WO2002016579A2 - Nucleic acids, vectors, host cells, polypeptides and uses thereof - Google Patents

Nucleic acids, vectors, host cells, polypeptides and uses thereof Download PDF

Info

Publication number
WO2002016579A2
WO2002016579A2 PCT/US2001/022602 US0122602W WO0216579A2 WO 2002016579 A2 WO2002016579 A2 WO 2002016579A2 US 0122602 W US0122602 W US 0122602W WO 0216579 A2 WO0216579 A2 WO 0216579A2
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
seq
amino acid
inclusive
sequence
Prior art date
Application number
PCT/US2001/022602
Other languages
French (fr)
Other versions
WO2002016579A3 (en
WO2002016579A8 (en
Inventor
Margret Barbara Basinski
Dong-Jing Fu
Bradley Jay Mills
Paul Robert Junior Rosteck
Patanjali Raghavacharya Sankhavaram
Original Assignee
Eli Lilly And Company
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Eli Lilly And Company filed Critical Eli Lilly And Company
Priority to AU2001284655A priority Critical patent/AU2001284655A1/en
Publication of WO2002016579A2 publication Critical patent/WO2002016579A2/en
Publication of WO2002016579A8 publication Critical patent/WO2002016579A8/en
Publication of WO2002016579A3 publication Critical patent/WO2002016579A3/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals

Definitions

  • the present invention relates to the identification and isolation of novel DNA, therapeutic uses and the recombinant production of novel polypeptides cloned from a normalized human bone marrow cDNA library, designated herein as LP123, LP127, and LP129 polypeptides.
  • the present invention also relates to vectors, host cells, and antibodies directed to LP123, LP127, or LP129 polypeptides.
  • Extracellular proteins play an important role in the formation, differentiation and maintenance of multicellular organisms.
  • secreted polypeptides or signaling molecules normally pass through the cellular secretory pathway to reach their site of action in the extracellular environment .
  • Secreted proteins have various industrial applications, including pharmaceuticals, diagnostics, biosensors and bioreactors.
  • Most protein drugs available at present such as thrombolytic agents, interferons, interleu ins, erythropoietins, colony stimulating factors, and various other cytokines, are secretory proteins.
  • Their receptors which are membrane proteins, also have potential as therapeutic or diagnostic agents .
  • the present invention describes the cloning and characterization of novel proteins, termed LP123, LP127, and LP129, and active variants thereof. As such, it is believed that LP123, LP127, and LP129, and their variants play a regulatory role in hematopoiesis, tumorigenesis, metabolism, neurological and immune responses.
  • the present invention provides isolated LP123, LP127, or LP129 nucleic acids and LP123, LP127, or LP129 polypeptides encoded thereby, including fragments and specified variants thereof.
  • Contemplated by the present invention are LP123, LP127, or LP129 probes, primers, recombinant vectors, host cells, transgenic animals, chimeric antibodies and constructs, LP123, LP127, or LP129 epitope recognizing bodies, as well as methods of making and using them diagnostically and therapeutically as described and enabled herein.
  • the present invention includes isolated nucleic acid molecules comprising polynucleotides that encode LP123, LP127, or LP129 polypeptides as defined herein, as well as specified variants thereof, or isolated nucleic acid molecules that are complementary to polynucleotides that encode LP123, LP127, or LP129 polypeptides or specified variants thereof .
  • Polypeptides of the present invention include isolated
  • LP123, LP127, or LP129 polypeptides comprising at least one fragment, domain, or specified variant of at least 90 to 100% of the contiguous amino acids of at least one portion of at least one of SEQ ID NO: 2, 4, and 6.
  • the present invention also provides isolated LP123, LP127, or LP129 polypeptides as described herein, wherein the polypeptides further comprise at least one specified substitution, insertion, or deletion, corresponding to portions or specific residues of at least one of SEQ ID NO: 2, 4, and 6.
  • the present invention also provides isolated nucleic acid probes, primers, or fragments, as described herein, wherein the nucleic acid comprises a polynucleotide of at least 10 nucleotides, corresponding or complementary to at least 10 nucleotides of at least one of SEQ ID NO:l, 3, and 5.
  • the present invention also provides compositions, including pharmaceutical compositions, comprising LP123, LP127, or LP129 polypeptide, SEQ ID NO: 2, 4, or 6 epitope recognizing antibody, and/or nucleic acid wherein the composition has at least one activity including, but not limited to, promoting or inhibiting cell proliferation, hematopoiesis, lymphocyte proliferation, tumorigenesis, immune response, neurological and metabolic function.
  • a method of treatment or prophylaxis for cancer, heart disease, diabetes, neurological disorders, immune or hematological disorders can be effected with the polypeptides, nucleic acids, antibodies, vectors, host cells, transgenic cells, and/or compositions described.
  • the present invention also includes methods for the prophylaxis or treatment of patho-physiological conditions in which at least one cell type involved in said condition is sensitive or responsive to a polypeptide, nucleic acid, antibody, host cell, transgenic cell, or composition of the present invention.
  • the present invention also provides a method for identifying compounds that bind LP123, LP127, or LP129 polypeptides, comprising admixing at least one isolated
  • LP123, LP127, or LP129 polypeptide as described herein with a test compound or composition, and detecting at least one binding interaction between the polypeptide and the compound or composition, optionally further comprising detecting a change in biological activity, such as a reduction or increase.
  • the present invention provides isolated nucleic acid molecules comprising DNA encoding the LP123, LP127, or LP129 polypeptides.
  • the isolated nucleic acids comprise DNA encoding the LP123 polypeptide having amino acid residues from about 1 through 85 of SEQ ID NO: 2 or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, high stringency conditions.
  • the isolated nucleic acids comprise DNA encoding the LP127 polypeptide having amino acid residues from about 1 through 108 of SEQ ID NO: 4 or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, high stringency conditions.
  • the isolated nucleic acids comprise DNA encoding the LP129 polypeptide having amino acid residues from about 1 through 71 of SEQ ID NO: 6 or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, high stringency conditions.
  • LP129 polypeptide when used herein encompass native sequence LP123, LP127, or LP129 polypeptides and polypeptide variants thereof (which are further defined herein) .
  • the LP123, LP127, or LP129 polypeptides may be isolated from a variety of sources, such as from human tissue types or from another source, or prepared by recombinant or synthetic methods .
  • a “native sequence LP123 polypeptide, " “native sequence LP127 polypeptide, “ or “native sequence LP129 polypeptide” comprises a polypeptide having the same amino acid sequence as an LP123, LP127, or LP129 polypeptide derived from nature. Such native sequence LP123, LP127, or LP129 polypeptide can be isolated from nature or can be produced by recombinant or synthetic means .
  • sequence LP123 polypeptide specifically encompasses naturally-occurring truncated or secreted forms of an LP123, LP127, or LP129 polypeptide, (e.g., soluble forms containing, for instance, an extracellular domain sequence) , naturally-occurring variant forms (e.g., alternatively spliced forms) and naturally- occurring allelic variants of an LP123, LP127, or LP129 polypeptide .
  • the native sequence LP123 polypeptide is a full-length or mature native sequence LP123 polypeptide comprising amino acids 1 or 22 through 85 of SEQ ID NO:2. Also, while the LP123 polypeptides disclosed in SEQ ID NO: 2 are shown to begin with a methionine residue designated as amino acid position 1, it is conceivable and possible that another methionine residue located either upstream or downstream from amino acid position 1 in SEQ ID NO : 2 may be employed as the starting amino acid residue.
  • the native sequence LP127 polypeptide is a full-length or mature native sequence LP127 polypeptide comprising amino acids 1 or 23 through 108 of SEQ ID NO: 4. While the LP127 polypeptides disclosed in SEQ ID NO: 4 are shown to begin with a methionine residue designated as amino acid position 1, it is conceivable and possible that another methionine residue located either upstream or downstream from amino acid position 1 in SEQ ID NO: 4 may be employed as the starting amino acid residue .
  • the native sequence LP129 polypeptide is a full-length or mature native sequence LP129 polypeptide comprising amino acids 1 through 71 of SEQ ID NO: 6. While the LP129 polypeptides disclosed in SEQ ID NO: 6.
  • amino acid position 1 a methionine residue designated as amino acid position 1
  • another methionine residue located either upstream or downstream from amino acid position 1 in SEQ ID NO: 6 may be employed as the starting amino acid residue.
  • LP123 variant means an "active" LP123, LP127, or LP129 polypeptide as defined below, having at least about 90% amino acid sequence identity with the LP123, LP127, or LP129 polypeptide, having the deduced amino acid sequence of residues 1 or about 22 to about 85, shown in SEQ ID NO: 2, residues 1 or about 23 to about 108, shown in SEQ ID NO: 4, for a full-length or mature native sequence LP123 or LP127 polypeptide, respectively, or residues 1 to about 71, shown in SEQ ID NO: 6, for a full- length LP129 polypeptide.
  • Such LP123, LP127, or LP129 polypeptide variants include, for instance, LP123, LP127, or LP129, wherein one or more amino acid residues are added, substituted or deleted, at the N- or C-terminus or within the sequence of SEQ ID NO:2, 4, or 6.
  • an LP123, LP127, or LP129 polypeptide variant will have at least about 90% sequence identity, preferably at least about 91% sequence identity, yet more preferably at least about 92% sequence identity, yet more preferably at least about 93% sequence identity, yet more preferably at least about 94% sequence identity, yet more preferably at least about 95% sequence identity, yet more preferably at least about 96% sequence identity, yet more preferably at least about 97% sequence identity, yet more preferably at least about 98% sequence identity, yet more preferably at least about 99% amino acid sequence identity with the amino acid sequence of SEQ ID NO: 2, 4, or 6 , with or without the signal peptide (e.g., with signal peptide amino acid residues 1 to 85 of
  • SEQ ID NO:2 without signal peptide about 22 to 85 of SEQ ID NO: 2; with signal peptide amino acid residues 1 to 108 of SEQ ID NO: 4, without signal peptide about 23 to 108 of SEQ ID NO: 4; without signal peptide about 1 to 71 of SEQ ID N0:6, respectively).
  • Percent (%) amino acid sequence identity with respect to the LP123, LP127, or LP129 amino acid sequences identified herein is defined as the percentage of amino acid residues in a candidate sequence that are identical with the amino acid residues in an LP123, LP127, or LP129 polypeptide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity.
  • Alignment for purposes of determining percent amino acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as ALIGN, ALIGN-2 , Megalign (DNASTAR) or BLAST (e.g., Blast, Blast-2, WU-Blast-2) software. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. For example, the % identity values used herein are generated using WU-BLAST-2 [Altschul, et al., Methods in Enzymology 266: 460-80 (1996)]. Most of the WU-BLAST-2 search parameters are set to the default values.
  • a % amino acid sequence identity value is determined by dividing (a) the number of matching identical amino acid residues between the amino acid sequence of the LP123, LP127, or LP129 polypeptide of interest and the comparison amino acid sequence of interest (i.e., the sequence against which the LP123, LP127, or LP129 polypeptide of interest is being compared) as determined by WU-BLAST-2, by (b) the total number of amino acid residues of the LP123, LP127, or LP129 polypeptide of interest.
  • LP123 variant polynucleotide means an active LP123, LP127, or LP129 polypeptide-encoding nucleic acid molecule as defined below having at least about 75% nucleic acid sequence identity with SEQ ID NO:l, 3, or 5 , respectively.
  • an LP123, LP127, or LP129 polypeptide will have at least about 75% nucleic acid sequence identity, more preferably at least about 80% nucleic acid sequence identity, yet more preferably at least about 81% nucleic acid sequence identity, yet more preferably at least about 82% nucleic acid sequence identity, yet more preferably at least about 83% nucleic acid sequence identity, yet more preferably at least about 84% nucleic acid sequence identity, yet more preferably at least about 85% nucleic acid sequence identity, yet more preferably at least about 86% nucleic acid sequence identity, yet more preferably at least about 87% nucleic acid sequence identity, yet more preferably at least about 88% nucleic acid sequence identity, yet more preferably at least about 89% nucleic acid sequence identity, yet more preferably at least about 90% nucleic acid sequence identity, yet more preferably at least about 91% nucleic acid sequence identity, yet more preferably at least about 92% nucleic acid sequence identity, yet more preferably at least about 93% nucleic acid sequence identity
  • Percent (%) nucleic acid sequence identity with respect to the LP123, LP127, or LP129 sequences identified herein is defined as the percentage of nucleotides in a candidate sequence that are identical with the nucleotides in the LP123, LP127, or LP129 sequence after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. Alignment for purposes of determining percent nucleic acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as ALIGN, Align-2, Megalign (DNASTAR) , or BLAST (e.g., Blast, Blast-2) software.
  • a % nucleic acid sequence identity value is determined by dividing (a) the number of matching identical nucleotides between the nucleic acid sequence of the LP123, LP127, or LP129 polypeptide- encoding nucleic acid molecule of interest and the comparison nucleic acid molecule of interest (i.e., the sequence against which the LP123, LP127, or LP129 polypeptide-encoding nucleic acid molecule of interest is being compared) as determined by WU-BLAST-2, by (b) the total number of nucleotides of the LP123, LP127, or LP129 polypeptide-encoding nucleic acid molecule of interest.
  • the LP123, LP127, or LP129 variant polypeptides are nucleic acid molecules that encode an active LP123, LP127, or LP129 polypeptide and which are capable of hybridizing, preferably under stringent hybridization and wash conditions, to nucleotide sequences encoding the full-length LP123, LP127, or LP129 polypeptide shown in SEQ ID NO: 2, 4, or 6, respectively.
  • This scope of variant polynucleotides specifically excludes those sequences that are known as of the filing and/or priority dates of the present application.
  • the term "mature protein” or "mature polypeptide” as used herein refers to the form(s) of the protein produced by expression in a mammalian cell. It is generally hypothesized that once export of a growing protein chain across the rough endoplasmic reticulum has been initiated, proteins secreted by mammalian cells have a signal peptide
  • SP sequence which is cleaved from the complete polypeptide to produce a "mature" form of the protein.
  • cleavage of a secreted protein is not uniform and may result in more than one species of mature protein.
  • the cleavage site of a secreted protein is determined by the primary amino acid sequence of the complete protein and generally cannot be predicted with complete accuracy. Methods for predicting whether a protein has an SP sequence, as well as the cleavage point for that sequence, are available.
  • a cleavage point may exist within, the N-terminal domain between amino acid 10 and amino acid 35.
  • cleavage point is likely to exist after amino acid 15 but before amino acid 30, more likely after amino acid 20 but before amino acid 25, and most likely after amino acid 21 and before amino acid 22, as presented in SEQ ID NO: 2, after amino acid 22 and before amino acid 23, as presented in SEQ ID NO: 4, respectively.
  • SP has been predicted for LP129
  • cleavage sites sometimes vary from organism to organism and cannot be predicted with absolute certainty.
  • cleavage sites for a secreted protein are determined experimentally by amino- erminal sequencing of the one or more species of mature proteins found within a purified preparation of the protein.
  • the % identity value of positives is determined by the fraction of residues scoring a positive value in the BLOSUM 62 matrix. This value is determined by dividing (a) the number of amino acid residues scoring a positive value in the BLOSUM62 matrix of WU-BLAST-2 between the LP123, LP127, or LP129 polypeptide amino acid sequence of interest and the comparison amino acid sequence (i.e., the amino acid sequence against which the LP123, LP127, or
  • LP129 polypeptide sequence is being compared) as determined by WU-BLAST-2, by (b) the total number of amino acid residues of the LP123, LP127, or LP129 polypeptide of interest .
  • isolated, when used to describe the various polypeptides disclosed herein, means a polypeptide that has been identified and separated and/or recovered from a component of its natural environment.
  • the isolated polypeptide is free of association with all components with which it is naturally associated.
  • Contaminant components of its natural environment are materials that would typically interfere with diagnostic or therapeutic uses for the polypeptide and may include enzymes, hormones, and other proteinaceous or non- proteinaceous solutes.
  • the polypeptide will be purified (1) to a degree sufficient to obtain at least 15 residues of N-terminal or internal amino acid sequence by use of a spinning cup sequenator, or (2) to homogeneity by SDS-PAGE under non-reducing or reducing conditions using Coomassie blue or, preferably, silver stain.
  • Isolated polypeptide includes polypeptide in situ within recombinant cells, since at least one component of the LP123, LP127, or LP129 polypeptide natural environment will not be present. Ordinarily, however, isolated polypeptide will be prepared by at least one purification step.
  • An "isolated" LP123, LP127, or LP129 polypeptide- encoding nucleic acid molecule is a nucleic acid molecule that is identified and separated from at least one contaminant nucleic acid molecule with which it is ordinarily associated in the natural source of the LP123, LP127, or LP129 polypeptide-encoding nucleic acid.
  • An isolated LP123, LP127, or LP129 polypeptide-encoding nucleic acid molecule is other than in the form or setting in which it is found in nature.
  • Isolated LP123, LP127, or LP129 polypeptide-encoding nucleic acid molecules therefore are distinguished from the LP123, LP127, or LP129 polypeptide- encoding nucleic acid molecule as it exists in natural cells.
  • an isolated LP123, LP127, or LP129 polypeptide-encoding nucleic acid molecule includes LP123, LP127, or LP129 polypeptide encoding nucleic acid molecules contained in cells that ordinarily express LP123, LP127, or LP129 polypeptide where, for example, the nucleic acid molecule is in a chromosomal location different from that of natural cells .
  • Nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence.
  • DNA for a presequence or secretory leader is operably linked to DNA for a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide;
  • a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; or
  • a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation.
  • "operably linked” means that the DNA sequences being linked are contiguous, and, in the case of a secretory leader, contiguous and in reading phase. However, enhancers do not have to be contiguous. Linking is accomplished by ligation at convenient restriction sites. If such sites do not exist, the synthetic oligonucleotide adaptors or linkers are used in accordance with conventional practice.
  • amino acid is used herein in its broadest sense, and includes naturally occurring amino acids as well as non-naturally occurring amino acids, including amino acid analogs and derivatives .
  • the latter includes molecules containing an amino acid moiety.
  • reference herein to an amino acid includes, for example, naturally occurring proteogenic L-amino acids; D-amino acids; chemically modified amino acids, such as amino acid analogs and derivatives; naturally occurring non-proteogenic amino acids such as norleucine, ⁇ -alanine, ornithine, etc.; and chemically synthesized compounds having properties known in the art to be characteristic of amino acids.
  • proteogenic indicates that the amino acid can be incorporated into a peptide, polypeptide, or protein in a cell through a metabolic pathway.
  • “Stringency” of hybridization reactions is readily determinable by one of ordinary skill in the art, and generally is an empirical calculation dependent upon probe length, washing temperature, and salt concentration. In general, longer probes required higher temperatures for proper annealing, while short probes need lower temperatures. Hybridization generally depends on the ability of denatured DNA to reanneal when complementary strands are present in an environment below their melting temperature. The higher the degree of desired homology between the probe and hybridizable sequence, the higher the relative temperature that can be used. As a result, it follows that higher relative temperatures would tend to make the reactions more stringent, while lower temperatures less so. For additional details and explanation of stringency of hybridization reactions, see Ausubel, et al . , Current Protocols in Molecular Biology, Wiley Interscience Publishers (1995) .
  • “Stringent conditions” or “high stringency conditions”, as defined herein, may be identified by those that (1) employ low ionic strength and high temperature for washing, for example, 15 mM sodium chloride/1.5 mM sodium citrate/0.1% sodium dodecyl sulfate at 50°C; (2) employ during hybridization a denaturing agent, such as formamide, for example, 50% (v/v) formamide with 0.1% bovine serum albumin/0.1% ficoll/0.1% polyvinylpyrrolidone/50 mM sodium phosphate buffer at pH 6.5 with 750 mM sodium chloride/75 mM sodium citrate at 42°C; or (3) employ 50% formamide, 5X SSC (750 mM sodium chloride, 75 mM sodium citrate) , 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5X Denhardt's solution, sonicated salmon sperm DNA (50 ⁇ g/mL) , 0.1% SDS, and 10% de
  • Modely stringent conditions may be identified as described by Sambrook, et al . [Molecular Cloning: A Laboratory Manual, New York: Cold Spring Harbor Press, (1989)], and include the use of washing solution and hybridization conditions (e.g., temperature, ionic strength and %SDS) less stringent than those described above.
  • moderately stringent conditions is overnight incubation at 37°C in a solution comprising: 20% formamide, 5X SSC (750 mM sodium chloride, 75 mM sodium citrate) , 50 mM sodium phosphate at pH 7.6, 5X Denhardt's solution, 10% dextran sulfate, and 20 mg/mL denatured sheared salmon sperm DNA, followed by washing the filters in IX SSC at about 37- 50°C.
  • 5X SSC 750 mM sodium chloride, 75 mM sodium citrate
  • 50 mM sodium phosphate at pH 7.6
  • 5X Denhardt's solution 10% dextran sulfate
  • 20 mg/mL denatured sheared salmon sperm DNA followed by washing the filters in IX SSC at about 37- 50°C.
  • the skilled artisan will recognize how to adjust the temperature, ionic strength, etc., as necessary to accommodate factors such as probe length and the like.
  • epitope tagged refers to a chimeric polypeptide comprising an LP123, LP127, or LP129 polypeptide, or domain sequence thereof, fused to a "tag polypeptide.”
  • the tag polypeptide has enough residues to provide an epitope against which an antibody may be made, or which can be identified by some other agent, yet is short enough such that it does not interfere with the activity of the LP123, LP127, or LP129 polypeptide.
  • the tag polypeptide preferably is also fairly unique so that the antibody does not substantially cross-react with other epitopes .
  • Suitable tag polypeptides generally have at least six amino acid residues and usually between about 8 to about 50 amino acid residues (preferably, between about 10 to about 20 residues) .
  • immunoadhesin As used herein, the term “immunoadhesin, " sometimes referred to as an Fc fusion, designates antibody-like molecules that combine the binding specificity of a heterologous protein (an “adhesin") with the effector functions of immunoglobulin constant domains.
  • the immunoadhesins comprise a fusion of an amino acid sequence with the desired binding specificity which is other than the antigen recognition and binding site of an antibody (i.e., is "heterologous") and an immunoglobulin constant domain sequence.
  • the adhesin part of an immunoadhesin molecule typically is a contiguous amino acid sequence comprising at least the binding site of a receptor or a ligand.
  • the immunoglobulin constant domain sequence in the immunoadhesin may be obtained from any immunoglobulin, such as IgG-1, IgG-2, IgG-3 or IgG-4 subtypes, IgA (including IgA-1 and IgA-2), IgE, IgD or IgM.
  • immunoglobulin such as IgG-1, IgG-2, IgG-3 or IgG-4 subtypes, IgA (including IgA-1 and IgA-2), IgE, IgD or IgM.
  • Activity refers to form(s) of LP123, LP127, or LP129 which retain the biologic and/or immunologic activities of native or naturally-occurring LP123, LP127, or LP129 polypeptide.
  • biological activity refers to a biological function (either inhibitory or stimulatory) caused by a native or naturally occurring LP123, LP127, or LP129 polypeptide other than the ability to induce the production of an antibody against an antigenic epitope possessed by a native or naturally occurring LP123, LP127, or LP129 polypeptide.
  • An “immunological” activity refers only to the ability to induce the production of an antibody against an antigenic epitope possessed by a native or naturally occurring LP123, LP127, or LP129 polypeptide.
  • Medical disorder describes a host of disorders that are characterized principally by uncontrolled cell proliferation, immune response, or abnormal neurological, hematological, or metabolic activity.
  • exemplary disorders encompassed within this definition include, but are not limited to, cancer, heart disease, stroke, diabetes, Alzheimer's, multiple sclerosis, and Parkinson's disease.
  • antagonist is used in the broadest sense and includes any molecule that partially or fully blocks, inhibits, or neutralizes a biological activity of a native LP123, LP127, or LP129 polypeptide disclosed herein.
  • agonist is used in the broadest sense and includes any molecule that mimics a biological activity of a native LP123, LP127, or LP129 polypeptide disclosed herein.
  • Suitable agonist or antagonist molecules specifically include agonist or antagonist antibodies or antibody fragments, fragments or amino acid sequence variants of native LP123, LP127, or LP129 polypeptides, peptides, small organic molecules, etc.
  • Methods for identifying agonists or antagonists of an LP123, LP127, or LP129 polypeptide may comprise contacting an LP123, LP127, or LP129 polypeptide with a candidate agonist or antagonist molecule and measuring a detectable change in one or more biological activities normally associated with the LP123, LP127, or LP129 polypeptide.
  • Antibodies are glycoproteins having the same structural characteristics. While antibodies exhibit binding specificity to a specific antigen, immunoglobulins include both antibodies and other antibody-like molecules that lack antigen specificity. Polypeptides of the latter kind are, for example, produced at low levels by the lymph system and at increased levels by myelomas.
  • antibody is used in the broadest sense and specifically covers, without limitation, intact monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies) formed from at least two intact antibodies ' , and antibody fragments so long as they exhibit the desired biological activity.
  • treating, " “treatment” and “therapy” as used herein refer to curative therapy, prophylactic therapy, and preventive therapy.
  • An example of “preventive therapy” is the prevention or lessened targeted pathological condition or disorder.
  • Those in need of treatment include those already with the disorder as well as those prone to have the disorder or those in whom the disorder is to be prevented.
  • “Chronic” administration refers to administration of the agent (s) in a continuous mode as opposed to an acute mode, so as to maintain the initial therapeutic effect (activity) for an extended period of time.
  • Intermittent administration is treatment that is not consecutively done without interruption but, rather, is cyclic in nature.
  • Administration "in combination with" one or more further therapeutic agents includes simultaneous (concurrent) and consecutive administration in any order.
  • a “therapeutically-effective amount” is the minimal amount of active agent (e.g., an LP123, LP127, or LP129 polypeptide, antagonist or agonist thereof) which is necessary to impart therapeutic benefit to a mammal.
  • a "therapeutically-effective amount" to a mammal suffering or prone to suffering or to prevent it from suffering from a medical disorder is such an amount which induces, ameliorates or otherwise causes an improvement in the pathological symptoms, disease progression, physiological conditions associated with or resistance to succumbing to a disorder principally characterized by uncontrolled cell proliferation, immune response, or abnormal neurological, hematological, or metabolic activity.
  • Carriers as used herein include pharmaceutically- acceptable carriers, excipients, or stabilizers which are nontoxic to the cell or mammal being exposed thereto at the dosages and concentrations employed. Often the physiologically-acceptable carrier is an aqueous pH buffered solution.
  • physiologically acceptable carriers include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid; low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and/or nonionic surfactants such as TWEENTM, polyethylene glycol (PEG), and PLURONICTM.
  • buffers such as phosphate, citrate, and other organic acids
  • antioxidants including ascorbic acid
  • low molecular weight (less than about 10 residues) polypeptides proteins, such as serum album
  • Antibody fragments comprise a portion of an intact antibody, preferably the antigen binding or variable region of the intact antibody.
  • antibody fragments include Fab, Fab', F(ab')2 and Fv fragments; diabodies; linear antibodies [Zapata, et al . , Protein Engin. 8(10): 1057-62 (1995)]; single-chain antibody molecules; and multispecific antibodies formed from antibody fragments.
  • Fv is the minimum antibody fragment which contains a complete antigen-recognition and binding site. This region consists of a dimer of one heavy- and one light-chain variable domain in tight, non-covalent association. It is in this configuration that the three CDRs of each variable domain interact to define an antigen-binding site on the surface of the VH-VL dimer. Collectively, the six CDRs confer antigen-binding specificity to the antibody.
  • variable domain or half of an Fv comprising only three CDR specific for an antigen
  • Single-chain Fv or “sFv” antibody fragments comprise the VH and VL domains of antibody, wherein these domains are present in a single polypeptide chain.
  • the Fv polypeptide further comprises a polypeptide linker between the VH and VL domain, which enables the sFv to form the desired structure for antigen binding.
  • diabodies refers to small antibody fragments with two antigen-binding sites, which fragments comprise a heavy-chain variable domain (VH) connected to a light-chain variable domain (VL) in the same polypeptide chain (VH-VL) .
  • VH heavy-chain variable domain
  • VL light-chain variable domain
  • VH-VL polypeptide chain
  • an “isolated” antibody is one which has been identified and separated and/or recovered from a component of its natural environment. Contaminant components of its natural environment are materials which would interfere with diagnostic or therapeutic uses for the antibody, and may include enzymes, hormones, and other proteinaceous or non- proteinaceous solutes.
  • the antibody will be purified (1) to greater than 95% by weight of antibody as determined by the Lowry method, and most preferably more than 99% by weight, (2) to a degree sufficient to obtain at least 15 residues of N-terminal or internal amino acid sequence by use of a spinning cup sequenator, or (3) to homogeneity by SDS-PAGE under reducing or nonreducing conditions using Coomassie blue, or preferably, silver stain.
  • Isolated antibody includes the antibody in situ within recombinant cells since at least one component of the antibody's natural environment will not be present. Ordinarily, however, isolated antibody will be prepared by at least one purification step.
  • a “liposome” is a small vesicle composed of various types of lipids, phospholipids and/or surfactant which is useful for delivery of a drug (such as an LP123, LP127, or LP129 polypeptide or antibody thereto) to a mammal.
  • a drug such as an LP123, LP127, or LP129 polypeptide or antibody thereto
  • the components of the liposome are commonly arranged in a bilayer formation, similar to the lipid arrangement of biological membranes .
  • a “small molecule” is defined herein to have a molecular weight below about 500 daltons.
  • the term “modulate” means to affect (e.g., either upregulate, downregulate or otherwise control) the level of a signaling pathway.
  • Cellular processes under the control of signal transduction include, but are not limited to, transcription of specific genes, normal cellular functions, such as metabolism, proliferation, differentiation, adhesion, apoptosis and survival, as well as abnormal processes, such as transformation, blocking of differentiation and metastasis.
  • the LP123, LP127, or LP129 polynucleotide can be composed of any polyribonucleotide or polydeoxy- ribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA.
  • the LP123, LP127, or LP129 polynucleotides can be composed of single- and double- stranded DNA, DNA that is a mixture of single- and double- stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single- stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions.
  • LP123, LP127, or LP129 polynucleotides can be composed of triple-stranded regions comprising RNA or DNA or both RNA and DNA.
  • LP123, LP127, or LP129 polynucleotides may also contain one or more modified bases or DNA or RNA backbones modified for stability or for other reasons.
  • Modified bases include, for example, tritylated bases and unusual bases such as inosine.
  • polynucleotide embraces chemically, enzymatically, or metabolically modified forms.
  • LP123, LP127, or LP129 polypeptides can be composed of amino acids joined to each other by peptide bonds or modified peptide bonds, i.e., peptide isosteres, and may contain amino acids other than the gene-encoded amino acids.
  • the LP123, LP127, or LP129 polypeptides may be modified by either natural processes, such as post-translational processing, or by chemical modification techniques which are well known in the art. Such modifications are well described in basic texts and in more detailed monographs, as well as in a voluminous research literature.
  • Modifications can occur anywhere in the LP123, LP127, or LP129 polypeptides, including the peptide backbone, the amino acid side-chains and the amino or carboxyl termini. It will be appreciated that the same type of modification may be present in the same or varying degrees at several sites in a given LP123, LP127, or LP129 polypeptide. Also, a given LP123, LP127, or LP129 polypeptide may contain many types of modifications. LP123, LP127, or LP129 polypeptides may be branched, for example, as a result of ubiquitination, and they may be cyclic, with or without branching. Cyclic, branched, and branched cyclic LP123, LP127, or LP129 polypeptides may result from post-translation natural processes or may be made by synthetic methods.
  • Modifications include acetylation, acylation, ADP- ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphotidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of covalent cross- links, formation of cystine, formation of pyroglutamate, formylation, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, pegylation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer-RNA mediated addition of amino acids to proteins such as arginylation, and ubiquitination. See, for instance, Creight
  • Variations may be a substitution, deletion or insertion of one or more codons encoding LP123, LP127, or LP129 polypeptide that results in a change in the amino acid sequence of the LP123, LP127, or LP129 polypeptide as compared with the native sequence LP123, LP127, or LP129 polypeptide.
  • the variation is by substitution of at least one amino acid with any other amino acid in one or more of the domains of the LP123, LP127, or LP129 polypeptide.
  • Guidance in determining which amino acid residue may be inserted, substituted or deleted without adversely affecting the desired activity may be found by comparing the sequence of the LP123., LP127, or LP129 polypeptide with that of homologous known protein molecules and minimizing the number of amino acid sequence changes made in regions of high homology.
  • Amino acid substitutions can be the result of replacing one amino acid with another amino acid having similar structural and/or chemical properties, such as the replacement of a leucine with a serine, i.e., conservative amino acid replacements. Insertions or deletions may optionally be in the range of 1 to 5 amino acids.
  • the variation allowed may be determined by systematically making insertions, deletions or substitutions of amino acids in the sequence and testing the resulting variants for activity (such as in any of the in vitro assays described herein) for activity exhibited by the full-length or mature native sequence.
  • LP123, LP127, or LP129 polypeptide fragments are provided herein. Such fragments may be truncated at the N- terminus or C-terminus, or may lack internal residues, for example, when compared with a full-length or native protein. Certain fragments lack amino acid residues that are not essential for a desired biological activity of the LP123, LP127, or LP129 polypeptide.
  • LP123, LP127, or LP129 fragments may be prepared by any of a number of conventional techniques . Desired peptide fragments may be chemically synthesized.
  • An alternative approach involves generating LP123, LP127, or LP129 fragments by enzymatic digestion, e.g., by treating the protein with an enzyme known to cleave proteins at sites defined by particular amino acid residues, or by digesting the DNA with suitable restriction enzymes and isolating the desired fragment.
  • Yet another suitable technique involves isolating and amplifying a DNA fragment encoding a desired polypeptide fragment by polymerase chain reaction (PCR) . Oligonucleotides that define the desired termini of the DNA fragment are employed at the 5' and 3' primers in the PCR.
  • LP123, LP127, or LP129 polypeptide fragments share at least one biological and/or immunological activity with the native LP123, LP127, or LP129 polypeptide shown in SEQ ID NO:2, 4, or 6.
  • Covalent modifications of LP123, LP127, or LP129 polypeptides are included within the scope of this invention.
  • One type of covalent modification includes reacting targeted amino acid residues of an LP123, LP127, or LP129 polypeptide with an organic derivatizing agent that is capable of reacting with selected side chains or the N- or C-terminal residues of an LP123, LP127, or LP129 polypeptide.
  • Derivatization with bifunctional agents is useful, for instance, for crosslinking LP123, LP127, or LP129 to a water-insoluble support matrix or surface for use in the method for purifying anti-LPl23, -LP127, or -LP129 antibodies, and vice-versa.
  • crosslinking agents include, e.g., 1, 1-bis (diazoacetyl) -2-phenylethane, glutaraldehyde, N-hydroxysuccinimide esters, for example, esters with 4-azidosalicylic acid, homobifunctional i idoesters, including disuccinimidyl esters such as 3,3'- dithiobis- (succinimidylpropionate) , bifunctional maleimides such as bis-N-maleimido-1, 8-octane and agents such as methyl-3- [ (p-azidophenyl) -dithio]propioimidate.
  • 1, 1-bis (diazoacetyl) -2-phenylethane glutaraldehyde
  • N-hydroxysuccinimide esters for example, esters with 4-azidosalicylic acid
  • homobifunctional i idoesters including disuccinimidyl esters such as 3,
  • Another type of covalent modification of the LP123, LP127, or LP129 polypeptide included within the scope of this invention comprises altering the native glycosylation pattern of the polypeptide.
  • "Altering the native glycosylation pattern" is intended for purposes herein to mean deleting one or more carbohydrate moieties found in native sequence LP123, LP127, or LP129 polypeptide and/or adding one or more glycosylation sites that are not present in the native sequence LP123, LP127, or LP129 polypeptide.
  • the phrase includes qualitative changes in the glycosylation of the native proteins, involving a change in the nature and proportions of the various carbohydrate moieties present.
  • Addition of glycosylation sites to LP123, LP127, or LP129 polypeptides may be accomplished by altering the amino acid sequence thereof.
  • the alteration may be made, for example, by the addition of, or substitution by, one or more serine or threonine residues to the native sequence LP123, LP127, or LP129 polypeptide (for 0-linked glycosylation sites) .
  • the LP123, LP127, or LP129 amino acid sequence may optionally be altered through changes at the DNA level, particularly by mutating the DNA encoding the LP123, LP127, or LP129 polypeptide at preselected bases such that codons are generated that will translate into the desired amino acids .
  • Another means of increasing the number of carbohydrate moieties on the LP123, LP127, or LP129 polypeptide is by chemical or enzymatic coupling of glycosides to the polypeptide. Such methods are described in the art, e.g., in WO 87/05330, published 11 September 1987, and in Aplin and Wriston, CRC Crit. Rev. Biochem., pp. 259-306 (1981).
  • Removal of carbohydrate moieties present on the LP123, LP127, or LP129 polypeptide may be accomplished chemically or enzymatically or by mutational substitution of codons encoding for amino acid residues that serve as targets for glycosylation.
  • Chemical deglycosylation techniques are known in the art and described, for instance, by Sojar, et al., Arch. Biochem. Biophys. 259: 52-7 (1987) and by Edge, et al., Anal. Biochem. 118: 131-7 (1981).
  • Enzymatic cleavage of carbohydrate moieties on polypeptides can be achieved by the use of a variety of endo- and exo- glycosidases as described by Thotakura, et al .
  • Another type of covalent modification of LP123, LP127, or LP129 comprises linking the LP123, LP127, or LP129 polypeptide to one of a variety of nonproteinaceous polymers, e.g., polyethylene glycol, polypropylene glycol, or polyoxyalkylenes, in the manner set forth in U.S. Patent Nos. 4,640,835; 4,496,689; 4,301,144; 4,670,417; 4,791,192 or 4,179,337.
  • LP123, LP127, or LP129 polypeptides of the present invention may also be modified in a way to form chimeric molecules comprising an LP123, LP127, or LP129 polypeptide fused to another heterologous polypeptide or amino acid sequence.
  • such a chimeric molecule comprises a fusion of an LP123, LP127, or LP129 polypeptide with a tag polypeptide which provides an epitope to which an anti-tag antibody can selectively bind.
  • the epitope tag is generally placed at the amino- or carboxyl-terminus of the LP123, LP127, or LP129 polypeptide.
  • epitope-tagged forms of an LP123, LP127, or LP129 polypeptide can be detected using an antibody against the tag polypeptide. Also, provision of the epitope tag enables the LP123, LP127, or LP129 polypeptide to be readily purified by affinity purification using an anti-tag antibody or another type of affinity matrix that binds to the epitope tag.
  • the chimeric molecule may comprise a fusion of an LP123, LP127, or LP129 polypeptide with an immunoglobulin or a particular region of an immunoglobulin.
  • a fusion could be to the Fc region of an IgG molecule.
  • the Ig fusions preferably include the substitution of a soluble transmembrane domain deleted or inactivated form of an LP123, LP127, or LP129 polypeptide in place of at least one variable region within an Ig molecule.
  • the immunoglobulin fusion includes the hinge, CH2 and CH3 or the hinge, CHI, CH2 and CH3 regions of an IgGl molecule.
  • the LP123, LP127, or LP129 polypeptides of the present invention may also be modified in a way to form a chimeric molecule comprising an LP123, LP127, or LP129 polypeptide fused to a leucine zipper.
  • leucine zipper polypeptides have been described in the art. See, -e.g., Landschulz, et al . , Science 240(4860): 1759-64 (1988); WO 94/10308; Hoppe, et al .
  • LP129 polypeptide in solution.
  • the leucine zipper may be fused at either the N- or C-terminal end of the LP123, LP127, or LP129 molecule.
  • LP123, LP127, or LP129 by culturing cells transformed or transfected with a vector containing LP123, LP127, or LP129 polypeptide encoding nucleic acid. It is, of course, contemplated that alternative methods, which are well known in the art, may be employed to prepare LP123, LP127, or LP129 polypeptides.
  • the LP123, LP127, or LP129 sequence, or portions thereof may be produced by direct peptide synthesis using solid-phase techniques [see, e.g., Stewart, et al . , Solid-Phase Peptide Synthesis, W.H.
  • LP123, LP127, or LP129 polypeptides may be chemically synthesized separately and combined using chemical or enzymatic methods to produce a full-length LP123, LP127, or LP129 polypeptide.
  • DNA encoding an LP123, LP127, or LP129 polypeptide may be obtained from a cDNA library prepared from tissue believed to possess LP123, LP127, or LP129 mRNA and to express it at a detectable level.
  • Libraries can be screened with probes (such as antibodies to an LP123, LP127, or LP129 polypeptide or oligonucleotides of at least about 20-80 bases) designed to identify the gene of interest or the protein encoded by it. Screening the cDNA or genomic library with the selected probe may be conducted using standard procedures, such as described in Sambrook, et al . , Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY (1989) .
  • Nucleic acids having protein coding sequences may be obtained by screening selected cDNA or genomic libraries using the deduced amino acid sequence disclosed herein for the first time and, if necessary, using conventional primer extension procedures as described in Sambrook, et al . , supra, to detect precursors and processing intermediates of mRNA that may not have been reverse-transcribed into cDNA.
  • Host cells are transfected or transformed with expression or cloning vectors described herein for LP123, LP127, or LP129 polypeptide production and cultured in conventional nutrient media modified as appropriate for inducing promoters, selecting transformants, or amplifying the genes encoding the desired sequences.
  • the culture conditions such as media, temperature, pH and the like, can be selected by the skilled artisan without undue experimentation.
  • principles, protocols, and practical techniques for maximizing the productivity of cell cultures can be found in Mammalian Cell Biotechnology: A Practical Approach, M. Butler, ed. (IRL Press, 1991) and Sambrook, et al . , supra.
  • Transformations into yeast are typically carried out according to the method of van Solingen, et al., J Bact. 130(2): 946-7 (1977) and Hsiao, et al . , Proc. Natl. Acad. Sci. USA 76(8): 3829-33 (1979).
  • other methods for introducing DNA into cells such as by nuclear microinjection, electroporation, bacterial protoplast fusion with intact cells, or polycations, e.g., polybrene or polyornithine, may also be used.
  • polycations e.g., polybrene or polyornithine
  • Suitable host cells for cloning or expressing the nucleic acid (e.g., DNA) in the vectors herein include prokaryote, yeast, or higher eukaryote cells.
  • Suitable prokaryotes include but are not limited to eubacteria, such as Gram-negative or Gram-positive organisms, for example, Enterobacteriacea such as E. coli.
  • E. coli strains are publicly available, such as E. coli K12 strain MM294 (ATCC 31,446); E.
  • coli strain X1776 ATCC 31,537); E. coli strain W3110 (ATCC 27,325) and K5 772 (ATCC 53,635).
  • Other suitable prokaryotic host cells include Enterobacteriaceae such as Escherichia, e.g., Enterobacter, Erwinia, Klebsiella, Proteus, Salmonella, e.g., Salmonella typhimurium, Serratia, e.g., Serratia marcescans, and Shigella, as well as Bacilli such as B. subtilis and B. lichenifor is (e.g., B. licheniformis 41P disclosed in DD 266,710, published 12 April 1989), Pseudomonas such as P.
  • Enterobacteriaceae such as Escherichia, e.g., Enterobacter, Erwinia, Klebsiella, Proteus, Salmonella, e.g., Salmonella typhimurium, Serrati
  • Strain W3110 is one particularly preferred host or parent host because it is a common host strain for recombinant DNA product fermentations. Preferably, the host cell secretes minimal amounts of proteolytic enzymes.
  • strain W3 110 may be modified to effect a genetic mutation in the genes encoding proteins endogenous to the host, with examples of such hosts including E. coli W3110 strain 1A2 , which has the complete genotype tonAD; E. coli W3110 strain 9E4, which has the complete genotype tonAD ptr3 ; E.
  • E. coli W3110 strain 27C7 (ATCC 55,244), which has the complete genotype tonAD ptr3 phoADEl5 D(argF-lac)169 ompTD degP41kanR'; E. coli W3110 strain 37D6, which has the complete genotype tonAD ptr3 phoADEl5 D(argF-lac)169 ompTD degP41kanR rbs7D ilvG; E. coli W3110 strain 40B4, which is strain 37D6 with a non-kanamycin resistant degP deletion mutation; and an E. coli strain having mutant periplasmic protease disclosed in U.S. Patent No. 4,946,783 issued 7 August 1990.
  • eukaryotic microbes such as filamentous fungi or yeast are suitable cloning or expression hosts for LP123, LP127, or LP129 vectors.
  • Saccharomyces cerevisiae is a commonly used lower eukaryotic host microorganism. Others include Schizosaccharomyces pombe [Beach and Nurse, Nature 290: 140-3 (1981); EP
  • Muyveromyces hosts [U.S. Patent No. 4,943,529; Fleer, et al . , Bio/Technology 9(10): 968-75 (1991)] such as, e.g., K. lactis (MW98-8C, CBS683, CBS4574) [de Louvencourt, et al . , J. Bacteriol . 154(2): 737- 42 (1983)]; K. fiagilis (ATCC 12,424), K. bulgaricus (ATCC 16,045), K. wickera ii (ATCC 24,178), K. waltii (ATCC 56,500), K.
  • K. lactis MW98-8C, CBS683, CBS4574
  • K. fiagilis ATCC 12,424
  • K. bulgaricus ATCC 16,045)
  • K. wickera ii ATCC 24,178
  • K. waltii ATCC 56,500
  • drosophilarum ATCC 36,906 [Van den Berg, et al., Bio/Technology 8(2): 135-9 (1990)]; K. thermotolerans, and K. marxianus; yarrowia (EP 402,226); Pichia pastoris (EP 183,070) [Sreekrishna, et al . , J. Basic Microbiol. 28(4): 265-78 (1988)]; Candida; Trichoderma reesia (EP 244,234); Neurospora crassa [Case, et al . , Proc. Natl. Acad Sci.
  • Schwanniomyces such as Schwanniomyces occidentulis (EP 394,538 published 31 October 1990); and filamentous fungi such as, e.g., Neurospora, Penicillium, Tolypocladium (WO 91/00357 published 10 January 1991) , and Aspergillus hosts such as A. nidulans [Ballance, et al . , Biochem. Biophys. Res. Comm. 112(1): 284-9 (1983)]; Tilburn, et al . , Gene 26(2-3): 205- 21 (1983); Yelton, et al . , Proc. Natl. Acad. Sci.
  • Methylotropic yeasts are selected from the genera consisting of Hansenula, Candida, Kloeckera, Pichia, Saccharomyces, Torulopsis, and Rhodotoruia. A list of specific species that are exemplary of this class of yeast may be found in C. Antony, The Biochemistry of Methylotrophs 269 (1982) .
  • Suitable host cells for the expression of glycosylated LP123, LP127, or LP129 are derived from multicellular organisms.
  • invertebrate cells include insect cells such as Drosophila S2 and Spodoptera Sp, Spodoptera High5 as well as plant cells.
  • useful mammalian host cell lines include Chinese hamster ovary (CHO) and COS cells. More specific examples include monkey kidney CV-1 line transformed by SV40 (COS-7, ATCC CRL 1651); human embryonic kidney line [293 or 293 cells subcloned for growth in suspension culture, Graham, et al . , J.
  • the LP123, LP127, or LP129 polypeptide may be produced recombinantly not only directly, but also as a fusion polypeptide with a heterologous polypeptide, which may be a signal sequence or other polypeptide having a specific cleavage site at the N-terminus of the mature protein or polypeptide.
  • the signal sequence may be a component of the vector, or it may be a part of the LP123, LP127, or LPl29-encoding DNA that is inserted into the vector.
  • the signal sequence may be a prokaryotic signal sequence selected, for example, from the group of the alkaline phosphatase, penicillinase, Ipp, or heat-stable enterotoxin II leaders.
  • the signal sequence may be, e.g., the yeast invertase leader, alpha factor leader (including Saccharomyces and Kluyveromyces cc- factor leaders, the latter described in U.S. Patent No. 5,010,182), or acid phosphatase leader, the C. albicans glucoamylase leader (EP 362,179), or the signal described in WO 90/13646.
  • yeast invertase leader alpha factor leader (including Saccharomyces and Kluyveromyces cc- factor leaders, the latter described in U.S. Patent No. 5,010,182)
  • acid phosphatase leader the C. albicans glucoamylase leader
  • mammalian signal sequences may be used to direct secretion of the protein, such as signal sequences from secreted polypeptides of the same or related species as well as viral secretory leaders .
  • Both expression and cloning vectors contain a nucleic acid sequence that enables the vector to replicate in one or more selected host cells. Such sequences are well known for a variety of bacteria, yeast, and viruses.
  • the origin of replication from the plasmid pBR322 is suitable for most Gram-negative bacteria, the 2 ⁇ plasmid origin is suitable for yeast, and various viral origins (SV40, polyoma, adenovirus, VSV or BPV) are useful for cloning vectors in mammalian cells .
  • Expression and cloning vectors will typically contain a selection gene, also termed a selectable marker.
  • Typical selection genes encode proteins that (a) confer resistance to antibiotics or other toxins, e.g., ampicillin, neomycin, methotrexate, or tetracycline, (b) complement auxotrophic deficiencies, or (c) supply critical nutrients not available from complex media, e.g., the gene encoding D-alanine racemase for Bacilli.
  • selectable markers for mammalian cells are those that enable the identification of cells competent to take up the LP123, LP127, or LPl29-encoding nucleic acid, such as DHFR or thymidine kinase.
  • An appropriate host cell when wild-type DHFR is employed is the CHO cell line deficient in DHFR activity, prepared and propagated as described by Urlaub and Chasin, Proc. Natl.
  • a suitable selection gene for use in yeast is the trp 1 gene present in the yeast plasmid YRp7 [Stinchcomb, et al . , Nature 282(5734): 39-43 (1979); Kingsman, et al . , Gene 7(2): 141-52 (1979); Tschumper, et al . , Gene 10(2): 157-66 (1980)].
  • the trp 1 gene provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, for example, ATCC No. 44076 or PEP4-1 [Jones, Genetics 85: 23-33 (1977) ] .
  • Expression and cloning vectors usually contain a promoter operably linked to the LP123, LP127, or LP129- encoding nucleic acid sequence to direct mRNA synthesis. Promoters recognized by a variety of potential host cells are well known. Promoters suitable for use with prokaryotic hosts include the P-lactamase and lactose promoter systems [Chang, et al . , Nature 275(5681): 617-24 (1978); Goeddel, et al., Nature 281(5732): 544-8 (1979)], alkaline phosphatase, a tryptophan (up) promoter system [Goeddel, Nucleic Acids Res.
  • Promoters for use in bacterial systems also will contain a Shine-Dalgarno (S.D.) sequence operably linked to the DNA encoding the LP123, LP127, or LP129 polypeptide.
  • S.D. Shine-Dalgarno
  • Suitable promoting sequences for use with yeast hosts include the promoters for 3-phosphoglycerate kinase [Hitzeman, et al . , J. Biol. Chem. 255(24): 12073-80 (1980)] or other glycolytic enzymes [Hess, et al . , J. Adv. Enzyme Reg.
  • yeast promoters which are inducible promoters having the additional advantage of transcription controlled by growth conditions, are the promoter regions for alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degradative enzymes associated with nitrogen metabolism, metallothionein, glyceraldehyde-3-phosphate dehydrogenase, and enzymes responsible for maltose and galactose utilization. Suitable vectors and promoters for use in yeast expression are further described in EP 73,657.
  • LP123, LP127, or LP129 transcription from vectors in mammalian host cells is controlled, for example, by promoters obtained from the genomes of viruses such as polyoma virus, fowlpox virus, adenovirus (such as Adenovirus 2), bovine papilloma virus, avian sarcoma virus, cytomegalovirus, a retrovirus, hepatitis-B virus and Simian Virus 40 (SV40) , from heterologous mammalian promoters, e.g., the actin promoter or an immunoglobulin promoter, and from heat-shock promoters, provided such promoters are compatible with the host cell systems.
  • viruses such as polyoma virus, fowlpox virus, adenovirus (such as Adenovirus 2), bovine papilloma virus, avian sarcoma virus, cytomegalovirus, a retrovirus, hepatitis-B virus and Simi
  • Enhancers are cis-acting elements of DNA, usually about from 10 to 300 bp, that act on a promoter to increase its transcription.
  • Many enhancer sequences are now known from mammalian genes (globin, elastase, albumin, alpha-ketoprotein, and insulin) . Typically, however, one will use an enhancer from a eukaryotic cell virus.
  • Examples include the SV40 enhancer on the late side of the replication origin (bp 100-270) , the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.
  • the enhancer may be spliced into the vector at a position 5' or 3' to the LP123, LP127, or LP129 coding sequence but is preferably located at a site 5' from the promoter.
  • Expression vectors used in eukaryotic host cells will also contain sequences necessary for the termination of transcription and for stabilizing the mRNA. Such sequences are commonly available from the 5' and occasionally 3' untranslated regions of eukaryotic or viral DNAs or cDNAs . These regions contain nucleotide segments transcribed as polyadenylated fragments in the untranslated portion of the mRNA encoding
  • LP123, LP127, or LP129 polypeptide Gene amplification and/or expression may be measured in a sample directly, for example, by conventional Southern blotting, Northern blotting to quantitate the transcription of mRNA [Thomas, Proc. Natl. Acad. Sci. USA 77(9): 5201-5 (1980)], dot blotting (DNA analysis), or in situ hybridization, using an appropriately labeled probe, based on the sequences provided herein.
  • antibodies may be employed that can recognize specific duplexes, including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or DNA-protein duplexes.
  • the antibodies in turn may be labeled and the assay may be carried out where the duplex is bound to a surface so that upon the formation of duplex on the surface, the presence of antibody bound to the duplex can be detected.
  • Gene expression alternatively, may be measured by immunological methods, such as immunohistochemical staining of cells or tissue sections and assay of cell culture or body fluids, to quantitate directly the expression of gene product.
  • Antibodies useful for immunohistochemical staining and/or assay of sample fluids may be either monoclonal or polyclonal and may be prepared in any mammal.
  • the antibodies may be prepared against a native sequence LP123, LP127, or LP129 polypeptide or against a synthetic peptide based on the DNA sequences provided herein or against exogenous sequence fused to LP123-, LP127-, or
  • LP123, LP127, or LP129 may be recovered from culture medium or from host cell lysates . If membrane- bound, it can be released from the membrane using a suitable detergent solution (e.g., Triton-X 100) or by enzymatic cleavage. Cells employed in expression of LP123, LP127, or LP129 polypeptides can be disrupted by various physical or chemical means, such as freeze-thaw cycling, sonication, mechanical disruption, or cell lysing agents.
  • LP123, LP127, or LP129 may be desired to purify LP123, LP127, or LP129 from recombinant cell proteins or polypeptides .
  • the following procedures are exemplary of suitable purification procedures: by fractionation on an ion-exchange column; ethanol precipitation; reversed-phase HPLC; chromatography on silica or on a cation-exchange resin such as DEAE; chromatofocusing; SDS-PAGE; ammonium sulfate precipitation; gel filtration using, for example, Sephadex G-75; protein A Sepharose columns to remove contaminants such as IgG; and metal chelating columns to bind epitope-tagged forms of the LP123, LP127, or LP129 polypeptide.
  • LP123, LP127, or LP129 polypeptides have various applications in the art of molecular biology, including uses as hybridization probes, in chromosome and gene mapping and in the generation of antisense RNA and DNA.
  • LP123, LP127, or LP129-encoding nucleic acid will also be useful for the preparation of LP123, LP127, or LP129 polypeptides by the recombinant techniques described herein.
  • the full-length LP123, LP127, or LP129 nucleotide- encoding sequence may be used as hybridization probes for a cDNA library to isolate the full-length LP123, LP127, or LP129 gene or genomic sequences including promoters, enhancer elements and introns of native sequence LP123, LP127, or LP129-encoding DNA or to isolate still other genes (for instance, those encoding naturally-occurring variants of LP123, LP127, or LP129, or the same from other species) which have a desired sequence identity to the LP123, LP127, or LP129 nucleotide sequence disclosed in SEQ ID N0:1, 3, or 5, respectively.
  • Hybridization techniques are well known in the art, some of which are described in further detail in the Examples below.
  • LP123, LP127, or LP129 nucleic acids include antisense or sense oligonucleotides comprising a single-stranded nucleic acid sequence (either RNA or DNA) capable of binding to target LP123, LP127, or LP129 mRNA (sense) of LP123, LP127, or LP129 DNA (antisense) sequences.
  • Antisense or sense oligonucleotides comprise a fragment of the coding region of LP123, LP127, or LP129 DNA. Such a fragment generally comprises at least about 14 nucleotides, preferably from about 14 to 30 nucleotides.
  • binding of antisense or sense oligonucleotides to target nucleic acid sequences results in the formation of duplexes that block transcription or translation of the target sequence by one of several means, including enhanced degradation of the duplexes, premature termination of transcription or translation, or by other means.
  • the antisense oligonucleotides thus may be used to block expression of LP123, LP127, or LP129 proteins.
  • Antisense or sense oligonucleotides further comprise oligonucleotides having modified sugar-phosphodiester backbones (or other sugar linkages, such as those described in WO 91/06629) and wherein such sugar linkages are resistant to endogenous nucleases .
  • Such oligonucleotides with resistant sugar linkages are stable in vivo (i.e., capable of resisting enzymatic degradation) but retain sequence specificity to be able to bind to target nucleotide sequences .
  • Other examples of sense or antisense oligonucleotides include those oligonucleotides which are covalently linked to organic moieties, such as those described in WO 90/10448, and other moieties that increase affinity of the oligonucleotide for a target nucleic acid sequence, such poly-L-lysine.
  • intercalating agents such as ellipticine, and alkylating agents or metal complexes may be attached to sense or antisense oligonucleotides to modify binding specificities of the antisense or sense oligonucleotide for the target nucleotide sequence.
  • Antisense or sense oligonucleotides may be introduced into a cell containing the target nucleic acid sequence by any gene transfer method, including, for example, CaP04- mediated DNA transfection, electroporation, or by using gene transfer vectors such as Epstein-Barr virus. In a preferred procedure, an antisense or sense oligonucleotide is inserted into a suitable retroviral vector.
  • a cell containing the target nucleic acid sequence is contacted with the recombinant retroviral vector, either in vivo or ex vivo.
  • Suitable retroviral vectors include, but are not limited to, those derived from the murine retrovirus M-MuLV, N2 (a retrovirus derived from M-MuLV) , or the double copy vectors designated DCT5A, DCT5B and DCT5C (see WO 90/13641) .
  • a sense or an antisense oligonucleotide may be introduced into a cell containing the target nucleic acid sequence by formation of an oligonucleotide-lipid complex, as described in WO 90/10448.
  • the sense or antisense oligonucleotide-lipid complex is preferably dissociated within the cell by an endogenous lipase.
  • the LP123, LP127, or LP129 polypeptide can be used in assays to identify the other proteins or molecules involved in the binding interaction. By such methods, inhibitors of the receptor/ligand binding interaction can be identified. Proteins involved in such binding interactions can also be used to screen for peptide or small molecule inhibitors or agonists of the binding interaction. Also, the receptor LP123, LP127, or LP129 polypeptide can be used to isolate correlative ligand ( s) .
  • Screening assays can be designed to find lead compounds that mimic the biological activity of a native LP123, LP127, or LP129 or a receptor for LP123, LP127, or LP129.
  • Such screening assays will include assays amenable to high- throughput screening of chemical libraries, making them particularly suitable for identifying small molecule drug candidates.
  • Small molecules contemplated include synthetic organic or inorganic compounds.
  • the assays can be performed in a variety of formats, including protein-protein binding assays, biochemical screening assays, immunoassays and cell -based assays, which are well characterized in the art.
  • Nucleic acids which encode LP123, LP127, or LP129 polypeptide or any modified forms can also be used to generate either transgenic animals or "knock out" animals which, in turn, are useful in the development and screening of therapeutically useful reagents.
  • Methods for generating transgenic animals, particularly animals such as mice or rats, have become conventional in the art and are described, for example, in U.S. Patent Nos. 4,736,866 and 4,870,009.
  • particular cells would be targeted for LP123, LP127, or LP129 transgene incorporation with tissue-specific enhancers.
  • Transgenic animals that include a copy of a transgene encoding LP123, LP127, or LP129 introduced into the germ line of the animal at an embryonic stage can be used to examine the effect of increased expression of DNA encoding LP123, LP127, or LP129 polypeptide.
  • Such animals can be used as tester animals for reagents thought to confer protection from, for example, pathological conditions associated with its overexpression.
  • an animal is treated with the reagent and a reduced incidence of the pathological condition, compared to untreated animals bearing the transgene, would indicate a potential therapeutic intervention for the pathological condition.
  • non-human homologues of LP123, LP127, or LP129 can be used to construct an LP123, LP127, or LP129 "knock out" animal which has a defective or altered gene encoding LP123, LP127, or LP129 polypeptide as a result of homologous recombination between the endogenous gene encoding LP123, LP127, or LP129 polypeptide and altered genomic DNA encoding LP123, LP127, or LP129 polypeptide introduced into an embryonic cell of the animal .
  • cDNA encoding LP123, LP127, or LP129 polypeptide can be used to clone genomic DNA encoding LP123, LP127, or LP129 polypeptide, respectively, in accordance with established techniques.
  • a portion of the genomic DNA encoding LP123, LP127, or LP129 polypeptide can be deleted or replaced with another gene, such as a gene encoding a selectable marker which can be used to monitor integration.
  • Typically, several kilobases of unaltered flanking DNA are included in the vector [see, e.g., Thomas and Capecchi, Cell 51(3): 503-12 (1987) for a description of homologous recombination vectors] .
  • the vector is introduced into an embryonic stem cell line (e.g., by electroporation) , and cells in which the introduced DNA has homologously recombined with the endogenous DNA are selected [see, e.g., Li, et al . , Cell 69(6): 915-26 (1992)].
  • the selected cells are then injected into a blastocyst of an animal (e.g., a mouse or rat) to form aggregation chimeras [see, e.g., Bradley, Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, E. J. Robertson, ed. (IRL,
  • a chimeric embryo can then be implanted into a suitable pseudopregnant female foster animal and the embryo brought to term to create a "knock out" animal.
  • Progeny harboring the homologously recombined DNA in their germ cells can be identified by standard techniques and used to breed animals in which all cells of the animal contain the homologously recombined DNA.
  • Knockout animals can be characterized, for instance, for their ability to defend against certain pathological conditions and for their development of pathological conditions due to absence of the LP123, LP127, or LP129 polypeptide .
  • LP123, LP127, or LP129 transgenic non-human mammals are useful as an animal models in both basic research and drug development endeavors.
  • Transgenic animals carrying at least one LP123, LP127, or LP129 polypeptide or nucleic acid can be used to test compounds or other treatment modalities which may prevent, suppress, or cure a pathology or disease associated with at least one of the above mentioned LP123, LP127, or LP129 activities.
  • Such transgenic animals can also serve as a model for the testing of diagnostic methods for those same diseases.
  • tissues derived from LP123, LP127, or LP129 transgenic non-human mammals are useful as a source of cells for cell culture in efforts to develop in vitro bioassays to identify compounds that modulate LP123, LP127, or LP129 activity or LP123, LP127, or LP129 dependent signaling.
  • another aspect of the present invention contemplates a method of identifying compounds efficacious in the treatment of at least one previously described disease or pathology associated with LP123, LP127, or LP129 activity.
  • a non-limiting example of such a method comprises: a) generating an LP123, LP127, or LP129 transgenic non-human animal which is, as compared to a wild-type animal, pathologically distinct in some detectable or measurable manner from wild-type version of said non-human mammal; b) exposing said transgenic animal to a compound, and; c) determining the progression of the pathology in the treated transgenic animal, wherein an arrest, delay, or reversal in disease progression in transgenic animal treated with said compound as compared to the progression of the pathology in an untreated control animals is indicative that the compound is useful for the treatment of said pathology.
  • Another embodiment of the present invention provides a method of identifying compounds capable of inhibiting LP123, LP127, or LP129 activity in vivo and/or in vitro wherein said method comprises: a) administering an experimental compound to an LP123, LP127, or LP129 transgenic non-human animal, or tissues derived therefrom, exhibiting one or more physiological or pathological conditions attributable to the overexpression of an LP123, LP127, or LP129 transgene ; and b) observing or assaying said animal and/or animal tissues to detect changes in said physiological or pathological condition or conditions.
  • Another embodiment of the invention provides a method for identifying compounds capable of overcoming deficiencies in LP123, LP127, or LP129 activity in vivo or in vitro wherein said method comprises: a) administering an experimental compound to an LP123, LP127, or LP129 transgenic non-human animal, or tissues derived therefrom, exhibiting one or more physiological or pathological conditions attributable to the disruption of the endogenous LP123, LP127, or LP129 gene; and b) observing or assaying said animal and/or animal tissues to detect changes in said physiological or pathological condition or conditions.
  • Various means for determining a compound's ability to modulate LP123, LP127, or LP129 in the body of the transgenic animal are consistent with the invention. Observing the reversal of a pathological condition in the transgenic animal after administering a compound is one such means . Another more preferred means is to assay for markers of LP123, LP127, or LP129 activity in the blood of a transgenic animal before and after administering an experimental compound to the animal. The level of skill of an artisan in the relevant arts readily provides the practitioner with numerous methods for assaying physiological changes related to therapeutic modulation of LP123, LP127, or LP129 activity.
  • Gene therapy includes both conventional gene therapy, where a lasting effect is achieved by a single treatment, and the administration of gene therapeutic agents, which involves the one time or repeated administration of a therapeutically effective DNA or mRNA.
  • Antisense RNAs and DNAs can be used as therapeutic agents for blocking the expression of certain genes in vivo. It has already been shown that short ' antisense oligonucleotides can be imported into cells where they act as inhibitors, despite their low intracellular concentrations caused by their restricted uptake by the cell membrane [Zamecnik, et al . , Proc. Natl. Acad Sci. USA 83(12): 4143-6 (1986)]. The oligonucleotides can be modified to enhance their uptake, e.g., by substituting their negatively charged phosphodiester groups with uncharged groups.
  • nucleic acids there are a variety of techniques available for introducing nucleic acids into viable cells.
  • the techniques vary depending upon whether the nucleic acid is transferred into cultured cells in vitro or in vivo in the cells of the intended host.
  • Techniques suitable for the transfer of nucleic acid into mammalian cells in vitro include the use of liposo es, electroporation, microinjection, cell fusion, DEAE-dextran, the calcium phosphate precipitation method, etc.
  • the currently preferred in vivo gene transfer techniques include transfection with viral (typically, retroviral) vectors and viral coat protein-liposome mediated transfection [Dzau, et al . , Trends in Biotechnology 11(5): 205-10 (1993)].
  • nucleic acid source with an agent that targets the target cells, such as an antibody specific for a cell surface membrane protein or the target cell, a ligand for a receptor on the target cells, etc.
  • an agent that targets the target cells such as an antibody specific for a cell surface membrane protein or the target cell, a ligand for a receptor on the target cells, etc.
  • proteins which bind to a cell surface membrane protein associated with endocytosis may by used for targeting and/or to facilitate uptake, e.g., capsid proteins or fragments thereof tropic for a particular cell type, antibodies for proteins which undergo internalization in cycling, proteins that target intracellular localization and enhance intracellular half-life.
  • the technique of receptor- mediated endocytosis is described, for example by Wu, et al., J. Biol. Chem.
  • nucleic acid molecule encoding the LP123, LP127, or LP129 polypeptides or fragments thereof described herein are useful for chromosome identification.
  • LP123, LP127, or LP129 nucleic acid molecule of the present invention can be used as a chromosome marker.
  • the present invention further provides anti-LPl23, -LP127, or -LP129 polypeptide antibodies.
  • exemplary antibodies include polyclonal, monoclonal, humanized, bispecific, and heteroconjugate antibodies.
  • the anti-LPl23, -LP127, or -LP129 antibodies of the present invention may comprise polyclonal antibodies. Methods of preparing polyclonal antibodies are known to the skilled artisan. Polyclonal antibodies can be raised in a mammal, for example, by one or more injections of an immunizing agent and, if desired, an adjuvant. Typically, the immunizing agent and/or adjuvant will be injected in the mammal by multiple subcutaneous or intraperitoneal injections.
  • the immunizing agent may include the LP123, LP127, or LP129 polypeptide or a fusion protein thereof. It may be useful to conjugate the immunizing agent to a protein known to be immunogenic in the mammal being immunized.
  • immunogenic proteins include, but are not limited to, keyhole limpet hemocyanin, serum albumin, bovine thyroglobulin, and soybean trypsin inhibitor.
  • adjuvants which may be employed include Freund's complete adjuvant and MPL-TDM adjuvant (monophosphoryl Lipid A, synthetic trehalose dicorynomycolate) .
  • the immunization protocol may be selected by one skilled in the art without undue experimentation.
  • the anti-LPl23, -LP127, or -LP129 antibodies may, alternatively, be monoclonal antibodies . Monoclonal antibodies may be prepared using hybridoma methods, such as those described by Kohler and Milstein, Nature 256(5517): 495-7 (1975) .
  • a mouse, hamster, or other appropriate host animal is typically immunized with an immunizing agent to elicit lymphocytes that produce or are capable of producing antibodies that will specifically bind to the immunizing agent.
  • the lymphocytes may be immunized in vitro.
  • the immunizing agent will typically include the LP123, LP127, or LP129 polypeptide or a fusion protein thereof.
  • PBLs peripheral blood lymphocytes
  • spleen cells or lymph node cells are used, if non-human mammalian sources are desired.
  • the lymphocytes are then fused with an immortalized cell line using a suitable fusing agent, such as polyethylene glycol, to form a hybridoma cell [Goding, Monoclonal Antibodies: Principles and Practice, Academic Press, (1986) pp. 59-103].
  • Immortalized cell lines are usually transformed mammalian cells, particularly myeloma cells of rodent, bovine and human origin. Usually, rat or mouse myeloma cell lines are employed.
  • the hybridoma cells may be cultured in a suitable culture medium that preferably contains one or more substances that inhibit the growth or survival of the unfused, immortalized cells.
  • the culture medium for the hybridomas typically will include hypoxanthine, aminopterin, and thymidine ("HAT medium”), which prevents the growth of HGPRT-deficient cells.
  • HGPRT hypoxanthine guanine phosphoribosyl transferase
  • Preferred immortalized cell lines are those that fuse efficiently, support stable high level expression of antibody by the selected antibody-producing cells, and are sensitive to a medium such as HAT medium. More preferred immortalized cell lines are murine myeloma lines, which can be obtained, for instance, from the Salk Institute Cell Distribution Center, San Diego, California, and the American Type Culture Collection, Rockville, Maryland. Human myeloma and mouse-human heteromyeloma cell lines also have been described for the production of human monoclonal antibodies [Kozbor, J. Immunol. 133(6): 3001-5 (1984); Brodeur, et al . , Monoclonal Antibody Production Techniques and
  • the culture medium in which the hybridoma cells are cultured can then be assayed for the presence of monoclonal antibodies directed against an LP123, LP127, or LP129 polypeptide.
  • the binding specificity of monoclonal antibodies produced by the hybridoma cells is determined by immunoprecipitation or by an in vitro binding assay, such as radioimmunoassay (RIA) or enzyme-linked immunoabsorbent assay (ELISA) .
  • RIA radioimmunoassay
  • ELISA enzyme-linked immunoabsorbent assay
  • the binding affinity of the monoclonal antibody can, for example, be determined by the Scatchard analysis of Munson and Rodbard, Anal. Biochem. 107(1) : 220-39 (1980) .
  • the clones may be subcloned by limiting dilution procedures and grown by standard methods (Goding, supra) .
  • Suitable culture media for this purpose include, for example, Dulbecco's Modified Eagle's Medium and RPMI-1640 medium.
  • the hybridoma cells may be grown in vivo as ascites in a mammal.
  • the monoclonal antibodies may also be made by recombinant DNA methods, such as those described in U.S. Patent No. 4,816,567.
  • DNA encoding the monoclonal antibodies of the invention can be readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of murine antibodies) .
  • the hybridoma cells of the invention serve as a preferred source of such DNA.
  • the DNA may be placed into expression vectors, which are then transfected into host cells such as simian COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not otherwise produce immunoglobulin protein, to obtain the synthesis of monoclonal antibodies in the recombinant host cells.
  • host cells such as simian COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not otherwise produce immunoglobulin protein, to obtain the synthesis of monoclonal antibodies in the recombinant host cells.
  • the DNA also may be modified, for example, by substituting the coding sequence for human heavy and light chain constant domains in place of the homologous murine sequences [U.S. Patent No. 4,816,567; Morrison, et al . , Proc. Natl. Acad. Sci.
  • non-immunoglobulin polypeptide can be substituted for the constant domains of an antibody of the invention or can be substituted for the variable domains of one antigen-combining site of an antibody of the invention to create a chimeric bivalent antibody.
  • the antibodies may be monovalent antibodies.
  • Methods for preparing monovalent antibodies are well known in the art. For example, one method involves recombinant expression of immunoglobulin light chain and modified heavy chain.
  • the heavy chain is truncated generally at any point in the Fc region so as to prevent heavy chain crosslinking.
  • the relevant cysteine residues are substituted with another amino acid residue or are deleted so as to prevent crosslinking.
  • In vitro methods are also suitable for preparing monovalent antibodies .
  • Digestion of antibodies to produce fragments thereof, particularly Fab fragments, can be accomplished using routine techniques known in the art.
  • the anti-LPl23, LP127, or LP129 antibodies of the invention may further comprise humanized antibodies or human antibodies.
  • Humanized forms of non-human (e.g., murine) antibodies are chimeric immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab', F(ab')2 or other antigen-binding subsequences of antibodies) which contain minimal sequence derived from non-human immunoglobulin.
  • Humanized antibodies include human immunoglobulins (recipient antibody) in which residues from a complementary-determining region (CDR) of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity and capacity.
  • CDR complementary-determining region
  • Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues.
  • Humanized antibodies may also comprise residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences.
  • the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin, and all or substantially all of the FR regions are those of a human immunoglobulin consensus sequence.
  • the humanized antibody optimally also will comprise at least a portion of an immunoglobulin constant region (Fc) , typically that of a human immunoglobulin [Jones, et al .
  • a humanized antibody has one or more amino acid residues introduced into it from a source which is non-human. These non-human amino acid residues are often referred to as "import" residues, which are typically taken from an "import” variable domain. Humanization can be essentially performed following the method of Winter and co- workers [Jones, et al . , Nature 321(6069): 522-5 (1986); Riechmann, et al., Nature 332(6162): 323-7 (1988); Verhoeyen, et al .
  • humanized antibodies are chimeric antibodies (U.S. Patent No. 4,816,567) wherein substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non-human species .
  • humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies .
  • Human antibodies can also be produced using various techniques known in the art, including phage display libraries [Hoogenboom and Winter, J. Mol. Biol. 227(2) : 381- 8 (1992); Marks, et al . , J. Mol. Biol. 222(3): 581-97 (1991)].
  • the techniques of Cole et al . and Boerner, et al . are also available for the preparation of human monoclonal antibodies (Cole, et al . , Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77 (1985) and Boerner, et al . , J. Immunol. 147(1): 86-95 (1991)].
  • human antibodies can be made by introducing human immunoglobulin loci into transgenic animals, e.g., mice in which the endogenous immunoglobulin genes have been partially or complete inactivated. Upon challenge, human antibody production is observed, which closely resembles that seen in humans in all respects, including gene rearrangement, assembly and antibody repertoire.
  • transgenic animals e.g., mice in which the endogenous immunoglobulin genes have been partially or complete inactivated.
  • human antibody production is observed, which closely resembles that seen in humans in all respects, including gene rearrangement, assembly and antibody repertoire.
  • This approach is described, for example, in U.S. Patent Nos. 5,545,807; 5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,661,016, and in the following scientific publications: Marks, et al . , Biotechnology 10(7): 779-83 (1992); Lonberg, et al .
  • Bispecific antibodies are monoclonal, preferably human or humanized, antibodies that have binding specificities for at least two different antigens.
  • one of the binding specificities is for an LP123, LP127, or LP129 polypeptide, the other one is for any other antigen, and preferably for a cell-surface protein or receptor or receptor subunit.
  • Methods for making bispecific antibodies are known in the art.
  • Antibodies with more than two valencies are contemplated.
  • trispecific antibodies can be prepared [Tutt, et al . , J. Immunol. 147(1) : 60-9 (1991) ] .
  • Heteroconjugate antibodies are also within the scope of the present invention.
  • Heteroconjugate antibodies are composed of two covalently joined antibodies. Such antibodies have, for example, been proposed to target immune system cells to unwanted cells [U.S. Patent No. 4,676,980], and for treatment of HIV infection [WO 91/00360; WO
  • the antibodies may be prepared in vitro using known methods in synthetic protein chemistry, including those involving crosslinking agents.
  • immunotoxins may be constructed using a disulfide exchange reaction or by forming a thioether bond.
  • suitable reagents for this purpose include iminothiolate and methyl-4-mercaptobutyrimidate and those disclosed, for example, in U.S. Patent No. 4,676,980.
  • the invention also pertains to immunoconjugates comprising an antibody conjugated to a cytotoxic agent such as a chemotherapeutic agent, toxin (e.g., an enzymatically active toxin of bacterial, fungal, plant or animal origin, or fragments thereof, or a small molecule toxin) , or a radioactive isotope (i.e., a radioconjugate) .
  • a cytotoxic agent such as a chemotherapeutic agent, toxin (e.g., an enzymatically active toxin of bacterial, fungal, plant or animal origin, or fragments thereof, or a small molecule toxin)
  • toxin e.g., an enzymatically active toxin of bacterial, fungal, plant or animal origin, or fragments thereof, or a small molecule toxin
  • radioactive isotope i.e., a radioconjugate
  • Conjugates of the antibody and cytotoxic agent are made using a variety of bifunctional protein coupling agents such as N-succinimidyl-3- (2-pyridyldithiol) propionate (SPDP) , iminothiolane (IT) , bifunctional derivatives of imidoesters (such as dimethyl adipimidate HCl) , active esters (such as disuccinimidyl suberate) , aldehydes (such as glutaraldehyde) , bis-azido compounds [such as bis- (p- azidobenzoyl) hexanediamine] , bis-diazonium derivatives [such as bis- (p-diazoniumbenzoyl) -ethylenediamine] , diisocyanates (such as tolylene 2 , 6-diisocyanate) , and bis- active fluorine compounds (such as 1, 5-difluoro-2 , 4- dinitrobenzene)
  • a ricin immunotoxin can be prepared as described in Vitetta, et al . , Science 238(4830): 1098-104 (1987) .
  • Carbon-14-labeled 1-isothiocyanatobenzyl- 3-methyldiethylene triaminepentaacetic acid (MX-DTPA) is an exemplary chelating agent for conjugation of radionucleotide to the antibody.
  • the antibody may be conjugated to a "receptor” (such as streptavidin) for utilization in tumor pretargeting wherein the antibody-receptor conjugate is administered to the patient, followed by removal of unbound conjugate from the circulation using a clearing agent, and then administration of a "ligand” (e.g., avidin) which is conjugated to a cytotoxic agent (e.g., a radionuclide) .
  • a ligand e.g., avidin
  • cytotoxic agent e.g., a radionuclide
  • the antibodies disclosed herein may also be formulated as immunoliposomes .
  • Liposomes containing the antibody are prepared by methods known in the art, such as described in Eppstein, et al . , Proc. Natl. Acad. Sci. USA 82: 3688-92 (1985); Hwang, et al . , Proc. Natl. Acad. Sci. USA 77(7): 4030-4 (1980); and U.S. Pat. Nos. 4,485,045 and 4,544,545. Liposomes with enhanced circulation time are disclosed in U.S. Patent No. 5,013,556.
  • Particularly useful liposomes can be generated by the reverse phase evaporation method with a lipid composition comprising phosphatidylcholine, cholesterol and PEG- derivatized phosphatidylethanolamine (PEG-PE) .
  • Liposomes are extruded through, filters of defined pore size to yield liposomes with the desired diameter.
  • Fab' fragments of the antibody of the present invention can be conjugated to the liposomes as described in Martin, et al . , J. Biol. Chem. 257(1): 286-8 (1982) via a disulfide interchange reaction.
  • a chemotherapeutic agent such as Doxorubicin is optionally contained within the liposome. See Gabizon, et al . , J. National Cancer Inst. 81(19): 484-8 ( 1989).
  • Antibodies specifically binding an LP123, LP127, or LP129 polypeptide identified herein, as well as other molecules identified by the screening assays disclosed hereinbefore, can be administered for the treatment of various disorders in the form of pharmaceutical compositions .
  • an LP123, LP127, or LP129 polypeptide is intracellular and whole antibodies are used as inhibitors, internalizing antibodies are preferred.
  • lipofections or liposomes can also be used to deliver the antibody or an antibody fragment into cells .
  • the smallest inhibitory fragment that specifically binds to the binding domain of the target protein is preferred.
  • peptide molecules can be designed that retain the ability to bind the target protein sequence.
  • Such peptides can be synthesized chemically and/or produced by recombinant DNA technology. See, e.g., Marasco, et al . , Proc. Natl. Acad. Sci. USA 90(16): 7889-93 (1993).
  • the formulation herein may also contain more than one active compound as necessary for the particular indication being treated, preferably those with complementary activities that do not adversely affect each other.
  • the composition may comprise an agent that enhances its function, such as, for example, a cytotoxic agent, cytokines, chemotherapeutic agent, or growth-inhibitory agent.
  • cytotoxic agent such as, for example, a cytotoxic agent, cytokines, chemotherapeutic agent, or growth-inhibitory agent.
  • the active ingredients may also be entrapped in microcapsules prepared, for example, by coacervation techniques or by interfacial polymerization, for example, hydroxymethylcellulose or gelatin-microcapsules and poly- (methylmethacrylate) microcapsules, respectively, in colloidal drug delivery systems (for example, liposomes, albumin microspheres, microemulsions, nano-particles, and nanocapsules) or in macroemulsions .
  • colloidal drug delivery systems for example, liposomes, albumin microspheres, microemulsions, nano-particles, and nanocapsules
  • the formulations to be used for in vivo administration must be sterile. This is readily accomplished by filtration through sterile filtration membranes. Sustained-release preparations may be prepared.
  • sustained-release preparations include semipermeable matrices of solid hydrophobic polymers containing the antibody, which matrices are in the form of shaped articles, e.g., films or microcapsules.
  • sustained-release matrices include polyesters, hydrogels (for example, poly (2-hydroxyethyl-methacrylate) , or poly(vinylalcohol) ) , polylactides (U.S. Pat. No. 3,773,919), copolymers of L-glutamic acid and ethyl-L-glutamate, non- degradable ethylene-vinylacetate, degradable lactic acid- glycolic acid copolymers such as the LUPRON DEPOTTM
  • injectable microspheres composed of lactic acid-glycolic acid copolymer and leuprolide acetate
  • poly-D-(-)3- hydroxybutyric acid While polymers such as ethylene-vinyl acetate and lactic acid-glycolic acid enable release of molecules for over 100 days, certain hydrogels release proteins for shorter time periods .
  • encapsulated antibodies When encapsulated antibodies remain in the body for a long time, they may denature or aggregate as a result of exposure to moisture at 37°C, resulting in a loss of biological activity and possible changes in immunogenicity. Rational strategies can be devised for stabilization depending on the mechanisms involved.
  • stabilization may be achieved by modifying sulfhydryl residues, lyophilizing from acidic solutions, controlling moisture content, using appropriate additives, and developing specific polymer matrix compositions .
  • anti-LP123, -LP127, or -LP129 antibodies of the present invention have various utilities.
  • anti-LP123, -LP127, or -LP129 antibodies may be used in diagnostic assays for LP123, LP127, or LP129 polypeptides, e.g., detecting expression in specific cells, tissues, or serum.
  • diagnostic assay techniques known in the art may be used, such as competitive binding assays, direct or indirect sandwich assays and immunoprecipitation assays conducted in either heterogeneous or homogeneous phases
  • the antibodies used in the assays can be labeled with a detectable moiety.
  • the detectable moiety should be capable of producing, either directly or indirectly, a detectable signal.
  • the detectable moiety may be a radioisotope, such as 3H, 14C, 32P, 35S, or 1251, a fluorescent or chemiluminescent compound, such as fluorescein isothiocyanate, rhodamine, or luciferin, or an enzyme, such as alkaline phosphatase, beta- galactosidase or horseradish peroxidase.
  • Anti-LPl23, -LP127, or -LP129 antibodies also are useful for the affinity purification of LP123, LP127, or LP129 polypeptides from recombinant cell culture or natural sources.
  • the antibodies against an LP123, LP127, or LP129 polypeptide are immobilized on a suitable support, such a Sephadex resin or filter paper, using methods well known in the art.
  • a suitable support such as a Sephadex resin or filter paper
  • the immobilized antibody is then contacted with a sample containing the LP123, LP127, or LP129 polypeptide to be purified, and thereafter the support is washed with a suitable solvent that will remove substantially all the material in the sample except the
  • LP123, LP127, or LP129 polypeptide which is bound to the immobilized antibody. Finally, the support is washed with another suitable solvent that will release the LP123, LP127, or LP129 polypeptide from the antibody.
  • This invention encompasses methods of screening compounds to identity those that mimic the LP123, LP127, or LP129 polypeptide (agonists) or prevent the effect of the LP123, LP127, or LP129 polypeptide (antagonists). Screening assays for antagonist drug candidates are designed to identify compounds that bind or complex with the LP123,
  • screening assays will include assays amenable to high- throughput screening of chemical libraries, making them particularly suitable for identifying small molecule drug candidates .
  • the assays can be performed in a variety of formats .
  • binding assays the interaction is binding, and the complex formed can be isolated or detected in the reaction mixture.
  • the LP123, LP127, or LP129 polypeptide encoded by the gene identified herein or the drug candidate is immobilized on a solid phase, e.g., on a microtiter plate, by covalent or non-covalent attachments.
  • Non-covalent attachment generally is accomplished by coating the solid surface with a solution of the LP123, LP127, or LP129 polypeptide and drying.
  • an immobilized antibody e.g., a monoclonal antibody, specific for the LP123, LP127, or LP129 polypeptide to be immobilized
  • the assay is performed by adding the non-immobilized component, which may be labeled by a detectable label, to the immobilized component, e.g., the coated surface containing the anchored component.
  • the non-reacted components are removed, e.g., by washing, and complexes anchored on the solid surface are detected.
  • the detection of label immobilized on the surface indicates that complexing occurred.
  • complexing can be detected, for example, by using a labeled antibody specifically binding the immobilized complex.
  • the candidate compound interacts with but does not bind to a particular LP123, LP127, or LP129 polypeptide encoded by a gene identified herein
  • its interaction with that polypeptide can be assayed by methods well known for detecting protein-protein interactions.
  • assays include traditional approaches, such as, e.g., cross-linking, co- immunoprecipitation, and co-purification through gradients or chromatographic columns.
  • protein-protein interactions can be monitored through gradients or chromatographic columns.
  • protein-protein interactions can be monitored by using a yeast-based genetic system described by Fields and co-workers [Fields and Song, Nature 340(6230): 245-6 (1989); Chien, et al . , Proc.
  • yeast GAL4 Many transcriptional activators, such as yeast GAL4, consist of two physically discrete modular domains, one acting as the DNA-binding domain, while the other functions as the transcription-activation domain.
  • yeast expression system described in the foregoing publications (generally referred to as the "two-hybrid system") takes advantage of this property, and employs two hybrid proteins, one in which the target protein is fused to the DNA-binding domain of GAL4, and another in which candidate activating proteins are fused to the activation domain.
  • GALl-lacZ reporter gene under control of a GAL4-activated promoter depends on reconstitution of GAL4 activity via protein- protein interaction. Colonies containing interacting polypeptides are detected with a chromogenic substrate for beta-galactosidase.
  • a complete kit (MATCHMAKERTM) for identifying protein-protein interactions between two specific proteins using the two-hybrid technique is commercially available from Clontech. This system can also be extended to map protein domains involved in specific protein interactions as well as to pinpoint amino acid residues that are crucial for these interactions .
  • a reaction mixture is prepared containing the product of the gene and the intra- or extracellular component under conditions and for a time allowing for the interaction and binding of the two products .
  • a candidate compound to inhibit binding, the reaction is run in the absence and in the presence of the test compound.
  • a placebo may be added to a third reaction mixture to serve as a positive control.
  • the binding (complex formation) between the test compound and the intra- or extracellular component present in the mixture is monitored as described hereinabove.
  • the formation of a complex in the control reaction (s) but not in the reaction mixture containing the test compound indicates that the test compound interferes with the interaction of the test compound and its reaction partner .
  • Antagonists may be detected by combining the LP123, LP127, or LP129 polypeptide and a potential antagonist with membrane-bound LP123, LP127, or LP129 polypeptide receptors or recombinant receptors under appropriate conditions for a competitive inhibition assay.
  • the LP123, LP127, or LP129 polypeptide can be labeled, such as by radioactivity, such that the number of LP123, LP127, or LP129 polypeptide molecules bound to the receptor can be used to determine the effectiveness of the potential antagonist.
  • the gene encoding the receptor can be identified by numerous methods known to those of skill in the art, for example, ligand panning and FACS sorting. See Coligan, et al .
  • RNA is prepared from a cell responsive to the LP123, LP127, or LP129 polypeptide, and a cDNA library created from this RNA is divided into pools and used to transfect COS cells or other cells that are not responsive to the LP123, LP127, or LP129 polypeptide.
  • Transfected cells that are grown on glass slides are exposed to labeled LP123, LP127, or LP129 polypeptide.
  • the LP123, LP127, or LP129 polypeptide can be labeled by a variety of means including iodination or inclusion of a recognition site for a site-specific protein kinase. Following fixation and incubation, the slides are subjected to autoradiographic analysis. Positive pools are identified and sub-pools are prepared and re-transfected using an interactive sub-pooling and re-screening process, eventually yielding a single clone that encodes the putative receptor.
  • labeled LP123, LP127, or LP129 polypeptide can be photoaffinity-linked with cell membrane or extract preparations that express the receptor molecule.
  • Cross- linked material is resolved by PAGE and exposed to X-ray film.
  • the labeled complex containing the receptor can be excised, resolved into peptide fragments, and subjected to protein micro-sequencing.
  • the amino acid sequence obtained from micro-sequencing would be used to design a set of degenerate oligonucleotide probes to screen a cDNA library to identify the gene encoding the putative receptor .
  • mammalian cells or a membrane preparation expressing the receptor would be incubated with labeled LP123, LP127, or LP129 polypeptide in the presence of the candidate compound. The ability of the compound to enhance or block this interaction could then be removed.
  • a potential antagonist may be a closely related protein, for example, a mutated form of the LP123, LP127, or LP129 polypeptide that recognizes the receptor but imparts no effect, thereby competitively inhibiting the action of the LP123, LP127, or LP129 polypeptide.
  • Another potential LP123, LP127, or LP129 polypeptide antagonist is an antisense RNA or DNA construct prepared using antisense technology, where, e.g., an antisense RNA or DNA molecule acts to block directly the translation of mRNA by hybridizing to targeted mRNA and prevent its translation into protein.
  • Antisense technology can be used to control gene expression through triple-helix formation or antisense DNA or RNA, both of which methods are based on binding of a polynucleotide to DNA or RNA.
  • the 5' coding portion of the polynucleotide sequence which encodes the mature LP123, LP127, or LP129 polypeptide herein, is used to design an antisense RNA oligonucleotide sequence of about 10 to 40 base pairs in length.
  • a DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription [triple helix; see Lee, et al . , Nucl. Acids Res 6(9): 3073-91 (1979); Cooney, et al .
  • the antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into the LP123, LP127, or LP129 polypeptide
  • oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA may be expressed in vivo to inhibit production of the LP123, LP127, or LP129 polypeptide.
  • antisense DNA oligodeoxy- ribonucleotides derived from the translation-initiation site, e.g., between about -10 and +10 positions of the target gene nucleotide sequence, are preferred.
  • Potential antagonists include small molecules that bind to the active site, the receptor binding site, or growth factor or other relevant binding site of the LP123, LP127, or LP129 polypeptide, thereby blocking the normal biological activity of the LP123, LP127, or LP129 polypeptide.
  • small molecules include, but are not limited to, small peptides or peptide-like molecules, preferably soluble peptides, and synthetic non-peptidyl organic or inorganic compounds .
  • Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA. Ribozymes act by sequence-specific hybridization to the complementary target RNA, followed by endonucleolytic cleavage. Specific ribozyme cleavage sites within a potential RNA target can be identified by known techniques. For further details, see, e.g., Rossi, Current Biology 4(5): 469-71 (1994) and PCT publication No. WO 97/33551.
  • Nucleic acid molecules in triple-helix formation used to inhibit transcription should be single-stranded and composed of deoxynucleotides .
  • the base composition of these oligonucleotides is designed such that it promotes triple- helix formation via Hoogsteen base-pairing rules, which generally require sizeable stretches of purines or pyrimidines on one strand of a duplex.
  • Hoogsteen base-pairing rules which generally require sizeable stretches of purines or pyrimidines on one strand of a duplex.
  • Another use of the compounds of the invention is to help diagnose whether a disorder is driven, to some extent, by LP123, LP127, or LP129 modulated signaling.
  • a diagnostic assay to determine whether a particular disorder is driven by LP123, LP127, or LP129 signaling can be carried out using the following steps: a) culturing test cells or tissues expressing LP123, LP127, or LP129; b) administering a compound which can inhibit LP123, LP127, or LP129 modulated signaling; and c) measuring the LP123, LP127, or LP129 mediated phenotypic effects in the test cells .
  • the steps can be carried out using standard techniques in light of the present disclosure.
  • Appropriate controls take into account the possible cytotoxic effect of a compound, such as treating cells not associated with a cell proliferative disorder (e.g., control cells) with a test compound and can also be used as part of the diagnostic assay.
  • the diagnostic methods of the invention involve the screening for agents that modulate the effects of LP123, LP127, or LPl29-associated disorders.
  • the LP123, LP127, or LP129 antagonists or agonists can be employed as therapeutic agents .
  • Such therapeutic agents are formulated according to known methods to prepare pharmaceutically useful compositions, whereby the LP123, LP127, or LP129 antagonist or agonist thereof is combined in a mixture with a pharmaceutically acceptable carrier.
  • LP123, LP127, or LP129 antagonist or agonist antibodies if the protein encoded by the amplified gene is intracellular and whole antibodies are used as inhibitors, internalizing antibodies are preferred.
  • lipofections or liposomes can also be used to deliver the antibody, or an antibody fragment, into cells. Where antibody fragments are used, the smallest inhibitory fragment which specifically binds to the binding domain of the target protein is preferred.
  • peptide molecules can be designed which retain the ability to bind the target protein sequence.
  • Such peptides can be synthesized chemically and/or produced by recombinant DNA technology [see, e.g., Marasco, et al . , Proc. Natl. Acad. Sci. USA 90(16): 7889-93 (1993)].
  • Therapeutic formulations are prepared for storage by mixing the active ingredient having the desired degree of purity with optional pharmaceutically acceptable carriers, excipients or stabilizers [Remington's Pharmaceutical Sciences 16th edition, A. Osal, Ed. (1980)], in the form of lyophilized formulations or aqueous solutions.
  • the formulation herein may also contain more than one active compound as necessary for the particular indication being treated, preferably those with complementary activities that do not adversely affect each other.
  • Such molecules are suitably present in combination in amounts that are effective for the purpose intended.
  • the active ingredients may also be entrapped in microcapsules prepared, for example, by coacervation techniques or by interfacial polymerization, for example, hydroxymethylcellulose or gelatin-microcapsules and poly (methylmethacrylate) microcapsules, respectively, in colloidal drug delivery systems (for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules) or in macroemulsions .
  • colloidal drug delivery systems for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules
  • the formulations to be used for in vivo administration must be sterile. This is readily accomplished by filtration through sterile filtration membranes.
  • compositions herein generally are placed into a container having a sterile access port, for example, an intravenous solution bag or vial having a stopper pierceable by a hypodermic injection needle.
  • Sustained-release preparations may be prepared. Suitable examples of sustained-release preparations include semipermeable matrices of solid hydrophobic polymers containing the therapeutic agent (s), which matrices are in the form of shaped articles, e.g., films, or microcapsules.
  • sustained-release matrices include polyesters, hydrogels [for example, poly (2-hydroxyethylmethacrylate) , or poly (vinylalcohol) ] , polylactides, copolymers of L-glutamic acid and gamma-ethyl-L-glutamate, non-degradable ethylene- vinyl acetate, degradable lactic acid-glycolic acid copolymers such as the LUPRON DEPOTTM (injectable microspheres composed of lactic acid-glycolic acid copolymer and leuprolide acetate), and poly-D- (-) -3-hydroxybutyric acid.
  • polyesters for example, poly (2-hydroxyethylmethacrylate) , or poly (vinylalcohol)
  • polylactides copolymers of L-glutamic acid and gamma-ethyl-L-glutamate
  • non-degradable ethylene- vinyl acetate non-degradable ethylene-
  • the sustained-release formulations of these proteins may be developed using polylactic-coglycolic acid (PLGA) polymer due to its biocompatibility and wide range of biodegradable properties .
  • PLGA polylactic-coglycolic acid
  • the degradation products of PLGA, lactic and glycolic acids, can be cleared quickly within the human body.
  • the degradability of this polymer can be adjusted from months to years depending on its molecular weight and composition. See Lewis, "Controlled release of bioactive agents from lactide/glycolide polymer" in Biodegradable Polymers as Drug Delivery Systems, Marcel Dekker; New York (1990), M. Chasin and R. Langer (Eds.) pp. 1-41.
  • An LP described herein can be useful in ameliorating, treating, preventing, modulating, and/or diagnosing a disease, disorder, syndrome, or condition of the immune system, by, e.g., activating or inhibiting the proliferation, differentiation, or mobilization (chemotaxis or directed movement) of an immune cell.
  • immune cells develop through a process called hematopoiesis, producing myeloid (platelets, red blood cells, neutrophils, and macrophages) and lymphoid (B and T lymphocytes) cells from pluripotent stem cells.
  • the etiology of an immune disease, disorder, syndrome, or condition may be genetic and/or somatic, (e.g., such as some forms of cancer or some autoimmune conditions acquired by e.g., chemotherapy or toxins or an infectious agent, e.g., a virus or prion-like entity.
  • an LP can be used to mark or detect a particular immune system disease, syndrome, disorder, state, or condition.
  • An LP can be useful in ameliorating, treating, preventing, modulating, and/or diagnosing a disease, disorder, syndrome, and/or a condition of a hematopoietic cell.
  • An LP could be used to increase or inhibit the differentiation or proliferation of a hematopoietic cell, including a pluripotent stem cell such an effect can be implemented to treat, prevent, modulate, or ameliorate a disease, disorder, syndrome, and/or a condition associated with a decrease in a specific type of hematopoietic cell.
  • An example of such an immunologic deficiency, disease, disorder, syndrome, and/or condition includes, e.g., without limitation, a blood condition (e.g.
  • agammaglobulinemia digammaglobulmemia
  • ataxia telangiectasia common variable immunodeficiency
  • Digeorge Syndrome HIV infection
  • HTLV-BLV infection leukocyte adhesion deficiency syndrome
  • lymphopenia phagocyte bactericidal dysfunction
  • severe combined immunodeficiency SCIDs
  • Wiskott-Aldrich Disorder anemia, thrombocytopenia, or hemoglobinuria.
  • an LP can be used to modulate hemostatic or thrombolytic activity.
  • increasing hemostatic or thrombolytic activity can treat or prevent a blood coagulation condition such as e.g., afibrinogenemia, a factor deficiency, a blood platelet disease (e.g. thrombocytopenia) , or a wound resulting from e.g., trauma, surgery, etc.
  • a composition of the invention can be used to decrease hemostatic or thrombolytic activity or to inhibit or dissolve a clotting condition.
  • Such compositions can be important in a treatment or prevention of a heart condition, e.g., an attack infarction, stroke, or mycardial scarring.
  • An LP may also be useful in ameliorating, treating, preventing, modulating and/or diagnosing an autoimmune disease, disorder, syndrome, and/or condition such as results, e.g., from the inappropriate recognition by a cell of the immune system of the self as a foreign material.
  • Such an inappropriate recognition results in an immune response leading to detrimental effect destruction on the host, e.g., on a host cell, tissue, protein, or moiety, e.g., a carbohydrate side chain.
  • administering may be effective in detecting, diagnosing, ameliorating, or preventing such an autoimmune disease, disorder, syndrome, and/or condition.
  • autoimmune conditions examples include, e.g., without limit Addison's Disease syndrome hemolytic anemia, anti-phospholipid syndrome, rheumatoid arthritis, dermatitis, allergic encephalomyelitis, glomerulonephritis, Goodpasture' s Syndrome, Graves' Disease syndrome, Multiple Sclerosis, Myasthenia Gravis, Neuritis, Ophthalmia, Bullous Pemphigoid, Pemphigus, Polyendocrinopathies, Purpura, Reiter's Disease syndrome, Stiff-Man Syndrome, Autoimmune Thyroiditis, Systemic Lupus Erythematosus, Autoimmune Pulmonary Inflammation, Guillain-BarreSyndrome, insulin dependent diabetes mellitis, and autoimmune inflammatory eye disease.
  • Addison's Disease syndrome hemolytic anemia e.g., without limit Addison's Disease syndrome hemolytic anemia, anti-phospholipid syndrome, rheumatoid arthritis, dermatiti
  • allergic reactions and conditions such as asthma (e.g., allergic asthma) or other respiratory problems, may also be ameliorated, treated, modulated or prevented, and/or diagnosed by an LP polynucleotide or polypeptide (or fragment thereof) , or an agonist or antagonist thereto.
  • inventive compositions can be used to effect, e.g., anaphylaxis, hypersensitivity to an antigenic molecule, or blood group incompatibility.
  • An LP may also be used to modulate, ameliorate, treat, prevent, and/or diagnose organ rejection or graft-versus- host disease (GVHD) .
  • organ rejection occurs by a host's, immune-cell destruction of a transplanted tissue or cell.
  • a similarly destructive immune response is involved in GVHD, however, in this case, transplanted foreign immune cells destroy host tissues and/or cells.
  • Administration of a composition of the invention, which ameliorates or modulates such a deleterious immune response e.g., a deleterious proliferation, differentiation, or chemotaxis of a T cell
  • a deleterious immune response e.g., a deleterious proliferation, differentiation, or chemotaxis of a T cell
  • an LP may also be used to detect, treat, modulate, ameliorate, prevent, and/or diagnose an inflammation, e.g., by inhibiting the proliferation and/or differentiation of a cell involved in an inflammatory response, or an inflammatory condition (either chronic or acute), including, e.g., without limitation, chronic prostatitis, granulomatous prostatitis and malacoplakia, an inflammation associated with an infection (such as, e.g., septic shock, sepsis, or systemic inflammatory response syndrome (SIRS) ) , ischemia-reperfusion injury, endotoxin lethality, arthritis, complement-mediated hyperacute rejection, nephritis, cytokine or chemokine induced lung injury, inflammatory bowel disease syndrome, Crohn's disease syndrome, or a condition resulting from an over production of a cytokine (s) (e.g., TNF or IL-1) .
  • a cytokine e.g.,
  • An LP can be used to modulate, ameliorate, treat, prevent, and/or diagnose a hyperproliferative disease, condition, disorder, or syndrome (such as, e.g., a neoplasm) via direct or indirect interactions. For example, such as by initiating the proliferation of cells that, in turn, modulate a hyperproliferative state; or by increasing an immune response (e.g., by increasing the antigenicity of a protein involved in a hyperproliferative condition) ; or by causing the proliferation, differentiation, or mobilization of a specific cell type (e.g., a T-cell).
  • a desired effect using a composition of the invention may also be accomplished either by, e.g., enhancing an existing immune response, or by initiating a new immune response.
  • the- desired result may be effected either by, e.g., diminishing or blocking an existing immune response, or by preventing the initiation of a new immune response.
  • hyperproliferative states, diseases, disorders, syndromes, and/or conditions include, e.g., without limitation, a neoplasm of the colon, abdomen, bone, breast, digestive system, liver, pancreas, peritoneum, endocrine system (e.g., an adrenal gland, a parathyroid gland, the pituitary, the testicles, the ovary, the thymus, or the thyroid) , eye, head, neck, nervous system (central or peripheral) , the lymphatic system, pelvis, skin, spleen, thorax, and urogenital system.
  • hyperproliferative conditions include, e.g., without limit hypergammaglobulinemia, lymphoproliferative conditions, paraproteinemias , purpura, sarcoidosis, Hamartoma, Sezary Syndrome, Waldenstron' s Macroglobulinemia, Gaucher's Disease syndrome, histiocytosis, and other hyperproliferative states .
  • One preferred embodiment utilizes an LP to inhibit aberrant cellular division, through a polynucleotide delivery technique.
  • the present invention provides a - method for treating, preventing, modulating, ameliorating, preventing, inhibiting, and/or diagnosing cell proliferative diseases, disorders, syndromes, and/or conditions described herein by inserting into an abnormally proliferating cell a composition of the present invention, wherein said composition beneficially modulates an excessive condition of cell proliferation, e.g., by inhibiting transcription and/or translation.
  • Another embodiment comprises administering one or more active copies of an LP polynucleotide sequence to an abnormally proliferating cell.
  • an LP polynucleotide sequence is operably linked in a construct comprising a recombinant expression vector that is effective in expressing a polypeptide (or fragment thereof) corresponding to the polynucleotide of interest.
  • the construct encoding a polypeptide or fragment thereof is inserted into a targeted cell utilizing a retrovirus or an adenoviral vector (see, e.g., Nabel, et al . (1999) Proc. Natl. Acad. Sci. USA 96: 324-326).
  • the viral vector is defective and only transforms or transfects a proliferating cell but does not transform or transfects a non-proliferating cell.
  • an LP polynucleotide sequence is inserted into a proliferating cell either alone, (or in combination with, or fused to, another polynucleotide sequence, which can subsequently be modulated via an external stimulus (e.g., a magnetic signal, a specific small molecule, a chemical moiety or a drug administration, etc.) that acts on an upstream promoter to induce expression of the LP polypeptide (or fragment thereof) .
  • an external stimulus e.g., a magnetic signal, a specific small molecule, a chemical moiety or a drug administration, etc.
  • a desired effect of the present invention may be accomplished based on using an external stimulus.
  • An LP may be used to, modulate, ameliorate, effect, treat, prevent, and/or diagnose a cardiovascular disease, disorder, syndrome, and/or condition.
  • cardiovascular abnormalities such as arterio-arterial fistula, arteriovenous fistula, cerebral arteriovenous malformations, congenital heart defects, pulmonary atresia, and Scimitar Syndrome peripheral artery disease, syndrome, such as limb ischemia.
  • Additional cardiovascular disorders encompass, e.g., congenital heart defects which include, e.g., aortic coarctation, car triatriatum, coronary vessel anomalies, crisscross heart, dextrocardia, patent ductus arteriosus, Ebstein's anomaly, Eisenmenger complex, hypoplastic left heart syndrome, levocardia, tetralogy of fallot, transposition of great vessels, double outlet right ventricle, tricuspid atresia, persistent truncus arteriosus, and heart septal defects, such as e.g., aortopulmonary septal defect, endocardial cushion defects, Lutembacher' s Syndrome, trilogy of Fallot, and ventricular heart septal defects.
  • congenital heart defects which include, e.g., aortic coarctation, car triatriatum, coronary vessel anomalies, crisscross heart, dextrocardia, patent ductus arteriosus, Eb
  • cardiovascular conditions include, e.g., heart disease syndrome, such as, e.g., arrhythmias, carcinoid heart disease syndrome, high cardiac output, low cardiac output, cardiac tamponade, endocarditis (including bacterial endocarditis) , heart aneurysm, cardiac arrest, congestive heart failure, congestive cardiomyopathy, paroxysmal dyspnea, cardiac edema, heart hypertrophy, congestive cardiomyopathy, left ventricular hypertrophy, right ventricular hypertrophy, post-infarction heart rupture, ventricular septal rupture, heart valve disease, myocardial disease, myocardial ischemia, pericardial effusion, pericarditis (including constrictive and tuberculous pericarditis) , pneumopericardium, post-pericardiotomy syndrome, pulmonary heart disease syndrome, rheumatic heart disease syndrome, ventricular dysfunction, hyperemia, cardiovascular pregnancy complications, Scimitar Syndrome, cardiovascular syphilis, and cardiovascular tub
  • cardiovascular disorders include, e.g., arrhythmias including, e.g., sinus arrhythmia, atrial fibrillation, atrial flutter, bradycardia, extra systole, Adams-Stokes Syndrome, bundle-branch block, sinoatrial block, long QT syndrome, parasystole, Lown-Ganong-Levine Syndrome, Mahaim-type pre-excitation syndrome, Wolff- Parkinson-White syndrome, sick sinus syndrome, and ventricular fibrillation tachycardias.
  • arrhythmias including, e.g., sinus arrhythmia, atrial fibrillation, atrial flutter, bradycardia, extra systole, Adams-Stokes Syndrome, bundle-branch block, sinoatrial block, long QT syndrome, parasystole, Lown-Ganong-Levine Syndrome, Mahaim-type pre-excitation syndrome, Wolff- Parkinson-White syndrome, sick sinus syndrome, and ventricular fibrillation tachy
  • Tachycardias encompassed with the cardiovascular condition described herein include, e.g., paroxysmal tachycardia, supraventricular tachycardia, accelerated idioventricular rhythm, atrioventricular nodal re-entry tachycardia, ectopic atrial tachycardia, ectopic junctional tachycardia, sinoatrial nodal re-entry tachycardia, sinus tachycardia, Torsades de Pointes Syndrome, and ventricular tachycardia .
  • Additional cardiovascular disorders include, e.g., heart valve disease such as, e.g., aortic valve insufficiency, aortic valve stenosis, heart murmurs, aortic valve prolapse, mitral valve prolapse, tricuspid valve prolapse, mitral valve insufficiency, mitral valve stenosis, pulmonary atresia, pulmonary valve insufficiency, pulmonary valve stenosis, tricuspid atresia, tricuspid valve insufficiency, and tricuspid valve stenosis.
  • heart valve disease such as, e.g., aortic valve insufficiency, aortic valve stenosis, heart murmurs, aortic valve prolapse, mitral valve prolapse, tricuspid valve prolapse, mitral valve insufficiency, mitral valve stenosis, pulmonary atresia, pulmonary valve insufficiency, pulmonary valve stenos
  • Myocardial conditions associated with cardiovascular disease include, e.g., myocardial diseases such as, e.g., alcoholic cardiomyopathy, congestive cardiomyopathy, hypertrophic cardiomyopathy, aortic subvalvular stenosis, pulmonary subvalvular stenosis, restrictive cardiomyopathy, Chagas cardiomyopathy, endocardial fibroelastosis, endomyocardial fibrosis, Kearns Syndrome, myocardial reperfusion injury, and myocarditis.
  • myocardial diseases such as, e.g., alcoholic cardiomyopathy, congestive cardiomyopathy, hypertrophic cardiomyopathy, aortic subvalvular stenosis, pulmonary subvalvular stenosis, restrictive cardiomyopathy, Chagas cardiomyopathy, endocardial fibroelastosis, endomyocardial fibrosis, Kearns Syndrome, myocardial reperfusion injury, and myocarditis.
  • Cardiovascular conditions include, e.g., myocardial ischemias such as, e.g., coronary disease syndrome, such as e.g., angina pectoris, coronary aneurysm, coronary arteriosclerosis, coronary thrombosis, coronary vasispasm, myocardial infarction, and myocardial. stunning.
  • myocardial ischemias such as, e.g., coronary disease syndrome, such as e.g., angina pectoris, coronary aneurysm, coronary arteriosclerosis, coronary thrombosis, coronary vasispasm, myocardial infarction, and myocardial. stunning.
  • coronary disease syndrome such as e.g., angina pectoris, coronary aneurysm, coronary arteriosclerosis, coronary thrombosis, coronary vasispasm, myocardial infarction, and myocardial. stunning.
  • Cardiovascular diseases also encompassed herein include, e.g., vascular diseases such as e.g., aneurysms, angiodysplasia, angiomatosis, bacillary angiomatosis, Hippel-Lindau Disease syndrome, Klippel-Trenaunay-Weber Syndrome, Sturge-Weber Syndrome, angioneurotic edema, aortic disease, Takayasu's Arteritis, aortitis, Leriche's Syndrome, arterial occlusive disease, arteritis, enarteritis, polyarteritis nodosa, cerebrovascular disease, diabetic angiopathies, diabetic retinopathy, embolism, thrombosis, erythromeialgia, hemorrhoids, hepatic veno-occlusive disease syndrome, hypertension, hypotension, ischemia, peripheral vascular diseases, phlebitis, pulmonary veno-
  • Cardiovascular conditions further include, e.g., aneurysms such as, e.g., dissecting aneurysms, false aneurysms, infected aneurysms, ruptured aneurysms, aortic aneurysms, cerebral aneurysms, coronary aneurysms, heart aneurysms, and iliac aneurysms.
  • aneurysms such as, e.g., dissecting aneurysms, false aneurysms, infected aneurysms, ruptured aneurysms, aortic aneurysms, cerebral aneurysms, coronary aneurysms, heart aneurysms, and iliac aneurysms.
  • Arterial occlusive cardiovascular conditions include, e.g., arteriosclerosis, intermittent claudication, carotid stenosis, fibromuscular dysplasias, mesenteric vascular occlusion, Moyamoya disease syndrome, renal artery obstruction, retinal artery occlusion, and thromboangiitis obliterans .
  • Cerebrovascular cardiovascular conditions include, e.g., carotid artery disease, cerebral amyloid angiopathy, cerebral aneurysm, cerebral anoxia, cerebral arteriosclerosis, cerebral arteriovenous malformation, cerebral artery disease, cerebral embolism and thrombosis, carotid artery thrombosis, sinus thrombosis, Wallenberg's syndrome, cerebral hemorrhage, epidural hematoma, subdural hematoma, subarachnoid hemorrhage, cerebral infarction, cerebral ischemia (including transient cerebral ischemia) , subclavian steal syndrome, periventricular leukomalacia, vascular headache, cluster headache, migraine, and vertebrobasilar insufficiency.
  • cerebral ischemia including transient cerebral ischemia
  • Embolic cardiovascular conditions include, e.g., air embolisms, amniotic fluid embolisms, cholesterol embolisms, blue toe syndrome, fat embolisms, pulmonary embolisms, and thromboembolisms .
  • Thrombotic cardiovascular conditions include, e.g., coronary thrombosis, hepatic vein thrombosis, retinal vein occlusion, carotid artery thrombosis, sinus thrombosis, Wallenberg's syndrome, and thrombophlebitis.
  • Ischemic conditions include, e.g., cerebral ischemia, ischemic colitis, compartment syndromes, anterior compartment syndrome, myocardial ischemia, reperfusion injuries, and peripheral limb ischemia.
  • Vasculitic conditions include, e.g., aortitis, arteritis, Behcet's Syndrome, Churg-Strauss Syndrome, mucocutaneous lymph node syndrome, thromboangiitis obliterans, hypersensitivity vasculitis, Schoenlein-Henoch purpura, allergic cutaneous vasculitis, and Wegener's granulomatosis .
  • An LP can be beneficial in ameliorating critical limb ischemia and coronary disease.
  • An LP may be administered using any art known method, described herein.
  • An LP may be - administered as part of a therapeutic composition or formulation, as described in detail herein. Methods of delivering an LP are also described in detail herein.
  • angiogenesis is stringently regulated, and delimited spatially and temporally.
  • pathological angiogenesis such as, e.g., during solid tumor formation, these regulatory controls fail and unregulated angiogenesis can become pathologic by sustaining progression of many neoplastic and non-neoplastic diseases.
  • a number of serious diseases are dominated by abnormal neovascularization (including, e.g., solid tumor growth and metastases, arthritis, some types of eye conditions, and psoriasis; see, e.g., reviews by Moses, et al . , Biotech. 9630-634 (1991); Folkman, et al . , N. Engl. J. Med., 333: 1757-1763 (1995); Auerbach, et al . , J. Microvasc. Res. 29:401-4 11 (1985); Folkman, "Advances in Cancer Research", eds. Klein and Weinhouse, Academic Press, New York, pp. 175- 203 (1985); Patz, Am. J. Opthalmol . 94:7 15-743 (1982); and Folkman, et al . , Science 221:7 19-725 (1983).
  • abnormal neovascularization including, e.g., solid tumor growth and metastases, arthritis, some types of eye conditions
  • angiogenesis contributes to a disease-state, e.g., for example, significant data have accumulated suggesting that solid tumor formation is dependent on angiogenesis (see, e.g., Folkman and Klagsbrun, Science 235:442-447 (1987)).
  • administration of an LP provides for the treatment, amelioration, modulation, diagnosis, and/or inhibition of a disease, disorder, syndrome, and/or condition associated with neovascularization .
  • Malignant and metastatic conditions that can be effected in a desired fashion using an LP include, e.g., without limitation, a malignancy, solid tumor, and a cancer as described herein or as otherwise known in the art (for a review of such disorders, syndromes, etc. see, e.g., Fishman, et al . , Medicine, 2d Ed., J. B. Lippincott Co., Philadelphia (1985)).
  • the present invention provides a method of ameliorating, modulating, treating, preventing, and/or diagnosing an angiogenesis-related disease and/or disorder, comprising administering to a subject in need thereof a beneficially effective amount of an LP.
  • cancers that may be so affected using a composition of the invention includes, e.g., without limit a solid tumor, including e.g., prostate, lung, breast, ovarian, stomach, pancreas, larynx, esophagus, testes, liver, parotid, biliary tract, colon, rectum, cervix, uterus, endometrium, kidney, bladder, thyroid cancer; primary tumors and metastases; melanomas; glioblastoma; Kaposi ' s sarcoma; leiomyosarcoma; non-small cell lung cancer; colorectal cancer; advanced malignancies; and blood born tumors such as e.g. , leukemia.
  • a solid tumor including e.g., prostate, lung, breast, ovarian, stomach, pancreas, larynx, esophagus, testes, liver, parotid, biliary tract, colon, rectum,
  • an LP may be delivered topically, to treat or prevent cancers such as, e.g., skin cancer, head and neck tumors, breast tumors, and Kaposi ' s sarcoma.
  • cancers such as, e.g., skin cancer, head and neck tumors, breast tumors, and Kaposi ' s sarcoma.
  • an LP may be utilized to treat superficial forms of bladder cancer by, e.g., intravesical administration into the tumor, or near the tumor site; via injection or a catheter.
  • intravesical administration into the tumor, or near the tumor site; via injection or a catheter.
  • the appropriate mode of administration will vary according to the cancer to be treated. Other modes of delivery are discussed herein.
  • An LP may also be useful in modulating, ameliorating, treating, preventing, and/or diagnosing another disease, disorder, syndrome, and/or condition, besides a cell proliferative condition (e.g., a cancer) that is assisted by abnormal angiogenic activity.
  • a cell proliferative condition e.g., a cancer
  • Such close group conditions include, e.g., without limitation, benign tumors, e.g., such as hemangiomas, acoustic neuromas, neurofibromas, trachomas, and pyogenic granulomas; atherosclerotic plaques; ocular angiogenic diseases, e.g., diabetic retinopathy, retinopathy of prematurity, macular degeneration, cornea graft rejection, neovascular glaucoma, retrolental fibroplasia, rubeosis, retinoblastoma, uvietis and Pterygia (abnormal blood vessel growth) of the eye; rheumatoid arthritis; psoriasis; delayed wound healing; endometriosis; vasculogenesis; granulations; hypertrophic scars (keloids) ; nonunion fractures; scleroderma; trachoma; vascular adhesions; myocardial angiogenesis
  • methods for modulating, ameliorating, treating, preventing, and/or diagnosing hypertrophic scars and keloids, comprising administering an LP to a site of hypertrophic scar or keloid formation.
  • the method involves a direct injection into a hypertrophic scar or keloid, to provide a beneficial effect, e.g., by preventing progression of such a lesion.
  • This method is of particular value to a prophylactic treatment of a condition known to result in the development of a hypertrophic scar or a keloid (e.g., burns), and is preferably initiated after the proliferative phase of scar formation has had time to progress (approximately, e.g., 14 days after the initial injury) , but before hypertrophic scar or keloid development .
  • the present invention also provides methods for ameliorating, treating, preventing, and/or diagnosing neovascular diseases of the eye, including e.g., corneal graft neovascularization, neovascular glaucoma, proliferative diabetic retinopathy, retrolental fibroplasia and macular degeneration.
  • ocular diseases, disorders, syndromes, and/or conditions associated with neovascularization that can be modulated ameliorated, treated, prevented, and/or diagnosed with an LP include, e.g., without limit; neovascular glaucoma, diabetic retinopathy, retinoblastoma, retrolental fibroplasia, uveitis, retinopathy of premature macular degeneration, corneal graft neovascularization, as well as other inflammatory eye diseases, ocular tumors, and diseases associated with choroidal or iris neovascularization (see, e.g., reviews by Waltman, et al . , (1978) Am. J. Ophthal.
  • neovascular diseases of the eye such as corneal neovascularization
  • the cornea is a tissue that normally lacks blood vessels.
  • capillaries may extend into the cornea from the pericorneal vascular plexus of the limbus .
  • the cornea becomes vascularized, it also becomes clouded, resulting in a decline in the patient's visual acuity. Visual loss may become complete if the cornea completely opacifies.
  • corneal neovascularization e.g., corneal infections (e.g., trachoma, herpes simplex keratitis, leishmaniasis and onchocerciasis) , immunological processes (e.g., graft rejection and Stevens-Johnson' s syndrome) , alkali burns, trauma, inflammation (of any cause) , toxic and nutritional deficiency states, and as a complication of using contact lenses.
  • corneal infections e.g., trachoma, herpes simplex keratitis, leishmaniasis and onchocerciasis
  • immunological processes e.g., graft rejection and Stevens-Johnson' s syndrome
  • alkali burns trauma, inflammation (of any cause)
  • toxic and nutritional deficiency states e.g., as a complication of using contact lenses.
  • an LP composition may be prepared for topical administration in saline (combined with any of the preservatives and antimicrobial agents commonly used in ocular preparations) , and administered in drop form to the eye.
  • the solution or suspension may be prepared in its pure form and administered several times daily.
  • anti-angiogenic compositions prepared as described herein, may also be administered directly to the cornea.
  • an anti- angiogenic composition is prepared with a muco-adhesive polymer, which binds to the cornea.
  • an anti-angiogenic factor or anti-angiogenic LP composition may be utilized as an adjunct to conventional steroid therapy.
  • Topical therapy may also be useful prophylactically in corneal lesions that are known to have a high probability of inducing an angiogenic response (such as, e.g., a chemical burn).
  • the treatment likely in combination with steroids
  • an LP composition may be injected directly into the corneal stroma using microscopic guidance by an ophthalmologist.
  • the preferred site of injection may vary with the morphology of the individual lesion, but the goal of the administration is to place a composition of the invention at the advancing front of the vasculature (i.e., interspersed between the blood vessels and the normal cornea) .
  • perilimbic corneal injection to "protect" the cornea from advancing blood vessels.
  • This method may also be utilized shortly after a corneal insult to prophylactically prevent corneal neovascularization.
  • the composition could be injected into the perilimbic cornea interspersed between the corneal lesion and its undesired potential limbic blood supply.
  • Such methods may also be utilized in a similar fashion to prevent capillary invasion of transplanted corneas. In a sustained- release form, injections might only be required 2-3 times per year.
  • a steroid could also be added to the injection solution to reduce inflammation resulting from the injection itself.
  • methods for treating or preventing neovascular glaucoma, comprising administering to a patient a therapeutically effective amount of an LP to the eye, such that the formation of blood vessels is inhibited.
  • the composition may be administered topically to the eye to treat or prevent early forms of neovascular glaucoma.
  • the composition may be implanted by injection into the region of the anterior chamber angle.
  • the composition may also be placed in any location such that the composition is continuously released into the aqueous humor.
  • proliferative diabetic retinopathy comprising administering to a patient a therapeutically effective amount of an LP to the eyes, such that the formation of blood vessels is inhibited.
  • proliferative diabetic retinopathy may be treated by injection into the aqueous or the .vitreous humor, to increase the local concentration of a composition of the invention in the retina.
  • this treatment should be initiated before the acquisition of severe disease requiring photocoagulation.
  • methods for treating or preventing retrolental fibroplasia, comprising administering to a patient a beneficially effective amount of an LP to the eye, such that the formation of blood vessels is inhibited.
  • the composition may be administered topically, via intravitreous injection and/or via intraocular implants.
  • Additional, diseases, disorders, syndromes, and/or conditions that can be modulated, ameliorated, treated, • prevented, and/or diagnosed with an LP include, e.g., without limitation, hemangioma, arthritis, psoriasis, angiofibroma, atherosclerotic plaques, delayed wound healing, granulations, hemophilic joints, hypertrophic scars, nonunion fractures, Osier-Weber syndrome, pyogenic granuloma, scleroder a, trachoma, and vascular adhesions.
  • diseases, disorders, states, syndromes, and/or conditions that can be modulated, ameliorated, treated, prevented, and/or diagnosed with an LP include, e.g., without limitation, solid tumors, blood born tumors such as leukemias, tumor metastasis, Kaposi' s sarcoma, benign tumors (e.g., hemangiomas) , acoustic neuromas, neurofibromas, trachomas, and pyogenic granulomas, rheumatoid arthritis, psoriasis, ocular angiogenic diseases, e.g., diabetic retinopathy, retinopathy of prematurity, macular degeneration, corneal graft rejection, neovascular glaucoma, retrolental fibroplasia, rubeosis, retinoblastoma, and uvietis, delayed wound healing, endometriosis, vasculogenesis, granulations, hypertrophic scar
  • an amount of an LP sufficient to block embryo implantation is administered before or after intercourse and fertilization have occurred, thus providing an effective method of birth control, possibly a "morning after" method.
  • An LP may also be used in controlling menstruation or administered either as a peritoneal lavage fluid or for peritoneal implantation in the treatment of endometriosis.
  • An LP may be utilized in a wide-variety of surgical procedures.
  • a compositions in the form of, e.g., a spray or film
  • an LP composition may be delivered via endoscopic procedures to coat tumors, or inhibit angiogenesis in a desired locale.
  • surgical meshes that have been coated with an anti-angiogenic composition of the invention may be utilized in a procedure in which a surgical mesh might be utilized.
  • a surgical mesh laden with an anti-angiogenic composition may be utilized during cancer resection surgery (e.g., abdominal surgery subsequent to colon resection) to provide support to the structure, and to release an amount of the anti-angiogenic factor.
  • methods for treating tumor excision sites, comprising administering an LP to the resection margins of a tumor after excision, such that the local recurrence of cancer and the formation of new blood vessels at the site is inhibited.
  • an anti-angiogenic composition of the invention is administered directly to a tumor excision site (e.g., applied by swabbing, brushing or otherwise coating the resection margins of the tumor with the anti-angiogenic composition) .
  • an anti- angiogenic composition may be incorporated into a known surgical paste before administration.
  • an anti- angiogenic composition of the invention is applied after hepatic resections for malignancy, and after neurosurgical operations.
  • administration can be to a resection margin of a wide variety of tumors, including e.g., breast, colon, brain, and hepatic tumors.
  • anti-angiogenic compositions may be administered to the site of a neurological tumor after excision, such that the formation of new blood vessels at the site is inhibited.
  • An LP may also be administered along with other anti- angiogenic factors such as, e.g., without limitation, Anti- Invasive Factor, retinoic acid, (and derivatives thereof) , paclitaxel, Suramin, Tissue Inhibitor of Metalloproteinase- 1, Tissue Inhibitor of Metalloproteinase-2 , Plasminogen Activator Inhibitor-1, Plasminogen Activator Inhibitor-2, and various forms of the lighter “d group” transition metals.
  • Lighter "d group” transition metals include, e.g., vanadium, molybdenum, tungsten, titanium, niobium, and tantalum species. Such transition metal species may form transition metal complexes.
  • Suitable complexes of the above-mentioned transition metal species include, e.g., oxo transition metal complexes.
  • Representative examples of vanadium complexes include, e.g., oxo-vanadium complexes such as vanadate, and vanadyl complexes.
  • Suitable vanadate complexes include, e.g., metavanadate, and orthovanadate complexes (such as, e.g.,” ammonium metavanadate, sodium metavanadate, and sodium orthovanadate) .
  • Suitable vanadyl complexes include, e.g., vanadyl acetylacetonate and vanadyl sulfate, including vanadyl sulfate hydrates (such as vanadyl sulfate mono- and trihydrates) .
  • Representative examples of tungsten and molybdenum complexes also include, e.g., oxo complexes.
  • Suitable oxo-tungsten complexes include, e.g., tungstate, and tungsten oxide complexes.
  • Suitable tungstate complexes include, e.g., ammonium tungstate, calcium tungstate, sodium tungstate dihydrate, and tungstic acid.
  • Suitable tungsten oxides include, e.g., tungsten (IV) oxide, and tungsten (VI) oxide.
  • Suitable oxo-molybdenum complexes include, e.g., molybdate, molybdenum oxide, and molybdenyl complexes.
  • Suitable molybdate complexes include, e.g., ammonium molybdate (and its hydrates) , sodium molybdate (and its hydrates) , and potassium molybdate (and its hydrates) .
  • Suitable molybdenum oxides include, e.g., molybdenum (VI) oxide, molybdenum (VI) oxide, and molybdic acid.
  • Suitable molybdenyl complexes include, e.g., molybdenyl acetylacetonate .
  • Other suitable tungsten and molybdenum complexes include, e.g., hydroxo derivatives derived from, e.g., glycerol, tartaric acid, and sugars.
  • anti-angiogenic factors include, e.g., without limitation, platelet factor 4; protamine sulfate; sulfated chitin derivatives (prepared from queen crab shells; Murata, et al., Cancer Res.
  • Sulfated Polysaccharide Peptidoglycan Complex (SP-PG; the function of this compound may be enhanced by the presence of steroids such as estrogen, and tamoxifen citrate) ; Staurosporine; modulators of matrix metabolism, (including e.g., proline analogs); cishydroxyproline; d, L-3 , 4-dehydroproline; Thiaproline; alpha alpha-dipyridyl; aminopropionitrile fumarate; 4-propyl-5- (4-pyridinyl) -2 (3H) -oxazolone; Methotrexate; Mitoxantrone; Heparin; Interferons; 2 Macroglobulin-serum; ChIMP-3 (Pavloff, et al . , J. Bio. Chem.267.17321-17326, 1992); Chymostatin (Tomkinson, et al . , Biochem J. 286:475-480, 1992); Cyclon-3 (P
  • cancers such as, e.g., follicular lymphomas, carcinomas with p53 mutations, and hormone- dependent tumors, including, e.g., but without limit, colon cancer, cardiac tumors, pancreatic cancer, melanoma, retinoblastoma, glioblastoma, lung cancer, intestinal cancer, testicular cancer, stomach cancer, neuroblastoma, myxoma, myoma, lymphoma, endothelioma, osteoblastoma, osteoclastoma, osteosarcoma, chondrosarcoma, adenoma, breast cancer, prostate cancer, Kaposi ' s sarcoma and ovarian cancer); autoimmune conditions (such as, e.g., multiple sclerosis, Sjogren's syndrome, Ha
  • an LP is used to inhibit growth, progression', and/or metastases of cancers such as, in particular, those listed herein.
  • Additional diseases, states, syndromes, or conditions associated with increased cell survival that could be modulated, ameliorated, treated, prevented, or diagnosed by an LP include, e.g., without limitation, progression, and/or metastases of malignancies and related disorders such as leukemia including acute leukemias (such as, e.g., acute lymphocytic leukemia, acute myelocytic leukemia, including myeloblastic, promyelocytic, myelomonocytic, monocytic, and erythroleukemia) and chronic leukemias (e.g., chronic myelocytic, chronic granulocytic, leukemia, and chronic lymphocytic leukemia) ) , polycythemia Vera, lymphomas (e.g., Hodgkin's disease, and non-Hodgkin '
  • Diseases associated with increased apoptosis that could be modulated, ameliorated, treated, prevented, and/or diagnosed by an LP include, e.g., AIDS, conditions (such as, e.g., Alzheimer's disease syndrome, Parkinson's disease syndrome, Amyotrophic lateral sclerosis, Retinitis pigmentosa, Cerebellar degeneration and brain tumor, or prion associated disease) ; autoimmune conditions (such as, e.g., multiple sclerosis, Sjogren's syndrome, Hashimoto's thyroiditis, biliary cirrhosis, Behcet's disease syndrome, Crohn's disease syndrome, polymyositis, systemic lupus erythematosus, immune-related glomerulonephritis, and rheumatoid arthritis) ; myelodysplastic syndromes (such as aplastic anemia) , graft v.
  • AIDS conditions
  • Alzheimer's disease syndrome Parkinson's disease syndrome, Amy
  • ischemic injury such as that caused by myocardial infarction, stroke and reperfusion injury
  • liver injury such as, e.g., hepatitis related liver injury, ischemia reperfusion injury, cholestosis (bile duct injury) , and liver cancer
  • toxin- induced liver disease such as, e.g., that caused by alcohol
  • septic shock cachexia, and anorexia.
  • a process for using an LP to stimulate epithelial cell proliferation and basal keratinocytes for the purpose of, e.g., wound healing, to stimulate hair follicle production, and to heal a dermal wound.
  • An LP composition may be clinically useful in stimulating wound healing including e.g., surgical wounds, excisional wounds, deep wounds involving damage of the dermis and epidermis, eye tissue wounds, dental tissue wounds, oral cavity wounds, diabetic ulcers, dermal ulcers, cubitus ulcers, arterial ulcers, venous stasis ulcers, burns resulting from exposure heat or chemicals, abnormal wound healing conditions associated with e.g., uremia, malnutrition, vitamin deficiency and wound healing complications associated with systemic treatment with steroids, radiation therapy, anti-neoplastic drugs, and anti-metabolites.
  • An LP could be used to promote dermal reestablishment after dermal loss.
  • An LP could be used to increase the adherence of skin grafts to a wound bed and to stimulate re-epithelialization from the wound bed.
  • the following is a non-exhaustive list of grafts that an LP could be used to increase adherence to: a wound bed, autografts, artificial skin, allografts, autodermic grafts, autoepidermic grafts, avascular grafts,
  • An LP can be used to promote skin strength and to improve the appearance of aged skin. It is believed that an LP will also produce changes in hepatocyte proliferation, and epithelial cell proliferation in, for example, the lung, breast, pancreas, stomach, small intestine, and large intestine. Epithelial cell proliferation can be effected in epithelial cells such as, e.g., sebocytes, hair follicles, hepatocytes, type II pneumocytes, mucin-producing goblet cells, and other epithelial cells or their progenitors which are contained within the skin, lung, liver, and gastrointestinal tract.
  • epithelial cells such as, e.g., sebocytes, hair follicles, hepatocytes, type II pneumocytes, mucin-producing goblet cells, and other epithelial cells or their progenitors which are contained within the skin, lung, liver, and gastrointestinal tract.
  • An LP may: promote proliferation of endothelial cells, keratinocytes, and basal keratinocytes; it could also be used to reduce the side effects of gut toxicity that result from radiation, chemotherapy treatments or viral infections, it may have a cytoprotective effect on the small intestine mucosa; it may also stimulate healing of mucositis (mouth ulcers) that result from chemotherapy and viral infections, it could further be used in full regeneration of skin in full and partial thickness skin defects, including burns, (i.e., re-population of hair follicles, sweat glands; and sebaceous glands) , treatment of other skin defects such as psoriasis, it also could be used to treat epidermolysis bullosa, a defect in adherence of the epidermis to the underlying dermis which results in frequent, open and painful blisters by accelerating re-epithelialization of these lesions; it could also be used to treat gastric and doudenal ulcers and help heal by
  • Inflammatory bowel diseases such as Crohn's disease and ulcerative colitis, are diseases that result in destruction of the mucosal surface of the small or large intestine, respectively.
  • an LP could be used to promote resurfacing of a mucosal surface to aid more rapid healing and to prevent progression of inflammatory bowel disease resulting in a desired effect, e.g., such as on the production of mucus throughout the gastrointestinal tract and the protection of intestinal mucosa from injurious substances that are ingested or following surgery.
  • An LP could be used to treat a condition associated with the under expression of an LP polynucleotide sequence or an LP polypeptide of the present invention (or fragment thereof) , or an agonist or antagonist thereto .
  • an LP could be used to prevent and heal damage to the lungs due to various pathological states, such as, e.g., stimulating proliferation and differentiation to promote repair of alveoli and bronchiolar epithelium.
  • pathological states such as, e.g., stimulating proliferation and differentiation to promote repair of alveoli and bronchiolar epithelium.
  • emphysema inhalation injuries, that (e.g., from smoke inhalation) and burns, which cause necrosis of the bronchiolar epithelium and alveoli could be effectively ameliorated, treated, prevented, and/or diagnosed using a polynucleotide or polypeptide of the invention (or fragment thereof), or an agonist or antagonist thereto.
  • an LP could be used to stimulate the proliferation of and differentiation of type II pneumocytes, to help treat or prevent hyaline membrane diseases, such as e.g., infant respiratory distress syndrome and bronchopulmonary displasia, (in premature infants) .
  • An LP could stimulate the proliferation and/or differentiation of a hepatocyte and, thus, could be used to alleviate or treat a liver condition such as e.g., fulminant liver failure (caused, e.g., by cirrhosis), liver damage caused by viral hepatitis and toxic substances (e.g., acetaminophen, carbon tetrachloride, and other known hepatotoxins) .
  • a liver condition such as e.g., fulminant liver failure (caused, e.g., by cirrhosis), liver damage caused by viral hepatitis and toxic substances (e.g., acetaminophen, carbon tetrachloride, and other known
  • an LP could be used treat or prevent the onset of diabetes mellitus.
  • an LP could be used to maintain the islet function so as to alleviate, modulate, ameliorate, delay, or prevent permanent manifestation of the disease.
  • an LP could be used as an auxiliary in islet cell transplantation to improve or promote islet cell function.
  • An LP composition of the invention can be used e.g., to differentiate a cell, tissue; or biological structure, de- differentiate a cell, tissue; or biological structure; cause proliferation in cell or a zone (similar to a ZPA in a limb bud), have an effect on chemotaxis, remodel a tissue (e.g., basement membrane, extra cell matrix, connective tissue, muscle, epithelia) , or initiate the regeneration of a tissue, organ, or biological structure (see, e.g., Science (1997) 276:59-87) .
  • a tissue e.g., basement membrane, extra cell matrix, connective tissue, muscle, epithelia
  • Regeneration using an LP composition of the invention could be used to repair, replace, remodel, or protect tissue damaged by, e.g., congenital defects, trauma (such as, e.g., wounds, burns, incisions, or ulcers) ; age; disease (such as, e.g., osteoporosis, osteoarthritis, periodontal disease syndrome, or liver failure), surgery, (including, e.g., cosmetic plastic surgery) ; fibrosis; re-perfusion injury; or cytokine damage.
  • trauma such as, e.g., wounds, burns, incisions, or ulcers
  • age disease
  • disease such as, e.g., osteoporosis, osteoarthritis, periodontal disease syndrome, or liver failure
  • surgery including, e.g., cosmetic plastic surgery
  • fibrosis re-perfusion injury
  • cytokine damage e.g., cytokine damage.
  • Tissues that can be regenerated include, e.g., without limitation, organs (e.g., pancreas, liver, intestine, kidney, epithelia, endothelium) , muscle (smooth, skeletal, or cardiac), vasculature (including vascular and lymphatics), nervous system tissue, cells, or structures; hematopoietic tissue; and skeletal (bone, cartilage, tendon, and ligament) tissue.
  • organs e.g., pancreas, liver, intestine, kidney, epithelia, endothelium
  • muscle smooth, skeletal, or cardiac
  • vasculature including vascular and lymphatics
  • nervous system tissue cells, or structures
  • hematopoietic tissue hematopoietic tissue
  • skeletal bone, cartilage, tendon, and ligament
  • regeneration occurs with little or no scarring.
  • Regeneration also may include, e.g., angiogenesis.
  • an LP composition may increase the regeneration of an aggregation of special cell types, a tissue, or a matrix that typically is difficult to heal. For example, by increasing the rate at which a tendon/ligament heals after damage. Also encompassed is using an LP prophylactically to avoid damage (e.g., in an interstitial space of a joint or on the cartalagenous capsule of a bone) .
  • Specific diseases that could be modulated, ameliorated, treated, prevented, and/or diagnosed using an LP composition include, e.g., without limitation, tendinitis, carpal tunnel syndrome, and other tendon or ligament defects.
  • non-healing wounds include, wounds that would benefit form regeneration treatment, e.g., without limit pressure ulcers, ulcers associated with vascular insufficiency, surgical wounds, and traumatic wounds.
  • nerve and brain tissue also could be regenerated using an LP.
  • Such nervous system conditions that could be modulated, ameliorated, treated, prevented, and/or diagnosed using an LP composition include, e.g., without limitation, central and peripheral nervous system diseases, neuropathies, or mechanical and traumatic conditions (e.g., spinal cord disorders or syndromes, head trauma, cerebrovascular disease syndrome, and stoke) .
  • diseases associated with peripheral nerve injuries include, e.g., without limitation, peripheral neuropathy (e.g., resulting from chemotherapy or other medical therapies) , localized neuropathies, and central nervous system diseases (e.g., Alzheimer's disease syndrome, Parkinson's disease syndrome, Huntington's disease syndrome, Amyotrophic lateral sclerosis, and Shy-Drager syndrome) . All could be ameliorated, treated, prevented, and/or diagnosed using an LP.
  • An LP may have an effect on a chemotaxis activity.
  • chemotactic molecules can attract or mobilize (but may also repeal) cells (e.g., monocytes, fibroblasts, neutrophils, T-cells, mast cells, eosinophils, epithelial and/or endothelial cells) or cell processes (e.g., filopodia, psuedopodia, lamellapodia, dendrites, axons, etc.) to a particular site (e.g., such as inflammation, infection, site of hyperproliferation, the floor plate of the developing spinal cord, etc.) .
  • a particular site e.g., such as inflammation, infection, site of hyperproliferation, the floor plate of the developing spinal cord, etc.
  • Such mobilized cells can then fight off and/or modulate a particular trauma, abnormality, condition, syndrome, or disease.
  • An LP may have an effect on a chemotactic activity of a cell (such as, e.g., an attractive or repulsive effect) .
  • a chemotactic molecule can be used to modulate, ameliorate, treat, prevent, and/or diagnose inflammation, infection, hyperproliferative diseases, disorders, syndromes, and/or conditions, or an immune system disorder by increasing the number of cells targeted to a particular location in the body.
  • a chemotactic molecule can be used to attract an immune cell to an injured location in a subject.
  • An LP that had an effect on a chemotactant could also attract a fibroblast, which can be used to modulate, ameliorate, and/or treat a wound. It is also contemplated that an LP may inhibit a chemotactic activity to modulate, ameliorate, treat, prevent, and/or diagnose a disease, disorder, syndrome, and/or a condition.
  • Sequences encoding an LP polypeptide are used for the diagnosis of disorders associated with LP (such as, e.g., LP misexpression, LP overexpression, LP underexpression, etc.).
  • disorders associated with LP such as, e.g., LP misexpression, LP overexpression, LP underexpression, etc.
  • disorders associated with LP include, without limit, a cell proliferative disorder such as actinic keratosis, arteriosclerosis, atherosclerosis, bursitis, cirrhosis, hepatitis, mixed connective tissue disease (MCTD) , myelofibrosis, paroxysmal nocturnal hemoglobinuria, polycythemia vera, psoriasis, primary thrombocythemia, and cancers including adenocarcinoma, leukemia, lymphoma, melanoma, myeloma, Hamartoma, sarcoma, teratocarcino
  • Sequences encoding an LP polypeptide (or fragment thereof) are used in Southern or northern analysis; dot blot or other membrane-based technologies; PCR technologies; in dipstick, pin, and multiformat ELISA-like assays; and in microarrays utilizing fluids or tissues from a subject; to detect an altered LP polypeptide (or fragment thereof) expression. Such qualitative or quantitative methods are well known in the art.
  • a sequence encoding an LP polypeptide (or fragment thereof) is used in an assay to detect the presence of an associated disorder, state, condition, syndrome, or disease (particularly, e.g., any mentioned above) .
  • Sequences encoding LP polypeptide (or fragments thereof) are labeled by standard methods and added to a sample under conditions suitable to form detectable hybridization complexes, wherein the resulting signals are quantified and compared with standard values. Any sample signal sufficiently different from a control implies the detection of an altered LP level that can be correlated with the disorder, state, condition, syndrome, or disease associated with the sample or the subject from whom the sample was obtained.
  • Such assays are also used to evaluate the efficacy of a particular treatment regimen (e.g., in an animal study, a clinical trial, or the treatment of an individual subject) .
  • a normal or standard profile of expression is established (e.g., this can be accomplished by combining a sample taken from a normal subject with a sequence encoding an LP polypeptide (or fragment thereof) under conditions suitable for hybridization or amplification) .
  • Standard hybridization is quantified by comparing values obtained from subjects with control values (in which a known amount of a substantially purified polynucleotide is used) .
  • Standard values are then compared with values obtained from samples of subjects who have a disorder, state, condition, syndrome, or disease suspected of being associated with an LP polypeptide (or fragment thereof) .
  • any detectable deviations from standard values are used to correlate the presence of a disorder, state, condition, syndrome, or disease with the LP.
  • hybridization assays are repeated on a regular basis to monitor the level of LP expression. The results obtained from successive assays are used to show the efficacy of treatment over a period ranging from several days to months .
  • the presence of an abnormal amount of transcript (either under- or over expressed) in biopsied tissue from a subject may indicate a predisposition for the development of a disorder, state, condition, syndrome, or disease of cell proliferation or it may provide a means for detecting such a disorder, state, condition, syndrome, or disease prior to the appearance of actual clinical symptoms.
  • a more definitive initial detection may allow earlier treatment thereby preventing and/or ameliorating further progression of cell proliferation.
  • oligonucleotides designed from an LP sequence may involve the use of PCR. These oligomers are chemically synthesized, generated enzymatically, or produced in vitro. Oligomers will preferably contain a fragment of a sequence encoding an LP polypeptide (or fragment thereof) , or a fragment of a sequence complementary to the sequence encoding an LP polypeptide (or fragment thereof) , and will be employed under optimized conditions to identify a specific gene or disorder, state, condition, syndrome, or disease. Oligomers may also be employed under less stringent conditions for detection or quantification of closely related DNA or RNA sequences .
  • LP & Inflammation Systemic inflammatory states are frequently accompanied by activation of the coagulation system and activation of the coagulation system is almost an invariable consequence of septic shock.
  • the simultaneous activation of the innate immune response and the coagulation system after injury is a phylogenetically ancient, adaptive response that can be traced back to the early stages of eukaryotic evolution.
  • Most invertebrate species lack differentiated phagocytic cells and platelets. They possess a common cellular and humoral pathway of inflammation and clotting after a breach in their internal milieu by either trauma or infection. The close linkage between clotting and inflammation has been preserved throughout vertebrate evolution and is readily demonstrable in human physiologic responses to a variety of potentially injurious stimuli.
  • phagocytic effector cells such as, e.g., neutrophils, monocytes, and macrophages. Consequently, the role of an LP in physiological functions will likely cross artificial boundaries designated solely as inflammation or immune responses and thus information suggesting a role for an LP of the invention in inflammation is also indicative of a role for the LP in an immune response and vice versa.
  • an LP, LP variant, LP agonist, LP antagonist, LP binding partner or an LP fragment as described herein may exhibit anti-inflammatory activity.
  • the anti-inflammatory activity may be achieved by providing a stimulus to cells involved in the inflammatory response, by inhibiting or promoting cell-cell interactions (such as, for example, cell adhesion) , by inhibiting or promoting chemotaxis of cells involved in the inflammatory process, inhibiting or promoting cell extravasation, or by stimulating or suppressing production of other factors which more directly inhibit or promote an inflammatory response.
  • Proteins exhibiting such activities can be used to treat inflammatory conditions including chronic or acute conditions) , including without limitation inflammation associated with infection (such as septic shock, sepsis or systemic inflammatory response syndrome (SIRS) ) , ischemia- reperfusion injury, endotoxin lethality, arthritis, complement-mediated hyperacute rejection, nephritis, cytokine or chemokine-induced lung injury, inflammatory bowel disease, Crohn's disease or resulting from over production of cytokines such as TNF or IL-1.
  • An LP, LP variant, LP agonist, LP antagonist, LP binding partner or an LP fragment may also be useful to treat anaphylaxis and hypersensitivity to an antigenic substance or material.
  • an LP of the invention in preventing life threatening fever, circulatory collapse, intravascular coagulation, hemorrhagic necrosis, and/or multiple organ failure one can adopt any of a number of art known animal sepsis models.
  • a sepsis model should have: (1) animals that show clinical signs of sepsis (malaise, fever, chills, generalized weakness); (2) septic insult that occurs over a period of time to allow the animal time to respond to the insult and attempt to overcome it; and (3) reproducibility so that a majority of prepared animals are available for study.
  • Experimental means of inducing a septic state include: (1) intravenous infusion of live bacteria; (2) surgical disruption of cecal mucosal integrity; and (3) administration of live organisms into the peritoneal cavity via cecal slurry.
  • mice Female Balb/c mice (approximately eight weeks of age and weighing about 17-20 g) are placed (in sets of ten) into different treatment groups to test the effect of an LP of the invention to mediate a bacterial lipopolysaccharide (LPS) challenge which normally produces sepsis and/or endotoxemia followed by death (over a 72 hour time period) .
  • LPS bacterial lipopolysaccharide
  • LPS 50ug in 0.2mls of PBS
  • mice are given intravenous injections of an LP of the invention or a suitable negative control (e.g., such as, human albumin or Fc protein) varying dosages (e.g., such as, 0.1, 1.0, 5.0, 10.0, 20.0, 25.0,
  • a suitable negative control e.g., such as, human albumin or Fc protein
  • dosages e.g., such as, 0.1, 1.0, 5.0, 10.0, 20.0, 25.0,
  • mice 30.0, 35.0, 40.0, 45.0, 50.0, 55.0 ug or in a range of from about 0.1 to about 100. Oug administered in about 0.2mls of PBS) . All mice are subsequently monitored for survival (3x daily) over a 72-hour time period. As a positive control, 1.5 ug of human IL-10 in 0.2 is of PBS + 0.1% human albumin will be mixed with 275 ug of LPS in 0.1 ml of PBS and then administered by inter-peritoneal injection. IL-10 protein has been shown to protect mice from a lethal challenge of LPS.
  • Data is assessed (using standard indices such as, e.g., hemodynamic parameters (heart rate, systolic pressure, diastolic pressure, and mean blood pressure) ; serum cytokine levels (such as, e.g., IL-18, IL-12, IL-6, TNF alpha, IL-1 beta, IFN gamma, IL-10 and GM-CSF) , and serum: AST, ALT, ALP, triglyceride and, glucose levels) comparing the effects of LP to IL-10 protection.
  • hemodynamic parameters hemodynamic parameters
  • serum cytokine levels such as, e.g., IL-18, IL-12, IL-6, TNF alpha, IL-1 beta, IFN gamma, IL-10 and GM-CSF
  • serum AST, ALT, ALP, triglyceride and, glucose levels
  • CLP Cecal ligation and puncture
  • cecal slurry method involves, a 0.25 cm vertical midline abdominal incision and cecal slurry is injected homogeneously throughout the peritoneum under direct vision. The incision is closed with an interrupted silk suture and the abdomen is gently massaged to distribute the injectate.
  • Cecal slurry 200 mg cecal material/kg is prepared by mixing cecal contents obtained from donor rats with 5% dextrose in water (D5W) to yield a concentration of 200 mg cecal material in 5 ml. The slurry is prepared fresh for each use and is administered within 2h to the experimental animal. Typically, within hours of the septic challenge, rats begin to manifest signs of septic shock such as piloerection and lethargy.
  • mean arterial blood pressure falls transiently, pulse pressure widens, and arterial blood lactate rises. Deaths in this model generally occur before 24 hours (-5%) , and between 5 and 7 days (40%) . At 24 hours, rats are hemodynamically stable, but display tachycardia, elevated arterial blood lactate, and leukopenia.
  • mean arterial pressure [MAP - 1/3 (systolic blood pressure - diastolic blood pressure) +diastolic blood pressure] is similar to pre-sepsis values, but pulse pressure remains widened —primarily due to a significant reduction in the diastolic arterial blood pressure.
  • MAP falls significantly, pulse pressure narrows (significantly different from pre-sepsis and day 3 of sepsis), heart rate elevates, and arterial blood lactate and white cell counts rise significantly over that seen on day 3 of sepsis.
  • Septic rats undergo significant weight loss by 48-72 hours, and do not regain baseline weight by day 7 (compared to pre-sepsis values) ; while non-septic animals gain 9.5 ⁇ 3 % weight over the same 7 day period.
  • Non-septic rats display no significant changes in any other of the shown parameters over 7 days after a sham surgical procedure.
  • Characteristic indices to identify moribund rats utilize hemodynamic parameters of heart rate, systolic pressure, diastolic pressure, and mean blood pressure. Typically, a reliable index of 24 hour mortality can be predicted using the following criteria: 1) pulse pressure divided by diastolic blood pressure ⁇ 50; and 2) diastolic blood pressure + 90 mm Hg. Generally, this index has a sensitivity of 94%, selectivity of 84%, diagnostic accuracy of 90% and positive predictive value of 92% (Mourelatos, et al . 1996 Shock 5:141-148; incorporated herein for these teachings) .
  • the ceccal slurry model is associated with early changes consistent with septic shock (hypotension, elevated lactate, and leukopenia) , followed by a period of hyperdynamic sepsis with hemodynamic compensation but with deteriorating conditions through day 7 of sepsis.
  • the increasing blood lactate and leukocytosis are also consistent with clinical sepsis, and indicate an ongoing septic process.
  • This model also allows the study of the septic condition at various stages in the course of the disease.
  • septic conditions are induced by infusion of E. coli into animals at concentrations of 4X 1010 organisms/kg (body weight) .
  • the infusion produces a shock state, which is accompanied first by a decrease of fibrinogen level to approximately 20% of control at T+360 (approximately 360 minutes following commencement of E. coli infusion), with an increase in SGPT level (a measure of liver cell injury) above the normal range.
  • leukocyte and platelet counts drops as does mean systemic arterial pressure (MSAP) . Death characteristically ensues about 24 to 32 hours after challenge.
  • MSAP systemic arterial pressure
  • an LP of the invention e.g., such as the amount of a protein as well as the period of time over which it is administered
  • modulating baboon sepsis can be determined. Briefly, the same dose of E. coli is infused but varying dosages of an LP is also administered with the organisms.
  • an LP infusion rate can range from an initial rate of 4.4g/kg/min. to as high as 64 ug/kg/min.
  • a total of 7-8 mg/kg of the LP is infused over a period of 8 to 10 hours.
  • doses of 1.0, 3.0, and 4.0 mg/kg body weight over a shorter two-four hour period are given. Positive outcomes are assessed as surviving animals.
  • the an appropriate dosage appears to be a function both of the amount of the LP given as well as the period of time over which it is administered.
  • the effect of an LP is determined for animals already in shock (e.g., such as during Stage II of the shock phase, after the endothelium has become perturbed) to determine if LP can reverse the inflammatory response and rescue animals from what otherwise would typically have been fatal sepsis.
  • the protocol employed here is identical, except that LP rescue is initiated after the onset of the inflammatory response, instead of with infusion of the organisms, and is continued over a longer period of time.
  • an LP of the invention in another embodiment, to test the role of an LP of the invention in an acute inflammation response, one can adapt the method of Eberini, et al . 1999 Electrophoresis 20(4-5): 846-53 (incorporated herein for these teachings) .
  • rodents are injected with a phlogistic stimulus (e.g., turpentine) , turpentine and daily doses of indomethacine, and indomethacine alone.
  • a phlogistic stimulus e.g., turpentine
  • peak changes for acute-phase reactants are evaluated between 48 and 72 h after the phlogistic stimulus by two-dimensional electrophoresis (2-DE) to check for, for example, plasma concentration of LP expression, among other expressed molecules .
  • Presence of LP is indicative of it being an acute phase protein whose changes are modulated via anti- inflammatory reaction.
  • LPS bacterial endotoxic lipopolysaccharide
  • transgenic female mice In comparison, the survival rate of transgenic female mice is assessed verses that of control female mice to assess LP response to hormonal differences. Recombinant LP levels in the circulation of these mice is assessed for increase after LPS treatment. The results are examined to determine if LP transgenic mice have a higher survival rate than their non- transgenic control littermates after endotoxin shock and whether there is a gender based resistance to lethality induced by endotoxin shock. These results will suggest if LP has a protective effect during acute phase inflammation.
  • an LP of the invention plays a role in hepatic disease (e.g., such as the result of inflammation response)
  • Electrophoresis 21(11): 2122-8 (incorporated herein for these methods) and generate a drug-induced increase in heptocellular rough endoplasmic reticulum (RER) in Sprague- Dawley rats by giving a substituted pyrimidine derivative.
  • RER heptocellular rough endoplasmic reticulum
  • the experimental subjects are checked for the presence of LP which is interpreted as being indicative of the presence of an acute phase protein whose changes follows an inflammatory reaction supporting the suggestion that LP plays a role in, for example, acute phase liver inflammation.
  • Cytokines such as interleukin-6 (IL-6) have been detected in the cortices of Alzheimer disease (AD) patients, indicating a local activation of components of the unspecific inflammatory system. IL-6 may precede neuritic changes, and the immunological mechanism may be involved both in the transformation from diffuse to neuritic plaques in AD and in the development of dementia.
  • IL-6 interleukin-6
  • IL-6 may precede neuritic changes, and the immunological mechanism may be involved both in the transformation from diffuse to neuritic plaques in AD and in the development of dementia.
  • Hull, et al . 1996 Eur Arch Psychiatry Clin Neurosci 246(3): 124-8 (incorporated herein for these teachings) to determine if an LP of the invention plays a role in such processes.
  • the acute phase protein antichymotrypsm is produced in response to pro-inflammatory cytokines by the reactive astrocytes, in particular those surrounding the amyloid plaques of Alzheimer's disease brains. Accordingly, one can also adapt the method of Cardinaux et al .
  • pro-inflammatory molecules e.g., such as, lipopolysaccharides (LPS) , IL-lbeta, and TNF alpha
  • LPS lipopolysaccharides
  • IL-lbeta IL-lbeta
  • TNF alpha TNF alpha
  • An LP as described herein may also exhibit hemostatic or thrombolytic activity.
  • a composition is expected to be useful in treatment of various coagulation disorders (including hereditary disorders, such as hemophilias) or to enhance coagulation and other hemostatic events in treating wounds resulting from trauma, surgery or other causes.
  • Such a composition may also be useful for dissolving or inhibiting formation of thromboses and for treatment and prevention of conditions resulting therefrom (such as, for example, infarction of cardiac and central nervous system vessels (e.g., stroke) .
  • the activity of an LP as described herein may, among other means, be measured by the following methods: Assay for hemostatic and thrombolytic activity include, without limitation, those described in: Linet et al .
  • a potential function of an LP of the invention in vascular biology can be investigated by studying the role of an LP of the invention in the proliferation and migration of cultured primary aortic vascular smooth muscle cells (VSMCs) in vitro and in neointima formation in rat artery after balloon angioplasty in vivo based on the methods of Miao et al . , 2000 Circ Res 86(4) : 418-24 which is incorporated herein by reference for the teachings assay with modification for LP specificity) .
  • VSMCs cultured primary aortic vascular smooth muscle cells
  • An LP as described herein may be useful in regulation of hematopoiesis and, consequently, in the treatment of myeloid or lymphoid cell deficiencies. Even marginal biological activity in support of colony forming cells or of factor-dependent cell lines indicates involvement in regulating hematopoiesis, e.g.
  • erythroid progenitor cells alone or in combination with other cytokines, thereby indicating utility, for example, in treating various anemias or for use in conjunction with irradiation/chemotherapy to stimulate the production of erythroid precursors and/or erythroid cells; in supporting the growth and proliferation of myeloid cells such as granulocytes and monocytes/macrophages (i.e., traditional CSF activity) useful, for example, in conjunction with chemotherapy to prevent or treat consequent myelo-suppression; in supporting the growth and proliferation of megakaryocytes and consequently of platelets thereby allowing prevention or treatment of various platelet disorders such as thrombocytopenia, and generally for use in place of or complimentary to platelet transfusions; and/or in supporting the growth and proliferation of hematopoietic stem cells which are capable of maturing to any and all of .
  • myeloid cells such as granulocytes and monocytes/macrophages (i.e., traditional CSF activity) useful, for
  • the above-mentioned hematopoietic cells find therapeutic utility in various stem cell disorders (such as those usually treated with transplantation, including, without limitation, aplastic anemia and paroxysmal nocturnal hemoglobinuria) , as well as in repopulating the stem cell compartment post irradiation/chemotherapy, either in- vivo or ex-vivo (i.e., in conjunction with bone marrow transplantation or with peripheral progenitor cell transplantation (homologous or heterologous) ) as normal cells or genetically manipulated for gene therapy.
  • stem cell disorders such as those usually treated with transplantation, including, without limitation, aplastic anemia and paroxysmal nocturnal hemoglobinuria
  • repopulating the stem cell compartment post irradiation/chemotherapy either in- vivo or ex-vivo (i.e., in conjunction with bone marrow transplantation or with peripheral progenitor cell transplantation (homologous or heterologous) ) as normal cells
  • an intravenous bolus injection of LP is given to a subject
  • LP can be delivered to hypotensive transgenic mouse lines by intramuscular injection (see, e.g., the method of Ma, et al . 1995 J Biol Chem 270(1) : 451-5, which is incorporated herein for these teachings) .
  • Expression of the LP is examined for expression in skeletal muscle by reverse transcription-polymerase chain reaction and Southern blot analysis at 10, 20, 30, and 40 days post-injection.
  • Immunoreactive LP levels in the muscle and serum of these mice is quantified by an LP-specific enzyme-linked immunosorbent assay and Western blot analysis. The levels of LP mRNA and immunoreactive protein are examined at 10, 20, and 30 days post-in ection. During this period, LP delivery is examined to determine its effect on systemic blood pressure compared to that of normotensive control mice.
  • an LP polynucleotide encoding an LP or variant thereof is directly introduced into spontaneously hypertensive rats (SHR) through portal vein injection (see, e.g., the method of Ma, et al . 1995 J Biol Chem 270(1): 451- 5, which is incorporated herein for these teachings) .
  • Chronic-inhibition-of- nitric-oxide-synthase-induced hypertension is created by giving N omega-nitro-L-arginine methyl ester (L-NAME, 40 mg/100 ml water or given in a dose of 50 mg/kg into the jugular vein) orally to Sprague-Dawley rats, while controls receive regular tap water.
  • L-NAME N omega-nitro-L-arginine methyl ester
  • Blood pressure is measured in the right carotid artery by a Statham pressure transducer in acute experiments, and on the tail artery by the . plethysmographic method weekly in chronic experiments. Subsequently, LP mRNA levels are measured and compared with known vascularization effecting proteins such as, e.g., proteins of the kallikrein-kinin system. The results are used to assess whether enhanced LP synthesis has a protective role against the cardiovascular effects induced by chronic inhibition of nitric oxide synthesis.
  • an LP of the invention plays a role in heart disease (e.g., such as cardiomyopathy)
  • a role in heart disease e.g., such as cardiomyopathy
  • MLP -/- model of heart failure designated the MLP -/- model of heart failure
  • MLP -/- model of heart failure involves the ablation of a muscle-restricted gene encoding the muscle LIM protein (MLP -/-) (Arber, et al.
  • the MLP -/- model of dilated cardiomyopathy closely resembles the phenotype of human dilated cardiomyopathy. MLP is a conserved positive regulator of myogenic differentiation, and recent findings suggest that it may act as a molecular adapter to promote protein assembly along the actin-based cytoskeleton. Hearts from
  • MLP-deficient mice are characterized by marked disruption of cardiomyocyte architecture.
  • Human heart failure also is a disease of cardiac muscle characterized by alterations in cardiomyocyte shape (Gerdes, et al . 1992 Circulation 86, 426-430), cytoskeletal abnormalities (Schaper, et al . 1991
  • Circulation 83, 504-514 Circulation 83, 504-514
  • bAR signaling Bristow, et al . 1982 N. Engl. J. Med. 307, 205-211
  • MLP- deficient mouse supports the MLP- deficient mouse as a model system to study heart disease.
  • LP expression levels are examined in the skeletal muscles of fasting rodents. Lowered levels of LP suggest that LP contributes to diseases of muscle wasting. Accordingly, increasing the level of LP in such conditions may ameliorate such conditions.
  • mice C57BL approximately 18-22 grams in weight
  • viable methylcholantreen-induced sarcoma MCG 101
  • MCGIOI is a non-metastasizing, undifferentiated, epithelial-like solid tumor that has been extensively used for modeling cancer cachexia.
  • the tumor grows locally in a reproducible growth pattern.
  • animals die within 12-15 days after implantation due to cancer-induced cachexia.
  • the tumor has been shown to produce the cytokines: IL-1 alpha, IL-l»beta, TNF-alpha, and IL-6.
  • Prostaglandins particularly PGE2 , are also produced.
  • mice are assembled into treatment groups of ten animals each.
  • Mice are given interperitoneal injections of varying dosages of an LP of the invention (e.g., such as, 0.1, 1.0, 5.0, 10.0, 20.0, 25.0, 30.0, 35.0, 40.0, 45.0, 50.0, 55.0 ug of an LP described herein or in a range of from about 0.1 to about 100.0 ug administered in about 0.2mls of PBS) or a suitable negative control (e.g., such as, human albumin or Fc protein. Additionally, as a negative control a group receives no implantation of MCGIOI but receives either IL-6 or indomethacin as described below) .
  • an LP of the invention e.g., such as, 0.1, 1.0, 5.0, 10.0, 20.0, 25.0, 30.0, 35.0, 40.0, 45.0, 50.0, 55.0 ug of an LP described herein or in a range of from about 0.1
  • one group receives (every three days post implantation) anti-mouse IL-6 (300 ug/mouse) while another receives indomethacin (5mg/ml) ad libitum in the drinking water. All mice are subsequently monitored for food intake, body composition and weight daily. On day twelve after tumor implantation, all animals are sacrificed; their tumors removed, weighed, and dried. Body carcass weight is subsequently determined and body composition is evaluated by lipid extraction and drying to constant weight. Biochemical analysis involves, e.g., testing for plasma cytokine levels such as, e.g., IL-6 and PGE2 levels. Data is compared to controls to assess the impact of an LP tested.
  • Sprague-Dawley rats (150 to 175 g, 6 weeks old) as confirmed by hyperglycemia and reduced body weight .
  • Retinas are dissected from animals at 1, 2, and 4 months of induced diabetes-like conditions.
  • the functional activity of LP in retinal homogenates is determined by immunoreactive LP levels measured by enzyme-linked immunosorbent assay. Additionally, LP messenger RNA (mRNA) levels in the retina are measured by Northern blot analysis using an LP complementary DNA probe.
  • the activity of total Na+, K(+)- ATPase is determined by a radioassay. Total protein concentration is determined by a protein assay.
  • Extracellular matrix (ECM) degradation and turnover are important processes in tissue remodeling during development, wound healing, regeneration, metastasis, tumor necrosis, bone and cartilage degenerative disease (e.g., arthritic conditions) , and inflammation.
  • An LP as described herein may also play a role in effecting the role of the ECM in, for example, tissue remodeling during development or repair, cell proliferation conditions, metastatic disease, wound healing, tumorgenesis, tumor necrosis, and inflammation.
  • ECM extracellular matrix
  • An LP as described herein also may have utility in compositions used for bone, cartilage, tendon, ligament and/or nerve tissue growth or regeneration, as well as for wound healing and tissue repair and replacement, and in the treatment of burns, incisions and ulcers.
  • An LP of the present invention which induces cartilage and/or bone growth in circumstances where bone is not normally formed, has application in the healing of bone fractures and cartilage damage or defects in humans and other animals .
  • Such a preparation employing an LP of the invention may have prophylactic use in closed as well as open fracture reduction and also in the improved fixation of artificial joints. De novo bone formation induced by an osteogenic agent contributes to the repair of congenital, trauma induced, or oncologic resection induced craniofacial defects, and also is useful in cosmetic plastic surgery.
  • An LP as described herein may also be used in the treatment of periodontal disease, and in other tooth repair processes. Such agents may provide an environment to attract bone-forming cells, stimulate growth of bone-forming cells or induce differentiation of progenitors of bone- forming cells.
  • An LP may also be useful in the treatment of osteoporosis or osteoarthritis, such as through stimulation of bone and/or cartilage repair or by blocking inflammation or processes of tissue destruction (collagenase activity, osteoclast activity, etc.) mediated by inflammatory processes .
  • tissue regeneration activity that may be attributable to an LP described herein is tendon/ligament formation.
  • An LP which induces tendon/ligament-like tissue or other tissue formation in circumstances where such tissue is not normally formed, has application in the healing of tendon or ligament tears, deformities and other tendon or ligament defects in humans and other animals .
  • Such a preparation employing a tendon/ligament-like tissue inducing protein may have prophylactic use in preventing damage to tendon or ligament tissue, as well as use in the improved fixation of tendon or ligament to bone or other tissues, and in repairing defects to tendon or ligament tissue.
  • a composition comprising an LP of the present invention may provide an environment to attract tendon- or ligament-forming cells, stimulate growth of tendon- or ligament-forming cells, induce differentiation of progenitors of tendon- or ligament-forming cells, or induce growth of tendon/ligament cells or progenitors ex vivo for return in vivo to effect tissue repair.
  • the composition may also be useful in the treatment of tendinitis, carpal tunnel syndrome and other tendon or ligament defects.
  • the compositions may also include an appropriate matrix and/or sequestering agent as a carrier as is well known in the art.
  • An LP of the invention may also be useful for proliferation of neural cells and for regeneration of nerve and brain tissue, i.e. for the treatment of central and peripheral nervous system diseases and neuropathies, as well as mechanical and traumatic disorders, which involve degeneration, death or trauma to neural cells or nerve tissue. More specifically, an LP herein may be used in the treatment of diseases of the peripheral nervous system, such as peripheral nerve injuries, peripheral neuropathy and localized neuropathies, and central nervous system diseases, such as Alzheimer's, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, and Shy-Drager syndrome. Further conditions, which may be treated in accordance with the present invention, include mechanical and traumatic disorders, such as spinal cord disorders, head trauma and cerebrovascular diseases such as stroke. Peripheral neuropathies resulting from chemotherapy or other medical therapies may also be treatable using an LP described herein.
  • An LP of the invention may also be useful to promote better or faster closure of non-healing wounds, including without limitation pressure ulcers, ulcers associated with vascular insufficiency, surgical and traumatic wounds, and the like.
  • an LP described herein may also exhibit activity for generation or regeneration of other tissues, such as organs (including, for example, pancreas, liver, intestine, kidney , skin, endothelium) , muscle (smooth, skeletal or cardiac) and vascular (including vascular endothelium) tissue, or for promoting the growth of cells comprising such tissues.
  • organs including, for example, pancreas, liver, intestine, kidney , skin, endothelium
  • muscle smooth, skeletal or cardiac
  • vascular including vascular endothelium
  • An LP described herein may also be useful for gut protection or regeneration and treatment of lung or liver fibrosis, reperfusion injury in various tissues, and conditions resulting from systemic cytokine damage.
  • An LP of the present invention may also be useful for promoting or inhibiting differentiation of tissues described above from precursor tissues or cells; or for inhibiting the growth of tissues described herein.
  • LRP alpha 2- macroglobulin receptor/low density lipoprotein receptor-related protein
  • various growth factors such as, e.g., serpins and serine proteases
  • an LP described herein may also play a role in affecting tissue regeneration and repair .
  • Assays for tissue generation activity include, without limitation, those described in: International Patent Publication No. W095/16035 (bone, cartilage, tendon) ,-
  • assays for wound healing activity include, without limitation, those described in: Winter, Epidermal Wound Healing, pp. 71-112 (Maibach, HI and Rovee, DT, eds.), Year Book Medical Publishers, Inc., Chicago, as modified by Eaglstein and Mertz, J. Invest. Dermatol 71:382-84 (1978) . All of these assays can be adapted for use in testing an LP of the invention.
  • a tissue culture system using axolotl spinal cord ependymal cells can be used to test the effects of an LP, an LP variant, an LP agonist, an LP antagonist, an LP binding partner or an LP fragment on, for example, nerve and tissue regeneration.
  • Additional techniques to investigate similar functionalities of an LP described herein include the techniques of, e.g., Itasaki, et al, 1999 Nature Cell Biology Dec; 1 (8) :E203-207 ; Momose, et al., 1999 Develop. Growth Differ.
  • Similar models can be adapted to examine the role of an LP, an LP variant, an LP agonist, an LP antagonist, an LP binding partner or an LP fragment in organ regeneration (e.g., such as hepatic regeneration using available liver models and assay techniques) .
  • Additional assays or methods for assessing an activity of an LP of the invention may, among ' other means, be measured by the following methods :
  • Suitable assays for thymocyte or splenocyte cytotoxicity include, without limitation, those described in: Current Protocols in Immunology, Ed by Coligan, et al . , Pub. Greene Publishing Associates and Wiley-Interscience (Chapter 3, In Vitro assays for Mouse Lymphocyte Function 3.1-3.19; Chapter 7, Immunologic studies in Humans); Herrmann et al . , Proc. Natl. Acad. Sci. USA 78:2488-2492, 1981; Herrmann et al . , J. Immunol. 128:1968-1974, 1982; Handa et al . , J. Immunol. 135:1564-1572, 1985; Takai et al . ,
  • Assays for T-cell-dependent immunoglobulin responses and isotype switching include, without limitation, those described in: Maliszewski, J. Immunol.
  • MLR Mixed lymphocyte reaction
  • Thl and CTL responses include, without limitation, those described in: Current Protocols in Immunology, Ed by J. E.
  • Dendritic cell-dependent assays (which will identify, among others, proteins expressed by dendritic cells that activate naive T-cells) include, without limitation, those described in: Guery et al . , J. Immunol. 134:536-544, 1995; Inaba et al . , Journal of Experimental Medicine 173:549-559, 1991; Macatonia et al . , Journal of Immunology 154:5071-5079, 1995; Porgador et al . , Journal of Experimental Medicine 182:255-260, 1995; Nair et al . , Journal of Virology 67:4062- 4069, 1993; Huang et al .
  • lymphocyte survival/apoptosis (which will identify, among others, proteins that prevent apoptosis after superantigen induction and proteins that regulate lymphocyte homeostasis) include, without limitation, those described in: Darzynkiewicz et al . , Cytometry 13:795-808, 1992; Gorczyca et al . , Leukemia 7:659-670, 1993; Gorczyca et al., Cancer Research 53:1945-1951, 1993; Itoh et al . , Cell 66:233-243, 1991; Zacharchuk, Journal of Immunology 145:4037-4045, 1990; Zamai et al . , Cytometry 14:891-897, 1993; Gorczyca.
  • Assays for embryonic stem cell differentiation include, without limitation, those described in: Johansson et al . Cellular Biology 15:141-151, 1995; Keller et al . , Molecular and
  • Assays for stem cell survival and differentiation include, without limitation, those described in: Methylcellulose colony forming assays, Freshney, M.G. In Culture of Hematopoietic Cells. R.I.
  • the compounds of the present invention may be used to treat various conditions including those characterized by overexpression and/or activation of the disease-associated genes identified herein.
  • exemplary conditions or disorders to be treated with such antibodies and other compounds including, but not limited to, small organic and inorganic molecules, peptides, antisense molecules, etc., include cancer, heart disease, diabetes, neurological, immune or hematological disorders or other diseases .
  • the active agents of the present invention are administered to a mammal, preferably a human, in accord with known methods, such as intravenous administration as a bolus or by continuous infusion over a period of time, by intramuscular, intraperitoneal, intracerebral, intracerebrospinal, subcutaneous, intra- articular, intrasynovial, intrathecal, intraoccular, intranasal, intralesional, oral, pulmonary, topical, inhalation or through sustained release .
  • LP123 LP123, LP127, or LP129 polypeptide, agonists, antagonists, or antibodies of the instant invention.
  • an active agent e.g., an antibody
  • the appropriate dosage of an active agent will depend on the type of disease to be treated, as defined above, the severity and course of the disease, whether the agent is administered for preventive or therapeutic purposes, previous therapy, the patient's clinical history and response to the agent, and the discretion of the attending physician.
  • the agent is suitably administered to the patient at one time or over a series of treatments. Dosages and desired drug concentration of pharmaceutical compositions of the present invention may vary depending on the particular use envisioned. The determination of the appropriate dosage or route of administration is well within the skill of an ordinary artisan. Animal experiments provide reliable guidance for the determination of effective does for human therapy.
  • Interspecies scaling of effective doses can be performed following the principles laid down by Mordenti and Chappell, "The Use of Interspecies Scaling in Toxicokinetics, " in Toxicokinetics and New Drug Development, Yacobi, et al . , Eds., Pergamon Press, NY (1989), pp. 4246.
  • normal dosage amounts may vary from about 10 ng/kg up to 100 mg/kg of mammal body weight or more per day, preferably about 1 pg/kg/day up to 100 mg/kg of mammal body weight or more per day, depending upon the route of administration.
  • dosages and methods of delivery are provided in the literature; see, for example, U.S. Pat. Nos. 4,657,760; 5,206,344 or 5,225,212. It is within the scope of the invention that different formulations will be effective for different treatment compounds and different disorders, that administration targeting one organ or tissue, for example, may necessitate delivery in a manner different from that to another organ or tissue. Moreover, dosages may be administered by one or more separate administrations or by continuous infusion. For repeated administrations over several days or longer, depending on the condition, the treatment is sustained until a desired suppression of disease symptoms occurs. However, other dosage regimens may be useful. The progress of this therapy is easily monitored by conventional techniques and assays .
  • an article of manufacture containing materials useful for the diagnosis or treatment of the disorders described above comprises a container and a label.
  • Suitable containers include, for example, bottles, vials, syringes, and test tubes.
  • the containers may be formed from a variety of materials such as glass or plastic.
  • the container holds a composition which is effective for diagnosing or treating the condition and may have a sterile access port (for example, the container may be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle) .
  • the active agent in the composition is typically an LP123, LP127, or LP129 polypeptide, antagonist or agonist thereof.
  • the label on, or associated with, the container indicates that the composition is used for diagnosing or treating .the condition of choice.
  • the article of manufacture may further comprise a second container comprising a pharmaceutically-acceptable buffer, such as phosphate-bu fered saline, Ringer's solution and dextrose solution. It may further include other materials desirable from a commercial end user standpoint, including other buffers, diluents, filters, needles, syringes, and package inserts with instructions for use.
  • a pharmaceutically-acceptable buffer such as phosphate-bu fered saline, Ringer's solution and dextrose solution.
  • It may further include other materials desirable from a commercial end user standpoint, including other buffers, diluents, filters, needles, syringes, and package inserts with instructions for use.
  • the following examples are offered for illustrative purposes only and are not intended to limit the scope of the present invention in any way.
  • the first strand of cDNA was synthesized using SuperScriptll (GibcoBRL, Rockville, MD) .
  • the second strand of cDNA was synthesized using the standard protocol with one modification: the E. coli DNA ligase was omitted from the reaction mix, producing the synthesis of short fragment cDNA in the range of 300 to 1000 bp.
  • the Notl/EcoRI adapters were ligated to blunt ended cDNA. Excess adapters were removed by column chromatography. Fractions of cDNA that were free of excess adapters were pooled and precipitated.
  • the human bone marrow cDNA were amplified using a single adapter primer (TCTAGAGAATTCGTCGACGCGG) .
  • Amplifications were performed in a Perkin-Elmer Thermal Cycler 9600 according to the following method: initially denature the template at 94°C for 30 seconds, then complete 30 cycles of 94°C for 20 seconds, 55°C for 30 seconds, and 72°C for 3 minutes with Advantage DNA Polymerase from Clontech. PCR products were extracted and precipitated using a phenol/chloroform extraction. Pellets were resuspended in 0.3 M sodium phosphate buffer at pH 6.8 containing 0.4 mM EDTA to a final concentration of 50 ⁇ g/mL. Reassociation reactions were performed in a 50 ⁇ L volume in 1.5 mL Eppendorf tubes .
  • Reaction mixtures were overlaid with a drop of mineral oil and heat denatured in a heating block at 95°C for 10 minutes.
  • the tubes were immediately transferred to another heating block and allowed to reassociate at 65°C for 24, 48, 72, or 96 hours.
  • Reactions were stopped by chilling the tubes on ice and diluting the reassociation mix with 1 mL of 10 mM sodium phosphate buffer at pH 6.8 containing 0.4 mM EDTA.
  • the diluted samples were applied to hydroxyapatite columns for separation of single and double-stranded DNA. Hydroxyapatite chromatography was performed using DNA grade Bio-Gel hydroxyapatite from BioRad.
  • the column packing was washed with 10 mM sodium phosphate at pH 6.8 containing 0.4 mM EDTA then suspended into a 50% slurry.
  • the slurry was used to pack a water-jacketed glass column to a bed volume of about 2 mL.
  • Conditions for binding and elution of single- and double-stranded fractions were determined by calibrating the column with phiX/Haelll (denatured at 95°C for 10 minutes) and double-stranded 1 kb ladder (GibcoBRL) .
  • the mixture of denatured single-stranded phiX DNA and double-stranded 1 kb ladder was applied to the column.
  • the column temperature was maintained at 60°C.
  • the elution profiles were determined by applying a step gradient from 0.1 to 0.35 M sodium phosphate at pH 6.8 in increments of 0.05 M sodium phosphate.
  • the 24, 48, 72, and 96 hour reassociation reaction samples were separated into single- and double-stranded DNA fractions using 0.15 M sodium phosphate at pH 6.8 containing 0.4 mM EDTA and 0.35 M sodium phosphate at pH 6.8 containing 0.4 mM EDTA, respectively. All fractions were eluted in 10 mL fractions and were then concentrated to about 100 ⁇ L by centrifugation in Centricon-30 filters (Millipore, Bedford, MA) .
  • the eluted fractions were amplified using the same conditions and cycling parameters as the initial DNA amplification.
  • the amplified single- and double-stranded DNA fractions were used to study the reassociation rate of several high and low abundance genes using semi-quantitative PCR.
  • Primers were designed to amplify gene fragments of about 300 bp.
  • Serial dilutions of each template and unnormalized DNA were made, yielding final quantities of template in the PCR reactions at 10 ng, 1 ng, 100 pg, 10 pg, 1 pg, and 0.1 pg.
  • the PCR reactions were performed in 96 well plates in an MJ thermal cycler in the three step PCR.
  • the initial denaturation step of 94°C for 30 seconds was followed by 30 cycles of 94°C for 30 seconds, 65°C for 30 seconds, and 72°C for 1.5 minutes.
  • PCR primers for G3PDH, actin, and Human Transferrin Receptor the best normalized condition was evaluated where the abundance levels of all three genes were within an order of magnitude .
  • the 72-hour reassociation mixture was chosen as the optimal time point for the library construction, as determined by semi-quantitative PCR.
  • the amplified single- stranded fraction was treated with T4 polynucleotide kinase (BM) and T4 DNA polymerase. It was then ligated into the Smal site of pUC18 (Pharmacia) . The colonies were picked into 96 well plates and frozen as glycerol stocks.
  • DNA sequencing gave the full-length DNA sequence for LP123, LP127, and LP129 (SEQ ID NO:l, 3, and 5, respectively) and the derived LP123, LP127, and LP129 protein sequence (SEQ ID NO: 2, 4, and 6, respectively) .
  • the bacterial expression vector pQE60 is used for bacterial expression in this example. (QIAGEN, Inc., Chatsworth, CA) .
  • pQE60 encodes ampicillin antibiotic resistance ("Ampr") and contains a bacterial origin of replication ("ori"), an IPTG inducible promoter, a riboso e binding site (“RBS”), six codons encoding histidine residues that allow affinity purification using nickel-nitrilo-tri- acetic acid (“Ni-NTA”) affinity resin sold by QIAGEN, Inc., and suitable single restriction enzyme cleavage sites.
  • a DNA fragment encoding a polypeptide can be inserted in such a way as to produce that polypeptide with the six His residues (i.e., a "6 X His tag") covalently linked to the carboxyl terminus of that polypeptide.
  • a polypeptide coding sequence can optionally be inserted such that translation of the six His codons is prevented and, therefore, a polypeptide is produced with no 6 X His tag.
  • the nucleic acid sequence encoding the desired portion of LP123, LP127, or LP129 lacking the hydrophobic leader sequence is amplified from a cDNA clone using PCR oligonucleotide primers (based on the sequences presented, e.g., as presented in SEQ ID NO: 2, 4, or 6) , which anneal to the amino terminal encoding DNA sequences of the desired portion of LP123, LP127, or LP129 and to sequences in the construct 3' to the cDNA coding sequence. Additional nucleotides containing restriction sites to facilitate cloning in the pQE60 vector are added to the 5' and 3' sequences, respectively.
  • the 5' and 3' primers have nucleotides corresponding or complementary to a portion of the coding sequence of LP123, LP127, or LP129, e.g., as presented in SEQ ID NO: 2, 4, or 6, according to known method steps .
  • the point in a polypeptide coding sequence where the 5' primer begins can be varied to amplify a desired portion of the complete polypeptide shorter or longer than the mature form.
  • the amplified LP123, LP127, or LP129 nucleic acid fragments and the vector pQE60 are digested with appropriate restriction enzymes and the digested DNAs are then ligated together. Insertion of the LP123, LP127, or LP129 DNA into the restricted pQE60 vector places the LP123, LP127, or LP129 polypeptide coding region, including its associated stop codon, downstream from the IPTG-inducible promoter and in-frame with an initiating AUG codon. The associated stop codon prevents translation of the six histidine codons downstream of the insertion point .
  • E. coli strain Ml5/rep4 containing multiple copies of the plasmid pREP4, which expresses the lac repressor and confers kanamycin resistance ("Kanr"), is used in carrying out the illustrative example described herein.
  • This strain which is only one of many that are suitable for expressing LP123, LP127, or LP129 polypeptide, is available commercially from QIAGEN, Inc. Transformants are identified by their ability to grow on LB plates in the presence of ampicillin and kanamycin. Plasmid DNA is isolated from resistant colonies and the identity of the cloned DNA confirmed by restriction analysis, PCR and DNA sequencing.
  • Clones containing the desired constructs are grown overnight ("0/N") in liquid culture in LB media supplemented with both ampicillin (100 ⁇ g/mL) and kanamycin (25 ⁇ g/mL) .
  • the 0/N culture is used to inoculate a large culture, at a dilution of approximately 1:25 to 1:250.
  • the cells are grown to an optical density at 600 nm ("OD600”) of between 0.4 and 0.6.
  • Isopropyl-b-D-thiogalactopyranoside (“IPTG”) is then added to a final concentration of 1 mM to induce transcription from the lac repressor sensitive promoter, by inactivating the lad repressor. Cells subsequently are incubated further for 3 to 4 hours.
  • Cells then are harvested by centrifugation. The cells are then stirred for 3-4 hours at 4°C in 6M guanidine-HCl, pH 8. The cell debris is removed by centrifugation, and the supernatant containing the LP123, LP127, or LP129 is dialyzed against 50 mM Na-acetate buffer, pH 6, supplemented with 200 mM NaCl. Alternatively, a polypeptide can be successfully refolded by dialyzing it against 500 mM NaCl, 20% glycerol, 25 mM Tris/HCl pH 7.4, containing protease inhibitors.
  • the protein is made soluble according to known method steps. After renaturation, the polypeptide is purified by ion exchange, hydrophobic interaction, and/or size exclusion chromatography. Alternatively, an affinity chromatography step such as an antibody column is used to obtain pure LP123, LP127, or LP129. The purified polypeptide is stored at 4°C or frozen at -40°C to -120°C.
  • the plasmid shuttle vector pA2 GP is used to insert the cloned DNA encoding the mature polypeptide into a baculovirus to express LP123, LP127, or LP129, using a baculovirus leader and standard methods as described in Summers, et al . , A Manual of Methods for Baculovirus Vectors and Insect Cell Culture Procedures, Texas Agricultural Experimental Station Bulletin No. 1555 (1987) .
  • This expression vector contains the strong polyhedrin promoter of the Autographa californica nuclear polyhedrosis virus (AcMNPV) followed by the secretory signal peptide (leader) of the baculovirus g ⁇ 67 polypeptide and convenient restriction sites such as BamHI, Xbal, and Asp718.
  • the polyadenylation site of the simian virus 40 ("SV40") is used for efficient polyadenylation.
  • the plasmid contains the beta-galactosidase gene from E. coli under control of a weak Drosophila promoter in the same orientation, followed by the polyadenylation signal of the polyhedrin gene .
  • the inserted genes are flanked on both sides by viral sequences for cell- mediated homologous recombination with wild-type viral DNA to generate viable virus that expresses the cloned polynucleotide.
  • baculovirus vectors are used in place of the vector above, such as pAc373, pVL941 and pAcIMl, as one skilled in the art would readily appreciate, as long as the construct provides appropriately located signals for transcription, translation, secretion and the like, including a signal peptide and an in-frame AUG as required.
  • Such vectors are described, for instance, in Luckow, et al . , Virology 170: 31-9 (1989).
  • the cDNA sequence encoding the mature LP123, LP127, or LP129 polypeptide in a clone, lacking the AUG initiation codon and the naturally associated nucleotide binding site, is amplified using PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the gene.
  • Non-limiting examples include 5' and 3' primers having nucleotides corresponding or complementary to a portion of the coding sequence of a LP123, LP127, or LP129 polypeptide, e.g., as presented in SEQ ID NO: 2, 4, or 6, according to known method steps .
  • the amplified fragment is isolated from a 1% agarose gel using a commercially available kit (e.g., "Geneclean, " BIO 101 Inc., La Jolla, CA) .
  • the fragment then is then digested with the appropriate restriction enzyme and again is purified on a 1% agarose gel. This fragment is designated herein "Fl.”
  • the plasmid is digested with the corresponding restriction enzymes and optionally, can be dephosphorylated using calf intestinal phosphatase, using routine procedures known in the art.
  • the DNA is then isolated from a 1% agarose gel using a commercially available kit ( "Geneclean, " BIO 101 Inc., La Jolla, CA) .
  • This vector DNA is designated herein "VI.”
  • Fragment Fl and the dephosphorylated plasmid VI are ligated together with T4 DNA ligase.
  • E. coli HB101 or other suitable E. coli hosts such as XL-1 Blue (Stratagene Cloning Systems, La Jolla, CA) cells are transformed with the ligation mixture and spread on culture plates.
  • Bacteria are identified that contain the plasmid bearing the human LP123, LP127, or LP129 gene using the PCR method, in which one of the primers that is used to amplify the gene and the second primer is from well within the vector so that only those bacterial colonies containing the LP123, LP127, or LP129 gene fragment will show amplification of the DNA.
  • the sequence of the cloned fragment is confirmed by DNA sequencing. This plasmid is designated herein as pBacLPl23, pBacLP127, or pBacLPl29.
  • plasmid pBacLPl23, pBacLP127, or pBacLPl29 Five ⁇ g of the plasmid pBacLPl23, pBacLP127, or pBacLPl29 is co-transfected with 1.0 ⁇ g of a commercially available linearized baculovirus DNA ( "BaculoGoldTM baculovirus DNA", Pharmingen, San Diego, CA) , using the lipofection method described by Feigner, et al . , Proc. Natl. Acad. Sci. USA 84: 7413-7 (1987).
  • baculovirus DNA "BaculoGoldTM baculovirus DNA”
  • 1 ⁇ g of BaculoGoldTM virus DNA and 5 ⁇ g of the plasmid pBacLPl23, pBacLPl27, or pBacLPl29 are mixed in a sterile well of a microtiter plate containing 50 ⁇ L of serum-free Grace's medium (Life Technologies, Inc., Rockville, MD) . Afterwards, 10 ⁇ L Lipofectin plus 90 ⁇ L Grace's medium are added, mixed and incubated for 15 minutes at room temperature. Then the transfection mixture is added drop-wise to Sf9 insect cells (ATCC CRL 1711) seeded in a 35mm tissue culture plate with 1 mL Grace's medium without serum.
  • Sf9 insect cells ATCC CRL 1711
  • the plate is rocked back and forth to mix the newly added solution.
  • the plate is then incubated for 5 hours at 27°C.
  • the transfection solution is removed from the plate and 1 mL of Grace's insect medium supplemented with 10% fetal calf serum is added.
  • the plate is put back into an incubator and cultivation is continued at 27°C for four days.
  • plaque assay After four days the supernatant is collected, and a plaque assay is performed.
  • An agarose gel with "Blue Gal” (Life Technologies, Inc., Rockville, MD) is used to allow easy identification and isolation of gal-expressing clones, which produce blue-stained plaques.
  • a detailed description of a "plaque assay” of this type can also be found in the user's guide for insect cell culture and baculovirology distributed by Life Technologies, Inc., Rockville, MD, pages 9-10) . After appropriate incubation, blue stained plaques are picked with a micropipettor tip (e.g., Eppendorf) .
  • the agar containing the recombinant viruses is then resuspended in a microcentrifuge tube containing 200 ⁇ L of Grace's medium, and the suspension containing the recombinant baculovirus is used to infect Sf9 cells seeded in 35mm dishes. Four days later the supernatants of these culture dishes are harvested, and then they are stored at 4°C.
  • the recombinant virus is called V-LP123, V-LP127, or V-LP129. To' verify the expression of the LP123, LP127, or LP129 gene, Sf9 cells are grown in Grace's medium supplemented with 10% heat-inactivated FBS .
  • the cells are infected with the recombinant baculovirus V-LP123, V-LP127, or V-LP129 at a multiplicity of infection ("MOI") of about 2.
  • MOI multiplicity of infection
  • the medium is removed and is replaced with SF900 II medium minus methionine and cysteine (available, e.g. , from Life Technologies, Inc., Rockville, MD) .
  • SF900 II medium minus methionine and cysteine (available, e.g. , from Life Technologies, Inc., Rockville, MD) .
  • radiolabeled polypeptides 42 hours later, 5 mCi of 35S- methionine and 5 Ci 35S-cysteine (available from Amersham) are added.
  • the cells are further incubated for 16 hours and then they are harvested by centrifugation.
  • polypeptides in the supernatant as well as the intracellular polypeptides are analyzed by SDS-PAGE followed by autoradiography (if radiolabeled) . Microsequencing of the amino acid sequence of the amino terminus of purified polypeptide can be used to determine the amino terminal sequence of the mature polypeptide and thus the cleavage point and length of the secretory signal peptide.
  • a typical mammalian expression vector contains at least one promoter element, which mediates the initiation of transcription of mRNA, the polypeptide coding sequence, and signals required for the termination of transcription and polyadenylation of the transcript. Additional elements include enhancers, Kozak sequences and intervening sequences flanked by donor and acceptor sites for RNA splicing. Highly efficient transcription can be achieved with the early and late promoters from SV40, the long terminal repeats (LTRS) from retroviruses, e.g., RSV, HTLVI, HIVI and the early promoter of the cytomegalovirus (CMV) . However, cellular elements can also be used (e.g., the human actin promoter) .
  • LTRS long terminal repeats
  • CMV cytomegalovirus
  • cellular elements can also be used (e.g., the human actin promoter) .
  • Suitable expression vectors for use in practicing the present invention include, for example, vectors such as pIRESlneo, pRetro-Off, pRetro-On, PLXSN, or pLNCX (Clonetech Labs, Palo Alto, CA) , pcDNA3.1 (+/-), pcDNA/Zeo (+/-) or pcDNA3.1/Hygro (+/-) (Invitrogen), PSVL and PMSG (Pharmacia, Uppsala, Sweden), pRSVcat (ATCC 37152), pSV2dhfr (ATCC 37146) and pBC12MI (ATCC 67109) .
  • vectors such as pIRESlneo, pRetro-Off, pRetro-On, PLXSN, or pLNCX (Clonetech Labs, Palo Alto, CA) , pcDNA3.1 (+/-), pcDNA/Zeo (+/-) or p
  • mammalian host cells include human Hela 293, H9 , Jurkat cells, mouse NIH3T3, C127 cells, Cos 1, Cos 7 and CV 1, quail QC1-3 cells, mouse L cells and Chinese hamster ovary (CHO) cells.
  • the gene is expressed in stable cell lines that contain the gene integrated into a chromosome.
  • a selectable marker such as DHRF (dihydrofolate reductase) , GPT neomycin, or hygromycin allows the identification and isolation of the transfected cells .
  • the transfected gene can also be amplified to express large amounts of the encoded polypeptide .
  • the DHFR marker is useful to develop cell lines that carry several hundred or even several thousand copies of the gene of interest.
  • Another useful selection marker is the enzyme glutamine synthase (GS) [Murphy, et al . , Biochem. J. 277 (Part 1): 277- 9 (1991); Bebbington, et al . , Bio/Technology 10(2): 169-175 (1992)].
  • GS glutamine synthase
  • the mammalian cells are grown in selective medium and the cells with the highest resistance are selected.
  • These cell lines contain the amplified gene(s) integrated into a chromosome. Chinese hamster ovary (CHO) and NSO cells are often used for the production of polypeptides.
  • the expression vectors pCl and pC4 contain the strong promoter (LTR) of the Rous Sarcoma Virus [Cullen, et al . , Mol. Cell. Biol. 5(3): 438-47 (1985)] plus a fragment of the CMV-enhancer [Boshart, et al . , Cell 41(2): 521-30 (1985)].
  • LTR Rous Sarcoma Virus
  • CMV-enhancer e.g., Cell 41(2): 521-30 (1985)
  • Multiple cloning sites e.g., with the restriction enzyme cleavage sites BamHI, Xbal and Asp718, facilitate the cloning of the gene of interest .
  • the vectors contain in addition the 3' intron, the polyadenylation and termination signal of the rat preproinsulin gene.
  • the expression plasmid, pLPl23 HA, pLPl27 HA, or pLPl29 HA is made by cloning a cDNA encoding LP123, LP127, or LP129 into the expression vector pcDNAI/Amp or pcDNAIII (which can be obtained from Invitrogen, Inc.).
  • the expression vector pcDNAI/amp contains: (1) an E. coli origin of replication effective for propagation in E. coli.
  • prokaryotic cells (2) an ampicillin resistance gene for selection of plasmid-containing prokaryotic cells; (3) an SV40 origin of replication for propagation in eukaryotic cells; (4) a CMV promoter, a polylinker, an SV40 intron; (5) several codons encoding a hemagglutinin fragment (i.e., an "HA" tag to facilitate purification) or HIS tag (see, e.g, Ausubel, supra) followed by a termination codon and polyadenylation signal arranged so that a cDNA can be conveniently placed under expression control of the CMV promoter and operably linked to the SV40 intron and the polyadenylation signal by means of restriction sites in the polylinker.
  • HA hemagglutinin fragment
  • HIS tag see, e.g, Ausubel, supra
  • the HA tag corresponds to an epitope derived from the influenza hemagglutinin polypeptide described by Wilson, et al . , Cell 37(3): 767-78 (1984) .
  • the fusion of the HA tag to the target polypeptide allows easy detection and recovery of the recombinant polypeptide with an antibody that recognizes the HA epitope.
  • pcDNAIII contains, in addition, the selectable neomycin marker.
  • a DNA fragment encoding the LP123, LP127, or LP129 is cloned into the polylinker region of the vector so that recombinant polypeptide expression is directed by the CMV promoter.
  • the plasmid construction strategy is as follows.
  • the LP123, LP127, or LP129 cDNA of a clone is amplified using primers that contain convenient restriction sites, much as described above for construction of vectors for expression of LP123, LP127, or LP129 in E. coli.
  • suitable primers include those based on the coding sequences presented in SEQ ID NO: 2, 4, or 6 as they encode LP123, LP127, or LP129 as described herein.
  • the PCR amplified DNA fragment and the vector, pcDNAI/Amp, are digested with suitable restriction enzyme (s) and then ligated.
  • the ligation mixture is transformed into E. coli strain SURE (available from Stratagene Cloning Systems, 11099 North Torrey Pines Road, La Jolla, CA 92037), and the transformed culture is plated on ampicillin media plates which then are incubated to allow growth of ampicillin resistant colonies. Plasmid DNA is isolated from resistant colonies and examined by restriction analysis or other means for the presence of the LP123-, LP127-, or LPl29-encoding fragment.
  • COS cells are transfected with an expression vector, as described above, using DEAE-DEXTRAN, as described, for instance, in Sambrook, et al . , Molecular Cloning: a Laboratory Manual, Cold Spring Laboratory Press, Cold Spring Harbor, New York (1989) . Cells are incubated under conditions for expression of LP123, LP127, or LP129 by the vector.
  • LP123-, LP127-, or LP129-HA fusion polypeptide is detected by radiolabeling and immunoprecipitation, using methods described in, for example Harlow, et al . , Antibodies: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (1988) . To this end, two days after transfection, the cells are labeled by incubation in media containing 35S- cysteine for 8 hours. The cells and the media are collected, and the cells are washed and lysed with detergent-containing RIPA buffer: 150.
  • Proteins are precipitated from the cell lysate and from the culture media using an HA- specific monoclonal antibody. The precipitated polypeptides are then analyzed by SDS-PAGE and autoradiography. An expression product of the expected size is seen in the cell lysate, which is not seen in negative controls.
  • Plasmid pC4 is used for the expression of LP123, LP127, or LP129 polypeptide.
  • Plasmid pC4 is a derivative of the plasmid pSV2-dhfr (ATCC Accession No. 37146) .
  • the plasmid contains the mouse DHFR gene under control of the SV40 early promoter.
  • Chinese hamster ovary cells or other cells lacking dihydrofolate activity that are transfected with these plasmids can be selected by growing the cells in a selective medium (alpha minus MEM, Life Technologies) supplemented with methotrexate.
  • MTX methotrexate
  • Plasmid pC4 contains for expressing the gene of interest the strong promoter of the long terminal repeat (LTR) of the Rous Sarcoma Virus [Cullen, et al . , Mol. Cell. Biol. 5(3): 438-47 (1985)] plus a fragment isolated from the enhancer of the immediate early gene of human cytomegalovirus (CMV) [Boshart, et al . , Cell 41(2): 521-30 (1985) ] .
  • LTR long terminal repeat
  • CMV cytomegalovirus
  • BamHI, Xbal, and Asp718 restriction enzyme cleavage sites that allow integration of the genes. Behind these cloning sites the plasmid contains the 3' intron and polyadenylation site of the rat preproinsulin gene.
  • Other high efficiency promoters can also be used for the expression, e.g., the human b-actin promoter, the SV40 early or late promoters or the long terminal repeats from other retroviruses, e.g., HIV and HTLVI .
  • Clontech's Tet-Off and Tet-On gene expression systems and similar systems can be used to express the
  • LP123, LP127, or LP129 in a regulated way in mammalian cells [M. Gossen, and H. Bujard, Proc. Natl. Acad. Sci. USA 89(12): 5547-51 (1992)].
  • Other signals e.g., from the human growth hormone or globin genes can be used as well.
  • Stable cell lines carrying a gene of interest integrated into the chromosomes can also be selected upon co-transfection with a selectable marker such as gpt, G418 or hygromycin. It is advantageous to use more than one selectable marker in the beginning, e.g., G418 plus methotrexate.
  • the plasmid pC4 is digested with restriction enzymes and then dephosphorylated using calf intestinal phosphatase by procedures known in the art.
  • the vector is then isolated from a 1% agarose gel .
  • the DNA sequence encoding the complete LP123, LP127, or LP129 polypeptide is amplified using PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the gene.
  • Non-limiting examples include 5' and 3' primers having nucleotides corresponding or complementary to a portion of the coding sequences of LP123, LP127, or LP129, e.g., as presented in SEQ ID NO: 2, 4, or 6, according to known method steps.
  • the amplified fragment is digested with suitable endonucleases and then purified again on a 1% agarose gel.
  • the isolated fragment and the dephosphorylated vector are then ligated with T4 DNA ligase.
  • E. coli HB101 or XL-1 Blue cells are then transformed and bacteria are identified that contain the fragment inserted into plasmid pC4 using, for instance, restriction enzyme analysis.
  • Chinese hamster ovary (CHO) cells lacking an active DHFR gene are used for transfection.
  • 5 ⁇ g of the expression plasmid pC4 is cotransfected with 0.5 ⁇ g of the plasmid pSV2-neo using lipofectin.
  • the plasmid pSV2-neo contains a dominant selectable marker, the neo gene from Tn5 encoding an enzyme that confers resistance to a group of antibiotics including G418.
  • the cells are seeded in alpha minus MEM supplemented with 1 ⁇ g/mL G418.
  • the cells are trypsinized and seeded in hybridoma cloning plates (Greiner, Germany) in alpha minus MEM supplemented with 10, 25, or 50 ng/mL of methotrexate plus 1 ⁇ g/mL G418. After about 10-14 days single clones are trypsinized and then seeded in 6-well petri dishes or 10 mL flasks using different concentrations of methotrexate (50 nM, 100 nM, 200 nM, 400 nM, 800 nM) .
  • Clones growing at the highest concentrations of methotrexate are then transferred to new 6-well plates containing even higher concentrations of methotrexate (1 mM, 2 mM, 5 mM, 10 mM, 20 mM) . The same procedure is repeated until clones are obtained which grow at a concentration of 100-200 mM. Expression of the desired gene product is analyzed, for instance, by SDS-PAGE and Western blot or by reversed-phase HPLC analysis.
  • Northern blot analysis is carried out to examine LP123, LP127, or LP129 gene expression in human tissues, using methods described by, among others, Sambrook, et al . , cited above.
  • a cDNA probe containing the entire nucleotide sequence of LP123, LP127, or LP129 polypeptide (SEQ ID N0:1, 3, or 5) is labeled with 32P using the RediprimeTM DNA labeling system (Amersham Life Science) , according to the manufacturer's instructions. After labeling, the probe is purified using a CHROMA SPIN-100TM column (Clontech Laboratories, Inc.), according to the manufacturer's protocol number PT1200-1. The purified and labeled probe is used to examine various human tissues for LP123, LP127, or LP129 mRNA.
  • MTN Multiple Tissue Northern
  • H human tissues
  • IM human immune system tissues

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The present invention provides nucleic acid sequences encoding novel huna LP123, LP127, and LP129 proteins. These novel nucleic acids are useful for constructing the claimed DNA vectors and host cells of the invention and for preparing the claimed recombinant proteins and antibodies that are useful in the claimed methods and medical uses.

Description

NUCLEIC ACIDS, VECTORS, HOST CELLS, POLYPEPTIDES and USES THEREOF
FIELD OF THE INVENTION The present invention relates to the identification and isolation of novel DNA, therapeutic uses and the recombinant production of novel polypeptides cloned from a normalized human bone marrow cDNA library, designated herein as LP123, LP127, and LP129 polypeptides. The present invention also relates to vectors, host cells, and antibodies directed to LP123, LP127, or LP129 polypeptides.
BACKGROUND OF THE INVENTION Extracellular proteins play an important role in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, e.g., proliferation, migration, differentiation, or interaction with other cells, is typically governed by information received from other cells and/or the immediate environme t. This information is often transmitted by secreted polypeptides (for instance, mitogenic factors, survival factors, cytotoxic factors, differentiation factors, neuropeptides, and hormones) which are, in turn, received and interpreted by diverse cell receptors or membrane-bound proteins. These secreted polypeptides or signaling molecules normally pass through the cellular secretory pathway to reach their site of action in the extracellular environment .
Secreted proteins have various industrial applications, including pharmaceuticals, diagnostics, biosensors and bioreactors. Most protein drugs available at present, such as thrombolytic agents, interferons, interleu ins, erythropoietins, colony stimulating factors, and various other cytokines, are secretory proteins. Their receptors, which are membrane proteins, also have potential as therapeutic or diagnostic agents . The present invention describes the cloning and characterization of novel proteins, termed LP123, LP127, and LP129, and active variants thereof. As such, it is believed that LP123, LP127, and LP129, and their variants play a regulatory role in hematopoiesis, tumorigenesis, metabolism, neurological and immune responses.
SUMMARY OF THE INVENTION The present invention provides isolated LP123, LP127, or LP129 nucleic acids and LP123, LP127, or LP129 polypeptides encoded thereby, including fragments and specified variants thereof. Contemplated by the present invention are LP123, LP127, or LP129 probes, primers, recombinant vectors, host cells, transgenic animals, chimeric antibodies and constructs, LP123, LP127, or LP129 epitope recognizing bodies, as well as methods of making and using them diagnostically and therapeutically as described and enabled herein.
The present invention includes isolated nucleic acid molecules comprising polynucleotides that encode LP123, LP127, or LP129 polypeptides as defined herein, as well as specified variants thereof, or isolated nucleic acid molecules that are complementary to polynucleotides that encode LP123, LP127, or LP129 polypeptides or specified variants thereof . Polypeptides of the present invention include isolated
LP123, LP127, or LP129 polypeptides comprising at least one fragment, domain, or specified variant of at least 90 to 100% of the contiguous amino acids of at least one portion of at least one of SEQ ID NO: 2, 4, and 6.
The present invention also provides isolated LP123, LP127, or LP129 polypeptides as described herein, wherein the polypeptides further comprise at least one specified substitution, insertion, or deletion, corresponding to portions or specific residues of at least one of SEQ ID NO: 2, 4, and 6.
The present invention also provides isolated nucleic acid probes, primers, or fragments, as described herein, wherein the nucleic acid comprises a polynucleotide of at least 10 nucleotides, corresponding or complementary to at least 10 nucleotides of at least one of SEQ ID NO:l, 3, and 5. The present invention also provides compositions, including pharmaceutical compositions, comprising LP123, LP127, or LP129 polypeptide, SEQ ID NO: 2, 4, or 6 epitope recognizing antibody, and/or nucleic acid wherein the composition has at least one activity including, but not limited to, promoting or inhibiting cell proliferation, hematopoiesis, lymphocyte proliferation, tumorigenesis, immune response, neurological and metabolic function.
A method of treatment or prophylaxis for cancer, heart disease, diabetes, neurological disorders, immune or hematological disorders can be effected with the polypeptides, nucleic acids, antibodies, vectors, host cells, transgenic cells, and/or compositions described. Accordingly, the present invention also includes methods for the prophylaxis or treatment of patho-physiological conditions in which at least one cell type involved in said condition is sensitive or responsive to a polypeptide, nucleic acid, antibody, host cell, transgenic cell, or composition of the present invention.
The present invention also provides a method for identifying compounds that bind LP123, LP127, or LP129 polypeptides, comprising admixing at least one isolated
LP123, LP127, or LP129 polypeptide as described herein with a test compound or composition, and detecting at least one binding interaction between the polypeptide and the compound or composition, optionally further comprising detecting a change in biological activity, such as a reduction or increase.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS Applicants have identified cDNA clones from a normalized human bone marrow library that encode novel polypeptides, designated in the present application as "LP123," "LP127," and "LP129." In one embodiment, the present invention provides isolated nucleic acid molecules comprising DNA encoding the LP123, LP127, or LP129 polypeptides. In another aspect, the isolated nucleic acids comprise DNA encoding the LP123 polypeptide having amino acid residues from about 1 through 85 of SEQ ID NO: 2 or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, high stringency conditions. In another aspect, the isolated nucleic acids comprise DNA encoding the LP127 polypeptide having amino acid residues from about 1 through 108 of SEQ ID NO: 4 or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, high stringency conditions. In another aspect, the isolated nucleic acids comprise DNA encoding the LP129 polypeptide having amino acid residues from about 1 through 71 of SEQ ID NO: 6 or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, high stringency conditions. The terms "LP123 polypeptide, " "LP127 polypeptide, "
"LP129 polypeptide," "LP123," "LP127," and "LP129" when used herein encompass native sequence LP123, LP127, or LP129 polypeptides and polypeptide variants thereof (which are further defined herein) . The LP123, LP127, or LP129 polypeptides may be isolated from a variety of sources, such as from human tissue types or from another source, or prepared by recombinant or synthetic methods .
A "native sequence LP123 polypeptide, " "native sequence LP127 polypeptide, " or "native sequence LP129 polypeptide" comprises a polypeptide having the same amino acid sequence as an LP123, LP127, or LP129 polypeptide derived from nature. Such native sequence LP123, LP127, or LP129 polypeptide can be isolated from nature or can be produced by recombinant or synthetic means . The term "native sequence LP123 polypeptide, " "native sequence LP127 polypeptide, " or "native sequence LP129 polypeptide" specifically encompasses naturally-occurring truncated or secreted forms of an LP123, LP127, or LP129 polypeptide, (e.g., soluble forms containing, for instance, an extracellular domain sequence) , naturally-occurring variant forms (e.g., alternatively spliced forms) and naturally- occurring allelic variants of an LP123, LP127, or LP129 polypeptide .
In one embodiment of the invention, the native sequence LP123 polypeptide is a full-length or mature native sequence LP123 polypeptide comprising amino acids 1 or 22 through 85 of SEQ ID NO:2. Also, while the LP123 polypeptides disclosed in SEQ ID NO: 2 are shown to begin with a methionine residue designated as amino acid position 1, it is conceivable and possible that another methionine residue located either upstream or downstream from amino acid position 1 in SEQ ID NO : 2 may be employed as the starting amino acid residue.
In another embodiment of the invention, the native sequence LP127 polypeptide is a full-length or mature native sequence LP127 polypeptide comprising amino acids 1 or 23 through 108 of SEQ ID NO: 4. While the LP127 polypeptides disclosed in SEQ ID NO: 4 are shown to begin with a methionine residue designated as amino acid position 1, it is conceivable and possible that another methionine residue located either upstream or downstream from amino acid position 1 in SEQ ID NO: 4 may be employed as the starting amino acid residue .
In one embodiment of the invention, the native sequence LP129 polypeptide is a full-length or mature native sequence LP129 polypeptide comprising amino acids 1 through 71 of SEQ ID NO: 6. While the LP129 polypeptides disclosed in SEQ ID
NO: 6 are shown to begin with a methionine residue designated as amino acid position 1, it is conceivable and possible that another methionine residue located either upstream or downstream from amino acid position 1 in SEQ ID NO: 6 may be employed as the starting amino acid residue.
"LP123 variant," "LP127 variant," and "LP129 variant" means an "active" LP123, LP127, or LP129 polypeptide as defined below, having at least about 90% amino acid sequence identity with the LP123, LP127, or LP129 polypeptide, having the deduced amino acid sequence of residues 1 or about 22 to about 85, shown in SEQ ID NO: 2, residues 1 or about 23 to about 108, shown in SEQ ID NO: 4, for a full-length or mature native sequence LP123 or LP127 polypeptide, respectively, or residues 1 to about 71, shown in SEQ ID NO: 6, for a full- length LP129 polypeptide. Such LP123, LP127, or LP129 polypeptide variants include, for instance, LP123, LP127, or LP129, wherein one or more amino acid residues are added, substituted or deleted, at the N- or C-terminus or within the sequence of SEQ ID NO:2, 4, or 6. Ordinarily, an LP123, LP127, or LP129 polypeptide variant will have at least about 90% sequence identity, preferably at least about 91% sequence identity, yet more preferably at least about 92% sequence identity, yet more preferably at least about 93% sequence identity, yet more preferably at least about 94% sequence identity, yet more preferably at least about 95% sequence identity, yet more preferably at least about 96% sequence identity, yet more preferably at least about 97% sequence identity, yet more preferably at least about 98% sequence identity, yet more preferably at least about 99% amino acid sequence identity with the amino acid sequence of SEQ ID NO: 2, 4, or 6 , with or without the signal peptide (e.g., with signal peptide amino acid residues 1 to 85 of
SEQ ID NO:2, without signal peptide about 22 to 85 of SEQ ID NO: 2; with signal peptide amino acid residues 1 to 108 of SEQ ID NO: 4, without signal peptide about 23 to 108 of SEQ ID NO: 4; without signal peptide about 1 to 71 of SEQ ID N0:6, respectively).
"Percent (%) amino acid sequence identity" with respect to the LP123, LP127, or LP129 amino acid sequences identified herein is defined as the percentage of amino acid residues in a candidate sequence that are identical with the amino acid residues in an LP123, LP127, or LP129 polypeptide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent amino acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as ALIGN, ALIGN-2 , Megalign (DNASTAR) or BLAST (e.g., Blast, Blast-2, WU-Blast-2) software. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. For example, the % identity values used herein are generated using WU-BLAST-2 [Altschul, et al., Methods in Enzymology 266: 460-80 (1996)]. Most of the WU-BLAST-2 search parameters are set to the default values. Those not set to default values, i.e., the adjustable parameters, are set with the following values: overlap span = 1; overlap fraction = 0.125; word threshold (T) = 11; and scoring matrix = BLOSUM 62. For purposes herein, a % amino acid sequence identity value is determined by dividing (a) the number of matching identical amino acid residues between the amino acid sequence of the LP123, LP127, or LP129 polypeptide of interest and the comparison amino acid sequence of interest (i.e., the sequence against which the LP123, LP127, or LP129 polypeptide of interest is being compared) as determined by WU-BLAST-2, by (b) the total number of amino acid residues of the LP123, LP127, or LP129 polypeptide of interest. An "LP123 variant polynucleotide, " "LP127 variant polynucleotide," and "LP129 variant polynucleotide," "LP123 variant nucleic acid sequence," "LP127 variant nucleic acid sequence, " or "LP129 variant nucleic acid sequence" means an active LP123, LP127, or LP129 polypeptide-encoding nucleic acid molecule as defined below having at least about 75% nucleic acid sequence identity with SEQ ID NO:l, 3, or 5 , respectively. Ordinarily, an LP123, LP127, or LP129 polypeptide will have at least about 75% nucleic acid sequence identity, more preferably at least about 80% nucleic acid sequence identity, yet more preferably at least about 81% nucleic acid sequence identity, yet more preferably at least about 82% nucleic acid sequence identity, yet more preferably at least about 83% nucleic acid sequence identity, yet more preferably at least about 84% nucleic acid sequence identity, yet more preferably at least about 85% nucleic acid sequence identity, yet more preferably at least about 86% nucleic acid sequence identity, yet more preferably at least about 87% nucleic acid sequence identity, yet more preferably at least about 88% nucleic acid sequence identity, yet more preferably at least about 89% nucleic acid sequence identity, yet more preferably at least about 90% nucleic acid sequence identity, yet more preferably at least about 91% nucleic acid sequence identity, yet more preferably at least about 92% nucleic acid sequence identity, yet more preferably at least about 93% nucleic acid sequence identity, yet more preferably at least about 94% nucleic acid sequence identity, yet more preferably at least about 95% nucleic acid sequence identity, yet more preferably at least about 96% nucleic acid sequence identity, yet more preferably at least about 97% nucleic acid sequence identity, yet more preferably at least about 98% nucleic acid sequence identity, yet more preferably at least about 99% nucleic acid sequence identity with the nucleic acid sequence of nucleotides about 20 or about 83 to about 274 of the LP123- encoding nucleotide sequence shown in SEQ ID NO:l; about 311 or about 377 to about 634 of the LPl27-encoding nucleotide sequence shown in SEQ ID NO : 3 ; or about 246 to about 458 of the LPl29-encoding nucleotide sequence shown in SEQ ID NO : 5 , respectively. Variants specifically exclude or do not encompass the native nucleotide sequence, as well as those prior art sequences that share 100% identity with the nucleotide sequences of the invention.
"Percent (%) nucleic acid sequence identity" with respect to the LP123, LP127, or LP129 sequences identified herein is defined as the percentage of nucleotides in a candidate sequence that are identical with the nucleotides in the LP123, LP127, or LP129 sequence after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. Alignment for purposes of determining percent nucleic acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as ALIGN, Align-2, Megalign (DNASTAR) , or BLAST (e.g., Blast, Blast-2) software. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. For purposes herein, however, % nucleic acid identity values are generated using the WU-BLAST-2 (BlastN module) computer program (Altschul, et al . , Methods in Enzymology 266: 460-80 (1996)). Most of the WU-BLAST-2 search parameters are set to the default values . Those not set default values, i.e., the adjustable parameters, are set with the following values: overlap span = 1; overlap fraction = 0.125; word threshold (T) = 11; and scoring matrix = BLOSUM62. For purposes herein, a % nucleic acid sequence identity value is determined by dividing (a) the number of matching identical nucleotides between the nucleic acid sequence of the LP123, LP127, or LP129 polypeptide- encoding nucleic acid molecule of interest and the comparison nucleic acid molecule of interest (i.e., the sequence against which the LP123, LP127, or LP129 polypeptide-encoding nucleic acid molecule of interest is being compared) as determined by WU-BLAST-2, by (b) the total number of nucleotides of the LP123, LP127, or LP129 polypeptide-encoding nucleic acid molecule of interest. In other embodiments, the LP123, LP127, or LP129 variant polypeptides are nucleic acid molecules that encode an active LP123, LP127, or LP129 polypeptide and which are capable of hybridizing, preferably under stringent hybridization and wash conditions, to nucleotide sequences encoding the full-length LP123, LP127, or LP129 polypeptide shown in SEQ ID NO: 2, 4, or 6, respectively. This scope of variant polynucleotides specifically excludes those sequences that are known as of the filing and/or priority dates of the present application. The term "mature protein" or "mature polypeptide" as used herein refers to the form(s) of the protein produced by expression in a mammalian cell. It is generally hypothesized that once export of a growing protein chain across the rough endoplasmic reticulum has been initiated, proteins secreted by mammalian cells have a signal peptide
(SP) sequence which is cleaved from the complete polypeptide to produce a "mature" form of the protein. Oftentimes, cleavage of a secreted protein is not uniform and may result in more than one species of mature protein. The cleavage site of a secreted protein is determined by the primary amino acid sequence of the complete protein and generally cannot be predicted with complete accuracy. Methods for predicting whether a protein has an SP sequence, as well as the cleavage point for that sequence, are available. A cleavage point may exist within, the N-terminal domain between amino acid 10 and amino acid 35. More specifically the cleavage point is likely to exist after amino acid 15 but before amino acid 30, more likely after amino acid 20 but before amino acid 25, and most likely after amino acid 21 and before amino acid 22, as presented in SEQ ID NO: 2, after amino acid 22 and before amino acid 23, as presented in SEQ ID NO: 4, respectively. Although no SP has been predicted for LP129, a signal peptide may be present. As one of ordinary skill would appreciate, cleavage sites sometimes vary from organism to organism and cannot be predicted with absolute certainty. Optimally, cleavage sites for a secreted protein are determined experimentally by amino- erminal sequencing of the one or more species of mature proteins found within a purified preparation of the protein.
The term "positives", in the context of sequence comparison performed as described above, includes residues in the sequences compared that are not identical but have similar properties (e.g., as a result of conservative substitutions) . The % identity value of positives is determined by the fraction of residues scoring a positive value in the BLOSUM 62 matrix. This value is determined by dividing (a) the number of amino acid residues scoring a positive value in the BLOSUM62 matrix of WU-BLAST-2 between the LP123, LP127, or LP129 polypeptide amino acid sequence of interest and the comparison amino acid sequence (i.e., the amino acid sequence against which the LP123, LP127, or
LP129 polypeptide sequence is being compared) as determined by WU-BLAST-2, by (b) the total number of amino acid residues of the LP123, LP127, or LP129 polypeptide of interest .
"Isolated, " when used to describe the various polypeptides disclosed herein, means a polypeptide that has been identified and separated and/or recovered from a component of its natural environment. Preferably, the isolated polypeptide is free of association with all components with which it is naturally associated. Contaminant components of its natural environment are materials that would typically interfere with diagnostic or therapeutic uses for the polypeptide and may include enzymes, hormones, and other proteinaceous or non- proteinaceous solutes. In preferred embodiments, the polypeptide will be purified (1) to a degree sufficient to obtain at least 15 residues of N-terminal or internal amino acid sequence by use of a spinning cup sequenator, or (2) to homogeneity by SDS-PAGE under non-reducing or reducing conditions using Coomassie blue or, preferably, silver stain. Isolated polypeptide includes polypeptide in situ within recombinant cells, since at least one component of the LP123, LP127, or LP129 polypeptide natural environment will not be present. Ordinarily, however, isolated polypeptide will be prepared by at least one purification step. An "isolated" LP123, LP127, or LP129 polypeptide- encoding nucleic acid molecule is a nucleic acid molecule that is identified and separated from at least one contaminant nucleic acid molecule with which it is ordinarily associated in the natural source of the LP123, LP127, or LP129 polypeptide-encoding nucleic acid. An isolated LP123, LP127, or LP129 polypeptide-encoding nucleic acid molecule is other than in the form or setting in which it is found in nature. Isolated LP123, LP127, or LP129 polypeptide-encoding nucleic acid molecules therefore are distinguished from the LP123, LP127, or LP129 polypeptide- encoding nucleic acid molecule as it exists in natural cells. However, an isolated LP123, LP127, or LP129 polypeptide-encoding nucleic acid molecule includes LP123, LP127, or LP129 polypeptide encoding nucleic acid molecules contained in cells that ordinarily express LP123, LP127, or LP129 polypeptide where, for example, the nucleic acid molecule is in a chromosomal location different from that of natural cells .
Nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For example, DNA for a presequence or secretory leader is operably linked to DNA for a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide; a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation. Generally, "operably linked" means that the DNA sequences being linked are contiguous, and, in the case of a secretory leader, contiguous and in reading phase. However, enhancers do not have to be contiguous. Linking is accomplished by ligation at convenient restriction sites. If such sites do not exist, the synthetic oligonucleotide adaptors or linkers are used in accordance with conventional practice.
The term "amino acid" is used herein in its broadest sense, and includes naturally occurring amino acids as well as non-naturally occurring amino acids, including amino acid analogs and derivatives . The latter includes molecules containing an amino acid moiety. One skilled in the art will recognize, in view of this broad definition, that reference herein to an amino acid includes, for example, naturally occurring proteogenic L-amino acids; D-amino acids; chemically modified amino acids, such as amino acid analogs and derivatives; naturally occurring non-proteogenic amino acids such as norleucine, β-alanine, ornithine, etc.; and chemically synthesized compounds having properties known in the art to be characteristic of amino acids. As used herein, the term "proteogenic" indicates that the amino acid can be incorporated into a peptide, polypeptide, or protein in a cell through a metabolic pathway.
"Stringency" of hybridization reactions is readily determinable by one of ordinary skill in the art, and generally is an empirical calculation dependent upon probe length, washing temperature, and salt concentration. In general, longer probes required higher temperatures for proper annealing, while short probes need lower temperatures. Hybridization generally depends on the ability of denatured DNA to reanneal when complementary strands are present in an environment below their melting temperature. The higher the degree of desired homology between the probe and hybridizable sequence, the higher the relative temperature that can be used. As a result, it follows that higher relative temperatures would tend to make the reactions more stringent, while lower temperatures less so. For additional details and explanation of stringency of hybridization reactions, see Ausubel, et al . , Current Protocols in Molecular Biology, Wiley Interscience Publishers (1995) .
"Stringent conditions" or "high stringency conditions", as defined herein, may be identified by those that (1) employ low ionic strength and high temperature for washing, for example, 15 mM sodium chloride/1.5 mM sodium citrate/0.1% sodium dodecyl sulfate at 50°C; (2) employ during hybridization a denaturing agent, such as formamide, for example, 50% (v/v) formamide with 0.1% bovine serum albumin/0.1% ficoll/0.1% polyvinylpyrrolidone/50 mM sodium phosphate buffer at pH 6.5 with 750 mM sodium chloride/75 mM sodium citrate at 42°C; or (3) employ 50% formamide, 5X SSC (750 mM sodium chloride, 75 mM sodium citrate) , 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5X Denhardt's solution, sonicated salmon sperm DNA (50 μg/mL) , 0.1% SDS, and 10% dextran sulfate at 42°C with washes at 42°C in 0.2X SSC (30 mM sodium chloride/3 mM sodium citrate) and 50% formamide at 55°C, followed by a high-stringency wash consisting of 0. IX SSC containing EDTA at 55°C.
"Moderately stringent conditions" may be identified as described by Sambrook, et al . [Molecular Cloning: A Laboratory Manual, New York: Cold Spring Harbor Press, (1989)], and include the use of washing solution and hybridization conditions (e.g., temperature, ionic strength and %SDS) less stringent than those described above. An example of moderately stringent conditions is overnight incubation at 37°C in a solution comprising: 20% formamide, 5X SSC (750 mM sodium chloride, 75 mM sodium citrate) , 50 mM sodium phosphate at pH 7.6, 5X Denhardt's solution, 10% dextran sulfate, and 20 mg/mL denatured sheared salmon sperm DNA, followed by washing the filters in IX SSC at about 37- 50°C. The skilled artisan will recognize how to adjust the temperature, ionic strength, etc., as necessary to accommodate factors such as probe length and the like.
The term "epitope tagged" where used herein refers to a chimeric polypeptide comprising an LP123, LP127, or LP129 polypeptide, or domain sequence thereof, fused to a "tag polypeptide." The tag polypeptide has enough residues to provide an epitope against which an antibody may be made, or which can be identified by some other agent, yet is short enough such that it does not interfere with the activity of the LP123, LP127, or LP129 polypeptide. The tag polypeptide preferably is also fairly unique so that the antibody does not substantially cross-react with other epitopes . Suitable tag polypeptides generally have at least six amino acid residues and usually between about 8 to about 50 amino acid residues (preferably, between about 10 to about 20 residues) .
As used herein, the term "immunoadhesin, " sometimes referred to as an Fc fusion, designates antibody-like molecules that combine the binding specificity of a heterologous protein (an "adhesin") with the effector functions of immunoglobulin constant domains. Structurally, the immunoadhesins comprise a fusion of an amino acid sequence with the desired binding specificity which is other than the antigen recognition and binding site of an antibody (i.e., is "heterologous") and an immunoglobulin constant domain sequence. The adhesin part of an immunoadhesin molecule typically is a contiguous amino acid sequence comprising at least the binding site of a receptor or a ligand. The immunoglobulin constant domain sequence in the immunoadhesin may be obtained from any immunoglobulin, such as IgG-1, IgG-2, IgG-3 or IgG-4 subtypes, IgA (including IgA-1 and IgA-2), IgE, IgD or IgM.
"Active" or "activity" for the purposes herein refers to form(s) of LP123, LP127, or LP129 which retain the biologic and/or immunologic activities of native or naturally-occurring LP123, LP127, or LP129 polypeptide. Elaborating further, "biological" activity refers to a biological function (either inhibitory or stimulatory) caused by a native or naturally occurring LP123, LP127, or LP129 polypeptide other than the ability to induce the production of an antibody against an antigenic epitope possessed by a native or naturally occurring LP123, LP127, or LP129 polypeptide. An "immunological" activity refers only to the ability to induce the production of an antibody against an antigenic epitope possessed by a native or naturally occurring LP123, LP127, or LP129 polypeptide.
"Medical disorder" describes a host of disorders that are characterized principally by uncontrolled cell proliferation, immune response, or abnormal neurological, hematological, or metabolic activity. Exemplary disorders encompassed within this definition include, but are not limited to, cancer, heart disease, stroke, diabetes, Alzheimer's, multiple sclerosis, and Parkinson's disease.
The term "antagonist" is used in the broadest sense and includes any molecule that partially or fully blocks, inhibits, or neutralizes a biological activity of a native LP123, LP127, or LP129 polypeptide disclosed herein. In a similar manner, the term "agonist" is used in the broadest sense and includes any molecule that mimics a biological activity of a native LP123, LP127, or LP129 polypeptide disclosed herein. Suitable agonist or antagonist molecules specifically include agonist or antagonist antibodies or antibody fragments, fragments or amino acid sequence variants of native LP123, LP127, or LP129 polypeptides, peptides, small organic molecules, etc. Methods for identifying agonists or antagonists of an LP123, LP127, or LP129 polypeptide may comprise contacting an LP123, LP127, or LP129 polypeptide with a candidate agonist or antagonist molecule and measuring a detectable change in one or more biological activities normally associated with the LP123, LP127, or LP129 polypeptide.
"Antibodies" (Abs) and "immunoglobulins" (Igs) are glycoproteins having the same structural characteristics. While antibodies exhibit binding specificity to a specific antigen, immunoglobulins include both antibodies and other antibody-like molecules that lack antigen specificity. Polypeptides of the latter kind are, for example, produced at low levels by the lymph system and at increased levels by myelomas. The term "antibody" is used in the broadest sense and specifically covers, without limitation, intact monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies) formed from at least two intact antibodies', and antibody fragments so long as they exhibit the desired biological activity.
The terms "treating, " "treatment" and "therapy" as used herein refer to curative therapy, prophylactic therapy, and preventive therapy. An example of "preventive therapy" is the prevention or lessened targeted pathological condition or disorder. Those in need of treatment include those already with the disorder as well as those prone to have the disorder or those in whom the disorder is to be prevented. "Chronic" administration refers to administration of the agent (s) in a continuous mode as opposed to an acute mode, so as to maintain the initial therapeutic effect (activity) for an extended period of time. "Intermittent" administration is treatment that is not consecutively done without interruption but, rather, is cyclic in nature. Administration "in combination with" one or more further therapeutic agents includes simultaneous (concurrent) and consecutive administration in any order. A "therapeutically-effective amount" is the minimal amount of active agent (e.g., an LP123, LP127, or LP129 polypeptide, antagonist or agonist thereof) which is necessary to impart therapeutic benefit to a mammal. For example, a "therapeutically-effective amount" to a mammal suffering or prone to suffering or to prevent it from suffering from a medical disorder is such an amount which induces, ameliorates or otherwise causes an improvement in the pathological symptoms, disease progression, physiological conditions associated with or resistance to succumbing to a disorder principally characterized by uncontrolled cell proliferation, immune response, or abnormal neurological, hematological, or metabolic activity. "Carriers" as used herein include pharmaceutically- acceptable carriers, excipients, or stabilizers which are nontoxic to the cell or mammal being exposed thereto at the dosages and concentrations employed. Often the physiologically-acceptable carrier is an aqueous pH buffered solution. Examples of physiologically acceptable carriers include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid; low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and/or nonionic surfactants such as TWEEN™, polyethylene glycol (PEG), and PLURONIC™. "Antibody fragments" comprise a portion of an intact antibody, preferably the antigen binding or variable region of the intact antibody. Examples of antibody fragments include Fab, Fab', F(ab')2 and Fv fragments; diabodies; linear antibodies [Zapata, et al . , Protein Engin. 8(10): 1057-62 (1995)]; single-chain antibody molecules; and multispecific antibodies formed from antibody fragments.
"Fv" is the minimum antibody fragment which contains a complete antigen-recognition and binding site. This region consists of a dimer of one heavy- and one light-chain variable domain in tight, non-covalent association. It is in this configuration that the three CDRs of each variable domain interact to define an antigen-binding site on the surface of the VH-VL dimer. Collectively, the six CDRs confer antigen-binding specificity to the antibody.
However, even a single variable domain (or half of an Fv comprising only three CDR specific for an antigen) has the ability to recognize and bind antigen, although at a lower affinity than the entire binding site. "Single-chain Fv" or "sFv" antibody fragments comprise the VH and VL domains of antibody, wherein these domains are present in a single polypeptide chain. Preferably, the Fv polypeptide further comprises a polypeptide linker between the VH and VL domain, which enables the sFv to form the desired structure for antigen binding. For a review of sFv, see Pluckthun, The Pharmacology of Monoclonal Antibodies, vol. 113, Rosenburg and Moore, eds., Springer-Verlag, New York, pp. 269-315 (1994).
The term "diabodies" refers to small antibody fragments with two antigen-binding sites, which fragments comprise a heavy-chain variable domain (VH) connected to a light-chain variable domain (VL) in the same polypeptide chain (VH-VL) . By using a linker that is too short to allow pairing between the two domains on the same chain, the domains are forced to pair with the complementary domains of another chain and create two antigen-binding sites. Diabodies are described more fully in, for example, EP 404,097, WO 93/11161; and Hollinger, et al . , Proc. Natl. Acad. Sci. USA 90: 6444-48 (1993) .
An "isolated" antibody is one which has been identified and separated and/or recovered from a component of its natural environment. Contaminant components of its natural environment are materials which would interfere with diagnostic or therapeutic uses for the antibody, and may include enzymes, hormones, and other proteinaceous or non- proteinaceous solutes. In preferred embodiments, the antibody will be purified (1) to greater than 95% by weight of antibody as determined by the Lowry method, and most preferably more than 99% by weight, (2) to a degree sufficient to obtain at least 15 residues of N-terminal or internal amino acid sequence by use of a spinning cup sequenator, or (3) to homogeneity by SDS-PAGE under reducing or nonreducing conditions using Coomassie blue, or preferably, silver stain. Isolated antibody includes the antibody in situ within recombinant cells since at least one component of the antibody's natural environment will not be present. Ordinarily, however, isolated antibody will be prepared by at least one purification step.
A "liposome" is a small vesicle composed of various types of lipids, phospholipids and/or surfactant which is useful for delivery of a drug (such as an LP123, LP127, or LP129 polypeptide or antibody thereto) to a mammal. The components of the liposome are commonly arranged in a bilayer formation, similar to the lipid arrangement of biological membranes .
A "small molecule" is defined herein to have a molecular weight below about 500 daltons. The term "modulate" means to affect (e.g., either upregulate, downregulate or otherwise control) the level of a signaling pathway. Cellular processes under the control of signal transduction include, but are not limited to, transcription of specific genes, normal cellular functions, such as metabolism, proliferation, differentiation, adhesion, apoptosis and survival, as well as abnormal processes, such as transformation, blocking of differentiation and metastasis.
The LP123, LP127, or LP129 polynucleotide can be composed of any polyribonucleotide or polydeoxy- ribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA. For example, the LP123, LP127, or LP129 polynucleotides can be composed of single- and double- stranded DNA, DNA that is a mixture of single- and double- stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single- stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions. In addition, the LP123, LP127, or LP129 polynucleotides can be composed of triple-stranded regions comprising RNA or DNA or both RNA and DNA. LP123, LP127, or LP129 polynucleotides may also contain one or more modified bases or DNA or RNA backbones modified for stability or for other reasons. "Modified" bases include, for example, tritylated bases and unusual bases such as inosine. A variety of modifications can be made to DNA and RNA; thus, "polynucleotide" embraces chemically, enzymatically, or metabolically modified forms. LP123, LP127, or LP129 polypeptides can be composed of amino acids joined to each other by peptide bonds or modified peptide bonds, i.e., peptide isosteres, and may contain amino acids other than the gene-encoded amino acids. The LP123, LP127, or LP129 polypeptides may be modified by either natural processes, such as post-translational processing, or by chemical modification techniques which are well known in the art. Such modifications are well described in basic texts and in more detailed monographs, as well as in a voluminous research literature. Modifications can occur anywhere in the LP123, LP127, or LP129 polypeptides, including the peptide backbone, the amino acid side-chains and the amino or carboxyl termini. It will be appreciated that the same type of modification may be present in the same or varying degrees at several sites in a given LP123, LP127, or LP129 polypeptide. Also, a given LP123, LP127, or LP129 polypeptide may contain many types of modifications. LP123, LP127, or LP129 polypeptides may be branched, for example, as a result of ubiquitination, and they may be cyclic, with or without branching. Cyclic, branched, and branched cyclic LP123, LP127, or LP129 polypeptides may result from post-translation natural processes or may be made by synthetic methods.
Modifications include acetylation, acylation, ADP- ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphotidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of covalent cross- links, formation of cystine, formation of pyroglutamate, formylation, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, pegylation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer-RNA mediated addition of amino acids to proteins such as arginylation, and ubiquitination. See, for instance, Creighton, Proteins - Structure and Molecular Properties, 2nd Ed., W. H. Freeman and Company, New York (1993) ; Johnson, Post-transational
Covalent Modification of Proteins, Academic Press, New York, pp. 1-12 (1983); Seifter, et al . , Meth. Enzymol. 182: 626-46 (1990); Rattan, et al . , Ann. NY Acad. Sci. 663: 48-62 (1992) . Variations in the native full-length sequence LP123, LP127, or LP129 or in various domains of the LP123, LP127, or LP129 polypeptide described herein can be made, for example, using any of the techniques and guidelines for conservative and non-conservative mutations set forth, for instance, in U.S. Patent No. 5,364,934. Variations may be a substitution, deletion or insertion of one or more codons encoding LP123, LP127, or LP129 polypeptide that results in a change in the amino acid sequence of the LP123, LP127, or LP129 polypeptide as compared with the native sequence LP123, LP127, or LP129 polypeptide. Optionally, the variation is by substitution of at least one amino acid with any other amino acid in one or more of the domains of the LP123, LP127, or LP129 polypeptide. Guidance in determining which amino acid residue may be inserted, substituted or deleted without adversely affecting the desired activity may be found by comparing the sequence of the LP123., LP127, or LP129 polypeptide with that of homologous known protein molecules and minimizing the number of amino acid sequence changes made in regions of high homology. Amino acid substitutions can be the result of replacing one amino acid with another amino acid having similar structural and/or chemical properties, such as the replacement of a leucine with a serine, i.e., conservative amino acid replacements. Insertions or deletions may optionally be in the range of 1 to 5 amino acids. The variation allowed may be determined by systematically making insertions, deletions or substitutions of amino acids in the sequence and testing the resulting variants for activity (such as in any of the in vitro assays described herein) for activity exhibited by the full-length or mature native sequence.
LP123, LP127, or LP129 polypeptide fragments are provided herein. Such fragments may be truncated at the N- terminus or C-terminus, or may lack internal residues, for example, when compared with a full-length or native protein. Certain fragments lack amino acid residues that are not essential for a desired biological activity of the LP123, LP127, or LP129 polypeptide.
LP123, LP127, or LP129 fragments may be prepared by any of a number of conventional techniques . Desired peptide fragments may be chemically synthesized. An alternative approach involves generating LP123, LP127, or LP129 fragments by enzymatic digestion, e.g., by treating the protein with an enzyme known to cleave proteins at sites defined by particular amino acid residues, or by digesting the DNA with suitable restriction enzymes and isolating the desired fragment. Yet another suitable technique involves isolating and amplifying a DNA fragment encoding a desired polypeptide fragment by polymerase chain reaction (PCR) . Oligonucleotides that define the desired termini of the DNA fragment are employed at the 5' and 3' primers in the PCR. Preferably, LP123, LP127, or LP129 polypeptide fragments share at least one biological and/or immunological activity with the native LP123, LP127, or LP129 polypeptide shown in SEQ ID NO:2, 4, or 6.
Covalent modifications of LP123, LP127, or LP129 polypeptides are included within the scope of this invention. One type of covalent modification includes reacting targeted amino acid residues of an LP123, LP127, or LP129 polypeptide with an organic derivatizing agent that is capable of reacting with selected side chains or the N- or C-terminal residues of an LP123, LP127, or LP129 polypeptide. Derivatization with bifunctional agents is useful, for instance, for crosslinking LP123, LP127, or LP129 to a water-insoluble support matrix or surface for use in the method for purifying anti-LPl23, -LP127, or -LP129 antibodies, and vice-versa. Commonly used crosslinking agents include, e.g., 1, 1-bis (diazoacetyl) -2-phenylethane, glutaraldehyde, N-hydroxysuccinimide esters, for example, esters with 4-azidosalicylic acid, homobifunctional i idoesters, including disuccinimidyl esters such as 3,3'- dithiobis- (succinimidylpropionate) , bifunctional maleimides such as bis-N-maleimido-1, 8-octane and agents such as methyl-3- [ (p-azidophenyl) -dithio]propioimidate. Other modifications include deamidation of glutaminyl and asparaginyl residues to the corresponding glutamyl and aspartyl residues, respectively, hydroxylation of proline and lysine, phosphorylation of hydroxyl groups of seryl or threonyl residues, methylation of the alpha-amino groups of lysine, arginine, and histidine side chains [T.E. Creighton, Proteins: Structure and Molecular Properties, W.H. Freeman & Co., San Francisco, pp. 79-86 (1983)], acetylation of the N- terminal amine, and amidation of any C-terminal carboxyl group .
Another type of covalent modification of the LP123, LP127, or LP129 polypeptide included within the scope of this invention comprises altering the native glycosylation pattern of the polypeptide. "Altering the native glycosylation pattern" is intended for purposes herein to mean deleting one or more carbohydrate moieties found in native sequence LP123, LP127, or LP129 polypeptide and/or adding one or more glycosylation sites that are not present in the native sequence LP123, LP127, or LP129 polypeptide. Additionally, the phrase includes qualitative changes in the glycosylation of the native proteins, involving a change in the nature and proportions of the various carbohydrate moieties present.
Addition of glycosylation sites to LP123, LP127, or LP129 polypeptides may be accomplished by altering the amino acid sequence thereof. The alteration may be made, for example, by the addition of, or substitution by, one or more serine or threonine residues to the native sequence LP123, LP127, or LP129 polypeptide (for 0-linked glycosylation sites) . The LP123, LP127, or LP129 amino acid sequence may optionally be altered through changes at the DNA level, particularly by mutating the DNA encoding the LP123, LP127, or LP129 polypeptide at preselected bases such that codons are generated that will translate into the desired amino acids .
Another means of increasing the number of carbohydrate moieties on the LP123, LP127, or LP129 polypeptide is by chemical or enzymatic coupling of glycosides to the polypeptide. Such methods are described in the art, e.g., in WO 87/05330, published 11 September 1987, and in Aplin and Wriston, CRC Crit. Rev. Biochem., pp. 259-306 (1981).
Removal of carbohydrate moieties present on the LP123, LP127, or LP129 polypeptide may be accomplished chemically or enzymatically or by mutational substitution of codons encoding for amino acid residues that serve as targets for glycosylation. Chemical deglycosylation techniques are known in the art and described, for instance, by Sojar, et al., Arch. Biochem. Biophys. 259: 52-7 (1987) and by Edge, et al., Anal. Biochem. 118: 131-7 (1981). Enzymatic cleavage of carbohydrate moieties on polypeptides can be achieved by the use of a variety of endo- and exo- glycosidases as described by Thotakura, et al . , Meth. Enzymol. 138: 350-9 (1987). Another type of covalent modification of LP123, LP127, or LP129 comprises linking the LP123, LP127, or LP129 polypeptide to one of a variety of nonproteinaceous polymers, e.g., polyethylene glycol, polypropylene glycol, or polyoxyalkylenes, in the manner set forth in U.S. Patent Nos. 4,640,835; 4,496,689; 4,301,144; 4,670,417; 4,791,192 or 4,179,337.
LP123, LP127, or LP129 polypeptides of the present invention may also be modified in a way to form chimeric molecules comprising an LP123, LP127, or LP129 polypeptide fused to another heterologous polypeptide or amino acid sequence. In one embodiment, such a chimeric molecule comprises a fusion of an LP123, LP127, or LP129 polypeptide with a tag polypeptide which provides an epitope to which an anti-tag antibody can selectively bind. The epitope tag is generally placed at the amino- or carboxyl-terminus of the LP123, LP127, or LP129 polypeptide. The presence of such epitope-tagged forms of an LP123, LP127, or LP129 polypeptide can be detected using an antibody against the tag polypeptide. Also, provision of the epitope tag enables the LP123, LP127, or LP129 polypeptide to be readily purified by affinity purification using an anti-tag antibody or another type of affinity matrix that binds to the epitope tag.
In an alternative embodiment, the chimeric molecule may comprise a fusion of an LP123, LP127, or LP129 polypeptide with an immunoglobulin or a particular region of an immunoglobulin. For a bivalent form of the chimeric molecule, such a fusion could be to the Fc region of an IgG molecule. The Ig fusions preferably include the substitution of a soluble transmembrane domain deleted or inactivated form of an LP123, LP127, or LP129 polypeptide in place of at least one variable region within an Ig molecule. In a particularly preferred embodiment, the immunoglobulin fusion includes the hinge, CH2 and CH3 or the hinge, CHI, CH2 and CH3 regions of an IgGl molecule. For the production of immunoglobulin fusions, see also U.S. Patent 5,428,130. In yet a further embodiment, the LP123, LP127, or LP129 polypeptides of the present invention may also be modified in a way to form a chimeric molecule comprising an LP123, LP127, or LP129 polypeptide fused to a leucine zipper. Various leucine zipper polypeptides have been described in the art. See, -e.g., Landschulz, et al . , Science 240(4860): 1759-64 (1988); WO 94/10308; Hoppe, et al . , FEBS Letters 344(2-3): 191-5 (1994); Abel, et al . , Nature 341(6237): 24- 5 (1989) . It is believed that use of a leucine zipper fused to an LP123, LP127, or LP129 polypeptide may be desirable to assist in dimerizing or trimerizing soluble LP123, LP127, or
LP129 polypeptide in solution. Those skilled in the art will appreciate that the leucine zipper may be fused at either the N- or C-terminal end of the LP123, LP127, or LP129 molecule.
The description below relates primarily to production of LP123, LP127, or LP129 by culturing cells transformed or transfected with a vector containing LP123, LP127, or LP129 polypeptide encoding nucleic acid. It is, of course, contemplated that alternative methods, which are well known in the art, may be employed to prepare LP123, LP127, or LP129 polypeptides. For instance, the LP123, LP127, or LP129 sequence, or portions thereof, may be produced by direct peptide synthesis using solid-phase techniques [see, e.g., Stewart, et al . , Solid-Phase Peptide Synthesis, W.H. Freeman Co., San Francisco, CA (1969); Merrifield, J. Am. Chem. Soc. 85: 2149-2154 (1963)]. In vitro protein synthesis may be performed using manual techniques or by automation. Automated synthesis may be accomplished, for instance, using an Applied Biosystems Peptide Synthesizer (Foster City, CA) using manufacturer's instructions. Various portions of LP123, LP127, or LP129 polypeptides may be chemically synthesized separately and combined using chemical or enzymatic methods to produce a full-length LP123, LP127, or LP129 polypeptide.
DNA encoding an LP123, LP127, or LP129 polypeptide may be obtained from a cDNA library prepared from tissue believed to possess LP123, LP127, or LP129 mRNA and to express it at a detectable level. Libraries can be screened with probes (such as antibodies to an LP123, LP127, or LP129 polypeptide or oligonucleotides of at least about 20-80 bases) designed to identify the gene of interest or the protein encoded by it. Screening the cDNA or genomic library with the selected probe may be conducted using standard procedures, such as described in Sambrook, et al . , Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY (1989) . An alternative means to isolate the gene encoding LP123, LP127, or LP129 is to use PCR methodology [Sambrook, et al . , supra; Dieffenbach, et al . , PCR Primer: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY (1995)].
Nucleic acids having protein coding sequences may be obtained by screening selected cDNA or genomic libraries using the deduced amino acid sequence disclosed herein for the first time and, if necessary, using conventional primer extension procedures as described in Sambrook, et al . , supra, to detect precursors and processing intermediates of mRNA that may not have been reverse-transcribed into cDNA. Host cells are transfected or transformed with expression or cloning vectors described herein for LP123, LP127, or LP129 polypeptide production and cultured in conventional nutrient media modified as appropriate for inducing promoters, selecting transformants, or amplifying the genes encoding the desired sequences. The culture conditions, such as media, temperature, pH and the like, can be selected by the skilled artisan without undue experimentation. In general, principles, protocols, and practical techniques for maximizing the productivity of cell cultures can be found in Mammalian Cell Biotechnology: A Practical Approach, M. Butler, ed. (IRL Press, 1991) and Sambrook, et al . , supra.
Methods of transfection are known to the ordinarily skilled artisan, for example, CaP04 and electroporation. General aspects of mammalian cell host system transformations have been described in U.S. Patent No.
4,399,216. Transformations into yeast are typically carried out according to the method of van Solingen, et al., J Bact. 130(2): 946-7 (1977) and Hsiao, et al . , Proc. Natl. Acad. Sci. USA 76(8): 3829-33 (1979). However, other methods for introducing DNA into cells, such as by nuclear microinjection, electroporation, bacterial protoplast fusion with intact cells, or polycations, e.g., polybrene or polyornithine, may also be used. For various techniques for transforming mammalian cells, see Keown, et al . , Methods in Enzymology 185: 527-37 (1990) and Mansour, et al . , Nature 336(6197) : 348-52 (1988) . Suitable host cells for cloning or expressing the nucleic acid (e.g., DNA) in the vectors herein include prokaryote, yeast, or higher eukaryote cells. Suitable prokaryotes include but are not limited to eubacteria, such as Gram-negative or Gram-positive organisms, for example, Enterobacteriacea such as E. coli. Various E. coli strains are publicly available, such as E. coli K12 strain MM294 (ATCC 31,446); E. coli strain X1776 (ATCC 31,537); E. coli strain W3110 (ATCC 27,325) and K5 772 (ATCC 53,635). Other suitable prokaryotic host cells include Enterobacteriaceae such as Escherichia, e.g., Enterobacter, Erwinia, Klebsiella, Proteus, Salmonella, e.g., Salmonella typhimurium, Serratia, e.g., Serratia marcescans, and Shigella, as well as Bacilli such as B. subtilis and B. lichenifor is (e.g., B. licheniformis 41P disclosed in DD 266,710, published 12 April 1989), Pseudomonas such as P. aeruginosa, and Streptomyces . These examples are illustrative rather than limiting. Strain W3110 is one particularly preferred host or parent host because it is a common host strain for recombinant DNA product fermentations. Preferably, the host cell secretes minimal amounts of proteolytic enzymes. For example, strain W3 110 may be modified to effect a genetic mutation in the genes encoding proteins endogenous to the host, with examples of such hosts including E. coli W3110 strain 1A2 , which has the complete genotype tonAD; E. coli W3110 strain 9E4, which has the complete genotype tonAD ptr3 ; E. coli W3110 strain 27C7 (ATCC 55,244), which has the complete genotype tonAD ptr3 phoADEl5 D(argF-lac)169 ompTD degP41kanR'; E. coli W3110 strain 37D6, which has the complete genotype tonAD ptr3 phoADEl5 D(argF-lac)169 ompTD degP41kanR rbs7D ilvG; E. coli W3110 strain 40B4, which is strain 37D6 with a non-kanamycin resistant degP deletion mutation; and an E. coli strain having mutant periplasmic protease disclosed in U.S. Patent No. 4,946,783 issued 7 August 1990. Alternatively, in vivo methods of cloning, e.g., PCR or other nucleic, acid polymerase reactions, are suitable. In addition to prokaryotes, eukaryotic microbes such as filamentous fungi or yeast are suitable cloning or expression hosts for LP123, LP127, or LP129 vectors. Saccharomyces cerevisiae is a commonly used lower eukaryotic host microorganism. Others include Schizosaccharomyces pombe [Beach and Nurse, Nature 290: 140-3 (1981); EP
139,383 published 2 May 1995]; Muyveromyces hosts [U.S. Patent No. 4,943,529; Fleer, et al . , Bio/Technology 9(10): 968-75 (1991)] such as, e.g., K. lactis (MW98-8C, CBS683, CBS4574) [de Louvencourt, et al . , J. Bacteriol . 154(2): 737- 42 (1983)]; K. fiagilis (ATCC 12,424), K. bulgaricus (ATCC 16,045), K. wickera ii (ATCC 24,178), K. waltii (ATCC 56,500), K. drosophilarum (ATCC 36,906) [Van den Berg, et al., Bio/Technology 8(2): 135-9 (1990)]; K. thermotolerans, and K. marxianus; yarrowia (EP 402,226); Pichia pastoris (EP 183,070) [Sreekrishna, et al . , J. Basic Microbiol. 28(4): 265-78 (1988)]; Candida; Trichoderma reesia (EP 244,234); Neurospora crassa [Case, et al . , Proc. Natl. Acad Sci. USA 76(10): 5259-63 (1979)]; Schwanniomyces such as Schwanniomyces occidentulis (EP 394,538 published 31 October 1990); and filamentous fungi such as, e.g., Neurospora, Penicillium, Tolypocladium (WO 91/00357 published 10 January 1991) , and Aspergillus hosts such as A. nidulans [Ballance, et al . , Biochem. Biophys. Res. Comm. 112(1): 284-9 (1983)]; Tilburn, et al . , Gene 26(2-3): 205- 21 (1983); Yelton, et al . , Proc. Natl. Acad. Sci. USA 81(5): 1470-4 (1984)] and A. Niger [Kelly and Hynes, EMBO J. 4(2): 475-9 (1985)]. Methylotropic yeasts are selected from the genera consisting of Hansenula, Candida, Kloeckera, Pichia, Saccharomyces, Torulopsis, and Rhodotoruia. A list of specific species that are exemplary of this class of yeast may be found in C. Antony, The Biochemistry of Methylotrophs 269 (1982) .
Suitable host cells for the expression of glycosylated LP123, LP127, or LP129 are derived from multicellular organisms. Examples of invertebrate cells include insect cells such as Drosophila S2 and Spodoptera Sp, Spodoptera High5 as well as plant cells. Examples of useful mammalian host cell lines include Chinese hamster ovary (CHO) and COS cells. More specific examples include monkey kidney CV-1 line transformed by SV40 (COS-7, ATCC CRL 1651); human embryonic kidney line [293 or 293 cells subcloned for growth in suspension culture, Graham, et al . , J. Gen Virol., 36(1): 59-74 (1977)]; Chinese hamster ovary cells/-DHFR [CHO, Urlaub and Chasin, Proc. Natl. Acad. Sci. USA, 77(7): 4216- 20 (1980)]; mouse sertoli cells [TM4, Mather, Biol. Reprod. 23(l):243-52 (1980)]; human lung cells (W138, ATCC CCL 75); human liver cells (Hep G2, HB 8065) ; and mouse mammary tumor (MMT 060562, ATCC CCL 51) . The selection of the appropriate host cell is deemed to be within the skill in the art .
The LP123, LP127, or LP129 polypeptide may be produced recombinantly not only directly, but also as a fusion polypeptide with a heterologous polypeptide, which may be a signal sequence or other polypeptide having a specific cleavage site at the N-terminus of the mature protein or polypeptide. In general, the signal sequence may be a component of the vector, or it may be a part of the LP123, LP127, or LPl29-encoding DNA that is inserted into the vector. The signal sequence may be a prokaryotic signal sequence selected, for example, from the group of the alkaline phosphatase, penicillinase, Ipp, or heat-stable enterotoxin II leaders. For yeast secretion the signal sequence may be, e.g., the yeast invertase leader, alpha factor leader (including Saccharomyces and Kluyveromyces cc- factor leaders, the latter described in U.S. Patent No. 5,010,182), or acid phosphatase leader, the C. albicans glucoamylase leader (EP 362,179), or the signal described in WO 90/13646. In mammalian cell expression, mammalian signal sequences may be used to direct secretion of the protein, such as signal sequences from secreted polypeptides of the same or related species as well as viral secretory leaders . Both expression and cloning vectors contain a nucleic acid sequence that enables the vector to replicate in one or more selected host cells. Such sequences are well known for a variety of bacteria, yeast, and viruses. The origin of replication from the plasmid pBR322 is suitable for most Gram-negative bacteria, the 2μ plasmid origin is suitable for yeast, and various viral origins (SV40, polyoma, adenovirus, VSV or BPV) are useful for cloning vectors in mammalian cells . Expression and cloning vectors will typically contain a selection gene, also termed a selectable marker. Typical selection genes encode proteins that (a) confer resistance to antibiotics or other toxins, e.g., ampicillin, neomycin, methotrexate, or tetracycline, (b) complement auxotrophic deficiencies, or (c) supply critical nutrients not available from complex media, e.g., the gene encoding D-alanine racemase for Bacilli.
An example of suitable selectable markers for mammalian cells are those that enable the identification of cells competent to take up the LP123, LP127, or LPl29-encoding nucleic acid, such as DHFR or thymidine kinase. An appropriate host cell when wild-type DHFR is employed is the CHO cell line deficient in DHFR activity, prepared and propagated as described by Urlaub and Chasin, Proc. Natl.
Acad. Sci. USA, 77(7): 4216-20 (1980). A suitable selection gene for use in yeast is the trp 1 gene present in the yeast plasmid YRp7 [Stinchcomb, et al . , Nature 282(5734): 39-43 (1979); Kingsman, et al . , Gene 7(2): 141-52 (1979); Tschumper, et al . , Gene 10(2): 157-66 (1980)]. The trp 1 gene provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, for example, ATCC No. 44076 or PEP4-1 [Jones, Genetics 85: 23-33 (1977) ] . Expression and cloning vectors usually contain a promoter operably linked to the LP123, LP127, or LP129- encoding nucleic acid sequence to direct mRNA synthesis. Promoters recognized by a variety of potential host cells are well known. Promoters suitable for use with prokaryotic hosts include the P-lactamase and lactose promoter systems [Chang, et al . , Nature 275(5681): 617-24 (1978); Goeddel, et al., Nature 281(5732): 544-8 (1979)], alkaline phosphatase, a tryptophan (up) promoter system [Goeddel, Nucleic Acids Res. 8(18): 4057-74 (1980); EP 36,776 published 30 September 1981] , and hybrid promoters such as the tat promoter [DeBoer, et al . , Proc. Natl. Acad. Sci. USA 80(1): 21-5 (1983)]. Promoters for use in bacterial systems also will contain a Shine-Dalgarno (S.D.) sequence operably linked to the DNA encoding the LP123, LP127, or LP129 polypeptide.
Examples of suitable promoting sequences for use with yeast hosts include the promoters for 3-phosphoglycerate kinase [Hitzeman, et al . , J. Biol. Chem. 255(24): 12073-80 (1980)] or other glycolytic enzymes [Hess, et al . , J. Adv. Enzyme Reg. 7: 149 (1968); Holland, Biochemistry 17(23): 4900-7 (1978) ] , such as enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 3- phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase, and glucokinase.
Other yeast promoters, which are inducible promoters having the additional advantage of transcription controlled by growth conditions, are the promoter regions for alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degradative enzymes associated with nitrogen metabolism, metallothionein, glyceraldehyde-3-phosphate dehydrogenase, and enzymes responsible for maltose and galactose utilization. Suitable vectors and promoters for use in yeast expression are further described in EP 73,657. LP123, LP127, or LP129 transcription from vectors in mammalian host cells is controlled, for example, by promoters obtained from the genomes of viruses such as polyoma virus, fowlpox virus, adenovirus (such as Adenovirus 2), bovine papilloma virus, avian sarcoma virus, cytomegalovirus, a retrovirus, hepatitis-B virus and Simian Virus 40 (SV40) , from heterologous mammalian promoters, e.g., the actin promoter or an immunoglobulin promoter, and from heat-shock promoters, provided such promoters are compatible with the host cell systems.
Transcription of a DNA encoding an LP123, LP127, or LP129 polypeptide by higher eukaryotes may be increased by inserting an enhancer sequence into the vector. Enhancers are cis-acting elements of DNA, usually about from 10 to 300 bp, that act on a promoter to increase its transcription. Many enhancer sequences are now known from mammalian genes (globin, elastase, albumin, alpha-ketoprotein, and insulin) . Typically, however, one will use an enhancer from a eukaryotic cell virus. Examples include the SV40 enhancer on the late side of the replication origin (bp 100-270) , the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers. The enhancer may be spliced into the vector at a position 5' or 3' to the LP123, LP127, or LP129 coding sequence but is preferably located at a site 5' from the promoter.
Expression vectors used in eukaryotic host cells (yeast, fungi, insect, plant, animal, human, or nucleated cells from other multicellular organisms) will also contain sequences necessary for the termination of transcription and for stabilizing the mRNA. Such sequences are commonly available from the 5' and occasionally 3' untranslated regions of eukaryotic or viral DNAs or cDNAs . These regions contain nucleotide segments transcribed as polyadenylated fragments in the untranslated portion of the mRNA encoding
LP123, LP127, or LP129 polypeptide. Gene amplification and/or expression may be measured in a sample directly, for example, by conventional Southern blotting, Northern blotting to quantitate the transcription of mRNA [Thomas, Proc. Natl. Acad. Sci. USA 77(9): 5201-5 (1980)], dot blotting (DNA analysis), or in situ hybridization, using an appropriately labeled probe, based on the sequences provided herein. Alternatively, antibodies may be employed that can recognize specific duplexes, including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or DNA-protein duplexes. The antibodies in turn may be labeled and the assay may be carried out where the duplex is bound to a surface so that upon the formation of duplex on the surface, the presence of antibody bound to the duplex can be detected. Gene expression, alternatively, may be measured by immunological methods, such as immunohistochemical staining of cells or tissue sections and assay of cell culture or body fluids, to quantitate directly the expression of gene product. Antibodies useful for immunohistochemical staining and/or assay of sample fluids may be either monoclonal or polyclonal and may be prepared in any mammal. Conveniently, the antibodies may be prepared against a native sequence LP123, LP127, or LP129 polypeptide or against a synthetic peptide based on the DNA sequences provided herein or against exogenous sequence fused to LP123-, LP127-, or
LPl29-encoding DNA and encoding a specific antibody epitope.
Forms of LP123, LP127, or LP129 may be recovered from culture medium or from host cell lysates . If membrane- bound, it can be released from the membrane using a suitable detergent solution (e.g., Triton-X 100) or by enzymatic cleavage. Cells employed in expression of LP123, LP127, or LP129 polypeptides can be disrupted by various physical or chemical means, such as freeze-thaw cycling, sonication, mechanical disruption, or cell lysing agents.
It may be desired to purify LP123, LP127, or LP129 from recombinant cell proteins or polypeptides . The following procedures are exemplary of suitable purification procedures: by fractionation on an ion-exchange column; ethanol precipitation; reversed-phase HPLC; chromatography on silica or on a cation-exchange resin such as DEAE; chromatofocusing; SDS-PAGE; ammonium sulfate precipitation; gel filtration using, for example, Sephadex G-75; protein A Sepharose columns to remove contaminants such as IgG; and metal chelating columns to bind epitope-tagged forms of the LP123, LP127, or LP129 polypeptide. Various methods of protein purification may be employed and such methods are known in the art and described, for example, in Deutscher, Methods in Enzymology 182: 83-9 (1990) and Scopes, Protein Purification: Principles and Practice, Springer-Verlag, NY (1982). The purification step(s) selected will depend, for example, on the nature of the production process used and the particular LP123, LP127, or LP129 polypeptide produced. Nucleotide sequences (or their complement) encoding LP123, LP127, or LP129 polypeptides have various applications in the art of molecular biology, including uses as hybridization probes, in chromosome and gene mapping and in the generation of antisense RNA and DNA. LP123, LP127, or LP129-encoding nucleic acid will also be useful for the preparation of LP123, LP127, or LP129 polypeptides by the recombinant techniques described herein.
The full-length LP123, LP127, or LP129 nucleotide- encoding sequence (SEQ ID NO:l, 3, or 5), or portions thereof, may be used as hybridization probes for a cDNA library to isolate the full-length LP123, LP127, or LP129 gene or genomic sequences including promoters, enhancer elements and introns of native sequence LP123, LP127, or LP129-encoding DNA or to isolate still other genes (for instance, those encoding naturally-occurring variants of LP123, LP127, or LP129, or the same from other species) which have a desired sequence identity to the LP123, LP127, or LP129 nucleotide sequence disclosed in SEQ ID N0:1, 3, or 5, respectively. Hybridization techniques are well known in the art, some of which are described in further detail in the Examples below.
Other useful fragments of the LP123, LP127, or LP129 nucleic acids include antisense or sense oligonucleotides comprising a single-stranded nucleic acid sequence (either RNA or DNA) capable of binding to target LP123, LP127, or LP129 mRNA (sense) of LP123, LP127, or LP129 DNA (antisense) sequences. Antisense or sense oligonucleotides, according to the present invention, comprise a fragment of the coding region of LP123, LP127, or LP129 DNA. Such a fragment generally comprises at least about 14 nucleotides, preferably from about 14 to 30 nucleotides. The ability to derive an antisense or a sense oligonucleotide, based upon a cDNA sequence encoding a given protein is described in, for example, Stein and Cohen, Cancer Res. 48(10): 2659-68 (1988) and Van der Krol, et al . , Bio/Techniques 6(10): 958-76 (1988) .
Binding of antisense or sense oligonucleotides to target nucleic acid sequences results in the formation of duplexes that block transcription or translation of the target sequence by one of several means, including enhanced degradation of the duplexes, premature termination of transcription or translation, or by other means. The antisense oligonucleotides thus may be used to block expression of LP123, LP127, or LP129 proteins. Antisense or sense oligonucleotides further comprise oligonucleotides having modified sugar-phosphodiester backbones (or other sugar linkages, such as those described in WO 91/06629) and wherein such sugar linkages are resistant to endogenous nucleases . Such oligonucleotides with resistant sugar linkages are stable in vivo (i.e., capable of resisting enzymatic degradation) but retain sequence specificity to be able to bind to target nucleotide sequences . Other examples of sense or antisense oligonucleotides include those oligonucleotides which are covalently linked to organic moieties, such as those described in WO 90/10448, and other moieties that increase affinity of the oligonucleotide for a target nucleic acid sequence, such poly-L-lysine. Further still, intercalating agents, such as ellipticine, and alkylating agents or metal complexes may be attached to sense or antisense oligonucleotides to modify binding specificities of the antisense or sense oligonucleotide for the target nucleotide sequence. Antisense or sense oligonucleotides may be introduced into a cell containing the target nucleic acid sequence by any gene transfer method, including, for example, CaP04- mediated DNA transfection, electroporation, or by using gene transfer vectors such as Epstein-Barr virus. In a preferred procedure, an antisense or sense oligonucleotide is inserted into a suitable retroviral vector. A cell containing the target nucleic acid sequence is contacted with the recombinant retroviral vector, either in vivo or ex vivo. Suitable retroviral vectors include, but are not limited to, those derived from the murine retrovirus M-MuLV, N2 (a retrovirus derived from M-MuLV) , or the double copy vectors designated DCT5A, DCT5B and DCT5C (see WO 90/13641) . Alternatively, a sense or an antisense oligonucleotide may be introduced into a cell containing the target nucleic acid sequence by formation of an oligonucleotide-lipid complex, as described in WO 90/10448. The sense or antisense oligonucleotide-lipid complex is preferably dissociated within the cell by an endogenous lipase.
When the coding sequences for LP123, LP127, or LP129 encode a protein which binds to another protein (for example, where the LP123, LP127, or LP129 polypeptide functions as a receptor), the LP123, LP127, or LP129 polypeptide can be used in assays to identify the other proteins or molecules involved in the binding interaction. By such methods, inhibitors of the receptor/ligand binding interaction can be identified. Proteins involved in such binding interactions can also be used to screen for peptide or small molecule inhibitors or agonists of the binding interaction. Also, the receptor LP123, LP127, or LP129 polypeptide can be used to isolate correlative ligand ( s) . Screening assays can be designed to find lead compounds that mimic the biological activity of a native LP123, LP127, or LP129 or a receptor for LP123, LP127, or LP129. Such screening assays will include assays amenable to high- throughput screening of chemical libraries, making them particularly suitable for identifying small molecule drug candidates. Small molecules contemplated include synthetic organic or inorganic compounds. The assays can be performed in a variety of formats, including protein-protein binding assays, biochemical screening assays, immunoassays and cell -based assays, which are well characterized in the art. Nucleic acids which encode LP123, LP127, or LP129 polypeptide or any modified forms can also be used to generate either transgenic animals or "knock out" animals which, in turn, are useful in the development and screening of therapeutically useful reagents. Methods for generating transgenic animals, particularly animals such as mice or rats, have become conventional in the art and are described, for example, in U.S. Patent Nos. 4,736,866 and 4,870,009. Typically, particular cells would be targeted for LP123, LP127, or LP129 transgene incorporation with tissue-specific enhancers. Transgenic animals that include a copy of a transgene encoding LP123, LP127, or LP129 introduced into the germ line of the animal at an embryonic stage can be used to examine the effect of increased expression of DNA encoding LP123, LP127, or LP129 polypeptide. Such animals can be used as tester animals for reagents thought to confer protection from, for example, pathological conditions associated with its overexpression. In accordance with this facet of the invention, an animal is treated with the reagent and a reduced incidence of the pathological condition, compared to untreated animals bearing the transgene, would indicate a potential therapeutic intervention for the pathological condition.
Alternatively, non-human homologues of LP123, LP127, or LP129 can be used to construct an LP123, LP127, or LP129 "knock out" animal which has a defective or altered gene encoding LP123, LP127, or LP129 polypeptide as a result of homologous recombination between the endogenous gene encoding LP123, LP127, or LP129 polypeptide and altered genomic DNA encoding LP123, LP127, or LP129 polypeptide introduced into an embryonic cell of the animal . For example, cDNA encoding LP123, LP127, or LP129 polypeptide can be used to clone genomic DNA encoding LP123, LP127, or LP129 polypeptide, respectively, in accordance with established techniques. A portion of the genomic DNA encoding LP123, LP127, or LP129 polypeptide can be deleted or replaced with another gene, such as a gene encoding a selectable marker which can be used to monitor integration. Typically, several kilobases of unaltered flanking DNA (both at the 5' and 3' ends) are included in the vector [see, e.g., Thomas and Capecchi, Cell 51(3): 503-12 (1987) for a description of homologous recombination vectors] . The vector is introduced into an embryonic stem cell line (e.g., by electroporation) , and cells in which the introduced DNA has homologously recombined with the endogenous DNA are selected [see, e.g., Li, et al . , Cell 69(6): 915-26 (1992)]. The selected cells are then injected into a blastocyst of an animal (e.g., a mouse or rat) to form aggregation chimeras [see, e.g., Bradley, Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, E. J. Robertson, ed. (IRL,
Oxford, 1987), pp. 113-152] . A chimeric embryo can then be implanted into a suitable pseudopregnant female foster animal and the embryo brought to term to create a "knock out" animal. Progeny harboring the homologously recombined DNA in their germ cells can be identified by standard techniques and used to breed animals in which all cells of the animal contain the homologously recombined DNA. Knockout animals can be characterized, for instance, for their ability to defend against certain pathological conditions and for their development of pathological conditions due to absence of the LP123, LP127, or LP129 polypeptide .
LP123, LP127, or LP129 transgenic non-human mammals are useful as an animal models in both basic research and drug development endeavors. Transgenic animals carrying at least one LP123, LP127, or LP129 polypeptide or nucleic acid can be used to test compounds or other treatment modalities which may prevent, suppress, or cure a pathology or disease associated with at least one of the above mentioned LP123, LP127, or LP129 activities. Such transgenic animals can also serve as a model for the testing of diagnostic methods for those same diseases. Furthermore, tissues derived from LP123, LP127, or LP129 transgenic non-human mammals are useful as a source of cells for cell culture in efforts to develop in vitro bioassays to identify compounds that modulate LP123, LP127, or LP129 activity or LP123, LP127, or LP129 dependent signaling. Accordingly, another aspect of the present invention contemplates a method of identifying compounds efficacious in the treatment of at least one previously described disease or pathology associated with LP123, LP127, or LP129 activity. A non-limiting example of such a method comprises: a) generating an LP123, LP127, or LP129 transgenic non-human animal which is, as compared to a wild-type animal, pathologically distinct in some detectable or measurable manner from wild-type version of said non-human mammal; b) exposing said transgenic animal to a compound, and; c) determining the progression of the pathology in the treated transgenic animal, wherein an arrest, delay, or reversal in disease progression in transgenic animal treated with said compound as compared to the progression of the pathology in an untreated control animals is indicative that the compound is useful for the treatment of said pathology. Another embodiment of the present invention provides a method of identifying compounds capable of inhibiting LP123, LP127, or LP129 activity in vivo and/or in vitro wherein said method comprises: a) administering an experimental compound to an LP123, LP127, or LP129 transgenic non-human animal, or tissues derived therefrom, exhibiting one or more physiological or pathological conditions attributable to the overexpression of an LP123, LP127, or LP129 transgene ; and b) observing or assaying said animal and/or animal tissues to detect changes in said physiological or pathological condition or conditions. Another embodiment of the invention provides a method for identifying compounds capable of overcoming deficiencies in LP123, LP127, or LP129 activity in vivo or in vitro wherein said method comprises: a) administering an experimental compound to an LP123, LP127, or LP129 transgenic non-human animal, or tissues derived therefrom, exhibiting one or more physiological or pathological conditions attributable to the disruption of the endogenous LP123, LP127, or LP129 gene; and b) observing or assaying said animal and/or animal tissues to detect changes in said physiological or pathological condition or conditions.
Various means for determining a compound's ability to modulate LP123, LP127, or LP129 in the body of the transgenic animal are consistent with the invention. Observing the reversal of a pathological condition in the transgenic animal after administering a compound is one such means . Another more preferred means is to assay for markers of LP123, LP127, or LP129 activity in the blood of a transgenic animal before and after administering an experimental compound to the animal. The level of skill of an artisan in the relevant arts readily provides the practitioner with numerous methods for assaying physiological changes related to therapeutic modulation of LP123, LP127, or LP129 activity.
"Gene therapy" includes both conventional gene therapy, where a lasting effect is achieved by a single treatment, and the administration of gene therapeutic agents, which involves the one time or repeated administration of a therapeutically effective DNA or mRNA. Antisense RNAs and DNAs can be used as therapeutic agents for blocking the expression of certain genes in vivo. It has already been shown that short ' antisense oligonucleotides can be imported into cells where they act as inhibitors, despite their low intracellular concentrations caused by their restricted uptake by the cell membrane [Zamecnik, et al . , Proc. Natl. Acad Sci. USA 83(12): 4143-6 (1986)]. The oligonucleotides can be modified to enhance their uptake, e.g., by substituting their negatively charged phosphodiester groups with uncharged groups.
There are a variety of techniques available for introducing nucleic acids into viable cells. The techniques vary depending upon whether the nucleic acid is transferred into cultured cells in vitro or in vivo in the cells of the intended host. Techniques suitable for the transfer of nucleic acid into mammalian cells in vitro include the use of liposo es, electroporation, microinjection, cell fusion, DEAE-dextran, the calcium phosphate precipitation method, etc. The currently preferred in vivo gene transfer techniques include transfection with viral (typically, retroviral) vectors and viral coat protein-liposome mediated transfection [Dzau, et al . , Trends in Biotechnology 11(5): 205-10 (1993)]. In some situations it is desirable to • provide the nucleic acid source with an agent that targets the target cells, such as an antibody specific for a cell surface membrane protein or the target cell, a ligand for a receptor on the target cells, etc. Where liposomes are employed, proteins which bind to a cell surface membrane protein associated with endocytosis may by used for targeting and/or to facilitate uptake, e.g., capsid proteins or fragments thereof tropic for a particular cell type, antibodies for proteins which undergo internalization in cycling, proteins that target intracellular localization and enhance intracellular half-life. The technique of receptor- mediated endocytosis is described, for example by Wu, et al., J. Biol. Chem. 262(10): 4429-32 (1987); and Wagner, et al., Proc. Natl. Acad. Sci. USA 87(9): 3410-4 (1990). For a review of gene marking and gene therapy protocols, see Anderson, Science 256(5058): 808-13 (1992). The nucleic acid molecule encoding the LP123, LP127, or LP129 polypeptides or fragments thereof described herein are useful for chromosome identification. In this regard, there exists an ongoing need to identify new chromosome markers, since relatively few chromosome marking reagents, based upon actual sequence data, are presently available. Each LP123, LP127, or LP129 nucleic acid molecule of the present invention can be used as a chromosome marker.
The present invention further provides anti-LPl23, -LP127, or -LP129 polypeptide antibodies. Exemplary antibodies include polyclonal, monoclonal, humanized, bispecific, and heteroconjugate antibodies.
The anti-LPl23, -LP127, or -LP129 antibodies of the present invention may comprise polyclonal antibodies. Methods of preparing polyclonal antibodies are known to the skilled artisan. Polyclonal antibodies can be raised in a mammal, for example, by one or more injections of an immunizing agent and, if desired, an adjuvant. Typically, the immunizing agent and/or adjuvant will be injected in the mammal by multiple subcutaneous or intraperitoneal injections. The immunizing agent may include the LP123, LP127, or LP129 polypeptide or a fusion protein thereof. It may be useful to conjugate the immunizing agent to a protein known to be immunogenic in the mammal being immunized. Examples of such immunogenic proteins include, but are not limited to, keyhole limpet hemocyanin, serum albumin, bovine thyroglobulin, and soybean trypsin inhibitor. Examples of adjuvants which may be employed include Freund's complete adjuvant and MPL-TDM adjuvant (monophosphoryl Lipid A, synthetic trehalose dicorynomycolate) . The immunization protocol may be selected by one skilled in the art without undue experimentation. The anti-LPl23, -LP127, or -LP129 antibodies may, alternatively, be monoclonal antibodies . Monoclonal antibodies may be prepared using hybridoma methods, such as those described by Kohler and Milstein, Nature 256(5517): 495-7 (1975) . In a hybridoma method, a mouse, hamster, or other appropriate host animal is typically immunized with an immunizing agent to elicit lymphocytes that produce or are capable of producing antibodies that will specifically bind to the immunizing agent. Alternatively, the lymphocytes may be immunized in vitro. The immunizing agent will typically include the LP123, LP127, or LP129 polypeptide or a fusion protein thereof. Generally, either peripheral blood lymphocytes ("PBLs") are used, if cells of human origin are desired, or spleen cells or lymph node cells are used, if non-human mammalian sources are desired. The lymphocytes are then fused with an immortalized cell line using a suitable fusing agent, such as polyethylene glycol, to form a hybridoma cell [Goding, Monoclonal Antibodies: Principles and Practice, Academic Press, (1986) pp. 59-103]. Immortalized cell lines are usually transformed mammalian cells, particularly myeloma cells of rodent, bovine and human origin. Usually, rat or mouse myeloma cell lines are employed. The hybridoma cells may be cultured in a suitable culture medium that preferably contains one or more substances that inhibit the growth or survival of the unfused, immortalized cells. For example, if the parental cells lack the enzyme hypoxanthine guanine phosphoribosyl transferase (HGPRT or HPRT) , the culture medium for the hybridomas typically will include hypoxanthine, aminopterin, and thymidine ("HAT medium"), which prevents the growth of HGPRT-deficient cells.
Preferred immortalized cell lines are those that fuse efficiently, support stable high level expression of antibody by the selected antibody-producing cells, and are sensitive to a medium such as HAT medium. More preferred immortalized cell lines are murine myeloma lines, which can be obtained, for instance, from the Salk Institute Cell Distribution Center, San Diego, California, and the American Type Culture Collection, Rockville, Maryland. Human myeloma and mouse-human heteromyeloma cell lines also have been described for the production of human monoclonal antibodies [Kozbor, J. Immunol. 133(6): 3001-5 (1984); Brodeur, et al . , Monoclonal Antibody Production Techniques and
Applications, Marcel Dekker, Inc., NY (1987) pp. 51-63]. The culture medium in which the hybridoma cells are cultured can then be assayed for the presence of monoclonal antibodies directed against an LP123, LP127, or LP129 polypeptide. Preferably, the binding specificity of monoclonal antibodies produced by the hybridoma cells is determined by immunoprecipitation or by an in vitro binding assay, such as radioimmunoassay (RIA) or enzyme-linked immunoabsorbent assay (ELISA) . Such techniques and assays are known in the art. The binding affinity of the monoclonal antibody can, for example, be determined by the Scatchard analysis of Munson and Rodbard, Anal. Biochem. 107(1) : 220-39 (1980) .
After the desired hybridoma cells are identified, the clones may be subcloned by limiting dilution procedures and grown by standard methods (Goding, supra) . Suitable culture media for this purpose include, for example, Dulbecco's Modified Eagle's Medium and RPMI-1640 medium. Alternatively, the hybridoma cells may be grown in vivo as ascites in a mammal.
The monoclonal antibodies may also be made by recombinant DNA methods, such as those described in U.S. Patent No. 4,816,567. DNA encoding the monoclonal antibodies of the invention can be readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of murine antibodies) . The hybridoma cells of the invention serve as a preferred source of such DNA. Once isolated, the DNA may be placed into expression vectors, which are then transfected into host cells such as simian COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not otherwise produce immunoglobulin protein, to obtain the synthesis of monoclonal antibodies in the recombinant host cells. The DNA also may be modified, for example, by substituting the coding sequence for human heavy and light chain constant domains in place of the homologous murine sequences [U.S. Patent No. 4,816,567; Morrison, et al . , Proc. Natl. Acad. Sci. USA 81(21): 6851-5 (1984)] or by covalently joining to- the immunoglobulin coding sequence all or part of the coding sequence for a non-immunoglobulin polypeptide. Such a non-immunoglobulin polypeptide can be substituted for the constant domains of an antibody of the invention or can be substituted for the variable domains of one antigen-combining site of an antibody of the invention to create a chimeric bivalent antibody.
The antibodies may be monovalent antibodies. Methods for preparing monovalent antibodies are well known in the art. For example, one method involves recombinant expression of immunoglobulin light chain and modified heavy chain. The heavy chain is truncated generally at any point in the Fc region so as to prevent heavy chain crosslinking. Alternatively, the relevant cysteine residues are substituted with another amino acid residue or are deleted so as to prevent crosslinking.
In vitro methods are also suitable for preparing monovalent antibodies . Digestion of antibodies to produce fragments thereof, particularly Fab fragments, can be accomplished using routine techniques known in the art.
The anti-LPl23, LP127, or LP129 antibodies of the invention may further comprise humanized antibodies or human antibodies. Humanized forms of non-human (e.g., murine) antibodies are chimeric immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab', F(ab')2 or other antigen-binding subsequences of antibodies) which contain minimal sequence derived from non-human immunoglobulin. Humanized antibodies include human immunoglobulins (recipient antibody) in which residues from a complementary-determining region (CDR) of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity and capacity. In some instances, Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues. Humanized antibodies may also comprise residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences. In general, the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin, and all or substantially all of the FR regions are those of a human immunoglobulin consensus sequence. The humanized antibody optimally also will comprise at least a portion of an immunoglobulin constant region (Fc) , typically that of a human immunoglobulin [Jones, et al . , Nature 321(6069): 522-5 (1986); Riechmann, et al., Nature 332(6162): 323-7 (1988); and Presta, Curr. Op. Struct. Biol. 2: 593-6 (1992)].
Methods for humanizing non-human antibodies are well known in the art. Generally, a humanized antibody has one or more amino acid residues introduced into it from a source which is non-human. These non-human amino acid residues are often referred to as "import" residues, which are typically taken from an "import" variable domain. Humanization can be essentially performed following the method of Winter and co- workers [Jones, et al . , Nature 321(6069): 522-5 (1986); Riechmann, et al., Nature 332(6162): 323-7 (1988); Verhoeyen, et al . , Science 239(4847): 1534-6 (1988)], by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody. Accordingly, such "humanized" antibodies are chimeric antibodies (U.S. Patent No. 4,816,567) wherein substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non-human species . In practice, humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies .
Human antibodies can also be produced using various techniques known in the art, including phage display libraries [Hoogenboom and Winter, J. Mol. Biol. 227(2) : 381- 8 (1992); Marks, et al . , J. Mol. Biol. 222(3): 581-97 (1991)]. The techniques of Cole et al . and Boerner, et al . , are also available for the preparation of human monoclonal antibodies (Cole, et al . , Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77 (1985) and Boerner, et al . , J. Immunol. 147(1): 86-95 (1991)]. Similarly, human antibodies can be made by introducing human immunoglobulin loci into transgenic animals, e.g., mice in which the endogenous immunoglobulin genes have been partially or complete inactivated. Upon challenge, human antibody production is observed, which closely resembles that seen in humans in all respects, including gene rearrangement, assembly and antibody repertoire. This approach is described, for example, in U.S. Patent Nos. 5,545,807; 5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,661,016, and in the following scientific publications: Marks, et al . , Biotechnology 10(7): 779-83 (1992); Lonberg, et al . , Nature 368(6474): 856-9 (1994); Morrison, Nature 368(6474): 812-3 (1994); Fishwild, et al . , Nature Biotechnology 14(7): 845- 51 (1996); Neuberger, Nature Biotechnology 14(7): 826 (1996); Lonberg and Huszar, Int. Rev. Immunol. 13(1): 65-93 (1995).
Bispecific antibodies are monoclonal, preferably human or humanized, antibodies that have binding specificities for at least two different antigens. In the present case, one of the binding specificities is for an LP123, LP127, or LP129 polypeptide, the other one is for any other antigen, and preferably for a cell-surface protein or receptor or receptor subunit. Methods for making bispecific antibodies are known in the art. Antibodies with more than two valencies are contemplated. For example, trispecific antibodies can be prepared [Tutt, et al . , J. Immunol. 147(1) : 60-9 (1991) ] . Heteroconjugate antibodies are also within the scope of the present invention. Heteroconjugate antibodies are composed of two covalently joined antibodies. Such antibodies have, for example, been proposed to target immune system cells to unwanted cells [U.S. Patent No. 4,676,980], and for treatment of HIV infection [WO 91/00360; WO
92/20373}. It is contemplated that the antibodies may be prepared in vitro using known methods in synthetic protein chemistry, including those involving crosslinking agents. For example, immunotoxins may be constructed using a disulfide exchange reaction or by forming a thioether bond. Examples of suitable reagents for this purpose include iminothiolate and methyl-4-mercaptobutyrimidate and those disclosed, for example, in U.S. Patent No. 4,676,980. The invention also pertains to immunoconjugates comprising an antibody conjugated to a cytotoxic agent such as a chemotherapeutic agent, toxin (e.g., an enzymatically active toxin of bacterial, fungal, plant or animal origin, or fragments thereof, or a small molecule toxin) , or a radioactive isotope (i.e., a radioconjugate) . Conjugates of the antibody and cytotoxic agent are made using a variety of bifunctional protein coupling agents such as N-succinimidyl-3- (2-pyridyldithiol) propionate (SPDP) , iminothiolane (IT) , bifunctional derivatives of imidoesters (such as dimethyl adipimidate HCl) , active esters (such as disuccinimidyl suberate) , aldehydes (such as glutaraldehyde) , bis-azido compounds [such as bis- (p- azidobenzoyl) hexanediamine] , bis-diazonium derivatives [such as bis- (p-diazoniumbenzoyl) -ethylenediamine] , diisocyanates (such as tolylene 2 , 6-diisocyanate) , and bis- active fluorine compounds (such as 1, 5-difluoro-2 , 4- dinitrobenzene) . For example, a ricin immunotoxin can be prepared as described in Vitetta, et al . , Science 238(4830): 1098-104 (1987) . Carbon-14-labeled 1-isothiocyanatobenzyl- 3-methyldiethylene triaminepentaacetic acid (MX-DTPA) is an exemplary chelating agent for conjugation of radionucleotide to the antibody. In another embodiment, the antibody may be conjugated to a "receptor" (such as streptavidin) for utilization in tumor pretargeting wherein the antibody-receptor conjugate is administered to the patient, followed by removal of unbound conjugate from the circulation using a clearing agent, and then administration of a "ligand" (e.g., avidin) which is conjugated to a cytotoxic agent (e.g., a radionuclide) .
The antibodies disclosed herein may also be formulated as immunoliposomes . Liposomes containing the antibody are prepared by methods known in the art, such as described in Eppstein, et al . , Proc. Natl. Acad. Sci. USA 82: 3688-92 (1985); Hwang, et al . , Proc. Natl. Acad. Sci. USA 77(7): 4030-4 (1980); and U.S. Pat. Nos. 4,485,045 and 4,544,545. Liposomes with enhanced circulation time are disclosed in U.S. Patent No. 5,013,556.
Particularly useful liposomes can be generated by the reverse phase evaporation method with a lipid composition comprising phosphatidylcholine, cholesterol and PEG- derivatized phosphatidylethanolamine (PEG-PE) . Liposomes are extruded through, filters of defined pore size to yield liposomes with the desired diameter. Fab' fragments of the antibody of the present invention can be conjugated to the liposomes as described in Martin, et al . , J. Biol. Chem. 257(1): 286-8 (1982) via a disulfide interchange reaction. A chemotherapeutic agent (such as Doxorubicin) is optionally contained within the liposome. See Gabizon, et al . , J. National Cancer Inst. 81(19): 484-8 ( 1989).
Antibodies specifically binding an LP123, LP127, or LP129 polypeptide identified herein, as well as other molecules identified by the screening assays disclosed hereinbefore, can be administered for the treatment of various disorders in the form of pharmaceutical compositions .
If an LP123, LP127, or LP129 polypeptide is intracellular and whole antibodies are used as inhibitors, internalizing antibodies are preferred. However, lipofections or liposomes can also be used to deliver the antibody or an antibody fragment into cells . Where antibody fragments are used, the smallest inhibitory fragment that specifically binds to the binding domain of the target protein is preferred. For example, based upon the variable- region sequences of an antibody, peptide molecules can be designed that retain the ability to bind the target protein sequence. Such peptides can be synthesized chemically and/or produced by recombinant DNA technology. See, e.g., Marasco, et al . , Proc. Natl. Acad. Sci. USA 90(16): 7889-93 (1993).
The formulation herein may also contain more than one active compound as necessary for the particular indication being treated, preferably those with complementary activities that do not adversely affect each other. Alternatively, or in addition, the composition may comprise an agent that enhances its function, such as, for example, a cytotoxic agent, cytokines, chemotherapeutic agent, or growth-inhibitory agent. Such molecules are suitably present in combination in amounts that are effective for the purpose intended. The active ingredients may also be entrapped in microcapsules prepared, for example, by coacervation techniques or by interfacial polymerization, for example, hydroxymethylcellulose or gelatin-microcapsules and poly- (methylmethacrylate) microcapsules, respectively, in colloidal drug delivery systems (for example, liposomes, albumin microspheres, microemulsions, nano-particles, and nanocapsules) or in macroemulsions . Such techniques are disclosed in Remington's Pharmaceutical Sciences, supra.
The formulations to be used for in vivo administration must be sterile. This is readily accomplished by filtration through sterile filtration membranes. Sustained-release preparations may be prepared.
Suitable examples of sustained-release preparations include semipermeable matrices of solid hydrophobic polymers containing the antibody, which matrices are in the form of shaped articles, e.g., films or microcapsules. Examples of sustained-release matrices include polyesters, hydrogels (for example, poly (2-hydroxyethyl-methacrylate) , or poly(vinylalcohol) ) , polylactides (U.S. Pat. No. 3,773,919), copolymers of L-glutamic acid and ethyl-L-glutamate, non- degradable ethylene-vinylacetate, degradable lactic acid- glycolic acid copolymers such as the LUPRON DEPOTTM
(injectable microspheres composed of lactic acid-glycolic acid copolymer and leuprolide acetate), and poly-D-(-)3- hydroxybutyric acid. While polymers such as ethylene-vinyl acetate and lactic acid-glycolic acid enable release of molecules for over 100 days, certain hydrogels release proteins for shorter time periods . When encapsulated antibodies remain in the body for a long time, they may denature or aggregate as a result of exposure to moisture at 37°C, resulting in a loss of biological activity and possible changes in immunogenicity. Rational strategies can be devised for stabilization depending on the mechanisms involved. For example, if the aggregation mechanism is discovered to be intermolecular S-S bond formation through thio-disulfide interchange, stabilization may be achieved by modifying sulfhydryl residues, lyophilizing from acidic solutions, controlling moisture content, using appropriate additives, and developing specific polymer matrix compositions .
The anti-LPl23, -LP127, or -LP129 antibodies of the present invention have various utilities. For example, anti-LP123, -LP127, or -LP129 antibodies may be used in diagnostic assays for LP123, LP127, or LP129 polypeptides, e.g., detecting expression in specific cells, tissues, or serum. Various diagnostic assay techniques known in the art may be used, such as competitive binding assays, direct or indirect sandwich assays and immunoprecipitation assays conducted in either heterogeneous or homogeneous phases
[Zola, Monoclonal Antibodies: A Manual of Techniques, CRC Press, Inc. (1987) pp. 147-158]. The antibodies used in the assays can be labeled with a detectable moiety. The detectable moiety should be capable of producing, either directly or indirectly, a detectable signal. For example, the detectable moiety may be a radioisotope, such as 3H, 14C, 32P, 35S, or 1251, a fluorescent or chemiluminescent compound, such as fluorescein isothiocyanate, rhodamine, or luciferin, or an enzyme, such as alkaline phosphatase, beta- galactosidase or horseradish peroxidase. Any method known in the art for conjugating the antibody to the detectable moiety may be employed, including those methods described by Hunter, et al . , Nature 144: 945 (1962); David, et al . , Biochemistry 13(5): 1014-21 (1974); Pain, et al . , J. Immunol. Meth. , 40(2): 219-30 (1981); and Nygren, J. Histochem. Cytoche . 30(5): 407-12 (1982). Anti-LPl23, -LP127, or -LP129 antibodies also are useful for the affinity purification of LP123, LP127, or LP129 polypeptides from recombinant cell culture or natural sources. In this process, the antibodies against an LP123, LP127, or LP129 polypeptide are immobilized on a suitable support, such a Sephadex resin or filter paper, using methods well known in the art. The immobilized antibody is then contacted with a sample containing the LP123, LP127, or LP129 polypeptide to be purified, and thereafter the support is washed with a suitable solvent that will remove substantially all the material in the sample except the
LP123, LP127, or LP129 polypeptide, which is bound to the immobilized antibody. Finally, the support is washed with another suitable solvent that will release the LP123, LP127, or LP129 polypeptide from the antibody. This invention encompasses methods of screening compounds to identity those that mimic the LP123, LP127, or LP129 polypeptide (agonists) or prevent the effect of the LP123, LP127, or LP129 polypeptide (antagonists). Screening assays for antagonist drug candidates are designed to identify compounds that bind or complex with the LP123,
LP127, or LP129 polypeptides encoded by the genes identified herein or otherwise interfere with the interaction of the encoded polypeptides with other cellular proteins. Such screening assays will include assays amenable to high- throughput screening of chemical libraries, making them particularly suitable for identifying small molecule drug candidates .
The assays can be performed in a variety of formats . In binding assays, the interaction is binding, and the complex formed can be isolated or detected in the reaction mixture. In a particular embodiment, the LP123, LP127, or LP129 polypeptide encoded by the gene identified herein or the drug candidate is immobilized on a solid phase, e.g., on a microtiter plate, by covalent or non-covalent attachments. Non-covalent attachment generally is accomplished by coating the solid surface with a solution of the LP123, LP127, or LP129 polypeptide and drying. Alternatively, an immobilized antibody, e.g., a monoclonal antibody, specific for the LP123, LP127, or LP129 polypeptide to be immobilized, can be used to anchor it to solid surface. The assay is performed by adding the non-immobilized component, which may be labeled by a detectable label, to the immobilized component, e.g., the coated surface containing the anchored component. When the reaction is complete, the non-reacted components are removed, e.g., by washing, and complexes anchored on the solid surface are detected. When the originally non- immobilized component carries a detectable label, the detection of label immobilized on the surface indicates that complexing occurred. Where the originally non-immobilized component does not carry a label, complexing can be detected, for example, by using a labeled antibody specifically binding the immobilized complex.
If the candidate compound interacts with but does not bind to a particular LP123, LP127, or LP129 polypeptide encoded by a gene identified herein, its interaction with that polypeptide can be assayed by methods well known for detecting protein-protein interactions. Such assays include traditional approaches, such as, e.g., cross-linking, co- immunoprecipitation, and co-purification through gradients or chromatographic columns. In addition, protein-protein interactions can be monitored through gradients or chromatographic columns. In addition, protein-protein interactions can be monitored by using a yeast-based genetic system described by Fields and co-workers [Fields and Song, Nature 340(6230): 245-6 (1989); Chien, et al . , Proc. Natl. Acad. Sci. USA 88(21): 9578-82 (1991); Chevray and Nathans, Proc. Natl. Acad. Sci. USA 89(13): 5789-93 (1992)]. Many transcriptional activators, such as yeast GAL4, consist of two physically discrete modular domains, one acting as the DNA-binding domain, while the other functions as the transcription-activation domain. The yeast expression system described in the foregoing publications (generally referred to as the "two-hybrid system") takes advantage of this property, and employs two hybrid proteins, one in which the target protein is fused to the DNA-binding domain of GAL4, and another in which candidate activating proteins are fused to the activation domain. The expression of GALl-lacZ reporter gene under control of a GAL4-activated promoter depends on reconstitution of GAL4 activity via protein- protein interaction. Colonies containing interacting polypeptides are detected with a chromogenic substrate for beta-galactosidase. A complete kit (MATCHMAKERTM) for identifying protein-protein interactions between two specific proteins using the two-hybrid technique is commercially available from Clontech. This system can also be extended to map protein domains involved in specific protein interactions as well as to pinpoint amino acid residues that are crucial for these interactions .
Compounds that interfere with the interaction of a gene encoding an LP123, LP127, or LP129 polypeptide identified herein and other intra- or extracellular components can be tested as follows: usually a reaction mixture is prepared containing the product of the gene and the intra- or extracellular component under conditions and for a time allowing for the interaction and binding of the two products . To test the ability of a candidate compound to inhibit binding, the reaction is run in the absence and in the presence of the test compound. In addition, a placebo may be added to a third reaction mixture to serve as a positive control. The binding (complex formation) between the test compound and the intra- or extracellular component present in the mixture is monitored as described hereinabove. The formation of a complex in the control reaction (s) but not in the reaction mixture containing the test compound indicates that the test compound interferes with the interaction of the test compound and its reaction partner .
Antagonists may be detected by combining the LP123, LP127, or LP129 polypeptide and a potential antagonist with membrane-bound LP123, LP127, or LP129 polypeptide receptors or recombinant receptors under appropriate conditions for a competitive inhibition assay. The LP123, LP127, or LP129 polypeptide can be labeled, such as by radioactivity, such that the number of LP123, LP127, or LP129 polypeptide molecules bound to the receptor can be used to determine the effectiveness of the potential antagonist. The gene encoding the receptor can be identified by numerous methods known to those of skill in the art, for example, ligand panning and FACS sorting. See Coligan, et al . , Current Protocols in Immunology 1(2): Chap. 5 (1991). Preferably, expression cloning is employed wherein polyadenylated RNA is prepared from a cell responsive to the LP123, LP127, or LP129 polypeptide, and a cDNA library created from this RNA is divided into pools and used to transfect COS cells or other cells that are not responsive to the LP123, LP127, or LP129 polypeptide. Transfected cells that are grown on glass slides are exposed to labeled LP123, LP127, or LP129 polypeptide. The LP123, LP127, or LP129 polypeptide can be labeled by a variety of means including iodination or inclusion of a recognition site for a site-specific protein kinase. Following fixation and incubation, the slides are subjected to autoradiographic analysis. Positive pools are identified and sub-pools are prepared and re-transfected using an interactive sub-pooling and re-screening process, eventually yielding a single clone that encodes the putative receptor.
As an alternative approach for receptor identification, labeled LP123, LP127, or LP129 polypeptide can be photoaffinity-linked with cell membrane or extract preparations that express the receptor molecule. Cross- linked material is resolved by PAGE and exposed to X-ray film. The labeled complex containing the receptor can be excised, resolved into peptide fragments, and subjected to protein micro-sequencing. The amino acid sequence obtained from micro-sequencing would be used to design a set of degenerate oligonucleotide probes to screen a cDNA library to identify the gene encoding the putative receptor . In another assay for antagonists, mammalian cells or a membrane preparation expressing the receptor would be incubated with labeled LP123, LP127, or LP129 polypeptide in the presence of the candidate compound. The ability of the compound to enhance or block this interaction could then be removed.
Alternatively, a potential antagonist may be a closely related protein, for example, a mutated form of the LP123, LP127, or LP129 polypeptide that recognizes the receptor but imparts no effect, thereby competitively inhibiting the action of the LP123, LP127, or LP129 polypeptide.
Another potential LP123, LP127, or LP129 polypeptide antagonist is an antisense RNA or DNA construct prepared using antisense technology, where, e.g., an antisense RNA or DNA molecule acts to block directly the translation of mRNA by hybridizing to targeted mRNA and prevent its translation into protein. Antisense technology can be used to control gene expression through triple-helix formation or antisense DNA or RNA, both of which methods are based on binding of a polynucleotide to DNA or RNA. For example, the 5' coding portion of the polynucleotide sequence, which encodes the mature LP123, LP127, or LP129 polypeptide herein, is used to design an antisense RNA oligonucleotide sequence of about 10 to 40 base pairs in length. A DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription [triple helix; see Lee, et al . , Nucl. Acids Res 6(9): 3073-91 (1979); Cooney, et al . , Science 241(4864): 456-9 (1988); Beal and Dervan, Science 251(4999): 1360-3 (1991)], thereby preventing transcription and the production of the LP123, LP127, or LP129 polypeptide. The antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into the LP123, LP127, or LP129 polypeptide
[antisense; see Okano, J. Neurochem. 56(2): 560-7 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press: Boca Raton, FL (1988)]. The oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA may be expressed in vivo to inhibit production of the LP123, LP127, or LP129 polypeptide. When antisense DNA is used, oligodeoxy- ribonucleotides derived from the translation-initiation site, e.g., between about -10 and +10 positions of the target gene nucleotide sequence, are preferred.
Potential antagonists include small molecules that bind to the active site, the receptor binding site, or growth factor or other relevant binding site of the LP123, LP127, or LP129 polypeptide, thereby blocking the normal biological activity of the LP123, LP127, or LP129 polypeptide. Examples of small molecules include, but are not limited to, small peptides or peptide-like molecules, preferably soluble peptides, and synthetic non-peptidyl organic or inorganic compounds .
Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA. Ribozymes act by sequence-specific hybridization to the complementary target RNA, followed by endonucleolytic cleavage. Specific ribozyme cleavage sites within a potential RNA target can be identified by known techniques. For further details, see, e.g., Rossi, Current Biology 4(5): 469-71 (1994) and PCT publication No. WO 97/33551.
Nucleic acid molecules in triple-helix formation used to inhibit transcription should be single-stranded and composed of deoxynucleotides . The base composition of these oligonucleotides is designed such that it promotes triple- helix formation via Hoogsteen base-pairing rules, which generally require sizeable stretches of purines or pyrimidines on one strand of a duplex. For further details see, e.g., PCT publication No. WO 97/33551, supra.
Another use of the compounds of the invention (e.g., LP123, LP127, or LP129 variants and anti-LPl23, -LP127, or -LP129 antibodies) described herein is to help diagnose whether a disorder is driven, to some extent, by LP123, LP127, or LP129 modulated signaling.
A diagnostic assay to determine whether a particular disorder is driven by LP123, LP127, or LP129 signaling can be carried out using the following steps: a) culturing test cells or tissues expressing LP123, LP127, or LP129; b) administering a compound which can inhibit LP123, LP127, or LP129 modulated signaling; and c) measuring the LP123, LP127, or LP129 mediated phenotypic effects in the test cells .
The steps can be carried out using standard techniques in light of the present disclosure. Appropriate controls take into account the possible cytotoxic effect of a compound, such as treating cells not associated with a cell proliferative disorder (e.g., control cells) with a test compound and can also be used as part of the diagnostic assay. The diagnostic methods of the invention involve the screening for agents that modulate the effects of LP123, LP127, or LPl29-associated disorders.
The LP123, LP127, or LP129 antagonists or agonists can be employed as therapeutic agents . Such therapeutic agents are formulated according to known methods to prepare pharmaceutically useful compositions, whereby the LP123, LP127, or LP129 antagonist or agonist thereof is combined in a mixture with a pharmaceutically acceptable carrier. In the case of LP123, LP127, or LP129 antagonist or agonist antibodies, if the protein encoded by the amplified gene is intracellular and whole antibodies are used as inhibitors, internalizing antibodies are preferred. However, lipofections or liposomes can also be used to deliver the antibody, or an antibody fragment, into cells. Where antibody fragments are used, the smallest inhibitory fragment which specifically binds to the binding domain of the target protein is preferred. For example, based upon the variable region sequences of an antibody, peptide molecules can be designed which retain the ability to bind the target protein sequence. Such peptides can be synthesized chemically and/or produced by recombinant DNA technology [see, e.g., Marasco, et al . , Proc. Natl. Acad. Sci. USA 90(16): 7889-93 (1993)].
Therapeutic formulations are prepared for storage by mixing the active ingredient having the desired degree of purity with optional pharmaceutically acceptable carriers, excipients or stabilizers [Remington's Pharmaceutical Sciences 16th edition, A. Osal, Ed. (1980)], in the form of lyophilized formulations or aqueous solutions.
The formulation herein may also contain more than one active compound as necessary for the particular indication being treated, preferably those with complementary activities that do not adversely affect each other. Such molecules are suitably present in combination in amounts that are effective for the purpose intended.
The active ingredients may also be entrapped in microcapsules prepared, for example, by coacervation techniques or by interfacial polymerization, for example, hydroxymethylcellulose or gelatin-microcapsules and poly (methylmethacrylate) microcapsules, respectively, in colloidal drug delivery systems (for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules) or in macroemulsions . Such techniques are disclosed in Remington's Pharmaceutical Sciences 16th edition, A. Osal, Ed. (1980) .
The formulations to be used for in vivo administration must be sterile. This is readily accomplished by filtration through sterile filtration membranes.
Therapeutic compositions herein generally are placed into a container having a sterile access port, for example, an intravenous solution bag or vial having a stopper pierceable by a hypodermic injection needle.
Sustained-release preparations may be prepared. Suitable examples of sustained-release preparations include semipermeable matrices of solid hydrophobic polymers containing the therapeutic agent (s), which matrices are in the form of shaped articles, e.g., films, or microcapsules. Examples of sustained-release matrices include polyesters, hydrogels [for example, poly (2-hydroxyethylmethacrylate) , or poly (vinylalcohol) ] , polylactides, copolymers of L-glutamic acid and gamma-ethyl-L-glutamate, non-degradable ethylene- vinyl acetate, degradable lactic acid-glycolic acid copolymers such as the LUPRON DEPOTTM (injectable microspheres composed of lactic acid-glycolic acid copolymer and leuprolide acetate), and poly-D- (-) -3-hydroxybutyric acid. Microencapsulation of recombinant proteins for sustained release has been successfully performed with human growth hormone (rhGH) and interleukin-2. Johnson, et al . , Nat. Med. 2(7): 795-9 (1996); Yasuda, et al . , Biomed. Ther. 27: 1221-3 (1993); Hora, et al.-, Bio/Technology 8(8): 755-8 (1990) ; Cleland, "Design and Production of Single Immunization Vaccines Using Polylactide Polyglycolide Microsphere Systems" i Vaccine Design: The Subunit and Adjuvant Approach, Powell and Newman, Eds., Plenum Press, NY, 1995, pp. 439-462; WO 97/03692; WO 96/40072; WO 96/07399; and U.S. Pat. No. 5,654,010. The sustained-release formulations of these proteins may be developed using polylactic-coglycolic acid (PLGA) polymer due to its biocompatibility and wide range of biodegradable properties . The degradation products of PLGA, lactic and glycolic acids, can be cleared quickly within the human body. Moreover, the degradability of this polymer can be adjusted from months to years depending on its molecular weight and composition. See Lewis, "Controlled release of bioactive agents from lactide/glycolide polymer" in Biodegradable Polymers as Drug Delivery Systems, Marcel Dekker; New York (1990), M. Chasin and R. Langer (Eds.) pp. 1-41.
While polymers such as ethylene-vinyl acetate and lactic acid-glycolic acid enable release of molecules for over 100 days, certain hydrogels release proteins for shorter time periods. When encapsulated antibodies remain in the body for a long time, they may denature or aggregate as a result of exposure to moisture at 37°C, resulting in a loss of biological activity and possible changes in immunogenicity. Immune System
An LP described herein can be useful in ameliorating, treating, preventing, modulating, and/or diagnosing a disease, disorder, syndrome, or condition of the immune system, by, e.g., activating or inhibiting the proliferation, differentiation, or mobilization (chemotaxis or directed movement) of an immune cell. Typically, immune cells develop through a process called hematopoiesis, producing myeloid (platelets, red blood cells, neutrophils, and macrophages) and lymphoid (B and T lymphocytes) cells from pluripotent stem cells.
The etiology of an immune disease, disorder, syndrome, or condition may be genetic and/or somatic, (e.g., such as some forms of cancer or some autoimmune conditions acquired by e.g., chemotherapy or toxins or an infectious agent, e.g., a virus or prion-like entity. Moreover, an LP can be used to mark or detect a particular immune system disease, syndrome, disorder, state, or condition.
An LP can be useful in ameliorating, treating, preventing, modulating, and/or diagnosing a disease, disorder, syndrome, and/or a condition of a hematopoietic cell. An LP could be used to increase or inhibit the differentiation or proliferation of a hematopoietic cell, including a pluripotent stem cell such an effect can be implemented to treat, prevent, modulate, or ameliorate a disease, disorder, syndrome, and/or a condition associated with a decrease in a specific type of hematopoietic cell. An example of such an immunologic deficiency, disease, disorder, syndrome, and/or condition includes, e.g., without limitation, a blood condition (e.g. agammaglobulinemia, digammaglobulmemia) , ataxia telangiectasia, common variable immunodeficiency, Digeorge Syndrome, HIV infection, HTLV-BLV infection, leukocyte adhesion deficiency syndrome, lymphopenia, phagocyte bactericidal dysfunction, severe combined immunodeficiency (SCIDs) , Wiskott-Aldrich Disorder, anemia, thrombocytopenia, or hemoglobinuria.
Moreover, an LP can be used to modulate hemostatic or thrombolytic activity. For example, increasing hemostatic or thrombolytic activity can treat or prevent a blood coagulation condition such as e.g., afibrinogenemia, a factor deficiency, a blood platelet disease (e.g. thrombocytopenia) , or a wound resulting from e.g., trauma, surgery, etc. Alternatively, a composition of the invention can be used to decrease hemostatic or thrombolytic activity or to inhibit or dissolve a clotting condition. Such compositions can be important in a treatment or prevention of a heart condition, e.g., an attack infarction, stroke, or mycardial scarring.
An LP may also be useful in ameliorating, treating, preventing, modulating and/or diagnosing an autoimmune disease, disorder, syndrome, and/or condition such as results, e.g., from the inappropriate recognition by a cell of the immune system of the self as a foreign material. Such an inappropriate recognition results in an immune response leading to detrimental effect destruction on the host, e.g., on a host cell, tissue, protein, or moiety, e.g., a carbohydrate side chain. Therefore, administration of an LP which inhibits a detrimental immune response, particularly, e.g., a proliferation, differentiation, or chemotaxis of a T-cell, may be effective in detecting, diagnosing, ameliorating, or preventing such an autoimmune disease, disorder, syndrome, and/or condition. Examples of autoimmune conditions that can be affected by the present invention include, e.g., without limit Addison's Disease syndrome hemolytic anemia, anti-phospholipid syndrome, rheumatoid arthritis, dermatitis, allergic encephalomyelitis, glomerulonephritis, Goodpasture' s Syndrome, Graves' Disease syndrome, Multiple Sclerosis, Myasthenia Gravis, Neuritis, Ophthalmia, Bullous Pemphigoid, Pemphigus, Polyendocrinopathies, Purpura, Reiter's Disease syndrome, Stiff-Man Syndrome, Autoimmune Thyroiditis, Systemic Lupus Erythematosus, Autoimmune Pulmonary Inflammation, Guillain-BarreSyndrome, insulin dependent diabetes mellitis, and autoimmune inflammatory eye disease. Similarly, allergic reactions and conditions, such as asthma (e.g., allergic asthma) or other respiratory problems, may also be ameliorated, treated, modulated or prevented, and/or diagnosed by an LP polynucleotide or polypeptide (or fragment thereof) , or an agonist or antagonist thereto. Moreover, such inventive compositions can be used to effect, e.g., anaphylaxis, hypersensitivity to an antigenic molecule, or blood group incompatibility.
An LP may also be used to modulate, ameliorate, treat, prevent, and/or diagnose organ rejection or graft-versus- host disease (GVHD) . Generally speaking, organ rejection occurs by a host's, immune-cell destruction of a transplanted tissue or cell. A similarly destructive immune response is involved in GVHD, however, in this case, transplanted foreign immune cells destroy host tissues and/or cells. Administration of a composition of the invention, which ameliorates or modulates such a deleterious immune response (e.g., a deleterious proliferation, differentiation, or chemotaxis of a T cell) , can be effective in modulating, ameliorating, diagnosing, and/or preventing organ rejection or GVHD.
Similarly, an LP may also be used to detect, treat, modulate, ameliorate, prevent, and/or diagnose an inflammation, e.g., by inhibiting the proliferation and/or differentiation of a cell involved in an inflammatory response, or an inflammatory condition (either chronic or acute), including, e.g., without limitation, chronic prostatitis, granulomatous prostatitis and malacoplakia, an inflammation associated with an infection (such as, e.g., septic shock, sepsis, or systemic inflammatory response syndrome (SIRS) ) , ischemia-reperfusion injury, endotoxin lethality, arthritis, complement-mediated hyperacute rejection, nephritis, cytokine or chemokine induced lung injury, inflammatory bowel disease syndrome, Crohn's disease syndrome, or a condition resulting from an over production of a cytokine (s) (e.g., TNF or IL-1) .
Proliferative Disorders
An LP can be used to modulate, ameliorate, treat, prevent, and/or diagnose a hyperproliferative disease, condition, disorder, or syndrome (such as, e.g., a neoplasm) via direct or indirect interactions. For example, such as by initiating the proliferation of cells that, in turn, modulate a hyperproliferative state; or by increasing an immune response (e.g., by increasing the antigenicity of a protein involved in a hyperproliferative condition) ; or by causing the proliferation, differentiation, or mobilization of a specific cell type (e.g., a T-cell). A desired effect using a composition of the invention may also be accomplished either by, e.g., enhancing an existing immune response, or by initiating a new immune response.
Alternatively, the- desired result may be effected either by, e.g., diminishing or blocking an existing immune response, or by preventing the initiation of a new immune response. Examples of such hyperproliferative states, diseases, disorders, syndromes, and/or conditions include, e.g., without limitation, a neoplasm of the colon, abdomen, bone, breast, digestive system, liver, pancreas, peritoneum, endocrine system (e.g., an adrenal gland, a parathyroid gland, the pituitary, the testicles, the ovary, the thymus, or the thyroid) , eye, head, neck, nervous system (central or peripheral) , the lymphatic system, pelvis, skin, spleen, thorax, and urogenital system. Similarly, other hyperproliferative conditions, include, e.g., without limit hypergammaglobulinemia, lymphoproliferative conditions, paraproteinemias , purpura, sarcoidosis, Hamartoma, Sezary Syndrome, Waldenstron' s Macroglobulinemia, Gaucher's Disease syndrome, histiocytosis, and other hyperproliferative states .
One preferred embodiment utilizes an LP to inhibit aberrant cellular division, through a polynucleotide delivery technique. Thus, the present invention provides a - method for treating, preventing, modulating, ameliorating, preventing, inhibiting, and/or diagnosing cell proliferative diseases, disorders, syndromes, and/or conditions described herein by inserting into an abnormally proliferating cell a composition of the present invention, wherein said composition beneficially modulates an excessive condition of cell proliferation, e.g., by inhibiting transcription and/or translation.
Another embodiment comprises administering one or more active copies of an LP polynucleotide sequence to an abnormally proliferating cell. For example in one embodiment, an LP polynucleotide sequence is operably linked in a construct comprising a recombinant expression vector that is effective in expressing a polypeptide (or fragment thereof) corresponding to the polynucleotide of interest. In another preferred embodiment, the construct encoding a polypeptide or fragment thereof, is inserted into a targeted cell utilizing a retrovirus or an adenoviral vector (see, e.g., Nabel, et al . (1999) Proc. Natl. Acad. Sci. USA 96: 324-326). In a still preferred embodiment, the viral vector is defective and only transforms or transfects a proliferating cell but does not transform or transfects a non-proliferating cell. Moreover, dn a still further preferred embodiment, an LP polynucleotide sequence is inserted into a proliferating cell either alone, (or in combination with, or fused to, another polynucleotide sequence, which can subsequently be modulated via an external stimulus (e.g., a magnetic signal, a specific small molecule, a chemical moiety or a drug administration, etc.) that acts on an upstream promoter to induce expression of the LP polypeptide (or fragment thereof) .
As such, a desired effect of the present invention (e.g., selectively increasing, decreasing, or inhibiting expression of an LP polynucleotide sequence) may be accomplished based on using an external stimulus.
Cardiovascular Condition
An LP may be used to, modulate, ameliorate, effect, treat, prevent, and/or diagnose a cardiovascular disease, disorder, syndrome, and/or condition. As described herein, including, e.g., without limitation, cardiovascular abnormalities, such as arterio-arterial fistula, arteriovenous fistula, cerebral arteriovenous malformations, congenital heart defects, pulmonary atresia, and Scimitar Syndrome peripheral artery disease, syndrome, such as limb ischemia.
Additional cardiovascular disorders encompass, e.g., congenital heart defects which include, e.g., aortic coarctation, car triatriatum, coronary vessel anomalies, crisscross heart, dextrocardia, patent ductus arteriosus, Ebstein's anomaly, Eisenmenger complex, hypoplastic left heart syndrome, levocardia, tetralogy of fallot, transposition of great vessels, double outlet right ventricle, tricuspid atresia, persistent truncus arteriosus, and heart septal defects, such as e.g., aortopulmonary septal defect, endocardial cushion defects, Lutembacher' s Syndrome, trilogy of Fallot, and ventricular heart septal defects.
Further cardiovascular conditions include, e.g., heart disease syndrome, such as, e.g., arrhythmias, carcinoid heart disease syndrome, high cardiac output, low cardiac output, cardiac tamponade, endocarditis (including bacterial endocarditis) , heart aneurysm, cardiac arrest, congestive heart failure, congestive cardiomyopathy, paroxysmal dyspnea, cardiac edema, heart hypertrophy, congestive cardiomyopathy, left ventricular hypertrophy, right ventricular hypertrophy, post-infarction heart rupture, ventricular septal rupture, heart valve disease, myocardial disease, myocardial ischemia, pericardial effusion, pericarditis (including constrictive and tuberculous pericarditis) , pneumopericardium, post-pericardiotomy syndrome, pulmonary heart disease syndrome, rheumatic heart disease syndrome, ventricular dysfunction, hyperemia, cardiovascular pregnancy complications, Scimitar Syndrome, cardiovascular syphilis, and cardiovascular tuberculosis. Further cardiovascular disorders include, e.g., arrhythmias including, e.g., sinus arrhythmia, atrial fibrillation, atrial flutter, bradycardia, extra systole, Adams-Stokes Syndrome, bundle-branch block, sinoatrial block, long QT syndrome, parasystole, Lown-Ganong-Levine Syndrome, Mahaim-type pre-excitation syndrome, Wolff- Parkinson-White syndrome, sick sinus syndrome, and ventricular fibrillation tachycardias.
Tachycardias encompassed with the cardiovascular condition described herein include, e.g., paroxysmal tachycardia, supraventricular tachycardia, accelerated idioventricular rhythm, atrioventricular nodal re-entry tachycardia, ectopic atrial tachycardia, ectopic junctional tachycardia, sinoatrial nodal re-entry tachycardia, sinus tachycardia, Torsades de Pointes Syndrome, and ventricular tachycardia .
Additional cardiovascular disorders include, e.g., heart valve disease such as, e.g., aortic valve insufficiency, aortic valve stenosis, heart murmurs, aortic valve prolapse, mitral valve prolapse, tricuspid valve prolapse, mitral valve insufficiency, mitral valve stenosis, pulmonary atresia, pulmonary valve insufficiency, pulmonary valve stenosis, tricuspid atresia, tricuspid valve insufficiency, and tricuspid valve stenosis.
Myocardial conditions associated with cardiovascular disease include, e.g., myocardial diseases such as, e.g., alcoholic cardiomyopathy, congestive cardiomyopathy, hypertrophic cardiomyopathy, aortic subvalvular stenosis, pulmonary subvalvular stenosis, restrictive cardiomyopathy, Chagas cardiomyopathy, endocardial fibroelastosis, endomyocardial fibrosis, Kearns Syndrome, myocardial reperfusion injury, and myocarditis. Cardiovascular conditions include, e.g., myocardial ischemias such as, e.g., coronary disease syndrome, such as e.g., angina pectoris, coronary aneurysm, coronary arteriosclerosis, coronary thrombosis, coronary vasispasm, myocardial infarction, and myocardial. stunning. Cardiovascular diseases also encompassed herein include, e.g., vascular diseases such as e.g., aneurysms, angiodysplasia, angiomatosis, bacillary angiomatosis, Hippel-Lindau Disease syndrome, Klippel-Trenaunay-Weber Syndrome, Sturge-Weber Syndrome, angioneurotic edema, aortic disease, Takayasu's Arteritis, aortitis, Leriche's Syndrome, arterial occlusive disease, arteritis, enarteritis, polyarteritis nodosa, cerebrovascular disease, diabetic angiopathies, diabetic retinopathy, embolism, thrombosis, erythromeialgia, hemorrhoids, hepatic veno-occlusive disease syndrome, hypertension, hypotension, ischemia, peripheral vascular diseases, phlebitis, pulmonary veno-occlusive disease syndrome, Raynaud's disease syndrome, CREST syndrome, retinal vein occlusion, Scimitar syndrome, superior vena cava syndrome, telangiectasia, ataxia telangiectasia, hereditary he orrhagic telangiectasia, varicocele, varicose veins, varicose ulcer, vasculitis, and venous insufficiency.
Cardiovascular conditions further include, e.g., aneurysms such as, e.g., dissecting aneurysms, false aneurysms, infected aneurysms, ruptured aneurysms, aortic aneurysms, cerebral aneurysms, coronary aneurysms, heart aneurysms, and iliac aneurysms.
Arterial occlusive cardiovascular conditions include, e.g., arteriosclerosis, intermittent claudication, carotid stenosis, fibromuscular dysplasias, mesenteric vascular occlusion, Moyamoya disease syndrome, renal artery obstruction, retinal artery occlusion, and thromboangiitis obliterans .
Cerebrovascular cardiovascular conditions include, e.g., carotid artery disease, cerebral amyloid angiopathy, cerebral aneurysm, cerebral anoxia, cerebral arteriosclerosis, cerebral arteriovenous malformation, cerebral artery disease, cerebral embolism and thrombosis, carotid artery thrombosis, sinus thrombosis, Wallenberg's syndrome, cerebral hemorrhage, epidural hematoma, subdural hematoma, subarachnoid hemorrhage, cerebral infarction, cerebral ischemia (including transient cerebral ischemia) , subclavian steal syndrome, periventricular leukomalacia, vascular headache, cluster headache, migraine, and vertebrobasilar insufficiency.
Embolic cardiovascular conditions include, e.g., air embolisms, amniotic fluid embolisms, cholesterol embolisms, blue toe syndrome, fat embolisms, pulmonary embolisms, and thromboembolisms .
Thrombotic cardiovascular conditions include, e.g., coronary thrombosis, hepatic vein thrombosis, retinal vein occlusion, carotid artery thrombosis, sinus thrombosis, Wallenberg's syndrome, and thrombophlebitis. Ischemic conditions include, e.g., cerebral ischemia, ischemic colitis, compartment syndromes, anterior compartment syndrome, myocardial ischemia, reperfusion injuries, and peripheral limb ischemia. Vasculitic conditions include, e.g., aortitis, arteritis, Behcet's Syndrome, Churg-Strauss Syndrome, mucocutaneous lymph node syndrome, thromboangiitis obliterans, hypersensitivity vasculitis, Schoenlein-Henoch purpura, allergic cutaneous vasculitis, and Wegener's granulomatosis .
An LP can be beneficial in ameliorating critical limb ischemia and coronary disease. An LP may be administered using any art known method, described herein. An LP may be - administered as part of a therapeutic composition or formulation, as described in detail herein. Methods of delivering an LP are also described in detail herein.
Anti-Hemopoietic Activity
The naturally occurring balance between endogenous stimulators and inhibitors of angiogenesis is one in which inhibitory influences typically predominate (see, e.g., Rastinejad, et al . , Cell 56345-355 (1989)). When neovascularization occurs under normal physiological conditions, such as wound healing, organ regeneration, embryonic development, and female reproductive processes, angiogenesis is stringently regulated, and delimited spatially and temporally. In pathological angiogenesis such as, e.g., during solid tumor formation, these regulatory controls fail and unregulated angiogenesis can become pathologic by sustaining progression of many neoplastic and non-neoplastic diseases. A number of serious diseases are dominated by abnormal neovascularization (including, e.g., solid tumor growth and metastases, arthritis, some types of eye conditions, and psoriasis; see, e.g., reviews by Moses, et al . , Biotech. 9630-634 (1991); Folkman, et al . , N. Engl. J. Med., 333: 1757-1763 (1995); Auerbach, et al . , J. Microvasc. Res. 29:401-4 11 (1985); Folkman, "Advances in Cancer Research", eds. Klein and Weinhouse, Academic Press, New York, pp. 175- 203 (1985); Patz, Am. J. Opthalmol . 94:7 15-743 (1982); and Folkman, et al . , Science 221:7 19-725 (1983).
In a number of pathological conditions, angiogenesis contributes to a disease-state, e.g., for example, significant data have accumulated suggesting that solid tumor formation is dependent on angiogenesis (see, e.g., Folkman and Klagsbrun, Science 235:442-447 (1987)). In another embodiment of the invention, administration of an LP provides for the treatment, amelioration, modulation, diagnosis, and/or inhibition of a disease, disorder, syndrome, and/or condition associated with neovascularization .
Malignant and metastatic conditions that can be effected in a desired fashion using an LP include, e.g., without limitation, a malignancy, solid tumor, and a cancer as described herein or as otherwise known in the art (for a review of such disorders, syndromes, etc. see, e.g., Fishman, et al . , Medicine, 2d Ed., J. B. Lippincott Co., Philadelphia (1985)). Thus, the present invention provides a method of ameliorating, modulating, treating, preventing, and/or diagnosing an angiogenesis-related disease and/or disorder, comprising administering to a subject in need thereof a beneficially effective amount of an LP. For example, cancers that may be so affected using a composition of the invention includes, e.g., without limit a solid tumor, including e.g., prostate, lung, breast, ovarian, stomach, pancreas, larynx, esophagus, testes, liver, parotid, biliary tract, colon, rectum, cervix, uterus, endometrium, kidney, bladder, thyroid cancer; primary tumors and metastases; melanomas; glioblastoma; Kaposi ' s sarcoma; leiomyosarcoma; non-small cell lung cancer; colorectal cancer; advanced malignancies; and blood born tumors such as e.g. , leukemia.
Moreover, an LP may be delivered topically, to treat or prevent cancers such as, e.g., skin cancer, head and neck tumors, breast tumors, and Kaposi ' s sarcoma. Within yet another aspect, an LP may be utilized to treat superficial forms of bladder cancer by, e.g., intravesical administration into the tumor, or near the tumor site; via injection or a catheter. Of course, the appropriate mode of administration will vary according to the cancer to be treated. Other modes of delivery are discussed herein.
An LP may also be useful in modulating, ameliorating, treating, preventing, and/or diagnosing another disease, disorder, syndrome, and/or condition, besides a cell proliferative condition (e.g., a cancer) that is assisted by abnormal angiogenic activity. Such close group conditions include, e.g., without limitation, benign tumors, e.g., such as hemangiomas, acoustic neuromas, neurofibromas, trachomas, and pyogenic granulomas; atherosclerotic plaques; ocular angiogenic diseases, e.g., diabetic retinopathy, retinopathy of prematurity, macular degeneration, cornea graft rejection, neovascular glaucoma, retrolental fibroplasia, rubeosis, retinoblastoma, uvietis and Pterygia (abnormal blood vessel growth) of the eye; rheumatoid arthritis; psoriasis; delayed wound healing; endometriosis; vasculogenesis; granulations; hypertrophic scars (keloids) ; nonunion fractures; scleroderma; trachoma; vascular adhesions; myocardial angiogenesis; coronary collaterals; cerebral collaterals; arteriovenous malformations; ischemic limb angiogenesis; Osier-Webber Syndrome; plaque neovascularization; telangiectasia; hemophiliac joints; angiofibroma; fibromuscular dysplasia; wound granulation; Crohn's disease; and atherosclerosis.
For example, within another aspect of the present invention methods are provided for modulating, ameliorating, treating, preventing, and/or diagnosing hypertrophic scars and keloids, comprising administering an LP to a site of hypertrophic scar or keloid formation. Within one embodiment, the method involves a direct injection into a hypertrophic scar or keloid, to provide a beneficial effect, e.g., by preventing progression of such a lesion. This method is of particular value to a prophylactic treatment of a condition known to result in the development of a hypertrophic scar or a keloid (e.g., burns), and is preferably initiated after the proliferative phase of scar formation has had time to progress (approximately, e.g., 14 days after the initial injury) , but before hypertrophic scar or keloid development . As noted above, the present invention also provides methods for ameliorating, treating, preventing, and/or diagnosing neovascular diseases of the eye, including e.g., corneal graft neovascularization, neovascular glaucoma, proliferative diabetic retinopathy, retrolental fibroplasia and macular degeneration. Moreover, ocular diseases, disorders, syndromes, and/or conditions associated with neovascularization that can be modulated ameliorated, treated, prevented, and/or diagnosed with an LP include, e.g., without limit; neovascular glaucoma, diabetic retinopathy, retinoblastoma, retrolental fibroplasia, uveitis, retinopathy of premature macular degeneration, corneal graft neovascularization, as well as other inflammatory eye diseases, ocular tumors, and diseases associated with choroidal or iris neovascularization (see, e.g., reviews by Waltman, et al . , (1978) Am. J. Ophthal. 8.51704-710 and Gartner, et al . , (1978) Sun. Ophthd. 22:291- 3 12). Thus, within one aspect of the present invention methods are provided for treating or preventing neovascular diseases of the eye such as corneal neovascularization
(including corneal graft neovascularization) , comprising administering to a patient a therapeutically effective amount of an LP composition to the cornea, such that the formation of blood vessels is inhibited or delayed. Briefly, the cornea is a tissue that normally lacks blood vessels. In certain pathological conditions however, capillaries may extend into the cornea from the pericorneal vascular plexus of the limbus . When the cornea becomes vascularized, it also becomes clouded, resulting in a decline in the patient's visual acuity. Visual loss may become complete if the cornea completely opacifies. A wide variety of diseases, disorders, syndromes, and/or conditions can result in corneal neovascularization, including e.g., corneal infections (e.g., trachoma, herpes simplex keratitis, leishmaniasis and onchocerciasis) , immunological processes (e.g., graft rejection and Stevens-Johnson' s syndrome) , alkali burns, trauma, inflammation (of any cause) , toxic and nutritional deficiency states, and as a complication of using contact lenses.
Within particularly preferred embodiments, an LP composition may be prepared for topical administration in saline (combined with any of the preservatives and antimicrobial agents commonly used in ocular preparations) , and administered in drop form to the eye. The solution or suspension may be prepared in its pure form and administered several times daily. Alternatively, anti-angiogenic compositions, prepared as described herein, may also be administered directly to the cornea. Within preferred embodiments, an anti- angiogenic composition is prepared with a muco-adhesive polymer, which binds to the cornea. Within further embodiments, an anti-angiogenic factor or anti-angiogenic LP composition may be utilized as an adjunct to conventional steroid therapy. Topical therapy may also be useful prophylactically in corneal lesions that are known to have a high probability of inducing an angiogenic response (such as, e.g., a chemical burn). In these instances, the treatment (likely in combination with steroids) may be instituted immediately to help prevent subsequent complications. Within other embodiments, an LP composition may be injected directly into the corneal stroma using microscopic guidance by an ophthalmologist. The preferred site of injection may vary with the morphology of the individual lesion, but the goal of the administration is to place a composition of the invention at the advancing front of the vasculature (i.e., interspersed between the blood vessels and the normal cornea) . In most instances, this would involve perilimbic corneal injection to "protect" the cornea from advancing blood vessels. This method may also be utilized shortly after a corneal insult to prophylactically prevent corneal neovascularization. In such a situation, the composition could be injected into the perilimbic cornea interspersed between the corneal lesion and its undesired potential limbic blood supply. Such methods may also be utilized in a similar fashion to prevent capillary invasion of transplanted corneas. In a sustained- release form, injections might only be required 2-3 times per year. A steroid could also be added to the injection solution to reduce inflammation resulting from the injection itself.
Within another aspect, methods are provided for treating or preventing neovascular glaucoma, comprising administering to a patient a therapeutically effective amount of an LP to the eye, such that the formation of blood vessels is inhibited. In one embodiment, the composition may be administered topically to the eye to treat or prevent early forms of neovascular glaucoma. Within other embodiments, the composition may be implanted by injection into the region of the anterior chamber angle. Within other embodiments, the composition may also be placed in any location such that the composition is continuously released into the aqueous humor. Within another aspect, methods are provided for treating or preventing proliferative diabetic retinopathy, comprising administering to a patient a therapeutically effective amount of an LP to the eyes, such that the formation of blood vessels is inhibited. Within a particularly preferred embodiment, proliferative diabetic retinopathy may be treated by injection into the aqueous or the .vitreous humor, to increase the local concentration of a composition of the invention in the retina. Preferably, this treatment should be initiated before the acquisition of severe disease requiring photocoagulation.
Within another aspect of the present invention, methods are provided for treating or preventing retrolental fibroplasia, comprising administering to a patient a beneficially effective amount of an LP to the eye, such that the formation of blood vessels is inhibited. The composition may be administered topically, via intravitreous injection and/or via intraocular implants. Additional, diseases, disorders, syndromes, and/or conditions that can be modulated, ameliorated, treated, •prevented, and/or diagnosed with an LP include, e.g., without limitation, hemangioma, arthritis, psoriasis, angiofibroma, atherosclerotic plaques, delayed wound healing, granulations, hemophilic joints, hypertrophic scars, nonunion fractures, Osier-Weber syndrome, pyogenic granuloma, scleroder a, trachoma, and vascular adhesions.
Moreover, diseases, disorders, states, syndromes, and/or conditions that can be modulated, ameliorated, treated, prevented, and/or diagnosed with an LP include, e.g., without limitation, solid tumors, blood born tumors such as leukemias, tumor metastasis, Kaposi' s sarcoma, benign tumors (e.g., hemangiomas) , acoustic neuromas, neurofibromas, trachomas, and pyogenic granulomas, rheumatoid arthritis, psoriasis, ocular angiogenic diseases, e.g., diabetic retinopathy, retinopathy of prematurity, macular degeneration, corneal graft rejection, neovascular glaucoma, retrolental fibroplasia, rubeosis, retinoblastoma, and uvietis, delayed wound healing, endometriosis, vasculogenesis, granulations, hypertrophic scars (keloids), nonunion fractures, scleroderma, trachoma, vascular adhesions, myocardial angiogenesis, coronary collaterals, cerebral collaterals, arteriovenous malformations, ischemic limb angiogenesis, Osier-Webber Syndrome, plaque neovascularization, telangiectasia, hemophiliac joints, angiofibroma fibromuscular dysplasia, wound granulation, Crohn's disease, syndrome, atherosclerosis, birth-control inhibition of vascularization necessary for embryo implantation during the control of menstruation, and diseases that have angiogenesis as a pathologic consequence such as, e.g., cat scratch disease (Rochele minalia quintosa) , ulcers (Helicobacter pylori) , Bartonellosis and bacillary angiomatosis.
In another embodiment as a birth control method, an amount of an LP sufficient to block embryo implantation is administered before or after intercourse and fertilization have occurred, thus providing an effective method of birth control, possibly a "morning after" method. An LP may also be used in controlling menstruation or administered either as a peritoneal lavage fluid or for peritoneal implantation in the treatment of endometriosis. An LP may be utilized in a wide-variety of surgical procedures. For example, within one aspect of the present invention a compositions (in the form of, e.g., a spray or film) may be utilized to coat or spray an area before removal of a tumor, to isolate normal surrounding tissues from malignant tissue, and/or to prevent the spread of disease to surrounding tissues. Within other aspects, an LP composition (e.g., in the form of a spray) may be delivered via endoscopic procedures to coat tumors, or inhibit angiogenesis in a desired locale.
Within yet another aspect, surgical meshes that have been coated with an anti-angiogenic composition of the invention may be utilized in a procedure in which a surgical mesh might be utilized. For example, a surgical mesh laden with an anti-angiogenic composition may be utilized during cancer resection surgery (e.g., abdominal surgery subsequent to colon resection) to provide support to the structure, and to release an amount of the anti-angiogenic factor.
Within further aspects of the present invention, methods are provided for treating tumor excision sites, comprising administering an LP to the resection margins of a tumor after excision, such that the local recurrence of cancer and the formation of new blood vessels at the site is inhibited.
Within one embodiment, an anti-angiogenic composition of the invention is administered directly to a tumor excision site (e.g., applied by swabbing, brushing or otherwise coating the resection margins of the tumor with the anti-angiogenic composition) . Alternatively, an anti- angiogenic composition may be incorporated into a known surgical paste before administration.
Within a particularly preferred embodiment, an anti- angiogenic composition of the invention is applied after hepatic resections for malignancy, and after neurosurgical operations. Within another aspect, administration can be to a resection margin of a wide variety of tumors, including e.g., breast, colon, brain, and hepatic tumors. For example, within one embodiment, anti-angiogenic compositions may be administered to the site of a neurological tumor after excision, such that the formation of new blood vessels at the site is inhibited.
An LP may also be administered along with other anti- angiogenic factors such as, e.g., without limitation, Anti- Invasive Factor, retinoic acid, (and derivatives thereof) , paclitaxel, Suramin, Tissue Inhibitor of Metalloproteinase- 1, Tissue Inhibitor of Metalloproteinase-2 , Plasminogen Activator Inhibitor-1, Plasminogen Activator Inhibitor-2, and various forms of the lighter "d group" transition metals. Lighter "d group" transition metals include, e.g., vanadium, molybdenum, tungsten, titanium, niobium, and tantalum species. Such transition metal species may form transition metal complexes. Suitable complexes of the above-mentioned transition metal species include, e.g., oxo transition metal complexes. Representative examples of vanadium complexes include, e.g., oxo-vanadium complexes such as vanadate, and vanadyl complexes. Suitable vanadate complexes include, e.g., metavanadate, and orthovanadate complexes (such as, e.g.," ammonium metavanadate, sodium metavanadate, and sodium orthovanadate) . Suitable vanadyl complexes include, e.g., vanadyl acetylacetonate and vanadyl sulfate, including vanadyl sulfate hydrates (such as vanadyl sulfate mono- and trihydrates) . Representative examples of tungsten and molybdenum complexes also include, e.g., oxo complexes. Suitable oxo-tungsten complexes include, e.g., tungstate, and tungsten oxide complexes. Suitable tungstate complexes include, e.g., ammonium tungstate, calcium tungstate, sodium tungstate dihydrate, and tungstic acid. Suitable tungsten oxides include, e.g., tungsten (IV) oxide, and tungsten (VI) oxide. Suitable oxo-molybdenum complexes include, e.g., molybdate, molybdenum oxide, and molybdenyl complexes. Suitable molybdate complexes include, e.g., ammonium molybdate (and its hydrates) , sodium molybdate (and its hydrates) , and potassium molybdate (and its hydrates) . Suitable molybdenum oxides include, e.g., molybdenum (VI) oxide, molybdenum (VI) oxide, and molybdic acid. Suitable molybdenyl complexes include, e.g., molybdenyl acetylacetonate . Other suitable tungsten and molybdenum complexes include, e.g., hydroxo derivatives derived from, e.g., glycerol, tartaric acid, and sugars.
A wide variety of other anti-angiogenic factors may also be utilized within the context of the present invention. Representative examples include, e.g., without limitation, platelet factor 4; protamine sulfate; sulfated chitin derivatives (prepared from queen crab shells; Murata, et al., Cancer Res. 5 1:22-26, 1991); Sulfated Polysaccharide Peptidoglycan Complex (SP-PG; the function of this compound may be enhanced by the presence of steroids such as estrogen, and tamoxifen citrate) ; Staurosporine; modulators of matrix metabolism, (including e.g., proline analogs); cishydroxyproline; d, L-3 , 4-dehydroproline; Thiaproline; alpha alpha-dipyridyl; aminopropionitrile fumarate; 4-propyl-5- (4-pyridinyl) -2 (3H) -oxazolone; Methotrexate; Mitoxantrone; Heparin; Interferons; 2 Macroglobulin-serum; ChIMP-3 (Pavloff, et al . , J. Bio. Chem.267.17321-17326, 1992); Chymostatin (Tomkinson, et al . , Biochem J. 286:475-480, 1992); Cyclodextrin
Tetradecasulfate; Eponemycin; Camptothecin; Fumagillin (Ingber, et al . , Nature 348:555-557, 1990); Gold Sodium Thiomalate ("GST"; Matsubara and Ziff, J. Clin. Invest. 79: 1440-1446, 1987) ; anticollagenase-serum; alpha-2-antiplasmin (Holmes, et al . , J. Biol. Chem. 262(4): 1659-1664 (1987)); Bisantrene (National Cancer Institute) ; Lobenzarit disodium (N- (2) -carboxyphenyl-4-chloroanthronilic acid disodium or "CCA"; Takeuchi, et al . , Agents Actions 36:312-316, (1992)); Thalido ide; Angostatic steroid; AGM- 1470; carboxynaminolmidazole; and metalloproteinase inhibitors such as BB94. Diseases at the Cellular Level
Diseases associated with increased cell survival or the inhibition of apoptosis that could be modulated, ameliorated, treated, prevented, and/or diagnosed by an LP include, e.g., cancers (such as, e.g., follicular lymphomas, carcinomas with p53 mutations, and hormone- dependent tumors, including, e.g., but without limit, colon cancer, cardiac tumors, pancreatic cancer, melanoma, retinoblastoma, glioblastoma, lung cancer, intestinal cancer, testicular cancer, stomach cancer, neuroblastoma, myxoma, myoma, lymphoma, endothelioma, osteoblastoma, osteoclastoma, osteosarcoma, chondrosarcoma, adenoma, breast cancer, prostate cancer, Kaposi ' s sarcoma and ovarian cancer); autoimmune conditions (such as, e.g., multiple sclerosis, Sjogren's syndrome, Hashimoto's thyroiditis, biliary cirrhosis, Behcet's disease syndrome, Crohn's disease syndrome, polymyositis, systemic lupus erythematosus, immune-related glomerulonephritis, and rheumatoid arthritis); viral infections (such as, e.g., herpes viruses, pox viruses, and adenoviruses) ; inflammation; graft v. host disease syndrome, acute graft rejection, and chronic graft rejection.
In preferred embodiments, an LP is used to inhibit growth, progression', and/or metastases of cancers such as, in particular, those listed herein. Additional diseases, states, syndromes, or conditions associated with increased cell survival that could be modulated, ameliorated, treated, prevented, or diagnosed by an LP include, e.g., without limitation, progression, and/or metastases of malignancies and related disorders such as leukemia including acute leukemias (such as, e.g., acute lymphocytic leukemia, acute myelocytic leukemia, including myeloblastic, promyelocytic, myelomonocytic, monocytic, and erythroleukemia) and chronic leukemias (e.g., chronic myelocytic, chronic granulocytic, leukemia, and chronic lymphocytic leukemia) ) , polycythemia Vera, lymphomas (e.g., Hodgkin's disease, and non-Hodgkin ' s disease), multiple myeloma, Waldenstrom' s macroglobulinemia, heavy chain disease, syndrome, and solid tumors including, e.g., without limitation, sarcomas and carcinomas (such as, e.g., fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas , cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilm's tumor, cervical cancer, testicular tumor, lung carcinoma, small cell lung carcinoma, bladder carcinoma, epithelial carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, menangioma, melanoma, neuroblastoma, and retinoblastoma) . Diseases associated with increased apoptosis that could be modulated, ameliorated, treated, prevented, and/or diagnosed by an LP include, e.g., AIDS, conditions (such as, e.g., Alzheimer's disease syndrome, Parkinson's disease syndrome, Amyotrophic lateral sclerosis, Retinitis pigmentosa, Cerebellar degeneration and brain tumor, or prion associated disease) ; autoimmune conditions (such as, e.g., multiple sclerosis, Sjogren's syndrome, Hashimoto's thyroiditis, biliary cirrhosis, Behcet's disease syndrome, Crohn's disease syndrome, polymyositis, systemic lupus erythematosus, immune-related glomerulonephritis, and rheumatoid arthritis) ; myelodysplastic syndromes (such as aplastic anemia) , graft v. host disease syndrome; ischemic injury (such as that caused by myocardial infarction, stroke and reperfusion injury); liver injury (such as, e.g., hepatitis related liver injury, ischemia reperfusion injury, cholestosis (bile duct injury) , and liver cancer) ; toxin- induced liver disease (such as, e.g., that caused by alcohol), septic shock, cachexia, and anorexia.
Wound Healing and Epithelial Cell Proliferation
In accordance with yet a further aspect of the invention, there is provided a process for using an LP to stimulate epithelial cell proliferation and basal keratinocytes for the purpose of, e.g., wound healing, to stimulate hair follicle production, and to heal a dermal wound.
An LP composition may be clinically useful in stimulating wound healing including e.g., surgical wounds, excisional wounds, deep wounds involving damage of the dermis and epidermis, eye tissue wounds, dental tissue wounds, oral cavity wounds, diabetic ulcers, dermal ulcers, cubitus ulcers, arterial ulcers, venous stasis ulcers, burns resulting from exposure heat or chemicals, abnormal wound healing conditions associated with e.g., uremia, malnutrition, vitamin deficiency and wound healing complications associated with systemic treatment with steroids, radiation therapy, anti-neoplastic drugs, and anti-metabolites. An LP could be used to promote dermal reestablishment after dermal loss. An LP could be used to increase the adherence of skin grafts to a wound bed and to stimulate re-epithelialization from the wound bed. The following is a non-exhaustive list of grafts that an LP could be used to increase adherence to: a wound bed, autografts, artificial skin, allografts, autodermic grafts, autoepidermic grafts, avascular grafts,
Blair-Brown grafts, bone grafts, brephoplastic grafts, cutis grafts, delayed grafts, dermic grafts, epidermic grafts, fascia grafts, full thickness grafts, heterologous grafts, xenografts, homologous grafts, hyperplastic grafts, lamellar grafts, mesh grafts, mucosal grafts, 011ier-Tb.ier.sch. grafts, o enpal grafts, patch grafts, pedicle grafts, penetrating grafts, split skin grafts, and thick split grafts. An LP can be used to promote skin strength and to improve the appearance of aged skin. It is believed that an LP will also produce changes in hepatocyte proliferation, and epithelial cell proliferation in, for example, the lung, breast, pancreas, stomach, small intestine, and large intestine. Epithelial cell proliferation can be effected in epithelial cells such as, e.g., sebocytes, hair follicles, hepatocytes, type II pneumocytes, mucin-producing goblet cells, and other epithelial cells or their progenitors which are contained within the skin, lung, liver, and gastrointestinal tract. An LP may: promote proliferation of endothelial cells, keratinocytes, and basal keratinocytes; it could also be used to reduce the side effects of gut toxicity that result from radiation, chemotherapy treatments or viral infections, it may have a cytoprotective effect on the small intestine mucosa; it may also stimulate healing of mucositis (mouth ulcers) that result from chemotherapy and viral infections, it could further be used in full regeneration of skin in full and partial thickness skin defects, including burns, (i.e., re-population of hair follicles, sweat glands; and sebaceous glands) , treatment of other skin defects such as psoriasis, it also could be used to treat epidermolysis bullosa, a defect in adherence of the epidermis to the underlying dermis which results in frequent, open and painful blisters by accelerating re-epithelialization of these lesions; it could also be used to treat gastric and doudenal ulcers and help heal by scar formation of the mucosal lining and regeneration of glandular mucosa and duodenal mucosal lining more rapidly. Inflammatory bowel diseases, such as Crohn's disease and ulcerative colitis, are diseases that result in destruction of the mucosal surface of the small or large intestine, respectively. Thus, an LP could be used to promote resurfacing of a mucosal surface to aid more rapid healing and to prevent progression of inflammatory bowel disease resulting in a desired effect, e.g., such as on the production of mucus throughout the gastrointestinal tract and the protection of intestinal mucosa from injurious substances that are ingested or following surgery. An LP could be used to treat a condition associated with the under expression of an LP polynucleotide sequence or an LP polypeptide of the present invention (or fragment thereof) , or an agonist or antagonist thereto . Moreover, an LP could be used to prevent and heal damage to the lungs due to various pathological states, such as, e.g., stimulating proliferation and differentiation to promote repair of alveoli and bronchiolar epithelium. For example, emphysema, inhalation injuries, that (e.g., from smoke inhalation) and burns, which cause necrosis of the bronchiolar epithelium and alveoli could be effectively ameliorated, treated, prevented, and/or diagnosed using a polynucleotide or polypeptide of the invention (or fragment thereof), or an agonist or antagonist thereto.
Also, an LP could be used to stimulate the proliferation of and differentiation of type II pneumocytes, to help treat or prevent hyaline membrane diseases, such as e.g., infant respiratory distress syndrome and bronchopulmonary displasia, (in premature infants) . An LP could stimulate the proliferation and/or differentiation of a hepatocyte and, thus, could be used to alleviate or treat a liver condition such as e.g., fulminant liver failure (caused, e.g., by cirrhosis), liver damage caused by viral hepatitis and toxic substances (e.g., acetaminophen, carbon tetrachloride, and other known hepatotoxins) .
In addition, an LP could be used treat or prevent the onset of diabetes mellitus. In patients with newly diagnosed Types I and II diabetes, where some islet cell function remains, an LP could be used to maintain the islet function so as to alleviate, modulate, ameliorate, delay, or prevent permanent manifestation of the disease. In addition, an LP could be used as an auxiliary in islet cell transplantation to improve or promote islet cell function.
Regeneration
An LP composition of the invention can be used e.g., to differentiate a cell, tissue; or biological structure, de- differentiate a cell, tissue; or biological structure; cause proliferation in cell or a zone (similar to a ZPA in a limb bud), have an effect on chemotaxis, remodel a tissue (e.g., basement membrane, extra cell matrix, connective tissue, muscle, epithelia) , or initiate the regeneration of a tissue, organ, or biological structure (see, e.g., Science (1997) 276:59-87) . Regeneration using an LP composition of the invention could be used to repair, replace, remodel, or protect tissue damaged by, e.g., congenital defects, trauma (such as, e.g., wounds, burns, incisions, or ulcers) ; age; disease (such as, e.g., osteoporosis, osteoarthritis, periodontal disease syndrome, or liver failure), surgery, (including, e.g., cosmetic plastic surgery) ; fibrosis; re-perfusion injury; or cytokine damage. Tissues that can be regenerated include, e.g., without limitation, organs (e.g., pancreas, liver, intestine, kidney, epithelia, endothelium) , muscle (smooth, skeletal, or cardiac), vasculature (including vascular and lymphatics), nervous system tissue, cells, or structures; hematopoietic tissue; and skeletal (bone, cartilage, tendon, and ligament) tissue. Preferably, regeneration occurs with little or no scarring. Regeneration also may include, e.g., angiogenesis.
Moreover, an LP composition may increase the regeneration of an aggregation of special cell types, a tissue, or a matrix that typically is difficult to heal. For example, by increasing the rate at which a tendon/ligament heals after damage. Also encompassed is using an LP prophylactically to avoid damage (e.g., in an interstitial space of a joint or on the cartalagenous capsule of a bone) .
Specific diseases that could be modulated, ameliorated, treated, prevented, and/or diagnosed using an LP composition include, e.g., without limitation, tendinitis, carpal tunnel syndrome, and other tendon or ligament defects. Examples of non-healing wounds include, wounds that would benefit form regeneration treatment, e.g., without limit pressure ulcers, ulcers associated with vascular insufficiency, surgical wounds, and traumatic wounds. Similarly, nerve and brain tissue also could be regenerated using an LP. Such nervous system conditions that could be modulated, ameliorated, treated, prevented, and/or diagnosed using an LP composition include, e.g., without limitation, central and peripheral nervous system diseases, neuropathies, or mechanical and traumatic conditions (e.g., spinal cord disorders or syndromes, head trauma, cerebrovascular disease syndrome, and stoke) . Specifically, diseases associated with peripheral nerve injuries include, e.g., without limitation, peripheral neuropathy (e.g., resulting from chemotherapy or other medical therapies) , localized neuropathies, and central nervous system diseases (e.g., Alzheimer's disease syndrome, Parkinson's disease syndrome, Huntington's disease syndrome, Amyotrophic lateral sclerosis, and Shy-Drager syndrome) . All could be ameliorated, treated, prevented, and/or diagnosed using an LP.
Chemotaxis
An LP may have an effect on a chemotaxis activity. Briefly, chemotactic molecules can attract or mobilize (but may also repeal) cells (e.g., monocytes, fibroblasts, neutrophils, T-cells, mast cells, eosinophils, epithelial and/or endothelial cells) or cell processes (e.g., filopodia, psuedopodia, lamellapodia, dendrites, axons, etc.) to a particular site (e.g., such as inflammation, infection, site of hyperproliferation, the floor plate of the developing spinal cord, etc.) . In some instances, such mobilized cells can then fight off and/or modulate a particular trauma, abnormality, condition, syndrome, or disease. An LP may have an effect on a chemotactic activity of a cell (such as, e.g., an attractive or repulsive effect) . A chemotactic molecule can be used to modulate, ameliorate, treat, prevent, and/or diagnose inflammation, infection, hyperproliferative diseases, disorders, syndromes, and/or conditions, or an immune system disorder by increasing the number of cells targeted to a particular location in the body. For example, a chemotactic molecule can be used to attract an immune cell to an injured location in a subject. An LP that had an effect on a chemotactant could also attract a fibroblast, which can be used to modulate, ameliorate, and/or treat a wound. It is also contemplated that an LP may inhibit a chemotactic activity to modulate, ameliorate, treat, prevent, and/or diagnose a disease, disorder, syndrome, and/or a condition.
Sequences encoding an LP polypeptide (or fragment thereof) are used for the diagnosis of disorders associated with LP (such as, e.g., LP misexpression, LP overexpression, LP underexpression, etc.). Examples of such disorders include, without limit, a cell proliferative disorder such as actinic keratosis, arteriosclerosis, atherosclerosis, bursitis, cirrhosis, hepatitis, mixed connective tissue disease (MCTD) , myelofibrosis, paroxysmal nocturnal hemoglobinuria, polycythemia vera, psoriasis, primary thrombocythemia, and cancers including adenocarcinoma, leukemia, lymphoma, melanoma, myeloma, Hamartoma, sarcoma, teratocarcinoma, and, in particular, a cancer of the adrenal gland, bladder, bone, bone marrow, brain, breast, cervix, gall bladder, ganglia, gastrointestinal tract, heart, kidney, liver, lung, muscle, ovary, pancreas, parathyroid, penis, prostate, salivary glands, skin, spleen, testis, thymus, thyroid, and uterus; an autoimmune/inflammatory disorder such as acquired immunodeficiency syndrome (AIDS) , Addison's disease, adult respiratory distress syndrome, allergies, ankylosing spondylitis, amyloidosis, anemia, asthma, atherosclerosis, autoimmune hemolytic anemia, autoimmune thyroiditis, autoimmune polyendocrinopathy- candidiasis-ectodermal dystrophy (APECED) , bronchitis, cholecystitis, contact dermatitis, Crohn's disease, atopic dermatitis, dermatomyositis, diabetes mellitus, emphysema, episodic lymphopenia with lymphocytotoxins, erythroblastosis fetalis, erythema nodosum, atrophic gastritis, glomerulonephritis, Goodpasture' s syndrome, gout, Graves' disease, Hashimoto's thyroiditis, hypereosinophilia, irritable bowel syndrome, multiple sclerosis, myasthenia gravis, myocardial or pericardial inflammation, osteoarthritis, osteoporosis, pancreatitis, polymyositis, psoriasis, Reiter's syndrome, rheumatoid arthritis, scleroderma, Sjδgren's syndrome, systemic anaphylaxis, systemic lupus erythematosus, systemic sclerosis, thrombocytopenic purpura, ulcerative colitis, uveitis, Werner syndrome, complications of cancer, hemodialysis, and extracorporeal circulation, viral, bacterial, fungal, parasitic, protozoal, and helminthic infections, and trauma; a cardiovascular disorder such as congestive heart failure, ischemic heart disease, angina pectoris, myocardial infarction, hypertensive heart disease, degenerative valvular heart disease, calcific aortic valve stenosis, congenitally bicuspid aortic valve, mitral annular calcification, mitral valve prolapse, rheumatic fever and rheumatic heart disease, infective endocarditis, nonbacterial thrombotic endocarditis, endocarditis of systemic lupus erythematosus, carcinoid heart disease, cardiomyopathy, myocarditis, pericarditis, neoplastic heart disease, congenital heart disease, complications, of cardiac transplantation, arteriovenous fistula, atherosclerosis, hypertension, vasculitis, Raynaud's disease, aneurysms, arterial dissections, varicose veins, thrombophlebitis and phlebothrombosis, vascular tumors, and complications of thrombolysis, balloon angioplasty, vascular replacement, and coronary artery bypass graft surgery; a neurological disorder such as epilepsy, ischemic cerebrovascular disease, stroke, cerebral neoplasms, Alzheimer's disease, Pick's disease, Huntington's disease, dementia, Parkinson's disease and other extrapyramidal disorders, Amyotrophic lateral sclerosis and other motor neuron disorders, progressive neural muscular atrophy, retinitis pigmentosa, hereditary ataxias, multiple sclerosis and other demyelinating diseases, bacterial and viral meningitis, brain abscess, subdural edema, epidural abscess, suppurative intracranial thrombophlebitis, myelitis and radiculitis, viral central nervous system disease, prion diseases including kuru, Creutzfeldt-Jakob disease, and Gerstmann- Straussler-Scheinker syndrome, fatal familial insomnia, nutritional and metabolic diseases of the nervous system, neurofibromatosis, tuberous sclerosis, cerebelloretinal hemangioblastomatosis, encephalotrigeminal syndrome, mental retardation and other developmental disorders of the central nervous system including Down syndrome, cerebral palsy, neuroskeletal disorders, autonomic nervous system disorders, cranial nerve disorders, spinal cord diseases, muscular dystrophy and other neuromuscular disorders, peripheral nervous system disorders, dermatomyositis and polymyositis, inherited, metabolic, endocrine, and toxic myopathies, myasthenia gravis, periodic paralysis, mental disorders including mood, anxiety, and schizophrenic disorders, seasonal affective disorder (SAD) , akathesia, amnesia, catatonia, diabetic neuropathy, tardive dyskinesia, dystonias, paranoid psychoses, post-therapeutic neuralgia, Tourette's disorder, progressive supranuclear palsy, corticobasal degeneration, and familial frontotemporal dementia; and a developmental disorder such as renal tubular acidosis, anemia, Cushing's syndrome, achondroplastic dwarfism, Duchenne and Becker muscular dystrophy, epilepsy, gonadal dysgenesis, WAGR syndrome (Wilms' tumor, aniridia, genitourinary abnormalities, and mental retardation) , Smith- Magenis syndrome, myelodysplastic syndrome, hereditary mucoepithelial dysplasia, hereditary keratodermas , hereditary neuropathies such as Charcot-Marie-Tooth disease and neurofibromatosis, hypothyroidism, hydrocephalus, seizure disorders such as Syndenham's chorea and cerebral palsy, spina bifida, anencephali, craniorachischisis, congenital glaucoma, cataract, and sensorineural hearing loss. Sequences encoding an LP polypeptide (or fragment thereof) are used in Southern or northern analysis; dot blot or other membrane-based technologies; PCR technologies; in dipstick, pin, and multiformat ELISA-like assays; and in microarrays utilizing fluids or tissues from a subject; to detect an altered LP polypeptide (or fragment thereof) expression. Such qualitative or quantitative methods are well known in the art.
In a particular aspect, a sequence encoding an LP polypeptide (or fragment thereof) is used in an assay to detect the presence of an associated disorder, state, condition, syndrome, or disease (particularly, e.g., any mentioned above) . Sequences encoding LP polypeptide (or fragments thereof) are labeled by standard methods and added to a sample under conditions suitable to form detectable hybridization complexes, wherein the resulting signals are quantified and compared with standard values. Any sample signal sufficiently different from a control implies the detection of an altered LP level that can be correlated with the disorder, state, condition, syndrome, or disease associated with the sample or the subject from whom the sample was obtained. Such assays are also used to evaluate the efficacy of a particular treatment regimen (e.g., in an animal study, a clinical trial, or the treatment of an individual subject) .
To provide a basis for the diagnosis of a disorder, state, condition, syndrome, or disease associated with LP expression, a normal or standard profile of expression is established (e.g., this can be accomplished by combining a sample taken from a normal subject with a sequence encoding an LP polypeptide (or fragment thereof) under conditions suitable for hybridization or amplification) . Standard hybridization is quantified by comparing values obtained from subjects with control values (in which a known amount of a substantially purified polynucleotide is used) . Standard values are then compared with values obtained from samples of subjects who have a disorder, state, condition, syndrome, or disease suspected of being associated with an LP polypeptide (or fragment thereof) . Any detectable deviations from standard values are used to correlate the presence of a disorder, state, condition, syndrome, or disease with the LP. Once the presence of a disorder, state, condition, syndrome, or disease is established and a treatment protocol is initiated, hybridization assays are repeated on a regular basis to monitor the level of LP expression. The results obtained from successive assays are used to show the efficacy of treatment over a period ranging from several days to months . With respect to disorders of cell proliferation (e.g., a cancer) , the presence of an abnormal amount of transcript (either under- or over expressed) in biopsied tissue from a subject may indicate a predisposition for the development of a disorder, state, condition, syndrome, or disease of cell proliferation or it may provide a means for detecting such a disorder, state, condition, syndrome, or disease prior to the appearance of actual clinical symptoms. A more definitive initial detection may allow earlier treatment thereby preventing and/or ameliorating further progression of cell proliferation.
Additional diagnostic uses for oligonucleotides designed from an LP sequence may involve the use of PCR. These oligomers are chemically synthesized, generated enzymatically, or produced in vitro. Oligomers will preferably contain a fragment of a sequence encoding an LP polypeptide (or fragment thereof) , or a fragment of a sequence complementary to the sequence encoding an LP polypeptide (or fragment thereof) , and will be employed under optimized conditions to identify a specific gene or disorder, state, condition, syndrome, or disease. Oligomers may also be employed under less stringent conditions for detection or quantification of closely related DNA or RNA sequences .
LP & Inflammation Systemic inflammatory states are frequently accompanied by activation of the coagulation system and activation of the coagulation system is almost an invariable consequence of septic shock. The simultaneous activation of the innate immune response and the coagulation system after injury is a phylogenetically ancient, adaptive response that can be traced back to the early stages of eukaryotic evolution. Most invertebrate species lack differentiated phagocytic cells and platelets. They possess a common cellular and humoral pathway of inflammation and clotting after a breach in their internal milieu by either trauma or infection. The close linkage between clotting and inflammation has been preserved throughout vertebrate evolution and is readily demonstrable in human physiologic responses to a variety of potentially injurious stimuli. The same pro-inflammatory stimuli that activate the human clotting cascade also activate phagocytic effector cells (such as, e.g., neutrophils, monocytes, and macrophages) . Consequently, the role of an LP in physiological functions will likely cross artificial boundaries designated solely as inflammation or immune responses and thus information suggesting a role for an LP of the invention in inflammation is also indicative of a role for the LP in an immune response and vice versa.
Consequently, an LP, LP variant, LP agonist, LP antagonist, LP binding partner or an LP fragment as described herein may exhibit anti-inflammatory activity. The anti-inflammatory activity may be achieved by providing a stimulus to cells involved in the inflammatory response, by inhibiting or promoting cell-cell interactions (such as, for example, cell adhesion) , by inhibiting or promoting chemotaxis of cells involved in the inflammatory process, inhibiting or promoting cell extravasation, or by stimulating or suppressing production of other factors which more directly inhibit or promote an inflammatory response. Proteins exhibiting such activities can be used to treat inflammatory conditions including chronic or acute conditions) , including without limitation inflammation associated with infection (such as septic shock, sepsis or systemic inflammatory response syndrome (SIRS) ) , ischemia- reperfusion injury, endotoxin lethality, arthritis, complement-mediated hyperacute rejection, nephritis, cytokine or chemokine-induced lung injury, inflammatory bowel disease, Crohn's disease or resulting from over production of cytokines such as TNF or IL-1. An LP, LP variant, LP agonist, LP antagonist, LP binding partner or an LP fragment may also be useful to treat anaphylaxis and hypersensitivity to an antigenic substance or material. LP & Sepsis
To test the role of an LP of the invention in preventing life threatening fever, circulatory collapse, intravascular coagulation, hemorrhagic necrosis, and/or multiple organ failure one can adopt any of a number of art known animal sepsis models.
In one embodiment a sepsis model should have: (1) animals that show clinical signs of sepsis (malaise, fever, chills, generalized weakness); (2) septic insult that occurs over a period of time to allow the animal time to respond to the insult and attempt to overcome it; and (3) reproducibility so that a majority of prepared animals are available for study. Experimental means of inducing a septic state include: (1) intravenous infusion of live bacteria; (2) surgical disruption of cecal mucosal integrity; and (3) administration of live organisms into the peritoneal cavity via cecal slurry. In one example, female Balb/c mice (approximately eight weeks of age and weighing about 17-20 g) are placed (in sets of ten) into different treatment groups to test the effect of an LP of the invention to mediate a bacterial lipopolysaccharide (LPS) challenge which normally produces sepsis and/or endotoxemia followed by death (over a 72 hour time period) . LPS (50ug in 0.2mls of PBS) is administered by inter- peritoneal injection to each treatment mouse. Approximately one hour after LPS challenge, mice are given intravenous injections of an LP of the invention or a suitable negative control (e.g., such as, human albumin or Fc protein) varying dosages (e.g., such as, 0.1, 1.0, 5.0, 10.0, 20.0, 25.0,
30.0, 35.0, 40.0, 45.0, 50.0, 55.0 ug or in a range of from about 0.1 to about 100. Oug administered in about 0.2mls of PBS) . All mice are subsequently monitored for survival (3x daily) over a 72-hour time period. As a positive control, 1.5 ug of human IL-10 in 0.2 is of PBS + 0.1% human albumin will be mixed with 275 ug of LPS in 0.1 ml of PBS and then administered by inter-peritoneal injection. IL-10 protein has been shown to protect mice from a lethal challenge of LPS. Data is assessed (using standard indices such as, e.g., hemodynamic parameters (heart rate, systolic pressure, diastolic pressure, and mean blood pressure) ; serum cytokine levels (such as, e.g., IL-18, IL-12, IL-6, TNF alpha, IL-1 beta, IFN gamma, IL-10 and GM-CSF) , and serum: AST, ALT, ALP, triglyceride and, glucose levels) comparing the effects of LP to IL-10 protection.
Clinically, human patients experience intermittent release of toxin into the blood stream from a septic focus thus, to mimic such clinical situations, episodic release of organisms into the bloodstream can be desirable in a sepsis animal model. Cecal ligation and puncture (CLP)
(Wichterman, et al . 1980 J Surg Res 29:189-210; incorporated herein for these teachings) and fecal pellet implantation (Rose & Sayeed 1997 Shock 7:263-268; incorporated herein for these teachings) are two common methods of inducing sepsis in experimental animals that can be adapted to test an LP of the invention. Another model that can be adapted here involves the intraperitoneal injection of a cecal slurry where a quantified dose of cecal contents is used as injection material into the peritoneum to induce sepsis in experimental animals (Lang, et al . 1982 J Surg Res 35:201- 210; Lang, et al . 1984 Am J Physiol 246: R331-R337; 30. Sharma, et al . Shock 6:1-5; Kazarian, et al . 1994 Shock 1:201-212; all incorporated herein for these teachings).
Briefly, the cecal slurry method involves, a 0.25 cm vertical midline abdominal incision and cecal slurry is injected homogeneously throughout the peritoneum under direct vision. The incision is closed with an interrupted silk suture and the abdomen is gently massaged to distribute the injectate. Cecal slurry (200 mg cecal material/kg) is prepared by mixing cecal contents obtained from donor rats with 5% dextrose in water (D5W) to yield a concentration of 200 mg cecal material in 5 ml. The slurry is prepared fresh for each use and is administered within 2h to the experimental animal. Typically, within hours of the septic challenge, rats begin to manifest signs of septic shock such as piloerection and lethargy. Mean arterial blood pressure falls transiently, pulse pressure widens, and arterial blood lactate rises. Deaths in this model generally occur before 24 hours (-5%) , and between 5 and 7 days (40%) . At 24 hours, rats are hemodynamically stable, but display tachycardia, elevated arterial blood lactate, and leukopenia. By day 3 (72 hours) after sepsis induction, mean arterial pressure [MAP - 1/3 (systolic blood pressure - diastolic blood pressure) +diastolic blood pressure] is similar to pre-sepsis values, but pulse pressure remains widened —primarily due to a significant reduction in the diastolic arterial blood pressure. Also by day 3, lactic acidosis continues, and leukocytosis becomes evident. At 7 days after sepsis induction, MAP falls significantly, pulse pressure narrows (significantly different from pre-sepsis and day 3 of sepsis), heart rate elevates, and arterial blood lactate and white cell counts rise significantly over that seen on day 3 of sepsis. Septic rats undergo significant weight loss by 48-72 hours, and do not regain baseline weight by day 7 (compared to pre-sepsis values) ; while non-septic animals gain 9.5 ± 3 % weight over the same 7 day period. Non-septic rats display no significant changes in any other of the shown parameters over 7 days after a sham surgical procedure.
Characteristic indices to identify moribund rats utilize hemodynamic parameters of heart rate, systolic pressure, diastolic pressure, and mean blood pressure. Typically, a reliable index of 24 hour mortality can be predicted using the following criteria: 1) pulse pressure divided by diastolic blood pressure ± 50; and 2) diastolic blood pressure + 90 mm Hg. Generally, this index has a sensitivity of 94%, selectivity of 84%, diagnostic accuracy of 90% and positive predictive value of 92% (Mourelatos, et al . 1996 Shock 5:141-148; incorporated herein for these teachings) . Advantages of this method are: (1) it reduces inter-investigator variation; and (2) lethality is less severe allowing for more accurate approximations of clinical realities . The ceccal slurry model is associated with early changes consistent with septic shock (hypotension, elevated lactate, and leukopenia) , followed by a period of hyperdynamic sepsis with hemodynamic compensation but with deteriorating conditions through day 7 of sepsis. The increasing blood lactate and leukocytosis are also consistent with clinical sepsis, and indicate an ongoing septic process. This model also allows the study of the septic condition at various stages in the course of the disease. A rodent variation of the cecal slurry model has recently been described (Martineau & Shek 1997 Shock 5:446- 454; incorporated herein for these teachings), which utilizes an infusion system of standardized E. coli inoculum simulating a slow leakage of bacteria into the peritoneal cavity.
One can also adapt the baboon sepsis model of Taylor, et al., (1987 J. Clin. Invest. 79:918-925 or US 5,009,889; each incorporated herein for these teachings) . Briefly, septic conditions are induced by infusion of E. coli into animals at concentrations of 4X 1010 organisms/kg (body weight) . Typically, the infusion produces a shock state, which is accompanied first by a decrease of fibrinogen level to approximately 20% of control at T+360 (approximately 360 minutes following commencement of E. coli infusion), with an increase in SGPT level (a measure of liver cell injury) above the normal range. Additionally, leukocyte and platelet counts drops as does mean systemic arterial pressure (MSAP) . Death characteristically ensues about 24 to 32 hours after challenge. Such responses and the associated post mortem findings are consistent with previous reports and they also mimic the clinical progression of sepsis and shock seen in humans thus providing a good model for human sepsis and/or endotoxemia. Using this model, the effect of an LP of the invention (e.g., such as the amount of a protein as well as the period of time over which it is administered) on modulating baboon sepsis can be determined. Briefly, the same dose of E. coli is infused but varying dosages of an LP is also administered with the organisms. In this treatment, SGPT, leukocyte, platelet, fibrinogen, and MSAP levels are also assessed. In one embodiment, an LP infusion rate can range from an initial rate of 4.4g/kg/min. to as high as 64 ug/kg/min. In another embodiment, a total of 7-8 mg/kg of the LP is infused over a period of 8 to 10 hours. In still another embodiment, doses of 1.0, 3.0, and 4.0 mg/kg body weight over a shorter two-four hour period are given. Positive outcomes are assessed as surviving animals. Typically, the an appropriate dosage appears to be a function both of the amount of the LP given as well as the period of time over which it is administered. To determine if in the absence of an LP of the invention an otherwise non-lethal dose of E coli would become lethal, sub-lethal doses of E. coli (10% of the lethal concentration) with and without pre-infusion of an anti-LP antibody are given. Outcomes and assessment is as described.
In another test, the effect of an LP is determined for animals already in shock (e.g., such as during Stage II of the shock phase, after the endothelium has become perturbed) to determine if LP can reverse the inflammatory response and rescue animals from what otherwise would typically have been fatal sepsis. The protocol employed here is identical, except that LP rescue is initiated after the onset of the inflammatory response, instead of with infusion of the organisms, and is continued over a longer period of time. Acute Inflammatory Response Model
In another embodiment, to test the role of an LP of the invention in an acute inflammation response, one can adapt the method of Eberini, et al . 1999 Electrophoresis 20(4-5): 846-53 (incorporated herein for these teachings) . In brief, rodents are injected with a phlogistic stimulus (e.g., turpentine) , turpentine and daily doses of indomethacine, and indomethacine alone. In inflamed animals, peak changes for acute-phase reactants are evaluated between 48 and 72 h after the phlogistic stimulus by two-dimensional electrophoresis (2-DE) to check for, for example, plasma concentration of LP expression, among other expressed molecules . Presence of LP is indicative of it being an acute phase protein whose changes are modulated via anti- inflammatory reaction.
Acute Inflammation Response Model with LP Transgenics
Using a method based on Chen, et al . , 1997 Life Sci 60(17): 1431-5 (which is incorporated herein for these teachings) , the potential role of an LP in inflammation is evaluated in transgenic mice by overexpressing the LP gene under the control for example, of mouse metallothionein metal-responsive promoter. Briefly, bacterial endotoxic lipopolysaccharide (LPS) is injected mtraperitoneally into mice at a dose of 600 microg/25 g body weight. The death toll is recorded every 12 hours for 3 days. The survival rate of transgenic male mice is assessed verses that of control male mice 3 days post LPS injection. In comparison, the survival rate of transgenic female mice is assessed verses that of control female mice to assess LP response to hormonal differences. Recombinant LP levels in the circulation of these mice is assessed for increase after LPS treatment. The results are examined to determine if LP transgenic mice have a higher survival rate than their non- transgenic control littermates after endotoxin shock and whether there is a gender based resistance to lethality induced by endotoxin shock. These results will suggest if LP has a protective effect during acute phase inflammation.
Inflammation Model for Liver Disease
To determine if an LP of the invention plays a role in hepatic disease (e.g., such as the result of inflammation response) one can adapt the method of Newsholme et al . 2000 Electrophoresis 21(11): 2122-8 (incorporated herein for these methods) and generate a drug-induced increase in heptocellular rough endoplasmic reticulum (RER) in Sprague- Dawley rats by giving a substituted pyrimidine derivative. Subsequently, the experimental subjects are checked for the presence of LP which is interpreted as being indicative of the presence of an acute phase protein whose changes follows an inflammatory reaction supporting the suggestion that LP plays a role in, for example, acute phase liver inflammation.
Inflammation and Neurological Disease
Cytokines such as interleukin-6 (IL-6) have been detected in the cortices of Alzheimer disease (AD) patients, indicating a local activation of components of the unspecific inflammatory system. IL-6 may precede neuritic changes, and the immunological mechanism may be involved both in the transformation from diffuse to neuritic plaques in AD and in the development of dementia. To determine if an LP of the invention plays a role in neurological disease (e.g., such as the result of an inflammation response) one can adapt the method of Hull, et al . 1996 Eur Arch Psychiatry Clin Neurosci 246(3): 124-8 (incorporated herein for these teachings) to determine if an LP of the invention plays a role in such processes.
Furthermore, in the brain, the acute phase protein antichymotrypsm is produced in response to pro-inflammatory cytokines by the reactive astrocytes, in particular those surrounding the amyloid plaques of Alzheimer's disease brains. Accordingly, one can also adapt the method of Cardinaux et al . , 2000 Glia 29(1): 91-7 to determine if similar pro-inflammatory molecules (e.g., such as, lipopolysaccharides (LPS) , IL-lbeta, and TNF alpha) induce the expression of an LP of the invention in mouse primary astrocytes and whether the results of such data support a role for the induction of LP expression by pro-inflammatory cytokines in the brain (e.g., using mouse cortical astrocytes as a model system) .
Hemostatic and Thrombolytic Activity
An LP as described herein may also exhibit hemostatic or thrombolytic activity. As a result, such a composition is expected to be useful in treatment of various coagulation disorders (including hereditary disorders, such as hemophilias) or to enhance coagulation and other hemostatic events in treating wounds resulting from trauma, surgery or other causes. Such a composition may also be useful for dissolving or inhibiting formation of thromboses and for treatment and prevention of conditions resulting therefrom (such as, for example, infarction of cardiac and central nervous system vessels (e.g., stroke) . The activity of an LP as described herein may, among other means, be measured by the following methods: Assay for hemostatic and thrombolytic activity include, without limitation, those described in: Linet et al . , J. Clin. Pharmacol. 26:131-140, 1986; Burdick et al . , Thrombosis Res. 45:413-419, 1987; Humphrey et al . , Fibrinolysis 5:71-79 (1991); Schaub, Prostaglandins 35:467-474, 1988; all of which are incorporated herein for these assay teachings. A potential function of an LP of the invention in vascular biology (such as, e.g., testing mitogenic responses via, for example, an induced MAPK pathway) can be investigated by studying the role of an LP of the invention in the proliferation and migration of cultured primary aortic vascular smooth muscle cells (VSMCs) in vitro and in neointima formation in rat artery after balloon angioplasty in vivo based on the methods of Miao et al . , 2000 Circ Res 86(4) : 418-24 which is incorporated herein by reference for the teachings assay with modification for LP specificity) . An LP as described herein may be useful in regulation of hematopoiesis and, consequently, in the treatment of myeloid or lymphoid cell deficiencies. Even marginal biological activity in support of colony forming cells or of factor-dependent cell lines indicates involvement in regulating hematopoiesis, e.g. in supporting the growth and proliferation of erythroid progenitor cells alone or in combination with other cytokines, thereby indicating utility, for example, in treating various anemias or for use in conjunction with irradiation/chemotherapy to stimulate the production of erythroid precursors and/or erythroid cells; in supporting the growth and proliferation of myeloid cells such as granulocytes and monocytes/macrophages (i.e., traditional CSF activity) useful, for example, in conjunction with chemotherapy to prevent or treat consequent myelo-suppression; in supporting the growth and proliferation of megakaryocytes and consequently of platelets thereby allowing prevention or treatment of various platelet disorders such as thrombocytopenia, and generally for use in place of or complimentary to platelet transfusions; and/or in supporting the growth and proliferation of hematopoietic stem cells which are capable of maturing to any and all of .the above-mentioned hematopoietic cells and therefore find therapeutic utility in various stem cell disorders (such as those usually treated with transplantation, including, without limitation, aplastic anemia and paroxysmal nocturnal hemoglobinuria) , as well as in repopulating the stem cell compartment post irradiation/chemotherapy, either in- vivo or ex-vivo (i.e., in conjunction with bone marrow transplantation or with peripheral progenitor cell transplantation (homologous or heterologous) ) as normal cells or genetically manipulated for gene therapy.
Blood Pressure Model
To examine if an LP of the invention has an effect on the vasculature and on blood pressure homeostasis, an intravenous bolus injection of LP is given to a subject
(e.g., such as an anesthetized rodent) to look for a rapid, potent, and transient reduction elevation of mean arterial blood pressures. Infusions of purified LP in the dosage of about 0.07-1.42 nmol/kg into cannulated rodent jugular veins are carried out and the effect on the mmHg reading of blood pressure is determined in a dose-dependent manner. Significant variation from controls indicates a role for LP in blood pressure homeostasis.
Alternatively, to investigate the role of an LP of the invention in blood pressure regulation, LP can be delivered to hypotensive transgenic mouse lines by intramuscular injection (see, e.g., the method of Ma, et al . 1995 J Biol Chem 270(1) : 451-5, which is incorporated herein for these teachings) . Expression of the LP is examined for expression in skeletal muscle by reverse transcription-polymerase chain reaction and Southern blot analysis at 10, 20, 30, and 40 days post-injection. Immunoreactive LP levels in the muscle and serum of these mice is quantified by an LP-specific enzyme-linked immunosorbent assay and Western blot analysis. The levels of LP mRNA and immunoreactive protein are examined at 10, 20, and 30 days post-in ection. During this period, LP delivery is examined to determine its effect on systemic blood pressure compared to that of normotensive control mice.
Furthermore, to elucidate therapeutic potentials of an LP described herein in hypertension, an LP polynucleotide encoding an LP or variant thereof (e.g., in an adenoviral vector) is directly introduced into spontaneously hypertensive rats (SHR) through portal vein injection (see, e.g., the method of Ma, et al . 1995 J Biol Chem 270(1): 451- 5, which is incorporated herein for these teachings) . Still furthermore, the following method (adapted from Gerova, M 1999 Physiol Res 48(4): 249-57, which is incorporated herein for these assay teachings) can be used to determine whether an LP described herein exerts a protective effect in chronic-inhibition-of-nitric-oxide- synthase-induced hypertension. Chronic-inhibition-of- nitric-oxide-synthase-induced hypertension is created by giving N omega-nitro-L-arginine methyl ester (L-NAME, 40 mg/100 ml water or given in a dose of 50 mg/kg into the jugular vein) orally to Sprague-Dawley rats, while controls receive regular tap water. Blood pressure is measured in the right carotid artery by a Statham pressure transducer in acute experiments, and on the tail artery by the . plethysmographic method weekly in chronic experiments. Subsequently, LP mRNA levels are measured and compared with known vascularization effecting proteins such as, e.g., proteins of the kallikrein-kinin system. The results are used to assess whether enhanced LP synthesis has a protective role against the cardiovascular effects induced by chronic inhibition of nitric oxide synthesis.
Heart Failure Model
To determine if an LP of the invention plays a role in heart disease (e.g., such as cardiomyopathy) one can adapt the methods of Choi, et al . 1997 J. Biol. Chem. 272:17223- 17229 and Ping, et al . 1995 J. Clin. Invest. 95:1271-1280. (incorporated herein for these methods) for an animal model of heart failure. Additionally, one could adapt the recently developed genetic model of murine-dilated cardiomyopathy (designated the MLP -/- model of heart failure) , which involves the ablation of a muscle-restricted gene encoding the muscle LIM protein (MLP -/-) (Arber, et al. 1997 Cell 88, 393-403; incorporated herein for these methods) . The MLP -/- model of dilated cardiomyopathy closely resembles the phenotype of human dilated cardiomyopathy. MLP is a conserved positive regulator of myogenic differentiation, and recent findings suggest that it may act as a molecular adapter to promote protein assembly along the actin-based cytoskeleton. Hearts from
MLP-deficient mice are characterized by marked disruption of cardiomyocyte architecture. Human heart failure also is a disease of cardiac muscle characterized by alterations in cardiomyocyte shape (Gerdes, et al . 1992 Circulation 86, 426-430), cytoskeletal abnormalities (Schaper, et al . 1991
Circulation 83, 504-514), and bAR signaling (Bristow, et al . 1982 N. Engl. J. Med. 307, 205-211), which supports the MLP- deficient mouse as a model system to study heart disease.
Diabetes & Muscle Wasting Model To investigate the role of an LP described herein as a factor contributing to muscle wasting (such as, e.g., observed in diabetes, fasting, and/or cachexia) , one can adopt the method of Kuehn et al . , 1988 Biol Chem Hoppe Seyler 369 Suppl : 299-305 (which is incorporated herein by reference for these assay teachings) . Briefly, using such techniques, LP expression levels are examined in the skeletal muscles of fasting rodents. Lowered levels of LP suggest that LP contributes to diseases of muscle wasting. Accordingly, increasing the level of LP in such conditions may ameliorate such conditions.
Additionally, one can use a murine tumor model to mimic human cachexia. In this model the carcinogen N-nitroso-N- methylurethan is used to induce an undifferentiated tumor — murine colon-26 adenocarcinoma (MCG-101) . Briefly, mice (C57BL approximately 18-22 grams in weight) are implanted subcutaneously with viable methylcholantreen-induced sarcoma (MCG 101) . MCGIOI is a non-metastasizing, undifferentiated, epithelial-like solid tumor that has been extensively used for modeling cancer cachexia. When implanted subcutaneously, the tumor grows locally in a reproducible growth pattern. Typically, animals die within 12-15 days after implantation due to cancer-induced cachexia. The tumor has been shown to produce the cytokines: IL-1 alpha, IL-l»beta, TNF-alpha, and IL-6. Prostaglandins, particularly PGE2 , are also produced.
Typically, mice are assembled into treatment groups of ten animals each. Mice are given interperitoneal injections of varying dosages of an LP of the invention (e.g., such as, 0.1, 1.0, 5.0, 10.0, 20.0, 25.0, 30.0, 35.0, 40.0, 45.0, 50.0, 55.0 ug of an LP described herein or in a range of from about 0.1 to about 100.0 ug administered in about 0.2mls of PBS) or a suitable negative control (e.g., such as, human albumin or Fc protein. Additionally, as a negative control a group receives no implantation of MCGIOI but receives either IL-6 or indomethacin as described below) . As positive controls, one group receives (every three days post implantation) anti-mouse IL-6 (300 ug/mouse) while another receives indomethacin (5mg/ml) ad libitum in the drinking water. All mice are subsequently monitored for food intake, body composition and weight daily. On day twelve after tumor implantation, all animals are sacrificed; their tumors removed, weighed, and dried. Body carcass weight is subsequently determined and body composition is evaluated by lipid extraction and drying to constant weight. Biochemical analysis involves, e.g., testing for plasma cytokine levels such as, e.g., IL-6 and PGE2 levels. Data is compared to controls to assess the impact of an LP tested. To determine the involvement of LP in the development of diabetic retinopathy, one can adopt the method of Hatcher, et al . , 1997 Invest Ophthalmol Vis Sci 38(3):658-64 (which is incorporated herein for these assay teachings) . Briefly, diabetes is induced by streptozotocin (STZ) (55 mg/kg body weight in 0.05 M citrate buffer, pH 4.5) in male
Sprague-Dawley rats (150 to 175 g, 6 weeks old) as confirmed by hyperglycemia and reduced body weight . Retinas are dissected from animals at 1, 2, and 4 months of induced diabetes-like conditions. The functional activity of LP in retinal homogenates is determined by immunoreactive LP levels measured by enzyme-linked immunosorbent assay. Additionally, LP messenger RNA (mRNA) levels in the retina are measured by Northern blot analysis using an LP complementary DNA probe. The activity of total Na+, K(+)- ATPase is determined by a radioassay. Total protein concentration is determined by a protein assay. LP & Extracellular Matrix
Extracellular matrix (ECM) degradation and turnover are important processes in tissue remodeling during development, wound healing, regeneration, metastasis, tumor necrosis, bone and cartilage degenerative disease (e.g., arthritic conditions) , and inflammation. An LP as described herein, may also play a role in effecting the role of the ECM in, for example, tissue remodeling during development or repair, cell proliferation conditions, metastatic disease, wound healing, tumorgenesis, tumor necrosis, and inflammation.
Moreover, growing evidence suggests that, through its interactions with cytokines and degradative enzymes, the extracellular matrix (ECM) microenvironment has a specialized role in providing intrinsic signals for coordinating actions of cells of the immune system (e.g., leukocytes) . Recent advances also reveal that modifications to ECM moieties and cytokines induce distinctive cellular responses, and are likely to be part of a mechanism that regulates the perpetuation or arrest of inflammation. LP may be important in such a role by its ability to modify the ECM microenvironment during the inflammatory response .
Tissue Growth Activity
An LP as described herein also may have utility in compositions used for bone, cartilage, tendon, ligament and/or nerve tissue growth or regeneration, as well as for wound healing and tissue repair and replacement, and in the treatment of burns, incisions and ulcers.
An LP of the present invention, which induces cartilage and/or bone growth in circumstances where bone is not normally formed, has application in the healing of bone fractures and cartilage damage or defects in humans and other animals . Such a preparation employing an LP of the invention may have prophylactic use in closed as well as open fracture reduction and also in the improved fixation of artificial joints. De novo bone formation induced by an osteogenic agent contributes to the repair of congenital, trauma induced, or oncologic resection induced craniofacial defects, and also is useful in cosmetic plastic surgery.
An LP as described herein may also be used in the treatment of periodontal disease, and in other tooth repair processes. Such agents may provide an environment to attract bone-forming cells, stimulate growth of bone-forming cells or induce differentiation of progenitors of bone- forming cells. An LP may also be useful in the treatment of osteoporosis or osteoarthritis, such as through stimulation of bone and/or cartilage repair or by blocking inflammation or processes of tissue destruction (collagenase activity, osteoclast activity, etc.) mediated by inflammatory processes .
Another category of tissue regeneration activity that may be attributable to an LP described herein is tendon/ligament formation. An LP, which induces tendon/ligament-like tissue or other tissue formation in circumstances where such tissue is not normally formed, has application in the healing of tendon or ligament tears, deformities and other tendon or ligament defects in humans and other animals . Such a preparation employing a tendon/ligament-like tissue inducing protein may have prophylactic use in preventing damage to tendon or ligament tissue, as well as use in the improved fixation of tendon or ligament to bone or other tissues, and in repairing defects to tendon or ligament tissue. De novo tendon/ligament-like tissue formation induced by a composition of the present invention contributes to the repair of congenital, trauma induced, or other tendon or ligament defects of other origin, and is also useful in cosmetic plastic surgery for attachment or repair of tendons or ligaments. A composition comprising an LP of the present invention may provide an environment to attract tendon- or ligament-forming cells, stimulate growth of tendon- or ligament-forming cells, induce differentiation of progenitors of tendon- or ligament-forming cells, or induce growth of tendon/ligament cells or progenitors ex vivo for return in vivo to effect tissue repair. The composition may also be useful in the treatment of tendinitis, carpal tunnel syndrome and other tendon or ligament defects. The compositions may also include an appropriate matrix and/or sequestering agent as a carrier as is well known in the art.
An LP of the invention may also be useful for proliferation of neural cells and for regeneration of nerve and brain tissue, i.e. for the treatment of central and peripheral nervous system diseases and neuropathies, as well as mechanical and traumatic disorders, which involve degeneration, death or trauma to neural cells or nerve tissue. More specifically, an LP herein may be used in the treatment of diseases of the peripheral nervous system, such as peripheral nerve injuries, peripheral neuropathy and localized neuropathies, and central nervous system diseases, such as Alzheimer's, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, and Shy-Drager syndrome. Further conditions, which may be treated in accordance with the present invention, include mechanical and traumatic disorders, such as spinal cord disorders, head trauma and cerebrovascular diseases such as stroke. Peripheral neuropathies resulting from chemotherapy or other medical therapies may also be treatable using an LP described herein.
An LP of the invention may also be useful to promote better or faster closure of non-healing wounds, including without limitation pressure ulcers, ulcers associated with vascular insufficiency, surgical and traumatic wounds, and the like.
It is expected that an LP described herein may also exhibit activity for generation or regeneration of other tissues, such as organs (including, for example, pancreas, liver, intestine, kidney , skin, endothelium) , muscle (smooth, skeletal or cardiac) and vascular (including vascular endothelium) tissue, or for promoting the growth of cells comprising such tissues. Part of the desired effects may be by inhibition or modulation of fibrotic scarring to allow normal tissue to regenerate. An LP of the invention may also exhibit angiogenic activity.
An LP described herein may also be useful for gut protection or regeneration and treatment of lung or liver fibrosis, reperfusion injury in various tissues, and conditions resulting from systemic cytokine damage. An LP of the present invention may also be useful for promoting or inhibiting differentiation of tissues described above from precursor tissues or cells; or for inhibiting the growth of tissues described herein.
Tissue Damage Model
To evaluate a role for LP in response to tissue damage, direct muscle injury can be induced in rodents (based on the method of Festoff, et al . 1994 J Cell Physiol 159 (1) : 11-18, which is incorporated herein for these assay teachings) .
Participation of complex receptors, such as the alpha 2- macroglobulin receptor/low density lipoprotein receptor- related protein (LRP) , various growth factors, cytokines, and other molecules, in regulating the balance of molecules such as, e.g., serpins and serine proteases have been implicated in playing a role in tissue regeneration and repair. Accordingly, it is likely that an LP, described herein may also play a role in affecting tissue regeneration and repair .
Assays for tissue generation activity include, without limitation, those described in: International Patent Publication No. W095/16035 (bone, cartilage, tendon) ,-
International Patent Publication No. W095/05846 (nerve, neuronal) ; International Patent Publication No. W091/07491 (skin, endothelium ) . Additionally, assays for wound healing activity include, without limitation, those described in: Winter, Epidermal Wound Healing, pp. 71-112 (Maibach, HI and Rovee, DT, eds.), Year Book Medical Publishers, Inc., Chicago, as modified by Eaglstein and Mertz, J. Invest. Dermatol 71:382-84 (1978) . All of these assays can be adapted for use in testing an LP of the invention.
Spinal Cord Regeneration Model
To evaluate the role of an LP described herein in a spinal cord regeneration response (based on the methods of O'Hara, and Chernoff 1994 Tissue and Cell, 26: 599-611; Chernoff, et al . 1998 Wound Rep. Reg. 6: 435-444; and
Chernoff, et al, 2000 Wound Rep. Reg. 8: 282-291, which are incorporated herein for these teachings) a tissue culture system using axolotl spinal cord ependymal cells can be used to test the effects of an LP, an LP variant, an LP agonist, an LP antagonist, an LP binding partner or an LP fragment on, for example, nerve and tissue regeneration. Additional techniques to investigate similar functionalities of an LP described herein include the techniques of, e.g., Itasaki, et al, 1999 Nature Cell Biology Dec; 1 (8) :E203-207 ; Momose, et al., 1999 Develop. Growth Differ. 41:335-344; and Atkins, et al., 2000 Biotechniques 28: 94-96, 98, 100. All of which are incorporated herein for these teachings . Adapting such methods to test an LP described herein, one can conduct localized transfection studies of LP constructs in frog limb cultures and frog spinal cord. Although the above referenced methods were first developed for use in the chick, they can also be adapted for use, for example, in a frog limb system to examine the role of an LP, an LP variant, an LP agonist, an LP antagonist, an LP binding partner or an LP fragment in, for example, cellular regeneration. Similar models can be adapted to examine the role of an LP, an LP variant, an LP agonist, an LP antagonist, an LP binding partner or an LP fragment in organ regeneration (e.g., such as hepatic regeneration using available liver models and assay techniques) .
Additional assays or methods for assessing an activity of an LP of the invention may, among 'other means, be measured by the following methods :
Suitable assays for thymocyte or splenocyte cytotoxicity include, without limitation, those described in: Current Protocols in Immunology, Ed by Coligan, et al . , Pub. Greene Publishing Associates and Wiley-Interscience (Chapter 3, In Vitro assays for Mouse Lymphocyte Function 3.1-3.19; Chapter 7, Immunologic studies in Humans); Herrmann et al . , Proc. Natl. Acad. Sci. USA 78:2488-2492, 1981; Herrmann et al . , J. Immunol. 128:1968-1974, 1982; Handa et al . , J. Immunol. 135:1564-1572, 1985; Takai et al . ,
J. Immunol. 137:3494-3500, 1986; Takai et al . , J. Immunol. 140:508-512, 1988; Herrmann et al . , Proc. Natl. Acad. Sci. USA 78:2488-2492, 1981; Herrmann et al . , J. Immunol.
128:1968-1974, 1982; Handa et al . , J. Immunol. 135:1564-
1572, 1985; Takai et al . , J. Immunol. 137:3494-3500, 1986;
Bowmanet al . , J. Virology 61:1992-1998; Takai et al . , J. Immunol. 140:508-512, 1988; Bertagnolli et al . , Cellular
Immunology 133:327-341, 1991; Brown et al . , J. Immunol.
153:3079-3092, 1994.
Assays for T-cell-dependent immunoglobulin responses and isotype switching (which will identify, among others, proteins that modulate T-cell dependent antibody responses and that affect Thl/Th2 profiles) include, without limitation, those described in: Maliszewski, J. Immunol.
144:3028-3033, 1990; and Assays for B cell function: In vitro antibody production, Mond, J.J. and Brunswick, M. In Current Protocols in Immunology. J.E. Coligan eds. Vol 1 pp.
3.8.1-3.8.16, John Wiley and Sons, Toronto. 1994.
Mixed lymphocyte reaction (MLR) assays (which will identify, among others, proteins that generate predominantly
Thl and CTL responses) include, without limitation, those described in: Current Protocols in Immunology, Ed by J. E.
Coligan, A.M. Kruisbeek, D.H. Margulies, E.M. Shevach, W Strober, Pub. Greene Publishing Associates and Wiley- Interscience (Chapter 3, In Vitro assays for Mouse Lymphocyte Function 3.1-3.19; Chapter 7, Immunologic studies in Humans); Takai et al . , J. Immunol. 137:3494-3500, 1986; Takai et al . , J. Immunol. 140:508-512, 1988; Bertagnolli et al., J. Immunol. 149:3778-3783, 1992.
Dendritic cell-dependent assays (which will identify, among others, proteins expressed by dendritic cells that activate naive T-cells) include, without limitation, those described in: Guery et al . , J. Immunol. 134:536-544, 1995; Inaba et al . , Journal of Experimental Medicine 173:549-559, 1991; Macatonia et al . , Journal of Immunology 154:5071-5079, 1995; Porgador et al . , Journal of Experimental Medicine 182:255-260, 1995; Nair et al . , Journal of Virology 67:4062- 4069, 1993; Huang et al . , Science 264:961- 965, 1994; Macatonia et al . , Journal of Experimental Medicine 169:1255- 1264, 1989; Bhardwaj et al . , Journal of Clinical Investigation 94:797-807, 1994; and Inaba et al . , Journal of Experimental Medicine 172:631-640, 1990.
Assays for lymphocyte survival/apoptosis (which will identify, among others, proteins that prevent apoptosis after superantigen induction and proteins that regulate lymphocyte homeostasis) include, without limitation, those described in: Darzynkiewicz et al . , Cytometry 13:795-808, 1992; Gorczyca et al . , Leukemia 7:659-670, 1993; Gorczyca et al., Cancer Research 53:1945-1951, 1993; Itoh et al . , Cell 66:233-243, 1991; Zacharchuk, Journal of Immunology 145:4037-4045, 1990; Zamai et al . , Cytometry 14:891-897, 1993; Gorczyca. et al . , International Journal of Oncology 1:639-648, 1992. Assays for proteins that influence early steps of T- cell commitment and development include, without limitation, those described in: Antica et al . , Blood 84:111-117, 1994; Fine et al . , Cellular Immunology 155:111-122, 1994; Galy et al., Blood 85:27,70-2778, 1995; Toki et al . , Proc. Nat. Acad Sci. USA 88:7548-7551, 1991.
Assays for embryonic stem cell differentiation (which will identify, among others, proteins that influence embryonic differentiation hematopoiesis) include, without limitation, those described in: Johansson et al . Cellular Biology 15:141-151, 1995; Keller et al . , Molecular and
Cellular Biology 13:473-486, 1993; McClanahan et al . , Blood 81:2903-2915, 1993. Assays for stem cell survival and differentiation (which will identify, among others, proteins that regulate lympho-hematopoiesis) include, without limitation, those described in: Methylcellulose colony forming assays, Freshney, M.G. In Culture of Hematopoietic Cells. R.I.
Freshney, et al . eds. Vol pp. 265-268, Wiley-Liss, Inc., New York, NY. 1994; Hirayama et al . , Proc. Natl. Acad. Sci. USA 89:5907-5911, 1992; Primitive hematopoietic colony forming cells with high proliferative potential, McNiece, I.K. and Briddell, R.A. In Culture of Hematopoietic Cells. R.I.
Freshney, et al . eds. Vol pp. 23-39, Wiley-Liss, Inc., New York, NY. 1994; Neben et al . , Experimental Hematology 22:353-359, 1994; Cobblestone area forming cell assay, Ploemacher, R.E. In Culture of Hematopoietic Cells. R.I. Freshney, et al . eds. Vol pp. 1-21, Wiley-Liss, Inc., New York, NY. 1994; Long term bone marrow cultures in the presence of stromal cells, Spooncer, E., Dexter, M. and Allen, T. In Culture of Hematopoietic Cells. R.I. Freshney, et al. eds. Vol pp. 163-179, Wiley-Liss, Inc., New York, NY. 1994; Long term culture initiating cell assay, Sutherland, H.J. In Culture of Hematopoietic Cells. R.I. Freshney, et al . eds. Vol pp. 139-162, Wiley-Liss, Inc., New York, NY. 1994.
It is contemplated that the compounds of the present invention may be used to treat various conditions including those characterized by overexpression and/or activation of the disease-associated genes identified herein. Exemplary conditions or disorders to be treated with such antibodies and other compounds, including, but not limited to, small organic and inorganic molecules, peptides, antisense molecules, etc., include cancer, heart disease, diabetes, neurological, immune or hematological disorders or other diseases .
The active agents of the present invention, e.g., antibodies, are administered to a mammal, preferably a human, in accord with known methods, such as intravenous administration as a bolus or by continuous infusion over a period of time, by intramuscular, intraperitoneal, intracerebral, intracerebrospinal, subcutaneous, intra- articular, intrasynovial, intrathecal, intraoccular, intranasal, intralesional, oral, pulmonary, topical, inhalation or through sustained release .
Other therapeutic regimens may be combined with the administration of LP123, LP127, or LP129 polypeptide, agonists, antagonists, or antibodies of the instant invention.
For the prevention or treatment of disease, the appropriate dosage of an active agent, (e.g., an antibody) will depend on the type of disease to be treated, as defined above, the severity and course of the disease, whether the agent is administered for preventive or therapeutic purposes, previous therapy, the patient's clinical history and response to the agent, and the discretion of the attending physician. The agent is suitably administered to the patient at one time or over a series of treatments. Dosages and desired drug concentration of pharmaceutical compositions of the present invention may vary depending on the particular use envisioned. The determination of the appropriate dosage or route of administration is well within the skill of an ordinary artisan. Animal experiments provide reliable guidance for the determination of effective does for human therapy. Interspecies scaling of effective doses can be performed following the principles laid down by Mordenti and Chappell, "The Use of Interspecies Scaling in Toxicokinetics, " in Toxicokinetics and New Drug Development, Yacobi, et al . , Eds., Pergamon Press, NY (1989), pp. 4246. When in vivo administration of an LP123, LP127, or LP129 polypeptide or agonist or antagonist thereof is employed, normal dosage amounts may vary from about 10 ng/kg up to 100 mg/kg of mammal body weight or more per day, preferably about 1 pg/kg/day up to 100 mg/kg of mammal body weight or more per day, depending upon the route of administration. Guidance as to particular dosages and methods of delivery is provided in the literature; see, for example, U.S. Pat. Nos. 4,657,760; 5,206,344 or 5,225,212. It is within the scope of the invention that different formulations will be effective for different treatment compounds and different disorders, that administration targeting one organ or tissue, for example, may necessitate delivery in a manner different from that to another organ or tissue. Moreover, dosages may be administered by one or more separate administrations or by continuous infusion. For repeated administrations over several days or longer, depending on the condition, the treatment is sustained until a desired suppression of disease symptoms occurs. However, other dosage regimens may be useful. The progress of this therapy is easily monitored by conventional techniques and assays .
In another embodiment of the invention, an article of manufacture containing materials useful for the diagnosis or treatment of the disorders described above is provided. The article of manufacture comprises a container and a label. Suitable containers include, for example, bottles, vials, syringes, and test tubes. The containers may be formed from a variety of materials such as glass or plastic. The container holds a composition which is effective for diagnosing or treating the condition and may have a sterile access port (for example, the container may be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle) . The active agent in the composition is typically an LP123, LP127, or LP129 polypeptide, antagonist or agonist thereof. The label on, or associated with, the container indicates that the composition is used for diagnosing or treating .the condition of choice. The article of manufacture may further comprise a second container comprising a pharmaceutically-acceptable buffer, such as phosphate-bu fered saline, Ringer's solution and dextrose solution. It may further include other materials desirable from a commercial end user standpoint, including other buffers, diluents, filters, needles, syringes, and package inserts with instructions for use. The following examples are offered for illustrative purposes only and are not intended to limit the scope of the present invention in any way.
EXAMPLES
Example 1
Isolation of cDNA Clones Encoding Human LP123, LP127, and LP129 and Sequencing of Human Bone Marrow Normalized Library A normalized human bone marrow library was prepared by a modification of the procedure described by Patanjali, et al. [Proc. Natl. Acad. Sci. USA 88: 1943-1947 (1991)]. For this procedure, the initial human bone marrow mRNA was purchased from Clontech (Palo Alto, CA) . The polyA+ mRNA was primed using 2 μg of random ninemers, with the oligonucleotide extension containing half Notl side: CCGC (N) 9. The first strand of cDNA was synthesized using SuperScriptll (GibcoBRL, Rockville, MD) . The second strand of cDNA was synthesized using the standard protocol with one modification: the E. coli DNA ligase was omitted from the reaction mix, producing the synthesis of short fragment cDNA in the range of 300 to 1000 bp. The Notl/EcoRI adapters were ligated to blunt ended cDNA. Excess adapters were removed by column chromatography. Fractions of cDNA that were free of excess adapters were pooled and precipitated. The human bone marrow cDNA were amplified using a single adapter primer (TCTAGAGAATTCGTCGACGCGG) . Amplifications were performed in a Perkin-Elmer Thermal Cycler 9600 according to the following method: initially denature the template at 94°C for 30 seconds, then complete 30 cycles of 94°C for 20 seconds, 55°C for 30 seconds, and 72°C for 3 minutes with Advantage DNA Polymerase from Clontech. PCR products were extracted and precipitated using a phenol/chloroform extraction. Pellets were resuspended in 0.3 M sodium phosphate buffer at pH 6.8 containing 0.4 mM EDTA to a final concentration of 50 μg/mL. Reassociation reactions were performed in a 50 μL volume in 1.5 mL Eppendorf tubes . Reaction mixtures were overlaid with a drop of mineral oil and heat denatured in a heating block at 95°C for 10 minutes. The tubes were immediately transferred to another heating block and allowed to reassociate at 65°C for 24, 48, 72, or 96 hours. Reactions were stopped by chilling the tubes on ice and diluting the reassociation mix with 1 mL of 10 mM sodium phosphate buffer at pH 6.8 containing 0.4 mM EDTA. The diluted samples were applied to hydroxyapatite columns for separation of single and double-stranded DNA. Hydroxyapatite chromatography was performed using DNA grade Bio-Gel hydroxyapatite from BioRad. The column packing was washed with 10 mM sodium phosphate at pH 6.8 containing 0.4 mM EDTA then suspended into a 50% slurry. The slurry was used to pack a water-jacketed glass column to a bed volume of about 2 mL. Conditions for binding and elution of single- and double-stranded fractions were determined by calibrating the column with phiX/Haelll (denatured at 95°C for 10 minutes) and double-stranded 1 kb ladder (GibcoBRL) . The mixture of denatured single-stranded phiX DNA and double-stranded 1 kb ladder was applied to the column. The column temperature was maintained at 60°C. The elution profiles were determined by applying a step gradient from 0.1 to 0.35 M sodium phosphate at pH 6.8 in increments of 0.05 M sodium phosphate. Next, the 24, 48, 72, and 96 hour reassociation reaction samples were separated into single- and double-stranded DNA fractions using 0.15 M sodium phosphate at pH 6.8 containing 0.4 mM EDTA and 0.35 M sodium phosphate at pH 6.8 containing 0.4 mM EDTA, respectively. All fractions were eluted in 10 mL fractions and were then concentrated to about 100 μL by centrifugation in Centricon-30 filters (Millipore, Bedford, MA) .
After concentration, the eluted fractions were amplified using the same conditions and cycling parameters as the initial DNA amplification. The amplified single- and double-stranded DNA fractions were used to study the reassociation rate of several high and low abundance genes using semi-quantitative PCR. Primers were designed to amplify gene fragments of about 300 bp. Serial dilutions of each template and unnormalized DNA were made, yielding final quantities of template in the PCR reactions at 10 ng, 1 ng, 100 pg, 10 pg, 1 pg, and 0.1 pg. The PCR reactions were performed in 96 well plates in an MJ thermal cycler in the three step PCR. The initial denaturation step of 94°C for 30 seconds was followed by 30 cycles of 94°C for 30 seconds, 65°C for 30 seconds, and 72°C for 1.5 minutes. Using PCR primers for G3PDH, actin, and Human Transferrin Receptor, the best normalized condition was evaluated where the abundance levels of all three genes were within an order of magnitude .
The 72-hour reassociation mixture was chosen as the optimal time point for the library construction, as determined by semi-quantitative PCR. The amplified single- stranded fraction was treated with T4 polynucleotide kinase (BM) and T4 DNA polymerase. It was then ligated into the Smal site of pUC18 (Pharmacia) . The colonies were picked into 96 well plates and frozen as glycerol stocks.
DNA sequencing gave the full-length DNA sequence for LP123, LP127, and LP129 (SEQ ID NO:l, 3, and 5, respectively) and the derived LP123, LP127, and LP129 protein sequence (SEQ ID NO: 2, 4, and 6, respectively) .
Example 2
Expression and Purification of LP123, LP127, or LP129 in E. coli
The bacterial expression vector pQE60 is used for bacterial expression in this example. (QIAGEN, Inc., Chatsworth, CA) . pQE60 encodes ampicillin antibiotic resistance ("Ampr") and contains a bacterial origin of replication ("ori"), an IPTG inducible promoter, a riboso e binding site ("RBS"), six codons encoding histidine residues that allow affinity purification using nickel-nitrilo-tri- acetic acid ("Ni-NTA") affinity resin sold by QIAGEN, Inc., and suitable single restriction enzyme cleavage sites. These elements are arranged such that a DNA fragment encoding a polypeptide can be inserted in such a way as to produce that polypeptide with the six His residues (i.e., a "6 X His tag") covalently linked to the carboxyl terminus of that polypeptide. However, a polypeptide coding sequence can optionally be inserted such that translation of the six His codons is prevented and, therefore, a polypeptide is produced with no 6 X His tag.
The nucleic acid sequence encoding the desired portion of LP123, LP127, or LP129 lacking the hydrophobic leader sequence is amplified from a cDNA clone using PCR oligonucleotide primers (based on the sequences presented, e.g., as presented in SEQ ID NO: 2, 4, or 6) , which anneal to the amino terminal encoding DNA sequences of the desired portion of LP123, LP127, or LP129 and to sequences in the construct 3' to the cDNA coding sequence. Additional nucleotides containing restriction sites to facilitate cloning in the pQE60 vector are added to the 5' and 3' sequences, respectively. For cloning LP123, LP127, or LP129, the 5' and 3' primers have nucleotides corresponding or complementary to a portion of the coding sequence of LP123, LP127, or LP129, e.g., as presented in SEQ ID NO: 2, 4, or 6, according to known method steps . One of ordinary skill in the art would appreciate, of course, that the point in a polypeptide coding sequence where the 5' primer begins can be varied to amplify a desired portion of the complete polypeptide shorter or longer than the mature form.
The amplified LP123, LP127, or LP129 nucleic acid fragments and the vector pQE60 are digested with appropriate restriction enzymes and the digested DNAs are then ligated together. Insertion of the LP123, LP127, or LP129 DNA into the restricted pQE60 vector places the LP123, LP127, or LP129 polypeptide coding region, including its associated stop codon, downstream from the IPTG-inducible promoter and in-frame with an initiating AUG codon. The associated stop codon prevents translation of the six histidine codons downstream of the insertion point .
The ligation mixture is transformed into competent E. coli cells using standard procedures such as those described in Sambrook, et al . , 1989; Ausubel, 1987-1998. E. coli strain Ml5/rep4, containing multiple copies of the plasmid pREP4, which expresses the lac repressor and confers kanamycin resistance ("Kanr"), is used in carrying out the illustrative example described herein. This strain, which is only one of many that are suitable for expressing LP123, LP127, or LP129 polypeptide, is available commercially from QIAGEN, Inc. Transformants are identified by their ability to grow on LB plates in the presence of ampicillin and kanamycin. Plasmid DNA is isolated from resistant colonies and the identity of the cloned DNA confirmed by restriction analysis, PCR and DNA sequencing.
Clones containing the desired constructs are grown overnight ("0/N") in liquid culture in LB media supplemented with both ampicillin (100 μg/mL) and kanamycin (25 μg/mL) . The 0/N culture is used to inoculate a large culture, at a dilution of approximately 1:25 to 1:250. The cells are grown to an optical density at 600 nm ("OD600") of between 0.4 and 0.6. Isopropyl-b-D-thiogalactopyranoside ("IPTG") is then added to a final concentration of 1 mM to induce transcription from the lac repressor sensitive promoter, by inactivating the lad repressor. Cells subsequently are incubated further for 3 to 4 hours. Cells then are harvested by centrifugation. The cells are then stirred for 3-4 hours at 4°C in 6M guanidine-HCl, pH 8. The cell debris is removed by centrifugation, and the supernatant containing the LP123, LP127, or LP129 is dialyzed against 50 mM Na-acetate buffer, pH 6, supplemented with 200 mM NaCl. Alternatively, a polypeptide can be successfully refolded by dialyzing it against 500 mM NaCl, 20% glycerol, 25 mM Tris/HCl pH 7.4, containing protease inhibitors.
If insoluble protein is generated, the protein is made soluble according to known method steps. After renaturation, the polypeptide is purified by ion exchange, hydrophobic interaction, and/or size exclusion chromatography. Alternatively, an affinity chromatography step such as an antibody column is used to obtain pure LP123, LP127, or LP129. The purified polypeptide is stored at 4°C or frozen at -40°C to -120°C.
Example 3
Cloning and Expression of LP123, LP127, or LP129 in a Baculovirus Expression System
In this example, the plasmid shuttle vector pA2 GP is used to insert the cloned DNA encoding the mature polypeptide into a baculovirus to express LP123, LP127, or LP129, using a baculovirus leader and standard methods as described in Summers, et al . , A Manual of Methods for Baculovirus Vectors and Insect Cell Culture Procedures, Texas Agricultural Experimental Station Bulletin No. 1555 (1987) . This expression vector contains the strong polyhedrin promoter of the Autographa californica nuclear polyhedrosis virus (AcMNPV) followed by the secretory signal peptide (leader) of the baculovirus gρ67 polypeptide and convenient restriction sites such as BamHI, Xbal, and Asp718. The polyadenylation site of the simian virus 40 ("SV40") is used for efficient polyadenylation. For easy selection of recombinant virus, the plasmid contains the beta-galactosidase gene from E. coli under control of a weak Drosophila promoter in the same orientation, followed by the polyadenylation signal of the polyhedrin gene . The inserted genes are flanked on both sides by viral sequences for cell- mediated homologous recombination with wild-type viral DNA to generate viable virus that expresses the cloned polynucleotide.
Other baculovirus vectors are used in place of the vector above, such as pAc373, pVL941 and pAcIMl, as one skilled in the art would readily appreciate, as long as the construct provides appropriately located signals for transcription, translation, secretion and the like, including a signal peptide and an in-frame AUG as required. Such vectors are described, for instance, in Luckow, et al . , Virology 170: 31-9 (1989).
The cDNA sequence encoding the mature LP123, LP127, or LP129 polypeptide in a clone, lacking the AUG initiation codon and the naturally associated nucleotide binding site, is amplified using PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the gene. Non-limiting examples include 5' and 3' primers having nucleotides corresponding or complementary to a portion of the coding sequence of a LP123, LP127, or LP129 polypeptide, e.g., as presented in SEQ ID NO: 2, 4, or 6, according to known method steps .
The amplified fragment is isolated from a 1% agarose gel using a commercially available kit (e.g., "Geneclean, " BIO 101 Inc., La Jolla, CA) . The fragment then is then digested with the appropriate restriction enzyme and again is purified on a 1% agarose gel. This fragment is designated herein "Fl."
The plasmid is digested with the corresponding restriction enzymes and optionally, can be dephosphorylated using calf intestinal phosphatase, using routine procedures known in the art. The DNA is then isolated from a 1% agarose gel using a commercially available kit ( "Geneclean, " BIO 101 Inc., La Jolla, CA) . This vector DNA is designated herein "VI." Fragment Fl and the dephosphorylated plasmid VI are ligated together with T4 DNA ligase. E. coli HB101 or other suitable E. coli hosts such as XL-1 Blue (Stratagene Cloning Systems, La Jolla, CA) cells are transformed with the ligation mixture and spread on culture plates. Bacteria are identified that contain the plasmid bearing the human LP123, LP127, or LP129 gene using the PCR method, in which one of the primers that is used to amplify the gene and the second primer is from well within the vector so that only those bacterial colonies containing the LP123, LP127, or LP129 gene fragment will show amplification of the DNA. The sequence of the cloned fragment is confirmed by DNA sequencing. This plasmid is designated herein as pBacLPl23, pBacLP127, or pBacLPl29.
Five μg of the plasmid pBacLPl23, pBacLP127, or pBacLPl29 is co-transfected with 1.0 μg of a commercially available linearized baculovirus DNA ( "BaculoGold™ baculovirus DNA", Pharmingen, San Diego, CA) , using the lipofection method described by Feigner, et al . , Proc. Natl. Acad. Sci. USA 84: 7413-7 (1987). 1 μg of BaculoGold™ virus DNA and 5 μg of the plasmid pBacLPl23, pBacLPl27, or pBacLPl29 are mixed in a sterile well of a microtiter plate containing 50 μL of serum-free Grace's medium (Life Technologies, Inc., Rockville, MD) . Afterwards, 10 μL Lipofectin plus 90 μL Grace's medium are added, mixed and incubated for 15 minutes at room temperature. Then the transfection mixture is added drop-wise to Sf9 insect cells (ATCC CRL 1711) seeded in a 35mm tissue culture plate with 1 mL Grace's medium without serum. The plate is rocked back and forth to mix the newly added solution. The plate is then incubated for 5 hours at 27°C. After 5 hours the transfection solution is removed from the plate and 1 mL of Grace's insect medium supplemented with 10% fetal calf serum is added. The plate is put back into an incubator and cultivation is continued at 27°C for four days.
After four days the supernatant is collected, and a plaque assay is performed. An agarose gel with "Blue Gal" (Life Technologies, Inc., Rockville, MD) is used to allow easy identification and isolation of gal-expressing clones, which produce blue-stained plaques. (A detailed description of a "plaque assay" of this type can also be found in the user's guide for insect cell culture and baculovirology distributed by Life Technologies, Inc., Rockville, MD, pages 9-10) . After appropriate incubation, blue stained plaques are picked with a micropipettor tip (e.g., Eppendorf) . The agar containing the recombinant viruses is then resuspended in a microcentrifuge tube containing 200 μL of Grace's medium, and the suspension containing the recombinant baculovirus is used to infect Sf9 cells seeded in 35mm dishes. Four days later the supernatants of these culture dishes are harvested, and then they are stored at 4°C. The recombinant virus is called V-LP123, V-LP127, or V-LP129. To' verify the expression of the LP123, LP127, or LP129 gene, Sf9 cells are grown in Grace's medium supplemented with 10% heat-inactivated FBS . The cells are infected with the recombinant baculovirus V-LP123, V-LP127, or V-LP129 at a multiplicity of infection ("MOI") of about 2. Six hours later the medium is removed and is replaced with SF900 II medium minus methionine and cysteine (available, e.g. , from Life Technologies, Inc., Rockville, MD) . If radiolabeled polypeptides are desired, 42 hours later, 5 mCi of 35S- methionine and 5 Ci 35S-cysteine (available from Amersham) are added. The cells are further incubated for 16 hours and then they are harvested by centrifugation. The polypeptides in the supernatant as well as the intracellular polypeptides are analyzed by SDS-PAGE followed by autoradiography (if radiolabeled) . Microsequencing of the amino acid sequence of the amino terminus of purified polypeptide can be used to determine the amino terminal sequence of the mature polypeptide and thus the cleavage point and length of the secretory signal peptide.
Example 4
Cloning and Expression of LP123, LP127, or LP129 in Mammalian Cells
A typical mammalian expression vector contains at least one promoter element, which mediates the initiation of transcription of mRNA, the polypeptide coding sequence, and signals required for the termination of transcription and polyadenylation of the transcript. Additional elements include enhancers, Kozak sequences and intervening sequences flanked by donor and acceptor sites for RNA splicing. Highly efficient transcription can be achieved with the early and late promoters from SV40, the long terminal repeats (LTRS) from retroviruses, e.g., RSV, HTLVI, HIVI and the early promoter of the cytomegalovirus (CMV) . However, cellular elements can also be used (e.g., the human actin promoter) . Suitable expression vectors for use in practicing the present invention include, for example, vectors such as pIRESlneo, pRetro-Off, pRetro-On, PLXSN, or pLNCX (Clonetech Labs, Palo Alto, CA) , pcDNA3.1 (+/-), pcDNA/Zeo (+/-) or pcDNA3.1/Hygro (+/-) (Invitrogen), PSVL and PMSG (Pharmacia, Uppsala, Sweden), pRSVcat (ATCC 37152), pSV2dhfr (ATCC 37146) and pBC12MI (ATCC 67109) . Other suitable mammalian host cells include human Hela 293, H9 , Jurkat cells, mouse NIH3T3, C127 cells, Cos 1, Cos 7 and CV 1, quail QC1-3 cells, mouse L cells and Chinese hamster ovary (CHO) cells.
Alternatively, the gene is expressed in stable cell lines that contain the gene integrated into a chromosome. The co-transfection with a selectable marker such as DHRF (dihydrofolate reductase) , GPT neomycin, or hygromycin allows the identification and isolation of the transfected cells .
The transfected gene can also be amplified to express large amounts of the encoded polypeptide . The DHFR marker is useful to develop cell lines that carry several hundred or even several thousand copies of the gene of interest. Another useful selection marker is the enzyme glutamine synthase (GS) [Murphy, et al . , Biochem. J. 277 (Part 1): 277- 9 (1991); Bebbington, et al . , Bio/Technology 10(2): 169-175 (1992)]. Using these markers, the mammalian cells are grown in selective medium and the cells with the highest resistance are selected. These cell lines contain the amplified gene(s) integrated into a chromosome. Chinese hamster ovary (CHO) and NSO cells are often used for the production of polypeptides.
The expression vectors pCl and pC4 contain the strong promoter (LTR) of the Rous Sarcoma Virus [Cullen, et al . , Mol. Cell. Biol. 5(3): 438-47 (1985)] plus a fragment of the CMV-enhancer [Boshart, et al . , Cell 41(2): 521-30 (1985)]. Multiple cloning sites, e.g., with the restriction enzyme cleavage sites BamHI, Xbal and Asp718, facilitate the cloning of the gene of interest . The vectors contain in addition the 3' intron, the polyadenylation and termination signal of the rat preproinsulin gene.
Example 4(a) Cloning and Expression in COS Cells
The expression plasmid, pLPl23 HA, pLPl27 HA, or pLPl29 HA, is made by cloning a cDNA encoding LP123, LP127, or LP129 into the expression vector pcDNAI/Amp or pcDNAIII (which can be obtained from Invitrogen, Inc.). The expression vector pcDNAI/amp contains: (1) an E. coli origin of replication effective for propagation in E. coli. and other prokaryotic cells; (2) an ampicillin resistance gene for selection of plasmid-containing prokaryotic cells; (3) an SV40 origin of replication for propagation in eukaryotic cells; (4) a CMV promoter, a polylinker, an SV40 intron; (5) several codons encoding a hemagglutinin fragment (i.e., an "HA" tag to facilitate purification) or HIS tag (see, e.g, Ausubel, supra) followed by a termination codon and polyadenylation signal arranged so that a cDNA can be conveniently placed under expression control of the CMV promoter and operably linked to the SV40 intron and the polyadenylation signal by means of restriction sites in the polylinker. The HA tag corresponds to an epitope derived from the influenza hemagglutinin polypeptide described by Wilson, et al . , Cell 37(3): 767-78 (1984) . The fusion of the HA tag to the target polypeptide allows easy detection and recovery of the recombinant polypeptide with an antibody that recognizes the HA epitope. pcDNAIII contains, in addition, the selectable neomycin marker.
A DNA fragment encoding the LP123, LP127, or LP129 is cloned into the polylinker region of the vector so that recombinant polypeptide expression is directed by the CMV promoter. The plasmid construction strategy is as follows. The LP123, LP127, or LP129 cDNA of a clone is amplified using primers that contain convenient restriction sites, much as described above for construction of vectors for expression of LP123, LP127, or LP129 in E. coli. Non- limiting examples of suitable primers include those based on the coding sequences presented in SEQ ID NO: 2, 4, or 6 as they encode LP123, LP127, or LP129 as described herein. The PCR amplified DNA fragment and the vector, pcDNAI/Amp, are digested with suitable restriction enzyme (s) and then ligated. The ligation mixture is transformed into E. coli strain SURE (available from Stratagene Cloning Systems, 11099 North Torrey Pines Road, La Jolla, CA 92037), and the transformed culture is plated on ampicillin media plates which then are incubated to allow growth of ampicillin resistant colonies. Plasmid DNA is isolated from resistant colonies and examined by restriction analysis or other means for the presence of the LP123-, LP127-, or LPl29-encoding fragment.
For expression of recombinant LP123, LP127, or LP129, COS cells are transfected with an expression vector, as described above, using DEAE-DEXTRAN, as described, for instance, in Sambrook, et al . , Molecular Cloning: a Laboratory Manual, Cold Spring Laboratory Press, Cold Spring Harbor, New York (1989) . Cells are incubated under conditions for expression of LP123, LP127, or LP129 by the vector.
Expression of the LP123-, LP127-, or LP129-HA fusion polypeptide is detected by radiolabeling and immunoprecipitation, using methods described in, for example Harlow, et al . , Antibodies: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (1988) . To this end, two days after transfection, the cells are labeled by incubation in media containing 35S- cysteine for 8 hours. The cells and the media are collected, and the cells are washed and lysed with detergent-containing RIPA buffer: 150. mM NaCl, 1% NP-40, 0.1% SDS, 0.5% DOC, 50 mM TRIS, pH 7.5 , as described by Wilson, et al . , cited above. Proteins are precipitated from the cell lysate and from the culture media using an HA- specific monoclonal antibody. The precipitated polypeptides are then analyzed by SDS-PAGE and autoradiography. An expression product of the expected size is seen in the cell lysate, which is not seen in negative controls.
Example 4 (b)
Cloning and Expression in CHO Cells
The vector pC4 is used for the expression of LP123, LP127, or LP129 polypeptide. Plasmid pC4 is a derivative of the plasmid pSV2-dhfr (ATCC Accession No. 37146) . The plasmid contains the mouse DHFR gene under control of the SV40 early promoter. Chinese hamster ovary cells or other cells lacking dihydrofolate activity that are transfected with these plasmids can be selected by growing the cells in a selective medium (alpha minus MEM, Life Technologies) supplemented with methotrexate. The amplification of the DHFR genes in cells resistant to methotrexate (MTX) has been well documented [see, e.g., F.W. Alt, et al . , J. Biol. Chem. 253(5): 1357-70 (1978); J.L. Hamlin and C. Ma, Biochem. et Biophys. Acta 1087(2): 107-25 (1990); and M.J. Page and M.A. Sydenham, Biotechnology 9 (1) : 64-8 (1991)]. Cells grown in increasing concentrations of MTX develop resistance to the drug by overproducing the target enzyme, DHFR, as a result of amplification of the DHFR gene. If a second gene is linked to the DHFR gene, it is usually co-amplified and over-expressed. It is known in the art that this approach can be used to develop cell lines carrying more than 1,000 copies of the amplified gene(s). Subsequently, when the methotrexate is withdrawn, cell lines are obtained which contain the amplified gene integrated into one or more chromosome (s) of the host cell. Plasmid pC4 contains for expressing the gene of interest the strong promoter of the long terminal repeat (LTR) of the Rous Sarcoma Virus [Cullen, et al . , Mol. Cell. Biol. 5(3): 438-47 (1985)] plus a fragment isolated from the enhancer of the immediate early gene of human cytomegalovirus (CMV) [Boshart, et al . , Cell 41(2): 521-30 (1985) ] . Downstream of the promoter are BamHI, Xbal, and Asp718 restriction enzyme cleavage sites that allow integration of the genes. Behind these cloning sites the plasmid contains the 3' intron and polyadenylation site of the rat preproinsulin gene. Other high efficiency promoters can also be used for the expression, e.g., the human b-actin promoter, the SV40 early or late promoters or the long terminal repeats from other retroviruses, e.g., HIV and HTLVI . Clontech's Tet-Off and Tet-On gene expression systems and similar systems can be used to express the
LP123, LP127, or LP129 in a regulated way in mammalian cells [M. Gossen, and H. Bujard, Proc. Natl. Acad. Sci. USA 89(12): 5547-51 (1992)]. For the polyadenylation of the mRNA other signals, e.g., from the human growth hormone or globin genes can be used as well. Stable cell lines carrying a gene of interest integrated into the chromosomes can also be selected upon co-transfection with a selectable marker such as gpt, G418 or hygromycin. It is advantageous to use more than one selectable marker in the beginning, e.g., G418 plus methotrexate.
The plasmid pC4 is digested with restriction enzymes and then dephosphorylated using calf intestinal phosphatase by procedures known in the art. The vector is then isolated from a 1% agarose gel .
The DNA sequence encoding the complete LP123, LP127, or LP129 polypeptide is amplified using PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the gene. Non-limiting examples include 5' and 3' primers having nucleotides corresponding or complementary to a portion of the coding sequences of LP123, LP127, or LP129, e.g., as presented in SEQ ID NO: 2, 4, or 6, according to known method steps.
The amplified fragment is digested with suitable endonucleases and then purified again on a 1% agarose gel. The isolated fragment and the dephosphorylated vector are then ligated with T4 DNA ligase. E. coli HB101 or XL-1 Blue cells are then transformed and bacteria are identified that contain the fragment inserted into plasmid pC4 using, for instance, restriction enzyme analysis.
Chinese hamster ovary (CHO) cells lacking an active DHFR gene are used for transfection. 5 μg of the expression plasmid pC4 is cotransfected with 0.5 μg of the plasmid pSV2-neo using lipofectin. The plasmid pSV2-neo contains a dominant selectable marker, the neo gene from Tn5 encoding an enzyme that confers resistance to a group of antibiotics including G418. The cells are seeded in alpha minus MEM supplemented with 1 μg/mL G418. After 2 days, the cells are trypsinized and seeded in hybridoma cloning plates (Greiner, Germany) in alpha minus MEM supplemented with 10, 25, or 50 ng/mL of methotrexate plus 1 μg/mL G418. After about 10-14 days single clones are trypsinized and then seeded in 6-well petri dishes or 10 mL flasks using different concentrations of methotrexate (50 nM, 100 nM, 200 nM, 400 nM, 800 nM) . Clones growing at the highest concentrations of methotrexate are then transferred to new 6-well plates containing even higher concentrations of methotrexate (1 mM, 2 mM, 5 mM, 10 mM, 20 mM) . The same procedure is repeated until clones are obtained which grow at a concentration of 100-200 mM. Expression of the desired gene product is analyzed, for instance, by SDS-PAGE and Western blot or by reversed-phase HPLC analysis.
Example 5 Tissue Distribution of LP123, LP127, or LP129 mRNA Expression
Northern blot analysis is carried out to examine LP123, LP127, or LP129 gene expression in human tissues, using methods described by, among others, Sambrook, et al . , cited above. A cDNA probe containing the entire nucleotide sequence of LP123, LP127, or LP129 polypeptide (SEQ ID N0:1, 3, or 5) is labeled with 32P using the Rediprime™ DNA labeling system (Amersham Life Science) , according to the manufacturer's instructions. After labeling, the probe is purified using a CHROMA SPIN-100™ column (Clontech Laboratories, Inc.), according to the manufacturer's protocol number PT1200-1. The purified and labeled probe is used to examine various human tissues for LP123, LP127, or LP129 mRNA.
Multiple Tissue Northern (MTN) blots containing various human tissues (H) or human immune system tissues (IM) are obtained from Clontech and are examined with the labeled probe using ExpressHyb hybridization solution (Clontech) according to manufacturer's protocol number PT1190-1. Following hybridization and washing, the blots are mounted and exposed to film at -70°C overnight, and developed according to standard procedures .

Claims

WHAT IS CLAIMED IS:
1. Isolated nucleic acid comprising DNA having at least an 75% sequence identity to nucleic acid selected from the group consisting of: a) a DNA molecule encoding an LP123 polypeptide comprising the sequence of amino acid residues 1 or 22 through 85, inclusive, of SEQ ID NO: 2; b) ■ the complement of the DNA molecule of (a) ; c) a DNA molecule encoding an LP127 polypeptide comprising the sequence of amino acid residues 1 or 23 through 108, inclusive, of SEQ ID NO: 4; d) the complement of the DNA molecule of (c) ; e) a DNA molecule encoding an LP129 polypeptide ' comprising the sequence of amino acid residues 1 through 71, inclusive, of SEQ ID NO: 6; and, f) the complement of the DNA molecule of (e) .
2. The nucleic acid of Claim 1, wherein said DNA comprises the sequence of corresponding nucleotides selected from the group consisting of: a) nucleotide positions 20 or 83 through 274, inclusive, of SEQ ID N0:1; b) nucleotide positions 311 or 377 through 634, inclusive, of SEQ ID NO: 3; and, c) nucleotide positions 246 through 458, inclusive, of SEQ ID NO: 5.
3. The nucleic acid of Claim 1, wherein said DNA comprises the nucleotide sequences selected from the group consisting of SEQ ID NO:l, SEQ ID NO: 3, and SEQ ID NO: 5.
4. The isolated nucleic acid molecule of Claim 1 comprising a nucleotide sequence that encodes the sequence of amino acid residues selected from the group consisting of: a) from 1 or about 22 to about 85 of SEQ ID NO : 2 ; b) from 1 or about 23 to about 108 of SEQ ID NO: 4; and, c) from 1 to about 71 of SEQ ID NO: 6.
5. An isolated nucleic acid molecule encoding a polypeptide comprising DNA that hybridizes to the complement of the nucleic acid sequence that encodes amino acids selected from the group consisting of: a) from 1 or about 22 to about 85 of SEQ ID NO : 2 ; b) from 1 or about 23 to about 108 of SEQ ID
NO: 4; and, c) from 1 to about 71 of SEQ ID NO: 6.
6. The isolated nucleic acid molecule of claim 5, wherein the isolated nucleic acid sequence is selected from the group consisting of: a) nucleotides 20 or about 83 to about 274, inclusive, of SEQ ID NO:l; b) nucleotides 311 or about 377 to about 634, inclusive, of SEQ ID NO: 3; and c) nucleotides 246 to about 458, inclusive, of SEQ ID NO: 5.
7. The isolated nucleic acid molecule of claim 5, wherein hybridization occurs under stringent hybridization and wash conditions.
8. An isolated nucleic acid molecule comprising DNA encoding a polypeptide scoring at least 90% positives when compared to the sequence of amino acid residues selected
5. from the group consisting of: a) amino acid residues 1 or 22 through 85, inclusive, of SEQ ID NO : 2 ; b) amino acid residues 1 or 23 through 108, inclusive, of SEQ ID NO: 4; and, 0 c) amino acid residues 1 through 71, inclusive, of SEQ ID NO: 6.
9. An isolated nucleic acid molecule comprising at least about 250 nucleotides in length and which is produced 5 by hybridizing a test DNA under stringent hybridization conditions with a DNA molecule which encodes a polypeptide comprising a sequence of amino acid residues selected from the group consisting of: a) amino acid residues 1 or 22 through 85, 0 inclusive, of SEQ ID NO : 2 ; b) the complement of the DNA molecule of (a) ; c) amino acid residue's 1 or 23 through 108, inclusive, of SEQ ID NO: 4; d) the complement of the DNA molecule of (c) ; 5 e) amino acid residues 1 through 71, inclusive, of SEQ ID NO: 6; and, f) the complement of the DNA molecule of (e) .
10. The isolated nucleic acid molecule of claim 9, 0 which has at least about 75% sequence identity to (a) through (f) .
11. A vector comprising the nucleic acid molecule of any of Claims 1 to 10.
12. The vector of Claim 11, wherein said nucleic acid molecule is operably linked to control sequences recognized
' by a host cell transformed with the vector.
13. A host cell comprising the vector of Claim 12.
14. The host cell of Claim 13, wherein said cell is a CHO cell.
15. The host cell of Claim 13, wherein said cell is an E. coli cell.
16. The host cell of Claim 13, wherein said cell is an Sf9 insect cell.
17. A process for producing a polypeptide comprising culturing the host cell of Claim 13 under conditions suitable for expression of said polypeptide and recovering said polypeptide from the cell culture.
18. An isolated polypeptide comprising an amino acid sequence comprising at least about 90% sequence identity to the sequence comprising amino acid residues selected from the group consisting of: a) amino acid residues 1 or 22 through 85, inclusive, of SEQ ID NO: 2; b) amino acid residues 1 or 23 through 108, inclusive, of SEQ ID NO: 4; and, c) amino acid residues 1 through 71, inclusive, of SEQ ID NO: 6.
19. The isolated polypeptide of claim 18 comprising a) amino acid residues selected from the group consisting of: b) amino acid residues 1 or 22 through 85, inclusive, of SEQ ID NO : 2 ; c) amino acid residues 1 or 23 through 108, inclusive, of SEQ ID NO: 4; and, amino acid residues 1 through 71, inclusive, of SEQ ID NO: 6.
20. An isolated polypeptide scoring at least 90% positives when compared to the sequence of amino acids selected from the group consisting of: a) amino acid residues 1 or 22 through 85, inclusive, of SEQ ID NO : 2 ; b) amino acid residues 1 or 23 through 108, inclusive, of SEQ ID NO: 4; and, c) amino acid residues 1 through 71, inclusive, of SEQ ID NO: 6.
21. An isolated polypeptide comprising the sequence of amino acid residues selected from the group consisting of: a) amino acid residues 1 or 22 through 85, inclusive, of SEQ ID NO: 2; b) amino acid residues 1 or 23 through 108, inclusive, of SEQ ID NO: 4; c) amino acid residues 1 through 71, inclusive, of SEQ ID NO: 6; and. d) fragments of (a) through (c) sufficient to provide a binding site for an antibody to a polypeptide selected from the group consisting of LP123, LP127, and LP129.
22. An isolated polypeptide produced by the method of Claim 17.
23. A chimeric molecule comprising a polypeptide fused to a heterologous amino acid sequence, wherein said polypeptide is selected from the group consisting of LP123, LP127, and LP129.
24. The chimeric molecule of Claim 23, wherein said heterologous amino acid sequence is an epitope tag sequence.
25. The chimeric molecule of Claim 23, wherein said heterologous amino acid sequence is an Fc region of an immunoglobulin.
26. An antibody which specifically binds to a polypeptide, wherein said polypeptide is selected from the group consisting of LP123, LP127, and LP129.
27. The antibody of Claim 26, wherein said antibody is a monoclonal antibody.
28. The antibody of Claim 26, wherein said antibody is selected from the group consisting of a humanized antibody and a human antibody.
29. An agonist to a polypeptide, wherein said polypeptide is selected from the group consisting of LP123, LP127, and LP129.
30. An antagonist to a polypeptide, wherein said polypeptide is selected from the group consisting of LP123, LP127, and LP129.
31. A composition comprising a therapeutically effective amount of an active agent selected from the group consisting of: (a) an LP123, LP127, and LP129 polypeptide,
(b) an agonist to an LP123, LP127, and LP129 polypeptide,
(c) an antagonist to an LP123, LP127, and LP129 polypeptide, and (d) an anti-LPl23, -LP127, and -LP129 antibody; in combination with a pharmaceutically acceptable carrier.
32. A method of treating a medical disorder comprising administering a therapeutically effective amount of an agonist or antagonist of a polypeptide to a mammal suffering from said disorder, wherein said polypeptide is selected from the group consisting of LP123, LP127, and LP129.
33. A method of diagnosing a medical disorder by: (1) culturing test cells or tissues expressing a polypeptide; (2) administering a compound which can inhibit the polypeptide-modulated signaling; and (3) measuring the polypeptide-mediated phenotypic effects in the test cells or tissues; wherein said polypeptide is selected from the group consisting of LP123, LP127, and LP129.
34. An article of manufacture comprising a container, label and therapeutically effective amount of an agonist or antagonist to a polypeptide, wherein said polypeptide is selected from the group consisting of LP123, LP127, and LP129, in combination with a pharmaceutically effective carrier.
PCT/US2001/022602 2000-08-24 2001-08-20 Nucleic acids, vectors, host cells, polypeptides and uses thereof WO2002016579A2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2001284655A AU2001284655A1 (en) 2000-08-24 2001-08-20 Nucleic acids, vectors, host cells, polypeptides and uses thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US22776000P 2000-08-24 2000-08-24
US60/227,760 2000-08-24

Publications (3)

Publication Number Publication Date
WO2002016579A2 true WO2002016579A2 (en) 2002-02-28
WO2002016579A8 WO2002016579A8 (en) 2002-05-30
WO2002016579A3 WO2002016579A3 (en) 2002-11-28

Family

ID=22854345

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2001/022602 WO2002016579A2 (en) 2000-08-24 2001-08-20 Nucleic acids, vectors, host cells, polypeptides and uses thereof

Country Status (2)

Country Link
AU (1) AU2001284655A1 (en)
WO (1) WO2002016579A2 (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999006427A1 (en) * 1997-08-04 1999-02-11 Millennium Biotherapeutics, Inc. Tango-78, tango-79, and tango-81 nucleic acid molecules and polypeptides
WO1999018204A2 (en) * 1997-10-08 1999-04-15 Sagami Chemical Research Center HUMAN PROTEINS HAVING SECRETORY SIGNAL SEQUENCES AND cDNAS ENCODING THESE PROTEINS

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001055321A2 (en) * 2000-01-31 2001-08-02 Human Genome Sciences, Inc. Nucleic acids, proteins, and antibodies

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999006427A1 (en) * 1997-08-04 1999-02-11 Millennium Biotherapeutics, Inc. Tango-78, tango-79, and tango-81 nucleic acid molecules and polypeptides
WO1999018204A2 (en) * 1997-10-08 1999-04-15 Sagami Chemical Research Center HUMAN PROTEINS HAVING SECRETORY SIGNAL SEQUENCES AND cDNAS ENCODING THESE PROTEINS

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
CLEMETSON J M ET AL.: "The platelet collagen receptor glycoprotein VI is a member of the immunoglobulin superfamily closely related to FcalphaR and the natural killer receptors." JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 274, no. 41, 8 October 1999 (1999-10-08), pages 29019-29024, XP002202379 ISSN: 0021-9258 *
DATABASE EMBL [Online] EMBL; partial doc, 4 August 1999 (1999-08-04) DOE JOINT GENOME INSTITUTE: "Homo sapiens chromosome 16 clone RP11-433G23, WORKING DRAFT SEQUENCE, 40 unordered pieces" Database accession no. AC009098 XP002202380 *
DATABASE EMBL [Online] GSN; 9 August 2001 (2001-08-09) ROSEN C A ET AL.: "Human immune/haematopoietic antigen genomic sequence SEQ ID NO:21268" Database accession no. AAK66456 XP002202381 -& WO 01 57182 A (HUMAN GENOME SCIENCES INC ;ROSEN CRAIG A (US); BARASH STEVEN C (US)) 9 August 2001 (2001-08-09) *
SULSTON J E ET AL.: "Toward a complete human genome sequence" GENOME RESEARCH, COLD SPRING HARBOR LABORATORY PRESS, US, vol. 8, no. 11, 1998, pages 1097-1108, XP002181292 ISSN: 1088-9051 *

Also Published As

Publication number Publication date
WO2002016579A3 (en) 2002-11-28
WO2002016579A8 (en) 2002-05-30
AU2001284655A1 (en) 2002-03-04

Similar Documents

Publication Publication Date Title
US6455283B1 (en) Nucleic acids encoding vascular endothelial cell growth factor-E (VEGF-E)
US20060147945A1 (en) Novel secreted proteins and their uses
WO2002014358A2 (en) Novel secreted proteins and their uses
US20040038242A1 (en) Novel secreted proteins and their uses
US20030215913A1 (en) Nucleic acids, vectors, host cells, polypeptides, and uses thereof
JP2012246296A (en) New inhibitor of hepatocyte growth factor for use in modulation of angiogenesis and cardiovascularization
US20040142333A1 (en) Novel secreted proteins and their uses
DE60038740T2 (en) Stimulation or inhibition of angiogenesis and cardiovascularisation
US20050048483A1 (en) Novel secreted proteins and their uses
JP2003530082A6 (en) Compositions and methods for treating immune related diseases
WO2002048361A2 (en) Novel secreted proteins and their uses
EP1313765A2 (en) Secreted proteins and methods of using same
WO2002016579A2 (en) Nucleic acids, vectors, host cells, polypeptides and uses thereof
CA2341767A1 (en) Promotion or inhibition of angiogenesis and cardiovascularization
US20030212258A1 (en) Novel secreted proteins and methods of using same
US20060142558A1 (en) Novel proteins and their uses
US20030216547A1 (en) Cerebellin homologous polypeptides and therapeutic uses thereof
US20040215007A1 (en) Novel secreted proteins and their uses
EP1500663A1 (en) Secreted proteins and their uses
AU2003204852B2 (en) Polypeptides homologous to VEGF and BMP1
WO2002008283A2 (en) Lp120 polypeptides and therapeutic uses thereof
WO2004044126A2 (en) Novel proteins and their uses
WO2003083048A2 (en) Novel secreted proteins and their uses
EP1529843A2 (en) Novel secreted proteins and their uses

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DE DK DK DM DZ EC EE ES FI FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PH PL PT RO RU SD SE SG SI SK SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
AK Designated states

Kind code of ref document: C1

Designated state(s): AE AG AL AM AT AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DE DK DK DM DZ EC EE ES FI FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PH PL PT RO RU SD SE SG SI SK SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: C1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

CFP Corrected version of a pamphlet front page
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
AK Designated states

Kind code of ref document: A3

Designated state(s): AE AG AL AM AT AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DE DK DK DM DZ EC EE ES FI FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PH PL PT RO RU SD SE SG SI SK SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase in:

Ref country code: JP