WO2002008734A2 - Methods using light emission for determining the effectiveness of plant treatment agents in controlling plant disease organisms - Google Patents
Methods using light emission for determining the effectiveness of plant treatment agents in controlling plant disease organisms Download PDFInfo
- Publication number
- WO2002008734A2 WO2002008734A2 PCT/US2001/022932 US0122932W WO0208734A2 WO 2002008734 A2 WO2002008734 A2 WO 2002008734A2 US 0122932 W US0122932 W US 0122932W WO 0208734 A2 WO0208734 A2 WO 0208734A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- plant
- disease
- light
- substrate
- treatment agent
- Prior art date
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
- G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
- G01N21/64—Fluorescence; Phosphorescence
- G01N21/6428—Measuring fluorescence of fluorescent products of reactions or of fluorochrome labelled reactive substances, e.g. measuring quenching effects, using measuring "optrodes"
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
- G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
- G01N21/64—Fluorescence; Phosphorescence
- G01N21/645—Specially adapted constructive features of fluorimeters
- G01N21/6456—Spatial resolved fluorescence measurements; Imaging
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/75—Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated
- G01N21/76—Chemiluminescence; Bioluminescence
- G01N21/763—Bioluminescence
Definitions
- Plant disease damage to ornamental, vegetable, field, cereal, and fruit crops can cause significant reduction in productivity and thereby result in increased costs to the consumer.
- Many products are commercially available for these purposes, but the need continues for new plant treatment agents, which are more effective, less costly, less toxic, environmentally safer or have different modes of action.
- the identification of crop protection chemicals effective in the control of plant pathogens relies on the evaluation of disease and the control thereof, and is routinely based on the visual evaluation of the area of plant tissue infected.
- the compound is evaluated for either preventative and/or curative activity.
- Preventative activity is assessed when the test compound is applied prior to infection with the disease organism and curative activity is assessed when the test compound is applied following infection with the disease organism.
- curative control of plant diseases see U.S. Patent No. 3,954,992, Examples 3, 4 and 9.
- Visual assessment of disease relies on assigning a quantitative value, such as an estimated percentage of plant area covered by disease or a numeric class designation, to a qualitative assessment (e.g., mild or severe). Extensive training with the individual disease is necessary for accurate assessment and to ensure that observational bias does not influence this type of evaluation. Observational bias and subjective drift in scoring are likely to decrease accuracy of the evaluation as the number of samples increases with high-throughput chemical screening strategies.
- U.S. 5,650,135 discloses the , use of non-invasive, macroscale imaging of light-emitting conjugates to detect mammalian pathogens within the animal. 0
- a means for the sensitive and reliable detection and measurement of disease on plants and the control thereof by plant treatment agents by an objective imaging methodology is needed.
- the ideal imaging methodology would rely not on color discrimination, but rather on the differential production of electromagnetic radiation and the subsequent detection of light emission.
- the methods of the present invention 5 provide an objective, sensitive and non-invasive approach to detect, localize and measure the extent of plant disease for the purpose of evaluating the effectiveness of a plant treatment agent.
- the methods involve detecting photon emission from light-generating moieties.
- the methods involve (a) applying the plant treatment agent to a substrate, (b) inoculating the substrate with the disease organism, and detecting photon emission from light-generating moieties. It is noted that (a) and (b) may be accomplished in either order. Generally, when (a) is accomplished before (b), the 5 effectiveness of the plant treatment agent in preventing disease is assessed and when (b) is accomplished before (a), the effectiveness of the plant treatment agent in curing disease is assessed.
- the method further includes (lc) after a period of time in which the disease organism can grow, applying a pro-light-generating moiety (a 0 "PLGM”) which is selectively transformed by the disease organism or the substrate to a light-generating moiety (a "LGM”), (I ) detecting photon emission from the light- generating moiety (e.g. over an area of the substrate), and (le) determining the effectiveness of the plant tieatment agent based on the amount of detected photon emission and/or the fraction of the substrate area from which photon emission is detected.
- a pro-light-generating moiety a 0 "PLGM”
- LGM light-generating moiety
- the method further includes (2c) after a period of time in which the disease can grow, detecting photon emission from an endogenous light-generating moiety, and (2d) determining the effectiveness of the plant treatment agent based on the detected photon emission.
- This method is characterized by the substrate having an endogenous light-generating moiety not present in the disease organism and/or the disease organism having an endogenous light-generating moiety not present in the substrate.
- the substrate is a plant substrate and the period of time is one in which the disease can be manifested in the plant substrate.
- This invention further provides a process for producing a crop protection agent that is suitable for controlling a plant disease caused by a plant disease organism and comprises a plant treatment agent. This process comprises determining the effectiveness of the plant treatment agent in controlling the plant disease organism as indicated above.
- This invention also provides a method for controlling a plant disease caused by a plant disease organism (for example, a fungal plant pathogen). This method comprises determining that a plant tieatment agent is effective for controlling the plant disease organism as indicated above; and applying to the plant or portion thereof to be protected, or to the plant seed or seedling to be protected, an effective amount of said plant treatment agent.
- a plant disease organism for example, a fungal plant pathogen.
- FIG. 1 is a diagram of a macro imaging system for detecting light generating moieties.
- FIG. 2 represents a map of a plasmid that can be used for the transformation of Magnaportha grisea to generate a disease organism expressing an endogenous LGM, the green fluorescent protein (GFP).
- GFP green fluorescent protein
- FIG. 3 represents a map of the plasmid pSLA2 that can be used for the transformation of tobacco to produce a plant substrate expressing an endogenous LGM, firefly luciferase.
- FIG. 4 relates to Example 1 and represents the imaging detection of the effect of treatment with the commercial fungicide flusilazole on Erysiphae graminis (powdery mildew) infected on barley and made fluorescent by differential staining with the PLGM, fluorescein diacetate.
- FIG. 5 also relates to Example 1 and represents the results of tests of the instrument and operating variability for the use of light emission to detect and measure the extent of plant disease.
- FIG. 6 relates to Example 2 and represents the effect of treatment with commercial fungicides on the plant pathogen Magnaportha grisea grown vegetatively in microtitre plate wells and made fluorescent with the addition of fluorescein diacetate.
- FIG. 7 relates to Example 5 and represents the effect of treatment with the commercial fungicide ridomil on Phytophthora infestans infected on tomato and measured by detecting fluorescence from the endogenous LGM chlorophyll.
- FIG. 8 relates to Example 6 and represents the detection and distribution of the bioluminescence from excised uninfected 35S::LUC::NOS3 ' tobacco leaves, and from leaves infected with Sclerotinia sclerotiorum.
- FIG. 9 relates to Examples 8 and 9 and represents a map of the plasmid pSM619 that can be used for the transformation of Magnaportha grisea to generate a disease organism expressing an endogenous LGM, a reef coral green fluorescent protein (ZsGreen FP).
- FIG. 10 relates to Example 8 and represents reference and fluorescence images representing the detection and distribution of the ZsGreen FP-expressing Magnaportha grisea pathogen strain MG619 infected on barley.
- FIG. 11 relates to Example 9 and represents the effect of treatment with commercial fungicides on the plant pathogen Magnaportha grisea made fluorescent by expression of the ZsGreen Fluorescent Protein and grown vegetatively in microtitre plate wells.
- This invention pertains to methods that can be used to detect the extent of growth of a plant disease organism on a substrate for the purpose of evaluating the effectiveness of a plant treatment agent.
- the methods involve detecting photon emission from light-generating moieties.
- Embodiments I and II of the invention both pertain to methods which involve the application of the plant tieatment agent to a substrate and the inoculation of the substiate with a disease organism.
- a pro-light-generating moiety that is selectively transformed by either the disease organism or the substiate to a light-generating moiety is applied and the resulting light is subsequently detected (Embodiment I), or light may be detected from an endogenous light- generating moiety present differentially in either the disease organism or the substrate (Embodiment II).
- the plant treatment agent may be a known agent (which may be evaluated for a number of purposes) or a substance not previously known as an effective control agent for the plant disease organism with which the substrate is inoculated (see Section I below).
- the substrate may be a plant (or a portion of a plant such as a leaf) or may be a non-plant medium adapted to support growth of the plant disease organism with which it is inoculated (see Section II below). While plant pathogens, in general, may be used in the methods of this invention, the methods are considered particularly suitable for determining the effectiveness of plant treatment agents in controlling fungal pathogens (see Section III below).
- Suitable PLGMs used in this invention are selectively transformed to LGMs, and include, for example compounds, such as fluorescein diacetate, that are transformed into the fluorescent fluorescein molecule. Of note are PLGMs that are selectively transformed by fungal pathogens to fluorescent LGMs (particularly when used with plant substrates).
- PLGMs that are selectively transformed by plant substrates.
- Disease organisms or substrates having endogenous LGMs may also be used.
- Endogeneous LGMs may be naturally present (e.g., chlorophyll) or may be introduced (e.g. by genetic transformation) into a disease organism and/or living substrate (see Section IV below).
- fungal pathogens that have endogenous fluorescent LGMs.
- plant substrates that have endogenous bioluminescent LGMs.
- the light generated by the LGM (i.e., photon emission) is used in accordance with this invention to determine the effectiveness of the plant treatment agent.
- Photon detectors may be employed in a number of ways to practice this invention.
- a photon-detecting device is preferably used to detect the photon emission from the light-generating moiety and the effectiveness of the plant treatment agent may be determined based on the photon emission detected by such a device (See Section V).
- Various means of imaging and photon emission analysis may be employed to determine the effectiveness of the plant treatment agent (see Section VI).
- One means to determine the effectiveness of the plant treatment agent is to measure the amount of photon emission.
- a PLGM when a PLGM is selectively transformed by the disease organism to an LGM or when the disease organism has an endogenous LGM that is not present in the substrate, one may compare the total amount of photon emission from an inoculated substrate (e.g. a non-plant growth medium inoculated with a plant disease organism or an standardized plant substrate inoculated with a plant disease organism) treated with a plant treatment agent with the total amount of photon emission from (i) an equivalent inoculated substrate that is not treated with a plant treatment agent (i.e., an untreated control), (ii) an equivalent inoculated substrate that is treated with a known plant treatment agent of known effectiveness in controlling the disease organism (i.e., a standard) and/or (iii) an equivalent non-inoculated substrate (i.e., a blank).
- an inoculated substrate e.g. a non-plant growth medium inoculated with a plant disease organism or an standardized plant substrate inoculated with
- At least one standard and at least one blank is used.
- the total amount of photon emission may be used to indicate the effectiveness of the plant treatment agent except that the light emitted is indicative of the portion of the plant that is not affected by the plant disease organism.
- Another means to determine the effectiveness of the plant treatment agent is to measure the fraction of the substrate area from which photon emission is detected.
- a PLGM when a PLGM is selectively transformed by the disease organism to an LGM or when the disease organism has an endogenous LGM that is not present in the substrate, one may compare the total area from which photons are emitted by said LGM to the total area of the inoculated substrate treated with a plant treatment agent to determine the fractional area affected by the disease organism.
- this result is compared to the fractional area affected by the disease organism obtained from (i) an equivalent inoculated substrate that is not treated with a plant treatment agent (i.e., an untreated control), (ii) an equivalent inoculated substrate that is treated with a known plant treatment agent of known effectiveness in controlling the disease organism (i.e., a standard) and/or (iii) an equivalent non-inoculated substrate (i.e., a blank).
- the fractional area of photon emission may be used to indicate the effectiveness of the plant tieatment agent except that the light emitted is indicative of the portion of the plant that is not affected by the plant disease organism.
- a plant treatment agent is identified as effective if it is able to significantly inhibit growth of the disease in experimental samples preferably relative to control samples and/or in comparison to samples treated with chemical standards of known efficacy. Growth of the disease organism is further defined, depending on the application, as the fractional area and/or distribution of the disease organism in or on the substrate, or the fractional area of damaged plant substrate resulting from the infection process versus undamaged plant substrate, or as the accumulated amount of the disease organism.
- the methods can be used to provide an objective means of evaluating the effectiveness of treatment agents in the control of plant disease.
- the use of photon-detecting devices can often enhance the detection of disease, thus providing a means for more sensitive and, in some cases, earlier determination of the effectiveness of a plant treatment agent.
- the methods of this invention may be used in connection with an imaging approach that is non-invasive. This permits a user to track the extent and localization of the disease organism over time, by repeating the imaging steps at selected intervals, and constructing images corresponding to each of those intervals.
- This aspect of the methods is particularly useful for determining the effectiveness of a plant treatment agent in a curative application.
- Computer-based digital image analysis of diseased plant material can generate an objective quantitative evaluation.
- This invention nevertheless may be used for detecting the level of a disease organism without necessarily localizing the subject in the form of an image. This might be useful for the evaluation of the effectiveness of plant treatment agents, for example, when the area of the substrate is uniform.
- the methods of this invention for detecting the effectiveness of plant treatment agents may be incorporated as an important step in the production of crop protection agents for controlling plant diseases containing effective plant treatment agents (see Section VII) and their use (see Section VIII).
- the plant treatment agent is a substance that is tested for agronomic utility as an active component of a crop protection agent effective in the control of plant disease (e.g., fungicides, antimicrobial and antiviral agents, and/or inducers of systemic acquired disease resistance), and may be a chemical compound or mixture of chemical compounds (e.g., a chemical mixture resulting from a physical mixing process or a mixed chemical synthesis process, a fermentation broth, or an extract preparation from a biological or non-biological origin).
- plant disease e.g., fungicides, antimicrobial and antiviral agents, and/or inducers of systemic acquired disease resistance
- plant disease e.g., fungicides, antimicrobial and antiviral agents, and/or inducers of systemic acquired disease resistance
- chemical compound or mixture of chemical compounds e.g., a chemical mixture resulting from a physical mixing process or a mixed chemical synthesis process, a fermentation broth, or an extract preparation from a biological or non-biological origin
- Compounds known to be fungicidal include acibenzolar S-methyl, azoxystrobin, benomyl, blasticidin-S, Bordeaux mixture (tribasic copper sulfate), bromuconazole, carpropamid, captafol, captan, carbendazim, chloroneb, chlorothalonil, copper oxychloride, copper salts, cymoxanil, cyproconazole, cyprodinil, (S)-3,5-dichloro-N-(3-chlor-l-ethyl-l- methyl-2-oxopropyl)-4-methylbenzamide (RH 7281), diclocymet (S-2900), diclomezine, dicloran, difenoconazole, fenamidone (RP 407213), dimethomorph, diniconazole, diniconazole-M, dodine, edifenphos, epoxi
- the substance to be evaluated can also be an organism (e.g., virus, bacterium, fungus) potentially capable of attacking the target disease organism.
- the methods of this invention may be used, for example, to confirm the effectiveness of known plant treatment agents such as those disclosed above in known applications, or to evaluate their effectiveness for new applications. However, the methods of this invention are considered particularly useful for determining the effectiveness of agents not previously known as effective for fungal control.
- the plant treatment agent being evaluated may be applied as a foliar treatment to the plant using conventional spray technology, drench or drip methods.
- One preferred foliar application method is by the use of a spray apparatus specially designed for the efficient application of microgram amounts of the plant treatment agent (see U.S. Patent Application No.
- the plant treatment agent may be applied as a systemic treatment directly to the growth medium, followed by the subsequent uptake by the plant and presentation to the disease organism.
- Known plant treatment agents may be used as controls in connection with the evaluation of new agents to provide a relative measure of effectiveness.
- substrates include plant substrates (i.e., plants including monocots and dicots, such as grasses and broadleaf plants, woody plants and trees, agronomic crop species, and weed species and parts of such plants).
- plant substrates i.e., plant substrates that are uniform with respect to such factors as species, size, age and/or stage of development so that the different responses to different treatments can be attributed to the differences in treatment.
- Preferred methods of this invention that use plant substrates include those using cultivars of Arabidopsis thaliana, barley, cucumber, grape, lovegrass, maize, potato, rice, squash, tomato, or wheat.
- the substrate may also be a liquid, soil or other solid growth medium sufficient to support the metabolism of the disease organism.
- the substiate is held in a container or on a support. Examples include containers used for the horticultural production of plants, test tubes, jars, wells of microtitre plates, or flat supports such as glass or plastic plates.
- the containers may also contain or support rock wool, or other inert support material.
- the disease organism is defined as a plant pathogen.
- Plant pathogens may include fungal, bacterial or viral agents that cause disease on plants.
- Preferred methods of this invention include those where disease organisms are fungal pathogens.
- Example fungal pathogens include Alternaria, Fusarium, Monilinia, Plasmopora, Pseudocercosporella, Puccinia, Pyrenophora, Rhyncosporum, and Sclerotinia species, and strains of Er ⁇ siphae cichoracearum, Erysiphae graminis, Magnaportha grisea, Phytophthora infestans, Pyricularia oryza, Septoria triticii, and Stagnospora nodorum. IV.
- a pro-light-generating moiety is an entity that is metabolized or otherwise selectively transformed by the action of either the plant substrate or the disease organism to produce a light-generating moiety (LGM).
- LGM light-generating moiety
- Light-generating moieties are typically molecules or macromolecules that emit light in the ultraviolet (UV), visible and or infrared (IR) portion of the spectrum.
- UV ultraviolet
- IR infrared
- Light is defined herein as electromagnetic radiation having a wavelength between about 300 nm and about HOO nm.
- LGMs and LGMs useful in the practice of the present invention may take a variety of forms, depending on the application and the specific disease/substrate combination.
- LGMs may generate light as a result of radiation absorption (e.g., fluorescent or phosphorescent molecules), or as a result of a chemical reaction (e.g., proteins that produce bioluminescence as a result of catalysis, and chemiluminescence).
- Fluorescence-based PLGMs and LGMs may generate light as a result of radiation absorption (e.g., fluorescent or phosphorescent molecules), or as a result of a chemical reaction (e.g., proteins that produce bioluminescence as a result of catalysis, and chemiluminescence).
- Fluorescence-based PLGMs and LGMs may generate light as a result of radiation absorption (e.g., fluorescent or phosphorescent molecules), or as a result of a chemical reaction (e.g., proteins that produce bioluminescence as a
- Fluorescence is the luminescence emitted from a substance in a single electronically excited state, induced by excitation of the substance with light of a wavelength suitable to induce electronic transitions.
- the wavelength of the emitted light is longer than that of the exciting illumination (Stokes shift), because the excited electron relaxes to the lowest excited state, generating heat as a by-product, before emitting a fluorescent quantum and returning to the ground state.
- the use of fluorescent molecules in the present invention is complicated by the requirement for light input to generate the luminescence.
- the light used to excite a fluorescent target may result in the fluorescence of substances other than the intended target. This is particularly true when the sample being imaged is as complex as the chemical milieu of a biological organism.
- excitation filter blocks the majority of photons having a wavelength similar to that emitted by the fluorescent LGM and of other ancillary LGMs that may be present in the sample.
- a laser producing high intensity light near the excitation wavelength, but not near the emission wavelength can also be used to specifically excite the LGM, as in confocal imaging applications.
- excitation of the sample may be achieved in confocal imaging by laser excitation with two photons of light of a longer wavelength, and therefore each photon has less energy. Known as two-photon excitation, this method reduces the amount of photobleaching, which often accompanies high-energy laser excitation of the fluorophore.
- the spectral sensitivity of the photon-detecting device maybe regulated by the addition of optical filters in front of the detector window to restrict the spectral range of light reaching the detector to those photons matching the emission wavelengths of that of the fluorescent LGM. Detectors may be selected that have reduced sensitivity to wavelengths of light used to excite the LGM.
- an imaging chamber suitable for housing the sample, excitation light and photodetector e.g. a camera
- additional radiation sources e.g., room light
- Exemplary fluorescent light-generating moieties are small fluorescent molecules, such as fluorescein, used either in un-conjugated form and/or conjugated to antibodies or other proteins, polymers or carbohydrates; and fluorescent proteins (FP's), such as those from marine coelenterates (e.g. a green fluorescent protein).
- fluorescent proteins e.g. a green fluorescent protein
- FDA PLGM fluorescein diacetate
- LGM ZsGreen FP PLGM fluorescein diacetate
- the diacetate derivative of fluorescein is a useful compound for the study of live cells.
- Fluorescein absorbs light maximally at about 475 nm and emits in the green region of the spectrum, with a maximum emission at about 517 nm.
- FP's are defined as the fluorescent proteins from coelenterates.
- FP's include GFP, the green fluorescent protein from the marine jellyfish Aequoria victoria and includes engineered variants with altered optical properties such as color-shifted fluorescence and increased extinction coefficient for enhanced quantum yield of fluorescence, engineered variants with altered protein properties such as altered solubility in solution.
- FP's also include fluorescent protein variants isolated from other natural sources, such as AmCyan, ZsGreen, Zs Yellow, DsRed, and AsRed Fluorescent Proteins (FP) isolated from related marine coelenterates (e.g. Zoanthus sp. or Discosoma striata) and their engineered sub-variants.
- the FP's are distinct from other naturally occurring fluorescent proteins, as the FP fluorescence is due entirely to an internal interaction between amino acids within the protein.
- the FP's require no other prosthetic groups or cofactors as are required for the fluorescent chromoproteins proteins, such as the chlorophyll-binding proteins.
- Aequoria victoria are brightly luminescent, with light appearing as glowing points around the margin of the jellyfish umbrella. Light arises from yellow tissue masses which each consist of about 6,000 to 7,000 photogenic cells. The cytoplasm of these cells is densely packed with fine granules of about 0.2 ⁇ m diameter, which are enclosed by a unit membrane, and contain the components necessary for bioluminescence.
- the components include a Ca 2+ activated photoprotein, aequorin, that emits blue-green light, and an accessory green fluorescent protein (GFP) which accepts energy from aequorin and re-emits it as green light.
- the GFP protein is intensely fluorescent with a quantum efficiency of approximately 80%.
- GFP absorbs light maximally at about 395 nm and has a smaller absorption peak at 470 nm, and fluorescence emission peaks at about 509 nm with a shoulder at about 540 nm. These optical properties make it suitable for use with argon laser- excited confocal microscopes and with epi-fluorescence microscopes equipped with common fluorescein filter sets.
- the protein fluorescence is due to a unique covalently attached chromophore, which is formed post-translationally by the cyclisation of the residues Ser-dehydroTyr-Gly within the protein.
- the gene encoding the green fluorescent protein has been cloned (Chalfie, M., et al., 1994, Science 263: 802-805) and successfully expressed in a wide range of heterologous organisms, including Escherichia coli, Caenorabditis elegans, Drosophila melanogaster, Saccharomyces ceriviae, mammals and plants (Chalfie, M., et al., 1994, Science 263: 802-805; Wang and Hazelrigg, 1994, Nature 369: 400-403; Haseloff and Amos, 1995, Trends Genet 11: 328-329; Cubitt et al., 1995, Trends Biochem Sci 20: 448- 455; Baulcombe et al., 1995, Plant J 7: 1045-1053; Sheen et al., 1995, Plant J 8: 777-784).
- Bioluminescent molecules are distinguished from fluorescent molecules in that they do not require the input of radiation to produce light. Rather, bioluminescent molecules utilize chemical energy, such as ATP, to produce light.
- An advantage of bioluminescent LGMs, as compared to fluorescent LGMs, is that there is virtually no background light signal in the disease organism or substrate in the absence of an excitation light. The only light signal detected is that produced by the bioluminescent LGM.
- Luciferase as defined here includes prokaryotic and eukaryotic luciferases, as well as variants possessing varied or altered optical properties, such as luciferases with color-shifted luminescence.
- Prokaryotic luciferase and other enzymes involved in prokaryotic luminescence (lux) systems and their corresponding genes have been cloned from marine bacteria in the Vibrio and Photobacterium genera and from the terrestrial microorganism Photorhabdus luminescens.
- luxCDABE luxCDABE operon from Photorhabdus luminescens provides the genes (luxAB) for synthesis of the bacterial luciferase enzyme which is optimally active at 37 °C and thermostable up to 47 °C, and the genes (luxCDE) for the synthesis of the aldehyde substrate of the prokaryotic luciferase.
- Oxygen is the only extrinsic requirement for bioluminescence using the prokaryotic lux system.
- luc luciferase system
- Firefly luciferase has been extensively studied and has long been used in ATP assays.
- the cDNA for the luciferase gene (luc) has been cloned from the firefly, Photinuspyralis, (DeWet et al., 1985, PNAS 82: 7870-7873), and more recently has been expressed in a wide range of biological systems, including bacterial, plant and animal cells (De Wet et al., 1987: Mol Cell Biol 7: 725-737; DeWet et al., 1985, PNAS 82: 7870-7873; Ow et al., 1986, Science 234: 856-859).
- the light from firefly luciferase ranges in color from green to yellow (550 to 580 nm).
- the range of bioluminescent light emitted from the related luminous click beetle (Pyroporus plagiophthalamus), is larger than that emitted from fireflies, ranging from blue-green to orange (530 to 590 nm).
- the cDNAs of the genes responsible for the bioluminescent light of the luminous click beetle have also been cloned.
- the availability of luciferase systems with a range of spectral emissions allows for the selection of color variants optimized for the custom application of the present invention, as described below.
- the firefly luc system requires the expression of only a single gene for light production, which is a potential advantage for expression in eukaryotic systems.
- Another advantage of the firefly luciferase system as a reporter in some applications of the present invention derives from the optimal catalytic activity of the luciferase enzyme at the ambient room temperatures (e.g., at about 23 to 28 °C) used for cultivation of the disease organisms and plant substrates.
- the firefly luciferase system requires the presence of the substrates O 2 , ATP and luciferin for catalysis.
- O 2 and ATP are derived from the biological tissue and firefly luciferin ((S)-4,5-dihydro-2-(6-hydroxy-2-benzothiazolyl)-4-thiazolecarboxylic acid) is supplied to the biological sample, depending on the organism and test format, either by spraying, feeding, watering, injection, or other means.
- firefly luciferin (S)-4,5-dihydro-2-(6-hydroxy-2-benzothiazolyl)-4-thiazolecarboxylic acid) is supplied to the biological sample, depending on the organism and test format, either by spraying, feeding, watering, injection, or other means.
- the preferred PLGMs and LGMs of this invention have spectral properties that facilitate photon detection (i.e., they produce light of a wavelength that can be distinguished from light generated by the disease organism and/or substiate, depending on the application).
- the spectral properties of the LGMs selected for use in the disease organism are particularly important when the substrate is a plant. Plants naturally produce a wide range of LGMs with varying spectral properties and which accumulate to varying extent dependent upon plant species, growth conditions and disease status. Plant LGMs include chromoproteins and pigments, such as chlorophyll, carotenoids, and anthocyanins, some aromatic amino acids, and some plant secondary metabolites.
- Chlorophylls are fluorescent molecules which absorb light at two wavelength maxima, one in the blue end of the visible spectrum, at about 430 nm, and a broader absorption band in the red wavelengths, with a maximum around 660 nm. The resulting chlorophyll fluorescence emission is in the red and far-red range of the visible spectrum. Chlorophyll absorbs little light energy in the green wavelengths, and notably plants reflect most green light back to the environment, resulting in the typical green color for most plant species.
- a LGM must be selected which emits and/or absorbs light at a wavelength that does not overlap significantly with the absorption and emission wavelengths for the endogenous LGM's and especially the abundant chlorophyll pigment-protein complexes.
- the LGM should optimally absorb in the blue to green wavelengths and emit in the green region of the spectrum so as to avoid spectral overlap with the predominant chlorophyll pigments.
- the absorption and emission spectra for the PLGM-derived fluorescein and for GFP including the engineered GFP variants that have been modified to absorb maximally at a range of about 473 to 489 nm and fluoresce at approximately 510 nm, and for FP's such as ZsGreen fall into the spectral gap for chlorophyll absorbance.
- Fluorescein, GFP and ZsGreen FP produce light at wavelengths predominantly reflected by the plant rather than absorbed, and are therefore particularly well suited for use in the present invention.
- a series of plasmids referred to as "compro" (because all the plasmids in the series have a common 20 bp sequence at the 3 ' end of the promoter) can be constructed according to standard molecular biology techniques well-known to those skilled in the art.
- such plasmids are based on pBluescript and containing a fungal promoter with the "compro" sequence, the Neurospora crassa B-tubulin transcription terminator, the bialaphos resistance gene for fungal selection, trpl of Saccharomyces cerevisiae, and a 2 ⁇ m yeast origin of replication.
- a version containing the M. grisea P2 ribosomal protein promoter is pSM324.
- Plasmid pSM324 can be digested with ⁇ Tio I and the 5' overhang filled-in with the Klenow fragment of DNA polymerase I.
- GFP variants engineered for enhanced fluorescent yield relative to wildtype GFP such as EGFP (available from Clontech Laboratories, Inc. Palo Alto, CA) and rsGFP (available from Quantum Biotechnologies, Inc. Montreal, Quebec, Canada).
- polymerase chain reaction is used to amplify the GFP coding sequences with 5' and 3' primers designed to the respective ends of the GFP sequence and with sequence extensions homologous to the pSM324 sequence flanking the Xho I site and sufficient for homologous recombination.
- primers "XFP5" aggaacccaatcttcaaaatggtgagcaagggcgag
- XFP3 aggaacccaatcttcaaaatggtgagcaagggcgag
- aatgttgagtggaatgatttacttgtacagctcgtcc designed to the Clontech EGFP sequence
- the XFP5/XFP3 amplification product and the -Yfto-digested pSM324 can then be transformed into Saccharomyces cerevisiase strain W303-1 A by the lithium acetate method (Agatep et al., 1998) to allow gap repair of the plasmid.
- Yeast colonies can be selected on tryptophan- minus plates. Plasmid minipreps can be performed on yeast tryptophan prototrophs and an aliquot transformed into E.
- Plasmid DNA can be prepared from ampicillin-resistant E. coli tiansformants and screened by restriction digest for the proper gap repair of the XFP5/XFP3 amplification product into pSM324 to generate the GFP expression vector (FIGURE 2).
- the GFP expression vector can be transformed into M. grisea strain 4091-5-8 using published transformation protocols (Sweigard et al, 1992).
- Bialaphos-resistant tiansformants of M. grisea can be selected and purified by single spore selection. Independent tiansformants can be screened for fluorescent intensity and an exceptionally bright transformant can be selected for further use.
- plant secondary metabolites whose accumulation is induced upon infection by plant pathogens and which are fluorescent are of relevance to the present invention.
- Such compounds include lignin, sinapoyl malate and other phenylpropanoid derivatives, among others.
- the luminescence derived from the secondary metabolites may be discounted and/or corrected for by comparison to the signal from the appropriate controls (e.g. diseased host plants lacking the LGM detected in the method). Similar considerations of spectral properties apply to the use of bioluminescent LGMs.
- bioluminescence may be hindered by absorbance of the bioluminescent light by the plant substiate or the disease organism.
- Plant tissue as described above, does not quantitatively absorb green light.
- bioluminescence in the green region of the spectrum as produced by the luciferase/luciferin reaction, will not be significantly quenched by chlorophyll absorption, but rather will be optimally transmitted through the plant tissue.
- Optimal transmission of light, whether arising from fluorescence or bioluminescence, through the plant substrate is particularly important in the application of the present invention for the assay of disease organisms which grow internal to the plant leaf, rather than primarily exposed on the leaf surface.
- Methods for the differential localization and accumulation of PLGMs or LGMs between the disease organism and substrate can be critical for the successful application of the present invention. In certain embodiments it is the differential accumulation of and the subsequent detection of the LGM that forms the basis of the method for detecting the extent of disease organism growth.
- the PLGM or LGM can be differentially conjugated to the disease organism or substrate by a variety of techniques, which include differential application to or accumulation in the disease organism and/or substrate by injection, pipeting, watering, submersion or spraying of a small molecule or chemical. Such methods may require subsequent redistribution and/or exclusion of the PLGM or LGM by the action of the biological organisms (e.g., Fluorescein diacetate, Embodiment I).
- the LGM may be an endogenous component of either the disease organism and/or plant substrate, which differentially accumulates. Endogenous is defined herein as a property or entity originating or developing within either the disease organism or the plant substrate, and includes proteins expressed as the result of genetic transformation of the organism with a heterologous gene.
- the disease organism and/or plant substrate may be engineered for in situ synthesis of the LGM (e.g., expression of a heterologous fluorescent protein in a transformed cell, regulated by either a constitutive promoter or an inducible promoter controlled by the administration of the appropriate promoter inducer, Embodiment II).
- the PLGM fluorescein diacetate has chemical properties that enable it to preferentially accumulate in and be transformed to a LGM in some fungal disease organisms relative to the plant substrate.
- the lipophilic diacetate moiety allows the FDA molecule to permeate cell membranes. Once inside the cell, the diacetate groups are cleaved by non-specific cellular esterases, forming a charged form of the fluorescent fluorescein molecule that leaks out of the cell far more slowly than the parent compound.
- pathogens such as Puccinia graminis, the causative agent of leaf rust, produce disease lesions with fruiting structures exposed on the leaf surface, but do not become highly fluorescent upon FDA application, likely due to pathogen-specific differences in FDA uptake and/or metabolism.
- FDA is excluded from the leaf by the hydrophobic epicuticular waxes and as a result is inaccessible to pathogens that grow primarily internal to the leaf.
- Some pathogens may be induced to sporulate under appropriate environmental conditions (i.e., high humidity), producing fruiting structures on the leaf exterior that are accessible to FDA staining.
- Magnaportha grisea the causative agent of rice blast disease, is an exemplary pathogen that grows internal to the leaf blade but can be differentially labeled with FDA following sporulation.
- the combination of chemical properties of the FDA/fluorescein pair, the biophysical differences in hydrophobicity of the cell membrane of the disease organism relative to the substiate, and the growth habit of the pathogen relative to the leaf surface regulates the differential accumulation of fluorescein in the disease organism.
- An individual skilled in the art of the present invention is able to identify disease organism/substrate pairs with the appropriate combination of growth habits and biophysical traits (e.g., surface pathogen capable of FDA uptake) for which FDA is the preferred PLGM.
- FDA is typically formulated in a dilute detergent working solution that aids in dispersing the FDA in solution and on the hydrophobic leaf surface.
- the FDA may be applied as a foliar treatment to the plant using conventional spray technology, drench or drip methods.
- the FDA working solution is preferably sprayed as a fine mist onto intact plants to avoid displacing fungal fine structure and is applied until runoff is observed.
- Preval® sprayers Precision Valve Corporation, Yonkers, N.Y.
- airbrush paint applicators also provide a suitably fine mist for this application.
- the disease Upon infection with the disease organism many host plants undergo the process of localized cell death in an attempt to curtail the spread of the infection. In some cases, the disease disrupts the host's normal cellular processes and/or causes cell death. As a result of the infection and disease progression process, the biosynthesis and accumulation of an endogenous LGM such as chlorophyll may be altered. The differential chlorosis resulting from this pathology can be used as a marker for disease growth.
- the predominant fluorescence signal from the chlorophyll pigment is used advantageously to detect the uninfected, healthy regions of the plant substrate. By subtracting the area of chlorophyll-fluorescent, healthy leaf tissue from the total area of the leaf determined from a reference image, the area infected by the disease organism may be determined.
- heterologous genes are genes that have been transformed into a host organism.
- a heterologous gene is a gene not originally derived from the transformed host organism's genomic DNA.
- the preferred heterologous genes are those encoding the LGMs luciferase and FP's with emission in the green wavelengths, such as GFP or ZsGreen FP, as described above. This method is applicable to disease organisms and host plant species in which genetic transformation is possible.
- This method includes administering to a subject (either disease organism or plant host) a vector construct effective to integrate a transgene into the subject's cells.
- a vector construct effective to integrate a transgene into the subject's cells.
- Such vector constructs are well known to those skilled in the art. Examples of vector constructs are represented by the plasmid maps of FIGURES 2, 3 and 9.
- the construct contains a transgene (e.g. a therapeutic gene or selectable marker) and a gene encoding the LGM under the control of a selected activatable promoter.
- the organism With the expression of the luciferase or FP (e.g. GFP or Zs Green FP) reporter genes in the disease organism, the organism becomes bioluminescent or fluorescent, respectively, and the resulting light generation can be used to directly detect the extent of infection by the disease organism.
- a constitutive promoter may be used to drive expression throughout the disease organism permitting detection of the organism whether it grows on the leaf surface or internal to the leaf blade.
- Inducible promoters may be used to drive expression only when desired for disease detection and in response to a promoter induction event.
- Promoter induction events include the administration of a substance that directly activates the promoter, the administration of a substance that stimulates the production of an endogenous promoter activator, the imposition of conditions resulting in the production of an endogenous promoter activator (e.g. heat shock or stress), and the like.
- tissue-specific promoters directing the expression of the LGM solely in the reproductive structures of the pathogen may be used to detect the ability of a plant treatment agent to prevent the spread of disease by inhibition of the infection cycle.
- the expression of luciferase or FP renders the host tissue light generating.
- the host plant expression of a heterologous gene encoding a LGM can be used to detect healthy, uninfected regions of the host plant.
- the expression and accumulation of a heterologous LGMs such as luciferase or FP may be altered.
- the differential reporter gene expression and light generation resulting from this pathology may be used as a marker for disease growth.
- inducible promoter systems may be used to direct the reporter gene expression in the host plant, and may include host promoters induced in response to infection with a pathogen.
- a photon-detecting device is an instrument that can detect photon emission.
- Photon- detecting devices may include the unaided human eye, the human eye aided by the use of night vision goggles, a fluorescence scanner, a fluorometer or spectrophotometer, a digital camera, a photomultiplier (PMT), a charge coupled device (CCD), or a time-delay integrating (TDI) CCD that detects photons from an object as it travels relative to the detector.
- PMT photomultiplier
- CCD charge coupled device
- TDI time-delay integrating
- An important aspect for many applications of the present invention is the selection of a photon-detecting device with sufficient sensitivity to enable the detection and imaging of faint light from within or on a plant in a reasonable amount of time to provide sufficient sample throughput.
- the subject may be held within the detection field of a photon-detecting device for a length of time necessary to measure a sufficient amount of photon emission to construct an image.
- a pair of night- vision goggles or a standard high-sensitivity video camera, such as a Silicon Intensified Tube (SIT) camera may be used. More typically, however, a more sensitive method of light detection is required.
- the photon flux per unit area can become so low that the scene being imaged no longer appears continuous. Instead, it may be represented by individual photons, which are both temporally and spatially distinct from each other. Viewed on a monitor, such an image typically appears as scintillating points of light, each representing a single detected photon. Nevertheless, by accumulating these photons in a digital image processor over time, an image can be acquired. At least two types of photon-detecting devices, described below, can detect individual photons and generate a signal that can be analyzed by an image processor. Photon Amplification Devices
- This class of sensitive photon-detecting devices employs additional devices to intensify single photon events before they reach the detector.
- This class includes CCD cameras with intensifiers, such as microchannel intensifiers.
- An exemplary microchannel intensifier-based single photon detection device is the C2400 system, available from Hamamatsu Photonic Systems (Bridgewater, N J.).
- a microchannel intensifier typically contains a metal array of channels perpendicular to, or at a slight angle to, the detection screen, which is co-extensive to and positioned in front of the detector screen.
- a photocathode device is positioned between the microchannel array and the sample. A photon striking the photocathode causes the ejection of an electron, which enters the microchannel array.
- This class of photon-detecting devices achieves sensitivity by reducing the background noise in the detector, as opposed to amplifying the signal. Noise is primarily reduced by cooling the detector array, thereby reducing the dark current (i.e., electrical current that results from leaks in the circuitry of the instrument) and, most significantly, accumulates at the detector head. The deeper the cooling (by, for example, liquid nitrogen, which can reduce the temperature of the CCD array to about -120 °C), the more sensitive the detector. More sensitive versions of these cooled devices include CCD arrays referred to as "backthinned" that may be operated in a back illuminated mode. "Backthinned" refers to an ultrathin backplate of the CCD array.
- Thinning the CCD array reduces the path length a photon must travel to be detected, and coupled with the back illumination, avoids light absorption by the polysilicon gates at the front of the CCD array, thus greatly improves the quantum efficiency of the detector.
- a new CCD technology called multi-pin phasing (MPP), by reducing the potential at the surface of the CCD during the exposure time, can reduce dark current by a factor of 100 or more.
- Detectors are available which employ all of these technologies (i.e., cooling, backthinned, back illuminated arrays, and MPP) for optimal camera performance.
- An exemplary reduced-noise photon-detection camera employing all of these technologies, and yet providing excellent high-resolution characteristics (1317 x 1035 imaging array with 6.8 x 6.8 ⁇ m pixels), is the SenSys®1401E camera system, available from Roper Scientific (Tucson, AZ).
- Camera systems are also available which combine both photon amplification and noise reduction technologies (e.g., a cooled, intensified CCD). Such camera systems are generally very sensitive for light detection, but provide somewhat lower spatial resolution than cameras employing solely noise reduction technologies.
- noise reduction technologies e.g., a cooled, intensified CCD
- Signals generated by photon-detecting devices that count single photons typically need to be processed by an image processor in order to construct an image that can be, for example, displayed on a monitor or printed.
- the detection of photon emission generates an array of numbers, representing the number of photons detected at each pixel location, in the image processor. These numbers are used to generate an image, typically by normalizing the photon counts (either to a fixed preselected value, or to the maximum number detected in any pixel in the field) and converting the normalized number to a brightness (grayscale) or to a color (pseudocolor) that is displayed on a monitor. In a grayscale presentation, typical color assignments are as follows.
- Pixels with zero photon counts are assigned black, low counts are assigned shades of gray, and white is assigned for pixels having the highest photon counts.
- the locations of the gray and white pixels on the monitor represent the distribution of photon emission, and, accordingly, the location of the light generating moieties.
- Image processors are typically sold as part of systems that include the sensitive photon-counting cameras described above, and accordingly are available from the same sources (e.g., Hamamatsu and Roper Scientific).
- the image processor is usually connected to a personal computer, such as an IBM-compatible PC or an Apple Macintosh, that may or may not be included as part of the purchased camera system.
- a personal computer such as an IBM-compatible PC or an Apple Macintosh, that may or may not be included as part of the purchased camera system.
- After the images are in the form of digital files, they can be manipulated and analyzed with a variety of image processing programs, including software applications available from the camera system vendors, other commercial applications such as MetaMorph® (Universal Imaging, West Chester, PA) or Adobe Photoshop® (Adobe Systems, Mountain View, CA), or custom software applications.
- MetaMorph® Universal Imaging, West Chester, PA
- Adobe Photoshop® Adobe Systems, Mountain View, CA
- FIGURE 1 One macro imaging system that can be used in the present invention (see FIGURE 1) is an integrated, computer-controlled instrument.
- the configuration is such that the samples are placed in the base (1) of the imaging chamber (10), and the camera (2) focuses downward.
- the camera it may be desirable to have the camera mounted on the side of the chamber. Still other configurations of the camera relative to the samples to be imaged may be used for other applications of the methods.
- the excitation light in this example is produced by dual light sources (3) (e.g. DCR® II LITE SOURCE available from Optical Apparatus Co., Inc., Ardmore, PA), each fitted with the appropriate bandpass filters (4) (for example filters available from Omega Optical, Brattleboro, VT) and coupled with a fiber optic bundle (5) to a 14" x 0.015" (35.6 cm x 0.038 cm) fiber optic line light (6) (e.g. Lightline® available from Optical Apparatus Co., Inc., Ardmore, PA).
- dual light sources (3) e.g. DCR® II LITE SOURCE available from Optical Apparatus Co., Inc., Ardmore, PA
- bandpass filters (4) for example filters available from Omega Optical, Brattleboro, VT
- fiber optic line light (6) e.g. Lightline® available from Optical Apparatus Co., Inc., Ardmore, PA.
- the line lights (6) are mounted inside the imaging chamber out of the field of view of the camera, and oriented to provide flat-field illumination, without spectral reflectance, across the imaging field of view.
- Low wattage white lights covered by a diffuser (7) are also mounted inside the chamber and are used to provide flat-field, nonreflecting illumination for the collection of the reference images.
- Establishing uniform excitation and reference light conditions without spectral reflectance is important for some applications of the present invention, particularly when flat transparent materials such as Lucite® polycarbonate or Mylar® polyester are used to hold plant samples in a single plane for improved image accuracy, or when the host substrate contains reflective material, such as with a microtitre plate.
- an additional flatbed reference light (15) may be placed in the base of the imaging chamber (1) to backlight samples relative to the camera (2). Emitted fluorescence, bioluminescence or reflected light may be detected by a camera
- a SenSys®1401E cooled CCD camera (Roper Scientific, Arlington, AZ), fitted with a macro photographic lens, such as an AF Nikkor 35mm f2.0 lens (available from Nikon, Inc., Melville, N.Y.), and an appropriate emission filter (8) (for example a filter available from Omega Optical, Brattleboro, VT), and connected to an image processor (9) having a 16-bit frame grabber.
- a SenSys®1401E cooled CCD camera Roper Scientific, Arlington, AZ
- a macro photographic lens such as an AF Nikkor 35mm f2.0 lens (available from Nikon, Inc., Melville, N.Y.)
- an appropriate emission filter (8) for example a filter available from Omega Optical, Brattleboro, VT
- Operation of the lighting systems for fluorescence and for reference images and of the CCD camera is controlled by a computer (11) through wire connections (12) and (13), respectively.
- a multifunction I O board (14) e.g. one available from National Instruments, Austin, TX
- Software drivers for the operation and control of the camera are generally provided by the camera manufacturer and are installed on the computer.
- a customized image analysis software program installed on a PC running the Microsoft Windows NT® operating system controls the lighting and camera operation.
- Image Acquisition and Analysis Samples to be imaged are placed within the imaging chamber (10) (see FIGURE 1), with orientation relative to the camera and dependent upon the substrate format (e.g., microtitre plate or plant leaf), and/or, when a plant is the substrate, upon the growth habit of the host plant (e.g., broadleaf or grass leaves).
- the field of view with a 35 mm macro lens may accommodate one or more plants, depending on their size, and one or more microtitre plates, depending on the working distance. Larger fields of view, and therefore increased throughput can be achieved with the use of shorter focal length lenses, such as 28 or 24 mm lenses.
- a field lens can be helpful for correcting parallax, especially when deep welled microtitre plates are used.
- Such lenses generally are optically slow and may reduce the amount of light detected.
- Sheets of glass, Lucite® polycarbonate, flexible Mylar® polyester or other transparent material may be used to flatten the samples by layering the leaves between the transparent sheets.
- both surfaces of the host leaf can be easily imaged with such flattened samples. This aspect is particularly useful when imaging diseases that manifest infection randomly on each side of the leaf.
- the fractional area of a leaf infected with a disease organism containing a LGM is determined according to the following Flow Scheme.
- One skilled in the art can practice this method by operating the photon detectors to detect the photon emissions and analyze the images according to the Flow Scheme.
- One skilled in the art of computer programming can obtain or create programs to carry out these steps by using commercially available software or custom software.
- a reference image of the sample is acquired under dim white light illumination.
- a customized software application is used to threshold the image, such that each pixel above a set intensity threshold is assigned a value of 1 for the sample, and each pixel with an intensity below that threshold is identified as the background field of view and assigned a value of 0.
- This step generates a binary image that is subsequently used to determine the total area of each object in the field of view.
- the software application delineates a minimum bounding box around each contiguous object with pixel values of 1, and thereby defines each object in the field of view, and assigns it an object number.
- a minimum pixel number size can be set to eliminate detection and localization of extraneous objects (e.g. dirt or other debris) that may contaminate the field of view.
- the total number of objects in the field of view is thus defined, and the total number of pixels comprising each object, or the total leaf area, is determined.
- the binary image is also used to generate a reference mask for the subsequent image acquisition step, i.e. detection of light that is generated by the fluorescent or bioluminescent moiety from regions of the defined object.
- the fluorescence or bioluminescence image is thresholded, assigning pixel values equal to 1 for regions of the object producing luminescence above a set threshold, and assigning pixel values of 0 to regions of the object with luminescence below that threshold.
- the pixels within the boundary of each object that contain a light generating moiety are thus defined, and the total number of pixels in which the light generating moiety is localized are determined. To determine the fractional area containing the disease organism with a LGM, the number of pixels associated with localized light-generation is divided by the total number of pixels comprising the object or leaf.
- the image detecting the localization of the disease organism can be superimposed on the reference image of the plant substrate to form a composite image providing a spatial frame of reference.
- the composite image may be further analyzed to provide spatial information on the location and/or distribution of the disease organism.
- the leaf may be divided into segments of a defined pixel length, and the fractional area of each segment, from the tip of the leaf to the base, infected by the disease organism calculated.
- the substrate may be a microtitre plate well with or without other growth media or support, or a host plant within a microtitre plate well, or plants cultivated such that relatively uniform leaf area results, spatial information may become irrelevant.
- the detection and integration of the signal from multiple plants contained within a single well of a microtitre plate and infected with a disease organism containing a LGM is performed as follows.
- An image of the sample fluorescence or bioluminescence, in this example for the entire microtitre plate, is acquired under excitation illumination.
- the operator can position a map of the plate that indexes and delimits the positions of the individual wells over the image of the plate on the computer monitor.
- the pixel intensities from this image are summed over the area defined for each well of the plate and the total signal from the fluorescent or bioluminescent LGM is reported out by well position.
- the luminescence intensity within the boundary of each well is thus defined, and is used as a measure of the accumulated amount of the disease organism.
- plant treatment agents that are effective for controlling the plant disease organism that causes the disease.
- plant treatment agents may be procured (when they are available) by purchase from manufacturers or other suppliers.
- the methods of this invention may be used to determine the effectiveness of the plant tieatment agent by the supplier or by the party procuring it.
- known plant treatment agents may be prepared by the producer of the crop protection agent.
- the methods of this invention may be used to determine the effectiveness of the plant treatment agent by the producer.
- new plant treatment agents that are particularly effective for controlling a plant disease may be discovered using the methods of this invention.
- the methods of this invention may be used in the production of crop protection agents by determining the effectiveness of plant tieatment agents and compositions containing them for the control of plant disease organisms.
- the determination of effectiveness can represent an important step in the production of crop protection agents suitable for agronomic utility. For example, determining the effectiveness of a plant treatment agent not previously known to be effective in the control of plant disease organisms and/or compositions containing said plant tieatment agent allows one skilled in the art to select said treatment agent and/or said compositions for production as crop protection agents. Determining the effectiveness of a previously unknown composition containing a previously known plant treatment agent allows one skilled in the art to select said composition for production as a crop protection agent.
- the methods of this invention may be used to determine the effectiveness of mixtures of plant treatment agents for controlling plant disease.
- One may also use methods of this invention to assay samples of known compositions to determine their effectiveness for controlling plant disease for quality control purposes during the manufacture, production and/or storage of said compositions.
- Chemical compounds determined to be effective can be obtained from chemical manufacturers and are typically prepared by those skilled in the art of chemical synthesis by chemical processes and transformations, including traditional solution-phase syntheses, syntheses employing combinatorial chemistry techniques such as polymer-bound or solid-phase reagents or substrates and parallel synthesis techniques and/or processes employing microbial agents, enzymes or enzyme preparations such as fermentations.
- Plant treatment agents will generally be used as crop protection agents consisting of a formulation or composition with an agriculturally suitable carrier comprising at least one of a liquid diluent, a solid diluent or a surfactant.
- an agriculturally suitable carrier comprising at least one of a liquid diluent, a solid diluent or a surfactant.
- Another aspect of producing crop protection agents effective in the control of plant disease can involve formulating plant treatment agents with other components.
- the methods of this invention may be used to determine the effectiveness of the plant treatment agent in combination with the other components of a particular formulation.
- the formulation or composition ingredients are selected to be consistent with the physical properties of the active ingredient(s) (i.e., the plant treatment agent), mode of application and environmental factors such as soil type, moisture and temperature.
- Useful formulations include liquids such as solutions (including emulsifiable concentrates), suspensions, emulsions (including microemulsions and/or suspoemulsions) and the like which optionally can be thickened into gels. Useful formulations further include solids such as dusts, powders, granules, pellets, tablets, films, and the like which can be water-dispersible ("wettable") or water-soluble. Active ingredient can be (micro)encapsulated and further formed into a suspension or solid formulation; alternatively the entire formulation of active ingredient can be encapsulated (or “overcoated”). Encapsulation can control or delay release of the active ingredient. Sprayable formulations can be extended in suitable media and used at spray volumes from about one to several hundred liters per hectare. High-strength compositions are primarily used as intermediates for further formulation.
- the formulations will typically contain effective amounts of active ingredient(s) and diluent(s) and surfactant(s) within the following approximate ranges that add up to 100 percent by weight.
- Weight Percent of active ingredient(s) and diluent(s) and surfactant(s) within the following approximate ranges that add up to 100 percent by weight.
- Typical solid diluents are described in Watkins, et al., Handbook of Insecticide Dust Diluents and Carriers, 2nd Ed., Dorland Books, Caldwell, New Jersey. Typical liquid diluents are described in Marsden, Solvents Guide, 2nd Ed., Interscience, New York, 1950. McCutcheon 's Detergents and Emulsifiers Annual, Allured Publ. Corp., Ridgewood, New Jersey, as well as Sisely and Wood, Encyclopedia of Surface Active Agents, Chemical Publ. Co., Inc., New York, 1964, list surfactants and recommended uses. All formulations can contain minor amounts of additives to reduce foam, caking, corrosion, microbiological growth and the like, or thickeners to increase viscosity.
- Surfactants include, for example, polyethoxylated alcohols, polyethoxylated alkylphenols, polyethoxylated sorbitan fatty acid esters, dialkyl sulfosuccinates, alkyl sulfates, alkylbenzene sulfonates, organosilicones, N,N-dialkyltaurates, lignin sulfonates, naphthalene sulfonate formaldehyde condensates, polycarboxylates, and polyoxyethylene/polyoxypropylene block copolymers.
- Solid diluents include, for example, clays such as bentonite, montmorillonite, attapulgite and kaolin, starch, sugar, silica, talc, diatomaceous earth, urea, calcium carbonate, sodium carbonate and bicarbonate, and sodium sulfate.
- Liquid diluents include, for example, water, N,N-dimethylformamide, dimethyl sulfoxide, N-alkylpyrrolidone, ethylene glycol, polypropylene glycol, paraffins, alkylbenzenes, alkylnaphthalenes, oils of olive, castor, linseed, tung, sesame, corn, peanut, cotton-seed, soybean, rape-seed and coconut, fatty acid esters, ketones such as cyclohexanone, 2-heptanone, isophorone and 4-hydroxy-4-methyl-2-pentanone, and alcohols such as methanol, cyclohexanol, decanol and tetrahydrofurfuryl alcohol.
- Water-dispersible and water-soluble granules can be prepared as taught in U.S. 4,144,050,
- Active Ingredient(s) 25.0% anhydrous sodium sulfate 10.0% crude calcium ligninsulfonate 5.0% sodium alkylnaphthalenesulfonate 1.0% calcium magnesium bentonite 59.0%.
- Plant treatment agents determined to be effective by the methods of this invention can also be mixed with one or more other insecticides, fungicides, nematocides, bactericides, acaricides, growth regulators, chemosterilants, semiochemicals, repellents, attiactants, pheromones, feeding stimulants or other biologically active plant tieatment agents to form a multi-component crop protection agent giving an even broader spectrum of agricultural protection.
- These mixtures may be prepared by obtaining the individual active ingredients and combining them with other formulation components as described above to provide a formulation containing two or more active ingredients. Mixtures may also be obtained by obtaining formulations containing individual active ingredients and physically mixing them to obtain a new formulation containing two or more active ingredients. The effectiveness of mixtures for controlling plant disease containing two or more active ingredients may be determined using the methods of this invention.
- the present invention further provides a method for controlling plant diseases (e.g. a disease caused by a fungal plant pathogen) comprising determining that a plant tieatment agent is effective by a method of this invention and applying to the plant or portion thereof to be protected, or to the plant seed or seedling to be protected, an effective amount of said plant treatment agent (e.g. as a component of a fungicidal composition containing said plant treatment agent).
- plant diseases e.g. a disease caused by a fungal plant pathogen
- the methods of this invention may be used to identify plant treatment agents and compositions effective in providing control of diseases caused by one or more fungal plant pathogens in the Basidiomycete, Ascomycete, Oomycete and Deuteromycete classes.
- pathogens may be effective in controlling plant diseases, particularly foliar pathogens of ornamental, vegetable, field, cereal, and fruit crops.
- pathogens include Plasmopara viticola, Phytophthora infestans, Peronospora tabacina, Pseudoperonospora cubensis, Pythium aphanidermatum, Alternaria brassicae, Septoria nodorum, Septoria tritici, Cercosporidium personatum, Cercospora arachidicola, Pseudocercosporella herpotrichoides, Cercospora beticola, Botrytis cinerea, Monilinia fructicola, Pyricularia oryzae, Podosphaera leucotricha, Venturia inaequalis, Erysiphe graminis, Uncinula necatur, Puccinia recondita, Puccinia graminis, Hemileia vastatrix, Puccini
- plant treatment agents that include a combination of one active component with another active component (see Mixtures in Section VII) having a similar spectrum of control but a different mode of action will be particularly advantageous for resistance management.
- plant treatment agents that are used for controlling fungal plant diseases by the methods of this invention and that comprise azoxystrobin, cymoxanil, epoxiconazole, famoxadone, fenamidone, fenpropimorph, flusilazole, fosetyl- aluminum, kresoxim-methyl, mancozeb, maneb, metalaxyl, metconazole, oxadixyl, pyraclostiobin, quinoxyfen, tricyclazole and/or trifloxystrobin in combination with another active ingredient of a different mode of action.
- Magnaportha grisea (the causal agent of blast disease). Either wild type or a tiansgenic strain of M. grisea, expressing a FP gene (ZsGreen FP) under the control of the ribosomal protein RP27 (p2) promoter (described below) are used for inoculation. Blast-inoculated barley plants are incubated in a saturated atmosphere at 27 °C for 24 h, and then moved to a growth chamber at 30 °C for 5 days, after which disease ratings are made. Blast-infected plants are 13 days old at the time of rating of disease.
- Eragrostis curvula plants are cultivated in deep-well polystyrene microtitie plates containing solid 1/2X Murashige and Skoog (MS) media and covered with gas-permeable seals (Marsh Biomedical). Plants are seeded to approximately 5-6 seeds per well and are grown in an environmentally regulated growth chamber at 25 °C and 85% humidity, with a 1% CO 2 enriched atmosphere. Blast inoculation is performed when the plants are 10 days old by spraying the plants with a spore suspension of Magnaportha grisea. A tiansgenic stiain of M.
- grisea expressing an engineered variant of the GFP gene under the control of the ribosomal protein RP27 (p2) promoter (see FIGURE 2 for a plasmid map) can be used for infection (see above for preparation of such a tiansgenic stiain).
- the plates containing the blast-inoculated plants are subsequently covered with the gas permeable seals and maintained under conditions similar to that for growth of the host plants prior to infection. Disease ratings are made 4 days after inoculation.
- Fungicide standards or experimental plant treatment agents are applied as a systemic application to the media prior to seeding.
- Tomato plants Lopersicon esculentum cv.
- Inoculation with tomato late blight is with a spore suspension of Phytophthora infestans, (the causal agent of tomato late blight disease). Following inoculation, the plants are held for 24 hours in a saturating atmosphere and are subsequently grown for an additional seven days at 20 °C and 70% humidity. Late blight-infected tomato plants are 20 days old at the time of rating of disease.
- Dried Sclerotinia sclerotiorum-i xfected dry bean blossoms used to infect the tiansgenic tobacco plants expressing the luciferase gene are generated as follows. Flower blossoms from 5- week old dry bean plants (Phaseolus vulgaris, 'garden bush' red kidney) are harvested and placed in a 150 x 15 mm petri dish containing moistened filter paper. Blossoms are inoculated with a Sclerotinia sclerotiorum spore suspension containing 20,000 spores/mL using a Preval® applicator. The petri dish containing the inoculated blossoms is sealed and stored in a 20 °C incubator for 48 hrs to initiate blossom infection. The resulting infected blossoms are allowed to air dry at 24 °C for 24 hrs before being stored at 4 °C in a sealed petri dish until use.
- Tobacco seeds (Nicotiana tabacum cv. Xanthi), wildtype and 35S::LUC::NOS3 ' T2 generation (see FIGURE 3 for the plasmid map and section C below), are germinated on agar plates with lx MS media containing 3% sucrose, and for tiansgenic lines 100 ⁇ g mL -1 kanamycin and 100 ⁇ g mL" 1 carbenicillin in an enviromnentally regulated growth chamber at 24 °C. Approximately 10-day-old seedlings are transferred to soil and grown under greenhouse conditions.
- Inoculation of 8-week old plants is by placing two dried Sclerotinia sclerotio m-ixifected dry bean blossoms onto each pre-wetted tobacco leaf. Plants are moved to a 20 °C dew chamber for 48 hrs to promote leaf infection, after which time the plants are imaged.
- Leaf segments of tobacco plants maintained in sterile culture on solid MS media containing 3% sucrose are transformed according to standard techniques (Horsch et al., 1988, Leaf disc transformation, in Plant Molecular Biology Manual, A5 (Gelvin, S. and Schilperoort, R. eds), Dordrecht: Kluwer Academic Publishers).
- Transformed callus tissue is selected on solid MS media containing 200 ⁇ g mL -1 kanamycin and 500 ⁇ g mL -1 carbenicillin.
- Regenerated shoots are selected on solid MS containing 3% sucrose, 100 ⁇ g mL -1 kanamycin and 500 ⁇ g mL" 1 carbenicillin.
- Resistant Tl (primary transformant) plants carrying the 35S::LUC::NOS3 ' fusion are subsequently grown to maturity in soil under greenhouse conditions and T2 seed collected.
- a series of plasmids referred to as "compro" (because all the plasmids in the series have a common 20 bp sequence at the 3' end of the promoter) is constructed according to standard molecular biology techniques well-known to those skilled in the art.
- Such plasmids are based on pBluescript and contain a fungal promoter with the "compro" sequence, the Neurospora crassa B-tubulin transcription terminator, the bialaphos resistance gene for fungal selection, trpl of Saccharomyces cerevisiae, and a 2 ⁇ m yeast origin of replication.
- a version containing the M. grisea RP27 (or P2) ribosomal protein promoter is pSM324.
- Plasmid pSM324 is digested with Xho I and the 5 ' overhang filled-in with the Klenow fragment of DNA polymerase I.
- FP's and their variants engineered for enhanced fluorescent yield relative to wildtype GFP such as EGFP, ZsGreenFP (both available from Clontech Laboratories, Inc. Palo Alto, CA) and rsGFP (available from Quantum Biotechnologies, Inc. Montreal, Quebec, Canada).
- polymerase chain reaction is used to amplify the FP coding sequences with 5' and 3' primers designed to the respective ends of the FP sequence and with sequence extensions homologous to the pSM324 sequence flanking I site and sufficient for homologous recombination.
- the primers "Zsgr5" (AGGAACCCAATCTTCAAAATGGCCCAGTCCAAGCAC) and "Zsgr3" (AATGTTGAGTGGAATGATTTATCTAGATCCGGTGG), designed to the Clontech ZsGreen FP sequence, are used for construction of a vector for expression of this FP in M grisea.
- the Zsgr5/Zsgr3 amplification product and the .ZTzo-digested pSM324 are then transformed into Saccharomyces cerevisiase strain W303-1 A by the lithium acetate method (Agatep et al., 1998) to allow gap repair of the plasmid. Yeast colonies are selected on tryptophan-minus plates.
- Samples or objects to be imaged for fluorescence are placed in a light-tight imaging chamber containing a door, excitation lights, white lights for reference image acquisition, and a cooled CCD camera outfitted with aNikkor® AF 35 mm £2 lens (Nikon Inc., Melville, N.Y.) and a suitable emission filter.
- Image data is obtained using a SenSys® 140 IE camera system, available from Roper Scientific (Tucson, AZ). (See FIGURE 1).
- FDA-derived and green fluorescent protein-derived fluorescence e.g. GFP- or ZsGreen FP- derived fluorescence
- a XF1073 filter with Optical Density (OD) 5 blocking and 475nm and 40 nm full width at half maximum tiansmission (FWHW) is used for excitation.
- An enhanced XF3084 filter with an AELP (alpha epsilon longpass) edge, 535nm center wavelength (CWL) and 45 nm FWHW is used for the emission.
- AELP alpha epsilon longpass
- CWL center wavelength
- FWHW 45 nm FWHW
- % disease area For the determination of the % disease area for a sample, a binary image is generated which defined the area of pixels associated with a LGM for each object in the field of view. The percent disease area is calculated by dividing the pixel number for the LGM area by the pixel number for the sample area. For the detection of a LGM endogenous to the plant substiate, an additional step of subtracting the fluorescence area from the total leaf area and then dividing by the total leaf area is required for the percent disease area calculation. For the determination of the accumulated amount of disease organism by integrating the fluorescent signal, the samples were imaged using a Hamamatsu C2400 photon detector system outfitted with the excitation light source and emission filters described above for use with the SenSys camera system.
- the discriminator is set to 20
- the sensitivity is set to 1
- the fluorescence signal is integrated for 10 sec.
- the fluorescence signal intensities of each pixel in the fluorescence image is summed for a defined region of interest, typically the area defined by the well of a microtitre plate, and is reported on a unit area basis.
- a reference image is collected under dim green light illumination by integrating typically 64 frames.
- the reference and fluorescence image data may be obtained as grayscale images.
- the reference and fluorescence images may be superimposed, using the image processor, to form a composite image.
- a hardcopy of the composite image is generated by saving the image as a digital file, transferring the file to the computer, and printing it on a printer attached to the computer.
- E. Imaging Bioluminescence Samples or objects to be imaged for bioluminescence may be collected using the system described above employing the SenSys® detector provided that sufficient bioluminescence is produced by the sample.
- the reference and bioluminescence image data may be obtained as grayscale and binary images. Hardcopies of the images are generated by saving the images as digital files, transferring the files to the computer, and printing them on a printer attached to the computer. EXAMPLE 1 DETECTING PHOTON EMISSION FROM A DISEASE ORGANISM TREATED WITH A PRO-LGM AND INFECTING A PLANT SUBSTRATE (EMBODIMENT I) - DETERMINATION OF DISEASE AREA The effectiveness of a plant treatment agent on plants infected with a disease organism is determined by treating the test unit with a pro-LGM and detecting photon emission.
- the barley plants are subsequently inoculated with a suspension of powdery mildew (Erysiphe graminis f. sp. hordei) spores, and incubated under the appropriate conditions for a period sufficient to allow the development of visible disease symptoms, as described above. Untreated plants are also infected at this time for the production of untreated, infected controls. Untreated, uninfected control plants are also generated in parallel.
- powdery mildew Ery mildew
- Plants to be rated for fungicide activity are first scored visually by eye for % disease coverage. The same samples are subsequently treated with the pro-LGM fluorescein diacetate.
- the FDA is formulated in a stock solution at 1 mg FDA/mL acetone. A final working solution is formulated which contains 5 ⁇ g/mL fluorescein diacetate and 0.005% Trem® 014.
- the FDA working solution is applied by spraying the sample using a Preval® sprayer (Precision Valve Corporation, Yonkers, N.Y.) with sufficient solution to wet all surfaces. Care must be taken not to allow access of FDA to leaves with cuts or abraded surfaces.
- the percent variation for the disease area determination increases to approximately 4% under typical operating conditions, reflecting variability in sample placement in the imaging chamber and in orientation relative to the camera. From these data, the precision of photon imaging is estimated to have a variability of approximately 4%.
- the imaging method of the present invention provides a robust and highly statistically-reproducible measure of the % disease area for determining the efficacy of a plant treatment agent even under typical operating conditions.
- the plant treatment agents are combined with the growth media to achieve the desired final concentration.
- Column 1 is comprised of controls treated with the DMSO diluent alone.
- Columns 2-6 are treated, respectively, with 1 :3 serial dilutions of the following (with the starting concentration in ppm indicated): MBC (5), flusilazole (2), famoxadone (2), azoxystiobin (2) and captan (5).
- MBC (5) flusilazole (2), famoxadone (2), azoxystiobin (2) and captan (5).
- the same treatments are repeated in columns 7-12.
- the wells are inoculated with 200 ⁇ L of a M. grisea spore suspension at a concentration of 75,000 spores/mL, in the media described above. Cultures are maintained in the dark at 22 °C. The fungal culture is grown for 7 days.
- the samples After allowing sufficient time for the uptake and conversion of FDA to fluorescein, typically 5 min, the samples are placed in the imaging chamber of the imaging system. Reference and fluorescence image data is collected as described above using a Hamamatsu C2400 photon detector (see above), and processed for the photon emission from each well.
- EXAMPLE 3 DETECTING PHOTON EMISSION FROM A DISEASE ORGANISM CONTAINING AN ENDOGENOUS LGM AND INFECTING A PLANT SUBSTRATE (EMBODIMENT ID- DETERMINATION OF DISEASE AREA
- the photon emission from an LGM endogenous to the disease organism infected on plants is detected as follows. Barley plants are inoculated with a suspension of spores of a tiansgenic strain of Magnaportha grisea expressing a FP or FP variant (e.g. GFP) engineered for enhanced fluorescence yield and incubated under the appropriate conditions for a period sufficient to allow the development of visible disease symptoms, as described above.
- a FP or FP variant e.g. GFP
- ACCUMULATION The effectiveness of a plant treatment agent on plants infected with a disease organism is determined by integrating photon emission from an LGM endogenous to the disease organism and determining the disease accumulation. This example illustrates quantifying fungal disease by measuring endogenous fluorescence under circumstances where ordinary visual rating is not practicable.
- Eragrostis curvula plants are grown as described above in a deep well microtitie plate.
- a systemic application (wells with media pre-treated with the plant treatment agent prior to seeding) of a preventative treatment containing 5 ppm of the commercial fungicide tricyclazole is made in all columns of the plate except two columns, which serve as untreated, inoculated controls.
- the plants are inoculated with a spore suspension of a M. grisea stiain expressing a FP (e.g. GFP variant engineered for enhanced fluorescence yield) and are incubated, as described above.
- the plate is imaged for FP fluorescence as described above.
- Plants in wells with media pre-tieated with tricyclazole prior to seeding exhibit reduced fluorescence relative to the fluorescence observed with the untreated, inoculated control columns, correlating with reduced disease symptoms. Visual rating for quantitation is not possible with this test format because over-seeding of the samples and the vertical growth habit of the plants within the wells prevents scoring by eye.
- the detection of fluorescence photon emission provides a sensitive means of detecting control with a commercial fungicide effective on this pathogen.
- the ability to detect and rate fungicidal activity on a whole plant test in a plate format provides several potential advantages. Such a test maintains the ability to detect disruption of the host-pathogen interaction, reduces the compound requirement, may be automated and may provide increased assay throughput.
- the effectiveness of a plant treatment agent, on plants infected with a disease organism is determined by detecting photon emission from an LGM endogenous to the plant substiate.
- Tomato plants cultivated as described above are given 125 ⁇ L spray applications of a preventative tieatment containing 20, 5, 1 and 0 ppm ridomil.
- the plant treatment agent is formulated and applied as described in EXAMPLE 1 above.
- Plants to be rated for fungicide activity are first scored conventionally by eye for % disease coverage. Plant tissue that has grown after tieatment and inoculation is then physically removed and the samples are subsequently imaged for chlorophyll fluorescence. Reference and fluorescence image data is collected as described above, and processed for the determination of disease area.
- FIGURE 7 Grayscale and binary images of the reference and fluorescence data are represented in FIGURE 7.
- Columns 1-3 represent images of leaves treated with 20, 5 and 1 ppm of ridomil and inoculated with P. infestans.
- Column 4 is an uninoculated and untreated leaf. Leaves inoculated with P. infestans and left untreated suffer severe necrosis and the leaves often abscise (not illustrated).
- FIGURES 7A and 7B represent the grayscale and binary images, respectively, of the plant samples collected under white light reference illumination
- FIGURES 7C and 7D represent the grayscale and binary images, respectively, of the same materials collected under fluorescence excitation conditions.
- a comparison of % disease area obtained from visual scoring or based on photon emission is represented in Chart 2. Data from both the fluorescence and visual scoring methods indicate that detection of photon emission and visual rating yield comparable results.
- the samples are subsequently imaged for luciferase bioluminescence following the application of firefly luciferin, the substrate for bioluminescence.
- Firefly luciferin is available as the potassium salt from Promega Corp, Madison, WI.
- the infected and control leaves of the plants are sprayed 3 times over a 2 hr period to run-off with an aqueous 5 mM luciferin solution containing 0.01% Triton X-100® surfactant. After allowing sufficient time for luciferin uptake, typically 10 min following the last luciferin application, individual leaves from plants are removed and placed inside the imaging chamber. Reference and bioluminescence image data is collected as described above.
- a second reference image may be obtained under backlight illumination with a flatbed light source (see FIGURE 1, element 15) (e.g. available from Schott-Fostec, Auburn, NY).
- the backlight image provides spatial reference for the location of the Sclerotinia infection zones, which are not evident under epi- illumination.
- FIGURE 8 Grayscale and binary images of the bioluminescence are presented in FIGURE 8.
- Column 1 represents uninoculated 35S::LUC::NOS3 ' tobacco leaves and column 2 represents 35S::LUC::NOS3 ' tobacco leaves inoculated with Sclerotinia.
- Row A represents a reference image collected under epi-illumination
- row B represents the same leaves under backlight illumination
- row C represents a grayscale image of the bioluminescence
- row D represents a binary image. Areas of the tobacco plant infected with the pathogen are not bioluminescent and are readily detected by the imaging system.
- the effectiveness of a plant treatment agent on a disease organism engineered to express an endogenous LGM and grown in liquid culture in wells of a microtitre plate is determined by integrating photon emission and determining the disease accumulation.
- Transgenic Magnaportha grisea engineered to express a FP (e.g. GFP) as described above is cultured in liquid growth media and treated as above in Example 2 contained within wells of a 96 well microtitre plate. The samples are subsequently placed in the dark box of the imaging system. Reference and FP fluorescence image data is collected as described above, and processed for the photon emission from each well.
- EXAMPLE 8 DETECTING PHOTON EMISSION FROM A DISEASE ORGANISM CONTAINING AN ENDOGENOUS LGM AND INFECTING A PLANT SUBSTRATE (EMBODIMENT IB- DETERMINATION OF DISEASE AREA
- the photon emission from an LGM endogenous to the disease organism infected on plants is detected as follows. Barley plants are inoculated with a suspension of spores of a tiansgenic stiain (MG619) of Magnaportha grisea expressing a the ZsGreen FP and incubated under the appropriate conditions for a period sufficient to allow the development of visible disease symptoms, as described above. Controls of uninfected plants and plants infected with the wildtype M.
- FIGURE 10A and B Reference grayscale and fluorescence grayscale images are represented in FIGURE 10A and B, respectively.
- Column A represents an uninoculated leaf
- column B represents a leaf inoculated with wild type M. grisea
- column C represents a leaf inoculated with M. grisea expressing the ZsGreen FP (stiain MG619).
- the fluorescence from the ZsGreen FP M. grisea strain is easily detected above the background fluorescence of the endogenous plant LGMs induced upon infection with the wild-type pathogen.
- Transgenic Magnaportha grisea strain MG619 engineered to express the ZsGreen FP as described above is cultured in liquid growth media with or without a plant treatment agent contained within wells of a 96 well microtitre plate in a manner similar to that described in Example 2.
- Plates to be rated for fungicide activity are first rated conventionally using a plate reader to measure optical density (OD) at 650 nm (see FIGURE 1 IC).
- OD optical density
- Reference and fluorescence image data is collected as described above using a Hamamatsu C2400 photon detector (see above), and processed for the photon emission from each well.
- FIGURE 11 A A grayscale image of the fluorescence data is presented in FIGURE 11 A.
- the normalized photon counts are represented in FIGURE 1 IB.
- FIGURE 1 IC represents the normalized OD data at 650 nm. Both the photon counts and OD 650 nm data have been normalized relative to the mean values for the respective measures for the controls in column 1, allowing easier comparison of the data from the two measurement types. Comparison of the photon counts and the OD measurements indicate that the methods yield comparable results.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- General Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Engineering & Computer Science (AREA)
- Plasma & Fusion (AREA)
- Optics & Photonics (AREA)
- Investigating, Analyzing Materials By Fluorescence Or Luminescence (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
Abstract
Description
Claims
Priority Applications (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US10/343,073 US20040033555A1 (en) | 2001-07-20 | 2001-07-20 | Methods using light emission for determining the effeciveness of plant treatment agents in controlling plant disease organisms |
EP01959077A EP1303749A2 (en) | 2000-07-26 | 2001-07-20 | Methods using light emission for determining the effectiveness of plant treatment agents in controlling plant disease organisms |
JP2002514377A JP2004506879A (en) | 2000-07-26 | 2001-07-20 | Method of determining the effectiveness of a plant treatment in controlling plant disease organisms using light radiation |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US22093300P | 2000-07-26 | 2000-07-26 | |
US60/220,933 | 2000-07-26 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2002008734A2 true WO2002008734A2 (en) | 2002-01-31 |
WO2002008734A3 WO2002008734A3 (en) | 2002-08-01 |
Family
ID=22825617
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US2001/022932 WO2002008734A2 (en) | 2000-07-26 | 2001-07-20 | Methods using light emission for determining the effectiveness of plant treatment agents in controlling plant disease organisms |
Country Status (3)
Country | Link |
---|---|
EP (1) | EP1303749A2 (en) |
JP (1) | JP2004506879A (en) |
WO (1) | WO2002008734A2 (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2004065945A1 (en) * | 2003-01-24 | 2004-08-05 | Plant Research International B.V. | Identification labels in plants or plant parts |
EP2056094A1 (en) * | 2007-10-12 | 2009-05-06 | Universiteit Hasselt | Fluorescence imaging system |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JP5124216B2 (en) * | 2007-09-14 | 2013-01-23 | オリンパス株式会社 | Optical signal observation method and optical signal observation system |
FR3092727B1 (en) * | 2019-02-19 | 2023-05-12 | Upl Ltd | Process for the preparation of copper compounds |
Family Cites Families (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5474909A (en) * | 1992-08-07 | 1995-12-12 | Anticancer, Inc. | Noncolorimetric histoculture method for predicting drug response of tumors |
US5968762A (en) * | 1998-03-19 | 1999-10-19 | The University Of Connecticut | Method for detecting bacteria in a sample |
-
2001
- 2001-07-20 EP EP01959077A patent/EP1303749A2/en not_active Withdrawn
- 2001-07-20 WO PCT/US2001/022932 patent/WO2002008734A2/en not_active Application Discontinuation
- 2001-07-20 JP JP2002514377A patent/JP2004506879A/en active Pending
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2004065945A1 (en) * | 2003-01-24 | 2004-08-05 | Plant Research International B.V. | Identification labels in plants or plant parts |
EP2056094A1 (en) * | 2007-10-12 | 2009-05-06 | Universiteit Hasselt | Fluorescence imaging system |
Also Published As
Publication number | Publication date |
---|---|
JP2004506879A (en) | 2004-03-04 |
WO2002008734A3 (en) | 2002-08-01 |
EP1303749A2 (en) | 2003-04-23 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US6947144B2 (en) | vivo monitoring method of transgenic plants and system using the same | |
Greer III et al. | Imaging of light emission from the expression of luciferases in living cells and organisms: a review | |
CN1154845C (en) | Biodetectors targeted to specific ligands | |
Chen et al. | A practicable detection system for genetically modified rice by SERS-barcoded nanosensors | |
Winson et al. | Flow cytometric analysis of microorganisms | |
US20040033555A1 (en) | Methods using light emission for determining the effeciveness of plant treatment agents in controlling plant disease organisms | |
Tanner et al. | Sensor-based phenotyping of above-ground plant-pathogen interactions | |
KR102594240B1 (en) | Novel luciferase and methods of using the same | |
ES2399563T3 (en) | Modified fluorescent green proteins and method for their use | |
JP5089936B2 (en) | Detection method of luminescence imaging | |
RU2345137C2 (en) | Fluorescing proteins from copepodas crustaceas and their application | |
US7951923B2 (en) | Fluorescent proteins and chromoproteins from non-Aequorea hydrozoa species and methods for using same | |
Toyota et al. | In vivo imaging enables understanding of seamless plant defense responses to wounding and pathogen attack | |
EP1303749A2 (en) | Methods using light emission for determining the effectiveness of plant treatment agents in controlling plant disease organisms | |
Thouand et al. | Comparison of the spectral emission of lux recombinant and bioluminescent marine bacteria | |
Dunuweera et al. | A comprehensive Exploration of bioluminescence systems, mechanisms, and advanced assays for Versatile applications | |
US20220235390A1 (en) | Method for quantitative co-expressing multiple proteins in vitro and application thereof | |
Jensen et al. | Exploitation of GFP-technology with filamentous fungi | |
JP6579539B2 (en) | Photodiscrimination method, substance detection method, reporter assay method, kit, luciferin-luciferase reaction inhibitor, luciferin-luciferase reaction inhibition method and apparatus | |
Halfhill et al. | Green fluorescent protein quantification in whole plants | |
Kumar et al. | Bioluminescent fungi: a flame of curiosity | |
Bellin et al. | Detection of peroxynitrite in plants exposed to bacterial infection | |
CN108659110A (en) | A kind of improved red fluorescent protein and its application | |
Etxebeste et al. | Fluorescence-based methods for the study of protein localization, interaction, and dynamics in filamentous fungi | |
JP2019010115A (en) | Luciferin-luciferase reaction inhibitor, luciferin-luciferase reaction inhibition method and kit |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): JP US |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
AK | Designated states |
Kind code of ref document: A3 Designated state(s): JP US |
|
AL | Designated countries for regional patents |
Kind code of ref document: A3 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2001959077 Country of ref document: EP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 10343073 Country of ref document: US |
|
WWP | Wipo information: published in national office |
Ref document number: 2001959077 Country of ref document: EP |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 2001959077 Country of ref document: EP |