WO2002020775A1 - A novel polypeptide- cyclin-dependent kinase-cdk411 and the polynucleotide encoding said polypeptide - Google Patents

Abstract

The invention discloses a new plypeptide- cyclin-dependent kinase-CDK411, the polynucleotide encoding said polypeptide, and a process for producing the polypeptide by recombiannt DNA technology. It also discloses methods of applying the polypeptide for the treatment of various diseases, such as malignacy, hemopathy, development disorder, HIV infection, immune disorders, and inflammation. This invention also discloses antagonist against said polypeptide and thereof therapy uses. In addition, it refers to the use of said polynucleotide encoding this new cyclin-dependent kinase-CDK411.

Description

 A new polypeptide, cyclin-dependent kinase-CDK411, and a polynucleotide encoding the polypeptide TECHNICAL FIELD

 The present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide ~~ M-phase protein-dependent kinase-CDK411, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a method and application for preparing such polynucleotides and polypeptides. technical background

The cell cycle runs very orderly, following the order G1 → S → G2 → M. Mammals have a series of key regulatory sites in the cell cycle, such as: R sites (or restriction sites). They are regulatory pathways that act on the timing of cell cycle transitions, ensuring that key events in the cell cycle are completed with high accuracy. To enter the next phase of the cell through the control point, the cell must go through all phases before this phase, and also be controlled by a series of checkpoints. The regulatory tests such as: whether DNA replication has been completed before the cell mitosis, etc. Finally, a set of related kinases and cyclin-dependent kinases ensure that the control information of these checkpoints is complete. Once the cell completes a cycle, the active CDK phosphorylates key substrates, allowing the cell to pass through the regulatory point and enter the next phase of the cell. The formation of the cell cycle is due to the controlled activity of different CDKs. Known members of the CDK family are CDK1, CDK2, CDK3, CDK5, CDK6, and CDK7. CDK activity is regulated by inducing, inhibiting phosphorylation, and forming complexes with other proteins. CDK must bind to a set of regulatory subunits such as the corresponding cyclins, and in some protein kinases and phosphatases p80. ^{With the} participation of ^{d <: 25} , it is possible to show kinase activity after phosphorylation and dephosphorylation. [Ni gg (1993) Trends Ce ll Bio l. 3: 296].

 The cyclin-dependent kinase-CDK4 gene cloned by Draet ta et al. In 1994 is a new member of the CDK family. CDK4 specifically binds to D-type (Dl, D2, D3) cyclin to form an active state heterodimer complex holoenzyme with protein kinase activity, cyclin is a regulatory subunit, and CDK is a catalytic subunit By phosphorylating the key substrate RB protein and releasing the transcription factor E2F, it plays an important role at the R point of the G1 phase, leading to the transcription of genes related to the initiation of the S phase, prompting cells to pass the R point, and transferring the G1 phase to the S phase.

Maintaining a normal cell cycle is of great significance for cell growth, reproduction, differentiation, and development. Many life processes such as embryonic development, tissue regeneration, wound healing, and immune response are closely related to the precise regulation of cell proliferation. Cyclin-dependent kinases have an important role in the regulation of the cell cycle. If over-expressed, the cells will proliferate infinitely, cause canceration of the cells, and eventually lead to death of the body. Gene chip analysis revealed that in the bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibrobl ast, growth factor stimulation, 1024NT, scar-like fc growth factor stimulation, 1013HT, and scar formation fc is not stimulated with growth factors, 1013HC, bladder cancer construct cells EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell lines, placenta, spleen, prostate cancer, jejunum adenocarcinoma, cardia cancer, the polypeptide of the present invention The expression profile is very similar to that of cyclin-dependent kinase-CDK4, so their functions may be similar. The present invention is named cyclin-dependent kinase-CDK411.

 As described above, the cyclin-dependent kinase-CDK411 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes. Therefore, there is always a need to identify more involved in these processes in the art The cyclin-dependent kinase-CDK411 protein, in particular, identifies the amino acid sequence of this protein. The isolation of the novel cyclin-dependent kinase-CDK411 protein-coding gene also provides the basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Object of the invention

 It is an object of the present invention to provide an isolated novel polypeptide-cyclin-dependent kinase-CDK411 and fragments, analogs and derivatives thereof.

 Another object of the invention is to provide a polynucleotide encoding the polypeptide.

 Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a cyclin-dependent kinase-CDK411.

 Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a cyclin-dependent kinase-CDK411.

 Another object of the present invention is to provide a method for producing cyclin-dependent kinase-CDK411.

 Another object of the present invention is to provide a cyclin-dependent kinase-

CDK411 antibody.

 Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention, cyclin-dependent kinase-CDK411.

 Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormalities of cyclin-dependent kinase-CDK411. Summary of invention

The invention relates to an isolated polypeptide, which is of human origin, and which comprises: SEQ ID No. 2 Amino acid sequence of a polypeptide, or a conservative variant, biologically active fragment or derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

 The invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;

 (b) a polynucleotide complementary to polynucleotide (a);

 (c) A polynucleotide having at least 70% identity to a polynucleotide sequence of (a) or (b).

 More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 355-657 in SEQ ID NO: 1; and (b) a sequence having positions 1-1 in SEQ ID NO: 1 394-bit sequence.

 The present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.

 The invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.

 The invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of cyclin-dependent kinase-CDK411 protein, which comprises utilizing the polypeptide of the invention. The invention also relates to compounds obtained by this method.

 The present invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of a cyclin-dependent kinase-CDK411 protein, comprising detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a biological The amount or biological activity of a polypeptide of the invention in a sample.

 The invention also relates to a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

 The present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental or epidemic diseases, or other diseases caused by abnormal expression of cyclin-dependent kinase-CDK411.

 Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein. BRIEF DESCRIPTION OF THE DRAWINGS

 The following drawings are used to illustrate specific embodiments of the invention, but not to limit the scope of the invention as defined by the claims.

FIG. 1 is a comparison diagram of gene chip expression profiles of cyclin-dependent kinase-CDK411 and cyclin-dependent kinase-CDK4 of the present invention. The upper picture is a graph of the cyclin-dependent kinase-CDK411 expression profile, and the lower picture is the week Plot of expression profile of phase protein-dependent kinase-CDK4. Among them, 1-fetal brain, 2-bladder mucosa, 3-PMA + Ecv304 cell line, 4-LPS + Ecv304 cell line thymus, 5-normal fibroblasts 1024NC, 6- Fibroblas t, growth factor stimulation, 1024NT, 7- Stimulation of scar into fc growth factor, 1013HT, 8-scar scar into fc without stimulation with growth factor, 1013HC, 9-bladder cancer plant cell EJ, 10-bladder cancer, 11-bladder cancer, 12-liver cancer, 13-liver cancer cells Strains, 14-fetal skin, 15-spleen, 16-prostate cancer, 17-jejunum adenocarcinoma, 18 cardia cancer.

 Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated cyclin-dependent kinase-CDK411. l lkDa is the molecular weight of the protein. The arrow indicates the isolated protein band. Summary of the Invention

 The following terms used in this specification and claims have the following meanings unless specifically stated: "Nucleic acid sequence" refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DM or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand. Similarly, the term "amino acid sequence" refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof. When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .

 A "variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.

 "Deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.

 "Insertion" or "addition" means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature. "Replacement" refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.

 "Biological activity" refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similarly, the term "immunologically active" refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.

An "agonist" refers to a molecule that, when combined with cyclin-dependent kinase CDK411, causes the protein to change, thereby regulating the activity of the protein. Agonists can include proteins, nucleic acids, carbohydrates A compound or any other molecule that can bind to a cyclin-dependent kinase-CDK411.

 An "antagonist" or "inhibitor" refers to a molecule that can block or regulate the biological or immunological activity of cyclin-dependent kinase-CDK411 when combined with cyclin-dependent kinase-CDK411. Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind to a cycle protein-dependent kinase-CDK411.

 "Regulation" refers to a change in the function of cyclin-dependent kinase-CDK411, including an increase or decrease in protein activity, a change in binding properties, and any other changes in the biological, functional, or immune properties of cyclin-dependent kinase-CDK411.

 "Substantially pure" means substantially free of other proteins, lipids, carbohydrates or other substances with which it is naturally associated. Those skilled in the art can purify cyclin-dependent kinase-CDK411 using standard protein purification techniques. Essentially pure cyclin-dependent kinase-CDK411 produces a single main band on a non-reducing polyacrylamide gel. The purity of the cyclin-dependent kinase-CDK411 polypeptide can be analyzed by amino acid sequence.

 "Complementary" or "complementary" refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "C-T-G-A" can be combined with the complementary sequence "G-A-C-T". The complementarity between two single-stranded molecules may be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.

 "Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.

"Percent identity" refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods, such as the Clus ter method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). _{0 The} Clus ter method groups each group by checking the distance between all pairs. The sequences are arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:

 Number of residues matching between sequence ^ and sequence 3

Residues sequence - the sequence number of residues in the interval ^ - ^ interval sequence of residues ^X The percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art such as; Totun Hein (He in L, (1990) Methods in enzymology 183: 625-645) ₀ '"similarity" It refers to the degree of the same or conservative substitution of amino acid residues at corresponding positions when the amino acid sequences are aligned. Amino acids used for conservative substitutions, for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

 "Antisense" refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence. "Antisense strand" refers to a nucleic acid strand that is complementary to a "sense strand."

 "Derivative" refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.

"Antibody" refers to a complete antibody molecule and its fragments, such as Fa,? (^,) ₂ and? It specifically binds to the cyclin-dependent kinase-CDK411 epitope.

 A "humanized antibody" refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.

 The term "isolated" refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring). For example, a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system. Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.

 As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .

 As used herein, "isolated cyclin-dependent kinase-CDK411" means that cyclin-dependent kinase-CDK411 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify cyclin-dependent kinase-CDK411 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the cyclin-dependent kinase-CDK411 polypeptide can be analyzed by amino acid sequence.

The present invention provides a new polypeptide ~~ M phase protein-dependent kinase CDK411, which is basically composed of SEQ It is composed of the amino acid sequence shown in ID NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.

 The invention also includes fragments, derivatives, and analogs of cyclin-dependent kinase-CDK411. As used in the present invention, the terms "fragment", "derivative" and "analog" refer to a polypeptide that substantially retains the same biological function or activity of the cyclin-dependent kinase-CDK411 of the present invention. A fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by a genetic codon; or (Π) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or (Π Ι) Such a polypeptide sequence in which the mature polypeptide is fused with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as the leader or secretory sequence or the sequence used to purify the polypeptide or protease sequence). As set forth herein, such fragments, derivatives, and analogs are considered to be within the knowledge of those skilled in the art.

 The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1. The polynucleotide of the present invention is found from a CDM library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 1394 bases, and its open reading frame 355-657 encodes 100 amino acids. According to the comparison of gene chip expression profiles, it was found that this peptide has a similar expression profile to cyclin-dependent kinase-CDK4. It can be inferred that the cyclin-dependent kinase-CDK411 has similar functions to cyclin-dependent kinase-CDK4.

 The polynucleotide of the present invention may be in the form of DNA or RNA. DM forms include cDM, genomic DM, or synthetic DNA. DNA can be single-stranded or double-stranded. DM can be coded or non-coded. The coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used herein, a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.

The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; The coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence (and optional additional coding sequences) of the mature polypeptide and non-coding sequences.

 The term "polynucleotide encoding a polypeptide" refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.

 The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .

 The present invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences). The present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Fi col l, 42 ° C, etc .; or (3) only between two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%. Moreover, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2 .

 The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used herein, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding cyclin-dependent kinase-CDK411.

 The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity. The specific polynucleotide sequence encoding the cyclin-dependent kinase-CDK411 of the present invention can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or CDM libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.

 The DNA fragment sequence of the present invention can also be obtained by the following methods: 1) separating the double-stranded DNA sequence from the DM of the genome; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DM of the polypeptide.

Of the methods mentioned above, genomic DM is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the separation of the CDM sequences. Isolate the CDM of interest The standard method is to isolate mRM from donor cells that highly express the gene and perform reverse transcription to form a plasmid or phage CDM library. There are many mature techniques for extracting mRNA, and kits are also commercially available (Qiagene;). The construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua, Cold Spruing Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.

 The genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DM-DM or DM-RM hybridization; (2) the appearance or loss of marker gene function; (3) determination of the level of cyclin-dependent kinase-CDK411 transcripts; (4) ) Detection of protein products expressed by genes through immunological techniques or determination of biological activity. The above methods can be used alone or in combination.

 In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides. The probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DM probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).

 In the (4) method, immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product expressed by the cyclin-dependent kinase-CDK411 gene. ,

 Methods for Amplifying DNA / RNA Using PCR Techniques (Sa iki, et a l. Science

1985; 230: 1350-1354) are preferred for obtaining the genes of the invention. In particular, when it is difficult to obtain a full-length cDNA from a library, the RACE method (RACE-Rapid Amplification of cDNA Ends) can be preferably used. The primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods. The amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.

 The polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.

The present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell genetically engineered using the vector of the present invention or directly using a cyclin-dependent kinase-CDK411 coding sequence, and A set of techniques for producing a polypeptide of the invention.

 In the present invention, a polynucleotide sequence encoding a cyclin-dependent kinase-CDK4I1 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al. Gene, 1987, 56: 125) expressed in bacteria; pMSXND expression vectors expressed in mammalian cells (Lee and Nathans, J Bio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In short, as long as it can be replicated and stabilized in the host, any plasmid and vector can be used to construct a recombinant expression vector. An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.

 Methods well known to those skilled in the art can be used to construct an expression vector containing a DNA sequence encoding a cyclin-dependent kinase-CDK411 and transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Molecular Cloning, a Laboratory Manual, Cold Spice Harbor Laboratory. New York, 1989). The DNA sequence can be operably linked to an appropriate promoter in the expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E. coli; the PL promoter of lambda phage; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, Retroviral LTRs and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 'base pairs, that act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.

 In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.

 Those of ordinary skill in the art will know how to select appropriate vector / transcription control elements (such as promoters, enhancers, etc.) and selectable marker genes.

In the present invention, a polynucleotide encoding a cyclin-dependent kinase-CDK411 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a base containing the polynucleotide or the recombinant vector. Due to engineered host cells. The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E. coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as fly S2 or Sf 9; animal cells such as CH0, COS or Bowes melanoma cells.

Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote, such as E. coli, competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl ₂ method. The steps used are well known in the art. Alternatively, MgCl ₂ is used. If necessary, transformation can also be performed by electroporation. When the host is a eukaryote, the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.

 By using conventional recombinant DNA technology, the polynucleotide sequence of the present invention can be used to express or produce recombinant cyclin-dependent kinase-CDK411 (Science, 1984; 224: 1431). Generally there are the following steps: '

(1) using the polynucleotide (or variant) encoding human cyclin-dependent kinase-CDK411 of the present invention, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;

 (2) culturing host cells in a suitable medium;

 (3) Isolate and purify protein from culture medium or cells.

 In step (2), depending on the host cell used, the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

 In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the physical, chemical, and other properties can be used to isolate and purify the recombinant protein by various separation methods. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.

 The polypeptides of the present invention, as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.

The cell cycle runs very orderly, following the order G1-S → G2 → M. Mammals have a series of key regulatory sites in the cell cycle, such as: R sites (or restriction sites). They are made A regulatory pathway for the timing of cell cycle transitions ensures that critical events in the cell cycle are completed with high accuracy. To enter the next phase of the cell through the control point, the cell must go through all phases before this phase, and also be controlled by a series of checkpoints. The regulatory tests such as: whether DNA replication has been completed before the cell mitosis, etc. Finally, a set of related kinases and cyclin-dependent kinases ensure that the control information of these checkpoints is complete. Once the cell completes a cycle, the active CDK phosphorylates key substrates, allowing the cell to pass through the regulatory point and enter the next phase of the cell. The formation of the cell cycle is due to the controlled activity of different CDKs. Known members of the CDK family are CDK1, CDK2, CDK3, CDK5, CDK6, and CDK7. CDK activity is regulated by inducing, inhibiting phosphorylation, and forming complexes with other proteins. CDK must be combined with a group of regulatory subunits such as the corresponding cyclin. With the participation of some protein kinases and phosphatase p80 ^{ed <: 25} , phosphorylation and dephosphorylation can show the kinase activity.

 CDK4 is a newly discovered cyclin-dependent kinase. CDK4 specifically binds to D-type (Dl, D2, D3) cyclin to form an active state heterodimer complex holoenzyme with protein kinase activity, cyclin is a regulatory subunit, and CDK is a catalytic subunit Through phosphorylation of the key substrate RB protein and release of the transcription factor E2F, it plays an important role at the R point of the G1 phase, leading to the transcription of genes related to the initiation of the S phase, prompting the cells to pass the R point, and transferring the G1 phase to the S phase.

 Maintaining a normal cell cycle is important for cell growth, reproduction, differentiation, and development. Many life processes such as embryonic development, tissue regeneration, wound healing, and immune response are closely related to the precise regulation of cell proliferation. Cyclin-dependent kinases have an important role in the regulation of the cell cycle. If over-expressed, the cells will proliferate indefinitely, cause canceration of the cells, and eventually lead to the death of the body.

 The expression profile of the polypeptide of the present invention is consistent with the expression profile of human cyclin-dependent kinase-CDK4, and both have similar biological functions. The polypeptide of the present invention can specifically bind to D-type cyclin to form an active state heterodimeric complex holoenzyme with protein kinase activity. It releases the transcription factor E2F by phosphorylating the key substrate RB protein It plays an important role at the R point of the G1 phase, leading to the transcription of genes related to the initiation of the S phase, urging the cells to pass the R point, and transferring the G1 phase to the S phase, thereby smoothly carrying out the cell cycle. Its abnormal expression can have adverse effects on cell growth, reproduction, differentiation, and development, such as embryonic developmental disorders, abnormal tissue regeneration, poor wound healing, immune response disorders, tumorigenesis and other closely related pathological processes, and produce related diseases.

 It can be seen that the abnormal expression of the cyclin-dependent kinase-CDK411 of the present invention will produce various diseases, especially embryonic developmental disorders, growth disorders, various tumors, inflammation, and immune diseases. These diseases include but are not limited to :

Embryonic disorders: congenital abortion, cleft palate, limb absentness, limb differentiation disorder, atrial septum Defects, neural tube defects, congenital hydrocephalus, congenital glaucoma or cataract, congenital hearing loss, growth and development disorders: mental retardation, brain development disorders, skin, fat and muscular dysplasia, bone and joint dysplasia Sexual diseases, various metabolic defects, stunting, dwarfism, Cushing syndrome, sexual retardation

 Tumors of various tissues: gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, Neurofibromas, colon cancer, melanoma, bladder cancer, uterine cancer, endometrial cancer, thymic tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma, lipoma, liposarcoma

 Inflammation: chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations

 Immune diseases: Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome

 The abnormal expression of the cyclin-dependent kinase-CDK411 of the present invention will also produce certain hereditary, hematological diseases and the like.

 The polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially embryonic developmental disorders, disorders of growth and development, various tumors, inflammation, and immunity. Sexual diseases, certain hereditary, blood diseases, etc.

 The invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) cyclin-dependent kinase-CDK411. Agonists increase cyclin-dependent kinase-CDK411 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers. For example, mammalian cells or membrane preparations expressing cyclin-dependent kinase-CD 411 can be cultured with labeled cyclin-dependent kinase-CDK411 in the presence of drugs. The ability of the drug to increase or suppress this interaction is then determined.

 Cyclin-dependent kinase-CDK411 antagonists include antibodies, compounds, receptor deletions, and the like that have been screened. An antagonist of cyclin-dependent kinase-CDK411 can bind to cyclin-dependent kinase-CDK411 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform a biological function.

When screening compounds as antagonists, cyclin-dependent kinase-CDK411 can be added to the bioanalytical assay to determine whether the compound is an antagonist by measuring the effect of the compound on the interaction between cyclin-dependent kinase-CDK411 and its receptor . Using the same method for screening compounds described above, To screen for receptor deletions and analogs that act as antagonists. Cyclin-dependent kinase 1

CDK411-bound polypeptide molecules can be obtained by screening a random peptide library consisting of various possible combinations of amino acids bound to a solid phase. When screening, cyclin-dependent kinase-CDK411 molecules should generally be labeled.

 The present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides antibodies against the cyclin-dependent kinase-CDK411 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.

Polyclonal antibodies can be produced by injecting cyclin-dependent kinase-CDK411 directly into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. Wait. Techniques for preparing cyclin-dependent kinase-CDK411 monoclonal antibodies include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology , EBV-hybridoma technology, etc. Chimeric antibodies that combine human constant regions with non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). ₀ Existing techniques for producing single-chain antibodies (US Pat No. 4946778) can also be used to produce single chain antibodies against cyclin-dependent kinase-CDK411.

 Anti-cyclin-dependent kinase-CDK411 antibodies can be used in immunohistochemistry to detect cyclin-dependent kinase-CDK411 in biopsy specimens.

 Monoclonal antibodies that bind to cyclin-dependent kinase-CDK411 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

 Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, cyclin-dependent kinase-CDK411 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through disulfide exchange. This hybrid antibody can be used to kill cyclin-dependent kinase-CDK411 positive cells .

 The antibodies of the present invention can be used to treat or prevent diseases related to cyclin-dependent kinase-CDK411. Administration of an appropriate dose of antibody can stimulate or block the production or activity of cyclin-dependent kinase-CDK411.

The invention also relates to a diagnostic test method for quantitatively and locally detecting the level of cyclin-dependent kinase-CDK411. These tests are well known in the art and include FISH assays and radioimmunoassays. Test The levels of cyclin-dependent kinase-CDK411 detected in this study can be used to explain the importance of cyclin-dependent kinase-CDK411 in various diseases and to diagnose diseases in which cyclin-dependent kinase-CM411 functions.

 The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.

 The polynucleotide encoding cyclin-dependent kinase-CDK411 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of cyclin-dependent kinase-CDK411. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated cyclin-dependent kinase-CDK411 to inhibit endogenous cyclin-dependent kinase-CDK411 activity. For example, a mutated cyclin-dependent kinase-CDK411 may be a shortened cyclin-dependent kinase-CDK411 lacking a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity. Therefore, recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of cyclin-dependent kinase-CDK411. Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding a cyclin-dependent kinase-CDK411 into a cell. A method for constructing a recombinant viral vector carrying a polynucleotide encoding a cyclin-dependent kinase-CDK411 can be found in the existing literature (Sambrook, et al.). In addition, recombinant polynucleotides encoding cyclin-dependent kinase-CDK411 can be packaged into liposomes and transferred into cells.

 Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.

 Oligonucleotides (including antisense RM and DNA) and ribozymes that inhibit cyclin-dependent kinase-CDK411 mRNA are also within the scope of the present invention. A ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation. Antisense RNA, DM, and ribozymes can be obtained by any existing RNA or DNA synthesis technology, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides. Antisense RNA molecules can be obtained by in vitro or in vivo transcription of DM sequences encoding the RNA. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.

A polynucleotide encoding cyclin-dependent kinase-CDK411 can be used in conjunction with cyclin-dependent kinase-1 Diagnosis of CDK411-related diseases. The polynucleotide encoding cyclin-dependent kinase-CDK411 can be used to detect the expression of cyclin-dependent kinase-CDK411 or the abnormal expression of cyclin-dependent kinase-CDK411 in a disease state. For example, the DNA sequence encoding cyclin-dependent kinase-CDK411 can be used to hybridize biopsy specimens to determine the expression of cyclin-dependent kinase-CDK411. Hybridization techniques include Southern blotting, or thern blotting, in situ hybridization, and the like. These techniques and methods are publicly available and mature, and related kits are commercially available. Some or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissue. Cyclin-dependent kinase-CDK411-specific primers can be used to detect RNA-polymerase chain reaction (RT-PCR) in vitro amplification of cyclin-dependent kinase-CDK411 transcription products.

 Detecting mutations in the cyclin-dependent kinase-CDK411 gene can also be used to diagnose cyclin-dependent kinase-CDK411-related diseases. Cyclin-dependent kinase-CDK411 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type cyclin-dependent kinase-CDK411 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect the expression of proteins. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.

 The sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.

 In short, PCR primers (preferably 15-35bp) are prepared according to cDM, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.

 PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes. Using the oligonucleotide primers of the present invention, in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDM libraries.

Fluorescent in situ hybridization (FISH) of cDM clones and metaphase chromosomes allows precise chromosomal localization in one step. For a review of this technique, see Verma et al., Human Chromosomes: a Manua l of Basic Techniques, Pergamon Pres s, New York (1988). Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in V. Mckusick, Mendelian ian Inherance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.

 Next, the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable by cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).

 The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

 The invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell. In addition, the polypeptides of the invention can be used in combination with other therapeutic compounds.

 The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. Cyclin-dependent kinase-CDK411 is administered in an amount effective to treat and / or prevent a specific indication. The amount and range of cyclin-dependent kinase-CDK411 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples

The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods without specific conditions in the following examples are generally based on conventional conditions, such as those described in Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Col Harbor Harbor Laboratory Pres s, 1989), or According to the manufacturer Conditions recommended by the dealer.

 Example 1 Cloning of cyclin-dependent kinase-CDK411

 Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Poly (A) raRNA was isolated from total RNA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA forms cDM by reverse transcription. Using Sma r t cDM cloning kit (purchased from C 1 on t ech), the cDNA fragment was inserted into the multiple cloning site of pBSK (+) vector (Clontech) to transform DH5 α, and the bacteria formed a cDNA library. Dye terminate cycle react ion sequencing kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer) were used to determine the sequences at the 5 'and 3' ends of all clones. Comparing the determined cDNA sequence with the existing public DNA sequence database (Genebank), it was found that the cDNA sequence of one of the clones, 0079g01, was new DNA. The inserted cDNA fragments contained in this clone were determined in both directions by synthesizing a series of primers. The results show that the 0079g01 clone contains a full-length CDM of 1394bp (as shown in Seq ID N0: l), and has a 302bp open reading frame (0RF) from 355bp to 657bp, encoding a new protein (such as Seq ID NO : Shown in 2). We named this clone pBS-0079g01, and the encoded protein was named cyclin-dependent kinase-CDK41L. Example 2 The gene encoding cyclin-dependent kinase-CDK411 was cloned by RT-PCR. The total RM of fetal brain cells was used as a template. igo-dT was used as a primer for reverse transcription reaction to synthesize cDNA. After purification with Qiagene's kit, PCR amplification was performed with the following primers:

 Primer 1: 5, — ACGGCTGCGAGAAGACGAAGCTTA -3, (SEQ ID NO: 3)

 Primer2: 5'- GATATTTAGTTTTATTCCACATTT -3 '(SEQ ID NO: 4)

 Pr imerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;

 Primer2 is the 3, terminal reverse sequence of Ψ of SEQ ID NO: 1.

Conditions for the amplification reaction: A reaction volume of 50 μ1 contains 50 mmol / L KCl, 10 mmol / L Tri s-HCl pH 8. 5, 1. 5 mmol / L MgCl ₂ , 20 (^ mol / L dNTP, lOpmol primer, 1U Taq DM polymerase (Clontech). The reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2rain. At RT- During PCR, β-act in was used as a positive control and template blank was used as a negative control. Amplification products were purified using a QIAGEN kit, and TA cloning kit was used to connect to a pCR vector (Invitrogen). DM sequence analysis results It was shown that the DNA sequence of the PCR product was identical to that of 1 to 1394 bp shown in SEQ ID NO: 1. Example 3 Analysis of the expression of cyclin-dependent kinase-CDK411 gene by Northern blotting method Total RNA was extracted in one step [Anal. Biochem 1987, 162 156-159] ₀ This method includes acid sulfur Guanidinium cyanate phenol-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH 4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water. Electrophoresis was performed on a 1.2% agarose gel containing 2 g of RNA on 20 mM 3- (N-morpholino) propanesulfonic acid (H7.0)-5 mM sodium acetate-1 mM EDTA-2.2M formaldehyde. Then transferred to nitrocellulose. cc- ³² P dATP with ³² P- D Preparation of labeled probes by random priming SYSTEM. the DNA probe used is shown in Figure 1 PCR amplified cyclin dependent kinases encoding a CDK411 Region sequence (355bp to 657bp). 32P-labeled probe (approximately 2 x 10 ⁶ cpm / ml) was hybridized with nitrocellulose membrane to which RNA was transferred in a solution at 42 ° C overnight, the solution contained 50% Formamide-25mM KH ₂ P0 ₄ (pH 7.4)-5 x SSC-5 x Denhardt, s solution and 200 μ _§ / ηι1 salmon sperm DNA. After hybridization, the filter was placed in 1 x SSC-O. 1% SDS in Wash at 55 ° C for 30 min. Then, use Phosphor Imager for analysis and quantification. Example 4 In vitro expression, isolation and purification of recombinant cyclin-dependent kinase-CDK411 In accordance with the coding region sequence shown in SEQ ID NO: 1 and Figure 1, design A pair of specific amplification primers was generated, and the sequence is as follows:

Primer3: 5'-CCCCATATGATGACTTCAAGAATGTTTTTGACC-3 '(Seq ID No: 5) Primer4: 5'-CCCGAGCTCTCAGGAGGTCAAGTGCAGAGCATC-3' (Seq ID No: 6) The 5 'ends of these two primers contain Ndel and Sacl restriction sites, respectively. The coding sequences of the 5 'and 3' ends of the gene of interest are followed, respectively. The Ndel and Sacl restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site. A pBS-OO gOl plasmid containing a full-length target gene was used as a template to perform a PCR reaction. PCR reaction conditions were: total volume of 50μ1 containing _P BS- _0079g01 plasmid 10pg, primers Primer_3 Primer- 4 and j is the other points lOpmol, Advantage polymerase Mix!

(Clontech) 1μ1. Cycle parameters: 94. C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles. Ndel and Sacl were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into Ca. bacillus DH5a by the calcium chloride method.

(Final concentration of 30μ ε _/ ίη1) LB plates after overnight culture, positive clones were screened by colony PCR method, and sequenced. A positive clone (pET-0079 _g 01) with the correct sequence was selected, and the recombinant plasmid was transformed into Escherichia coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method. In LB liquid medium containing kanamycin (final concentration 3 (^ g / ml)), the host strain BL21 (pET- 0079g01) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1 mmol / L , Continue culturing for 5 hours. Collect the cells by centrifugation, decompose by ultrasound, collect the supernatant by centrifugation, and use an affinity chromatography column His. Bind Quick Cartridge that can bind to 6 histidines (6His-Tag).

(Novagen company product). Chromatography was performed to obtain the purified cyclin-dependent kinase-1. CDK411. After SDS-PAGE electrophoresis, a single band was obtained at llkDa (Figure 2). The band was transferred to a PVDF membrane and the N-terminal amino acid sequence was analyzed by Edams hydrolysis method. As a result, the 15 amino acids at the N-terminus were identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2. Example 5 Production of anti-cyclin-dependent kinase-CDK411 antibodies

 A peptide synthesizer (product of PE company) was used to synthesize the following cyclin-dependent kinase-CDK411-specific peptides:

 NH2-Met-Thr-Ser-Arg-Met-Phe-Leu-Thr-Arg-Lys-Pro-Thr-Thr-Phe-Pro-C00H (SEQ ID NO: 7). The polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex. For methods, see: Avrameas, et al. Im Jean Ochemi s try, 1969; 6:43. Rabbits were immunized with 4 mg of the hemocyanin polymorphic complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once. A titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum. Total IgG was isolated from antibody-positive rabbit sera using protein A-Sepharose. The peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography. Immunoprecipitation demonstrated that the purified antibody specifically binds to cyclin-dependent kinase-CDK411. Example 6 Application of the polynucleotide fragment of the present invention as a hybridization probe

 Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways. For example, the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.

The purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method. Acid sequence or a homologous polynucleotide sequence thereof. Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter. These same steps are ... The sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and synthetic polymer. The pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to allow the probe to hybridize to the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of membrane washing steps. This embodiment makes use of higher intensity membrane washing conditions (such as lower salt concentration and higher temperature) to enable hybridization The background is reduced and only strong specific signals are retained. The probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention The polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment. In this embodiment, the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained. ―

 First, the selection of the probe

 The selection of oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:

 1. The preferred range of probe size is 18-50 nucleotides;

 2. GC content is 30% -70%, if it exceeds, non-specific hybridization increases;

 3, there should be no complementary regions inside the probe;

 4. Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecule region is greater than 85½ or there are more than 15 consecutive bases, then the primary probe should not be used;

 5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments. After completing the above analysis, select and synthesize the following two probes:

 Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):

 5'-TGACTTCAAGAATGTTTTTGACCAGAAAACCGACAACCTTC-3 '(SEQ ID NO: 8) Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment of SEQ ID NO: 1 or its complementary fragment:

 5'-TGACTTCAAGAATGTTTTTGCCCAGAAAACCGACAACCTTC-3 '(SEQ ID NO: 9) For other commonly used reagents and their preparation methods related to the following specific experimental procedures, please refer to the literature: DNA PROBES GH Kel ler; M. Mann; Stockton Pres s, 1989 (USA) and more commonly used molecular cloning laboratory manuals such as "Molecular Cloning Experiment Guide" (Second Edition 1998) [US] Sambrook et al., Science Press.

 Sample Preparation:

 1.Extract DM from fresh or frozen tissue

Steps: 1) Place fresh or freshly thawed normal liver tissue in a plate immersed in ice and filled with phosphate buffered saline (PBS). Cut the tissue into small pieces with scissors or a scalpel. Tissue should be kept moist during operation. 2) Centrifuge the tissue at 1000 g for 10 minutes. 3) cold homogenate buffer (0.25mol / L sucrose; 25 legs ol / L Tris-HCl, pH 7.5; 25 mraol / L NaCl; 25 mmol / L MgCl ₂ ) Suspended precipitate (approximately 10 ml / g). 4) Pad the tissue suspension at full speed with an electric homogenizer at 4 ° C until the tissue is completely broken. 5) Centrifuge at 1000g for 10 minutes. 6) Resuspend the cell pellet (1 to 5 ml per 0.1 g of the original tissue sample) and centrifuge at 1,000 g for 10 minutes. 7) Resuspend the pellet with lysis buffer (1 ml per 0.1 g of the initial tissue sample), and then follow the phenol extraction method below.

 2, DNA phenol extraction method

Steps: 1) Wash cells with 1-10 ml of cold PBS and centrifuge at 1QOOg for 10 minutes. 2) Resuspend the pelleted cells with cold cell lysate (1 x ^{10 8} cells / ml). Use a minimum of 100ul lysis buffer. 3) Likou SDS to a final concentration of 1%. If SDS is added directly to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 ⁷ cells. 4) Add proteinase K to a final concentration of 200ug / ml. 5) Incubate at 50 ° C for 1 hour or shake gently at 37 ° C overnight.

6) Extract with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge in a small centrifuge tube for 10 minutes. The two should be clearly separated, otherwise centrifuge again. 7) Transfer the water phase to a new tube. 8) Extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 9) Transfer DNA-containing cypress to a new tube. The DNA was then purified and ethanol precipitated.

 3, DNA purification and ethanol precipitation

Steps: 1) Add 180 vol. 2mol / L sodium vinegar. Sodium and double volume cold 100% ethanol to the DNA solution and mix. At -20. C Let stand for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) Wash the pellet with 500ul of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol. Wash the pellet with 500ul of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, then invert on the absorbent paper to drain off the residual ethanol. Air dry for 10-15 minutes to allow the surface ethanol to evaporate. Be careful not to allow the pellet to dry completely, otherwise it will be more difficult to re-dissolve. 7) Resuspend the DM pellet in a small volume of TE or water. Low-speed vortexing or pipetting, with a dropper, while gradually increasing the TE, mixed until fully dissolved DNA, every 1- 5 χ 10 ⁶ cells extracted about plus lul.

 The following steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.

8) Add RMase A to the DM solution to a final concentration of 100 ug / ml, 37. C was held for 30 minutes. 9) Add SDS and proteinase K to the final concentration of 0.5% and 100ug / ml _o 37 ° C for 30 minutes. 10) Extract the reaction solution with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase and re-extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 12) Carefully remove the water phase, add 180 vols of 2mol / L sodium acetate and 2.5 vols of cold ethanol, and mix well at -20 ° C for 1 hour. 13) Wash the pellet with 70% ethanol and 100% ethanol, air dry, and resuspend the nucleic acid. The process is the same as steps 3-6. 14) Measure A ₂₆ . And A _28ΰ to check the purity and yield of DM. 15) Store at -20 ° C after dispensing. Preparation of sample film:

 1) Take 4x2 pieces of nitrocellulose membranes (NC membranes) of appropriate size, and mark the spotting position and sample number on it with a pencil. Two NC membranes are required for each probe, so that they can be used in the following experimental steps. The film was washed with high-strength conditions and strength conditions, respectively.

 2) Pipette and control 15 microliters each, spot on the sample film, and dry at room temperature.

 3) Place on filter paper infiltrated with 0.1 mol / L NaOH, 1.5 mol / L NaCl for 5 minutes (twice), dry and put in 0.5 mol / L Tris-HCl (pH 7.0), 3 mol / L NaCl filter paper for 5 minutes (twice) and allowed to dry.

 4) Clamped in clean filter paper, wrapped in aluminum foil, and dried under vacuum at 60-80 ° C for 2 hours.

 Labeling of probes

1) 3μ1 Probe (0.1OD / Ιθμΐ), add 2μ1 Kinase buffer, 8-10 uCi γ- ³² P-dATP + 2U Kinase to make up to a final volume of 20μ1.

 2) Incubate at 37 ° C for 2 hours.

 3) Add 1/5 volume of Bromophenol Blue Indicator (BPB). '

4) Pass through a Sephadex G-50 column.

5) Collect the first peak before ³² P-Probes are washed out (monitorable).

 6) 5 drops / tube, collect 10-15 tubes.

 7) Monitor the amount of isotope with a liquid scintillator.

8) The ³² P-Probe (the second peak is free γ- ³² P-dATP) after the collection of the first peak is combined.

 Pre-hybridization,

 The sample membrane was placed in a plastic bag, and 3-1 Omg pre-hybridization solution (1 OxDenhardt's; 6xSSC, 0.1 lrag / ml CT DNA (calf thymus DNA)) was added. After closing the bag, 68. C water bath for 2 hours.

 Cross

 Cut off the corner of the plastic bag, add the prepared probe, and seal the bag, 42. C. Water was shaken overnight. Wash film:

 High-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, 40. C Wash for 15 minutes (twice).

 3) 0.1xSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (twice).

4) 0.1xSSC, 0.1% SDS, 55. Wash for 30 minutes (twice) and dry at room temperature. Low-intensity washing film:

 1) Take out the sample membrane of hybridization.

 2) 2xSSC, 0.1% SDS, 37. C Wash for 15 minutes (twice).

 3) Wash in 0.1xSSC, 0.1% SDS at 37 ° C for 15 minutes (twice).

 4) Wash in 0.1xSSC, 0.1% SDS at 40 ° C for 15 minutes (twice), and dry at room temperature.

X-ray auto-development:

 -70 ° C, X-ray autoradiography (compression time depends on the radioactivity of the hybrid spot).

 Experimental results:

 The hybridization experiments performed under low-intensity membrane washing conditions showed no significant difference in the radioactive intensity of the above two probes. However, in the hybridization experiments performed under high-intensity membrane washing conditions, the radioactive intensity of probe 1 was significantly stronger than that of hybridization spots. The radioactive intensity of the hybridization spot of the other probe. Therefore, the presence and differential expression of the polynucleotide of the present invention in different tissues can be analyzed qualitatively and quantitatively with the probe 1. Example 7 DNA Microarray

 Gene microarrays or DNA microarrays are new technologies currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information. The polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific method steps have been reported in the literature. For example, see the documents DeRis i, JL, Lyer, V. & Brown, PO (1997) Science 278, 680-686. And the documents Helle, RA, Schema, M. , Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.

 (A) spotting

 A total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR, and the concentration of the amplified product was adjusted to about 500ng / ul after purification. The spots were spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 μm. The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the glass slides to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:

1. Hydration in a humid environment for 4 hours; 2. 0.2% SDS was washed for 1 minute;

 3. dd 0 wash twice, 1 minute each time;

4. NaBH _{4 is} blocked for 5 minutes;

 5. 95 ° C water for 2 minutes;

 6. Wash with 0.2% SDS for 1 minute;

7. Rinse twice with ddH ₂ 0;

 8. Dry and store at 25 ° C in the dark for future use.

 (Two) probe marking

 Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified with Oligotex mRNA Midi Ki t (purchased from QiaGen). Cy3dUTP (5-Amino-propargyl-2'-deoxyuridine 5 '-triphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5-Amino- propargyl-2' -deoxyuridine 5'-triphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech Company, labeled the specific tissue (or stimulated cell line) mRNA of the body, and purified the probe to prepare a probe. For specific steps and methods, see:

 Schena, M., Shalon, D., Heller, R. (1996) Proc. Natl. Acad. Sci. USA. Vol. 93: 10614-10619. Schena, M., Sha lon, Dar i., Davi s, RW (1995) Sc ience. 270. (20): 467-480.

 (Three) cross

 The probes from the two types of tissues and the chip were hybridized in a UniHyb ™ Hybridizat ion Solut ion (purchased from TeleChera) hybridization solution for 16 hours, and washed with a washing solution (lx SSC, 0.2 SDS) at room temperature before use. ScanArray 3000 scanner (purchased from General Scanning Company, USA) was used for scanning. The scanned image was analyzed and processed with Imagene software (Biodicovery Company, USA) to calculate the Cy3 / Cy5 ratio of each point.

 The above specific tissues (or stimulated cell lines) are fetal brain, bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibroblas t, growth factor stimulation, 1024NT, scar formation fc growth factor stimulation, 1013HT, scar into fc without growth factor stimulation, 1013HC, bladder cancer cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunal adenocarcinoma, Cardiac cancer. Based on these 18 Cy3 / Cy5 ratios, a histogram is drawn (Figure 1). It can be seen from the figure that the expression profiles of cyclin-dependent kinase-CDK411 and cyclin-dependent kinase-CDK4 according to the present invention are very similar.

Claims

Rights request

1. An isolated polypeptide-cyclin-dependent kinase-CDK411, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID NO: 2, or an active fragment, analog, or derivative thereof.

 2. The polypeptide according to claim 1, characterized in that the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.

 3. The polypeptide according to claim 2, further comprising a polypeptide having the amino acid sequence shown in SEQ ID NO: 2.

 4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having an amino acid sequence shown in SEQ ID NO: 2 or a fragment, analog, or derivative thereof;

 (b) a polynucleotide complementary to polynucleotide (a); or

 (c) A polynucleotide that is at least 70% identical to (a) or (b).

 5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence shown in SEQ ID NO: 2.

 6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises the sequence of positions 355 to 657 in SEQ ID NO: 1 or positions 1-1 to 394 in SEQ ID NO: 1. the sequence of.

 7. A recombination vector containing an exogenous polynucleotide, characterized in that it is a recombination constructed by the polynucleotide according to any one of claims 4-6 and a plasmid, virus or a carrier expression vector Carrier.

 8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from one of the following host cells:

 (a) a host cell transformed or transduced with the recombinant vector of claim 7; or

 (b) A host cell transformed or transduced with any of the polynucleotides of claim 4-6.

 9. A method for preparing a polypeptide having cyclin-dependent kinase-CDK411 activity, characterized in that the method comprises:

 (a) culturing the engineered host cell according to claim 8 under the condition of expressing cyclin-dependent kinase-CDK411;

(b) Isolating a polypeptide having cyclin-dependent kinase-CDK411 activity from the culture.

10. An antibody capable of binding to a polypeptide, characterized in that said antibody is an antibody capable of specifically binding to a cyclin-dependent kinase-CDK411.

 11. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they are compounds that mimic, promote, antagonize or inhibit the activity of cyclin-dependent kinase-CDK411.

 12. The compound according to claim 11, characterized in that it is an antisense sequence of a polynucleotide sequence or a fragment thereof as shown in SEQ ID NO: 1.

 13. The use of the compound according to claim 11, characterized in that the compound is used for a method for regulating the activity of cyclin-dependent kinase-CDK411 in vivo and in vitro.

 14. A method for detecting a disease or susceptibility to a polypeptide according to any one of claims 1 to 3, characterized in that it comprises detecting the expression level of the polypeptide, or detecting the polypeptide Activity, or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.

 15. The use of the polypeptide according to any of claims 1-3, which is characterized in that it is used for screening mimics, agonists, antagonists or inhibitors of cyclin-dependent kinase-CDK411; or Identification of peptide fingerprints.

 16. The application of the nucleic acid molecule according to any of the claims 4-6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or for manufacturing Gene chip or microarray.

 17. The use of the polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that the polypeptide, polynucleotide or mimetic, agonist, The antagonist or inhibitor is composed of a safe and effective dose with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with an abnormality of cyclin-dependent kinase-CDK411.

 18. The use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that the polypeptide, polynucleotide or compound is used for preparing for treating malignant tumors, blood, etc. Disease, HIV infection and immune diseases and drugs of various inflammations.