned into an expression construct using standard recombinant DNA methods, and introduced into a cell to express the coding sequence, as described below.
  • single-chain antibodies can be produced directly using, for example, filamentous phage technology (Verhaar et al, 1995, Int. J. Cancer 61, 497-501; Nicholls et al., 1993, J. Immunol. Meth. 165, 81-91).
  • Antibodies which specifically bind to carboxypeptidase-like enzyme polypeptides also can be produced by inducing in vivo production in the lymphocyte population or by screening immunoglobulin libraries or panels of highly specific binding reagents as disclosed in the literature (Orlandi et al, Proc. Natl. Acad. Sci. 86, 38333837, 1989; Winter et al, Nature 349, 293299, 1991).
  • chimeric antibodies can be constructed as disclosed in WO 93/03151.
  • Binding proteins which are derived from immunoglobulins and which are multivalent and multispecific, such as the odiabodieso described in WO
  • Antibodies according to the invention can be purified by methods well known in the art. For example, antibodies can be affinity purified by passage over a column to which a carboxypeptidase-like enzyme polypeptide is bound. The bound antibodies can then be eluted from the column using a buffer with a high salt concentration.
  • Antisense oligonucleotides are nucleotide sequences which are complementary to a specific DNA or RNA sequence. Once introduced into a cell, the complementary nucleotides combine with natural sequences produced by the cell to form complexes and block either transcription or translation. Preferably, an antisense oligonucleotide is at least 11 nucleotides in length, but can be at least 12, 15, 20, 25, 30, 35, 40, 45, or 50 or more nucleotides long. Longer sequences also can be used. Antisense oligonucleotide molecules can be provided in a DNA construct and introduced into a cell as described above to decrease the level of carboxypeptidase-like enzyme gene products in the cell.
  • Antisense oligonucleotides can be deoxyribonucleotides, ribonucleotides, or a com- bination of both. Oligonucleotides can be synthesized manually or by an automated synthesizer, by covalently linking the 5' end of one nucleotide with the 3' end of another nucleotide with non-phosphodiester internucleotide linkages such alkyl- phosphonates, phosphorothioates, phosphorodithioates, alkylphosphonothioates, alkylphosphonates, phosphoramidates, phosphate esters, carbamates, acetamidate, carboxymethyl esters, carbonates, and phosphate triesters. See Brown, Meth. Mol.
  • Modifications of carboxypeptidase-like enzyme gene expression can be obtained by designing antisense oligonucleotides which will form duplexes to the control, 5', or regulatory regions of the carboxypeptidase-like enzyme gene. Oligonucleotides derived from the transcription initiation site, e.g., between positions 10 and +10 from the start site, are preferred. Similarly, inhibition can be achieved using "triple helix" base-pairing methodology. Triple helix pairing is useful because it causes inhibition of the ability of the double helix to open sufficiently for the binding of polymerases, transcription factors, or chaperons.
  • An antisense oligonucleotide also can be designed to block translation of mRNA by preventing the transcript from binding to ribosomes.
  • Antisense oligonucleotides which comprise, for example, 2, 3, 4, or 5 or more stretches of contiguous nucleotides which are precisely complementary to a carboxypeptidase-like enzyme polynucleotide, each separated by a stretch of contiguous nucleotides which are not complementary to adjacent carboxypeptidase-like enzyme nucleotides, can provide sufficient targeting specificity for carboxypeptidase-like enzyme mRNA.
  • each stretch of complementary contiguous nucleotides is at least 4, 5, 6, 7, or 8 or more nucleotides in length.
  • Non-complementary intervening sequences are preferably 1, 2, 3, or 4 nucleotides in length.
  • One skilled in the art can easily use the calculated melting point of an antisense-sense pair to determine the degree of mismatching which will be tolerated between a particular antisense oligonucleotide and a particular carboxypeptidase-like enzyme polynucleotide sequence.
  • Antisense oligonucleotides can be modified without affecting their ability to hybridize to a carboxypeptidase-like enzyme polynucleotide. These modifications can be internal or at one or both ends of the antisense molecule.
  • internucleoside phosphate linkages can be modified by adding cholesteryl or diamine moieties with varying numbers of carbon residues between the amino groups and terminal ribose.
  • Modified bases and/or sugars such as arabinose instead of ribose, or a 3', 5' substituted oligonucleotide in which the 3' hydroxyl group or the 5' phosphate group are substituted, also can be employed in a modified antisense oligonucleotide.
  • modified oligonucleotides can be prepared by methods well known in the art. See, e.g., Agrawal et al, Trends Biotechnol 10, 152158, 1992; Uhlmann et al, Chem. Rev. 90, 543584, 1990; Uhlmann et al, Tetrahedron. ett.
  • Ribozymes are RNA molecules with catalytic activity. See, e.g., Cech, Science 236,
  • Ribozymes can be used to inhibit gene function by cleaving an RNA sequence, as is known in the art (e.g., Haseloff et al, U.S. Patent 5,641,673).
  • the mechanism of ribozyme action involves sequence-specific hybridization of the ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage. Examples include engineered hammerhead motif ribozyme molecules that can specifically and efficiently catalyze endonucleolytic cleavage of specific nucleotide sequences.
  • the coding sequence of a carboxypeptidase-like enzyme polynucleotide can be used to generate ribozymes which will specifically bind to mRNA transcribed from the carboxypeptidase-like enzyme polynucleotide.
  • Methods of designing and constructing ribozymes which can cleave other RNA molecules in trans in a highly sequence specific manner have been developed and described in the art (see Haseloff et al. Nature 334, 585591, 1988).
  • the cleavage activity of ribozymes can be targeted to specific RNAs by engineering a discrete "hybridization" region into the ribozyme.
  • the hybridization region contains a sequence complementary to the target RNA and thus specifically hybridizes with the target (see, for example, Gerlach et al, EP 321,201).
  • Specific ribozyme cleavage sites within a carboxypeptidase-like enzyme RNA target can be identified by scanning the target molecule for ribozyme cleavage sites which include the following sequences: GUA, GUU, and GUC. Once identified, short RNA sequences of between 15 and 20 ribonucleotides corresponding to the region of the target RNA containing the cleavage site can be evaluated for secondary structural features which may render the target inoperable.
  • RNA targets also can be evaluated by testing accessibility to hybridization with complementary oligonucleotides using ribonuclease protection assays. Longer complementary sequences can be used to increase the affinity of the hybridization sequence for the target.
  • the hybridizing and cleavage regions of the ribozyme can be integrally related such that upon hybridizing to the target RNA through the complementary regions, the catalytic region of the ribozyme can cleave the target.
  • Ribozymes can be introduced into cells as part of a DNA construct. Mechanical methods, such as microinjection, liposome-mediated transfection, electroporation, or calcium phosphate precipitation, can be used to introduce a ribozyme-containing DNA construct into cells in which it is desired to decrease carboxypeptidase-like enzyme expression. Alternatively, if it is desired that the cells stably retain the DNA construct, the construct can be supplied on a plasmid and maintained as a separate element or integrated into the genome of the cells, as is known in the art.
  • a ribozyme-encoding DNA construct can include transcriptional regulatory elements, such as a promoter element, an enhancer or UAS element, and a transcriptional terminator signal, for controlling transcription of ribozymes in the cells.
  • ribozymes can be engineered so that ribozyme expression will occur in response to factors which induce expression of a target gene. Ribozymes also can be engineered to provide an additional level of regulation, so that destruction of mRNA occurs only when both a ribozyme and a target gene are induced in the cells. Differentially Expressed Genes
  • genes whose products interact with human carboxypeptidase-hke enzyme may represent genes which are differentially expressed in disorders including, but not limited to, COPD, cancer, allergies, and asthma. Further, such genes may represent genes which are differentially regulated in response to manipulations relevant to the progression or treatment of such diseases. Additionally, such genes may have a temporally modulated expression, increased or decreased at different stages of tissue or organism development. A differentially expressed gene may also have its expression modulated under control versus experimental conditions. In addition, the human carboxypeptidase-like gene or gene product may itself be tested for differential expression.
  • the degree to which expression differs in a normal versus a diseased state need only be large enough to be visualized via standard characterization techniques such as differential display techniques.
  • standard characterization techniques such as differential display techniques.
  • Other such standard characterization techniques by which expression differences may be visualized include but are not limited to, quantitative RT (reverse transcriptase), PCR, and Northern analysis.
  • RNA samples are obtained from tissues of experimental subjects and from corresponding tissues of control subjects. Any RNA isolation technique which does not select against the isolation of mRNA may be utilized for the purification of such RNA samples. See, for example, Ausubel et al, ed. dislike CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, Inc. New York, 1987-1993. Large numbers of tissue samples may readily be processed using techniques well known to those of skill in the art, such as, for example, the single-step RNA isolation process of Chomczynski, U.S. Patent 4,843,155.
  • Transcripts within the collected RNA samples which represent RNA produced by differentially expressed genes are identified by methods well known to those of skill in the art. They include, for example, differential screening (Tedder et al, Proc. Natl. Acad. Sci. U.S.A. 85, 208-12, 1988), subtractive hybridization (Hedrick et al, Nature 308, 149-53; Lee et al, Proc. Natl. Acad. Sci. U.S.A. 88, 2825, 1984), and, preferably, differential display (Liang & Pardee, Science 257, 967-71, 1992; U.S. Patent 5,262,311).
  • the differential expression information may itself suggest relevant methods for the treatment of disorders involving the human carboxypeptidase-like enzyme.
  • treatment may include a modulation of expression of the differentially expressed genes and/or the gene encoding the human carboxypeptidase-like enzyme.
  • the differential expression information may indicate whether the expression or activity of the differentially expressed gene or gene product or the human carboxypeptidase-hke gene or gene product are up-regulated or down-regulated.
  • the invention provides assays for screening test compounds which bind to or modulate the activity of a carboxypeptidase-like enzyme polypeptide or a carboxypeptidase-like enzyme polynucleotide.
  • a test compound preferably binds to a carboxypeptidase-like enzyme polypeptide or polynucleotide. More preferably, a test compound decreases or increases carboxypeptidase-like activity by at least about 10, preferably about 50, more preferably about 75, 90, or 100% relative to the absence of the test compound.
  • Test compounds can be pharmacologic agents already known in the art or can be compounds previously unknown to have any pharmacological activity.
  • the compounds can be naturally occurring or designed in the laboratory. They can be isolated from microorganisms, animals, or plants, and can be produced re- combinantly, or synthesized by chemical methods known in the art. If desired, test compounds can be obtained using any of the numerous combinatorial library methods known in the art, including but not limited to, biological libraries, spatially addressable parallel solid phase or solution phase libraries, synthetic library methods requiring deconvolution, the "one-bead one-compoundo library method, and synthetic library methods using affinity chromatography selection.
  • the biological library approach is limited to polypeptide libraries, while the other four approaches are applicable to polypeptide, non-peptide oligomer, or small molecule libraries of compounds. See Lam, Anticancer Drug Des. 12, 145, 1997.
  • Test compounds can be screened for the ability to bind to carboxypeptidase-like enzyme polypeptides or polynucleotides or to affect carboxypeptidase-like enzyme activity or carboxypeptidase-like enzyme gene expression using high throughput screening.
  • high throughput screening many discrete compounds can be tested in parallel so that large numbers of test compounds can be quickly screened.
  • the most widely established techniques utilize 96-well microtiter plates. The wells of the microtiter plates typically require assay volumes that range from 50 to 500 ⁇ l.
  • many instruments, materials, pipettors, robotics, plate washers, and plate readers are commercially available to fit the 96-well format.
  • free format assays o or assays that have no physical barrier between samples, can be used.
  • an assay using pigment cells (melanocytes) in a simple homogeneous assay for combinatorial peptide libraries is described by Jayawickreme et al, Proc. Natl. Acad. Sci. U.S.A. 19, 161418 (1994).
  • the cells are placed under agarose in petri dishes, then beads that carry combinatorial compounds are placed on the surface of the agarose.
  • the combinatorial compounds are partially released the compounds from the beads. Active compounds can be visualized as dark pigment areas because, as the compounds diffuse locally into the gel matrix, the active compounds cause the cells to change colors.
  • Chelsky "Strategies for Screening Combinatorial Libraries: Novel and Traditional Approaches," reported at the First Annual Conference of The Society for Biomolecular Screening in Philadelphia, Pa. (Nov. 710, 1995).
  • Chelsky placed a simple homogenous enzyme assay for carbonic anhydrase inside an agarose gel such that the enzyme in the gel would cause a color change throughout the gel.
  • beads carrying combinatorial compounds via a photolinker were placed inside the gel and the compounds were partially released by UV LIGHT. Compounds that inhibited the enzyme were observed as local zones of inhibition having less color change.
  • test samples are placed in a porous matrix.
  • One or more assay components are then placed within, on top of, or at the bottom of a matrix such as a gel, a plastic sheet, a filter, or other form of easily manipulated solid support.
  • a matrix such as a gel, a plastic sheet, a filter, or other form of easily manipulated solid support.
  • the test compound is preferably a small molecule which binds to and occupies, for example, the active site of the carboxypeptidase-like enzyme polypeptide, such that normal biological activity is prevented.
  • small molecules include, but are not limited to, small peptides or peptide-like molecules.
  • either the test compound or the carboxypeptidase-like enzyme polypeptide can comprise a detectable label, such as a fluorescent, radioisotopic, chemiluminescent, or enzymatic label, such as horseradish peroxidase, alkaline phosphatase, or luciferase.
  • a detectable label such as a fluorescent, radioisotopic, chemiluminescent, or enzymatic label, such as horseradish peroxidase, alkaline phosphatase, or luciferase.
  • Detection of a test compound which is bound to the carboxypeptidase-like enzyme polypeptide can then be accomplished, for example, by direct counting of radioemmission, by scintillation counting, or by determining conversion of an appropriate substrate to a detectable product.
  • binding of a test compound to a carboxypeptidase-like enzyme polypeptide can be determined without labeling either of the interactants.
  • a microphysiometer can be used to detect binding of a test compound with a carboxypeptidase-like enzyme polypeptide.
  • a microphysiometer e.g., Cyto- sensorTM
  • a microphysiometer is an analytical instrument that measures the rate at which a cell acidifies its environment using a light-addressable potentiometric sensor (LAPS). Changes in this acidification rate can be used as an indicator of the interaction between a test compound and a carboxypeptidase-like enzyme polypeptide (McConnell et al, Science 257, 19061912, 1992).
  • Determining the ability of a test compound to bind to a carboxypeptidase-like enzyme polypeptide also can be accomplished using a technology such as real-time Bimolecular Interaction Analysis (BIA) (Sjolander & Urbaniczky, Anal. Chem. 63, 23382345, 1991, and Szabo et al, Curr. Opin. Struct. Biol 5, 699705, 1995).
  • BIA is a technology for studying biospecific interactions in real time, without labeling any of the interactants (e.g., BIAcoreTM). Changes in the optical phenomenon surface plasmon resonance (SPR) can be used as an indication of real-time reactions between biological molecules.
  • a carboxypeptidase-like enzyme polypeptide can be used as a "bait protein" in a two-hybrid assay or three-hybrid assay (see, e.g., U.S. Patent 5,283,317; Zervos et al, Cell 72, 223232, 1993; Madura et al, J. Biol. Chem.
  • the two-hybrid system is based on the modular nature of most transcription factors, which consist of separable DNA BINDING and activation domains.
  • the assay utilizes two different DNA constructs.
  • polynucleotide encoding a carboxypeptidase-like enzyme polypeptide can be fused to a polynucleotide encoding the DNA binding domain of a known transcription factor (e.g., GAL4).
  • a DNA sequence that encodes an unidentified protein (“prey" or "sample” can be fused to a polynucleotide that codes for the activation domain of the known transcription factor.
  • the DNA BINDING and activation domains of the transcription factor are brought into close proximity. This proximity allows transcription of a reporter gene (e.g., LacZ), which is operably linked to a transcriptional regulatory site responsive to the transcription factor. Expression of the reporter gene can be detected, and cell colonies containing the functional transcription factor can be isolated and used to obtain the DNA sequence encoding the protein which interacts with the carboxypeptidase-like enzyme polypeptide.
  • a reporter gene e.g., LacZ
  • either the carboxypeptidase-like enzyme polypeptide (or polynucleotide) or the test compound can be bound to a solid support.
  • suitable solid supports include, but are not limited to, glass or plastic slides, tissue culture plates, microtiter wells, tubes, silicon chips, or particles such as beads
  • any method known in the art can be used to attach the carboxypeptidase-like enzyme polypeptide (or polynucleotide) or test compound to a solid support, including use of covalent and non-covalent linkages, passive absorption, or pairs of binding moieties attached respectively to the polypeptide (or polynucleotide) or test compound and the solid support.
  • Test compounds are preferably bound to the solid support in an array, so that the location of individual test compounds can be tracked. Binding of a test compound to a carboxypeptidase-like enzyme polypeptide (or polynucleotide) can be accomplished in any vessel suitable for containing the reactants. Examples of such vessels include microtiter plates, test tubes, and microcentrifuge tubes.
  • the carboxypeptidase-like enzyme polypeptide is a fusion protein comprising a domain that allows the carboxypeptidase-like enzyme polypeptide to be bound to a solid support.
  • glutathione S-transferase fusion pro- teins can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis,
  • the test compound or the test compound and the nonadsorbed carboxypeptidase-like enzyme polypeptide are then combined with the test compound or the test compound and the nonadsorbed carboxypeptidase-like enzyme polypeptide; the mixture is then incubated under conditions conducive to complex formation (e.g., at physiological conditions for salt and pH). Following incubation, the beads or microtiter plate wells are washed to remove any unbound components. Binding of the interactants can be determined either directly or indirectly, as described above. Alternatively, the complexes can be dissociated from the solid support before binding is determined.
  • a carboxypeptidase-like enzyme polypeptide or polynucleotide
  • a test compound can be immobilized utilizing conjugation of biotin and streptavidin.
  • Biotinylated carboxypeptidase-like enzyme polypeptides (or polynucleotides) or test compounds can be prepared from biotinNHS (Nhydroxysuccinimide) using techniques well known in the art (e.g., biotinylation kit, Pierce Chemicals, Rockford, 111.) and immobilized in the wells of streptavidin-coated 96 well plates (Pierce Chemical).
  • biotinNHS Nhydroxysuccinimide
  • Pierce Chemicals Pierce Chemicals, Rockford, 111.
  • antibodies which specifically bind to a carboxypeptidase-like enzyme polypeptide, polynucleotide, or a test compound, but which do not interfere with a desired binding site, such as the active site of the carboxypeptidase-like enzyme polypeptide can be derivatized to the wells of the plate. Unbound target or protein can be trapped in the wells by antibody conjugation.
  • Methods for detecting such complexes include immunodetection of complexes using antibodies which specifically bind to the carboxypeptidase-like enzyme polypeptide or test compound, enzyme-linked assays which rely on detecting an activity of the carboxypeptidase-like enzyme polypeptide, and SDS gel electrophoresis under non-reducing conditions.
  • Screening for test compounds which bind to a carboxypeptidase-like enzyme polypeptide or polynucleotide also can be carried out in an intact cell. Any cell which comprises a carboxypeptidase-like enzyme polypeptide or polynucleotide can be used in a cell-based assay system. A carboxypeptidase-like enzyme polynucleotide can be naturally occurring in the cell or can be introduced using techniques such as those described above. Binding of the test compound to a carboxypeptidase-like enzyme polypeptide or polynucleotide is determined as described above.
  • Test compounds can be tested for the ability to increase or decrease the carboxypeptidase activity of a human carboxypeptidase-like enzyme polypeptide.
  • Carboxypeptidase activity can be measured using an appropriate assay for particular carboxypeptidase activities, as known by those of skill in the art. For example, carboxypeptidase A-like activity can be assayed as described in Hilhnan et al, U.S.
  • Enzyme assays can be carried out after contacting either a purified carboxypeptidase-like enzyme polypeptide, a cell membrane preparation, or an intact cell with a test compound.
  • a test compound which decreases a carboxypeptidase activity of a carboxypeptidase-like enzyme polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% is identified as a potential therapeutic agent for decreasing carboxypeptidase-like enzyme activity.
  • a test compound which increases a carboxypeptidase activity of a human carboxypeptidase-like enzyme polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% is identified as a potential therapeutic agent for increasing human carboxypeptidase-like enzyme activity.
  • test compounds which increase or decrease carboxypeptidase-like enzyme gene expression are identified.
  • a carboxypeptidase-like enzyme polynucleotide is contacted with a test compound, and the expression of an RNA or polypeptide product of the carboxypeptidase-like enzyme polynucleotide is determined.
  • the level of expression of appropriate mRNA or polypeptide in the presence of the test compound is compared to the level of expression of mRNA or polypeptide in the absence of the test compound.
  • the test compound can then be identified as a modulator of expression based on this comparison.
  • test compound when expression of mRNA or polypeptide is greater in the presence of the test compound than in its absence, the test compound is identified as a stimulator or enhancer of the mRNA or polypeptide expression.
  • test compound when expression of the mRNA or polypeptide is less in the presence of the test compound than in its absence, the test compound is identified as an inhibitor of the mRNA or polypeptide expression.
  • the level of carboxypeptidase-like enzyme mRNA or polypeptide expression in the cells can be determined by methods well known in the art for detecting mRNA or polypeptide. Either qualitative or quantitative methods can be used.
  • the presence of polypeptide products of a carboxypeptidase-like enzyme polynucleotide can be determined, for example, using a variety of techniques known in the art, including immunochemical methods such as radioimmunoassay, Western blotting, and immunohistochemistry.
  • polypeptide synthesis can be determined in vivo, in a cell culture, or in an in vitro translation system by detecting incorporation of labeled amino acids into a carboxypeptidase-like enzyme polypeptide.
  • Such screening can be carried out either in a cell-free assay system or in an intact cell.
  • Any cell which expresses a carboxypeptidase-like enzyme polynucleotide can be used in a cell-based assay system.
  • the carboxypeptidase-like enzyme polynucleotide can be naturally occurring in the cell or can be introduced using techniques such as those described above.
  • Either a primary culture or an established cell line, such as CHO or human embryonic kidney 293 cells, can be used.
  • compositions of the invention can comprise, for example, a carboxypeptidase-like enzyme polypeptide, carboxypeptidase-like enzyme polynucleotide, ribozymes or antisense oligonucleotides, antibodies which specifically bind to a carboxypeptidase-like enzyme polypeptide, or mimetics, agonists, antagonists, or inhibitors of a carboxypeptidase-like enzyme polypeptide activity.
  • compositions can be administered alone or in combination with at least one other agent, such as stabilizing compound, which can be administered in any sterile, biocompatible pharmaceutical carrier, including, but not limited to, saline, buffered saline, dextrose, and water.
  • agent such as stabilizing compound
  • the compositions can be administered to a patient alone, or in combination with other agents, drugs or hormones.
  • compositions of the invention can be a lministered by any number of routes including, but not limited to, oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intraventricular, transdermal, subcutaneous, intraperitoneal, intranasal, parenteral, topical, sublingual, or rectal means.
  • Pharmaceutical compositions for oral administration can be formulated using pharmaceutically acceptable carriers well known in the art in dosages suitable for oral administration. Such carriers enable the pharmaceutical compositions to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for ingestion by the patient.
  • compositions for oral use can be obtained through combination of active compounds with solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores.
  • Suitable excipients are carbohydrate or protein fillers, such as sugars, including lactose, sucrose, mannitol, or sorbitol; starch from corn, wheat, rice, potato, or other plants; cellulose, such as methyl cellulose, hydroxy- propylmethylcellulose, or sodium carboxymethylcellulose; gums including arabic and tragacanth; and proteins such as gelatin and collagen.
  • disintegrating or solubilizing agents can be added, such as the cross-linked polyvinyl pyrrolidone, agar, alginic acid, or a salt thereof, such as sodium alginate.
  • Dragee cores can be used in conjunction with suitable coatings, such as concentrated sugar solutions, which also can contain gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
  • suitable coatings such as concentrated sugar solutions, which also can contain gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
  • Dyestuffs or pigments can be added to the tablets or dragee coatings for product identification or to characterize the quantity of active compound, i.e., dosage.
  • Push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a coating, such as glycerol or sorbitol.
  • Push-fit capsules can contain active ingredients mixed with a filler or binders, such as lactose or starches, lubricants, such as talc or magnesium stearate, and, optionally, stabilizers.
  • the active compounds can be dissolved or suspended in suitable liquids, such as fatty oils, liquid, or liquid polyethylene glycol with or without stabilizers.
  • compositions suitable for parenteral administration can be formulated in aqueous solutions, preferably in physiologically compatible buffers such as
  • Aqueous injection suspensions can contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran.
  • suspensions of the active compounds can be prepared as appropriate oily injection suspensions.
  • Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes.
  • Non-lipid polycationic amino polymers also can be used for delivery.
  • the suspension also can contain suitable stabilizers or agents which increase the solubility of the compounds to allow for the preparation of highly concentrated solutions.
  • penetrants appropriate to the particular barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
  • compositions of the present invention can be manufactured in a manner that is known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee making, levigating, emulsifying, encapsulating, entrapping, or lyophilizing processes.
  • the pharmaceutical composition can be provided as a salt and can be formed with many acids, including but not limited to, hydrochloric, sulfuric, acetic, lactic, tartaric, malic, succinic, etc. Salts tend to be more soluble in aqueous or other protonic solvents than are the co ⁇ esponding free base forms.
  • the prefe ⁇ ed preparation can be a lyophilized powder which can contain any or all of the following: 150 mM histidine, 0.1 %2% sucrose, and 27% mannitol, at a pH range of 4.5 to 5.5, that is combined with buffer prior to use.
  • compositions After pharmaceutical compositions have been prepared, they can be placed in an appropriate container and labeled for treatment of an indicated condition. Such labeling would include amount, frequency, and method of administration.
  • carboxypeptidases have been found to be associated with tissues or fluids collected from patients with diseases, implicating a role for carboxypeptidases in a number of diseases. For example, carboxypeptidase M activity is increased in broncheoalveolar lavage in human lung disease (Dragovic et al, 1995). Carboxy- peptidase A appears to be expressed in peripheral blood basophils from patients with asthma or allergy, whereas little or no carboxypeptidase A is detected in the peripheral blood basophils from normal individuals (Li et al, 1998). Human prostatic carcinoma cells have been observed to have a specific membrane antigen that has a carboxypeptidase activity (folate hydrolase) (Pinto et al, 1996). Carboxypeptidases have thus been implicated in a number of diseases, including pulmonary diseases, cancer, asthma, and allergies. Compounds directed to the regulation of human carboxypeptidase-like enzyme may therefore prove useful as therapeutic agents for these diseases.
  • Carboxypeptidase M cleaves the terminal arginine or lysine from peptides including bradykinin and Lys 6 -enkephalin (Dragovic et al, 1995). Carboxypeptidase M is found throughout the body, including in the kidney and central nerve tissues, and is particularly prominent in the lung (Dragovic et al,
  • carboxypeptidase M in broncheoalveolar lavage (BAL) fluid, carboxypeptidase M levels were found to be approximately 4 times higher in the BAL fluid of patients with acute pneumonia, Pneumocystis carinii pneumonia, and lung cancer compared to the levels in BAL fluid of patients without lung disease (Dragovic et al, 1995).
  • BAL broncheoalveolar lavage
  • carboxypeptidase M found in BAL fluid is believed to be expressed from lung type I alveolar cells.
  • the high levels of carboxypeptidase M activity in the BAL fluid that co ⁇ elated with several lung diseases suggests that inhibition of carboxypeptidase M or a related human carboxypeptidase-like enzyme may be therapeutically useful for treating a number of lung diseases, including chronic obstructive pulmonary disease.
  • COPD chronic obstructive pulmonary (or airways) disease
  • COPD chronic obstructive pulmonary (or airways) disease
  • COPD chronic obstructive pulmonary (or airways) disease
  • Emphysema is characterized by destruction of alveolar walls leading to abnormal enlargement of the air spaces of the lung.
  • Chronic bronchitis is defined clinically as the presence of chronic productive cough for three months in each of two successive years.
  • airflow obstruction is usually progressive and is only partially reversible. By far the most important risk factor for development of COPD is cigarette smoking, although the disease does occur in non-smokers.
  • the inflammatory cell population comprises increased numbers of macrophages, neutrophils, and CD8 + lymphocytes.
  • Inhaled irritants such as cigarette smoke, activate macrophages which are resident in the respiratory tract, as well as epithelial cells leading to release of chemokines (e.g., interleukin-8) and other chemotactic factors.
  • chemokines e.g., interleukin-8
  • chemotactic factors act to increase the neutrophil/- monocyte trafficking from the blood into the lung tissue and airways.
  • Neutrophils and monocytes recruited into the airways can release a variety of potentially damaging mediators such as proteolytic enzymes and reactive oxygen species.
  • Matrix degradation and emphysema along with airway wall thickening, surfactant dysfunction, and mucus hypersecretion, all are potential sequelae of this inflammatory response that lead to impaired airflow and gas exchange.
  • COPD is characterized by damage to the lung extracellular matrix and emphysema can be viewed as the pathologic process that affects the lung parenchyma. This process eventually leads to the destruction of the airway walls resulting in permanent airspace enlargement (Senior and Shapiro, in PULMONARY DISEASES AND DISORDERS, 3 rd ed., New York, McGraw-Hill, 1998, pp. 659 - 681, 1998).
  • a broad range of immune and inflammatory cells including neutrophils, macro- phages, T lymphocytes and eosinophils contain proteolytic enzymes that could contribute to the destruction of lung extracellular matrix (Shapiro, 1999).
  • proteases include serine proteases, matrix metalloproteinases and cysteine proteases. Of these classes of enzymes, a number can hydrolyze elastin and have been shown to be elevated in COPD patients
  • Human carboxypeptidase-like enzyme also may be regulated to treat cancer.
  • Cancer is a disease fundamentally caused by oncogenic cellular transformation. There are several hallmarks of transformed cells that distinguish them from their normal counterparts and underlie the pathophysiology of cancer. These include uncontrolled cellular proliferation, unresponsiveness to normal death-inducing signals (immortali- zation), increased cellular motility and invasiveness, increased ability to recruit blood supply through induction of new blood vessel formation (angiogenesis), genetic instability, and dysregulated gene expression.
  • Various combinations of these abe ⁇ ant physiologies, along with the acquisition of drug resistance frequently lead to an intractable disease state in which organ failure and patient death ultimately ensue.
  • Genes or gene fragments identified through genomics can readily be expressed in one or more heterologous expression systems to produce functional recombinant proteins.
  • proteins are characterized in vitro for their biochemical properties and then used as tools in high-throughput molecular screening programs to identify chemical modulators of their biochemical activities.
  • Agonists and or antagonists of target protein activity can be identified in this manner and subsequently tested in cellular and in vivo disease models for anticancer activity. Optimization of lead compounds with iterative testing in biological models and detailed pharmacokinetic and toxicological analyses form the basis for drug development and subsequent testing in humans.
  • carboxypeptidase M has been implicated in lung cancer.
  • Another example of a carboxypeptidase implicated in cancer is the carboxypeptidase activity of a prostate-specific membrane antigen.
  • a pteroyl poly-gamma-glutamyl carboxypeptidase (folate hydrolase) activity has been attributed to a specific membrane antigen identified in human LNCaP prostatic carcinoma cells (Pinto et al, 1996, Clin. Cancer Res. 2: 1445). This antigen has co ⁇ espondingly been found to be highly expressed in human prostate cancer (Pinto et al, 1996).
  • carboxy- peptidase enables cancer cells to hydrolyze methofrexate, yielding the cells resistant to methofrexate cancer therapy. Iiihibition of a human carboxypeptidase-like enzyme may therefore prove useful as a cancer therapeutic agent, either directly or in conjunction with another cancer therapy, such as methofrexate, that might be rendered ineffective by the carboxypeptidase-like activity.
  • carboxypeptidases may be associated with asthma and allergy. Basophils in the peripheral blood of patients with asthma or allergy were found to express carboxypeptidase A by immunohistochemistry, where- as peripheral blood basophils from normal individuals were found to contain little to no carboxypeptidase A (Li et al, 1998, J. Immunol. 161:5079). Because carboxypeptidases and related proteases regulate many biological processes, expression of carboxypeptidase A in circulating blood cells of patients with asthma or allergy indicates that carboxypeptidase A may contribute to the immune responses associ- ated with asthma or allergy. Compounds directed to human carboxypeptidase-like enzyme may therefore be useful in treatment of asthma or allergy.
  • allergens typically elicit a specific IgE response and, although in most cases the allergens themselves have little or no intrinsic toxicity, they induce pathology when the IgE response in turn elicits an IgE-dependent or T cell-dependent hypersensitivity reaction.
  • Hypersensitivity reactions can be local or systemic and typically occur within minutes of allergen exposure in individuals who have previously been sensitized to an allergen.
  • the hypersensitivity reaction of allergy develops when the allergen is recognized by IgE antibodies bound to specific receptors on the surface of effector cells, such as mast cells, basophils, or eosinophils, which causes the activation of the effector cells and the release of mediators that produce the acute signs and symptoms of the reactions.
  • Allergic diseases include asthma, allergic rhinitis (hay fever), atopic dermatitis, and anaphylaxis.
  • Asthma is thought to arise as a result of interactions between multiple genetic and environmental factors and is characterized by three major features: 1) intermittent and reversible airway obstruction caused by bronchoconstriction, increased mucus production, and thickening of the walls of the airways that leads to a na ⁇ owing of the airways, 2) airway hype ⁇ esponsiveness caused by a decreased control of airway caliber, and 3) airway inflammation.
  • Certain cells are critical to the inflammatory reaction of asthma and they include T cells and antigen presenting cells, B cells that produce IgE, and mast cells, basophils, eosinophils, and other cells that bind IgE.
  • effector cells accumulate at the site of allergic reaction in the airways and release toxic products that contribute to the acute pathology and eventually to the tissue destruction related to the disorder.
  • Other resident cells such as smooth muscle cells, lung epithelial cells, mucus-producing cells, and nerve cells may also be abnormal in individuals with asthma and may contribute to the pathology. While the airway obstruction of asthma, presenting clinically as an intermittent wheeze and shortness of breath, is generally the most pressing symptom of the disease requiring immediate treatment, the inflammation and tissue destruction associated with the disease can lead to irreversible changes that eventually make asthma a chronic disabling disorder requiring long-term management.
  • Cu ⁇ ent pharmacological treatments suffer their own set of disadvantages.
  • Commonly used therapeutic agents such as beta agonists, can act as symptom relievers to transiently improve pulmonary function, but do not affect the underlying inflammation.
  • Agents that can reduce the underlying inflammation such as anti-inflammatory steroids, can have major drawbacks that range from immunosuppression to bone loss (Goodman and Oilman's THE PHARMACOLOGIC BASIS OF THERAPEUTICS, Seventh Edition, MacMillan
  • Glycophorin A Cho and Sharom, Cell. Immunol. 145, 223-39, 1992
  • cyclosporin Alexander et al, Lancet 339, 324-28, 1992
  • a nonapeptide fragment of IL-2 Zav'yalov et al, Immunol. Lett. 31, 285-88, 1992
  • cyclosporin is used as a immunosuppres- sant after organ transplantation.
  • This invention further pertains to the use of novel agents identified by the screening assays described above. Accordingly, it is within the scope of this invention to use a test compound identified as described herein in an appropriate animal model.
  • an agent identified as described herein e.g., a modulating agent, an anti- sense nucleic acid molecule, a specific antibody, ribozyme, or a carboxypeptidase-like enzyme polypeptide binding molecule
  • an agent identified as described herein can be used in an animal model to determine the efficacy, toxicity, or side effects of treatment with such an agent.
  • an agent identified as described herein can be used in an animal model to determine the mechanism of action of such an agent.
  • this invention pertains to uses of novel agents identified by the above described screening assays for treatments as described herein.
  • a reagent which affects carboxypeptidase-like enzyme activity can be administered to a human cell, either in vitro or in vivo, to reduce carboxypeptidase-like enzyme activity.
  • the reagent preferably binds to an expression product of a human carboxypeptidase-like enzyme gene. If the expression product is a protein, the reagent is preferably an antibody.
  • an antibody can be added to a preparation of stem cells which have been removed from the body. The cells can then be replaced in the same or another human body, with or without clonal propagation, as is known in the art.
  • the reagent is delivered using a hposome.
  • the liposome is stable in the animal into which it has been administered for at least about 30 minutes, more preferably for at least about 1 hour, and even more preferably for at least about 24 hours.
  • a liposome comprises a lipid composition that is capable of targeting a reagent, particularly a polynucleotide, to a particular site in an animal, such as a human.
  • the hpid composition of the hposome is capable of targeting to a specific organ of an animal, such as the lung, liver, spleen, heart brain, lymph nodes, and skin.
  • a liposome useful in the present invention comprises a hpid composition that is capable of fusing with the plasma membrane of the targeted cell to deliver its contents to the cell.
  • the transfection efficiency of a liposome is about 0.5 ⁇ g of DNA per 16 nmole of liposome delivered to about 10 6 cells, more preferably about 1.0 ⁇ g of DNA per 16 nmole of liposome delivered to about 10 6 cells, and even more preferably about 2.0 ⁇ g of DNA per 16 nmol of liposome delivered to about 10 6 cells.
  • a liposome is between about 100 and 500 nm, more preferably between about 150 and 450 nm, and even more preferably between about 200 and 400 nm in diameter.
  • Suitable liposomes for use in the present invention include those liposomes standardly used in, for example, gene delivery methods known to those of skill in the art. More preferred liposomes include liposomes having a polycationic lipid composition and/or liposomes having a cholesterol backbone conjugated to polyethylene glycol.
  • a liposome comprises a compound capable of targeting the liposome to a particular cell type, such as a cell-specific ligand exposed on the outer surface of the liposome.
  • a liposome with a reagent such as an antisense oligonucleotide or ribozyme can be achieved using methods which are standard in the art (see, for example, U.S. Patent 5,705,151).
  • a reagent such as an antisense oligonucleotide or ribozyme
  • from about 0.1 ⁇ g to about 10 ⁇ g of polynucleotide is combined with about 8 nmol of liposomes, more preferably from about 0.5 ⁇ g to about 5 ⁇ g of polynucleotides are combined with about 8 nmol liposomes, and even more preferably about 1.0 ⁇ g of polynucleotides is combined with about 8 nmol liposomes.
  • antibodies can be delivered to specific tissues in vivo using receptor-mediated targeted delivery.
  • Receptor-mediated DNA delivery techniques are taught in, for example, Findeis et al. Trends in Biotechnol 11, 202-05 (1993);
  • a therapeutically effective dose refers to that amount of active ingredient which increases or decreases carboxypeptidase-like enzyme activity relative to the carboxypeptidase-like enzyme activity which occurs in the absence of the therapeutically effective dose.
  • the therapeutically effective dose can be estimated initially either in cell culture assays or in animal models, usually mice, rabbits, dogs, or pigs.
  • the animal model also can be used to determine the appropriate concentration range and route of administration. Such information can then be used to determine useful doses and routes for administration in humans.
  • Therapeutic efficacy and toxicity e.g., ED 50 (the dose therapeutically effective in
  • LD5 0 the dose lethal to 50% of the population
  • the dose ratio of toxic to therapeutic effects is the therapeutic index, and it can be expressed as the ratio, LD50/ED 50 .
  • compositions which exhibit large therapeutic indices are prefe ⁇ ed.
  • the data obtained from cell culture assays and animal studies is used in formulating a range of dosage for human use.
  • the dosage contained in such compositions is preferably within a range of circulating concentrations that include the EDs 0 with little or no toxicity.
  • the dosage varies within this range depending upon the dosage form employed, sensitivity of the patient, and the route of administration.
  • Dosage and administration are adjusted to provide sufficient levels of the active ingredient or to maintain the desired effect.
  • Factors which can be taken into account include the severity of the disease state, general health of the subject, age, weight, and gender of the subject, diet, time and frequency of administration, drug combination(s), reaction sensitivities, and tolerance/response to therapy.
  • Long-acting pharmaceutical compositions can be administered every 3 to 4 days, every week, or once every two weeks depending on the half-life and clearance rate of the particular formulation.
  • Normal dosage amounts can vary from 0.1 to 100,000 micrograms, up to a total dose of about 1 g, depending upon the route of administration.
  • Guidance as to particular dosages and methods of delivery is provided in the literature and generally available to practitioners in the art. Those skilled in the art will employ different formulations for nucleotides than for proteins or their inhibitors. Similarly, delivery of polynucleotides or polypeptides will be specific to particular cells, conditions, locations, etc.
  • polynucleotides encoding the antibody can be constructed and introduced into a cell either , ex vivo or in vivo using well- established techniques including, but not limited to, fransferrin-polycation-mediated DNA transfer, fransfection with naked or encapsulated nucleic acids, liposome-mediated cellular fusion, intracellular transportation of DNA-coated latex beads, protoplast fusion, viral infection, electroporation, "gene gun,o and DEAE- or calcium phosphate-mediated fransfection.
  • Effective in vivo dosages of an antibody are in the range of about 5 ⁇ g to about 50 ⁇ g/kg, about 50 ⁇ g to about 5 mg kg, about 100 ⁇ g to about 500 ⁇ g/kg of patient body weight, and about 200 to about 250 ⁇ g/kg of patient body weight.
  • effective in vivo dosages are in the range of about 100 ng to about 200 ng, 500 ng to about 50 mg, about 1 ⁇ g to about 2 mg, about 5 ⁇ g to about 500 ⁇ g, and about 20 ⁇ g to about 100 ⁇ g of DNA.
  • the reagent is preferably an antisense oligonucleotide or a ribozyme.
  • Polynucleotides which express antisense oligonucleotides or ribozymes can be introduced into cells by a variety of methods, as described above.
  • a reagent reduces expression of a carboxypeptidase-like enzyme gene or the activity of a carboxypeptidase-like enzyme polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% relative to the absence of the reagent.
  • the effectiveness of the mechanism chosen to decrease the level of expression of a carboxypeptidase-like enzyme gene or the activity of a carboxypeptidase-like enzyme polypeptide can be assessed using methods well known in the art, such as hybridization of nucleotide probes to carboxypeptidase-like enzyme-specific mRNA, quantitative RT-PCR, immunologic detection of a carboxypeptidase-like enzyme polypeptide, or measurement of carboxypeptidase-like enzyme activity.
  • any of the pharmaceutical compositions of the invention can be administered in combination with other appropriate therapeutic agents.
  • Selection of the appropriate agents for use in combination therapy can be made by one of ordinary skill in the art, according to conventional pharmaceutical principles.
  • the combination of therapeutic agents can act synergistically to effect the treatment or prevention of the various disorders described above. Using this approach, one may be able to achieve therapeutic efficacy with lower dosages of each agent, thus reducing the potential for adverse side effects.
  • any of the therapeutic methods described above can be applied to any subject in need of such therapy, including, for example, mammals such as dogs, cats, cows, horses, rabbits, monkeys, and most preferably, humans. Diagnostic Methods
  • Human carboxypeptidase-like enzyme also can be used in diagnostic assays for detecting diseases and abnormalities or susceptibility to diseases and abnormalities related to the presence of mutations in the nucleic acid sequences which encode the enzyme. For example, differences can be determined between the cDNA or genomic sequence encoding carboxypeptidase-like enzyme in individuals afflicted with a disease and in normal individuals. If a mutation is observed in some or all of the afflicted individuals but not in normal individuals, then the mutation is likely to be the causative agent of the disease.
  • Sequence differences between a reference gene and a gene having mutations can be revealed by the direct DNA sequencing method.
  • cloned DNA segments can be employed as probes to detect specific DNA segments.
  • the sensitivity of this method is greatly enhanced when combined with PCR.
  • a sequencing primer can be used with a double-stranded PCR product or a single-stranded template molecule generated by a modified PCR.
  • the sequence determination is performed by conventional procedures using radiolabeled nucleotides or by automatic sequencing procedures using fluorescent tags.
  • DNA sequence differences can be carried out by detection of alteration in electrophoretic mobility of DNA fragments in gels with or without denaturing agents. Small sequence deletions and insertions can be visualized, for example, by high resolution gel electrophoresis. DNA fragments of different sequences can be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific melting or partial melting temperatures (see, e.g., Myers et al., Science 230, 1242, 1985). Sequence changes at specific locations can also be revealed by nuclease protection assays, such as RNase and S 1 protection or the chemical cleavage method (e.g., Cotton et al, Proc. Natl. Acad. Sci. USA
  • the detection of a specific DNA sequence can be pe" by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes and Southern blotting of genomic DNA.
  • methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes and Southern blotting of genomic DNA.
  • mutations can also be detected by in situ analysis.
  • Altered levels of a carboxypeptidase-like enzyme also can be detected in various tissues.
  • Assays used to detect levels of the receptor polypeptides in a body sample, such as blood or a tissue biopsy, derived from a host are well known to those of skill in the art and include radioimmunoassays, competitive binding assays, Western blot analysis, and ELISA assays.
  • the polynucleotide of SEQ ID NO: 23 is inserted into the expression vector pCEV4 and the expression vector pCEV4-carboxypeptidase-like enzyme polypeptide obtained is transfected into human embryonic kidney 293 cells. From these cells extracts are obtained and the carboxypeptidase-like enzyme activity is measured according to the o-phthaldialdehyde [OP A] method which is based on detection of a free amino group. At 25°C, 50 ⁇ l of the cell extract is added to 1 ml of a 0,5 mM carbobenzoxy (Z)-Ala-Glu solution in 20 mM sodium acetate buffer (pH 4,5).
  • the release of free glutamic acid is monitored by using OP A and dithiothreitol (18).
  • One unit of activity is defined as the quantity of enzyme which liberated 1 ⁇ mol of glutamic acid per min under the conditions described above for the second method. It is shown that the polypeptide of SEQ ID NO: 24 has a carboxypeptidase-like enzyme activity
  • the Pichia pastoris expression vector pPICZB (Invitrogen, San Diego, CA) is used to produce large quantities of recombinant human carboxypeptidase-like polypeptides in yeast.
  • the carboxypeptidase-like enzyme-encoding DNA sequence is derived from SEQ ID NO:23. Before insertion into vector pPICZB, the DNA sequence is modified by well known methods in such a way that it contains at its 5' end an imtiation codon and at its 3' end an enterokinase cleavage site, a His6 reporter tag and a termination codon.
  • the yeast is cultivated under usual conditions in 5 liter shake flasks and the re- combinantly produced protein isolated from the culture by affinity chromatography
  • NiNTAResin in the presence of 8 M urea.
  • the bound polypeptide is eluted with buffer, pH 3.5, and neutralized. Separation of the polypeptide from the His6 reporter tag is accomplished by site-specific proteolysis using enterokinase (Invitrogen, San Diego, CA) according to manufacturer's instructions. Purified human carboxypeptidase-like enzyme polypeptide is obtained.
  • Carboxypeptidase-like enzyme polypeptides comprising a glutathione- S-transferase protein and absorbed onto glutathione-derivatized wells of 96-well microtiter plates are contacted with test compounds from a small molecule library at pH 7.0 in a physiological buffer solution.
  • Carboxypeptidase-like enzyme polypeptides comprise the amino acid sequence shown in SEQ ID NO:24.
  • the test compounds comprise a fluorescent tag. The samples are incubated for 5 minutes to one hour. Control samples are incubated in the absence of a test compound.
  • the buffer solution containing the test compounds is washed from the wells.
  • Binding of a test compound to a carboxypeptidase-like enzyme polypeptide is detected by fluorescence measurements of the contents of the wells.
  • a test compound which increases the fluorescence in a well by at least 15% relative to fluorescence of a well in which a test compound is not incubated is identified as a compound which binds to a carboxypeptidase-like enzyme polypeptide.
  • test compound is administered to a culture of human cells transfected with a carboxypeptidase-like enzyme expression construct and incubated at 37°C for 10 to 45 minutes.
  • a culture of the same type of cells which have not been transfected is incubated for the same time without the test compound to provide a negative control.
  • RNA is isolated from the two cultures as described in Chirgwin et al, Biochem. 18, 5294-99, 1979).
  • Northern blots are prepared using 20 to 30 ⁇ g total RNA and hybridized with a 32 P-labeled carboxypeptidase-like enzyme-specific probe at 65°C in Express-hyb (CLONTECH).
  • the probe comprises at least 11 contiguous nucleotides selected from the complement of SEQ ID NO:23.
  • a test compound which decreases the carboxypeptidase-like enzyme-specific signal relative to the signal obtained in the absence of the test compound is identified as an inhibitor of carboxypeptidase-like enzyme gene expression.
  • carboxypeptidase enzyme that consistently occurs in terminally differentiated prostate cancers cells in vitro suggests that the increased carboxypeptidase expression may be instrumental in causing a ⁇ est of cancerous cell growth in vivo.
  • Compounds that induce expression of human carboxypeptidase-like enzyme thus may prove beneficial in the treatment of prostate and other cancers.
  • RNA samples isolated from a wide range of human cells and tissues. Total RNA samples were either purchased from commercial suppliers or purified in-house. Two panels of RNAs were used for profiling: a whole body organ panel (Table 1) and a respiratory specific panel (Table 2).
  • PCR amplification is performed in the presence of an oligonucleotide probe (TaqMan probe) that is complementary to the target sequence and labeled with a fluorescent reporter dye and a quencher dye.
  • TaqMan probe oligonucleotide probe
  • the probe is cleaved by the 5 '-3' endonuclease activity of Taq DNA polymerase, releasing the fluorophore from the effect of the quenching dye (Holland et al, Proc. Natl. Acad. Sci. U.S.A. 88, 7276-80, 1991).
  • the exponential growth phase of PCR product can be detected and used to determine the initial template concentration (Heid et al, Genome Res. 6, 986-94, 1996, and Gibson et al, Genome Res. 6, 995-1001, 1996).
  • RNA extraction and cDNA preparation Total RNA from each of the 'in-house' samples listed in Table 2 was isolated using Qiagen's (Crawley, Westshire, UK)
  • RNA concentration of the samples purchased from commercial suppliers were also determined using RiboGreen.
  • RNA concentrations of the samples purchased from commercial suppliers were also determined using RiboGreen.
  • l ⁇ g of total RNA was reverse transcribed using 200U of
  • Quantitative PCR was performed with lOng of reverse transcribed RNA from each sample. Each determination was done in duplicate.
  • the assay reaction mix was as follows: IX final TaqMan Universal PCR Master Mix (from 2X stock) (PE Applied Biosystems, CA); 900 nM forward primer; 900 nM reverse primer; 200 nM probe; 10 ng cDNA; and water to 25 ⁇ l.
  • Real-time quantitative PCR was done using an ABI Prism 7700 Sequence Detector.
  • the CT value generated for each reaction was used to determine the initial template concentration (copy number) by interpolation from a universal standard curve.
  • the level of expression of the target gene in each sample was calculated relative to the sample with the lowest expression of the gene.
  • FIG. 32 The relative expression of carboxypeptidase-like enzyme gene across various human tissues is shown in FIG. 32.
  • the gene was highly expressed in kidney but it was also abundantly expressed in all of the other tissues tested.
  • carboxypeptidase-like enzyme gene in lung was investigated further by analysing the expression of the gene in some of the constituent cell types of the lung. In these samples, expression was detected predominantly in airway epithelial cells and was particularly high in the Clara-like cell line H441 and cultured bronchial and small airway epithelial cells (FIG. 33). Abundant expression was also detected in cultured airway smooth muscle cells and in cultured alveolar type II cells. Although expression of the gene in inflammatory cell types was much lower than that seen in the epithelial cells, it was, nevertheless, readily detected (FIG. 33).
  • carboxypeptidase-like enzyme in lung is not known, it is likely involved in the regulation of biologically active peptides and proteins. It may also have a role in tissue remodelling and it is possible that dysfunction or dysregulation of the protease could play a significant role in the destruction of the lung matrix in diseases such as COPD. Carboxypeptidase-like enzyme, therefore, represents a potential therapeutic target for COPD.
  • Table 2 Human respiratory specific RNA panel used for real-time quantitative PCR.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

Reagents which regulate human carboxypeptidase-like enzyme and reagents which bind to human carboxypeptidase-like enzyme gene products can play a role in preventing, ameliorating, or correcting dysfunctions or diseases including, but not limited to, COPD, cancer, asthma, and allergies.

Description

REGULATION OF HUMAN CARBOXYPEPTIDASE-LIKE ENZYME
TECHNICAL FIELD OF THE INNENTION
The invention relates to the regulation of human carboxypeptidase-like enzyme and to provide therapeutic effects.
BACKGROUND OF THE INVENTION
Carboxypeptidases are enzymes that function in many physiological processes by removing a wide range of amino acid residues from the carboxyl termini of polypeptides. In doing so, carboxypeptidases are able to activate, inactivate, and modulate enzyme and peptide hormone activity. For example, carboxypeptidase M, which cleaves carboxyl-terminal arginine or lysrne residues from polypeptides, modulates the activity of the peptide hormones bradykinin and Lys6-enkephalin in the lung (Dragovic et al, Am. J. Respir. Crit. Care Med. 152, 760, 1995). Another such enzyme is carboxypeptidase H, which removes carboxyl-terminal arginine or lysine in the processing of neuropeptide precursors and prohormones in tissues including adrenal gland, pituitary, and brain (Hwang and Hook, Brain Res. Mol.
Brain Res. 25, 135, 1994). Many carboxypeptidases are metalloproteases, such as the eukaryotic zinc-dependent carboxypeptidases A, B, H, M, and N (Tan et al, J. Biol Chem. 264, 13165, 1989), and the bacterial carboxypeptidase G2 (Rowsell et al, Structure 15, 337, 1997).
Carboxypeptidases have been implicated in a number of diseases, including pulmonary diseases, cancer, asthma, and allergies (Dragovic et al, 1995; Pinto et al, Clin. Cancer Res. 2, 1445, 1996; Li et al, J. Immunol 161, 5079, 1998). Because of the importance of carboxypeptidases in a variety of metabolic pathways and their implications in a number of diseases, there is a need in the art to identify additional human carboxypeptidase enzymes which can be regulated to provide therapeutic effects.
SUMMARY OF THE INVENTION
It is an object of the invention to provide reagents and methods of regulating a human cafboxypeptidase-like enzyme. This and other objects of the invention are provided by one or more of the embodiments described below.
One embodiment of the invention is a carboxypeptidase-like enzyme polypeptide comprising an amino acid sequence selected from the group consisting of:
amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO: 24; and
the amino acid sequence shown in SEQ ID NO: 24.
Yet another embodiment of the invention is a method of screening for agents which decrease extracellular matrix degradation. A test compound is contacted with a carboxypeptidase-like enzyme polypeptide comprising an amino acid sequence selected from the group consisting of:
amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO: 24; and
the amino acid sequence shown in SEQ ID NO: 24.
Binding between the test compound and the carboxypeptidase-like enzyme polypeptide is detected. A test compound which binds to the carboxypeptidase-like enzyme polypeptide is thereby identified as a potential agent for decreasing extra- cellular matrix degradation. The agent can work by decreasing the activity of the carboxypeptidase-like enzyme.
Another embodiment of the invention is a method of screening for agents which decrease extracellular matrix degradation. A test compound is contacted with a polynucleotide encoding a carboxypeptidase-like enzyme polypeptide, wherein the polynucleotide comprises a nucleotide sequence selected from the group consisting of:
nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO: 23; and
the nucleotide sequence shown in SEQ ID NO: 23.
Binding of the test compound to the polynucleotide is detected. A test compound which binds to the polynucleotide is identified as a potential agent for decreasing extracellular matrix degradation. The agent can work by decreasing the amount of the carboxypeptidase-like enzyme through interacting with the carboxypeptidase-like enzyme mRNA.
Another embodiment of the invention is a method of screening for agents which regulate extracellular matrix degradation. A test compound is contacted with a carboxypeptidase-like enzyme polypeptide comprising an amino acid sequence selected from the group consisting of:
amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ 3D NO: 24; and
the amino acid sequence shown in SEQ ID NO: 24. A carboxypeptidase-like enzyme activity of the polypeptide is detected. A test compound which increases carboxypeptidase-like enzyme activity of the polypeptide relative to carboxypeptidase-like enzyme activity in the absence of the test compound is thereby identified as a potential agent for increasing extracellular matrix degradation. A test compound which decreases carboxypeptidase-like enzyme activity of the polypeptide relative to carboxypeptidase-like enzyme activity in the absence of the test compound is thereby identified as a potential agent for decreasing extracellular matrix degradation.
Even another embodiment of the invention is a method of screening for agents which decrease extracellular matrix degradation. A test compound is contacted with a carboxypeptidase-like enzyme product of a polynucleotide which comprises a nucleotide sequence selected from the group consisting of:
nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO: 23; and
the nucleotide sequence shown in SEQ ID NO: 23.
Binding of the test compound to the carboxypeptidase-like enzyme product is detected. A test compound which binds to the carboxypeptidase-like enzyme product is thereby identified as a potential agent for decreasing extracellular matrix degradation.
Still another embodiment of the invention is a method of reducing extracellular matrix degradation. A cell is contacted with a reagent which specifically binds to a polynucleotide encoding a carboxypeptidase-like enzyme polypeptide or the product encoded by the polynucleotide, wherein the polynucleotide comprises a nucleotide sequence selected from the group consisting of: nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO: 23; and
the nucleotide sequence shown in SEQ ID NO: 23.
Carboxypeptidase-like enzyme activity in the cell is thereby decreased.
The invention thus provides a human carboxypeptidase-like enzyme which can be used to identify test compounds which may act, for example, as agonists or antagomsts at the enzyme's active site. Human carboxypeptidase-like enzyme and fragments thereof also are useful in raising specific antibodies which can block the enzyme and effectively reduce its activity.
BRIEF DESCRIPTION OF THE DRAWINGS
Fig. 1 shows the DNA-sequence encoding a carboxypeptidase-like enzyme polypeptide (SEQ ID NO:l).
Fig. 2 shows the DNA-sequence encoding a carboxypeptidase-like enzyme polypeptide (SEQ ID NO:2).
Fig. 3 shows the DNA-sequence encoding a carboxypeptidase-like enzyme polypeptide (SEQ ID NO:3).
Fig. 4 shows the DNA-sequence encoding a carboxypeptidase-like enzyme polypeptide (SEQ ID NO:4).
Fig. 5 shows the DNA-sequence encoding a carboxypeptidase-like enzyme polypeptide (SEQ ID NO:5). Fig. 6 shows the DNA-sequence encoding a carboxypeptidase-like enzyme polypeptide (SEQ ID NO:6).
Fig. 7 shows the DNA-sequence encoding a carboxypeptidase-like enzyme polypeptide (SEQ ID NO:7).
Fig. 8 shows the DNA-sequence encoding a carboxypeptidase-like enzyme polypeptide (SEQ ID NO: 8).
Fig. 9 shows the DNA-sequence encoding a carboxypeptidase-like enzyme polypeptide (SEQ ID NO:9).
Fig. 10 shows the DNA-sequence encoding a carboxypeptidase-like enzyme polypeptide (SEQ ID NO: 10).
Fig. 11 shows the DNA-sequence encoding a carboxypeptidase-like enzyme polypeptide (SEQ ID NO: 11).
Fig. 12 shows the DNA-sequence encoding a carboxypeptidase-like enzyme polypeptide (SEQ ID NO: 12).
Fig. 13 shows the DNA-sequence encoding a carboxypeptidase-like enzyme polypeptide (SEQ ID NO: 13).
Fig. 14 shows the DNA-sequence encoding a carboxypeptidase-like enzyme polypeptide (SEQ ID NO: 14).
Fig. 15 shows the DNA-sequence encoding a carboxypeptidase-like enzyme polypeptide (SEQ ID NO: 15). Fig. 16 shows the DNA-sequence encoding a carboxypeptidase-like enzyme polypeptide (SEQ ID NO: 16).
Fig. 17 shows the DNA-sequence encoding a carboxypeptidase-like enzyme polypeptide (SEQ ID NO: 17).
Fig. 18 shows the DNA-sequence encoding a carboxypeptidase-like enzyme polypeptide (SEQ ID NO: 18).
Fig. 19 shows the DNA-sequence encoding a carboxypeptidase-like enzyme polypeptide (SEQ ID NO: 19).
Fig. 20 shows the DNA-sequence encoding a carboxypeptidase-like enzyme polypeptide (SEQ ID NO:20).
Fig. 21 shows the DNA-sequence encoding a carboxypeptidase-like enzyme polypeptide (SEQ ID NO.21).
Fig. 22 shows the DNA-sequence encoding a carboxypeptidase-like enzyme polypeptide (SEQ ID NO:22).
Fig. 23 shows the DNA-sequence encoding a cafboxypeptidase-like enzyme polypeptide (SEQ ID NO:23).
Fig. 24 shows the amino acid sequence deduced from the DNA-sequence of
Fig.23 (SEQ ID NO:24).
Fig. 25 shows the amino acid sequence of the protein identified with
Pdb/1CG2/1CG2-A (SEQ ID NO:25). Fig. 26 shows the amino acid sequence of the protein identified with
Accession No. W38239 (SEQ ID NO:26).
Fig. 27 shows the amino acid sequence of pfam/hmm/Peptidase_M20 (SEQ ID NO:27).
Fig. 28 shows the DNA-sequence encoding a carboxypeptidase-like enzyme polypeptide (SEQ ID NO:28).
Fig.29 shows the BLASTP alignment of human carboxypeptidase-like enzyme (SEQ ID NO:24) with the protein identified with pdb|lCG2|lCG2-A (SEQ ID NO.25).
Fig. 30 shows the BLASTP alignment of human carboxypeptidase-like enzyme (SEQ ID NO:24) with the protein identified with the
Accession No. W38239 (SEQ ID NO:26).
Fig. 31 shows the HMMPFAM alignment of human carboxypeptidase-like enzyme (SEQ ID NO:24) against pfam|hmm|Peptidase_M20 (SEQ ID NO:27).
Fig. 32 shows the relative expression of human carboxypeptidase-like enzyme in various human tissues.
Fig. 33 shows the relative expression of human carboxypeptidase-like enzyme in various human respiratory tissues and cells. Key: HBEC=cultured human bronchial epithelial cells; H441=Clara-like cells; SMC=cultured airway smooth muscle cells; SAE= cultured small airway epithelial cells;
Figure imgf000009_0001
cultured alveolar type II cells; PMN=polymorphonuclear leukocytes; Mono=monocytes; Cult.
Mono=cultured monocytes (macrophage-like). DETAILED DESCRIPTION OF THE INVENTION
The invention relates to an isolated polynucleotide encoding a carboxypeptidase-like enzyme polypeptide and being selected from the group consisting of:
a) a polynucleotide encoding a carboxypeptidase-like enzyme polypeptide comprising an amino acid sequence selected from the group consisting of:
amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO: 24; and the amino acid sequence shown in SEQ ID NO: 24.
b) a polynucleotide comprising the sequence of SEQ ID NO: 23 ;
c) a polynucleotide which hybridizes under stringent conditions to a polynucleotide specified in (a) and (b);
d) a polynucleotide the sequence of which deviates from the polynucleotide sequences specified in (a) to (c) due to the degeneration of the genetic code; and
e) a polynucleotide which represents a fragment, derivative or allelic variation of a polynucleotide sequence specified in (a) to (d).
Furthermore, it has been discovered by the present applicant that a novel carboxypeptidase-like enzyme, particularly a human carboxypeptidase-like enzyme, is a discovery of the present invention. Human carboxypeptidase-like enzyme comprises the amino acid sequence shown in SEQ ID NO:24, as encoded by the coding sequence shown in SEQ ID NO:23. A number of ESTs are contained within or overlap with the coding sequence of human carboxypeptidase-like enzyme, indicating that SEQ ID NO:23 is expressed (SEQ ID NOS: 1-22). Expression occurs in, inter alia, in lung (small cell carcinoma), breast, uterus, placenta (chorio- carcinoma), cervix, kidney (renal cell adenocarcinoma), skin (melanotic melanoma), colon, head, neck, esophagus (squamous cell carcinoma), fetal brain, lymph, retina, and white blood cells.
Human carboxypeptidase-like enzyme is 26% identical over a 254 amino acid overlap to the bacterial protein identified by Accession Nos. P06621 and W38239 and annotated as carboxypeptidase G2 precursor (FIGS. 29 and 30). Carboxy- peptidase G2 has five active site zinc binding residues that bind two zinc ions, and an additional active site residue that is proposed to coordinate a water molecule on the substrate (Rowsell et al, 1997). Four active carboxypeptidase G2 active site residues are conserved in human carboxypeptidase-like enzyme, while a fifth active site residue, a glutamate, is conservatively replaced by a similar aspartate (see FIG. 29). The sixth active site residue, which binds zinc, is outside the range of the alignment.
Human carboxypeptidase-like enzyme also contains many identities to amino acids present in a hidden Markov model (hrnm) of several families classified as peptidases, including the glutamate carboxypeptidases (Rawlings and Barrett, Methods Enzymol 248, 183-228, 1995).
The human carboxypeptidase-like enzyme of the invention is expected to be useful for the same purposes as previously identified carboxypeptidases. Thus, human carboxypeptidase-like enzyme can be used in therapeutic methods to treat disorders such as chronic obstructive cardiopulmonary disease, cancer, asthma, and allergies.
Human carboxypeptidase-like enzyme also can be used to screen for human carboxypeptidase-like enzyme agonists and antagonists. Polypeptides
Carboxypeptidase-like enzyme polypeptides according to the invention comprise at least 4, 5, 10, 15, 25, 50, 75, 100, 125, 150, 175, 200, 250, 300, 350, 400, 450, or 475 contiguous amino acids selected from the amino acid sequence shown in SEQ ID
NO:24 or a biologically active variant thereof, as defined below. A carboxypeptidase-like enzyme polypeptide of the invention therefore can be a portion of a carboxypeptidase-like enzyme protein, a full-length carboxypeptidase-like enzyme protein, or a fusion protein comprising all or a portion of a carboxypeptidase-like enzyme protein.
Biologically Active Variants
Carboxypeptidase-like enzyme polypeptide variants which are biologically active, e.g., retain the ability to catalyze the removal of carboxy terminal amino acids from a protein, also are carboxypeptidase-like enzyme polypeptides. Preferably, naturally or non-naturally occurring carboxypeptidase-like enzyme polypeptide variants have amino acid sequences which are at least about 30, 35, 40, 45, 50, 55, 60, 65, or 70, preferably about 75, 80, 85, 90, 96, 96, or 98% identical to the amino acid sequence shown in SEQ ID NO:24 or a fragment thereof. Percent identity between a putative carboxypeptidase-like enzyme polypeptide variant and an amino acid sequence of SEQ ID NO:24 is determined using the Blast2 alignment program (Blosum62, Expect 10, standard genetic codes).
Variations in percent identity can be due, for example, to amino acid substitutions, insertions, or deletions. Amino acid substitutions are defined as one for one amino acid replacements. They are conservative in nature when the substituted -irnino acid has similar structural and/or chemical properties. Examples of conservative replacements are substitution of a leucine with an isoleucine or valine, an aspartate with a glutamate, or a threonine with a serine. Amino acid insertions or deletions are changes to or within an amino acid sequence. They typically fall in the range of about 1 to 5 amino acids. Guidance in determining which amino acid residues can be substituted, inserted, or deleted without aboHshing biological or immunological activity of a carboxypeptidase-like enzyme polypeptide can be found using computer programs well known in the art, such as DNASTAR software. Whether an amino acid change results in a biologically active carboxypeptidase-like enzyme polypeptide can readily be determined by assaying for carboxypeptidase-like activity.
Fusion Proteins
Fusion proteins are useful for generating antibodies against carboxypeptidase-like enzyme polypeptide amino acid sequences and for use in various assay systems. For example, fusion proteins can be used to identify proteins which interact with portions of a carboxypeptidase-like enzyme polypeptide. Protein affinity chromatography or library-based assays for protein-protein interactions., such as the yeast two-hybrid or phage display systems, can be used for this purpose. Such methods are well known in the art and also can be used as drug screens.
A carboxypeptidase-like enzyme polypeptide fusion protein comprises two polypeptide segments fused together by means of a peptide bond. The first polypeptide segment comprises at least 4, 5, 10, 15, 25, 50, 75, 100, 125, 150, 175, 200, 250, 300, 350, 400, 450, or 475 contiguous amino acids of SEQ ED NO:24 or of a biologically active variant, such as those described above. The first polypeptide segment also can comprise full-length carboxypeptidase-like enzyme protein.
The second polypeptide segment can be a full-length protein or a protein fragment. Proteins commonly used in fusion protein construction include β-galactosidase, β- glucuronidase, green fluorescent protein (GFP), autofluorescent proteins, including blue fluorescent protein (BFP), glutathione-S-transferase (GST), luciferase, horseradish peroxidase (HRP), and chloramphenicol acetyltransferase (CAT). Addi- tionally, epitope tags are used in fusion protein constructions, including histidine (His) tags, FLAG tags, influenza hemagglutinin (HA) tags, Myc tags, NSN-G tags, and thioredoxin (Trx) tags. Other fusion constructions can include maltose binding protein (MBP), S-tag, Lex a DΝA binding domain (DBD) fusions, GAL4 DΝA binding domain fusions, and herpes simplex virus (HSN) BP16 protein fusions. A fusion protein also can be engineered to contain a cleavage site located between the carboxypeptidase-like enzyme polypeptide-encoding sequence and the heterologous protein sequence, so that the carboxypeptidase-like enzyme polypeptide can be cleaved and purified away from the heterologous moiety.
A fusion protein can be synthesized chemically, as is known in the art. Preferably, a fusion protein is produced by covalently linking two polypeptide segments or by standard procedures in the art of molecular biology. Recombinant DΝA methods can be used to prepare fusion proteins, for example, by making a DΝA construct which comprises coding sequences selected from SEQ ID ΝO:23 in proper reading frame with nucleotides encoding the second polypeptide segment and expressing the DNA construct in a host cell, as is known in the art. Many kits for constructing fusion proteins are available from companies such as Promega Corporation (Madison, WT), Stratagene (La Jolla, CA), CLONTECH (Mountain View, CA), Santa Cruz Biotechnology (Santa Cruz, CA), MBL International Corporation (MIC; Watertown,
MA), and Quantum Biotechnologies (Montreal, Canada; 1-888-DNA-KITS).
Identification of Species Homologs
Species homologs of human carboxypeptidase-like enzyme polypeptide can be obtained using carboxypeptidase-like enzyme polypeptide polynucleotides (described below) to make suitable probes or primers for screening cDNA expression libraries from other species, such as mice, monkeys, or yeast, identifying cDNAs which encode homologs of carboxypeptidase-like enzyme polypeptide, and expressing the cDNAs as is known in the art. Polynucleotides
A carboxypeptidase-like enzyme polynucleotide can be single- or double-stranded and comprises a coding sequence or the complement of a coding sequence for a carboxypeptidase-like enzyme polypeptide. A coding sequence for human carboxypeptidase-like enzyme is shown in SEQ ID NO:23. This coding sequence is contained in the human genomic clone identified with Accession No. AC009704. Additional sequences 5' and 3' to the coding sequence are shown in SEQ ID NO:28.
Degenerate nucleotide sequences encoding human carboxypeptidase-like enzyme polypeptides, as well as homologous nucleotide sequences which are at least about 50, 55, 60, 65, 70, preferably about 75, 90, 96, or 98% identical to the nucleotide sequence shown in SEQ ID NO:23 also are carboxypeptidase-like enzyme poly- nucleotides. Percent sequence identity between the sequences of two polynucleotides is determined using computer programs such as ALIGN which employ the FASTA algorithm, using an affine gap search with a gap. open penalty of -12 and a gap extension penalty of -2. Complementary DNA (cDNA) molecules, species homologs, and variants of carboxypeptidase-like enzyme polynucleotides which encode biologically active carboxypeptidase-like enzyme polypeptides also are carboxypeptidase-like enzyme polynucleotides.
Identification of Polynucleotide Variants and Homologs
Variants and homologs of the carboxypeptidase-like enzyme polynucleotides de- scribed above also are carboxypeptidase-like enzyme polynucleotides. Typically, homologous carboxypeptidase-like enzyme polynucleotide sequences can be identified by hybridization of candidate polynucleotides to known carboxypeptidase-like enzyme polynucleotides under stringent conditions, as is known in the art. For example, using the following wash conditions: 2X SSC (0.3 M NaCI, 0.03 M sodium citrate, pH 7.0), 0.1% SDS, room temperature twice, 30 minutes each; then
2X SSC, 0.1% SDS, 50°C once, 30 minutes; then 2X SSC, room temperature twice, 10 minutes each homologous sequences can be identified which contain at most about 25-30% basepair mismatches. More preferably, homologous nucleic acid strands contain 15-25% basepair mismatches, even more preferably 5-15% basepair mismatches.
Species homologs of the carboxypeptidase-like enzyme polynucleotides disclosed herein also can be identified by making suitable probes or primers and screening cDNA expression libraries from other species, such as mice, monkeys, or yeast. Human variants of carboxypeptidase-like enzyme polynucleotides can be identified, for example, by screening human cDNA expression libraries. It is well known that the Tm of a double-stranded DNA decreases by 1-1.5°C with every 1% decrease in homology (Bonner et al, J. Mol Biol. 81, 123 (1973). Variants of human carboxypeptidase-like enzyme polynucleotides or carboxypeptidase-like enzyme polynucleotides of other species can therefore be identified by hybridizing a putative homologous carboxypeptidase-like enzyme polynucleotide with a polynucleotide having a nucleotide sequence of SEQ ID NO:23 or the complement thereof to form a test hybrid. The melting temperature of the test hybrid is compared with the melting temperature of a hybrid comprising polynucleotides having perfectly complementary nucleotide sequences, and the number or percent of basepair mismatches within the test hybrid is calculated.
Nucleotide sequences which hybridize to carboxypeptidase-like enzyme polynucleotides or their complements following stringent hybridization and/or wash conditions also are carboxypeptidase-like enzyme polynucleotides. Stringent wash conditions are well known and understood in the art and are disclosed, for example, in Sambrook et al, MOLECULAR CLONING: A LABORATORY MANUAL, 2d ed., 1989, at pages 9.50-9.51.
Typically, for stringent hybridization conditions a combination of temperature and salt concentration should be chosen that is approximately 12-20°C below the calculated Tm of the hybrid under study. The Tm of a hybrid between a carboxypeptidase-like enzyme polynucleotide having a nucleotide sequence shown in SEQ ID NO:23 or 28 or the complement thereof and a polynucleotide sequence which is at least about 50, 55, 60, 65, 70, preferably about 75, 90, 96, or 98% identical to one of those nucleotide sequences can be calculated, for example, using the equation of Bolton and McCarthy, Proc Natl Acad. Set U.S.A. 48, 1390 (1962):
Tm = 81.5°C - lό.ό ogiotNa ]) + 0.41 (%G + Q - 0.63(%formamide) - 600//), where I = the length of the hybrid in basepairs.
Stringent wash conditions include, for example, 4X SSC at 65°C, or 50% formamide,
4X SSC at 42°C, or 0.5X SSC, 0.1% SDS at 65°C. Highly stringent wash conditions include, for example, 0.2X SSC at 65°C.
Preparation of Polynucleotides
A naturally occurring carboxypeptidase-like enzyme polynucleotide can be isolated free of other cellular components such as membrane components, proteins, and lipids. Polynucleotides can be made by a cell and isolated using standard nucleic acid purification techniques, or synthesized using an amplification technique, such as the polymerase chain reaction (PCR), or by using an automatic synthesizer. Methods for isolating polynucleotides are routine and are known in the art. Any such technique for obtaining a polynucleotide can be used to obtain isolated carboxypeptidase-like enzyme polynucleotides. For example, restriction enzymes and probes can be used to isolate polynucleotide fragments which comprises carboxypeptidase-like enzyme nucleotide sequences. Isolated polynucleotides are in preparations which are free or at least 70, 80, or 90% free of other molecules.
Carboxypeptidase-like enzyme cDNA molecules can be made with standard molecular biology techniques, using carboxypeptidase-like enzyme mRNA as a template. Carboxypeptidase-like enzyme cDNA molecules can thereafter be replicated using molecular biology techniques known in the art and disclosed in manuals such as Sambrook et al. (1989). An amplification technique, such as PCR, can be used to obtain additional copies of polynucleotides of the invention, using either human genomic DNA or cDNA as a template.
Alternatively, synthetic chemistry techniques can be used to synthesizes carboxypeptidase-like enzyme polynucleotides. The degeneracy of the genetic code allows alternate nucleotide sequences to be synthesized which will encode a carboxypeptidase-like enzyme polypeptide having, for example, an amino acid sequence shown in SEQ ID NO:24 or a biologically active variant thereof.
Extending Polynucleotides
Various PCR-based methods can be used to extend the nucleic acid sequences disclosed herein to detect upstream sequences such as promoters and regulatory elements. For example, restriction site PCR uses universal primers to retrieve unknown sequence adjacent to a known locus (Sarkar, PCR Methods Applic 2, 318322, 1993). Genomic DNA is first amplified in the presence of a primer to a linker sequence and a primer specific to the known region. The amplified sequences are then subjected to a second round of PCR with the same linker primer and another specific primer internal to the first one. Products of each round of PCR are transcribed with an appropriate RNA polymerase and sequenced using reverse transcriptase.
Inverse PCR also can be used to amplify or extend sequences using divergent primers based on a known region (Triglia et al, Nucleic Acids Res. 16, 8186, 1988). Primers can be designed using commercially available software, such as OLIGO 4.06 Primer Analysis software (National Biosciences Inc., Plymouth, Minn.), to be 2230 nucleotides in length, to have a GC content of 50% or more, and to anneal to the target sequence at temperatures about 68-72°C. The method uses several restriction enzymes to generate a suitable fragment in the known region of a gene. The fragment is then circularized by intramolecular ligation and used as a PCR template. Another method which can be used is capture PCR, which involves PCR amplification of DNA fragments adjacent to a known sequence in human and yeast artificial chromosome DNA (Lagerstrom et al, PCR Methods Applic 1, 111119, 1991). In this method, multiple restriction enzyme digestions and ligations also can be used to place an engineered double-stranded sequence into an unknown fragment of the DNA molecule before performing PCR.
Another method which can be used to retrieve unknown sequences is that of Parker et al, Nucleic Acids Res. 19, 30553060, 1991). Additionally, PCR, nested primers, and PROMOTERFINDER libraries (CLONTECH, Palo Alto, Calif.) can be used to walk genomic DNA (CLONTECH, Palo Alto, Calif.). This process avoids the need to screen libraries and is useful in finding intron/exon junctions.
When screening for full-length cDNAs, it is preferable to use libraries that have been size-selected to include larger cDNAs. Randomly-primed libraries are preferable, in that they will contain more sequences which contain the 5' regions of genes. Use of a randomly primed library may be especially preferable for situations in which an oligo d(T) library does not yield a full-length cDNA. Genomic libraries can be useful for extension of sequence into 5 ' nontranscribed regulatory regions.
Commercially available capillary electrophoresis systems can be used to analyze the size or confirm the nucleotide sequence of PCR or sequencing products. For example, capillary sequencing can employ flowable polymers for electrophoretic separation, four different fluorescent dyes (one for each nucleotide) which are laser activated, and detection of the emitted wavelengths by a charge coupled device camera. Output/light intensity can be converted to electrical signal using appropriate software (e.g. GENOTYPER and Sequence NAVIGATOR, Perkin Elmer), and the entire process from loading of samples to computer analysis and electronic data display can be computer controlled. Capillary electrophoresis is especially preferable for the sequencing of small pieces of DNA which might be present in limited amounts in a particular sample.
Obtaining Polypeptides
Carboxypeptidase-like enzyme polypeptides can be obtained, for example, by purification from human cells, by expression of carboxypeptidase-like enzyme polynucleotides, or by direct chemical synthesis.
Protein Purification
Carboxypeptidase-like enzyme polypeptides can be purified from any cell which expresses the enzyme, including host cells which have been transfected with carboxypeptidase-like enzyme expression constructs. Lung (small cell carcinoma), breast, uterus, placenta (choriocarcinoma), cervix, kidney (renal cell adeno- carcinoma), skin (melanotic melanoma), colon, head, neck, esophagus (squamous cell carcinoma), fetal brain, lymph, retina, white blood cells provides an especially useful source of carboxypeptidase-like enzyme polypeptides. A purified carboxypeptidase-like enzyme polypeptide is separated from other compounds which normally associate with the carboxypeptidase-like enzyme polypeptide in the cell, such as certain proteins, carbohydrates, or lipids, using methods well-known in the art. Such methods include, but are not limited to, size exclusion chromatography, ammonium sulfate fractionation, ion exchange chromatography, affinity chromatography, and preparative gel electrophoresis. A preparation of purified carboxypeptidase-like enzyme polypeptides is at least 80% pure; preferably, the preparations are 90%, 95%, or 99% pure. Purity of the preparations can be assessed by any means known in the art, such as SDS-polyacrylamide gel electrophoresis. Expression of Polynucleotides
To express a carboxypeptidase-like enzyme polynucleotide, the polynucleotide can be inserted into an expression vector which contains the necessary elements for the transcription and translation of the inserted coding sequence. Methods which are well known to those skilled in the art can be used to construct expression vectors containing sequences encoding carboxypeptidase-like enzyme polypeptides and appropriate transcriptional and translational control elements. These methods include in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. Such techniques are described, for example, in Sambrook et al. (1989) and in Ausubel et al, CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, N.Y., 1989.
A variety of expression vector/host systems can be utilized to contain and express sequences encoding a carboxypeptidase-like enzyme polypeptide. These include, but are not limited to, microorganisms, such as bacteria transformed with recombinant bacteriophage, plasmid, or cosmid DNA expression vectors; yeast transformed with yeast expression vectors, insect cell systems infected with virus expression vectors (e.g., baculovirus), plant cell systems transformed with virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or with bacterial expression vectors (e.g., Ti or pBR322 plasmids), or animal cell systems.
The control elements or regulatory sequences are those nontranslated regions of the vector enhancers, promoters, 5' and 3' untranslated regions which interact with host cellular proteins to carry out transcription and translation. Such elements can vary in their strength and specificity. Depending on the vector system and host utilized, any number of suitable transcription and translation elements, including constitutive and inducible promoters, can be used. For example, when cloning in bacterial systems, inducible promoters such as the hybrid lacZ promoter of the BLUESCRIPT phagemid (Stratagene, LaJolla, Calif.) or pSPORTl plasmid (Life Technologies) and the like can be used. The baculovirus polyhedrin promoter can be used in insect cells. Promoters or enhancers derived from the genomes of plant cells (e.g., heat shock, RUBISCO, and storage protein genes) or from plant viruses (e.g., viral promoters or leader sequences) can be cloned into the vector. In mammalian cell systems, promoters from mammalian genes or from mammalian viruses are preferable. If it is necessary to generate a cell line that contains multiple copies of a nucleotide sequence encoding a carboxypeptidase-like enzyme polypeptide, vectors based on SV40 or EBV can be used with an appropriate selectable marker.
Bacterial and Yeast Expression Systems
In bacterial systems, a number of expression vectors can be selected depending upon the use intended for the carboxypeptidase-like enzyme polypeptide. For example, when a large quantity of a carboxypeptidase-like enzyme polypeptide is needed for the induction of antibodies, vectors which direct high level expression of fusion proteins that are readily purified can be used. Such vectors include, but are not limited to, multifunctional E. coli cloning and expression vectors such as BLUESCRIPT (Stratagene). In a BLUESCRIPT vector, a sequence encoding the carboxypeptidase-like enzyme polypeptide can be ligated into the vector in frame with sequences for the amino terminal Met and the subsequent 7 residues of β- galactosidase so that a hybrid protein is produced. pESf vectors (Van Heeke &
Schuster, J. Biol. Chem. 264, 55035509, 1989) or pGEX vectors (Promega, Madison, Wis.) also can be used to express foreign polypeptides as fusion proteins with glutathione S-transferase (GST). In general, such fusion proteins are soluble and can easily be purified from lysed cells by adsorption to glutathione-agarose beads followed by elution in the presence of free glutathione. Proteins made in such systems can be designed to include heparin, thrombin, or factor Xa protease cleavage sites so that the cloned polypeptide of interest can be released from the GST moiety at will.
In the yeast Saccharomyces cerevisiae, a number of vectors containing constitutive or inducible promoters such as alpha factor, alcohol oxidase, and PGH can be used. For reviews, see Ausubel et al. (1989) and Grant et ah, Methods Enzymol. 153, 516544, 1987.
Plant and Insect Expression Systems
If plant expression vectors are used, the expression of sequences encoding carboxypeptidase-enzyme polypeptides can be driven by any of a number of promoters. For example, viral promoters such as the 35S and 19S promoters of CaMV can be used alone or in combination with the omega leader sequence from TMV (Takamatsu, EMBO J. 6, 307311, 1987). Alternatively, plant promoters such as the small subunit of RUBISCO or heat shock promoters can be used (Coruzzi et al, EMBO J. 3, 16711680, 1984; Broglie et al, Science 224, 838843, 1984; Winter et al, Results Probl Cell Differ. 17, 85105, 1991). These constructs can be introduced into plant cells by direct DNA transformation or by pathogen-mediated transfection. Such techniques are described in a number of generally available reviews (e.g., Hobbs or Murray, in McGRAW HILL YEARBOOK OF SCIENCE AND TECHNOLOGY, McGraw Hill, New York, N.Y., pp. 191196, 1992).
An insect system also can be used to express a carboxypeptidase-like enzyme poly- peptide. For example, in one such system Autographa californica nuclear poly- hedrosis virus (AcNPV) is used as a vector to express foreign genes in Spodoptera frugiperda cells or in Trichoplusia larvae. Sequences encoding carboxypeptidase-like enzyme polypeptides can be cloned into a nonessential region of the virus, such as the polyhedrin gene, and placed under control of the polyhedrin promoter. Successful insertion of carboxypeptidase-like enzyme polypeptides will render the polyhedrin gene inactive and produce recombinant virus lacking coat protein. The recombinant viruses can then be used to infect S. frugiperda cells or
Trichoplusia larvae in which carboxypeptidase-like enzyme polypeptides can be expressed (Engelhard et al, Proc. Nat. Acad. Sci. 91, 32243227, 1994). Mammalian Expression Systems
A number of viral-based expression systems can be used to express carboxypeptidase-like enzyme polypeptides in mammalian host cells. For example, if an adenovirus is used as an expression vector, sequences encoding carboxypeptidase-like enzyme polypeptides can be ligated into an adenovirus transcription/translation complex comprising the late promoter and tripartite leader sequence. Insertion in a nonessential El or E3 region of the viral genome can be used to obtain a viable virus which is capable of expressing a carboxypeptidase-like enzyme polypeptide in infected host cells (Logan & Shenk, Proc Natl Acad. Sci. 81,
36553659, 1984). If desired, transcription enhancers, such as the Rous sarcoma virus (RS V) enhancer, can be used to increase expression in mammalian host cells.
Human artificial chromosomes (HACs) also can be used to deliver larger fragments of DNA than can be contained and expressed in a plasmid. HACs of 6M to 10M are constructed and delivered to cells via conventional delivery methods (e.g., liposomes, polycationic amino polymers, or vesicles).
Specific initiation signals also can be used to achieve more efficient translation of sequences encoding carboxypeptidase-like enzyme polypeptides. Such signals include the ATG initiation codon and adjacent sequences. In cases where sequences encoding a carboxypeptidase-like enzyme polypeptide, its imtiation codon, and upstream sequences are inserted into the appropriate expression vector, no additional transcriptional or translational control signals may be needed. However, in cases where only coding sequence, or a fragment thereof, is inserted, exogenous translational control signals (including the ATG initiation codon) should be provided.
The initiation codon should be in the correct reading frame to ensure translation of the entire insert. Exogenous translational elements and initiation codons can be of various origins, both natural and synthetic. The efficiency of expression can be enhanced by the inclusion of enhancers which are appropriate for the particular cell system which is used (see Scharf etal, Results Probl Cell Differ. 20, 125162, 1994). Host Cells
A host cell strain can be chosen for its ability to modulate the expression of the inserted sequences or to process the expressed carboxypeptidase-like enzyme polypeptide in the desired fashion. Such modifications of the polypeptide include, but are not limited to, acetylation, carboxylation, glycosylation, phosphorylation, lipidation, and acylation. Posttranslational processing which cleaves a "prepro" form of the polypeptide also can be used to facilitate correct insertion, folding and/or function. Different host cells which have specific cellular machinery and characteristic mechanisms for post-translational activities (e.g., CHO, HeLa, MDCK, HE 293, and WI38), are available from the American Type Culture Collection (ATCC; 10801 University Boulevard, Manassas, VA 20110-2209) and can be chosen to ensure the correct modification and processing of the foreign protein.
Stable expression is preferred for long-term, high-yield production of recombinant proteins. For example, cell lines which stably express carboxypeptidase-like enzyme polypeptides can be transformed using expression vectors which can contain viral origins of replication and/or endogenous expression elements and a selectable marker gene on the same or on a separate vector. Following the introduction of the vector, cells can be allowed to grow for 12 days in an enriched medium before they are switched to a selective medium. The purpose of the selectable marker is to confer resistance to selection, and its presence allows growth and recovery of cells which successfully express the introduced carboxypeptidase-like enzyme sequences. Resistant clones of stably transformed cells can be proliferated using tissue culture techniques appropriate to the cell type. See, for example, ANIMAL CELL CULTURE, R.I. Freshney, ed., 1986.
Any number of selection systems can be used to recover transformed cell lines. These include, but are not limited to, the herpes simplex virus thymidine kinase (Wigler et al, Cell 11, 22332, 1977) and adenine phosphoribosylxransferase (Lowy et al, Cell 22, 81723, 1980) genes which can be employed in tk" or aprf cells, respectively. Also, antimetabolite, antibiotic, or herbicide resistance can be used as the basis for selection. For example, dhfr confers resistance to methotrexate (Wigler et al, Proc Nail. Acad. Sci. 77, 356770, 1980), npt confers resistance to the amino- glycosides, neomycin and G418 (Colbere-Garapin et al, J. Mol Biol. 150, 114, 1981), and als and pat confer resistance to chlorsulfuron and phosphinotricin acetyltransferase, respectively (Murray, 1992, supra). Additional selectable genes have been described. For example, trpB allows cells to utilize indole in place of tryptophan, or hisD, which allows cells to utilize histinol in place of histidine (Hartman & Mulligan, Proc. Natl Acad. Sci. 85, 804751, 1988). Visible markers such as anthocyanins, β-glucuronidase and its substrate GUS, and luciferase and its substrate luciferin, can be used to identify transformants and to quantify the amount of transient or stable protein expression attributable to a specific vector system
(Rhodes et al, Methods Mol. Biol 55, 121131, 1995).
Detecting Expression
Although the presence of marker gene expression suggests that the carboxypeptidase-like enzyme polynucleotide is also present, its presence and expression may need to be confirmed. For example, if a sequence encoding a carboxypeptidase-like enzyme polypeptide is inserted within a marker gene sequence, transformed cells containing sequences which encode a carboxypeptidase-like enzyme polypeptide can be identified by the absence of marker gene function. Alternatively, a marker gene can be placed in tandem with a sequence encoding a carboxypeptidase-like enzyme polypeptide under the control of a single promoter. Expression of the marker gene in response to induction or selection usually indicates expression of the carboxypeptidase-like enzyme polynucleotide. Alternatively, host cells which contain a carboxypeptidase-like enzyme polynucleotide and which express a carboxypeptidase-like enzyme polypeptide can be identified by a variety of procedures known to those of skill in the art. These procedures include, but are not limited to, DNA-DNA or DNA-RNA hybridizations and protein bioassay or immunoassay techniques which include membrane, solution, or chip-based technologies for the detection and/or quantification of nucleic acid or protein. For example, the presence of a polynucleotide sequence encoding a carboxypeptidase-like enzyme polypeptide can be detected by DNA-DNA or DNA- RNA hybridization or ampHfication using probes or fragments or fragments of polynucleotides encoding a carboxypeptidase-like enzyme polypeptide. Nucleic acid amplification-based assays involve the use of oligonucleotides selected from sequences encoding a carboxypeptidase-like enzyme polypeptide to detect transfor- ants which contain a carboxypeptidase-like enzyme polynucleotide.
A variety of protocols for detecting and measuring the expression of a carboxypeptidase-like enzyme polypeptide, using either polyclonal or monoclonal antibodies specific for the polypeptide, are known in the art. Examples include enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), and fluorescence activated cell sorting (FACS). A two-site, monoclonal-based immuno- assay using monoclonal antibodies reactive to two non-interfering epitopes on a carboxypeptidase-like enzyme polypeptide can be used, or a competitive binding assay can be employed. These and other assays are described in Hampton et ah, SEROLOGICAL METHODS: A LABORATORY MANUAL, APS Press, St. Paul, Minn., 1990) and Maddox et al, J. Exp. Med. 158, 12111216, 1983).
A wide variety of labels and conjugation techniques are known by those skilled in the art and can be used in various nucleic acid and amino acid assays. Means for producing labeled hybridization or PCR probes for detecting sequences related to polynucleotides encoding carboxypeptidase-like enzyme polypeptides include oHgolabeling, nick translation, end-labeling, or PCR amplification using a labeled nucleotide. Alternatively, sequences encoding a carboxypeptidase-like enzyme polypeptide can be cloned into a vector for the production of an mRNA probe. Such vectors are known in the art, are commercially available, and can be used to synthesize RNA probes in vitro by addition of labeled nucleotides and an appropriate RNA polymerase such as T7, T3, or SP6. These procedures can be conducted using a variety of commercially available kits (Amersham Pharmacia Biotech, Promega, and US Biochemical). Suitable reporter molecules or labels which can be used for ease of detection include radionuclides, enzymes, and fluorescent, chemiluminescent, or chromogenic agents, as well as substrates, cofactors, inhibitors, magnetic particles, and the like.
Expression and Purification of Polypeptides
Host cells transformed with nucleotide sequences encoding a carboxypeptidase-like enzyme polypeptide can be cultured under conditions suitable for the expression and recovery of the protein from cell culture. The polypeptide produced by a transformed cell can be secreted or contained intracellularly depending on the sequence and/or the vector used. As will be understood by those of skill in the art, expression vectors containing polynucleotides which encode carboxypeptidase-like enzyme polypeptides can be designed to contain signal sequences which direct secretion of soluble carboxypeptidase-like enzyme polypeptides through a prokaryotic or eukaryotic cell membrane or which direct the membrane insertion of membrane-bound carboxypeptidase-Hke enzyme polypeptide.
As discussed above, other constructions can be used to join a sequence encoding a carboxypeptidase-like enzyme polypeptide to a nucleotide sequence encoding a polypeptide domain which will facilitate purification of soluble proteins. Such purification facilitating domains include, but are not limited to, metal chelating peptides such as histidine-tryptophan modules that allow purification on immobilized metals, protein A domains that allow purification on immobilized immunoglobulin, and the domain utilized in the FLAGS extension/affinity purification system
(Immunex Corp., Seattle, Wash.). Inclusion of cleavable linker sequences such as those specific for Factor Xa or enterokinase (frivitrogen, San Diego, CA) between the purification domain and the carboxypeptidase-like enzyme polypeptide also can be used to facilitate purification. One such expression vector provides for expression of a fusion protein containing a carboxypeptidase-like enzyme polypeptide and 6 histidine residues preceding a thioredoxin or an enterokinase cleavage site. The histidine residues facilitate purification by IMAC (immobiHzed metal ion affinity chromatography, as described in Porath et al, Prot. Exp. Purif. 3, 263281, 1992), while the enterokinase cleavage site provides a means for purifying the carboxypeptidase-like enzyme polypeptide from the fusion protein. Vectors which contain fusion proteins are disclosed in Kroll et al, DNA Cell Biol. 12, 441453,
1993.
Chemical Synthesis
Sequences encoding a carboxypeptidase-like enzyme polypeptide can be synthesized, in whole or in part, using chemical methods well known in the art (see Caruthers et al, Nucl Acids Res. Symp. Ser. 215223, 1980; Horn et al. Nucl Acids Res. Symp. Ser. 225232, 1980). Alternatively, a carboxypeptidase-like enzyme polypeptide itself can be produced using chemical methods to synthesize its amino acid sequence, such as by direct peptide synthesis using solid-phase techniques (Merrifield, J. Am. Chem.
Soc. 85, 21492154, 1963; Roberge et al, Science 269, 202204, 1995). Protein synthesis can be performed using manual techniques or by automation. Automated synthesis can be achieved, for example, using Applied Biosystems 431 A Peptide Synthesizer (Perkin Elmer). Optionally, fragments of carboxypeptidase-like enzyme polypeptides can be separately synthesized and combined using chemical methods to produce a full-length molecule.
The newly synthesized peptide can be substantially purified by preparative high performance liquid chromatography (e.g., Creighton, PROTEINS: STRUCTURES AND MOLECULAR PRINCIPLES, WH Freeman and Co., New York, N.Y., 1983). The composition of a synthetic carboxypeptidase-like enzyme polypeptide can be confirmed by amino acid analysis or sequencing (e.g., the Edman degradation procedure; see Creighton, supra). Additionally, any portion of the amino acid sequence of the carboxypeptidase-like enzyme polypeptide can be altered during direct synthesis and/or combined using chemical methods with sequences from other proteins to produce a variant polypeptide or a fusion protein.
Production of Altered Polypeptides
As will be understood by those of skill in the art, it may be advantageous to produce carboxypeptidase-like enzyme polypeptide encoding nucleotide sequences possessing non-naturally occurring codons. For example, codons preferred by a particular prokaryotic or eukaryotic host can be selected to increase the rate of protein expression or to produce an RNA transcript having desirable properties, such as a half-life which is longer than that of a transcript generated from the naturally occurring sequence.
The nucleotide sequences disclosed herein can be engineered using methods generally known in the art to alter carboxypeptidase-like enzyme polypeptide-encoding sequences for a variety of reasons, including but not limited to, alterations which modify the cloning, processing, and/or expression of the polypeptide or mRNA product. DNA shuffling by random fragmentation and PCR reassembly of gene fragments and synthetic oligonucleotides can be used to engineer the nucleotide sequences. For example, site-directed mutagenesis can be used to insert new restriction sites, alter glycosylation patterns, change codon preference, produce splice variants, introduce mutations, and so forth.
Antibodies
Any type of antibody known in the art can be generated to bind specifically to an epitope of a carboxypeptidase-like enzyme polypeptide. oAntibodyo as used herein includes intact immunoglobulin molecules, as well as fragments thereof, such as Fab, F(ab§)2, and Fv, which are capable of binding an epitope of a carboxypeptidase-like enzyme polypeptide. Typically, at least 6, 8, 10, or 12 contiguous amino acids are required to form an epitope. However, epitopes which involve non-contiguous amino acids may require more, e.g., at least 15, 25, or 50 amino acids.
An antibody which specifically binds to an epitope of a carboxypeptidase-like enzyme polypeptide can be used therapeutically, as well as in immunochemical assays, such as Western blots, ELISAs, radioimmunoassays, immunohistochemical assays, immunoprecipitations, or other immunochemical assays known in the art. Various immimoassays can be used to identify antibodies having the desired specificity. Numerous protocols for competitive binding or immunoradiometric assays are well known in the art. Such immunoassays typically involve the measurement of complex formation between an immunogen and an antibody which specifically binds to the immunogen.
Typically, an antibody which specifically binds to. a carboxypeptidase-like enzyme polypeptide provides a detection signal at least 5-, 10-, or 20-fold higher than a detection signal provided with other proteins when used in an immunochemical assay. Preferably, antibodies which specifically bind to carboxypeptidase-like enzyme polypeptides do not detect other proteins in immunochemical assays and can immunoprecipitate a carboxypeptidase-like enzyme polypeptide from solution.
Carboxypeptidase-like enzyme polypeptides can be used to immunize a mammal, such as a mouse, rat, rabbit, guinea pig, monkey, or human, to produce polyclonal antibodies. If desired, a carboxypeptidase-like enzyme polypeptide can be conjugated to a carrier protein, such as bovine serum albumin, thyroglobulin, and keyhole limpet hemocyanin. Depending on the host species, various adjuvants can be used to increase the immunological response. Such adjuvants include, but are not limited to, Freund's adjuvant, mineral gels (e.g., aluminum hydroxide), and surface active substances (e.g. lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, and dinitrophenol). Among adjuvants used in humans, BCG (bacilli Calmette-Guerin) and Corynebacterium parvum are especially useful.
Monoclonal antibodies which specifically bind to a carboxypeptidase-like enzyme polypeptide can be prepared using any technique which provides for the production of antibody molecules by continuous cell lines in culture. These techniques include, but are not limited to, the hybridoma technique, the human B cell hybridoma technique, and the EBV HYBRIDOMA technique (Kohler et al, Nature 256, 495497, 1985; Kozbor et al, J. Immunol. Methods 81, 3142, 1985; Cote et al, Proc. Natl Acad. Sci. 80, 20262030, 1983; Cole et al, Mol. Cell Biol. 62, 109120, 1984).
In addition, techniques developed for the production of ochimeric antibodies, o the splicing of mouse antibody genes to human antibody genes to obtain a molecule with appropriate antigen specificity and biological activity, can be used (Morrison et al, Proc. Natl. Acad. Sci. 81, 68516855, 1984; Neuberger et al, Nature 312, 604608,
1984; Takeda et al, Nature 314, 452454, 1985). Monoclonal and other antibodies also can be ohumanizedo to prevent a patient from mounting an immune response against the antibody when it is used therapeutically. Such antibodies may be sufficiently similar in sequence to human antibodies to be used directly in therapy or may require alteration of a few key residues. Sequence differences between rodent antibodies and human sequences can be minimized by replacing residues which differ from those in the human sequences by site directed mutagenesis of individual residues or by grating of entire complementarity determining regions. Alternatively, humanized antibodies can be produced using recombinant methods, as described in GB2188638B. Antibodies which specifically bind to a carboxypeptidase-like enzyme polypeptide can contain antigen binding sites which are either partially or fully humanized, as disclosed in U.S. 5,565,332.
Alternatively, techniques described for the production of single chain antibodies can be adapted using methods known in the art to produce single chain antibodies which specifically bind to carboxypeptidase-like enzyme polypeptides. Antibodies with related specificity, but of distinct idiotypic composition, can be generated by chain shuffling from random combinatorial immunoglobin libraries (Burton, Proc. Natl. Acad. Sci. 88, 1112023, 1991).
Single-chain antibodies also can be constructed using a DNA amplification method, such as PCR, using hybridoma cDNA as a template (Thirion et al, 1996, Eur. J. Cancer Prev. 5, 507-11). Single-chain antibodies can be mono- or bispecific, and can be bivalent or tetravalent. Construction of tetravalent, bispecific single-chain antibodies is taught, for example, in Coloma & Morrison, 1997, Nat. Biotechnol 15, 159-63. Construction of bivalent, bispecific single-chain antibodies is taught in
Mallender & Voss, 1994, J. Biol. Chem. 269, 199-206.
A nucleotide sequence encoding a single-chain antibody can be constructed using manual or automated nucleotide synthesis, cloned into an expression construct using standard recombinant DNA methods, and introduced into a cell to express the coding sequence, as described below. Alternatively, single-chain antibodies can be produced directly using, for example, filamentous phage technology (Verhaar et al, 1995, Int. J. Cancer 61, 497-501; Nicholls et al., 1993, J. Immunol. Meth. 165, 81-91).
Antibodies which specifically bind to carboxypeptidase-like enzyme polypeptides also can be produced by inducing in vivo production in the lymphocyte population or by screening immunoglobulin libraries or panels of highly specific binding reagents as disclosed in the literature (Orlandi et al, Proc. Natl. Acad. Sci. 86, 38333837, 1989; Winter et al, Nature 349, 293299, 1991).
Other types of antibodies can be constructed and used therapeutically in methods of the invention. For example, chimeric antibodies can be constructed as disclosed in WO 93/03151. Binding proteins which are derived from immunoglobulins and which are multivalent and multispecific, such as the odiabodieso described in WO
94/13804, also can be prepared. Antibodies according to the invention can be purified by methods well known in the art. For example, antibodies can be affinity purified by passage over a column to which a carboxypeptidase-like enzyme polypeptide is bound. The bound antibodies can then be eluted from the column using a buffer with a high salt concentration.
Antisense Oligonucleotides
Antisense oligonucleotides are nucleotide sequences which are complementary to a specific DNA or RNA sequence. Once introduced into a cell, the complementary nucleotides combine with natural sequences produced by the cell to form complexes and block either transcription or translation. Preferably, an antisense oligonucleotide is at least 11 nucleotides in length, but can be at least 12, 15, 20, 25, 30, 35, 40, 45, or 50 or more nucleotides long. Longer sequences also can be used. Antisense oligonucleotide molecules can be provided in a DNA construct and introduced into a cell as described above to decrease the level of carboxypeptidase-like enzyme gene products in the cell.
Antisense oligonucleotides can be deoxyribonucleotides, ribonucleotides, or a com- bination of both. Oligonucleotides can be synthesized manually or by an automated synthesizer, by covalently linking the 5' end of one nucleotide with the 3' end of another nucleotide with non-phosphodiester internucleotide linkages such alkyl- phosphonates, phosphorothioates, phosphorodithioates, alkylphosphonothioates, alkylphosphonates, phosphoramidates, phosphate esters, carbamates, acetamidate, carboxymethyl esters, carbonates, and phosphate triesters. See Brown, Meth. Mol.
Biol. 20, 18, 1994; Sonveaux, Meth. Mol Biol 26, 1-72, 1994; Uhlmann et al, Chem. Rev. 90, 543583, 1990.
Modifications of carboxypeptidase-like enzyme gene expression can be obtained by designing antisense oligonucleotides which will form duplexes to the control, 5', or regulatory regions of the carboxypeptidase-like enzyme gene. Oligonucleotides derived from the transcription initiation site, e.g., between positions 10 and +10 from the start site, are preferred. Similarly, inhibition can be achieved using "triple helix" base-pairing methodology. Triple helix pairing is useful because it causes inhibition of the ability of the double helix to open sufficiently for the binding of polymerases, transcription factors, or chaperons. Therapeutic advances using triplex DNA have been described in the literature (e.g., Gee et al, in Huber & Carr, MOLECULAR AND IMMUNOLOGIC APPROACHES, Futura PubHshing Co., Mt. Kisco, N.Y., 1994). An antisense oligonucleotide also can be designed to block translation of mRNA by preventing the transcript from binding to ribosomes.
Precise complementarity is not required for successful complex formation between an antisense oligonucleotide and the complementary sequence of a carboxypeptidase-like enzyme polynucleotide. Antisense oligonucleotides which comprise, for example, 2, 3, 4, or 5 or more stretches of contiguous nucleotides which are precisely complementary to a carboxypeptidase-like enzyme polynucleotide, each separated by a stretch of contiguous nucleotides which are not complementary to adjacent carboxypeptidase-like enzyme nucleotides, can provide sufficient targeting specificity for carboxypeptidase-like enzyme mRNA. Preferably, each stretch of complementary contiguous nucleotides is at least 4, 5, 6, 7, or 8 or more nucleotides in length. Non-complementary intervening sequences are preferably 1, 2, 3, or 4 nucleotides in length. One skilled in the art can easily use the calculated melting point of an antisense-sense pair to determine the degree of mismatching which will be tolerated between a particular antisense oligonucleotide and a particular carboxypeptidase-like enzyme polynucleotide sequence.
Antisense oligonucleotides can be modified without affecting their ability to hybridize to a carboxypeptidase-like enzyme polynucleotide. These modifications can be internal or at one or both ends of the antisense molecule. For example, internucleoside phosphate linkages can be modified by adding cholesteryl or diamine moieties with varying numbers of carbon residues between the amino groups and terminal ribose. Modified bases and/or sugars, such as arabinose instead of ribose, or a 3', 5' substituted oligonucleotide in which the 3' hydroxyl group or the 5' phosphate group are substituted, also can be employed in a modified antisense oligonucleotide. These modified oligonucleotides can be prepared by methods well known in the art. See, e.g., Agrawal et al, Trends Biotechnol 10, 152158, 1992; Uhlmann et al, Chem. Rev. 90, 543584, 1990; Uhlmann et al, Tetrahedron. ett.
215, 35393542, 1987.
Ribozymes
Ribozymes are RNA molecules with catalytic activity. See, e.g., Cech, Science 236,
15321539; 1987; Cech, Ann. Rev. Biochem. 59, 543568; 1990, Cech, Curr. Opin. Struct. Biol. 2, 605609; 1992, Couture & Stinchcomb, Trends Genet. 12, 510515, 1996. Ribozymes can be used to inhibit gene function by cleaving an RNA sequence, as is known in the art (e.g., Haseloff et al, U.S. Patent 5,641,673). The mechanism of ribozyme action involves sequence-specific hybridization of the ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage. Examples include engineered hammerhead motif ribozyme molecules that can specifically and efficiently catalyze endonucleolytic cleavage of specific nucleotide sequences.
The coding sequence of a carboxypeptidase-like enzyme polynucleotide can be used to generate ribozymes which will specifically bind to mRNA transcribed from the carboxypeptidase-like enzyme polynucleotide. Methods of designing and constructing ribozymes which can cleave other RNA molecules in trans in a highly sequence specific manner have been developed and described in the art (see Haseloff et al. Nature 334, 585591, 1988). For example, the cleavage activity of ribozymes can be targeted to specific RNAs by engineering a discrete "hybridization" region into the ribozyme. The hybridization region contains a sequence complementary to the target RNA and thus specifically hybridizes with the target (see, for example, Gerlach et al, EP 321,201). Specific ribozyme cleavage sites within a carboxypeptidase-like enzyme RNA target can be identified by scanning the target molecule for ribozyme cleavage sites which include the following sequences: GUA, GUU, and GUC. Once identified, short RNA sequences of between 15 and 20 ribonucleotides corresponding to the region of the target RNA containing the cleavage site can be evaluated for secondary structural features which may render the target inoperable. Suitability of candidate carboxypeptidase-like enzyme RNA targets also can be evaluated by testing accessibility to hybridization with complementary oligonucleotides using ribonuclease protection assays. Longer complementary sequences can be used to increase the affinity of the hybridization sequence for the target. The hybridizing and cleavage regions of the ribozyme can be integrally related such that upon hybridizing to the target RNA through the complementary regions, the catalytic region of the ribozyme can cleave the target.
Ribozymes can be introduced into cells as part of a DNA construct. Mechanical methods, such as microinjection, liposome-mediated transfection, electroporation, or calcium phosphate precipitation, can be used to introduce a ribozyme-containing DNA construct into cells in which it is desired to decrease carboxypeptidase-like enzyme expression. Alternatively, if it is desired that the cells stably retain the DNA construct, the construct can be supplied on a plasmid and maintained as a separate element or integrated into the genome of the cells, as is known in the art. A ribozyme-encoding DNA construct can include transcriptional regulatory elements, such as a promoter element, an enhancer or UAS element, and a transcriptional terminator signal, for controlling transcription of ribozymes in the cells.
As taught in Haseloff et al, U.S. Patent 5,641,673, ribozymes can be engineered so that ribozyme expression will occur in response to factors which induce expression of a target gene. Ribozymes also can be engineered to provide an additional level of regulation, so that destruction of mRNA occurs only when both a ribozyme and a target gene are induced in the cells. Differentially Expressed Genes
Described herein are methods for the identification of genes whose products interact with human carboxypeptidase-hke enzyme. Such genes may represent genes which are differentially expressed in disorders including, but not limited to, COPD, cancer, allergies, and asthma. Further, such genes may represent genes which are differentially regulated in response to manipulations relevant to the progression or treatment of such diseases. Additionally, such genes may have a temporally modulated expression, increased or decreased at different stages of tissue or organism development. A differentially expressed gene may also have its expression modulated under control versus experimental conditions. In addition, the human carboxypeptidase-like gene or gene product may itself be tested for differential expression.
The degree to which expression differs in a normal versus a diseased state need only be large enough to be visualized via standard characterization techniques such as differential display techniques. Other such standard characterization techniques by which expression differences may be visualized include but are not limited to, quantitative RT (reverse transcriptase), PCR, and Northern analysis.
Identification of Differentially Expressed Genes
To identify differentially expressed genes total RNA or, preferably, mRNA is isolated from tissues of interest. For example, RNA samples are obtained from tissues of experimental subjects and from corresponding tissues of control subjects. Any RNA isolation technique which does not select against the isolation of mRNA may be utilized for the purification of such RNA samples. See, for example, Ausubel et al, ed.„ CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, Inc. New York, 1987-1993. Large numbers of tissue samples may readily be processed using techniques well known to those of skill in the art, such as, for example, the single-step RNA isolation process of Chomczynski, U.S. Patent 4,843,155. Transcripts within the collected RNA samples which represent RNA produced by differentially expressed genes are identified by methods well known to those of skill in the art. They include, for example, differential screening (Tedder et al, Proc. Natl. Acad. Sci. U.S.A. 85, 208-12, 1988), subtractive hybridization (Hedrick et al, Nature 308, 149-53; Lee et al, Proc. Natl. Acad. Sci. U.S.A. 88, 2825, 1984), and, preferably, differential display (Liang & Pardee, Science 257, 967-71, 1992; U.S. Patent 5,262,311).
The differential expression information may itself suggest relevant methods for the treatment of disorders involving the human carboxypeptidase-like enzyme. For example, treatment may include a modulation of expression of the differentially expressed genes and/or the gene encoding the human carboxypeptidase-like enzyme. The differential expression information may indicate whether the expression or activity of the differentially expressed gene or gene product or the human carboxypeptidase-hke gene or gene product are up-regulated or down-regulated.
Screening Methods
The invention provides assays for screening test compounds which bind to or modulate the activity of a carboxypeptidase-like enzyme polypeptide or a carboxypeptidase-like enzyme polynucleotide. A test compound preferably binds to a carboxypeptidase-like enzyme polypeptide or polynucleotide. More preferably, a test compound decreases or increases carboxypeptidase-like activity by at least about 10, preferably about 50, more preferably about 75, 90, or 100% relative to the absence of the test compound.
Test Compounds
Test compounds can be pharmacologic agents already known in the art or can be compounds previously unknown to have any pharmacological activity. The compounds can be naturally occurring or designed in the laboratory. They can be isolated from microorganisms, animals, or plants, and can be produced re- combinantly, or synthesized by chemical methods known in the art. If desired, test compounds can be obtained using any of the numerous combinatorial library methods known in the art, including but not limited to, biological libraries, spatially addressable parallel solid phase or solution phase libraries, synthetic library methods requiring deconvolution, the "one-bead one-compoundo library method, and synthetic library methods using affinity chromatography selection. The biological library approach is limited to polypeptide libraries, while the other four approaches are applicable to polypeptide, non-peptide oligomer, or small molecule libraries of compounds. See Lam, Anticancer Drug Des. 12, 145, 1997.
Methods for the synthesis of molecular libraries are well known in the art (see, for example, DeWitt et al, Proc. Natl. Acad. Sci. U.S.A. 90, 6909, 1993; Erb et al. Proc. Natl. Acad. Sci. U.S.A. 91, 11422, 1994; Zuckermann et al, J. Med. Chem. 37, 2678, 1994; Cho et al, Science 261, 1303, 1993; Carell et al, Angew. Chem. Int. Ed. Engl
33, 2059, 1994; Carell et al, Angew. Chem. Int. Ed. Engl 33, 2061; Gallop et al, J. Med. Chem. 37, 1233, 1994). Libraries of compounds can be presented in solution (see, e.g., Houghten, BioTechniques 13, 412421, 1992), or on beads (Lam, Nature 354, 8284, 1991), chips (Fodor, Nature 364, 555556, 1993), bacteria or spores (Ladner, U.S. Patent 5,223,409), plasmids (Cull et al, Proc. Natl. Acad. Sci. U A.
89, 18651869, 1992), or phage (Scott & Smith, Science 249, 386390, 1990; Devlin, Science 249, 404406, 1990); Cwirla et al, Proc. Natl. Acad. Sci. 97, 63786382, 1990; Felici, J. Mol. Biol. 222, 301310, 1991; and Ladner, U.S. Patent 5,223,409).
High Throughput Screening
Test compounds can be screened for the ability to bind to carboxypeptidase-like enzyme polypeptides or polynucleotides or to affect carboxypeptidase-like enzyme activity or carboxypeptidase-like enzyme gene expression using high throughput screening. Using high throughput screening, many discrete compounds can be tested in parallel so that large numbers of test compounds can be quickly screened. The most widely established techniques utilize 96-well microtiter plates. The wells of the microtiter plates typically require assay volumes that range from 50 to 500 μl. In addition to the plates, many instruments, materials, pipettors, robotics, plate washers, and plate readers are commercially available to fit the 96-well format.
Alternatively, "free format assays, o or assays that have no physical barrier between samples, can be used. For example, an assay using pigment cells (melanocytes) in a simple homogeneous assay for combinatorial peptide libraries is described by Jayawickreme et al, Proc. Natl. Acad. Sci. U.S.A. 19, 161418 (1994). The cells are placed under agarose in petri dishes, then beads that carry combinatorial compounds are placed on the surface of the agarose. The combinatorial compounds are partially released the compounds from the beads. Active compounds can be visualized as dark pigment areas because, as the compounds diffuse locally into the gel matrix, the active compounds cause the cells to change colors.
Another example of a free format assay is described by Chelsky, "Strategies for Screening Combinatorial Libraries: Novel and Traditional Approaches," reported at the First Annual Conference of The Society for Biomolecular Screening in Philadelphia, Pa. (Nov. 710, 1995). Chelsky placed a simple homogenous enzyme assay for carbonic anhydrase inside an agarose gel such that the enzyme in the gel would cause a color change throughout the gel. Thereafter, beads carrying combinatorial compounds via a photolinker were placed inside the gel and the compounds were partially released by UV LIGHT. Compounds that inhibited the enzyme were observed as local zones of inhibition having less color change.
Yet another example is described by Salmon et al, Molecular Diversity 2, 5763 (1996). In this example, combinatorial libraries were screened for compounds that had cytotoxic effects on cancer cells growing in agar.
Another high throughput screening method is described in Beutel et al, U.S. Patent
5,976,813. In this method, test samples are placed in a porous matrix. One or more assay components are then placed within, on top of, or at the bottom of a matrix such as a gel, a plastic sheet, a filter, or other form of easily manipulated solid support. When samples are introduced to the porous matrix they diffuse sufficiently slowly, such that the assays can be performed without the test samples running together.
Binding Assays
For binding assays, the test compound is preferably a small molecule which binds to and occupies, for example, the active site of the carboxypeptidase-like enzyme polypeptide, such that normal biological activity is prevented. Examples of such small molecules include, but are not limited to, small peptides or peptide-like molecules.
In binding assays, either the test compound or the carboxypeptidase-like enzyme polypeptide can comprise a detectable label, such as a fluorescent, radioisotopic, chemiluminescent, or enzymatic label, such as horseradish peroxidase, alkaline phosphatase, or luciferase. Detection of a test compound which is bound to the carboxypeptidase-like enzyme polypeptide can then be accomplished, for example, by direct counting of radioemmission, by scintillation counting, or by determining conversion of an appropriate substrate to a detectable product.
Alternatively, binding of a test compound to a carboxypeptidase-like enzyme polypeptide can be determined without labeling either of the interactants. For example, a microphysiometer can be used to detect binding of a test compound with a carboxypeptidase-like enzyme polypeptide. A microphysiometer (e.g., Cyto- sensor™) is an analytical instrument that measures the rate at which a cell acidifies its environment using a light-addressable potentiometric sensor (LAPS). Changes in this acidification rate can be used as an indicator of the interaction between a test compound and a carboxypeptidase-like enzyme polypeptide (McConnell et al, Science 257, 19061912, 1992). Determining the ability of a test compound to bind to a carboxypeptidase-like enzyme polypeptide also can be accomplished using a technology such as real-time Bimolecular Interaction Analysis (BIA) (Sjolander & Urbaniczky, Anal. Chem. 63, 23382345, 1991, and Szabo et al, Curr. Opin. Struct. Biol 5, 699705, 1995). BIA is a technology for studying biospecific interactions in real time, without labeling any of the interactants (e.g., BIAcore™). Changes in the optical phenomenon surface plasmon resonance (SPR) can be used as an indication of real-time reactions between biological molecules.
In yet another aspect of the invention, a carboxypeptidase-like enzyme polypeptide can be used as a "bait protein" in a two-hybrid assay or three-hybrid assay (see, e.g., U.S. Patent 5,283,317; Zervos et al, Cell 72, 223232, 1993; Madura et al, J. Biol. Chem. 268, 1204612054, 1993; Bartel et al, BioTechniques 14, 920924, 1993; Iwabucbi et al, Oncogene 8, 16931696, 1993; and Brent W094/10300), to identify other proteins which bind to or interact with the carboxypeptidase-like enzyme polypeptide and modulate its activity.
The two-hybrid system is based on the modular nature of most transcription factors, which consist of separable DNA BINDING and activation domains. Briefly, the assay utilizes two different DNA constructs. For example, in one construct, polynucleotide encoding a carboxypeptidase-like enzyme polypeptide can be fused to a polynucleotide encoding the DNA binding domain of a known transcription factor (e.g., GAL4). In the other construct a DNA sequence that encodes an unidentified protein ("prey" or "sample") can be fused to a polynucleotide that codes for the activation domain of the known transcription factor. If the "bait" and the "prey" proteins are able to interact in vivo to form an protein-dependent complex, the DNA BINDING and activation domains of the transcription factor are brought into close proximity. This proximity allows transcription of a reporter gene (e.g., LacZ), which is operably linked to a transcriptional regulatory site responsive to the transcription factor. Expression of the reporter gene can be detected, and cell colonies containing the functional transcription factor can be isolated and used to obtain the DNA sequence encoding the protein which interacts with the carboxypeptidase-like enzyme polypeptide.
It may be desirable to immobilize either the carboxypeptidase-like enzyme polypeptide (or polynucleotide) or the test compound to facilitate separation of bound from unbound forms of one or both of the interactants, as well as to accommodate automation of the assay. Thus, either the carboxypeptidase-like enzyme polypeptide (or polynucleotide) or the test compound can be bound to a solid support. Suitable solid supports include, but are not limited to, glass or plastic slides, tissue culture plates, microtiter wells, tubes, silicon chips, or particles such as beads
(including, but not limited to, latex, polystyrene, or glass beads). Any method known in the art can be used to attach the carboxypeptidase-like enzyme polypeptide (or polynucleotide) or test compound to a solid support, including use of covalent and non-covalent linkages, passive absorption, or pairs of binding moieties attached respectively to the polypeptide (or polynucleotide) or test compound and the solid support. Test compounds are preferably bound to the solid support in an array, so that the location of individual test compounds can be tracked. Binding of a test compound to a carboxypeptidase-like enzyme polypeptide (or polynucleotide) can be accomplished in any vessel suitable for containing the reactants. Examples of such vessels include microtiter plates, test tubes, and microcentrifuge tubes.
In one embodiment, the carboxypeptidase-like enzyme polypeptide is a fusion protein comprising a domain that allows the carboxypeptidase-like enzyme polypeptide to be bound to a solid support. For example, glutathione S-transferase fusion pro- teins can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis,
Mo.) or glutathione derivatized microtiter plates, which are then combined with the test compound or the test compound and the nonadsorbed carboxypeptidase-like enzyme polypeptide; the mixture is then incubated under conditions conducive to complex formation (e.g., at physiological conditions for salt and pH). Following incubation, the beads or microtiter plate wells are washed to remove any unbound components. Binding of the interactants can be determined either directly or indirectly, as described above. Alternatively, the complexes can be dissociated from the solid support before binding is determined.
Other techniques for immobilizing proteins or polynucleotides on a solid support also can be used in the screening assays of the invention. For example, either a carboxypeptidase-like enzyme polypeptide (or polynucleotide) or a test compound can be immobilized utilizing conjugation of biotin and streptavidin. Biotinylated carboxypeptidase-like enzyme polypeptides (or polynucleotides) or test compounds can be prepared from biotinNHS (Nhydroxysuccinimide) using techniques well known in the art (e.g., biotinylation kit, Pierce Chemicals, Rockford, 111.) and immobilized in the wells of streptavidin-coated 96 well plates (Pierce Chemical). Alternatively, antibodies which specifically bind to a carboxypeptidase-like enzyme polypeptide, polynucleotide, or a test compound, but which do not interfere with a desired binding site, such as the active site of the carboxypeptidase-like enzyme polypeptide, can be derivatized to the wells of the plate. Unbound target or protein can be trapped in the wells by antibody conjugation.
Methods for detecting such complexes, in addition to those described above for the GST-DVIMOBILIZED complexes, include immunodetection of complexes using antibodies which specifically bind to the carboxypeptidase-like enzyme polypeptide or test compound, enzyme-linked assays which rely on detecting an activity of the carboxypeptidase-like enzyme polypeptide, and SDS gel electrophoresis under non-reducing conditions.
Screening for test compounds which bind to a carboxypeptidase-like enzyme polypeptide or polynucleotide also can be carried out in an intact cell. Any cell which comprises a carboxypeptidase-like enzyme polypeptide or polynucleotide can be used in a cell-based assay system. A carboxypeptidase-like enzyme polynucleotide can be naturally occurring in the cell or can be introduced using techniques such as those described above. Binding of the test compound to a carboxypeptidase-like enzyme polypeptide or polynucleotide is determined as described above.
Enzyme Assays
Test compounds can be tested for the ability to increase or decrease the carboxypeptidase activity of a human carboxypeptidase-like enzyme polypeptide. Carboxypeptidase activity can be measured using an appropriate assay for particular carboxypeptidase activities, as known by those of skill in the art. For example, carboxypeptidase A-like activity can be assayed as described in Hilhnan et al, U.S.
Patent 5,998,373; carboxypeptidase G2-like activity can be assayed as described in Sherwood et al., Eur. J. Biochem. 148, 447, 1985; and carboxypeptidase M-like activity can be assayed as described in Dragovic et al, 1995.
Enzyme assays can be carried out after contacting either a purified carboxypeptidase-like enzyme polypeptide, a cell membrane preparation, or an intact cell with a test compound. A test compound which decreases a carboxypeptidase activity of a carboxypeptidase-like enzyme polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% is identified as a potential therapeutic agent for decreasing carboxypeptidase-like enzyme activity. A test compound which increases a carboxypeptidase activity of a human carboxypeptidase-like enzyme polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% is identified as a potential therapeutic agent for increasing human carboxypeptidase-like enzyme activity.
Gene Expression
In another embodiment, test compounds which increase or decrease carboxypeptidase-like enzyme gene expression are identified. A carboxypeptidase-like enzyme polynucleotide is contacted with a test compound, and the expression of an RNA or polypeptide product of the carboxypeptidase-like enzyme polynucleotide is determined. The level of expression of appropriate mRNA or polypeptide in the presence of the test compound is compared to the level of expression of mRNA or polypeptide in the absence of the test compound. The test compound can then be identified as a modulator of expression based on this comparison. For example, when expression of mRNA or polypeptide is greater in the presence of the test compound than in its absence, the test compound is identified as a stimulator or enhancer of the mRNA or polypeptide expression. Alternatively, when expression of the mRNA or polypeptide is less in the presence of the test compound than in its absence, the test compound is identified as an inhibitor of the mRNA or polypeptide expression.
The level of carboxypeptidase-like enzyme mRNA or polypeptide expression in the cells can be determined by methods well known in the art for detecting mRNA or polypeptide. Either qualitative or quantitative methods can be used. The presence of polypeptide products of a carboxypeptidase-like enzyme polynucleotide can be determined, for example, using a variety of techniques known in the art, including immunochemical methods such as radioimmunoassay, Western blotting, and immunohistochemistry. Alternatively, polypeptide synthesis can be determined in vivo, in a cell culture, or in an in vitro translation system by detecting incorporation of labeled amino acids into a carboxypeptidase-like enzyme polypeptide.
Such screening can be carried out either in a cell-free assay system or in an intact cell. Any cell which expresses a carboxypeptidase-like enzyme polynucleotide can be used in a cell-based assay system. The carboxypeptidase-like enzyme polynucleotide can be naturally occurring in the cell or can be introduced using techniques such as those described above. Either a primary culture or an established cell line, such as CHO or human embryonic kidney 293 cells, can be used. Pharmaceutical Compositions
The invention also provides pharmaceutical compositions which can be administered to a patient to achieve a therapeutic effect. Pharmaceutical compositions of the invention can comprise, for example, a carboxypeptidase-like enzyme polypeptide, carboxypeptidase-like enzyme polynucleotide, ribozymes or antisense oligonucleotides, antibodies which specifically bind to a carboxypeptidase-like enzyme polypeptide, or mimetics, agonists, antagonists, or inhibitors of a carboxypeptidase-like enzyme polypeptide activity. The compositions can be administered alone or in combination with at least one other agent, such as stabilizing compound, which can be administered in any sterile, biocompatible pharmaceutical carrier, including, but not limited to, saline, buffered saline, dextrose, and water. The compositions can be administered to a patient alone, or in combination with other agents, drugs or hormones.
In addition to the active ingredients, these pharmaceutical compositions can contain suitable pharmaceutically acceptable carriers comprising excipients and auxiliaries which facilitate processing of the active compounds into preparations which can be used pharmaceutically. Pharmaceutical compositions of the invention can be a lministered by any number of routes including, but not limited to, oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intraventricular, transdermal, subcutaneous, intraperitoneal, intranasal, parenteral, topical, sublingual, or rectal means. Pharmaceutical compositions for oral administration can be formulated using pharmaceutically acceptable carriers well known in the art in dosages suitable for oral administration. Such carriers enable the pharmaceutical compositions to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for ingestion by the patient.
Pharmaceutical preparations for oral use can be obtained through combination of active compounds with solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores. Suitable excipients are carbohydrate or protein fillers, such as sugars, including lactose, sucrose, mannitol, or sorbitol; starch from corn, wheat, rice, potato, or other plants; cellulose, such as methyl cellulose, hydroxy- propylmethylcellulose, or sodium carboxymethylcellulose; gums including arabic and tragacanth; and proteins such as gelatin and collagen. If desired, disintegrating or solubilizing agents can be added, such as the cross-linked polyvinyl pyrrolidone, agar, alginic acid, or a salt thereof, such as sodium alginate.
Dragee cores can be used in conjunction with suitable coatings, such as concentrated sugar solutions, which also can contain gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures. Dyestuffs or pigments can be added to the tablets or dragee coatings for product identification or to characterize the quantity of active compound, i.e., dosage.
Pharmaceutical preparations which can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a coating, such as glycerol or sorbitol. Push-fit capsules can contain active ingredients mixed with a filler or binders, such as lactose or starches, lubricants, such as talc or magnesium stearate, and, optionally, stabilizers. In soft capsules, the active compounds can be dissolved or suspended in suitable liquids, such as fatty oils, liquid, or liquid polyethylene glycol with or without stabilizers.
Pharmaceutical formulations suitable for parenteral administration can be formulated in aqueous solutions, preferably in physiologically compatible buffers such as
Hanks' solution, Ringer's solution, or physiologically buffered saline. Aqueous injection suspensions can contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Additionally, suspensions of the active compounds can be prepared as appropriate oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes. Non-lipid polycationic amino polymers also can be used for delivery. Optionally, the suspension also can contain suitable stabilizers or agents which increase the solubility of the compounds to allow for the preparation of highly concentrated solutions. For topical or nasal administration, penetrants appropriate to the particular barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
The pharmaceutical compositions of the present invention can be manufactured in a manner that is known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee making, levigating, emulsifying, encapsulating, entrapping, or lyophilizing processes. The pharmaceutical composition can be provided as a salt and can be formed with many acids, including but not limited to, hydrochloric, sulfuric, acetic, lactic, tartaric, malic, succinic, etc. Salts tend to be more soluble in aqueous or other protonic solvents than are the coπesponding free base forms. In other cases, the prefeπed preparation can be a lyophilized powder which can contain any or all of the following: 150 mM histidine, 0.1 %2% sucrose, and 27% mannitol, at a pH range of 4.5 to 5.5, that is combined with buffer prior to use.
Further details on techniques for formulation and administration can be found in the latest edition of REMINGTON'S PHARMACEUTICAL SCIENCES (Maack Publishing Co., Easton, Pa.). After pharmaceutical compositions have been prepared, they can be placed in an appropriate container and labeled for treatment of an indicated condition. Such labeling would include amount, frequency, and method of administration.
Therapeutic Indications and Methods
Various carboxypeptidases have been found to be associated with tissues or fluids collected from patients with diseases, implicating a role for carboxypeptidases in a number of diseases. For example, carboxypeptidase M activity is increased in broncheoalveolar lavage in human lung disease (Dragovic et al, 1995). Carboxy- peptidase A appears to be expressed in peripheral blood basophils from patients with asthma or allergy, whereas little or no carboxypeptidase A is detected in the peripheral blood basophils from normal individuals (Li et al, 1998). Human prostatic carcinoma cells have been observed to have a specific membrane antigen that has a carboxypeptidase activity (folate hydrolase) (Pinto et al, 1996). Carboxypeptidases have thus been implicated in a number of diseases, including pulmonary diseases, cancer, asthma, and allergies. Compounds directed to the regulation of human carboxypeptidase-like enzyme may therefore prove useful as therapeutic agents for these diseases.
Human carboxypeptidase-like enzyme may possess activities similar to those of carboxypeptidase M. Carboxypeptidase M cleaves the terminal arginine or lysine from peptides including bradykinin and Lys6-enkephalin (Dragovic et al, 1995). Carboxypeptidase M is found throughout the body, including in the kidney and central nerve tissues, and is particularly prominent in the lung (Dragovic et al,
1995). In studies examining the distribution of carboxypeptidase M in broncheoalveolar lavage (BAL) fluid, carboxypeptidase M levels were found to be approximately 4 times higher in the BAL fluid of patients with acute pneumonia, Pneumocystis carinii pneumonia, and lung cancer compared to the levels in BAL fluid of patients without lung disease (Dragovic et al, 1995). The carboxypeptidase
M found in BAL fluid is believed to be expressed from lung type I alveolar cells. The high levels of carboxypeptidase M activity in the BAL fluid that coπelated with several lung diseases suggests that inhibition of carboxypeptidase M or a related human carboxypeptidase-like enzyme may be therapeutically useful for treating a number of lung diseases, including chronic obstructive pulmonary disease.
Chronic obstructive pulmonary (or airways) disease (COPD) is a condition defined physiologically as airflow obstruction that generally results from a mixture of emphysema and peripheral airway obstruction due to chronic bronchitis (Senior & Shapiro, Pulmonary Diseases and Disorders, 3d ed., New York, McGraw-Hill, 1998, pp. 659-681, 1998; Barnes, Chest 117, 10S-14S, 2000). Emphysema is characterized by destruction of alveolar walls leading to abnormal enlargement of the air spaces of the lung. Chronic bronchitis is defined clinically as the presence of chronic productive cough for three months in each of two successive years. In COPD, airflow obstruction is usually progressive and is only partially reversible. By far the most important risk factor for development of COPD is cigarette smoking, although the disease does occur in non-smokers.
Chronic inflammation of the airways is a key pathological feature of COPD (Senior & Shapiro, 1998). The inflammatory cell population comprises increased numbers of macrophages, neutrophils, and CD8+ lymphocytes. Inhaled irritants, such as cigarette smoke, activate macrophages which are resident in the respiratory tract, as well as epithelial cells leading to release of chemokines (e.g., interleukin-8) and other chemotactic factors. These chemotactic factors act to increase the neutrophil/- monocyte trafficking from the blood into the lung tissue and airways. Neutrophils and monocytes recruited into the airways can release a variety of potentially damaging mediators such as proteolytic enzymes and reactive oxygen species. Matrix degradation and emphysema, along with airway wall thickening, surfactant dysfunction, and mucus hypersecretion, all are potential sequelae of this inflammatory response that lead to impaired airflow and gas exchange.
COPD is characterized by damage to the lung extracellular matrix and emphysema can be viewed as the pathologic process that affects the lung parenchyma. This process eventually leads to the destruction of the airway walls resulting in permanent airspace enlargement (Senior and Shapiro, in PULMONARY DISEASES AND DISORDERS, 3rd ed., New York, McGraw-Hill, 1998, pp. 659 - 681, 1998). The observation that inherited deficiency of αl-antitrypsin (αl-AT), the primary inhibitor of neutrophil elastase, predisposes individuals to early onset emphysema, and that intrapulmonary instillation of elastolytic enzymes in experimental animals causes emphysema, led to the elastase:antielastase hypothesis for the pathogenesis of emphysema (Eriksson, Acta Med. Scand. 177(Suppl), 432, 1965, Gross, J. Occup. Med. 6, 481-84, 1964). This in turn led to the concept that destruction of elastin in the lung parenchyma is the basis of the development of emphysema.
A broad range of immune and inflammatory cells including neutrophils, macro- phages, T lymphocytes and eosinophils contain proteolytic enzymes that could contribute to the destruction of lung extracellular matrix (Shapiro, 1999). In addition, a number of different classes of proteases have been identified that have the potential to contribute to lung matrix destruction. These include serine proteases, matrix metalloproteinases and cysteine proteases. Of these classes of enzymes, a number can hydrolyze elastin and have been shown to be elevated in COPD patients
(neutrophil elastase, MMP-2, 9, 12) (Culpitt et al, Am. J. Respir. Crit. Care Med. 160, 1635-39, 1999, Shapiro, Am. J. Crit. Care Med. 160 (5), S29 - S32, 1999).
It is expected that in the future novel members of the existing classes of proteases and new classes of proteases will be identified that play a significant role in the damage of the extracellular lung matrix including elastin proteolysis. Novel protease targets therefore remain very attractive therapeutic targets.
Human carboxypeptidase-like enzyme also may be regulated to treat cancer. Cancer is a disease fundamentally caused by oncogenic cellular transformation. There are several hallmarks of transformed cells that distinguish them from their normal counterparts and underlie the pathophysiology of cancer. These include uncontrolled cellular proliferation, unresponsiveness to normal death-inducing signals (immortali- zation), increased cellular motility and invasiveness, increased ability to recruit blood supply through induction of new blood vessel formation (angiogenesis), genetic instability, and dysregulated gene expression. Various combinations of these abeπant physiologies, along with the acquisition of drug resistance frequently lead to an intractable disease state in which organ failure and patient death ultimately ensue.
Most standard cancer therapies target cellular proliferation and rely on the differential prohferative capacities between transformed and normal cells for their efficacy. This approach is hindered by the facts that several important normal cell types are also highly prohferative and that cancer cells frequently become resistant to these agents. Thus, the therapeutic indices for traditional anticancer therapies rarely exceed 2.0.
The advent of genomics driven molecular target identification has opened up the possibility of identifying new cancer-specific targets for therapeutic intervention that will provide safer, more effective treatments for cancer patients. Thus, newly discovered tumor-associated genes and their products can be tested for their role(s) in disease and used as tools to discover and develop innovative therapies. Genes playing important roles in any of the physiological processes outlined above can be characterized as cancer targets.
Genes or gene fragments identified through genomics can readily be expressed in one or more heterologous expression systems to produce functional recombinant proteins.
These proteins are characterized in vitro for their biochemical properties and then used as tools in high-throughput molecular screening programs to identify chemical modulators of their biochemical activities. Agonists and or antagonists of target protein activity can be identified in this manner and subsequently tested in cellular and in vivo disease models for anticancer activity. Optimization of lead compounds with iterative testing in biological models and detailed pharmacokinetic and toxicological analyses form the basis for drug development and subsequent testing in humans.
As noted above, carboxypeptidase M has been implicated in lung cancer. Another example of a carboxypeptidase implicated in cancer is the carboxypeptidase activity of a prostate-specific membrane antigen. A pteroyl poly-gamma-glutamyl carboxypeptidase (folate hydrolase) activity has been attributed to a specific membrane antigen identified in human LNCaP prostatic carcinoma cells (Pinto et al, 1996, Clin. Cancer Res. 2: 1445). This antigen has coπespondingly been found to be highly expressed in human prostate cancer (Pinto et al, 1996). Expression of this carboxy- peptidase enables cancer cells to hydrolyze methofrexate, yielding the cells resistant to methofrexate cancer therapy. Iiihibition of a human carboxypeptidase-like enzyme may therefore prove useful as a cancer therapeutic agent, either directly or in conjunction with another cancer therapy, such as methofrexate, that might be rendered ineffective by the carboxypeptidase-like activity.
In addition to cancer and lung diseases, carboxypeptidases may be associated with asthma and allergy. Basophils in the peripheral blood of patients with asthma or allergy were found to express carboxypeptidase A by immunohistochemistry, where- as peripheral blood basophils from normal individuals were found to contain little to no carboxypeptidase A (Li et al, 1998, J. Immunol. 161:5079). Because carboxypeptidases and related proteases regulate many biological processes, expression of carboxypeptidase A in circulating blood cells of patients with asthma or allergy indicates that carboxypeptidase A may contribute to the immune responses associ- ated with asthma or allergy. Compounds directed to human carboxypeptidase-like enzyme may therefore be useful in treatment of asthma or allergy.
Allergy is a complex process in which environmental antigens induce clinically adverse reactions. The inducing antigens, called allergens, typically elicit a specific IgE response and, although in most cases the allergens themselves have little or no intrinsic toxicity, they induce pathology when the IgE response in turn elicits an IgE-dependent or T cell-dependent hypersensitivity reaction. Hypersensitivity reactions can be local or systemic and typically occur within minutes of allergen exposure in individuals who have previously been sensitized to an allergen. The hypersensitivity reaction of allergy develops when the allergen is recognized by IgE antibodies bound to specific receptors on the surface of effector cells, such as mast cells, basophils, or eosinophils, which causes the activation of the effector cells and the release of mediators that produce the acute signs and symptoms of the reactions. Allergic diseases include asthma, allergic rhinitis (hay fever), atopic dermatitis, and anaphylaxis. Asthma is thought to arise as a result of interactions between multiple genetic and environmental factors and is characterized by three major features: 1) intermittent and reversible airway obstruction caused by bronchoconstriction, increased mucus production, and thickening of the walls of the airways that leads to a naπowing of the airways, 2) airway hypeπesponsiveness caused by a decreased control of airway caliber, and 3) airway inflammation. Certain cells are critical to the inflammatory reaction of asthma and they include T cells and antigen presenting cells, B cells that produce IgE, and mast cells, basophils, eosinophils, and other cells that bind IgE. These effector cells accumulate at the site of allergic reaction in the airways and release toxic products that contribute to the acute pathology and eventually to the tissue destruction related to the disorder. Other resident cells, such as smooth muscle cells, lung epithelial cells, mucus-producing cells, and nerve cells may also be abnormal in individuals with asthma and may contribute to the pathology. While the airway obstruction of asthma, presenting clinically as an intermittent wheeze and shortness of breath, is generally the most pressing symptom of the disease requiring immediate treatment, the inflammation and tissue destruction associated with the disease can lead to irreversible changes that eventually make asthma a chronic disabling disorder requiring long-term management.
Despite recent important advances in our understanding of the pathophysiology of asthma, the disease appears to be increasing in prevalence and severity (Gergen and Weiss, Am. Rev. Respir. Dis. 146, 823-24, 1992). It is estimated that 30-40% of the population suffer with atopic allergy, and 15% of children and 5% of adults in the population suffer from asthma (Gergen and Weiss, 1992). Thus, an enormous burden is placed on our health care resources. However, both diagnosis and treatment of asthma are difficult. The severity of lung tissue inflammation is not easy to measure and the symptoms of the disease are often indistinguishable from those of respiratory infections, chronic respiratory inflammatory disorders, allergic rhinitis, or other respiratory disorders. Often, the inciting allergen cannot be determined, making removal of the causative environmental agent difficult. Cuπent pharmacological treatments suffer their own set of disadvantages. Commonly used therapeutic agents, such as beta agonists, can act as symptom relievers to transiently improve pulmonary function, but do not affect the underlying inflammation. Agents that can reduce the underlying inflammation, such as anti-inflammatory steroids, can have major drawbacks that range from immunosuppression to bone loss (Goodman and Oilman's THE PHARMACOLOGIC BASIS OF THERAPEUTICS, Seventh Edition, MacMillan
Publishing Company, NY, USA, 1985). In addition, many of the present therapies, such as inhaled corticosteroids, are short-lasting, inconvenient to use, and must be used often on a regular basis, in some cases for life, making failure of patients to comply with the treatment a major problem and thereby reducing their effectiveness as a treatment.
Because of the problems associated with conventional therapies, alternative treatment strategies have been evaluated. Glycophorin A (Chu and Sharom, Cell. Immunol. 145, 223-39, 1992), cyclosporin (Alexander et al, Lancet 339, 324-28, 1992), and a nonapeptide fragment of IL-2 (Zav'yalov et al, Immunol. Lett. 31, 285-88, 1992) all inhibit interleukin-2 dependent T lymphocyte proliferation; however, they are known to have many other effects. For example, cyclosporin is used as a immunosuppres- sant after organ transplantation. While these agents may represent alternatives to steroids in the treatment of asthmatics, they inhibit interleukin-2 dependent T lymphocyte proliferation and potentially critical immune functions associated with homeostasis. Other treatments that block the release or activity of mediators of bronchochonstriction, such as cromones or anti-leukotrienes, have recently been introduced for the treatment of mild asthma, but they are expensive and not effective in all patients and it is unclear whether they have any effect on the chronic changes associated with asthmatic inflammation. What is needed in the art is the identification of a treatment that can act in pathways critical to the development of asthma that both blocks the episodic attacks of the disorder and preferentially dampens the hyperactive allergic immune response without immunocompromising the patient.
This invention further pertains to the use of novel agents identified by the screening assays described above. Accordingly, it is within the scope of this invention to use a test compound identified as described herein in an appropriate animal model. For example, an agent identified as described herein (e.g., a modulating agent, an anti- sense nucleic acid molecule, a specific antibody, ribozyme, or a carboxypeptidase-like enzyme polypeptide binding molecule) can be used in an animal model to determine the efficacy, toxicity, or side effects of treatment with such an agent. Alternatively, an agent identified as described herein can be used in an animal model to determine the mechanism of action of such an agent. Furthermore, this invention pertains to uses of novel agents identified by the above described screening assays for treatments as described herein.
A reagent which affects carboxypeptidase-like enzyme activity can be administered to a human cell, either in vitro or in vivo, to reduce carboxypeptidase-like enzyme activity. The reagent preferably binds to an expression product of a human carboxypeptidase-like enzyme gene. If the expression product is a protein, the reagent is preferably an antibody. For treatment of human cells ex vivo, an antibody can be added to a preparation of stem cells which have been removed from the body. The cells can then be replaced in the same or another human body, with or without clonal propagation, as is known in the art.
In one embodiment, the reagent is delivered using a hposome. Preferably, the liposome is stable in the animal into which it has been administered for at least about 30 minutes, more preferably for at least about 1 hour, and even more preferably for at least about 24 hours. A liposome comprises a lipid composition that is capable of targeting a reagent, particularly a polynucleotide, to a particular site in an animal, such as a human. Preferably, the hpid composition of the hposome is capable of targeting to a specific organ of an animal, such as the lung, liver, spleen, heart brain, lymph nodes, and skin.
A liposome useful in the present invention comprises a hpid composition that is capable of fusing with the plasma membrane of the targeted cell to deliver its contents to the cell. Preferably, the transfection efficiency of a liposome is about 0.5 μg of DNA per 16 nmole of liposome delivered to about 106 cells, more preferably about 1.0 μg of DNA per 16 nmole of liposome delivered to about 106 cells, and even more preferably about 2.0 μg of DNA per 16 nmol of liposome delivered to about 106 cells. Preferably, a liposome is between about 100 and 500 nm, more preferably between about 150 and 450 nm, and even more preferably between about 200 and 400 nm in diameter.
Suitable liposomes for use in the present invention include those liposomes standardly used in, for example, gene delivery methods known to those of skill in the art. More preferred liposomes include liposomes having a polycationic lipid composition and/or liposomes having a cholesterol backbone conjugated to polyethylene glycol. Optionally, a liposome comprises a compound capable of targeting the liposome to a particular cell type, such as a cell-specific ligand exposed on the outer surface of the liposome.
Complexing a liposome with a reagent such as an antisense oligonucleotide or ribozyme can be achieved using methods which are standard in the art (see, for example, U.S. Patent 5,705,151). Preferably, from about 0.1 μg to about 10 μg of polynucleotide is combined with about 8 nmol of liposomes, more preferably from about 0.5 μg to about 5 μg of polynucleotides are combined with about 8 nmol liposomes, and even more preferably about 1.0 μg of polynucleotides is combined with about 8 nmol liposomes.
In another embodiment, antibodies can be delivered to specific tissues in vivo using receptor-mediated targeted delivery. Receptor-mediated DNA delivery techniques are taught in, for example, Findeis et al. Trends in Biotechnol 11, 202-05 (1993);
Chiou et al, GENE THERAPEUTICS: METHODS AND APPLICAΉONS OF DIRECT GENE
TRANSFER (J.A. Wolff, ed.) (1994); Wu & Wu, J. Biol Chem. 263, 621-24 (1988);
Wu et al, J. Biol. Chem. 269, 542-46 (1994); Zenke et al, Proc. Natl. Acad. Sci. U.S.A. 87, 3655-59 (1990); Wu et al, J. Biol. Chem. 266, 338-42 (1991). Determination of a Therapeutically Effective Dose
The determination of a therapeutically effective dose is well within the capability of those skilled in the art. A therapeutically effective dose refers to that amount of active ingredient which increases or decreases carboxypeptidase-like enzyme activity relative to the carboxypeptidase-like enzyme activity which occurs in the absence of the therapeutically effective dose.
For any compound, the therapeutically effective dose can be estimated initially either in cell culture assays or in animal models, usually mice, rabbits, dogs, or pigs. The animal model also can be used to determine the appropriate concentration range and route of administration. Such information can then be used to determine useful doses and routes for administration in humans.
Therapeutic efficacy and toxicity, e.g., ED50 (the dose therapeutically effective in
50% of the population) and LD50 (the dose lethal to 50% of the population), can be determined by standard pharmaceutical procedures in cell cultures or experimental animals. The dose ratio of toxic to therapeutic effects is the therapeutic index, and it can be expressed as the ratio, LD50/ED50.
Pharmaceutical compositions which exhibit large therapeutic indices are prefeπed. The data obtained from cell culture assays and animal studies is used in formulating a range of dosage for human use. The dosage contained in such compositions is preferably within a range of circulating concentrations that include the EDs0 with little or no toxicity. The dosage varies within this range depending upon the dosage form employed, sensitivity of the patient, and the route of administration.
The exact dosage will be determined by the practitioner, in light of factors related to the subject that requires treatment. Dosage and administration are adjusted to provide sufficient levels of the active ingredient or to maintain the desired effect.
Factors which can be taken into account include the severity of the disease state, general health of the subject, age, weight, and gender of the subject, diet, time and frequency of administration, drug combination(s), reaction sensitivities, and tolerance/response to therapy. Long-acting pharmaceutical compositions can be administered every 3 to 4 days, every week, or once every two weeks depending on the half-life and clearance rate of the particular formulation.
Normal dosage amounts can vary from 0.1 to 100,000 micrograms, up to a total dose of about 1 g, depending upon the route of administration. Guidance as to particular dosages and methods of delivery is provided in the literature and generally available to practitioners in the art. Those skilled in the art will employ different formulations for nucleotides than for proteins or their inhibitors. Similarly, delivery of polynucleotides or polypeptides will be specific to particular cells, conditions, locations, etc.
If the reagent is a single-chain antibody, polynucleotides encoding the antibody can be constructed and introduced into a cell either, ex vivo or in vivo using well- established techniques including, but not limited to, fransferrin-polycation-mediated DNA transfer, fransfection with naked or encapsulated nucleic acids, liposome-mediated cellular fusion, intracellular transportation of DNA-coated latex beads, protoplast fusion, viral infection, electroporation, "gene gun,o and DEAE- or calcium phosphate-mediated fransfection.
Effective in vivo dosages of an antibody are in the range of about 5 μg to about 50 μg/kg, about 50 μg to about 5 mg kg, about 100 μg to about 500 μg/kg of patient body weight, and about 200 to about 250 μg/kg of patient body weight. For administration of polynucleotides encoding single-chain antibodies, effective in vivo dosages are in the range of about 100 ng to about 200 ng, 500 ng to about 50 mg, about 1 μg to about 2 mg, about 5 μg to about 500 μg, and about 20 μg to about 100 μg of DNA. If the expression product is mRNA, the reagent is preferably an antisense oligonucleotide or a ribozyme. Polynucleotides which express antisense oligonucleotides or ribozymes can be introduced into cells by a variety of methods, as described above.
Preferably, a reagent reduces expression of a carboxypeptidase-like enzyme gene or the activity of a carboxypeptidase-like enzyme polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% relative to the absence of the reagent. The effectiveness of the mechanism chosen to decrease the level of expression of a carboxypeptidase-like enzyme gene or the activity of a carboxypeptidase-like enzyme polypeptide can be assessed using methods well known in the art, such as hybridization of nucleotide probes to carboxypeptidase-like enzyme-specific mRNA, quantitative RT-PCR, immunologic detection of a carboxypeptidase-like enzyme polypeptide, or measurement of carboxypeptidase-like enzyme activity.
In any of the embodiments described above, any of the pharmaceutical compositions of the invention can be administered in combination with other appropriate therapeutic agents. Selection of the appropriate agents for use in combination therapy can be made by one of ordinary skill in the art, according to conventional pharmaceutical principles. The combination of therapeutic agents can act synergistically to effect the treatment or prevention of the various disorders described above. Using this approach, one may be able to achieve therapeutic efficacy with lower dosages of each agent, thus reducing the potential for adverse side effects.
Any of the therapeutic methods described above can be applied to any subject in need of such therapy, including, for example, mammals such as dogs, cats, cows, horses, rabbits, monkeys, and most preferably, humans. Diagnostic Methods
Human carboxypeptidase-like enzyme also can be used in diagnostic assays for detecting diseases and abnormalities or susceptibility to diseases and abnormalities related to the presence of mutations in the nucleic acid sequences which encode the enzyme. For example, differences can be determined between the cDNA or genomic sequence encoding carboxypeptidase-like enzyme in individuals afflicted with a disease and in normal individuals. If a mutation is observed in some or all of the afflicted individuals but not in normal individuals, then the mutation is likely to be the causative agent of the disease.
Sequence differences between a reference gene and a gene having mutations can be revealed by the direct DNA sequencing method. In addition, cloned DNA segments can be employed as probes to detect specific DNA segments. The sensitivity of this method is greatly enhanced when combined with PCR. For example, a sequencing primer can be used with a double-stranded PCR product or a single-stranded template molecule generated by a modified PCR. The sequence determination is performed by conventional procedures using radiolabeled nucleotides or by automatic sequencing procedures using fluorescent tags.
Genetic testing based on DNA sequence differences can be carried out by detection of alteration in electrophoretic mobility of DNA fragments in gels with or without denaturing agents. Small sequence deletions and insertions can be visualized, for example, by high resolution gel electrophoresis. DNA fragments of different sequences can be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific melting or partial melting temperatures (see, e.g., Myers et al., Science 230, 1242, 1985). Sequence changes at specific locations can also be revealed by nuclease protection assays, such as RNase and S 1 protection or the chemical cleavage method (e.g., Cotton et al, Proc. Natl. Acad. Sci. USA
43974401, 1985). Thus, the detection of a specific DNA sequence can be pe" by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes and Southern blotting of genomic DNA. In addition to direct methods such as gel electrophoresis and DNA sequencing, mutations can also be detected by in situ analysis.
Altered levels of a carboxypeptidase-like enzyme also can be detected in various tissues. Assays used to detect levels of the receptor polypeptides in a body sample, such as blood or a tissue biopsy, derived from a host are well known to those of skill in the art and include radioimmunoassays, competitive binding assays, Western blot analysis, and ELISA assays.
All patents and patent applications cited in this disclosure are expressly incorporated herein by reference. The above disclosure generally describes the present invention. A more complete understanding can be obtained by reference to the following specific examples which are provided for purposes of illustration only and are not intended to limit the scope of the invention.
EXAMPLE 1
Detection of carboxypeptidase-like enzyme activity
The polynucleotide of SEQ ID NO: 23 is inserted into the expression vector pCEV4 and the expression vector pCEV4-carboxypeptidase-like enzyme polypeptide obtained is transfected into human embryonic kidney 293 cells. From these cells extracts are obtained and the carboxypeptidase-like enzyme activity is measured according to the o-phthaldialdehyde [OP A] method which is based on detection of a free amino group. At 25°C, 50 μl of the cell extract is added to 1 ml of a 0,5 mM carbobenzoxy (Z)-Ala-Glu solution in 20 mM sodium acetate buffer (pH 4,5). The release of free glutamic acid is monitored by using OP A and dithiothreitol (18). One unit of activity is defined as the quantity of enzyme which liberated 1 μmol of glutamic acid per min under the conditions described above for the second method. It is shown that the polypeptide of SEQ ID NO: 24 has a carboxypeptidase-like enzyme activity
EXAMPLE 2
Expression of recombinant human carboxypeptidase-like enzyme
The Pichia pastoris expression vector pPICZB (Invitrogen, San Diego, CA) is used to produce large quantities of recombinant human carboxypeptidase-like polypeptides in yeast. The carboxypeptidase-like enzyme-encoding DNA sequence is derived from SEQ ID NO:23. Before insertion into vector pPICZB, the DNA sequence is modified by well known methods in such a way that it contains at its 5' end an imtiation codon and at its 3' end an enterokinase cleavage site, a His6 reporter tag and a termination codon. Moreover, at both termini recognition sequences for restriction endonucleases are added and after digestion of the multiple cloning site of pPICZ B with the coπesponding restriction enzymes the modified DNA sequence is ligated into pPICZB. This expression vector is designed for inducible expression in Pichia pastoris, driven by a yeast promoter. The resulting pPICZ/mdHis6 vector is used to transform the yeast.
The yeast is cultivated under usual conditions in 5 liter shake flasks and the re- combinantly produced protein isolated from the culture by affinity chromatography
(NiNTAResin) in the presence of 8 M urea. The bound polypeptide is eluted with buffer, pH 3.5, and neutralized. Separation of the polypeptide from the His6 reporter tag is accomplished by site-specific proteolysis using enterokinase (Invitrogen, San Diego, CA) according to manufacturer's instructions. Purified human carboxypeptidase-like enzyme polypeptide is obtained.
EXAMPLE 3
Identification of test compounds that bind to carboxypeptidase-like enzyme polypeptides
Purified carboxypeptidase-like enzyme polypeptides comprising a glutathione- S-transferase protein and absorbed onto glutathione-derivatized wells of 96-well microtiter plates are contacted with test compounds from a small molecule library at pH 7.0 in a physiological buffer solution. Carboxypeptidase-like enzyme polypeptides comprise the amino acid sequence shown in SEQ ID NO:24. The test compounds comprise a fluorescent tag. The samples are incubated for 5 minutes to one hour. Control samples are incubated in the absence of a test compound.
The buffer solution containing the test compounds is washed from the wells.
Binding of a test compound to a carboxypeptidase-like enzyme polypeptide is detected by fluorescence measurements of the contents of the wells. A test compound which increases the fluorescence in a well by at least 15% relative to fluorescence of a well in which a test compound is not incubated is identified as a compound which binds to a carboxypeptidase-like enzyme polypeptide. EXAMPLE 4
Identification of a test compound which decreases carboxypeptidase-like enzyme gene expression
A test compound is administered to a culture of human cells transfected with a carboxypeptidase-like enzyme expression construct and incubated at 37°C for 10 to 45 minutes. A culture of the same type of cells which have not been transfected is incubated for the same time without the test compound to provide a negative control.
RNA is isolated from the two cultures as described in Chirgwin et al, Biochem. 18, 5294-99, 1979). Northern blots are prepared using 20 to 30 μg total RNA and hybridized with a 32P-labeled carboxypeptidase-like enzyme-specific probe at 65°C in Express-hyb (CLONTECH). The probe comprises at least 11 contiguous nucleotides selected from the complement of SEQ ID NO:23. A test compound which decreases the carboxypeptidase-like enzyme-specific signal relative to the signal obtained in the absence of the test compound is identified as an inhibitor of carboxypeptidase-like enzyme gene expression.
EXAMPLE 5
Expression of a carboxypeptidase enzyme is induced during terminal differentiation of a prostate cancer cell line
Studies of terminal differentiation in a cancer line indicate that induction of expression of human carboxypeptidase-like enzyme may be useful for treatment of cancer. Exposure of several cultured prostate cancer cell lines, including PC-3 cells, with sodium butyrate causes the cells to undergo terminal differentiation and apoptosis (Huang et al, 1999, Cancer Res. 59, 2981-8). These effects by sodium butyrate are accompanied by induction of increased expression of a cDNA that has been identified as carboxypeptidase A3, based on its amino acid similarity to both eukaryotic and bacterial zinc carboxypeptidases. The increased expression of a carboxypeptidase enzyme that consistently occurs in terminally differentiated prostate cancers cells in vitro suggests that the increased carboxypeptidase expression may be instrumental in causing aπest of cancerous cell growth in vivo. Compounds that induce expression of human carboxypeptidase-like enzyme thus may prove beneficial in the treatment of prostate and other cancers.
EXAMPLE 6
Tissue-specific expression of human carboxypeptidase-like enzyme gene.
As a first step to establishing a role for human carboxypeptidase-like enzyme in the pathogenesis of COPD, expression profiling of the gene was done using real-time quantitative PCR (TaqMan) with RNA samples isolated from a wide range of human cells and tissues. Total RNA samples were either purchased from commercial suppliers or purified in-house. Two panels of RNAs were used for profiling: a whole body organ panel (Table 1) and a respiratory specific panel (Table 2).
Real-time quantitative PCR. This technique is a development of the kinetic analysis of PCR first described by Higuchi et al. (BioTechnology 10, 413-17, 1992;
BioTechnology 11, 1026-30, 1993). The principle is that at any given cycle within the exponential phase of PCR, the amount of product is proportional to the initial number of template copies. PCR amplification is performed in the presence of an oligonucleotide probe (TaqMan probe) that is complementary to the target sequence and labeled with a fluorescent reporter dye and a quencher dye. During the extension phase of PCR, the probe is cleaved by the 5 '-3' endonuclease activity of Taq DNA polymerase, releasing the fluorophore from the effect of the quenching dye (Holland et al, Proc. Natl. Acad. Sci. U.S.A. 88, 7276-80, 1991). Because the fluorescence emission increases in direct proportion to the amount of the specific amphfied product, the exponential growth phase of PCR product can be detected and used to determine the initial template concentration (Heid et al, Genome Res. 6, 986-94, 1996, and Gibson et al, Genome Res. 6, 995-1001, 1996).
RNA extraction and cDNA preparation. Total RNA from each of the 'in-house' samples listed in Table 2 was isolated using Qiagen's (Crawley, West Sussex, UK)
RNeasy system according to the manufacturer's protocol. The concentration of purified RNA was determined using RiboGreen RNA quantitation kit (Molecular Probes Europe, The Netherlands). RNA concentrations of the samples purchased from commercial suppliers were also determined using RiboGreen. For the preparation of cDNA, lμg of total RNA was reverse transcribed using 200U of
SUPERSCRIPT™ II RNaseH" Reverse Transcriptase (Life Technologies, Paisley, UK), lOmM dithiothreitol, 0.5mM of each dNTP, and 5μM random hexamers (PE Applied Biosystems, Warrington, Cheshire, UK) in a final volume of 20μl according to the manufacturer's protocol. TaqMan quantitative analysis. Specific primers and probe were designed according to the recommendations of PE Applied Biosystems and are listed below:
Forward primer: 5'- CCAGGAAGGTGGTTGGCA -3' Reverse primer: 5'- CTCGCCGACGACTTCAGG -3' Probe: 5'-(FAM TTCTCCATCAGGCTCGTGCCGAAC -3' where FAM = 6-carboxy-fluorescein.
Quantitative PCR was performed with lOng of reverse transcribed RNA from each sample. Each determination was done in duplicate.
The assay reaction mix was as follows: IX final TaqMan Universal PCR Master Mix (from 2X stock) (PE Applied Biosystems, CA); 900 nM forward primer; 900 nM reverse primer; 200 nM probe; 10 ng cDNA; and water to 25 μl.
Each of the following steps were carried out once: pre PCR, 2 minutes at 50°C, and
10 minutes at 95°C. The following steps were carried out 40 times: denaturation, 15 seconds at 95°C, annealing/extension, 1 minute at 60°C.
Real-time quantitative PCR was done using an ABI Prism 7700 Sequence Detector. The CT value generated for each reaction was used to determine the initial template concentration (copy number) by interpolation from a universal standard curve. The level of expression of the target gene in each sample was calculated relative to the sample with the lowest expression of the gene.
The relative expression of carboxypeptidase-like enzyme gene across various human tissues is shown in FIG. 32. The gene was highly expressed in kidney but it was also abundantly expressed in all of the other tissues tested. Of particular interest was the expression of carboxypeptidase-like enzyme gene in lung and this was investigated further by analysing the expression of the gene in some of the constituent cell types of the lung. In these samples, expression was detected predominantly in airway epithelial cells and was particularly high in the Clara-like cell line H441 and cultured bronchial and small airway epithelial cells (FIG. 33). Abundant expression was also detected in cultured airway smooth muscle cells and in cultured alveolar type II cells. Although expression of the gene in inflammatory cell types was much lower than that seen in the epithelial cells, it was, nevertheless, readily detected (FIG. 33).
Although the function of carboxypeptidase-like enzyme in lung is not known, it is likely involved in the regulation of biologically active peptides and proteins. It may also have a role in tissue remodelling and it is possible that dysfunction or dysregulation of the protease could play a significant role in the destruction of the lung matrix in diseases such as COPD. Carboxypeptidase-like enzyme, therefore, represents a potential therapeutic target for COPD. Table 1 Human organ RNA panel used for real-time quantitative PCR.
All samples were obtained from Clontech UK Ltd, Basingstoke, UK.
Figure imgf000071_0001
Table 2: Human respiratory specific RNA panel used for real-time quantitative PCR.
Figure imgf000072_0001

Claims

1. An isolated polynucleotide encoding a carboxypeptidase-like enzyme polypeptide and being selected from the group consisting of:
a) a polynucleotide encoding a carboxypeptidase-like enzyme polypeptide comprising an amino acid sequence selected form the group consisting of:
amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO: 24; and the amino acid sequence shown in SEQ ID NO: 24.
b) a polynucleotide comprising the sequence of SEQ ID NO: 23;
c) a polynucleotide which hybridizes under stringent conditions to a polynucleotide specified in (a) and (b);
d) a polynucleotide the sequence of which deviates from the poly- nucleotide sequences specified in (a) to (c) due to the degeneration of the genetic code; and
e) a polynucleotide which represents a fragment, derivative or allelic variation of a polynucleotide sequence specified in (a) to (d).
2. An expression vector containing any polynucleotide of claim 1.
3. A host cell containing the expression vector of claim 2.
4. A substantially purified carboxypeptidase-like enzyme polypeptide encoded by a polynucleotide of claim 1.
5. A method for producing a carboxypeptidase-like enzyme polypeptide, wherein the method comprises the following steps:
a) culturing the host cell of claim 3 under conditions suitable for the expression of the carboxypeptidase-like enzyme polypeptide; and
b) recovering the carboxypeptidase-like enzyme polypeptide from the host cell culture.
6. A method for detection of a polynucleotide encoding a carboxypeptidase-like enzyme polypeptide in a biological sample comprising the following steps:
a) hybridizing any polynucleotide of claim 1 to a nucleic acid material of a biological sample, thereby forming a hybridization complex; and
b) detecting said hybridization complex.
7. The method of claim 6, wherein before hybridization, the nucleic acid material of the biological sample is amplified.
8. A method for the detection of a polynucleotide of claim 1 or a carboxypeptidase-like enzyme polypeptide of claim 4 comprising the steps of:
contacting a biological sample with a reagent which specifically interacts with the polynucleotide or the carboxypeptidase-hke enzyme polypeptide.
9. A diagnostic kit for conducting the method of any one of claims 6 to 8.
10. A method of screening for agents which decrease the activity of a carboxypeptidase-like enzyme, comprising the steps of: contacting a test compound with any carboxypeptidase-like enzyme polypeptide encoded by any polynucleotide of claiml;
detecting binding of the test compound to the carboxypeptidase-like enzyme polypeptide, wherein a test compound which binds to the polypeptide is identified as a potential therapeutic agent for decreasing the activity of a carboxypeptidase-like enzyme.
11. A method of screening for agents which regulate the activity of a carboxypeptidase-like enzyme, comprising the steps of:
contacting a test compound with a carboxypeptidase-like enzyme polypeptide encoded by any polynucleotide of claim 1; and
detecting a carboxypeptidase-like enzyme activity of the polypeptide, wherein a test compound which increases the carboxypeptidase-like enzyme activity is identified as a potential therapeutic agent for increasing the activity of the carboxypeptidase-like enzyme, and wherein a test compound which decreases the carboxypeptidase-like enzyme activity of the polypeptide is identified as a potential therapeutic agent for decreasing the activity of the carboxypeptidase-like enzyme.
12. A method of screening for agents which decrease the activity of a carboxypeptidase-like enzyme, comprising the steps of:
contacting a test compound with any polynucleotide of claim 1 and detecting binding of the test compound to the polynucleotide, wherein a test compound which binds to the polynucleotide is identified as a potential therapeutic agent for decreasing the activity of carboxypeptidase-like enzyme.
13. A method of reducing the activity of carboxypeptidase-like enzyme, comprising the steps of:
contacting a cell with a reagent which specifically binds to any poly- nucleotide of claim 1 or any carboxypeptidase-like enzyme polypeptide of claim 4, whereby the activity of carboxypeptidase-like enzyme is reduced.
14. A reagent that modulates the activity of a carboxypeptidase-like enzyme polypeptide or a polynucleotide wherein said reagent is identified by the method of any of the claim 10 to 12.
15. A pharmaceutical composition, comprising: the expression vector of claim 2 or the reagent of claim 14 and a pharmaceutically acceptable carrier.
16. Use of the pharmaceutical composition of claim 15 for modulating the activity of a carboxypeptidase-like enzyme in a disease.
17. Use of claim 16 wherein the disease is COPD, cancer, asthma and allergy.
18. A cDNA encoding a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 24.
19. The cDNA of claim 18 which comprises SEQ ID NO: 23.
20. The cDNA of claim 18 which consists of SEQ ID NO: 23.
21. An expression vector comprising a polynucleotide which encodes a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 24.
22. The expression vector of claim 21 wherein the polynucleotide consists of SEQ ID NO: 23.
23. A host cell comprising an expression vector which encodes a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 24.
24. The host cell of claim 23 wherein the polynucleotide consists of SEQ ID NO:
23.
25. A purified polypeptide comprising the amino acid sequence shown in SEQ ID
NO: 24.
26. The purified polypeptide of claim 25 which consists of the amino acid sequence shown in SEQ ID NO: 24.
27. A fusion protein comprising a polypeptide having the amino acid sequence shown in SEQ ID NO: 24.
28. A method of producing a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 24, comprising the steps of:
culturing a host cell comprising an expression vector which encodes the polypeptide under conditions whereby the polypeptide is expressed; and
isolating the polypeptide.
29. The method of claim 28 wherein the expression vector comprises SEQ ID NO: 23.
30. A method of detecting a coding sequence for a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 24, comprising the steps of: hybridizing a polynucleotide comprising 11 contiguous nucleotides of SEQ ID NO: 23 to nucleic acid material of a biological sample, thereby forming a hybridization complex; and
detecting the hybridization complex.
31. The method of claim 30 further comprising the step of amplifying the nucleic acid material before the step of hybridizing.
32. A kit for detecting a coding sequence for a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 24, comprising:
a polynucleotide comprising 11 contiguous nucleotides of SEQ ID NO: 23; and instructions for the method of claim 30.
33. A method of detecting a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 24, comprising the steps of:
contacting a biological sample with a reagent that specifically binds to the polypeptide to form a reagent-polypeptide complex; and
detecting the reagent-polypeptide complex.
34. The method of claim 33 wherein the reagent is an antibody.
35. A kit for detecting a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 24, comprising:
an antibody which specifically binds to the polypeptide; and instructions for the method of claim 33.
36. A method of screening for agents which can modulate the activity of a human carboxypeptidase-like enzyme, comprising the steps of:
contacting a test compound with a polypeptide comprising an amino acid sequence selected from the group consisting of: (1) amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO: 24 and (2) the amino acid sequence shown in SEQ ID NO: 24; and detecting binding of the test compound to the polypeptide, wherein a test compound which binds to the polypeptide is identified as a potential agent for regulating activity of the human carboxypeptidase-like enzyme.
37. The method of claim 36 wherein the step of contacting is in a cell.
38. The method of claim 36 wherein the cell is in vitro.
39. The method of claim 36 wherein the step of contacting is in a cell-free system.
40. The method of claim 36 wherein the polypeptide comprises a detectable label.
41. The method of claim 36 wherein the test compound comprises a detectable label.
42. The method of claim 36 wherein the test compound displaces a labeled ligand which is bound to the polypeptide.
43. The method of claim 36 wherein the polypeptide is bound to a solid support.
44. The method of claim 36 wherein the test compound is bound to a solid support.
45. A method of screening for agents which modulate an activity of a human carboxypeptidase-like enzyme, comprising the steps of:
contacting a test compound with a polypeptide comprising an amino acid sequence selected from the group consisting of: (1) amino acid sequences which are at least about 50% identical to the amino acid sequence shown in
SEQ ID NO: 24 and (2) the amino acid sequence shown in SEQ ID NO: 24; and detecting an activity of the polypeptide, wherein a test compound which increases the activity of the polypeptide is identified as a potential agent for increasing the activity of the human carboxypeptidase-like enzyme, and wherein a test compound which decreases the activity of the polypeptide is identified as a potential agent for decreasing the activity of the human carboxypeptidase-like enzyme.
46. The method of claim 45 wherein the step of contacting is in a cell.
47. The method of claim 45 wherein the cell is in vitro.
48. The method of claim 45 wherein the step of contacting is in a cell-free system.
49. A method of screening for agents which modulate an activity of a human carboxypeptidase-like enzyme, comprising the steps of:
contacting a test compound with a product encoded by a polynucleotide which comprises the nucleotide sequence shown in SEQ ID NO: 23; and detecting binding of the test compound to the product, wherein a test compound which binds to the product is identified as a potential agent for regulating the activity of the human carboxypeptidase-like enzyme.
50. The method of claim 49 wherein the product is a polypeptide.
51. The method of claim 49 wherein the product is RNA.
52. A method of reducing activity of a human carboxypeptidase-like enzyme, comprising the step of:
contacting a cell with a reagent which specifically binds to a product encoded by a polynucleotide comprising the nucleotide sequence shown in SEQ ID NO: 23, whereby the activity of a human carboxypeptidase-like enzyme is reduced.
53. The method of claim 52 wherein the product is a polypeptide.
54. The method of claim 53 wherein the reagent is an antibody.
55. The method of claim 52 wherein the product is RNA.
56. The method of claim 55 wherein the reagent is an antisense oligonucleotide.
57. The method of claim 56 wherein the reagent is a ribozyme.
58. The method of claim 52 wherein the cell is in vitro.
59. The method of claim 52 wherein the cell is in vivo.
60. A pharmaceutical composition, comprising:
a reagent which specifically binds to a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 24; and
a pharmaceutically acceptable carrier.
61. The pharmaceutical composition of claim 60 wherein the reagent is an antibody.
62. A pharmaceutical composition, comprising:
a reagent which specifically binds to a product of a polynucleotide comprising the nucleotide sequence shown in SEQ ID NO: 23; and
a pharmaceutically acceptable carrier.
63. The pharmaceutical composition of claim 62 wherein the reagent is a ribozyme.
64. The pharmaceutical composition of claim 62 wherein the reagent is an antisense oligonucleotide.
65. The pharmaceutical composition of claim 62 wherein the reagent is an antibody.
66. A pharmaceutical composition, comprising:
an expression vector encoding a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 24; and a pharmaceutically acceptable carrier.
67. The pharmaceutical composition of claim 66 wherein the expression vector comprises SEQ ID NO: 23.
68. A method of treating a carboxypeptidase-like enzyme disfunction related disease, wherein the disease is selected from COPD, cancer, asthma and allergy, comprising the step of:
administering to a patient in need thereof a therapeutically effective dose of a reagent that modulates a function of a human carboxypeptidase-like enzyme, whereby symptoms of the carboxypeptidase-like enzyme disfunction related disease are ameliorated.
69. The method of claim 68 wherein the reagent is identified by the method of claim 36.
70. The method of claim 68 wherein the reagent is identified by the method of claim 45.
71. The method of claim 68 wherein the reagent is identified by the method of claim 49.
PCT/EP2001/010203 2000-09-11 2001-09-05 Regulation of human carboxypeptidase-like enzyme WO2002020805A2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2002218160A AU2002218160A1 (en) 2000-09-11 2001-09-05 Regulation of human carboxypeptidase-like enzyme

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US23154600P 2000-09-11 2000-09-11
US60/231,546 2000-09-11

Publications (2)

Publication Number Publication Date
WO2002020805A2 true WO2002020805A2 (en) 2002-03-14
WO2002020805A3 WO2002020805A3 (en) 2002-09-19

Family

ID=22869683

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2001/010203 WO2002020805A2 (en) 2000-09-11 2001-09-05 Regulation of human carboxypeptidase-like enzyme

Country Status (2)

Country Link
AU (1) AU2002218160A1 (en)
WO (1) WO2002020805A2 (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998044128A1 (en) * 1997-03-31 1998-10-08 Incyte Pharmaceuticals, Inc. Novel human serine carboxypeptidase
WO2000055350A1 (en) * 1999-03-12 2000-09-21 Human Genome Sciences, Inc. Human cancer associated gene sequences and polypeptides
EP1122307A1 (en) * 2000-02-04 2001-08-08 Sanofi-Synthelabo Human carnosinase 2
WO2001083782A2 (en) * 2000-05-04 2001-11-08 Sugen, Inc. Novel proteases

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998044128A1 (en) * 1997-03-31 1998-10-08 Incyte Pharmaceuticals, Inc. Novel human serine carboxypeptidase
WO2000055350A1 (en) * 1999-03-12 2000-09-21 Human Genome Sciences, Inc. Human cancer associated gene sequences and polypeptides
EP1122307A1 (en) * 2000-02-04 2001-08-08 Sanofi-Synthelabo Human carnosinase 2
WO2001083782A2 (en) * 2000-05-04 2001-11-08 Sugen, Inc. Novel proteases

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DATABASE EM_HUM [Online] EMBL; 22 February 2000 (2000-02-22) ISOGAI ET AL.: "Homo sapiens cDNA FLJ10830 fis, ...." retrieved from EBI, accession no. AK001692 Database accession no. AK001692 XP002200306 -& DATABASE SWALL [Online] 1 October 2000 (2000-10-01) ISOGAI ET AL.: "cDNA FLJ10830 fis, ...." retrieved from EBI, accession no. Q9NVB4 Database accession no. Q9NVB4 XP002200307 *
LI ET AL.: "Identification of basophilic cells that express mast cell granule proteases in the peripheral blood of asthma, allergy, and drug-reactive patients" THE JOURNAL OF IMMUNOLOGY, vol. 161, 1998, pages 5079-5086, XP002200305 cited in the application *

Also Published As

Publication number Publication date
WO2002020805A3 (en) 2002-09-19
AU2002218160A1 (en) 2002-03-22

Similar Documents

Publication Publication Date Title
US6734006B2 (en) Regulation of human transmembrane serine protease
WO2002004610A2 (en) Regulation of human dipeptidyl-peptidase iv-like enzyme
US7060810B2 (en) Regulation of human eosinophil serine protease 1-like enzyme
US7192732B2 (en) Regulation of human caspase-1-like protease
US20040105853A1 (en) Regulation of human epithin-like serine-protease
US6821745B2 (en) Regulation of human pyroglutamyl peptidase-like enzyme
WO2002024927A2 (en) Regulation of human adam-ts 1 precursor-like protein
US20050170486A1 (en) Nucleic acids encoding human inositolpolyphosphate 5-phosphatase
WO2002020805A2 (en) Regulation of human carboxypeptidase-like enzyme
WO2002026996A2 (en) Regulation of human phosphatidylinositol-specific phospholipase c-like enzyme
WO2003016345A1 (en) Regulation of human regulator of g-protein signaling
WO2002040684A2 (en) Polynucleotide and polypeptide sequences of human purple acid phosphate
WO2002030969A2 (en) Regulation of human carboxylesterase-like enzyme
US20040091965A1 (en) Regulation of human adam-ts-like protein
WO2002074811A1 (en) Regulation of human carboxypeptidase inhibitor-like protein
WO2002024886A2 (en) Regulation of human serine protease
US20040115670A1 (en) Regulation of human carboxypeptidase a
WO2001085959A2 (en) Regulation of human lysostaphin-like protease
WO2002053714A2 (en) Regulation of human phosphatidylinositol-4-phosphate 5-kinase
WO2002026957A2 (en) Regulation of a human serine protease
EP1364028A2 (en) Regulation of human carboxypeptidase a
US20030049670A1 (en) Regulation of human leucine aminopeptidase-like enzyme
JP2004511244A (en) Regulation of human serine-threonine protein kinase
WO2002033097A2 (en) Regulation of human sulfotransferase
WO2002010404A2 (en) Regulation of human masp-like serine protease

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PH PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
AK Designated states

Kind code of ref document: A3

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PH PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase in:

Ref country code: JP