WO2002018640A2

WO2002018640A2 - Gene called aladin, involved in allgrove syndrome, its expression product and their applications

Info

Publication number: WO2002018640A2
Application number: PCT/IB2001/001574
Authority: WO
Inventors: Anastella Tullio-Pelet; Rémi SALOMON; Smail Hadj-Rabia; Stanislas Lyonnet; Arnold Munnich
Original assignee: Institut National De La Sante Et De La Recherche Medicale (Inserm)
Priority date: 2000-08-30
Filing date: 2001-08-30
Publication date: 2002-03-07
Also published as: WO2002018640A3

Abstract

The present invention relates to the identification of a novel gene, called ALADIN involved in Allgrove syndrome, and of the ALADIN gene products, as well as to the diagnostic and therapeutic applications thereof. More particularly, the invention relates to a method of in vitro diagnosis of a disorder of Allgrove syndrome's family, wherein either one or more mutation(s) is detected in the ALADIN gene, or an abnormal expression of ALADIN gene product is detected.

Description

Gene called ALADIN, involved in AUgrove syndrome, its expression product and their applications

FIELD OF THE INVENTION

The present invention relates to the identification of a novel gene, called ALADIN, involved in AUgrove syndrome and of the ALADIN gene products, as well as to the diagnostic and therapeutic applications thereof.

BACKGROUND OF THE INVENTION

AUgrove syndrome is an autosomal recessive condition causing Adrenal insufficiency, Achalasia and Alacrima (Triple A). Life-threatening hypoglycemic episodes and severe feeding difficulties related to achalasia and gastric atonia frequently occur in the first decade. Several lines of evidence suggest that Triple A syndrome results from the mutation of a gene involved in the development of the autonomic nervous system, namely : i) the cholinergic innervation of most affected organs, ii) the abnormal regulation of postural systolic blood pressure, and iii) the occasional anomaly of pupillary reflexes. Late-onset progressive neurological symptoms including cerebellar ataxia, peripheral neuropathy and mild dementia have suggested that the central nervous system could be involved in the disease as well.

The disease gene has been mapped to chromosome 12q13 (Weber et al, 1996 ; Stratakis et al, 1997).

SUMMARY OF THE INVENTION

Linkage analyses and homozygosity mapping allowed the authors of the present invention to refine the mapping of the Triple A locus to the 3.9 cM interval defined by two loci. They have at last cloned the gene responsible for AUgrove syndrome, which they have called ALADIN gene for ALacrima - Achalasia - ADrenal INsuffisiency - Neurologic disorders. The transcript contains an open-reading frame (ORF) which encodes a protein of 547 amino acids the sequence of which is close to a sequence incidentally disclosed by Sugano et al, (EMBL/Genbank/DDBJ databases/ access number AK 000833) on the one hand, and by Li et al (EMBL/Genbank/DDBJ databases/AF 226048) on the other hand. Determination of exon-intron boundaries was performed through sequence comparison between cDNA clones and genomic DNA, which led to the identification of 16 exons.

A subject of the present invention is thus an isolated nucleic acid the sequence of which is selected from the group consisting of sequences SEQ ID n° 1 to SEQ ID n° 17.

SEQ ID n° 1 represents a fragment of the genomic DNA of the ALADIN gene including exon 1 (nucleotide 102 to 224).

SEQ ID n° 2 represents a fragment of the genomic DNA of the ALADIN gene including exon 2 (nucleotide 101 to 228).

SEQ ID n° 3 represents a fragment of the genomic DNA of the ALADIN gene including exon 3 (nucleotide 101 to 156). SEQ ID n° 4 represents a fragment of the genomic DNA of the

ALADIN gene including exon 4 (nucleotide 101 to 192).

SEQ ID n° 5 represents a fragment of the genomic DNA of the ALADIN gene including exon 5 (nucleotide 101 to 147).

SEQ ID n° 6 represents a fragment of the genomic DNA of the ALADIN gene including exon 6 (nucleotide 101 to 199).

SEQ ID n° 7 represents a fragment of the genomic DNA of the ALADIN gene including exon 7 (nucleotide 101 to 244).

SEQ ID n° 8 represents a fragment of the genomic DNA of the ALADIN gene including exon 8 (nucleotide 101 to 221). SEQ ID n° 9 represents a fragment of the genomic DNA of the

ALADIN gene including exon 9 (nucleotide 101 to 225).

SEQ ID n° 10 represents a fragment of the genomic DNA of the ALADIN gene including exon 10 (nucleotide 99 to 159).

SEQ ID n° 11 represents a fragment of the genomic DNA of the ALADIN gene including exon 11 (nucleotide 101 to 195).

SEQ ID n° 12 represents a fragment of the genomic DNA of the _4 4D/N gene including exon 12 (nucleotide 105 to 293). SEQ ID n° 13 represents a fragment of the genomic DNA of the ALADIN gene including exon 13 (nucleotide 101 to 168).

SEQ ID n° 14 represents a fragment of the genomic DNA of the ALADIN gene including exon 14 (nucleotide 101 to 182). SEQ ID n° 15 represents a fragment of the genomic DNA of the

ALADIN gene including exon 15 (nucleotide 101 to 185).

SEQ ID n° 16 represents a fragment of the genomic DNA of the ALADIN gene including exon 16 (nucleotide 101 to 358).

SEQ ID n° 17 is the promoter of the ALADIN gene. In the annexed sequence listing, the cDNA coding sequence

(SEQ ID n° 18), and the aminoacid corresponding sequence (SEQ ID n° 19) are also shown.

The invention further relates to a method of in vitro diagnosis of a disorder of AUgrove syndrome's family, wherein : - either one or more mutation(s) is detected in the ALADIN gene defined as comprising any sequences from SEQ ID n° 1 to n° 17, by means of at least one nucleotide probe or primer which specifically hybridizes with any of said sequences ;

- or an abnormal expression of ALADIN gene product defined as comprising aminoacid sequence SEQ ID n° 19 is detected.

The present invention also provides pharmaceutical compositions comprising an ALADIN polypeptide, or a nucleic acid encoding said polypeptide.

A further subject-matter of the invention is a pharmaceutical composition comprising an anti-sense sequence or an antibody directed against the ALADIN gene product. BRIEF DESCRIPTION OF THE DRAWINGS :

Figure 1 shows mutant Triple A chromosome haplotypes in North

African patients, physical map of the Triple A interval at 12 13, and genomic organization of ALADIN gene.

In Figure 1a, mutant haplotypes in North African families (16 chromosomes studied) at the Triple A locus show linkage disequilibrium with allele 5 at locus D12S1604.

In Figure 1b, physical map of the Triple A critical region shows STSs, polymorphic markers, BACs and genes. BAG clone AC021103 that contains the Triple A ORF is 170 kb in length. Genomic organization of the ALADIN gene is shown underneath (ATG: translation initiation codon; TAG: stop codon). Introns (filled line) and exons (rectangles) are drawn to scale. The position of the mutations is indicated.

Figure 2 shows a sequence analysis and identification of ALADIN gene mutations in Triple A patients. One representative pedigree is shown for each of the five mutations identified. DNA sequence of a control and a homozygote patient (mutant) are presented. Heterozygosity for sequence alterations have been confirmed by DNA sequence analysis in both parents for each of the kindreds studied.

Figure 3a shows prediction of the WD-repeat structure of ALADIN gene product according to the bmerc program. The most significant WD-repeat is indicated by an arrow. Residues in marked columns are predicted to fold into β-strands.

Figure 3b shows relative expression pattern of the ALADIN mRNA as compared to UBIQUITINE (AU: arbitrary unit).

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

The nucleic acid of the invention preferably comprises, or in a preferred embodiment consists in, sequence SEQ ID n° 1 to SEQ ID n° 17. The invention is also directed to the intron and exon sequences included in listed sequences SEQ ID n° 1 to n° 17.

The homologous nucleotide sequences are also part of the present invention. Such homologous sequences are defined as : i) sequences which exhibit a similarity of at least 70 % in comparison with SEQ ID n° 1 to n° 17 ; or ii) sequence which hybridize with SEQ ID n° 1 to n° 17 or their complementary sequences, under stringent conditions of hybridization. Preferably, such homologous sequences show at least 75 % of similarity, preferably at least 85 %, more preferably at least 90 % of similarity with SEQ ID n° 1 to n° 17.

Preferably a homologous nucleotide sequence of the invention specifically hybridizes to the sequences to which it refers or to their complementary sequences under stringent conditions. Parameters that define the conditions of stringency depend upon the temperature at which 50 % of annealed strands separate (T_m).

For sequences comprising more than 30 nucleotides, T_m is calculated as follows : T_m = 81.5 + 0.41 (% G + C) + 16.6 Log (positive ion concentration) - 0.63 (% formamide) - (600/polynucleotide size in base pairs) (Sambrook et al, 1989).

For sequences comprising less than 30 nucleotides, T_m is calculated as follows :

T_m= 4(G + C) + 2 (A + T). Under appropriate stringent conditions avoiding the hybridization of non specific sequences, hybridization temperature is preferably around from 5°C to 10° C below the calculated T_m, and hybridization buffer solutions that are used are preferably solutions with high ionic strength, such as an aqueous 6 X SSC solution for example. Said homologous sequences include mammalian genes coding for the ALADIN geneproduct, preferably of primate, cattle, sheep, swine, or rodent, as well as allelic variants. Such homologous nucleic acids can be readily retrieved by polymerase chain reaction (PCR) amplification of genomic DNA extracts by conventional methods. This involves the use of synthetic oligonucleotide primers matching upstream and downstream of the 5' and 3' ends of the domain to be amplified. Suitable primers can be designed according to the nucleotide sequences SEQ ID n° 1 to SEQ ID n° 17.

Typically, a primer can consist of 10 to 40, preferably 15 to 25 nucleotides. It may also be advantageous to select primers containing C and G nucleotides in a proportion sufficient to ensure efficient hybridization ; e.g, an amount of C and G nucleotides of at least 40 %, preferably 50 % of the total nucleotide amount.

As an example, such primers may be selected from the group consisting of sequences SEQ ID n° 20 to SEQ ID n° 53.

The nucleic acid sequences of the invention are useful for the detection of an abnormality, such as a mutation, in the ALADIN gene or in the transcripts of the ALADIN gene. Such an analysis allows in vitro diagnosis of disorders associated with said abnormality.

A subject of the present invention is a method of in vitro diagnosis of a disorder associated with an abnormality in the ALADIN gene or in the transcripts of the ALADIN gene, wherein one or more mutation(s), preferably inducing a modification of the expression of the ALADIN gene, is detected in the ALADIN gene or in the transcripts of the ALADIN gene.

The authors of the present invention have more particularly investigated the abnormalities in ALADIN gene or in the transcripts of the ALADIN gene which are responsible for AUgrove syndrome.

The following table reports a non exhaustive spectrum of mutations in the ALADIN gene : Table 1 - ALADIN gene mutations

Family Geographic Number of Age at Clinical Consanguinity Allele at the Mutation Location / Nature origin affected diagnosis features D12S1604 locus (homozygous)

(years) 1 France 1 4 4A yes ND _VS4-2A→G intron 4 (splice acceptor)

2 Algeria 1 6 3A yes 5/5 1024C→T (R312X) exon 9 (nonsense)

3 Turquia 3 ND /ND /2 3A yes 2/2 1071insT exon 10 (frameshift)

4 Algeria 2 20 / 14 3A yes 5/5 IVS14+1G→A intron 14 (splice donor)

5 Algeria 2 ND 3A yes 5/5 id id

6 Algeria 1 ND 3A yes 5/5 id id

7 Algeria 1 9 3A yes 5/5 id id

8 Algeria 1 7 3A yes 5/5 id id

9 Algeria 2 9 / 3 4A / 3A no 5/5 id id

10 Tunisia 1 5 4A yes 5/5 id id

11 Tunisia 2 5 / 3 3A / 2A yes 5/5 id id

12 Tunisia 2 6 / 9 3A / 2A no 5/5 id id

13 Spain 1 ND 3A no 5/5 id id

14 Portugal 1 30 4A yes 5/5 1522C→T (R478X) exon 16 (nonsense)

ND: not determined. 4A: Achalasia, Alacrima, Adrenal insufficiency, Autonomous neuropathy and others neurologic manifestations; 3A: the first three only; 2A: the first two only. Allele at the D12S1604 locus: 5 = 265 bp, 2 = 272 bp.

The present invention relates to methods of in vitro diagnosis wherein the nucleic acid sequences of the invention or probes or primers derived thereof are used to detect aberrant synthesis or genetic abnormalities such as genetic rearrangement at the ALADIN gene level.

The present invention is more particularly directed to a method of in vitro diagnosis comprising the steps of :

- contacting a biological sample containing DNA with specific oligonucleotides (primers) permitting the amplification of all or part of the ALADIN gene, the DNA contained in the sample having being rendered accessible, where appropriate, to hybridization, and under conditions permitting a hybridization of the primers with the DNA contained in the biological sample ;

- amplifying said DNA ; - detecting the amplification products ;

- comparing the amplified products as obtained to the amplified products obtained with a normal control biological sample, and thereby detecting a possible abnormality in the ALADIN gene.

The method of the invention can also be applied to the detection of an abnormality in the transcript of the ALADIN gene, by amplifying the mRNAs contained in a biological sample, for example by RT-PCR.

So another subject of the present invention is a method of in vitro diagnosis comprising the steps of :

- producing cDNA from mRNA contained in a biological sample ; - contacting said cDNA with specific oligonucleotides (primers) permitting the amplification of all or part of the transcript of the ALADIN gene, under conditions permitting a hybridization of the primers with said cDNA ;

- amplifying said cDNA ;

- detecting the amplification products ; - comparing the amplified products as obtained to the amplified products obtained with a normal control biological sample, and thereby detecting a possible abnormality in the transcript of the ALADIN gene. This comparison of the amplified products obtained from the biological sample with the amplified products obtained with a normal biological sample can be carried out for example by specific probe hybridization, by sequencing or by restriction site analysis. One skilled in the art knows very well the standard methods for analysing the DNA contained in a biological sample and for diagnosing a genetic disorder. Many strategies for genotypic analysis are available (Antonarakis et al., 1989, Cooper et al., 1991 ).

Preferably, one can use the DGGE method (Denaturing Gradient Gel Electrophoresis), the SSCP method (Single Strand Conformation Polymorphism) and DHPLC Method (Denaturing high-performance liquid chromatography) for detecting an abnormality in the ALADIN gene. Such methods are preferably followed by direct sequencing. The RT-PCR method may be advantageously used for detecting abnormalities in the ALADIN transcript, as it allows to visualize the consequences of a splicing mutation such as exon skipping or aberrant splicing due to the activation of a cryptic site. This method is preferably followed by direct sequencing as well. The more recently developped technique using DNA chip can also be advantageously implemented for detecting an abnormality in the ALADIN gene (Bellis et al., 1997).

The cloning of the ALADIN gene, as well as the identification of various mutations responsible for various disorders according to the invention, allow direct or semi-direct diagnosis. The specificity and reliability of such diagnosis methods are more particularly appreciable for prenatal diagnosis. The nucleic acid sequences of the present invention represent a highly interesting tool for genetic counseling.

Defects in the ALADIN gene, or in the ALADIN gene product cause AUgrove syndrome involving cerebellar ataxia, mild dementia or neuropathy. More generally, this gene could be involved in neurodegenerative diseases, as well as in diseases such as familial glucocorticoϊd insufficiency or oesophagal achalasia. All these diseases involving the ALADIN gene product are here designated as disorders of AUgrove syndrome's family. The ALADIN gene of the present invention codes for polypeptide having the aminoacid sequence encoded shown in SEQ ID n° 19.

This polypeptide can be prepared by any of the standard methods of purification of soluble proteins, by peptide synthesis or by genetic engineering. Said techniques comprise the insertion of a nucleic acid sequence of SEQ ID n° 18 into an expression vector, such as a plasmid, and the transformation of host cells with the expression vector, by any of the methods available to the skilled person, like for instance electroporation. Said expression vector contains a promoter sequence, signals for initiation and termination of translation, as well as appropriate regions for regulation of translation. Its insertion into the host cell may be transient or stable.

These various control signals are selected according to the host cell which may be inserted into vectors which self-replicate in the selected host cell, or into vectors which integrate the genome of said host. Host cells may be prokaryotic or eukaryotic, including but not limiting to bacteria, yeasts, insect cells, mammalian cells, including cell lines which are commercially available.

This polypeptide can be used to produce specific monoclonal or polyclonal antibodies, or fragments thereof, or chimeric or immunoconjugate antibobies.

Polyclonal antibodies can be obtained from serum of an animal immunized against the ALADIN gene product, which can be produced by genetic engineering for example, as above described, according to standard methods well-known by one skilled in the art. Monoclonal antibodies can be obtained according to the standard method of hybridoma culture (Kohler and Milstein, 1975).

Said antibodies are particularly useful for detecting or purifying an ALADIN gene product polypeptide according to the invention in a biological sample.

They are more particularly useful for detecting an abnormal expression of the ALADIN gene product in connection with a disorder of AUgrove syndrome's family. A further subject of the present invention is thus a method of diagnosis comprising the steps of :

- contacting a biological sample from a person to be tested with at least one antibody specifically directed against an ALADIN polypeptide, said antibody being detectably labelled ;

- detecting the formation of immune complexes, and thereby assaying the quantity of ALADIN polypeptide in said sample ;

- comparing the quantity of ALADIN polypeptide in said sample with the quantity of ALADIN polypeptide in a control sample ; any differences being correlated with AUgrove syndrome's family diseases.

This immunoassay can be carried out according to any standard technique well-known by one skilled in the art, such as ELISA (Enzyme-Linked Immunosorbent Assays), E.I.A. (Enzyme-lmmunoAssays), R.I.A. (RadiolmmunoAssays) and the like. Sandwich-type immunoassays are particularly advantageous. For that purpose, the antibodies directed against the ALADIN gene product can be detectably labelled, either directly (for example by means of coupling with a radioisotope, an enzyme, biotine, ...) or indirectly (for example by means of a secondary labelled antibody).

Another subject of the present invention is a pharmaceutical composition comprising, as an active agent, the ALADIN polypeptide, in association with a pharmaceutically acceptable carrier.

A further subject of the present invention is a pharmaceutical composition comprising, as an active agent, a nucleic acid encoding said polypeptide and a pharmaceutically acceptable carrier. Said nucleic acid, preferably inserted in a vector, may be administered in a naked form or in association with transfection facilitating agents.

A further subject of the invention is a pharmaceutical composition comprising, as an active agent, an anti-sense sequence capable of specifically hybridizing with SEQ ID n° 18, in association with a pharmaceutically acceptable carrier.

A still further subject of the invention is a pharmaceutical composition comprising, as an active agent, an antibody directed against said the ALADIN gene product, in association with a pharmaceutically acceptable carrier.

The pharmaceutical compositions of the invention are useful for preventing and/or treating disorders, wherein the ALADIN gene or its expression product is implicated, as above described.

The pharmaceutical compositions of the invention may be administered to a mammal, preferably to a human, in need of a such treatment, according to a dosage which may vary widely as a function of the age, weight and state of health of the patient, the nature and severity of the complaint and the route of administration.

The appropriate unit forms of administration comprise oral forms such as tablets, gelatin capsules, powders, granules and oral suspensions or solutions, sublingual and buccai administration forms, subcutaneous, intramuscular, intravenous, intranasal or intraoccular administration forms and rectal administration forms.

A further subject of the present invention is a method of preventing and/or treating disorders, wherein the ALADIN gene or its expression product is implicated, which comprises administering to a subject in need of a such treatment an amount of a pharmaceutical composition as above defined effective to prevent and/or alleviate said disorders.

The below examples illustrate the invention without limiting its scope.

EXAMPLE 1 : Cloning of the ALADIN gene :

1. Experimental procedures Patients

A total of 21 patients and 58 relatives from 14 families were included in the study. Ten families originated from North Africa (Algeria : 7 families and Tunisia : 3 families). The other families originated from France,

Portugal, Spain and Turkey. Inclusion criteria were : i) laboratory evidence of glucocorticoid deficiency, ii) alacrima with positive Schirmer test, and iii) achalasia of the cardia with positive manometry or barium study, in at least one family member.

Genotyping Genomic DNA was extracted from blood samples with informed consent and linkage studies were performed using microsatellite DNA markers from the Genethon genetic map and the Genome Database (map available on http://www.cephb.fr/cqi-bin/wdb/ceph/systeme/form - http://www.cephb.fr/cgi- bin/wdb/ceph/systeme/form - http://research.marshfieldclinic.org/genetics/) (Dib et al, 1996). Marker informativity varied from 61 to 83 %. Genotyping with microsatellite markers was performed as described, in a 25-μl total reaction volume containing 100 ng genomic DNA (Belin et al, 1998).

Statistical and computer analyses Linkage studies were performed assuming that the disease is inherited as an autosomal recessive trait with full penetrance (normal allele frequency f = .999). Two-point lod scores were calculated using the Linkage Package (Version 5.1 , M-LINK program). For linkage disequilibrium, allele frequencies in mutant chromosomes were compared to 60 control chromosomes in 30 unrelated individuals originating from the same ethnic background. Significance of the test was estimated using the standard χ² test. The common ancestral haplotype was reconstructed and the age of the Triple A mutation was estimated by measuring the number of generations elapsed since the appearance of the founder mutation in the North African population, based on the earliest common ancestor as proposed by Picollo et al, (1996) (ABEL program).

Comparison of the nucleotide ALADIN cDNA sequence to known genes and ESTs was performed using the BLAST program in a non-redundant compilation of the EMBL and GenBank databases. Amino-acid comparisons were carried out with the non-redundant Swiss-Prot database using the BLASTP program. Multiple alignments were performed using CLUSTAL W, protein-domain homologies and motifs predicted using the Prosite and bmerk databases, and membrane topology using the PSORT program. Physical mapping and BAC contig construction

For physical mapping of the Triple A locus, the YACs of the 12q13 region were selected from the CEPH-Genethon database (Chumakov et al, 1993 ; Burke et al, 1991) using polymorphic markers mapped to the critical region. A human genomic BAC library of the CNS was screened by PCR using microsatellites, STS and ESTs. The length of BAC and YAC clones was evaluated by field inversion gel electrophoresis (FIGE Mapper, Biorad, Richmond, CA, USA) under the following conditions: forward : 180V, reverse : 120 V, with a 0.1-2 s switch time for 16 h at 20°C. The authors of the invention designed STSs by directly sequencing the ends of BAC clones. The BAC DNA was isolated and directly sequenced (Osoegawa) and sequence data were integrated to the CNS contig.

2. Results :

Linkage analysis allowed the authors of the present invention to refine the mapping of the Triple A locus to the 3.9 cM interval defined by loci D12S368 and D12S312 (Zmax = 10.89 at θ = 0, at locus D12S1604, Fig. 1a). All affected individuals born to consanguineous parents were homozygotes for each of the markers comprised in this region. Moreover, each of the affected individuals in eight North African inbred families shared a 1 cM common ancestral haplotype (haplotype 5-2-5-4 at loci D12S1604, D12S1651 , D12S1586 and D12S325 respectively, Fig. 1a). Interestingly, all North African patients were homozygotes for an unfrequent allele (allele 5) at the D12S1604 locus (versus 9.1 % in control North African chromosomes, p<0.001 , Fig.1a). These data supported an ancient founder effect in Triple A families of North African ancestry and strongly suggested that the disease gene maps at (or close to) the D12S1604 locus. In order to construct a detailed physical map of the region, the authors of the invention screened YAC and BAC libraries with the microsatellites DNA markers of the D12S1618-D12S1651 interval (Fig. 1 b). Three YACs encompassed the entire Triple A interval (YACs 813h5, 927f5, and 903f1), while the region in full linkage disequilibrium was included into YAC 903f1 only (1.7 Mb, Fig. 1 b). Interestingly, BAC AC0ACA566F07 contained both the D12S1618 and D12S1604 loci that were in partial and complete linkage disequilibrium with the Triple A mutation respectively (Fig. 1b). This suggested that this BAC encompassed the centromeric boundary of the Triple A gene. Extensive sequencing revealed that five genes map to BAC AC0ACA566F07 (Fig. 1 b), namely the SP1 (UniGene Hs.2021), ZPK (Hs.211601 ), polyRC (Hs.63525), TAR (Hs.326), and AMHR (Hs.123014) genes, but none of them showed sequence variation in our patients and no other significant ORF could be detected in this BAC, suggesting that the Triple A locus was telomeric to D12S1604, most probably in the D12S1604- D12S1651 genetic interval.

The Centre National de Sequencage (CNS) BAC library was further screened using the most telomeric STS of BAC ACO566F07 (Fig. 1b). Two BAC clones (1035M9 and 541 P23) were identified that contained a novel EST (AK000833, Fig 1b). This EST (1,792 bp) derives from a human adipose tissue cDNA library and encodes an hitherto unknown protein (NEDO human cDNA sequencing project, submission 2-15-2000). Genomic sequence alignment and exon-prediction programs revealed that the AK000833 EST is transcribed from a 16 exon gene, mapping 30 kb telomeric to D12S1604 (Fig. 1b). This gene was regarded as a candidate in Triple A syndrome, based on fine linkage disequilibrium mapping.

EXAMPLE 2 : Identification of mutations in unrelated patients with AUgrove syndrome

1. Experimental procedure Mutation screening Intronic primers derived from the sequences of the 15 ALADIN gene introns were designed by aligning the cDNA sequence of EST AK000833 with the genomic sequence (http://www-shgc.stanford.edu). Primers and PCR conditions were selected using the Oligo 5.0 program (NBI): exon 1 , 5'- GTCCGCATACGAATCTAGCCC -3' (SEQ ID n° 20) and 5'- AGACTCTGTGACCCTGCCCCT-3' (SEQ ID n° 21) ; exon 2, 5'- ATCTCTTATACTTAGCCCAGC-3' (SEQ ID n° 22) and 5'- GAATAAAAGTCTTTTGAAGAACAC -3' (SEQ ID n° 23) ; exon 3, 5'- GTGCCCATATTTTTAATACAT-3' (SEQ ID n° 24) and 5'- GGCTAAAAGAGGCTGAGCCAA-3' (SEQ ID n° 25) ; exon 4, 5'- GGACCTGGGGAGTGCCTGTCC-3' (SEQ ID n° 26) and 5'- AAGTCATCACACCCAACCCTG-3' (SEQ ID n 27); exon 5, 5'- TGACTTCAGAGGGTAGGAGTG-3' (SEQ ID n° 28) and 5'- GAGCAATCAGAAAAGGAGTAG-3' (SEQ ID n° 29) ; exon 6, 5'- AAAAGTAGGAAAAAACCATGT-3' (SEQ ID n° 30) and 5'- CATGAATCAGGTTCAAGAACT-3' (SEQ ID n° 31) ; exon 7, 5'- ATCATCCTTCTTCTCTGTGGCTTT-3'(SEQ ID n° 32) and 5'- GTGAGGACAAAGAACTTCTCC-3' (SEQ ID n° 33) ; exon 8, 5'- CAGAGTGGGCCATCAGGATAG G -3' (SEQ ID n° 34) and 5'- CCGAGTGAGGAACACTTTTGC C-3" (SEQ ID n° 35) ; exon 9 5'-

TTTGTACATTAGAGAGGCCAG-3' (SEQ ID n° 36) and 5'- CTAAGTTCTAAAAGTTGGACC-3' (SEQ ID n° 37) exon 10, 5'- AGAAAGGCACTTAGCTCCTGG-3' (SEQ ID n° 38) and 5'- GAATGCAGGAGGGAAAGTAGA-3' (SEQ ID n° 39) ; exon 11 , 5'- CCAATGGGCCCCTGATGCTCCCAA-3' (SEQ ID n 40) and 5'- CTCCTAAGCTTCTATATTTCC-3' (SEQ ID n° 41 ) exon 12, 5'- CTTAGGAGA1 rCGAGGTGTT-3' (SEQ ID n° 42) and 5'- GCCTCTCCCCCAAGCCTGTGGGTA-3' (SEQ ID n° 43) ; exon 13, 5'- AGATGGTGAGGAGAGGTGAGCTGA-3' (SEQ ID n° 44) and 5'- CCCAGGACATGGGCAGAGGAG-3' (SEQ ID n° 45) ; exon 14, 5'- ATCTAATGAGGCCGTGCCCTGGCC-3' (SEQ ID n° 46) and 5'- AACCGGAGGCAAGAAGGGAGC-3' (SEQ ID n° 47) ; exon 15, 5'- GGTCTGGACTTCTCACCAGCCTTC-3' (SEQ ID n° 48) and 5'- CTGGGCCCAAAGAAGGGCCACCTG-3' (SEQ ID n° 49) ; exon 16, 5'- AGTTGGATGGAGAAGCTGAGG-3' (SEQ ID n° 50) and 5'- AGTGGCTAAAAAGTGACAGAA-3' (SEQ ID n° 51). PCR-amplified DNA was sequenced on both strands using the fluorochrome PRISM kit (PE Biosystems). Electrophoresis was carried out for 12 h on a 373 automated DNA sequencer (ABI).

2. Results The 16 coding exons and intron-exon junctions were sequenced in 14 unrelated families and a total of five homozygous mutations were detected in 14/14 index cases (Fig 2 and Table 1). Each of the five mutations resulted in either a premature stop codon or a frameshift, predicted to produce a truncated, presumably, nonfunctional protein. Indeed, two nonsense mutations occurred in CpG dinucleotides in exons 9 and 16 respectively (mutations R312X and R478X). The third mutation, a single nucleotide insertion at position 1071 in exon 10 (1071 insT), resulted in translation termination 38 codons downstream the coding sequence (Fig. 2 and Table 1 ). The other two mutations were located in canonical consensus splice sites, namely the acceptor site of intron 4 (IVS4 -2 A→G) and the donor site of intron 14 (IVS14 +1 G→A, Fig. 3 and Table 1). The IVS4 -2 A→G mutation resulted in the retention of intron 4 in the mutant mRNA and in a premature translation termination 47 codons downstream exon 4. On the other hand, the IVS14 +1 G→A mutation produced various abnormal transcripts, which resulted in premature translation termination upstream exon 16. This latter mutation was found in 9/10 families of North African ancestry carrying allele 5 at the D12S1604 locus, thus confirming our prediction of linkage disequilibrium. The base changes segregated with the disease in each of the affected families studied (Fig 2) and heterozygosity was confirmed in all parents. Finally, none of the sequence alterations could be found in 60 control chromosomes matched for their ethnic background. EXAMPLE 3 : Expression of the ALADIN gene

1. Experimental procedure Northern-blot analysis EST AKOOO833 was amplified using primers 5'-

CACCATAGTCCCCTCCCTGAA-3' (SEQ ID n° 52) and 5'-CAGGGAAGGAGC TCAAACACA -3' (SEQ ID n° 53) (from exon 7 to exon 14), labelled with [32P]-dCTP and used as a probe on a human fetal and adult multiple-tissue dot blots (Clontech) and on human adult Northern blots (control probe : UBIQUITINE).

2. Results

The gene product is expected to contain four putative WD- repeats (Fig. 3a). Northern blot and dot blot studies showed that the gene is widely expressed but much stronger signals were observed in endocrine and neuroendocrine derivatives (adrenal and pituitary), the cerebellum and the corpus callosum (Fig. 3b).

The presence of 4 WD-repeat modules suggest that this protein belongs to an ancient regulatory-protein family whose members may be involved in functions as diverse as cell division, cell-fate determination, transcription or transmembrane signaling (Neer et al, 1994 ; Smith et al, 1999). Along these lines, ACTH-resistant glucocorticoid deficiency in Triple A syndrome patients may suggest that the ALADIN gene product could be involved in the ACTH signaling pathway mediated by the melanocortin 2 receptor (MC2R) (Clark et al, 1998 ; Naville et al, 1996). In particular, it could play a role in addressing of the MC2R to the membrane as suggested by the involvement of several WD-repeat proteins in intracellular membrane trafficking (Smith et al, 1999). Furthermore, since the MC2R is expressed in the adrenal cortex only, the ALADIN gene product may be associated with other membrane receptors in other tissues such as the lacrymal glands, oesophageal cardia, and brain. Conclusion

Linkage and homozygosity mapping allowed the authors of the invention to reduce the Triple A gene interval to 3.9 cM only, while strong linkage disequilibrium further reduced this critical region to a 180 kb BAC contig, as all North African patients shared a rare genotype at the D12S1604 locus mapping to this BAC contig. Since EST AK00833 : i) maps 30 kb telomeric to D12S1604 locus on the contig, ii) is strongly expressed in organs and tissues targeted in the disease, and iii) is consistently mutated in the patients, it is now clear that this EST, now referred to as ALADIN (for ALacrima - Achalasia - ADrenal INsuffisiency - Neurologic disorders), corresponds to the disease causing gene.

REFERENCES

- Antonarakis et al, (1989) Diagnosis of genetic disorders at the DNA level. N Engl J. Med. 320 : 153-163.

- Belin et al, (1998) SHOX mutations in dyschondrosteosis (Leri- Weill syndrome). Nature Genet. 19, 67-69

- Bellis et al, (1997) medecine/sciences, 13 : 1317-24.

- Burke et al, (1991) The role of Yeast artificial chromosome clones in generating genome maps. Curr. Opin. Genet. Dev. 1, 69-74

- Chumakov et al, (1993) A YAC contig map of the human genome. Nature 377, 175-197

- Clark et al, (1998) Adrenocorticotropin insensitivity syndromes. Endocrine Reviews 19, 828-843 - Cooper et al, (1991) Diagnosis of genetic disease using recombinant DNA, 3^rd Edition, Hum Genet., 87: 519-560.

- Dib et al, (1996) A comprehensive genetic map of the human genome based on 5,264 microsatellites. Nature 380, 152-154

- Kόhler and Milstein, (1975), Nature vol. 256, 495-497. - Naville et al, (1996) Demonstration by transfection studies that mutations in the adrenocorticotropin receptor gene are one cause of the hereditary syndrome of glucocorticoid deficiency. J Clin Endocr Metab 81, 1442-1448

- Neer et al, (1994) The ancient regulatory-protein of WD-repeat protein family. Nature 371 , 297-300

- Osoegawa et al, (1998) An Improved Approach for construction of Bacterial Artificial Chromosome Libraries. Genomics 52, 1-8

- Piccolo et al, (1996) A founder mutation in the γ-sarcoglycan gene of Gypsies possibly predating their migration out of India. Hum. Mol. Genet. 5, 2019-2022

- Sambrook et al, (1989) In Molecular cloning: a laboratory manual, (Cold spring Harbor Laboratory Press).

- Smith et al, (1999) The WD repeat: a common architecture for diverse functions. Trends Biochem. Sci. 24,181-185

- Stratakis et al, (1997) Segregation of AUgrove (Triple-A) syndrome in Puerto Rican kindreds with chromosome 12 (12q13) polymorphic markers. Proc. Assoc. Am. Physicians 109, 478-482

- Weber et al, (1996) Linkage of the gene for the Triple A syndrome to chromosome 12q13 near the type II keratin gene cluster. Hum. Mol. Genet. 5, 2061-2066

Claims

1. Isolated nucleic acid, the sequence of which is selected from the group consisting of SEQ ID n° 1 to SEQ ID n° 17.

2. Isolated nucleic acid, the sequence of which differs from said nucleic acid sequences of claim 1 by one or more mutation(s) selected from the mutations defined in table 1.

3. A method of in vitro diagnosis of a disorder of AUgrove syndrome's family, wherein one or more mutation(s) is detected in the ALADIN gene defined as comprising any sequences from SEQ ID n° 1 to n° 17, by means of at least one nucleotide probe or primer which specifically hybridizes with any of said sequences.

4. The method of in vitro diagnosis according to claim 3 comprising the steps of :

- contacting a biological sample containing DNA with specific oligonucleotide primers permitting the amplification of all or part of the ALADIN gene, the DNA contained in the sample having being rendered accessible, where appropriate, to hybridization, and under conditions permitting a hybridization of the primers with the DNA contained in the biological sample ;

- amplifying said DNA ;

- detecting the amplification products ;

5. A method of in vitro diagnosis of a disorder of AUgrove syndrome's family, wherein one or more mutation's is detected in the ALADIN gene transcript defined as comprising sequence SEQ ID n° 18, by means of at least one nucleotide probe or primer which specifically hybridizes with said sequence.

6. The method of in vitro diagnosis according to claim 5 comprising the steps of :

- producing cDNA from mRNA contained in a biological sample ;

- contacting said cDNA with specific oligonucleotide primers permitting the amplification of all or part of the transcript of the ALADIN gene, under conditions permitting a hybridization of the primers with said cDNA ;

- amplifying said cDNA ;

- detecting the amplification products ;

- comparing the amplified products as obtained to the amplified products obtained with a normal control biological sample, and thereby detecting a possible abnormality in the transcript of the ALADIN gene.

7. A method of in vitro diagnosis of a disorder of AUgrove syndrome's family, wherein an abnormal expression of ALADIN gene product defined as comprising aminoacid sequence SEQ ID n° 19 is detected.

8. The method of in vitro diagnosis according to claim 7, comprising the steps of :

- comparing the quantity of ALADIN polypeptide in said sample with the quantity of ALADIN polypeptide in a control sample ; any differences being correlated with a disorder of AUgrove syndrome's family.

9. A method for preventing and/or treating a disorder of AUgrove syndrome's family, which comprises administering to a subject in need of a such treatment an amount of a pharmaceutical composition comprising an active agent selected from the group consisting of :

- a nucleic acid comprising sequence SEQ ID n° 18 ;

- a polypeptide comprising sequence SEQ ID n° 19 ;

- an antisense sequence capable of specifically hybridizing with sequence SEQ ID n° 18 ; and

- an antibody directed against a polypeptide comprising sequence SEQ ID n° 19 ; in association with a pharmaceutically acceptable carrier.