WO2002012503A1

WO2002012503A1 - Production in pichia pastoris yeast and system for purifying the recombinant allergen of olea europaea ole e 1 for utilization in the diagnosis and treatment of allergies

Info

Publication number: WO2002012503A1
Application number: PCT/ES2001/000287
Authority: WO
Inventors: Rosalia Rodriguez Garcia; Maria Teresa Villalba Diaz; Rafael Monsalve Clemente; Eva Batanero Cremades
Original assignee: Universidad Complutense De Madrid
Priority date: 2000-07-28
Filing date: 2001-07-19
Publication date: 2002-02-14
Also published as: WO2002012503A8; ES2209563B1; ES2209563A1; AU2001272565A1

Abstract

The invention relates to the production in Pichia pastoris yeast and a system for purifying the recombinant allergen of Olea europaea Ole e 1 for utilization in the diagnosis and treatment of allergies. The recombinant DNA coding for allergens Ole e 1 of olive tree pollen (Olea europaea), Syr v 1 from lilac pollen (Syringa vulgaris) and Lig v 1 of privet (Ligustrum vulgare) has been cloned and expressed. Such allergens have great structural similarity amongst them and with other pollen allergens of other Oleaceae. Recombinant proteins produced in the Pichia pastoris yeast are isolated with high yields, are correctly folded and exhibit immunological properties equivalent to those of natural allergens. Hence, they can be used in diagnosis protocol and immunotherapy.

Description

TITLE

Production in the yeast Pichia pastoris and purification system of the recombinant allergen of Olea europaea Ole e 1 for use in diagnosis and treatment of allergies.

SECTOR OF THE TECHNIQUE. OBJECT OF THE INVENTION

The present invention, as expressed in the description of this specification, refers to one of the olive pollen allergens (Olea europaea), the Ole e 1 protein, and allergenic epitopes present in the protein. The invention also refers to recombinant DNAs that encode both complete proteins and fragments that include one or more epitopes of the molecule, and homologous Ole e 1 molecules with allergenic capacity in other species, such as Lig v 1 pollen Aligustre (igustrum vulgare) and Syr v 1 of lilac pollen (Syr inga vulgaris) The object of the invention is also the production of Ole e 1, Syr v 1 and Lig v 1 proteins by recombinant technology in yeast Pichia pastoris, which implies the use of the nucleotide sequences SEQ ID NO: 1, 2, 3,, 5, 6, 7, 8 or other nucleotide sequences obtained by mutagenesis of the sequences SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8.

The invention provides an effective method of isolation for these proteins with high yield.

STATE OF THE PRIOR ART OF THE INVENTION

Type I allergy is a disease that affects more than 20% of the population of industrialized countries. This condition is caused by allergens, present in both organisms and biological products - food, mites, insect poisons, pollens, fungi, mammalian epithelia - and in synthetic materials. In most of the allergenic biological sources, the allergens they are proteins of molecular masses between 5 and 70 Da. Symptoms that arise from allergy, such as rhinitis, conjunctitis, or asthma, are caused by the release of cell mediators, such as histamine, from basophils and mast cells, cells of the immune system. Said release is induced by cross-linking of IgEs antibodies bound to high affinity receptors.

FcεRI, which are in turn anchored to basophils and mast cells. The cross-linking of the IgE is caused by the binding of the corresponding allergen, or a fragment thereof, through an IgE epitope (contained in said allergen, or in its fragment). The therapy that is currently being used to treat the allergy involves the hyposensitization of the patient by parental or oral administration of adequate doses of the allergen itself, or related allergoids. In almost all cases, an allergenic extract is obtained, through minimal manipulation, of the natural biological source, which implies a very complex mixture of proteins and other substances, in which the allergen - or allergens - can represent a very small part of the total product used.

In fact, at present, the protocols used for the diagnosis of allergy cases and their subsequent immunotherapy involve the use of allergenic extracts that are often not characterized, or even standardized with respect to the most important allergens they may contain. Often, its administration does not provide a complete diagnosis, especially when the patient's hypersensitivity refers to allergens present in low concentration in said extracts. On the other hand, the immunotherapy performed with these preparations is often ineffective and sometimes causes undesirable side effects that may come to be more serious than the allergic condition that is intended to resolve. An alternative to the use of these extracts is the preparation of mixtures of the most significant allergens, obtained by isolation from their natural source. However, this route presents two important barriers. On the one hand, it implies a good knowledge of the allergenic components of the material that causes the allergy, at least of all its main allergens, and this data is frequently not available. On the other hand, the process of isolation of known allergens, from the biological material, is often difficult and does not provide the necessary quantities or the quality required for subsequent use, mainly due to the low levels in which it is found. All these problems are accentuated when the allergenic material is the pollen of a plant species. The large amount of pigments, carbohydrates, lipids and insoluble components make handling very difficult. It goes without saying that its availability is also very low and of high economic cost, due to the difficulty of its collection. For all the above, it is necessary to design procedures for the production of allergens to be used in allergy diagnosis and immunotherapy protocols. The production of recombinant DNA is predicted as the most reproducible and effective way to obtain well-defined allergenic polypeptides, not only for clinical use, but even for research.

Olive polynose is one of the most important causes of allergy in Mediterranean countries, where the olive is intensely cultivated. At present, several allergens of olive pollen are known, with Ole e 1 showing the highest incidence among patients allergic to olive trees since it affects more than 70% of them. Ole e 1 is a glycoprotein consisting of 145 amino acids - corresponding to 16.3 kDa- and a carbohydrate fraction of 1.5 kDa [Villalba, M, et al. Eur. J. Biochem. 216, 863-869 (1993)]. The DNA encoding Ole e 1 has been cloned, sequenced and expressed in E. coli, by the inventors [Villalba, M., et al. J. Biol. Chem. 269, 15217-15222, 1994], having been determined to occur in pollen with a high degree of polymorphism. Likewise, the antigenic properties of the glycosidic fraction have been characterized [Batanero, E., et al.J. Allergy Clin Immunol 97, 1264-71, 1996; Batanero, E., et al. J. Allergy Clin. Immunol 103, 147-53, 1999], and its tissue location [Martín-Orozco, E., et al. Int. Arch. Allergy Immunol. 104, 160-170, 1994]. On the other hand, the homologous proteins of Ole e 1 in alligator pollen (Ligustrum vulgare), Lig v 1, and in lilac pollen (Syringa vulgaris), Syr v 1, have been isolated from their natural source, and have originated a cross-allergenic reaction with Ole e 1, against the sera of patients allergic to olive pollen. The specific cDNA encoding these proteins has been cloned, sequenced, and expressed in E. coli [Batanero E., et al Clin. Exp. Allergy 26, 1401-1410, 1996; Batanero E., et al. Eur. J. Biochem. 221, 187-193, 1994].

EXPLANATION OF THE INVENTION The present invention relates to the production in Pichia pastoris yeast and purification of the recombinant allergen of Olea europaea Ole e 1.

By means of the process, object of the invention, recombinant DNA molecules are obtained that encode polypeptides that exhibit the antigenicity of Ole e 1, an olive allergen (Olea europaea) and other plants (lilac and aligustre) that possess homologous allergens of Ole e 1, as well as for polypeptides containing at least one epitope of Ole e 1 in its structure. The invention has DNA polynucleotide sequences that hybridize under restrictive conditions with those described above - which implies an identity level of at least 60% between their nucleotide sequences - or are derived from them by degeneracy of the genetic code or mutagenesis.

The procedure for obtaining the "Olea europaea Ole e 1" recombinant allergen includes expression vectors and host cells that contain a nucleotide sequence such as those described in SEQ No. 1, 2, 3, 4, 5, 6, 7, encoders of Ole e 1, homologous proteins or fragments thereof.

By means of the process object of this invention, polypeptides are obtained that possess the antigenic activity of the Ole e 1 allergen of olive tree or of its fragments, as well as of homologous Ole e 1 allergens - mainly in species related to the olive tree, such as all Oleaceae - that, given the structural similarity, at least 60%, have cross allergenic reactivity with Ole e 1 or with a part of it. These polypeptides may contain the antigenic sequence linked to other polypeptides (for example as fusion proteins), or have been chemically or enziically modified.

The methods of preparing these polypeptides involve their recombinant production from the aforementioned polynucleotide molecules, in a eukaryotic cell culture system containing the expression vectors described as carriers of those A. Once the polypeptide molecule with antigenic activity of Ole e 1 or its epitopes is produced, it is isolated from the extracellular medium of the culture in soluble form by penetrability and ion exchange chromatography, as described in detail below.

The products obtained through the procedure The object of the invention is the ability to bind IgE antibodies of the serum of patients allergic to olive, sensitive to Ole e 1 or their antigenic segments.

To date, the preparation of the Ole e 1 allergen has not been described, with a yield comparable to that offered with this invention. Obtaining protein from its natural source provides insufficient yields and a highly polymorphic structure. On the other hand, the E. coli expression of the Ole e 1 allergen (Villalba, M., et al. J. Biol. Chem. 269, 15217-15222, 1994; Asturias, JA, et al. J. Allergy Clin. Im unol. 100, 365-372, 1997], produces very little amounts of protein and in conditions of very low solubility due, fundamentally, to an incorrect folding during protein synthesis, with which its subsequent use becomes practically impossible. The procedure described in this invention produces protein levels of an order of greater magnitude: tens of milligrams of protein (about 60) per liter of culture.Finally, with the process object of the invention, Ole e 1 -a will be available olive pollen allergen of the utmost clinical importance - immunologically active, in addition to antigenic fragments of this allergen, and homologous proteins of it, which will be used in the "in vivo" and "in vitro" tests to be carried out for the faithful hypers diagnosis Ensibility to this pollen, and other pollen related phylogenetically with it. They may also be used in allergen preparations that are used to carry out the corresponding immunotherapy for the treatment of olive pollen allergy.

Protein extracts obtained from pollen are currently used for the diagnosis and therapy of olive pollen allergy. This implies a scarce reproducibility and a high content of contaminating molecules, of protein and non-protein origin, which can cause adverse side effects in treated patients. The availability of homogeneous molecules obtained by recombinant DNA techniques, in unlimited quantities, perfectly quantifiable and standardized, will considerably reduce all the aforementioned inconveniences. This technology allows these molecules to be available and in addition to peptides or modified forms thereof containing at least one of the allergenic epitopes.

The use of recombinant Ole e 1 in diagnosis in vivo, by means of skin tests, or in vitro, through immunodetection techniques (ELISA, RAST), will allow to specify which allergens are responsible for the clinical symptoms of an individual and thus reduce the number of molecules necessary for your immunotherapy. Therefore, a personalized immunotherapy will originate.

EMBODIMENT OF THE INVENTION

In the procedure for obtaining the "Olea europaea" Ole e 1 recombinant allergen, the Ole e 1, Syr v 1 and Lig v 1 allergens purified from olive pollen (Olea europaea) (Villalba, M., et. al. Eur. J. Biochem. 216, 863-869, 1993), of lilac (Syringa vulgaris) (Batanero E., et al. J. Biochem. 211, 187-193, 1994) and of aligustre (Ligustrum vulgare) (Batanero E., et al. Clin. Exp. Allergy 26, 1401-1410, 1996). The pollens were supplied by the Allergon AB commercial house. The knowledge of the amino acid sequence of the amino and carboxyl terminal zone of Ole e 1 allowed the design of the oligonucleotides with which its cloning was addressed by PCR and expression. The procedure object of this invention is carried out by the following phases:

• Total RNA isolation

For this purpose, total RNA was isolated from olive pollen following the protocol published by Ullrich A, et al. (Science 196, 1313-1318, 1977). In this isolation, 0.5 g of pollen was started and homogenized in a 0.1 M Tris-HCl buffer, pH 7.5 containing 4M guanidinium thiocyanate and 0.5% sodium lauryl sararinate and 0.14 M 2-mercaptoethanol using a Polytron homogenizer. This suspension was centrifuged at 5000 xg at 20 ° C in a Sorvall centrifuge. The supernatant was subsequently subjected to a gradient centrifugation of 5.7 M CsCl at 0.01 M EDTA at 40,000 rpm in a SW 60 rotor (Beckman) for 12 hours. The same procedure was carried out to isolate other RNAs from different pollens used (corn and birch) and with the different olive tissues used (stem, leaves and fruits). With the latter, an additional initial stage was introduced in which they were macerated in the presence of liquid nitrogen until a fine and homogeneous powder was obtained. From 5 μg of total RNA, double stranded DNA synthesis was carried out using the cDNA synthesis kit (Clontech).

• Cloning of Ole e 1 based on PCR techniques As previously mentioned, the primers used were designed taking into account the sequence of the protein obtained by Edman degradation. The method used was based on a two-stage PCR reaction. In the first one, the Ole e 1 specific cDNA that has been used as a template and the degenerated primers, OLÍ, 5 'CARTTYCAYATZCARGGNCARGT3' and OL2,

5 'ATCATTRTTNGGNGGRTACATNCC3', corresponding to the amino and carboxyl terminal sequence of the protein, respectively, were dissolved in a standard PCR mixture (250μM dNTPs, standard buffer and 50 pmoles of the primers). After a first stage of denaturation at 95 ° C for 15 min, 30 cycles were carried out that each included a stage of denaturation at 94 ° C for 1 min, hybridization at 42 ° C for 1 min 30 s and extension at 72 ° C for 2 min in the presence of Taq DNA polymerase (US. Biochemical Corp.). After cutting the 408 bp band, it was again amplified using 5 cycles of denaturation at 94 ° C (60s), hybridization at 47 ° C (60s) and extension at 72 ° C (90s) and 20 cycles of denaturation at 94 ° C (60s), hybridization

55 ° C (90 s) and extension 72 ° C (90s). Then, and to finish this amplification cycle, the samples are incubated at 72 ° C for 10 minutes. The oligonucleotides used in this reaction were OL3 5 'CCGGGATCCGAARGAYGTNCCNCA 3' and OL4

5 'CGGAATTCTCACATGTTGGGCGGGTA 3' The fragment was purified using the Magic PCR Prep kit (Promega), phosphorylated with the T4 polynucleotide kinase (U. S. Biochemical Corp.) and inserted into the Smal restriction site of a previously digested and dephosphorylated plasmid pUC18. With this construction pUC18 / 01eel, competent DH5αF 'cells were transformed and recombinants were selected and sequencing of some of the selected clones was carried out, obtaining the sequences given in SEQ ID NO 1, SEQ ID NO 2 and SEQ ID NO 3.

Following the same strategy the cloning was carried out of DNA encoding Ole homologous proteins, and also allergens, in other members of the Oleaceae family, such as Syr v 1 of Syringa vulgar is and Lyg v 1 of Lygustrum vulgare. Three clones of Syr v 1 (sequences given in SEQ ID NO 4, SEQ ID NO 5 and SEQ ID NO 6) and two clones of Lyg v 1 (sequences SEQ ID NO 7 and SEQ ID NO 8) were sequenced. The amino acid sequences of the proteins encoded by the clones corresponding to the specific DNA of Ole e 1 are SEQ ID NO 9, SEQ ID NO 10 and SEQ ID NO 11, those corresponding to Syr v 1, SEQ ID NO 12, SEQ ID NO 13 and SEQ ID NO 14 and those corresponding to Lig v 1, SEQ ID NO 15 and SEQ ID NO 16.

For the production of the recombinant forms of these proteins, the DNA coding sequence was linked to the expression plasmid pPIC9 (Invitrogen Corp.). The cells used were from the GS115 strain of Pichia pastoris. The induction was carried out by 0.5% methanol for four days, the cells growing at 30 ° C. The cells were pelleted by centrifuging at 5000 xg and the supernatants were collected and a sample thereof was applied on a 15% polyacrylamide gel in the presence of SDS. A unique 20.5 kDa band was detected by staining the gels with Coomassie Blue. The protein is recognized by the natural Ole e 1 specific polyclonal antibody (1: 5000 dilution), by several monoclonal antibodies and by sera from patients allergic to Ole e 1. Protein purification was carried out by two stages, one Ion exchange chromatography in DEAE-cellulose and a gel filtration in Sephadex G-75, after which the recombinant allergen is obtained at a concentration of 15 to 35 mg / ml and with a purity level of 99%. Structural characterization studies (near and far UV and dichroism spectra and fluorescence spectra) and immunology (with individual sera of allergic patients and with 9 monoclonal antibodies) and in all cases the recombinant proteins behaved in a manner equivalent to that of the natural allergen.

These examples are illustrative only and do not set limits on the conditions, efficacy or applications of the invention defined in the corresponding claims.

Claims

1. Recombinant DNA molecules characterized by SEQ ID NO 1,2,3,4,5,6,7 and 8 encoding polypeptides with allergenic activity that possess at least one common allergenic epitope with the main allergen of Olea europaea.

2. Recombinant DNA molecules, according to claim 1, or modifications thereof, which encode polypeptides with at least one epitope of Ole e 1 in their structure, attached to an additional polypeptide, or chemically or enzymatically modified.

3. Recombinant DNA molecules characterized by presenting at least 60% identity with those described in SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 3, SEQ ID NO 4, SEQ ID NO 5, SEQ ID NO 6, SEQ Id NO 7 and SEQ ID NO 8, containing a nucleotide sequence encoding a polypeptide with identical or reduced allergenic activity (hypoallergenic) with respect to Ole e 1.

4. Recombinant polypeptides of the Ole e 1 allergen of Olea europaea, or fragments of said polypeptides, according to claim 1, characterized by the sequences given in SEQ ID NO 9,10,11, which have the antigenicity of at least one epitope of Ole e 1.

5. Recombinant polypeptides of the main allergen of Syringa vulgaris, or fragments of said polypeptides, according to claim 1, characterized by the sequences given in SEQ, ID NO 12,13,14 which have the antigenicity of at least one epitope of Ole e one.

6. Recombinant polypeptides of the main allergen of Ligustrum vulgare, or fragments of said polypeptides, according to claim 1, characterized by the sequences given in SEQ ID NO 15 and 16 presenting the antigenicity of at least one epitope of Ole e 1.

7. Polypeptides or fragments of said pollen polypeptides of Olea europaea, Syringa vulgaris and Ligustrum vulgare with at least one epitope of Ole e 1 according to previous claims, which produce recombinants bound to an additional polypeptide.

8. Pollen polypeptides of Olea europaea, Syringa vulgaris and Ligustrum vulgare, according to previous claims, which are modified chemically or enzi ent.

9. A eukaryotic expression vector, and preferably pPIC9, containing the nucleotide sequences mentioned in the preceding claims and allowing recombinant production.

10. A eukaryotic host organism, transformed with the construct formed by the expression vector pPIC9 and the DNA sequences (SEQ No. 1,2,3,4,5,6,7,8) of claims 1,2 and 3, which serve to produce the polypeptides indicated in claims 4,5,6 and 7.

11. A method for producing the recombinant forms corresponding to the polypeptide sequences mentioned in claims 4,5,6 and 7, in the yeast eukaryotic system Pichia pastoris and preferably of strain GS15, characterized by ion exchange chromatography in DEAE -cellulose and a gel filtration in Sephadex G-75.

12. Use of the molecules according to claims 1-9 in vitro diagnosis in ^λ "allergy.

13. Application of the recombinant molecules of claims 1,2,3,4,5,6 and 7 for the design of vaccines intended for allergy immunotherapy.

14. Application of the recombinant molecules of claims 4-7 to produce peptides containing at least one T epitope capable of acting as vaccines.

15. Application of the recombinant molecules of claims 4-7 for the production of hypoallergenic recombinant isoforms that have decreased or nullified their binding to IgE for the treatment of allergies.