WO2002011748A1 - Procede et composition d'immunisation utilisant des pools melanges d'acides nucleiques ou de peptides mutes - Google Patents

Procede et composition d'immunisation utilisant des pools melanges d'acides nucleiques ou de peptides mutes Download PDF

Info

Publication number
WO2002011748A1
WO2002011748A1 PCT/US2001/024286 US0124286W WO0211748A1 WO 2002011748 A1 WO2002011748 A1 WO 2002011748A1 US 0124286 W US0124286 W US 0124286W WO 0211748 A1 WO0211748 A1 WO 0211748A1
Authority
WO
WIPO (PCT)
Prior art keywords
target antigen
nucleic acid
vaccine
species
immune response
Prior art date
Application number
PCT/US2001/024286
Other languages
English (en)
Inventor
Manuel Engelhorn
Alan N. Houghton
Original Assignee
Sloan-Kettering Institute For Cancer Research
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Sloan-Kettering Institute For Cancer Research filed Critical Sloan-Kettering Institute For Cancer Research
Priority to CA002417240A priority Critical patent/CA2417240A1/fr
Priority to AU2001283094A priority patent/AU2001283094A1/en
Priority to EP01961861A priority patent/EP1311278A4/fr
Publication of WO2002011748A1 publication Critical patent/WO2002011748A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/53—DNA (RNA) vaccination
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • This application relates to a method for immunization which makes use of mixed pools of mutated nucleic acids (DNA or RNA) encoding variants of a target antigen as a nucleic acid vaccine or expressed peptides derived from such pools to stimulate an immune response to the target antigen.
  • mutated nucleic acids DNA or RNA
  • the immune system provides a sophisticated and multi-faceted defense against antigens which are recognized as foreign. Antigens which are recognized, and which therefore stimulate an immune response, are referred to as immunogenic. However, not all antigens are immunogenic, and there are many instances of disease that the immune system deals with poorly, if at all. These include most cancers and infectious organisms such as human immunodeficiency virus- 1, Mycobacterium tuberculosis, Borrelia burgdorferi (the causative organism of Lyme disease), Epstein Barr virus, papilloma virus, hepatitis viruses and cytomegalovirus (CMV) to which the immune system fails to mount an effective response. This maybe due to tolerance to self-antigens (i.e. the body does not recognize a cancer cell as foreign) or because the antigen is an inherently weak immunogen. Regardless of the cause, however, these factors make the product of vaccines targeting these conditions both desirable and difficult.
  • human immunodeficiency virus- 1 Mycobacterium tuberculosis
  • the present invention provides a method for inducing an immune response to a target antigen in a subject comprising administering to the subject a vaccine composition in an amount sufficient to induce an immune response to the target antigen.
  • the vaccine composition comprises a mixed pool of a plurality of DNA or RNA species encoding a plurality of mutant forms of the target antigen which are expressed by the subject, or a mixture of peptides derived from pre-administration expression of the mixed pool of nucleic acids.
  • the vaccine compositions of the invention are administered to a subject, for example a human subject, to induce an immune response to the target antigen.
  • Fig. 1 shows the number of tumor-free surviving mice immunized with nucleic acid vaccine derived from murine gp75 using various protocols
  • Fig. 2 shows the number of tumor-free surviving mice immunized with nucleic acid vaccine derived from murine TRP-2 using various protocols
  • Fig. 3 shows the quantitative survey of autoimmune depigmentation in mice immunized with nucleic acid vaccine derived from murine gp75 using various protocols.
  • the present invention provides a method and composition for inducing an immune response to a target antigen.
  • nucleic acid vaccine compositions are administered to a subject in a manner which results in expression of the nucleic acid and recognition of the resulting proteins or peptides by the immune system.
  • the target antigen against which the invention induces an immune response may be any antigen for which a therapeutic benefit is derived as a result of the induction of an immune response, including antigens associated with pathogenic microorganisms and antigens associated with cancers.
  • the invention is particularly applicable for inducing an immune response to inherently non-immunogenic or poorly immunogenic antigens.
  • target antigens include gp75/TRP-l, TRP-2, tyrosinase, gpl00/pMell7 on melanoma; prostate specific membrane antigen, prostate specific antigen and prostate stem cell antigen on prostate cancers; HER2/neu and the mucin MUC1 on breast cancers; CD 19 and CD20 on malignancies of B lymphocyte origin; MAGE, BAGE and GAGE, NY-ESO-1 and other "cancer-testes" antigens on a variety of cancer types; gene products from the human immunodeficiency virus- 1 ; angiogenic factors (such as VEGF, bFGF, angiopoietins, their cognate cell surface receptors, and ELR C-X-C chemokines); tumor suppressor genes such as p53; dipeptidyl peptidase IV and fibroblast activation protein- 1.
  • angiogenic factors such as VEGF, bFGF, angiopoietins, their
  • the phrase "inducing an immune response” refers to both the stimulation of a new immune response or to the enhancement of a pre-existing immune response to a target antigen.
  • the immune response may be a cytolytic T-cell mediated cellular immune response or a B-cell mediated humoral response, or some combination thereof.
  • subject refers to the living organism being treated to induce an immune response.
  • the subject will generally be mammalian or avian.
  • preferred “subjects” are human patients.
  • an immune response to a target antigen is induced in a subject comprising administering to the subject a vaccine composition in an amount sufficient to induce an immune response to the target antigen, wherein the vaccine composition comprises a plurality of vaccine molecule species corresponding to a plurality of mutant forms of the target antigen.
  • the term “vaccine molecule species” refers to either nucleic acids (DNA or RNA) or to peptides.
  • corresponding encompasses both mutant forms of the target antigen per se (i.e, peptide vaccine molecule species) and nucleic acid vaccine molecule species encoding the mutant forms of the target antigen.
  • the vaccine compositions of the invention comprise a mixture of mutated nucleic acids which encode mutant variants of the target antigen.
  • the present invention intentionally uses a mixture of different species of mutant nucleic acid all derived from a starting nucleic acid encoding the target antigen.
  • a nucleic acid sequence encoding the target antigen This sequence may be in the form of PCR amplicon, or it may be incorporated in a vector system to facilitate its reproduction in an appropriate host.
  • the sequence may be cDNA encoding the entire antigen or it may be a partial sequence encoding only a portion of the antigen. Although there is no absolute minimum size, partial sequences used will preferably be at least 24 bases, encoding 8 amino acids.
  • This "starting nucleic acid sequence" is used as the starting material for generating the vaccine compositions of the invention.
  • the starting nucleic acid sequence may be an accepted "wild-type” sequence derived from a normal source.
  • polymorphic sequences may have a multiplicity of "normal” or “wild-type” sequences, and that it is not critical which of these sequences are used as the starting sequence.
  • the starting nucleic acid sequence may also be a mutant sequence (i.e. a sequence which differs from the established norm.)
  • the starting nucleic acid sequence may also be (but does not have to be) derived from the subject. Thus, for example, in the latter case, a subject's own cancer cells could be used as a source for the starting nucleic acid sequence.
  • Mutations which can be insertions, deletions, translations, or inversions of one or more bases, can be introduced into the starting nucleic acid sequence using any of various known techniques. For example, random mutations can be introduced into the starting nucleic acid sequences using error-prone PCR as described in Cadwell et al. in PCR Methods and Applications 2:28-33 (1992) and PCR Methods and Applications 3:5136-5140 (1994). Mutations can also be introduced into the starting nucleic acid sequence by expressing the starting nucleic acid sequence in bacteria that are prone to mutations (for example Stratagene's XL 1-RED competent cells) or by exposing the starting nucleic acid to mutagenic principles such as chemicals, x-rays or ultraviolet radiation.
  • mutagenic principles such as chemicals, x-rays or ultraviolet radiation.
  • the result of these methods is a library of nucleic acid made up of many copies of mutated nucleic acid, with most individual nucleic acid molecules containing unique combinations of mutations. Aliquots of this library are then subcloned into an expression vector to make a "pool" of mutant nucleic acid for use in a vaccine. Such a pool will suitably contain at least 50, preferably at least 400, or even 2000-3000 different mutant nucleic acid species. If the starting sequence is a complex population of sequences (such as a cDNA library), the number of clones is driven by the sensitivity of the immunization protocol. This pool is used to form the vaccine compositions of the invention.
  • the nucleic acids in the pool may be either DNA or RNA since both are known to useful in vaccine compositions.
  • RNA Ribonucleic acid
  • one suitable mode of administration is subcutaneous injection of particles coated with the nucleic acid mixture using a GENE GUN.
  • the vaccine composition comprises carrier particles coated with the pool of nucleic acid, i.e. with a mixture comprising a plurality of nucleic acid species encoding a plurality of mutant forms of the target antigen.
  • the expressed mutant proteins or peptides are immunogenic and stimulate an immune response to the target antigen, even in the case where the target antigen is inherently non-immunogenic or only weakly immunogenic in the subject.
  • the carrier particles used in this composition may be any of various types of particles known for use in this purpose, including without limitation gold, clay and tungsten. The particles suitably are from 0.5 to 2 microns in diameter to facilitate transdermal injection.
  • nucleic acid vaccine compositions of the invention include the pressure delivery systems, for instance the BIOJECT system which delivers vaccines using carbon dioxide pressure cartridges, this case, particles are not required, but can be used.
  • the vaccine compositions can also be administered without a particle carrier using non-pressurized systems, for example syringe needles. Administration could also be accomplished using a mucosal route (e.g, a nasal spray).
  • the pool of mutated DNA may also be incorporated into a viral vector, which is then associated with particles for adminstration by the routes described above.
  • the vaccine composition above may be administered in a liquid carrier by subcutaneous injection.
  • the composition is suitably packaged into therapeutic administration units, sometimes referred to as "bullets". This is accomplished by drawing the composition into the lumen, a thin hollow tube, and then cutting the tube into lengths containing about 1 ⁇ g of nucleic acid.
  • the vaccine is apeptide vaccine created by expressing the pool of nucleic acids prior to administration. Expression is suitably carried out in host cells which may be bacterial or eukaryotic (for example, yeast, insect or mammalian). For such expression, the pool of nucleic acids are incorporated into an expression vector compatible with the host cells and then introduced into the host cells for expression without specific selection steps. Such expression systems are well known in the art.
  • the peptide vaccine compositions of the invention are different from known vaccine compositions, such as flu vaccines, which may contain mixtures of peptide antigens, because such mixtures are mixtures of several target antigens themselves rather than of mutant forms of one target antigen.
  • flu vaccines which may contain mixtures of peptide antigens, because such mixtures are mixtures of several target antigens themselves rather than of mutant forms of one target antigen.
  • the peptide antigens are selected to match the known epitopes of various strains of influenza.
  • the peptide vaccine of the invention can be administered using methods known in the art, including without limitation by intravenous, intramuscular and subcutaneous injection and by transdermal or intranasal administration.
  • the determination of the appropriate amount of peptide to vaccine to administer to arrive at the desired immune response is a routine matter within the ordinary skill in the art.
  • Example 1 To prepare mutant DNA, full length murine tyrosine-related protein 2 (mTRP-2) and murine gp75 were randomly mutated by PCR using the protocol of Cadwell et al., supra. Briefly, 20 ng of non-mutated plasmid encoding either protein served as a template for PCR. Mutagenic PCR was performed in Boehringer Mannheim's IX PCR buffer supplemented to contain 7 mM MgC12, 0.5 mM MnC12, 0.2 mM dATP and dGTP, and 1 mM dCTP and dTTP. 30 PCR cycles were performed with primers pairs specific for each coding sequence (mTRP-2 primers, upstream:
  • AAGGCGGCGCATGGGCCTTGTGGGATG (Seq. ID. No. 1), downstream: ATGCGGCCGCTAGGCTTCCTCCGTGTA (Seq. ID. No. 2); mgp75 primers, upstream: TTGCGGCCGCCATGAAATCTTACAACGTG (Seq. ID. No. 3), downstream: CGGAATTCTCAGACCATGGAGTGGTTA (Seq. ID. No. 4)) and Taq polymerase from Boehringer Mannheim.
  • the primers contained unique restriction sites for subsequent subcloning. Nonmutagenic control reactions were performed with the same template and primers using Stratagene's Pfu Turbo DNA polymerase in the corresponding buffer.
  • mutated and unmutated PCR products were subcloned into the CMV-based plasmid expression vector WRGBEN. Ross et al., Clin. Can. Res. 3: 2191-2196 (1997).
  • the clones deriving from mutagenic PCR were plated and grown, so as to obtain pools of approximately 2,500 clones.
  • the plasmid DNA of these clones was purified using QIAGEN 500 maxiprep columns in batches of variant plasmids containing random mutations. Each batch is referred to as a pool.
  • Tables 1 and 2 list the observed mutations by type and extrapolate the numbers to the full-length coding sequences for mgp75 mutagenesis and mTRP-2 mutagenesis, respectively.
  • the overall mutation frequency observed after 30 PCR cycles is 1.2 per 100 bp for mgp75, and 0.8 per 100 bp for mTRP-2.
  • Example 2 DNA from the plasmid pools was coated onto 1 m gold particles (BioRad) at a ratio of 100 g DNA for 50 mg of gold.
  • the gold/DNA precipitate was deposited in plastic tubing which was cut into "bullets", each representing 1 g of DNA. Bullets were loaded in a helium-pressure POWDER- JECT gene gun for genetic immunization of mice by delivery of the DNA-coated gold to the epidermis.
  • Example 3 C57BL/6 mice were depilated and immunized four times at intervals of 8-10 days, receiving 4 g of DNA at each immunization.
  • the DNA was delivered to the abdomen at three sites and the base of the tail. There were 5 mice per group.
  • Control groups received empty vector DNA, or the unmutated murine sequence or the human ortholog of either protein in the WRGBEN vector.
  • mice received 105 B16F10LM3 syngeneic melanoma cells in 50 1 of serum-free RPMI1640 medium, injected intradermally in the right flank. Tumor growth and coat color change (depigmentation) were measured every 2-3 days for 40 days minimum.
  • Depigmentation was quantified by densitometric analysis of digital images of the immunized animals. Mice were sacrificed upon ulceration of the tumor or when it reached a diameter of 20 mm. Tumor growth was monitored in untreated control animals, in animals injected with xenogeneic (human) gp75, in animals injected with wild-type syngeneic (mouse) gp75 and in animals injected with a mutant mgp75 pool in accordance with the invention. The results are summarized in Fig. 1.
  • Fig. 2 Tumor growth was also monitored in control animals injected with empty vector, in animals injected with xenogeneic (human) TRP-2, in animals injected with wild-type syngeneic (mouse) TRP-2 and in animals injected with a mutant mTRP-2 pool in accordance with the invention.
  • the results are summarized in Fig. 2.
  • the fraction of tumor free mice is shown in each figure.
  • the pools of mutagenized mgp75 or mTRP-2 conferred significant protection against tumor challenge, to an extent superior to that observed with any of the controls.
  • all mice which received one of the mutagenized pools displayed autoimmunity, as manifested by depigmentation. (see. Fig.
  • mice immunized with non-mutagenized syngeneic DNA No depigmentation was observed in mice immunized with non-mutagenized syngeneic DNA. In mice immunized with xenogeneic human antigen, depigmentation was observed, but it was consistently weaker, more sporadic and started later. This autoimmunity is indicative of the inducement of an immune response to the self-proteins gp75 and TRP-2.
  • mice from three different H-2 congenic strains (B10.A-H2a, B10.BR-H2k, B10.PL-H2u) were immunized with either of the following DNA preparations: unmutated mgp75, human gp75, and two independent pools of mutated mgp75 (2500 clones each).
  • B10.BR-H2k mice were immunized with either unmutated mTRP-2, human TRP-2 or two independent pools of mutated mTRP-2 (2500 clones each).
  • Autoimmune depigmentation was monitored in these mice as a measure of immunization efficiency. The fraction of depigmented mice over the total of each group is scored in Table 3.
  • Example 5 BALB/c mice were immunized with a pool of plasmid DNA containing mutagenized PSMA. Antibody responses were measured by ELISA assays using diluted mouse sera against purified recombinant mouse and human PSMA made by expression of recombinant baculovirus in insect cells. Often mice tested, 10 has a positive response to human PSMA. Of another ten mice tested, 2 had a positive response to mouse PSMA.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne une réponse immunitaire à un antigène cible, qui est induite chez un sujet par l'administration d'une composition vaccinale dans des quantités suffisantes pour induire une réponse immunitaire à l'antigène cible. La composition vaccinale contient un pool mélangé de plusieurs espèces d'ADN ou d'ARN codant pour plusieurs formes mutantes de l'antigène cible, qui sont exprimées par le sujet, ou un mélange de peptides dérivé de l'expression avant administration du pool mélangé d'acides nucléiques. Les compositions vaccinales sont administrées à un sujet, par exemple un sujet humain, afin d'induire une réponse immunitaire à l'antigène cible.
PCT/US2001/024286 2000-08-07 2001-08-02 Procede et composition d'immunisation utilisant des pools melanges d'acides nucleiques ou de peptides mutes WO2002011748A1 (fr)

Priority Applications (3)

Application Number Priority Date Filing Date Title
CA002417240A CA2417240A1 (fr) 2000-08-07 2001-08-02 Procede et composition d'immunisation utilisant des pools melanges d'acides nucleiques ou de peptides mutes
AU2001283094A AU2001283094A1 (en) 2000-08-07 2001-08-02 Method and composition for immunization using mixed pools of mutated nucleic acids or peptides
EP01961861A EP1311278A4 (fr) 2000-08-07 2001-08-02 Procede et composition d'immunisation utilisant des pools melanges d'acides nucleiques ou de peptides mutes

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US22316500P 2000-08-07 2000-08-07
US60/223,165 2000-08-07

Publications (1)

Publication Number Publication Date
WO2002011748A1 true WO2002011748A1 (fr) 2002-02-14

Family

ID=22835326

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2001/024286 WO2002011748A1 (fr) 2000-08-07 2001-08-02 Procede et composition d'immunisation utilisant des pools melanges d'acides nucleiques ou de peptides mutes

Country Status (4)

Country Link
EP (1) EP1311278A4 (fr)
AU (1) AU2001283094A1 (fr)
CA (1) CA2417240A1 (fr)
WO (1) WO2002011748A1 (fr)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1675596A2 (fr) * 2003-10-10 2006-07-05 Powderject Vaccines, Inc. Procede
WO2016054003A1 (fr) * 2014-10-01 2016-04-07 The Trustees Of The University Of Pennsylvania Vaccins possédant un antigène et une interleukine-21 en tant qu'adjuvant
EP2852608A4 (fr) * 2012-05-21 2016-05-04 Distributed Bio Inc Focalisation d'épitope par concentration de surface effective variable d'antigène

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5976862A (en) * 1985-03-30 1999-11-02 Ixsys Corporation Process for obtaining DNA, RNA, peptides, polypeptides, or proteins, by recombinant DNA technique

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2677363A1 (fr) * 1991-06-07 1992-12-11 Pasteur Institut Compositions a base de peptides multiepitopiques, leur procede d'obtention et leurs applications, notamment en tant que vaccins.
US5741492A (en) * 1996-01-23 1998-04-21 St. Jude Children's Research Hospital Preparation and use of viral vectors for mixed envelope protein vaccines against human immunodeficiency viruses
DE19907485B4 (de) * 1999-02-12 2008-01-17 Strathmann Ag & Co. Virus-Vakzine

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5976862A (en) * 1985-03-30 1999-11-02 Ixsys Corporation Process for obtaining DNA, RNA, peptides, polypeptides, or proteins, by recombinant DNA technique

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DYALL ET AL.: "Heteroclitic immunization induces tumor immunity", J. EXP. MEDICINE, vol. 188, no. 9, 2 November 1998 (1998-11-02), pages 1553 - 1561, XP002947142 *
See also references of EP1311278A4 *

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1675596A2 (fr) * 2003-10-10 2006-07-05 Powderject Vaccines, Inc. Procede
EP1675596A4 (fr) * 2003-10-10 2009-01-21 Powderject Vaccines Inc Procede
EP2852608A4 (fr) * 2012-05-21 2016-05-04 Distributed Bio Inc Focalisation d'épitope par concentration de surface effective variable d'antigène
US9884893B2 (en) 2012-05-21 2018-02-06 Distributed Bio, Inc. Epitope focusing by variable effective antigen surface concentration
US10196427B2 (en) 2012-05-21 2019-02-05 Distributed Bio, Inc. Epitope focusing by variable effective antigen surface concentration
US10836797B2 (en) 2012-05-21 2020-11-17 Distributed Bio, Inc. Epitope focusing by variable effective antigen surface concentration
EP3937179A1 (fr) * 2012-05-21 2022-01-12 Distributed Bio Inc Focalisation d'épitope par concentration de surface effective variable d'antigène
US11560409B2 (en) 2012-05-21 2023-01-24 Centivax, Inc. Epitope focusing by variable effective antigen surface concentration
WO2016054003A1 (fr) * 2014-10-01 2016-04-07 The Trustees Of The University Of Pennsylvania Vaccins possédant un antigène et une interleukine-21 en tant qu'adjuvant
US10166288B2 (en) 2014-10-01 2019-01-01 The Trustees Of The University Of Pennsylvania Vaccines having an antigen and interleukin-21 as an adjuvant
US11007265B2 (en) 2014-10-01 2021-05-18 The Trustees Of The University Of Pennsylvania Vaccines having an antigen and interleukin-21 as an adjuvant

Also Published As

Publication number Publication date
CA2417240A1 (fr) 2002-02-14
EP1311278A1 (fr) 2003-05-21
EP1311278A4 (fr) 2005-01-05
AU2001283094A1 (en) 2002-02-18

Similar Documents

Publication Publication Date Title
Irvine et al. Cytokine enhancement of DNA immunization leads to effective treatment of established pulmonary metastases.
Tüting et al. Gene-based strategies for the immunotherapy of cancer
Casares et al. Immunization with a tumor‐associated CTL epitope plus a tumor‐related or unrelated Th1 helper peptide elicits protective CTL immunity
Ribas Genetically modified dendritic cells for cancer immunotherapy
AU753738B2 (en) Use of MHC class II ligands as adjuvant for vaccination and of LAG-3 in cancer treatment
Shibagaki et al. Dendritic cells transduced with TAT protein transduction domain‐containing tyrosinase‐related protein 2 vaccinate against murine melanoma
AU2001268452A1 (en) A recombinant non-replicating virus expressing GM-CSF and uses thereof to enhance immune responses
AU2003228229B2 (en) DNA vaccine against proliferating endothelial cells and methods of use thereof
DK1802340T3 (en) A combination of recombinant mycobacteria and a biologically active agent as a vaccine
Burger et al. Plasmids encoding granulocyte–macrophage colony-stimulating factor and CD154 enhance the immune response to genetic vaccines
Kikuchi Genetically modified dendritic cells for therapeutic immunity
WO1997032987A1 (fr) Procede et compositions nucleiques immunogenes codant pour des antigenes, et molecules co-stimulant l'immunisation
EP3866848A1 (fr) Vaccin contre le cancer à chaîne invariante de téléost
ZA200506548B (en) Vaccines derived from epithelial cell mucin MUC-1
EP1311278A1 (fr) Procede et composition d'immunisation utilisant des pools melanges d'acides nucleiques ou de peptides mutes
Nair et al. RNA-transfected dendritic cells
US6358933B1 (en) Formulation of nucleic acid and acemannan
AU776795B2 (en) Chorionic gonadotropin DNA vaccines and methods
US20030224392A1 (en) Method for identification of mutant antigens with enhanced immunogenicity
JP2021180677A (ja) 免疫療法における使用のためのポリエピトープ構築物
US20030157534A1 (en) DNA immunization with libraries of minigenes encoding degenerate variants of major histocompatability class l restricted epitopes
US20070042047A1 (en) Vaccines
Tüting et al. The immunology of DNA vaccines
Paterson Rational approaches to immune regulation
JP2005526511A (ja) ワクチン

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2417240

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2001961861

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 2001961861

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

NENP Non-entry into the national phase

Ref country code: JP

WWW Wipo information: withdrawn in national office

Ref document number: 2001961861

Country of ref document: EP