WO2002016656A2

WO2002016656A2 - Methods for detecting mutations in the human scurfy/foxp3 gene

Info

Publication number: WO2002016656A2
Application number: PCT/US2001/041814
Authority: WO
Inventors: Mary E. Brunkow
Original assignee: Celltech R & D, Inc.
Priority date: 2000-08-21
Filing date: 2001-08-20
Publication date: 2002-02-28
Also published as: AU2001285467A1; WO2002016656A3

Abstract

Methods and compositions are provided for detecting a mutation of the human ortholog of the murine scurfy gene, called FOXP3. Also provided are oligonucleotide primers for amplifying specific regions of the FOXP3 gene. Such primers find use in providing polynucleotides from humans suspected of having a FOXP3 gene mutation because of family history and/or clinical indications.

Description

METHODS FOR DETECTING MUTATIONS IN THE HUMAN SCURFY/EQZP3 GENE

BACKGROUND OF THE INVENTION

Field of the Invention The-present invention relates generally to pharmaceutical products and methods and, more specifically, to methods and compositions useful for detecting mutations in the FOXP3 gene and for diagnosing FOXP3 gene-related diseases in humans.

Description of the Related Art Mice hemizygous for the X-linked mutation, scurfy (sf), exhibit a severe lymphoproliferative disorder. In particular, males hemizygous (X^sf/Y) for the scurfy mutation develop a progressive lymphocytic infiltration of the lymph nodes, spleen, liver and skin resulting in gross morphological symptoms which include splenomegaly, hepatomegaly, greatly enlarged lymph nodes, runting, exfoliative dermatitis, and thickened malformed ears (Godfrey et ah, Amer. J. Pathol. 138:1379, 1991; Godfrey et al, Proc. Natl. Acad. Sci. USA 88:5528, 1991). Other clinical symptoms include elevated leukocyte counts, hypergammaglobulinemia, and severe anemia (Lyon et al., Proc. Natl. Acad. Sci. USA 87:2433, 1990); the death of affected males usually occurs by 3 weeks of age. The sf locus has been mapped to the extreme proximal region of the X chromosome, approximately 0.7 centimorgans from the locus for sparse-fur (spf) (Lyon et al, Proc. Natl. Acad. Sci. USA 87:2433, 1990; Blair et al, Mamm. Genome 5:652, 1994), itself a point mutation within the ornithine transcarbamylase gene (Otc) (Veres et al, Science 237:415, 1987). The ,s/Tocus is also tightly linked to the murine Gatal, Tcfe3, and Wasp loci (Blair et al, Mamm. Genome 5:652, 1994; Deny et al, Genomics 29:471, 1995). The mouse scurfy gene, and its human ortholog, were recently cloned and assigned the gene name designations Foxp3 (mouse) and FOXP3 (human)(Brunkow et al, Nat. Genet. 27:68, 2001).

There is a need in the art for compositions and methods for identifying the human disease affected by mutations in the FOXP3 gene and for diagnosing FOXP3 gene-related diseases. As described in detail herein below, the present invention fulfills these and other related needs.

BRIEF SUMMARY OF THE INVENTION

The present invention relates generally to the detection of FOXP3 gene mutations associated with human disorders that may or may not be similar in phenotype to the mouse scurfy disorder.

The invention further relates to mutations, including missense, nonsense, insertions or deletions, within the FOXP3 gene such as, for example, within the region encoding the forkhead/winged helix-like domain of the FOXP3 protein. The invention also relates to oligonucleotides capable of specifically binding to a mutated region within the human FOXP3 gene.

The invention further relates to oligonucleotides capable of specifically binding to a polynucleotide encoding a mutation within the FOXP3 gene such as, for example, within the region encoding within the forkhead/winged helix-like domain of the FOXP3 protein.

The invention also relates to pairs of oligonucleotides useful for amplifying regions of human FOXP3 genomic DNA. Exemplary oligonucleotides suitable for amplifying DNA from human FOXP3 genomic DNA may be selected from the group consisting of: SEQ ID NO: 1 and SEQ ID NO:2;

SEQ ID NO:3 and SEQ ID NO:4;

SEQ ID NO:5 and SEQ ID NO:6;

SEQ ID NO:7 and SEQ ID NO:8;

SEQ ID NO:9 and SEQ ID NO:10; SEQ ID NO: 11 and SEQ ID NO: 12;

SEQ ID NO: 13 and SEQ ID NO: 14;

SEQ ID NO:15 and SEQ ID NO:16; and

SEQ ID NO:17 and SEQ ID NO:18. The invention also relates to pairs of oligonucleotides useful for amplifying regions of human FOXP3 mRNA and/or cDNA. Exemplary pairs of oligogonucleotides may be selected from the group consisting of SEQ ID NO:30 and SEQ ID NO:31.

The invention also relates to methods of detecting a mutation(s) in a human FOXP3 gene using one or more of the oligonucleotides and polynucleotides disclosed herein. Exemplary methods comprise the steps of isolating a population of nucleic acids from a biological sample, amplifying a FOXP3 gene specific nucleic acid from said isolated population of nucleic acids, and detecting said mutation in said FOXP3 gene. Suitable populations of nucleic acids that are isolated from biological samples may include mRNA, cDNA and/or genomic DNAs.

By some embodiments of the present invention, the step of amplification may be performed by a polymerase chain reaction wherein said polymerase chain reaction is performed with a pair of oligonucleotides. Certain embodiments provide that the step of detecting said mutation in

FOXP3 gene further comprises the steps of determining the nucleotide sequence of said FOXP3 gene specific nucleic acid, and comparing the sequence of said FOXP3 gene specific nucleic acid with the FOXP3 cDNA and FOXP3 genomic DNA sequences as presented herein as SEQ ID NOs:19 and 20, respectively, wherein a difference between the sequence of said amplified FOXP3 specific nucleic acid and the sequence of wild- type FOXP3 indicates the presence of a FOXP3 mutation the nucleic acid of said biological sample.

The invention further relates to oligonucleotide fragments (including probes and primers) which are based upon the sequence of the human FOXP3 gene. Such fragments are at least 8, 10, 12, 15, 20, or 25 nucleotides in length, and may extend up to 100, 200, 500, 1000, 1500, or 2000 nucleotides in length.

The invention also relates to a polypeptide encoded by a human FOXP3 gene or oligonucleotide fragments thereof wherein the FOXP3 gene or oligonucleotide fragments contains one or more mutation within one or more regions that encode a FOXP3 functional domain. The present invention also provides antibodies capable of binding to the inventive polypeptides, and to methods of detecting a mutated protein using the antibodies.

The invention still further relates to a kit for detection of a mutated FOXP3 gene or an expression product thereof, comprising at least one oligonucleotide

(e.g., primer or probe) or antibody of the invention, a carrier, reagent(s), an optional control sample, and instructions for carrying out the assay. Exemplary kits may be used according to one or more of the methods disclosed herein.

These and other aspects of the present invention will become evident upon reference to the following detailed description and attached drawings. In addition, various references are set forth herein which describe in more detail certain procedures, compounds, sequences, or compositions (e.g., plasmids, etc.), and are therefore incorporated by reference in their entirety.

DETAILED DESCRIPTION OF THE INVENTION The present invention relates generally to methods and compositions useful for diagnosing EOZP3-related diseases and to methods and compositions for detecting a mutation in a human scurfy/EQ P3 gene.

As discussed in more detail below this discovery has led to the development of assays that may be utilized to identify mutations in the human FOXP3 gene that affect expression and/or function of FOXP 3 gene products.

The X-linked recessive mouse mutant, scurfy (sf), has provided a valuable system in which to study the regulation of T lymphocyte activation.

Hemizygous males succumb to a severe and rapidly fatal lymphoproliferative disease within a few weeks after birth. Carrier females are unaffected. The disease is characterized by multiorgan lymphocyte infiltration, which leads to greatly enlarged lymph nodes, hepatosplenomegaly and exfoliative dermatitis. Other clinical features include elevated leukocyte counts, hypergammaglobulinemia and severe anemia (Lyon et al, Proc Nat'l Acad. Sci USA 87:2433-37, 1990). The increase in expression of a number of cytokines, most notably GM-CSF, IL-2, IL-4, IL-5, IL-6, IL-7, IL-10, IFN-γ and TNF-oc are consistent with the range of pathological symptoms leading to death.

The disease appears to result from an inability to properly regulate T cell function (Kanangat et al, Eur. J. Immunol. 26:161-65, 1996; Blair et al, J. Immunol 153:3764-74, 1994; Clark et al, J. Immunol 162:2546-54, 1999). The effector cells in the disease have been shown to be CD4+CD8- T cells, in that H-2-compatible nude or scid mice transplanted with sf CD4+ cells exhibit the symptoms of a progressive lymphoproliferative, scurfy-like disease 3-4 weeks after transplantation (Blair et al, J. Immunol. 153:3764-74, 1994; Godfrey et al, Am. J. Pathol. 145:281-86, 1994). Histological examination of lesions in the skin and spleen of these animals reveal little difference from lesions in sf mutant males. Flow cytometric analyses of freshly explanted sf CD4+ cells reveal an increased number of cells expressing activation- related cell surface markers, such as CD44, CD69, CD25 (IL-2R), CD80 and CD86 (Blair et al, J. Immunol. 153:3764-74, 1994; Clark et al, J. Immunol. 162:2546-54, 1999). In in vitro activation studies purified mutant CD4+CD8- T cells are exquisitely sensitive to low levels of stimulation through the T cell receptor (TCR). In addition, they retain the requirement for two activation signals, one through the TCR and the second through a co-receptor such as CD28, for maximal activation (Clark et al, J. Immunol. 162:2546-54, 1999).

The scurfy mutation was originally mapped to the proximal portion of the X chromosome (Lyon et al, Proc Nat'l Acad. Sci USA 87:2433-37, 1990), tightly linked to the genes for the hematopoietic-specific transcription factors, Gatal and Tcfe3 (Blair et al, Mamm. Genome 5:652-54, 1994), as well as the mouse ortholog of the gene responsible for Wiskott-Aldrich syndrome (WAS, OMIM 301000), or Wasp (Derry et al, Cell 78:635-44, 1994). The molecular basis of the scurfy mutation was recently shown to be a frameshift mutation in the gene encoding a novel member of the forkhead family of proteins, designated Foxp3 (Brunkow et al, Nat. Genet. 27:68, 2001). The human ortholog was cloned by homology, and is designated FOXP3.

According to the invention, mutations in the human scurfy/EOZP3 gene causing human X-linked disorders, which may or may not be similar to scurfy disease in mice, may be detected using the methods described herein. An example of such a human disorder is immune dysregulation, polyendocrinopathy, enteropathy, X-linked syndrome (IPEX, XPID, or PIDX; MIM 304930), which resembles the mouse scurfy phenotype in several respects. It is characterized by variable expression in hemizygous males of autoimmune polyendocrinopathy (type I diabetes melitus and/or hypothyroidism), severe enteropathy, immunodeficiency, eczema, and growth retardation or cachexia beginning in infancy or early childhood. The disorder has been mapped to Xp23.3-Xql3.3 (Ferguson et al, Am. J. Med. Genet. 90:390-97, 2000; Bennett et al, Am. J. Hum. Genet. 66:461-68, 2000), a region which includes the human scurfy/EQZP3 gene. As described in EXAMPLE 1, mutations within the forkhead domain of the FOXP3 gene have been detected in IPEX patients (Wildin et al, Nat. Genet. 27:18, 2001; Bennett et al, Nat. Genet. 27:20, 2001). It is understood, however, that the present invention provides a method for detecting mutations present anywhere within the FOXP3 gene, and these mutations may be associated with any other as yet not described human disorder.

Nucleic Acid Molecules, Proteins, and Methods of Producing Proteins The following terms are used as defined herein:

"Scurfy" refers to an inherited disease in mice that exhibit a severe lymphoproliferative disorder (see, e.g., Lyon et al, Proc. Natl. Acad. Sci. USA 87:2433, 1990). "EøX_/?3" refers to the forkhead domain-containing gene, which is mutated in the scurfy mouse mutant. "Foxp3" refers to the protein encoded by the mouse Foxp3 gene. "FOXP3" refers to the human ortholog of the murine Foxp3 gene. "FOXP3" refers to the protein encoded by the human FOXP3 gene. The cDNA sequences for murine Foxp3 and human FOXP3 as well as the amino acid sequences of murine Foxp3 and human FOXP3 are disclosed in U.S. Patent Application No. 09/372,668 wherein the mouse scurfy gene is designated Fkh^and the human ortholog is designated FKH^. The human FOXP3 cDNA sequence is also provided herein as SEQ ID NO: 19. The genomic sequence for human FOXP3 is disclosed in Genbank Accession No. AF235097 and herein as SEQ ID NO:20. Genbank Accession No. AF235097 and U.S. Patent Application No. 09/372,668 are incorporated herein by reference in their entireties for all purposes.

"Molecule" should be understood to include proteins or peptides (e.g., antibodies, recombinant binding partners, peptides with a desired binding affinity), nucleic acids (e.g., DNA, RNA, chimeric nucleic acid molecules, and nucleic acid analogues such as PNA), and organic or inorganic compounds.

"Nucleic acid" or "nucleic acid molecule" refers to any of deoxyribonucleic acid (DNA), ribonucleic acid (RNA), oligonucleotides, fragments generated by the polymerase chain reaction (PCR), and fragments generated by any of ligation, scission, endonuclease action, and exonuclease action. Nucleic acids can be composed of monomers that are naturally-occurring nucleotides (such as deoxyribonucleotides and ribonucleotides), or analogs of naturally-occurring nucleotides (e.g., α-enantiomeric forms of naturally-occurring nucleotides), or a combination of both. Modified nucleotides can have modifications in sugar moieties and/or in pyrimidine or purine base moieties. Sugar modifications include, for example, replacement of one or more hydroxyl groups with halogens, alkyl groups, amines, and azido groups, or sugars can be functionalized as ethers or esters. Moreover, the entire sugar moiety can be replaced with sterically and electronically similar structures, such as aza-sugars and carbocyclic sugar analogs. Examples of modifications in a base moiety include alkylated purines and pyrimidines, acylated purines or pyrimidines, or other well-known heterocyclic substitutes. Nucleic acid monomers can be linked by phosphodiester bonds or analogs of such linkages. Analogs of phosphodiester linkages include phosphorothioate, phosphorodithioate, phosphoroselenoate, phosphorodiselenoate, phosphoroanilothioate, phosphoranilidate, phosphoramidate, and the like. The term "nucleic acid" also includes so-called "peptide nucleic acids," which comprise naturally-occurring or modified nucleic acid bases attached to a polyamide backbone. Nucleic acids can be either single stranded or double stranded.

"Isolated nucleic acid molecule" is a nucleic acid molecule that is not integrated in the genomic DNA of an organism. For example, a DNA molecule that encodes a gene that has been separated from the genomic DNA of a eukaryotic cell is an isolated DNA molecule. Another example of an isolated nucleic acid molecule is a chemically-synthesized nucleic acid molecule that is not integrated in the genome of an organism. "Promoter" is a nucleotide sequence that directs the transcription of a structural gene. Typically, a promoter is located in the 5' region of a gene, proximal to the transcriptional start site of a structural gene. If a promoter is an inducible promoter, then the rate of transcription increases in response to an inducing agent. In contrast, the rate of transcription is not regulated by an inducing agent if the promoter is a constitutive promoter.

"Vector" refers to an assembly, which is capable of directing the expression of desired protein. The vector must include transcriptional promoter elements that are operably linked to the genes of interest. The vector may be composed of deoxyribonucleic acids ("DNA"), ribonucleic acids ("RNA"), or a combination of the two (e.g., a DNA-RNA chimeric). Optionally, the vector may include a polyadenylation sequence, one or more restriction sites, as well as one or more selectable markers such as neomycin phosphotransferase or hygromycin phosphotransferase. Additionally, depending on the host cell chosen and the vector employed, other genetic elements such as an origin of replication, additional nucleic acid restriction sites, enhancers, sequences conferring inducibility of transcription, and selectable markers, may also be incorporated into the vectors described herein.

"Isolated" in the case of proteins or polypeptides, refers to molecules which are present in the substantial absence of other biological macromolecules, and appear nominally as a single band on SDS-PAGE gel with coomassie blue staining. "Isolated" when referring to organic molecules means that the compounds are greater than 90% pure utilizing methods which are well known in the art (e.g., NMR, melting point).

"Cloning vector" refers to nucleic acid molecules, such as a plasmid, cosmid, or bacteriophage, that have the capability of replicating autonomously in a host cell. Cloning vectors typically contain one or a small number of restriction endonuclease recognition sites at which foreign nucleotide sequences can be inserted in a determinable fashion without loss of an essential biological function of the vector, as well as nucleotide sequences encoding a marker gene that is suitable for use in the identification and selection of cells transformed with the cloning vector. Marker genes typically include genes that provide tetracycline resistance or ampicillin resistance.

"Expression vector" refers to a nucleic acid molecule encoding a gene that is expressed in a host cell. Typically, gene expression is placed under the control of a promoter, and optionally, under the control of at least one regulatory element. Such a gene is said to be "operably linked to" the promoter. Similarly, a regulatory element and a promoter are operably linked if the regulatory element modulates the activity of the promoter.

"Recombinant host" refers to any prokaryotic or eukaryotic cell that contains either a cloning vector or expression vector. This term also includes those prokaryotic or eukaryotic cells that have been genetically engineered to contain the cloned gene(s) in the chromosome or genome of the host cell.

In eukaryotes, RNA polymerase II catalyzes the transcription of a structural gene to produce mRNA. A nucleic acid molecule can be designed to contain an RNA polymerase II template in which the RNA transcript has a sequence that is complementary to that of a specific mRNA. The RNA transcript is termed an "anti- sense RNA" and a nucleic acid molecule that encodes the anti-sense RNA is termed an "anti-sense gene." Anti-sense RNA molecules are capable of binding to mRNA molecules, resulting in an inhibition of mRNA translation.

An "anti-sense oligonucleotide specific for Foxp3" or a Foxp3 anti- sense oligonucleotide" is an oligonucleotide having a sequence (a) capable of forming a stable triplex with a portion of the gene, or (b) capable of foπrring a stable duplex with a portion of an mRNA transcript. Similarly, an "anti-sense oligonucleotide specific for "Foxp3" or a Foxp3 anti-sense oligonucleotide" is an oligonucleotide having a sequence (a) capable of forming a stable triplex with a portion of the Foxp3 gene, or (b) capable of forming a stable duplex with a portion of an mRNA transcript of the Foxp3 gene.

A "ribozyme" is a nucleic acid molecule that contains a catalytic center. The term includes RNA enzymes, self-splicing RNAs, self-cleaving RNAs, and nucleic acid molecules that perform these catalytic functions. A nucleic acid molecule that encodes a ribozyme is termed a "ribozyme gene." Abbreviations: YAC, yeast artificial chromosome; PCR, polymerase chain reaction; RT-PCR, PCR process in which RNA is first transcribed into DNA at the first step using reverse transcriptase (RT); cDNA, any DNA made by copying an RNA sequence into DNA form. As utilized herein "Foxp3" refers to the gene product of the Foxp3 gene (irrespective of whether the gene is obtained from humans, mammals, or any other warm-blooded animal). When capitalized "FOXP3" (the gene product) and "FOXP3" (the gene) should be understood to be derived from humans.

Although various proteins, nucleic acid molecules and oligonucleotides related to a human EQZP3-related gene have been provided herein, it should be understood that, within the context of the present invention, reference to one or more of these proteins includes proteins of a substantially similar activity. As used herein, proteins are deemed to be "substantially similar" if: (a) they are encoded by a nucleotide sequence which is derived from the coding region of a gene which encodes the protein (including, for example, portions of the sequence or allelic variations of the sequence); (b) the nucleotide sequence is capable of hybridization to nucleotide sequences of the present invention under moderate, high or very high stringency (see Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, NY, 1989), or has at least 50%, 60%, 70%, 75%, 80%, 90%, 95%, or greater homology to the sequences disclosed herein, or, (c) the DNA sequences are degenerate as a result of the genetic code to the DNA sequences defined in (a) or (b). Further, the nucleic acid molecule disclosed herein includes both complementary and non-complementary sequences, provided the sequences otherwise meet the criteria set forth herein. Within the context of the present invention, high stringency means standard hybridization conditions (e.g., 5X SSPE, 0.5% SDS at 65°C, or the equivalent). For purpose of hybridization, nucleic acid molecules that encode the amino-terminal domain, zinc finger domain, middle domain, or forkhead domain may be utilized.

The structure of the proteins encoded by the nucleic acid molecules described herein may be predicted from the primary translation products using the hydrophobicity plot function of, for example, P/C Gene or Intelligenetics Suite (Intelligenetics, Mountain View, California), or according to the methods described by Kyte and Doolittle (J. Mol. Biol. 157:105-132, 1982).

The present invention provides methods for selecting and/or isolating molecules that are capable of modulating the immune system. Representative examples of suitable assays include the yeast and mammalian 2-hybrid systems (e.g., Dang et al, Mol. Cell. Biol. 11:954, 1991; Fearon et al, Proc. Natl. Acad. Sci. USA 89:7958, 1992), DNA binding assays, antisense assays, traditional protein binding assays (e.g., utilizing ¹²⁵I or time-resolved fluorescence), immunoprecipitation coupled with gel electrophoresis and direct protein sequencing, transcriptional analysis of FOXP3- regulated genes, cytokine production and proliferation assays. For example, within one embodiment proteins that directly interact with

FOXP3 can be detected by an assay such as a yeast 2-hybrid binding system (see, e.g., U.S. Patent Nos. 5,283,173, 5,468,614, 5,610,015, and 5,667,973). Briefly, in a two- hybrid system, a fusion of a DNA-binding domain-FOXP3 protein (e.g., GAL4-FOXP3 fusion) is constructed and transfected into a cell containing a GAL4 binding site linked to a selectable marker gene. The whole FOXP3 protein or subregions of FOXP3 may be used. A library of cDNAs fused to the GAL4 activation domain is also constructed and co-transfected. When the cDNA in the cDNA-GAL4 activation domain fusion encodes a protein that interacts with FOXP3, the selectable marker is expressed. Cells containing the cDNA are then grown, the construct isolated and characterized. Other assays may also be used to identify interacting proteins. Such assays include ELISA, Western blotting, co-immunoprecipitations, in vitro transcription/translation analysis and the like.

Within another aspect of the present invention, methods are provided for determining whether a selected molecule is capable of modulating the immune system, comprising the steps of (a) exposing a selected candidate molecule to cells which express FOXP3, or mutant FOXP3, and (b) determining whether the molecule modulates the activity of FOXP3, and thereby determining whether said molecule can modulate the immune system. Cells for such tests may derive from (a) normal lymphocytes, (b) cell lines engineered to overexpress the FOXP3 (or Foxp3) protein (or mutant forms thereof) or (c) transgenic animals engineered to express said protein. Cells from such transgenic mice are characterized, in part, by a hyporesponsive state including diminished cell number and a decreased responsiveness to various stimuli.

It should be noted that while the methods recited herein may refer to the analysis of an individual test molecule, that the present invention should not be so limited. In particular, the selected molecule may be contained within a mixture of compounds. Hence, the recited methods may further comprise the step of isolating the desired molecule. Furthermore, it should be understood that candidate molecules can be assessed for their ability to modulate the immune system by a number of parameters, including for example, T-cell proliferation, cytokine production, and the like. A wide variety of molecules may be assayed for their ability to modulate the immune system. Representative examples which are discussed in more detail below include organic molecules, proteins or peptides, and nucleic acid molecules.

A. Organic Molecules

Numerous organic molecules may be assayed for their ability to modulate the immune system. For example, within one embodiment of the invention suitable organic molecules may be selected either from a chemical library, wherein chemicals are assayed individually, or from combinatorial chemical libraries where multiple compounds are assayed at once, then deconvoluted to determine and isolate the most active compounds. Representative examples of such combinatorial chemical libraries include those described by Agrafiotis et al, "System and method of automatically generating chemical compounds with desired properties," U.S. Patent No. 5,463,564; Armstrong, R.W., "Synthesis of combinatorial arrays of organic compounds through the use of multiple component combinatorial array syntheses," WO 95/02566; Baldwin, J.J. et al, "Sulfonamide derivatives and their use," WO 95/24186; Baldwin, J.J. et al, "Combinatorial dihydrobenzopyran library," WO 95/30642; Brenner, S., "New kit for preparing combinatorial libraries," WO 95/16918; Chenera, B. et al, "Preparation of library of resin-bound aromatic carbocyclic compounds," WO 95/16712; Ellman, J.A., "Solid phase and combinatorial synthesis of benzodiazepine compounds on a solid support," U.S. Patent No. 5,288,514; Felder, E. et al, "Novel combinatorial compound libraries," WO 95/16209; Lerner, R. et al, "Encoded combinatorial chemical libraries," WO 93/20242; Pavia, M.R. et al, "A method for preparing and selecting pharmaceutically useful non-peptide compounds from a structurally diverse universal library," WO 95/04277; Summerton, J.E. and D.D. Weller, "Morpholino-subunit combinatorial library and method," U.S. Patent No. 5,506,337; Holmes, C, "Methods for the Solid Phase Synthesis of Thiazolidinones, Metathiazanones, and Derivatives thereof," WO 96/00148; Phillips, G.B. and G.P. Wei, "Solid-phase Synthesis of Benzimidazoles," Tet. Letters 37:4887-90, 1996; Ruhland, B. et al, "Solid-supported Combinatorial Synthesis of Structurally Diverse β-Lactams," J. Amer. Chem. Soc. 111:253-4, 1996; Look, G.C. et al, "The Identification of Cyclooxygenase-1 Inhibitors from 4-Thiazolidinone Combinatorial Libraries," Bioorg. and Med. Chem. Letters 6:707-12, 1996.

B. Proteins and Peptides A wide range of proteins and peptides may likewise be utilized as candidate molecules for modulating the immune system. 1. Combinatorial Peptide Libraries

Peptide molecules which modulate the immune system may be obtained through the screening of combinatorial peptide libraries. Such libraries may either be prepared by one of skill in the art (see e.g., U.S. Patent Nos. 4,528,266 and 4,359,535, and Patent Cooperation Treaty Publication Nos. WO 92/15679, WO 92/15677, WO 90/07862, WO 90/02809, or purchased from commercially available sources (e.g., New England Biolabs Ph.D.™ Phage Display Peptide Library Kit).

2. Antibodies

Antibodies which modulate the immune system may readily be prepared given the disclosure provided herein. Within the context of the present invention, antibodies are understood to include monoclonal antibodies, polyclonal antibodies, anti- idiotypic antibodies, antibody fragments (e.g., Fab, and F(ab')2, Fv variable regions, or complementarity determining regions). As discussed above, antibodies are understood to be specific against FOXP3 (or Foxp3) if they bind with a K_a of greater than or equal to 10⁷M, preferably greater than of equal to 10⁸M. The affinity of a monoclonal antibody or binding partner, as well as inhibition of binding can be readily determined by one of ordinary skill in the art (see Scatchard, Ann. NY. Acad. Sci. 51:660-672, 1949).

Briefly, polyclonal antibodies may be readily generated by one of ordinary skill in the art from a variety of warm-blooded animals such as horses, cows, various fowl, rabbits, mice, or rats. Typically, FOXP3 (or Foxp3), or a unique peptide thereof of 13-20 amino acids (preferably conjugated to keyhole limpet hemocyanin by cross-linking with glutaraldehyde) is utilized to immunize the animal through intraperitoneal, intramuscular, intraocular, or subcutaneous injections, in conjunction with an adjuvant such as Freund's complete or incomplete adjuvant. Following several booster immunizations, samples of serum are collected and tested for reactivity to the protein or peptide. Particularly preferred polyclonal antisera will give a signal on one of these assays that is at least three times greater than background. Once the titer of the animal has reached a plateau in terms of its reactivity to the protein, larger quantities of antisera may be readily obtained either by weekly bleedings, or by exsanguinating the animal.

Monoclonal antibodies may also be readily generated using conventional techniques (see U.S. Patent Nos. RE 32,011, 4,902,614, 4,543,439, and 4,411,993 which are incorporated herein by reference; see also Monoclonal Antibodies, Hybridomas: A New Dimension in Biological Analyses, Plenum Press, Kennett, McKearn, and Bechtol (eds.), 1980, and Antibodies: A Laboratory Manual, Harlow and Lane (eds.), Cold Spring Harbor Laboratory Press, 1988, which are also incorporated herein by reference). , Other techniques may also be utilized to construct monoclonal antibodies (see William D. Huse et al, "Generation of a Large Combinational Library of the Immunoglobulin Repertoire in Phage Lambda," Science 246:1275-1281, December 1989; see also L. Sastry et al, "Cloning of the Immunological Repertoire in Escherichia coli for Generation of Monoclonal Catalytic Antibodies: Construction of a Heavy Chain Variable Region-Specific cDNA Library," Proc. Natl. Acad. Sci. USA 86:5728-5732, August 1989; see also Michelle Alting-Mees et al, "Monoclonal Antibody Expression Libraries: A Rapid Alternative to Hybridomas," Strategies in Molecular Biology 3:1-9, January 1990).

A wide variety of assays may be utilized to determine the presence of antibodies which are reactive against FOXP3 (or the mutant forms of FOXP3 described herein), including for example countercurrent immuno-electrophoresis, radioimmunoassays, radioimmunoprecipitations, enzyme-linked immuno-sorbent assays (ELISA), dot blot assays, western blots, immunoprecipitation, Inhibition or Competition Assays, and sandwich assays (see U.S. Patent Nos. 4,376,110 and 4,486,530; see also Antibodies: A Laboratory Manual, Harlow and Lane (eds.), Cold Spring Harbor Laboratory Press, 1988).

Once suitable antibodies have been obtained, they may be isolated or purified by many techniques well known to those of ordinary skill in the art (see Antibodies: A Laboratory Manual, Harlow and Lane (eds.), Cold Spring Harbor Laboratory Press, 1988). Suitable techniques include peptide or protein affinity columns, HPLC or RP-HPLC, purification on protein A or protein G columns, or any combination of these techniques.

As noted above, the present invention also provides a variety of pharmaceutical compositions, comprising one of the above-described molecules that modulates the immune system, along with a pharmaceutically or physiologically acceptable carrier, excipients or diluents. Generally, such carriers should be nontoxic to recipients at the dosages and concentrations employed. Ordinarily, the preparation of such compositions entails combining the therapeutic agent with buffers, antioxidants such as ascorbic acid, low molecular weight (less than about 10 residues) polypeptides, proteins, amino acids, carbohydrates including glucose, sucrose or dextrins, chelating agents such as EDTA, glutathione and other stabilizers and excipients. Neutral buffered saline or saline mixed with nonspecific serum albumin are exemplary appropriate diluents. Preferably, the pharmaceutical composition (or, 'medicament') is provided in sterile, pyrogen-free form. In addition, the pharmaceutical compositions of the present invention may be prepared for administration by a variety of different routes. In addition, pharmaceutical compositions of the present invention may be placed within containers, along with packaging material that provides instructions regarding the use of such pharmaceutical compositions. Generally, such instructions will include a tangible expression describing the reagent concentration, as well as within certain embodiments, relative amounts of excipient ingredients or diluents (e.g., water, saline or PBS) which may be necessary to reconstitute the pharmaceutical composition.

The invention also relates to pairs of oligonucleotides useful for amplifying regions of human FOXP3 genomic DNA. Exemplary oligonucleotides suitable for amplifying DNA from human FOXP3 genomic DNA may be selected from the group consisting of:

SEQ ID NO:l and SEQ ID NO:2; SEQ ID NO:3 and SEQ ID NO:4; SEQ ID NO:5 and SEQ ID NO:6; SEQ ID NO:7 and SEQ ID NO:8; SEQ ID NO:9 and SEQ ID NO:10;

SEQ ID NO:l 1 and SEQ ID NO: 12;

SEQ ID NO:13 and SEQ ID NO:14;

SEQ ID NO: 15 and SEQ ID NO: 16; and SEQ ID NO:17 and SEQ ID NO: 18.

The invention also relates to pairs of oligonucleotides useful for amplifying regions of human FOXP3 mRNA and/or cDNA. Exemplary oligogonucleotides may be selected from the group consisting of SEQ ID NO:30 and SEQ ID NO:31. SEQ ID NO:30 refers to the sequence CTTTTCTGTCAGTCCACTTCAC while SEQ ID NO:31 refers to the sequence GGCAAGACAGTGGAAACCTCAC.

The invention also relates to methods of detecting a mutation in the human FOXP3 gene using one or more of the oligonucleotides and polynucleotides disclosed herein. The mutations can be identified in specific regions of the gene using one or more pairs of primers selected from the following:

SEQ ID NO:l and 2 are used to amplify the 5' non-coding region (SEQ ID NO.-21).

SEQ ID NO:3 and 4 are used to amplify exon 1 (SEQ ID NO:22).

SEQ ID NO:5 and 6 are used to amplify exons 2 and 3 (SEQ ID NO:23). SEQ ID NO:7 and 8 are used to amplify exons 4 and 5 (SEQ ID NO:24).

SEQ ID NO:9 and 10 are used to amplify exons 6 and 7 (SEQ ID NO:25).

SEQ ID NO:l 1 and 12 are used to amplify exon 8 (SEQ ID NO:26).

SEQ ID NO: 13 and 14 are used to amplify exon 9 (SEQ ID NO:27). SEQ ID NO:15 and 16 are used to amplify exons 10 and 11 (SEQ ID

NO:28).

SEQ ID NO: 17 and 18 are used to amplify the UTR (SEQ ID NO:29). SEQ ID NO:30 and 31 are used to amplify the FOXP3 cDNA (SEQ ID

NO: 19). After the desired region(s) is amplified using DNA from a tissue or cell sample, the presence of a mutation can be determined by hybridizing with a probe designed to detect one or more of the mutations disclosed herein, and/or a probe designed to detect other potential mutations. Alternatively, the amplified region can be sequenced and compared to the sequence of a normal comparable region, and to the sequences of mutated regions, thereby allowing the detection of additional mutations. Suitable methodology for performing hybridization, polymerase chain, and nucleic acid sequencing reactions are readily available in the art. See, e.g., Ausubel, F.M. et al, Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology (John Wiley & Sons, 4th ed. April 1999).

The primers for amplification can be provided in a kit form, along with appropriate reagents, optional control sample, and instructions. The probes designed to detect mutations can be in any suitable form, including a microarray for detecting one, two, three, or more than three mutations of the FOXP3 gene. The microarray can optionally include oligonucleotide probes for detecting mutations in one or more other human genes.

The following examples are offered by way of illustration, and not by way of limitation.

EXAMPLES

^• EXAMPLE 1

IDENTIFICATION OF MUTATED GENE IN HUMAN TISSUE SAMPLES

The patients were identified in the course of their medical care. The Oregon Health Sciences University Institutional Review Board approved the human subjects uses and informed consent was obtained from patients or their guardians for participation. Genomic DNA was extracted from peripheral blood or from cultured skin fibroblasts using standard techniques. Nine human FOXP3 gene amplicons representing coding exons 1 through 11, the 3' UTR, one 5' non-coding exon, as well as at least 50 bases of flanking intronic sequence for each exon were amplified by PCR from the genomic DNAs of subjects and unaffected controls. Primers used:

5' non-coding exon (SEQ ID NO:21): GGTTGGCCCTGTGATTTAT (SEQ ID NO:l) and CCCCCGCCGTGCCTACCT (SEQ ID NO:2);

exon 1 (SEQ ID NO:22): GCCAATGCCTGCTTTGACCAG (SEQ ID NO:3) and CCAGTGCCACAGTAAAGGTCG (SEQ ID NO:4);

exons 2+3 (SEQ ID NO:23): CCATGTGGGCTTGCAGTGCAG (SEQ ID NO:5) and GCTCACAGCCAAGGATCTGGG (SEQ ID NO:6);

exons 4+5 (SEQ ID NO:24): TGGGAGTCAGGGTTTTCGAGG (SEQ ID NO:7) and TTATTGGGATGAAGCCTGAGC (SEQ ID NO:8);

exons 6+7 (SEQ ID NO:25): CAGAGCATTGAGCCAGACCAG (SEQ ID NO:9) and CCAGCAGTCTGAGTCTGCCAC (SEQ ID NO: 10);

exon 8 (SEQ ID NO:26): GTGGGAAGTTTAAGCCTCTGG (SEQ ID NO: 11) and TTGTGAGCGGATGCATTTTC (SEQ ID NO: 12);

exon 9 (SEQ ID NO:27): TGTCAGGTGCTCAGCAAACAG (SEQ ID NO: 13) and CATGAGGGGTCACATTTGAGG (SEQ ID NO: 14);

exons 10+11 (SEQ ID NO:28): ACCCCAAGTTTGGGGAATGTG (SEQ ID NO:15) and CAGTTTGGCCCCTGTTCGTCC (SEQ ID NO:16);

3' UTR (SEQ ID NO:29): ACGGGATGTGGGTTGTTGGT (SEQ ID NO: 17) and GGGTTGTCAGGGCTGTGCTTGTGT (SEQ ID NO: 18). Amplicon products were purified over Sephadex G-50 columns and subjected to direct sequencing by big-dye terminator chemistry run on automated sequences (ABI 377). Sequence data were analyzed using Sequencher program (Gene Codes Corp.). Full sequence from both strands of all amplicons was obtained for the mutation analysis. In addition to the patients and unaffected family members analyzed for this study, FOXP3 gene exons were sequenced from a number of unrelated normal control genomic DNAs. Sequence of all nine amplicons was obtained from a set of 90 ethnically diverse individuals from the NIGMS Human Variation Collection, panels HD01-HD09. Exons 10 and 11, encoding the forkhead domain, were also sequenced in an additional 150 individuals from the NIGMS DNA Polymorphism Discovery Resource, Panels 1 and 2 (all DNAs obtained from Coriell Cell Repositories). Exemplary FOXP3 mutations are disclosed herein in Table 1.

Table 1 : Results of mutation analysis of the human scurfy gene in IPEX families

Family DNA variation* Amino acid change** Exon

1 11890T R397W 11

2 Dell290- GPter>VGKGGWTNRGQ 11 1309/insTGG TGGRQRWWGQG

3 1113G>T F371C 10

4 1150G>A A384T 11

5 None - ~

It will be apparent to one skilled in the art that, although specific exemplary primer sequences and FOXP3 mutations are disclosed herein, alternative primer pairs may be substituted to generate amplicons encompassing a variety of FOXP3 mutations, both as disclosed herein or as otherwise readily identifiable by comparison to the nucleic acid sequence of human FOXP3 disclosed herein as SEQ ID NO: 19. Thus, from the foregoing, it will be appreciated that, although specific embodiments of the invention have been described herein for purposes of illustration, various modifications may be made without deviating from the spirit and scope of the invention. Accordingly, the invention is not limited except as by the appended claims.

Claims

CLAIMS We claim:

1. A method of detecting the presence of a mutated scurfy/EOXP3 nucleic acid sequence in a biological sample from a subject, comprising the steps of:

(a) contacting a FOXP3 specific nucleic acid probe under hybridizing conditions with either (i) test nucleic acid molecules isolated from said biological sample, or (ii) nucleic acid molecules synthesized from RNA molecules, wherein said probe recognizes at least a portion of nucleotide sequence of the FOXP3 nucleic acid, and

(b) detecting the formation of hybrids of said nucleic acid probe and (i) or (ii).

2. The method of claim 1, wherein said test nucleic acid molecule is obtained by RT-PCR.

3. The method of claim 2, wherein said RT-PCR is performed using at least two oligonucleotide primers.

4. The method of claim 1 , wherein said test nucleic acid molecule is genomic DNA.

5. A method of detecting one or more mutation in a human FOXP3 gene specific nucleic acid, comprising:

(a) isolating a population of nucleic acids from a biological sample;

(b) amplifying a FOXP3 specific nucleic acid sequence from said isolated population of nucleic acids; and

(c) detecting said mutation in said FOXP3 gene.

6. The method of claim 5 wherein said human FOXP3 gene specific nucleic acid is genomic DNA.

7. The method of claim 6 wherein the step of amplifying is achieved by a polymerase chain reaction.

8. The method of claim 7 wherein said polymerase chain reaction utilizes a pair of oligonucleotides specific for human FOXP3 genomic DNA.

9. The method of claim 8 wherein said pair of oligonucleotides is selected from the group consisting of:

SEQ ID NO:l and SEQ ID NO:2; SEQ ID NO:3 and SEQ ID NO:4; SEQ ID NO:5 and SEQ ID NO:6; SEQ ID NO:7 and SEQ ID NO:8; SEQ ID NO:9 and SEQ ID NO: 10; SEQ ID NO:l 1 and SEQ ID NO: 12; SEQ ID NO: 13 and SEQ ID NO: 14; SEQ ID NO:15 and SEQ ID NO:16; and SEQ ID NO:17and SEQ ID NO: 18.

10. The method of claim 5 wherein said human FOXP3 gene specific nucleic acid is mRNA or cDNA.

11. The method of claim 10 wherein the amplifying is achieved by a polymerase chain reaction.

12. The method of claim 11 wherein said polymerase chain reaction utilizes a pair of oligonucleotides specific for human FOXP3 mRNA or cDNA.

13. The method of claim 12 wherein said pair of oligonucleotides is selected from the group consisting of: SEQ ID NO:30 and SEQ ID NO:31.

14. The method of any of claims 5-13 wherein the detecting said mutation in said FOXP3 gene further comprises:

(a) nucleic acid sequencing said amplified FOXP3 specific nucleic acid sequence; and

(b) comparing of the sequence of said amplified FOXP3 specific nucleic acid sequence with the sequence of wild-type FOXP3 as disclosed herein by SEQ ID NOs 19 and 20; wherein a difference between the sequence of said amplified FOXP3 specific nucleic acid and the sequence of wild-type FOXP3 indicates the presence of a FOXP3 mutation.

15. An isolated nucleic acid comprising an oligonucleotide capable of specifically binding to a polynucleotide encoding a mutation within the forkhead/winged helix-like domain of the FOXP3 protein.

16. A kit for detection of a mutated FOXP3 gene or a polynucleotide expression product thereof, comprising at least one oligonucleotide capable of hybridizing specifically to a mutated region of the gene or a polynucleotide expression product thereof, a carrier, reagent(s), an optional control sample, and instructions for carrying out the assay.